Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
LOC649330	649330	broad.mit.edu	37	1	12907844	12907844	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12907844G>T	uc009vno.2	-	1	394	c.299C>A	c.(298-300)TCA>TAA	p.S100*	HNRNPCL1_uc010obf.1_Nonsense_Mutation_p.S100*	NM_001146181	NP_001139653	B7ZW38	B7ZW38_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	100							nucleic acid binding|nucleotide binding				0						CTCCGCTGCTGATCGTTTCAC	0.488													17	107	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16913756	16913756	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16913756C>A	uc009vos.1	-	11	1455	c.567G>T	c.(565-567)AGG>AGT	p.R189S	NBPF1_uc009vot.1_5'UTR|NBPF1_uc001ayz.1_5'UTR|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	189	NBPF 1.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCTGCACCTCCCTGATGAGCC	0.522													64	474	---	---	---	---	PASS
PAX7	5081	broad.mit.edu	37	1	19018401	19018401	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19018401G>T	uc001bay.2	+	5	1338	c.740G>T	c.(739-741)CGC>CTC	p.R247L	PAX7_uc001baz.2_Missense_Mutation_p.R245L|PAX7_uc010oct.1_Missense_Mutation_p.R247L	NM_002584	NP_002575	P23759	PAX7_HUMAN	paired box 7 isoform 1	247	Homeobox.				anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		ATATACACCCGCGAGGAGCTG	0.607			T	FOXO1A	alveolar rhabdomyosarcoma								14	20	---	---	---	---	PASS
RAP1GAP	5909	broad.mit.edu	37	1	21952818	21952818	+	5'UTR	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21952818A>G	uc001bex.2	-	3					RAP1GAP_uc001bew.2_Silent_p.Y51Y|RAP1GAP_uc001bey.2_5'UTR	NM_002885	NP_002876	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein isoform c						regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding			breast(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		GTGAAGGAGTATAGGAGGGAA	0.577													47	33	---	---	---	---	PASS
RRAGC	64121	broad.mit.edu	37	1	39330343	39330343	+	Translation_Start_Site	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39330343T>C	uc001ccr.2	-	6	954	c.-31A>G	c.(-33--29)ATAGG>ATGGG		MYCBP_uc001ccs.2_Nonstop_Mutation_p.*104W	NM_022157	NP_071440	Q9HB90	RRAGC_HUMAN	Ras-related GTP binding C						apoptosis|cell growth|cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade|RNA splicing|small GTPase mediated signal transduction|transcription, DNA-dependent	lysosome|nucleus	GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein heterodimerization activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)				AGAAGAATCCTATTCAGCACG	0.338													36	527	---	---	---	---	PASS
KDM4A	9682	broad.mit.edu	37	1	44137484	44137484	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44137484G>C	uc001cjx.2	+	11	1838	c.1672G>C	c.(1672-1674)GAG>CAG	p.E558Q	KDM4A_uc010oki.1_Intron	NM_014663	NP_055478	O75164	KDM4A_HUMAN	jumonji domain containing 2A	558					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1						CACTGTGGGAGAGCCATGCAC	0.592													63	238	---	---	---	---	PASS
CYP4Z1	199974	broad.mit.edu	37	1	47564825	47564825	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47564825G>A	uc001cqu.1	+	8	939	c.936G>A	c.(934-936)ATG>ATA	p.M312I		NM_178134	NP_835235	Q86W10	CP4Z1_HUMAN	cytochrome P450 4Z1	312	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			skin(1)	1						AAACGTTCATGTTTGCAGGAC	0.448													79	221	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67185013	67185013	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67185013C>G	uc001dcr.2	+	19	1884	c.1667C>G	c.(1666-1668)GCT>GGT	p.A556G	SGIP1_uc010opd.1_Missense_Mutation_p.A156G|SGIP1_uc001dcs.2_Missense_Mutation_p.A156G|SGIP1_uc001dct.2_Missense_Mutation_p.A158G|SGIP1_uc009wat.2_Missense_Mutation_p.A350G|SGIP1_uc001dcu.2_Missense_Mutation_p.A61G	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	556					positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						ACCATGGGAGCTCAGGACACT	0.423													25	52	---	---	---	---	PASS
TCTEX1D1	200132	broad.mit.edu	37	1	67220352	67220352	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67220352C>G	uc001dcv.2	+	2	142	c.11C>G	c.(10-12)TCA>TGA	p.S4*	TCTEX1D1_uc009wau.2_RNA|TCTEX1D1_uc009wav.2_RNA	NM_152665	NP_689878	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1	4											0						ATGATGATGTCAGACAATGCT	0.368													35	72	---	---	---	---	PASS
TYW3	127253	broad.mit.edu	37	1	75229610	75229610	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75229610G>A	uc001dgn.2	+	6	682	c.593G>A	c.(592-594)AGG>AAG	p.R198K	TYW3_uc010oqw.1_Missense_Mutation_p.R165K|TYW3_uc010oqx.1_Missense_Mutation_p.R114K|TYW3_uc010oqy.1_RNA	NM_138467	NP_612476	Q6IPR3	TYW3_HUMAN	tRNA-yW synthesizing protein 3 homolog isoform	198					tRNA processing		methyltransferase activity			ovary(2)	2						GCTTTGGAAAGGGAAACGATG	0.348													46	110	---	---	---	---	PASS
ASB17	127247	broad.mit.edu	37	1	76384752	76384752	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76384752T>G	uc001dhe.1	-	3	913	c.773A>C	c.(772-774)CAT>CCT	p.H258P	ASB17_uc001dhf.1_RNA	NM_080868	NP_543144	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box-containing 17	258	SOCS box.				intracellular signal transduction					ovary(1)	1						TCTGCAAAGATGTAATAGTTC	0.348													40	103	---	---	---	---	PASS
CLCA4	22802	broad.mit.edu	37	1	87041018	87041018	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87041018G>T	uc009wcs.2	+	11	1731	c.1687G>T	c.(1687-1689)GGC>TGC	p.G563C	CLCA4_uc009wct.2_Missense_Mutation_p.G326C|CLCA4_uc009wcu.2_Missense_Mutation_p.G383C	NM_012128	NP_036260	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	563						apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity			ovary(2)	2		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		CTTTTAGGTGGGCACTTGGGC	0.353													34	80	---	---	---	---	PASS
CLCA4	22802	broad.mit.edu	37	1	87041019	87041019	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87041019G>T	uc009wcs.2	+	11	1732	c.1688G>T	c.(1687-1689)GGC>GTC	p.G563V	CLCA4_uc009wct.2_Missense_Mutation_p.G326V|CLCA4_uc009wcu.2_Missense_Mutation_p.G383V	NM_012128	NP_036260	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	563						apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity			ovary(2)	2		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		TTTTAGGTGGGCACTTGGGCA	0.353													33	79	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103548429	103548429	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103548429C>A	uc001dul.2	-	2	524	c.206G>T	c.(205-207)GGC>GTC	p.G69V	COL11A1_uc001dum.2_Missense_Mutation_p.G69V|COL11A1_uc001dun.2_Missense_Mutation_p.G69V|COL11A1_uc009weh.2_Missense_Mutation_p.G69V	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	69	TSP N-terminal.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AGTATCTGAGCCTTTAGAATT	0.348													57	184	---	---	---	---	PASS
AMY2B	280	broad.mit.edu	37	1	104114855	104114855	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104114855G>T	uc001duq.2	+	4	908	c.292G>T	c.(292-294)GTG>TTG	p.V98L	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Missense_Mutation_p.V98L	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	98					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TAGAAACATGGTGACTAGATG	0.358													72	198	---	---	---	---	PASS
HIPK1	204851	broad.mit.edu	37	1	114499410	114499410	+	Silent	SNP	T	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114499410T>G	uc001eem.2	+	6	1730	c.1569T>G	c.(1567-1569)CTT>CTG	p.L523L	HIPK1_uc001eel.2_Silent_p.L523L|HIPK1_uc001een.2_Silent_p.L523L|HIPK1_uc001eeo.2_Silent_p.L149L|HIPK1_uc001eep.2_Silent_p.L129L	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	523					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGACTCACCTTTTGGATTTTC	0.368													13	183	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120512258	120512258	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120512258G>A	uc001eik.2	-	6	1240	c.984C>T	c.(982-984)AAC>AAT	p.N328N	NOTCH2_uc001eil.2_Silent_p.N328N|NOTCH2_uc001eim.3_Silent_p.N245N	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	328	Extracellular (Potential).|EGF-like 8; calcium-binding (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACTCCAGCCGTTGACACATA	0.557			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				23	44	---	---	---	---	PASS
HIST2H3D	653604	broad.mit.edu	37	1	149785117	149785117	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149785117G>C	uc010pbl.1	-	1	120	c.120C>G	c.(118-120)CAC>CAG	p.H40Q	HIST2H2BF_uc010pbj.1_5'Flank|HIST2H2BF_uc010pbk.1_5'Flank|HIST2H2BF_uc001esr.2_5'Flank	NM_001123375	NP_001116847	Q71DI3	H32_HUMAN	histone cluster 2, H3d	40					blood coagulation|nucleosome assembly	nucleoplasm|nucleosome	DNA binding|protein binding				0						GCCGGTAGCGGTGCGGCTTCT	0.711													6	31	---	---	---	---	PASS
MEF2D	4209	broad.mit.edu	37	1	156452388	156452388	+	Silent	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156452388A>G	uc001fpc.2	-	3	489	c.99T>C	c.(97-99)TAT>TAC	p.Y33Y	MEF2D_uc001fpb.2_Silent_p.Y33Y|MEF2D_uc001fpd.2_Silent_p.Y33Y|MEF2D_uc001fpe.1_Silent_p.Y33Y|MEF2D_uc009wsa.2_RNA	NM_005920	NP_005911	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	33	MADS-box.				apoptosis|muscle organ development|nervous system development|positive regulation of transcription from RNA polymerase II promoter	nucleus	activating transcription factor binding|histone deacetylase binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CGCTCAGCTCATACGCCTTCT	0.547													53	182	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157514060	157514060	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157514060T>G	uc001fqu.2	-	5	994	c.836A>C	c.(835-837)CAG>CCG	p.Q279P	FCRL5_uc009wsm.2_Missense_Mutation_p.Q279P|FCRL5_uc010phv.1_Missense_Mutation_p.Q279P|FCRL5_uc010phw.1_Missense_Mutation_p.Q194P|FCRL5_uc001fqv.1_Missense_Mutation_p.Q279P|FCRL5_uc010phx.1_Missense_Mutation_p.Q30P	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	279	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				ACTCTGCACCTGTATCCAGGA	0.507													88	282	---	---	---	---	PASS
USP21	27005	broad.mit.edu	37	1	161133756	161133756	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161133756C>T	uc010pke.1	+	9	1580	c.1203C>T	c.(1201-1203)TCC>TCT	p.S401S	USP21_uc010pkc.1_Silent_p.S401S|USP21_uc010pkd.1_Silent_p.S401S|USP21_uc010pkf.1_Silent_p.S401S|PPOX_uc001fyj.2_5'Flank|PPOX_uc001fyn.2_5'Flank|PPOX_uc001fyg.2_5'Flank|PPOX_uc001fyl.2_5'Flank|PPOX_uc001fym.2_5'Flank|PPOX_uc001fyk.2_5'Flank|PPOX_uc001fyh.2_5'Flank|PPOX_uc010pkg.1_5'Flank|PPOX_uc009wuc.1_5'Flank|PPOX_uc010pkh.1_5'Flank|PPOX_uc001fyi.2_5'Flank	NM_001014443	NP_001014443	Q9UK80	UBP21_HUMAN	ubiquitin-specific protease 21	401					histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding|NEDD8-specific protease activity|protein binding|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)|prostate(1)|breast(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			GTGACCTGTCCCTGCCCATCC	0.592													62	92	---	---	---	---	PASS
FCGR3A	2214	broad.mit.edu	37	1	161519618	161519618	+	Intron	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161519618C>A	uc001gat.3	-						FCGR3A_uc001gar.2_Missense_Mutation_p.G6V|FCGR3A_uc001gas.2_Missense_Mutation_p.G6V|FCGR3A_uc009wuh.2_Intron|FCGR3A_uc009wui.2_Intron	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor						immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CAGCCTTTCCCCAGCCCCTCC	0.517													7	51	---	---	---	---	PASS
FCGR3A	2214	broad.mit.edu	37	1	161519619	161519619	+	Intron	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161519619C>T	uc001gat.3	-						FCGR3A_uc001gar.2_Missense_Mutation_p.G6R|FCGR3A_uc001gas.2_Missense_Mutation_p.G6R|FCGR3A_uc009wuh.2_Intron|FCGR3A_uc009wui.2_Intron	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor						immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AGCCTTTCCCCAGCCCCTCCA	0.512													6	50	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167097643	167097643	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167097643T>C	uc001geb.1	+	5	3275	c.3275T>C	c.(3274-3276)TTT>TCT	p.F1092S		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	1092					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						ACCCAGAGCTTTATGAGGTCT	0.517													26	28	---	---	---	---	PASS
SERPINC1	462	broad.mit.edu	37	1	173878825	173878825	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173878825G>A	uc001gjt.2	-	5	1137	c.1018C>T	c.(1018-1020)CTG>TTG	p.L340L		NM_000488	NP_000479	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C, member 1	340					blood coagulation|regulation of proteolysis	extracellular space|plasma membrane	heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(1)	1					Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)	AATTCATCCAGCCACTCTTGC	0.552													72	151	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175049472	175049472	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175049472G>T	uc001gkl.1	+	4	1071	c.958G>T	c.(958-960)GGT>TGT	p.G320C	TNN_uc010pmx.1_Missense_Mutation_p.G320C	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	320	Fibronectin type-III 1.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TGAGATTCTTGGTTTGCTGCC	0.537													31	116	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176998800	176998800	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176998800C>T	uc001glc.2	-	5	1302	c.1090G>A	c.(1090-1092)GAT>AAT	p.D364N	ASTN1_uc001glb.1_Missense_Mutation_p.D364N|ASTN1_uc001gld.1_Missense_Mutation_p.D364N|ASTN1_uc009wwx.1_Missense_Mutation_p.D364N|ASTN1_uc001gle.3_RNA|MIR488_hsa-mir-488|MI0003123_5'Flank	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	364					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						CTTGAAGGATCCGTGTAAAAG	0.547													18	59	---	---	---	---	PASS
TDRD5	163589	broad.mit.edu	37	1	179609057	179609057	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179609057G>A	uc001gnf.1	+	10	1854	c.1604G>A	c.(1603-1605)AGG>AAG	p.R535K	TDRD5_uc010pnp.1_Missense_Mutation_p.R535K|TDRD5_uc001gnh.1_Missense_Mutation_p.R90K	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	535	Tudor.				DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						TGTTGTGTAAGGATTTCTGAG	0.413													85	303	---	---	---	---	PASS
TDRD5	163589	broad.mit.edu	37	1	179609058	179609058	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179609058G>T	uc001gnf.1	+	10	1855	c.1605G>T	c.(1603-1605)AGG>AGT	p.R535S	TDRD5_uc010pnp.1_Missense_Mutation_p.R535S|TDRD5_uc001gnh.1_Missense_Mutation_p.R90S	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	535	Tudor.				DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						GTTGTGTAAGGATTTCTGAGG	0.418													85	302	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181708377	181708377	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181708377C>T	uc001gow.2	+	25	3872	c.3707C>T	c.(3706-3708)GCC>GTC	p.A1236V	CACNA1E_uc009wxs.2_Missense_Mutation_p.A1124V|CACNA1E_uc001gox.1_Missense_Mutation_p.A462V|CACNA1E_uc009wxt.2_Missense_Mutation_p.A462V	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1236	III.|Helical; Name=S3 of repeat III.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						GCATTGGTGGCCTTTGCTCTG	0.498													121	156	---	---	---	---	PASS
LAMC2	3918	broad.mit.edu	37	1	183204853	183204853	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183204853G>T	uc001gqa.2	+	16	2758	c.2444G>T	c.(2443-2445)GGG>GTG	p.G815V	LAMC2_uc001gpz.3_Missense_Mutation_p.G815V|LAMC2_uc010poa.1_Missense_Mutation_p.G515V	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	815	Potential.|Domain II and I.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						GTGGTGCAAGGGCTTGTGGAA	0.562											OREG0014042	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	57	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186303599	186303599	+	Silent	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186303599T>C	uc001grv.2	-	36	5337	c.5040A>G	c.(5038-5040)AAA>AAG	p.K1680K		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1680					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CAGCTGTCACTTTACTTGGAG	0.448			T	NTRK1	papillary thyroid								34	99	---	---	---	---	PASS
PLA2G4A	5321	broad.mit.edu	37	1	186957570	186957570	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186957570C>G	uc001gsc.2	+	18	2385	c.2180C>G	c.(2179-2181)TCT>TGT	p.S727C	PLA2G4A_uc010pos.1_Missense_Mutation_p.S667C	NM_024420	NP_077734	P47712	PA24A_HUMAN	cytosolic phospholipase A2, group IVA	727	PLA2c.				phospholipid catabolic process|platelet activating factor biosynthetic process|platelet activation	cytosol|endoplasmic reticulum membrane	calcium ion binding|calcium-dependent phospholipid binding|lysophospholipase activity			lung(2)|breast(1)	3					Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Medrysone(DB00253)|Quinacrine(DB01103)	TCTCGTTGCTCTGTTTCCCTT	0.383													32	122	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197086919	197086919	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197086919C>T	uc001gtu.2	-	17	4322	c.4065G>A	c.(4063-4065)CAG>CAA	p.Q1355Q	ASPM_uc001gtv.2_Silent_p.Q1355Q|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	1355	IQ 1.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						GATACTATACCTGAATAAGTG	0.269													24	126	---	---	---	---	PASS
MTR	4548	broad.mit.edu	37	1	236976069	236976069	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236976069G>A	uc001hyi.3	+	6	957	c.534G>A	c.(532-534)GAG>GAA	p.E178E	MTR_uc010pxv.1_RNA|MTR_uc010pxw.1_5'UTR|MTR_uc010pxx.1_Silent_p.E178E|MTR_uc010pxy.1_Silent_p.E178E|MTR_uc009xgj.1_Missense_Mutation_p.S9N	NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine	178	Hcy-binding.				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	CATACCAAGAGCAGGCCAAAG	0.428													50	134	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240370927	240370927	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240370927G>A	uc010pyd.1	+	5	3040	c.2815G>A	c.(2815-2817)GGA>AGA	p.G939R	FMN2_uc010pye.1_Missense_Mutation_p.G943R	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	939	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCCTCTACCCGGAGCGGGAAT	0.697													35	28	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004991	248004991	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004991C>A	uc001idn.1	-	1	208	c.208G>T	c.(208-210)GAG>TAG	p.E70*		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TACCAGACCTCCAGAAAGGAG	0.562													23	26	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004992	248004992	+	Silent	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004992C>A	uc001idn.1	-	1	207	c.207G>T	c.(205-207)CTG>CTT	p.L69L		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ACCAGACCTCCAGAAAGGAGA	0.567													23	25	---	---	---	---	PASS
OR2T33	391195	broad.mit.edu	37	1	248436163	248436163	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248436163C>A	uc010pzi.1	-	1	954	c.954G>T	c.(952-954)AGG>AGT	p.R318S		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	318	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ATCATCTTGACCTGTGGGCCT	0.403													6	256	---	---	---	---	PASS
ASAP2	8853	broad.mit.edu	37	2	9508556	9508556	+	Silent	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9508556C>A	uc002qzh.2	+	16	1804	c.1464C>A	c.(1462-1464)CTC>CTA	p.L488L	ASAP2_uc002qzi.2_Silent_p.L488L	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH	488	Arf-GAP.				regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0						TTTTGCAGCTCGCCAAGAATA	0.408													23	54	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15557812	15557812	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15557812G>C	uc002rcc.1	-	24	2628	c.2602C>G	c.(2602-2604)CGA>GGA	p.R868G	NBAS_uc010exl.1_Intron|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	868										ovary(2)|liver(1)|skin(1)	4						ATCCCAAGTCGAATAAGTGAC	0.378													16	60	---	---	---	---	PASS
KIAA1841	84542	broad.mit.edu	37	2	61333770	61333770	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61333770G>C	uc002saw.3	+	14	1887	c.1584G>C	c.(1582-1584)TGG>TGC	p.W528C	KIAA1841_uc002sax.3_Missense_Mutation_p.W382C|KIAA1841_uc002say.2_Missense_Mutation_p.W528C	NM_001129993	NP_001123465	Q6NSI8	K1841_HUMAN	KIAA1841 protein isoform a	528											0			Epithelial(17;0.193)			ATACACCATGGGGTCCCAAAA	0.368													25	94	---	---	---	---	PASS
KIAA1841	84542	broad.mit.edu	37	2	61333771	61333771	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61333771G>T	uc002saw.3	+	14	1888	c.1585G>T	c.(1585-1587)GGT>TGT	p.G529C	KIAA1841_uc002sax.3_Missense_Mutation_p.G383C|KIAA1841_uc002say.2_Missense_Mutation_p.G529C	NM_001129993	NP_001123465	Q6NSI8	K1841_HUMAN	KIAA1841 protein isoform a	529											0			Epithelial(17;0.193)			TACACCATGGGGTCCCAAAAC	0.363													24	92	---	---	---	---	PASS
C2orf86	51057	broad.mit.edu	37	2	63631451	63631451	+	Silent	SNP	A	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63631451A>C	uc002sch.2	-	10	1613	c.1167T>G	c.(1165-1167)GGT>GGG	p.G389G	C2orf86_uc002sce.2_RNA|C2orf86_uc002scf.2_Silent_p.G230G|C2orf86_uc010ypu.1_RNA|C2orf86_uc002scg.2_Silent_p.G197G|C2orf86_uc002sci.1_Silent_p.G365G|C2orf86_uc010fcr.1_Silent_p.G279G	NM_015910	NP_056994	O95876	FRITZ_HUMAN	hypothetical protein LOC51057 isoform 2	389	WD 2.				cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0						GCAGAATGGCACCACTTGGGT	0.443													8	199	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71740924	71740924	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71740924G>C	uc002sie.2	+	6	912	c.536G>C	c.(535-537)GGC>GCC	p.G179A	DYSF_uc010feg.2_Missense_Mutation_p.G210A|DYSF_uc010feh.2_Missense_Mutation_p.G179A|DYSF_uc002sig.3_Missense_Mutation_p.G179A|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.G179A|DYSF_uc010fef.2_Missense_Mutation_p.G210A|DYSF_uc010fei.2_Missense_Mutation_p.G210A|DYSF_uc010fek.2_Missense_Mutation_p.G211A|DYSF_uc010fej.2_Missense_Mutation_p.G180A|DYSF_uc010fel.2_Missense_Mutation_p.G180A|DYSF_uc010feo.2_Missense_Mutation_p.G211A|DYSF_uc010fem.2_Missense_Mutation_p.G180A|DYSF_uc010fen.2_Missense_Mutation_p.G211A|DYSF_uc002sif.2_Missense_Mutation_p.G180A	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	179	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						CAAAGCGGAGGCCCGGGGGCT	0.587													21	32	---	---	---	---	PASS
DCTN1	1639	broad.mit.edu	37	2	74605138	74605138	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74605138G>A	uc002skx.2	-	2	579	c.268C>T	c.(268-270)CGC>TGC	p.R90C	DCTN1_uc002skw.1_Missense_Mutation_p.R73C|DCTN1_uc010ffd.2_Missense_Mutation_p.R90C|DCTN1_uc002sky.2_Missense_Mutation_p.R73C	NM_004082	NP_004073	Q14203	DCTN1_HUMAN	dynactin 1 isoform 1	90	CAP-Gly.				cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding			ovary(3)|skin(2)	5						TGGGACTGGCGCACAAAGATG	0.488													6	58	---	---	---	---	PASS
C2orf3	6936	broad.mit.edu	37	2	75917778	75917778	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75917778C>G	uc002sno.2	-	8	1342	c.1212G>C	c.(1210-1212)GAG>GAC	p.E404D	C2orf3_uc010ffs.2_5'UTR|C2orf3_uc002snn.2_Missense_Mutation_p.E235D|C2orf3_uc010fft.2_Missense_Mutation_p.E79D	NM_003203	NP_003194	P16383	GCF_HUMAN	hypothetical protein LOC6936	404					negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						GAGATTCAATCTCTTCTAAAA	0.313													9	213	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109381112	109381112	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109381112G>C	uc002tem.3	+	20	4243	c.4117G>C	c.(4117-4119)GTA>CTA	p.V1373L		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	1373	RanBP2-type 1.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						TAAGAAATGTGTATCATGCCA	0.398													64	204	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116538554	116538554	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116538554T>A	uc002tla.1	+	16	1923	c.1466T>A	c.(1465-1467)TTC>TAC	p.F489Y	DPP10_uc002tlb.1_Missense_Mutation_p.F439Y|DPP10_uc002tlc.1_Missense_Mutation_p.F485Y|DPP10_uc002tle.2_Missense_Mutation_p.F493Y|DPP10_uc002tlf.1_Missense_Mutation_p.F482Y	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	489	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						AATCAACATTTCTTATTATTC	0.289													43	104	---	---	---	---	PASS
SMPD4	55627	broad.mit.edu	37	2	130930227	130930227	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130930227A>G	uc002tqq.1	-	7	1115	c.595T>C	c.(595-597)TTC>CTC	p.F199L	SMPD4_uc002tqp.1_5'UTR|SMPD4_uc010yzy.1_Intron|SMPD4_uc010yzz.1_Intron|SMPD4_uc002tqr.1_Missense_Mutation_p.F199L|SMPD4_uc002tqs.1_Missense_Mutation_p.F67L|SMPD4_uc002tqt.1_Missense_Mutation_p.F77L|SMPD4_uc010zaa.1_Missense_Mutation_p.F86L|SMPD4_uc010zab.1_Missense_Mutation_p.F126L|SMPD4_uc010zac.1_Intron|SMPD4_uc010zad.1_Intron	NM_017951	NP_060421	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4 isoform 2	160					sphingomyelin catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|trans-Golgi network	metal ion binding|protein binding|sphingomyelin phosphodiesterase activity|sphingomyelin phosphodiesterase D activity				0	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	aaggcaaagaagaatatgtaa	0.458													79	60	---	---	---	---	PASS
ARL5A	26225	broad.mit.edu	37	2	152670727	152670727	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152670727C>T	uc002txx.1	-	3	530	c.211G>A	c.(211-213)GAA>AAA	p.E71K	ARL5A_uc010zcc.1_RNA|ARL5A_uc002txv.1_Missense_Mutation_p.E34K|ARL5A_uc002txw.1_Missense_Mutation_p.E34K	NM_012097	NP_036229	Q9Y689	ARL5A_HUMAN	ADP-ribosylation factor-like 5A isoform 1	71					small GTPase mediated signal transduction	intracellular	GTP binding				0				BRCA - Breast invasive adenocarcinoma(221;0.153)		CGAAGAGATTCTTGGCCACCA	0.323													84	93	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166226715	166226715	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166226715T>C	uc002udc.2	+	20	4045	c.3755T>C	c.(3754-3756)ATA>ACA	p.I1252T	SCN2A_uc002udd.2_Missense_Mutation_p.I1252T|SCN2A_uc002ude.2_Missense_Mutation_p.I1252T	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	1252	Helical; Name=S2 of repeat III; (Potential).|III.				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	TTCACTTACATATTCATTCTG	0.368													4	246	---	---	---	---	PASS
PHOSPHO2	493911	broad.mit.edu	37	2	170557600	170557600	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170557600G>A	uc002ufg.2	+	4	507	c.119G>A	c.(118-120)CGA>CAA	p.R40Q	KLHL23_uc002ufh.1_Intron	NM_001008489	NP_001008489	Q8TCD6	PHOP2_HUMAN	phosphatase, orphan 2	40							metal ion binding|pyridoxal phosphatase activity			skin(1)	1						GATTCTTATCGAAAAGGATTT	0.363													48	92	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179399137	179399137	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179399137G>C	uc010zfg.1	-	307	94725	c.94501C>G	c.(94501-94503)CAG>GAG	p.Q31501E	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Q25196E|TTN_uc010zfi.1_Missense_Mutation_p.Q25129E|TTN_uc010zfj.1_Missense_Mutation_p.Q25004E	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32428							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATGGGTGCTGGAGAGCCTCC	0.433													74	73	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179428869	179428869	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179428869C>G	uc010zfg.1	-	275	74510	c.74286G>C	c.(74284-74286)CAG>CAC	p.Q24762H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Q18457H|TTN_uc010zfi.1_Missense_Mutation_p.Q18390H|TTN_uc010zfj.1_Missense_Mutation_p.Q18265H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	25689							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.Q18265Q(1)		ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGTTGTTTTCTGAATAGTAG	0.388													9	346	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179435834	179435834	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179435834G>A	uc010zfg.1	-	275	67545	c.67321C>T	c.(67321-67323)CCA>TCA	p.P22441S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P16136S|TTN_uc010zfi.1_Missense_Mutation_p.P16069S|TTN_uc010zfj.1_Missense_Mutation_p.P15944S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	23368							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGTCCTGGTGGATCACATGGG	0.463													77	92	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186670893	186670893	+	Intron	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186670893T>C	uc002upm.2	+						uc010zfu.1_Silent_p.F118F					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		AAAGCTCATTTAAAAAAGATG	0.338													43	56	---	---	---	---	PASS
EEF1B2	1933	broad.mit.edu	37	2	207026083	207026083	+	Nonsense_Mutation	SNP	A	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207026083A>T	uc002vbf.1	+	4	375	c.217A>T	c.(217-219)AAG>TAG	p.K73*	NDUFS1_uc010ziq.1_5'Flank|NDUFS1_uc002vbe.2_5'Flank|NDUFS1_uc010zir.1_5'Flank|NDUFS1_uc010zis.1_5'Flank|NDUFS1_uc010zit.1_5'Flank|NDUFS1_uc010ziu.1_5'Flank|EEF1B2_uc002vbg.1_Nonsense_Mutation_p.K73*|EEF1B2_uc002vbh.1_Nonsense_Mutation_p.K73*|SNORD51_uc002vbi.1_5'Flank|SNORA41_uc002vbj.2_5'Flank	NM_001037663	NP_001032752	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta	73	GST C-terminal.					cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity				0						GCCAGGAGTGAAGAAAGCTTT	0.378													9	133	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227945151	227945151	+	Intron	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227945151C>G	uc010zlt.1	-							NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor						axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		GAGAAGAATTCTACATACTGG	0.438													4	168	---	---	---	---	PASS
SP140	11262	broad.mit.edu	37	2	231101851	231101851	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231101851G>T	uc002vql.2	+	2	228	c.113G>T	c.(112-114)TGC>TTC	p.C38F	SP140_uc010zma.1_RNA|SP140_uc002vqj.2_Missense_Mutation_p.C38F|SP140_uc002vqk.2_Missense_Mutation_p.C38F|SP140_uc002vqn.2_Missense_Mutation_p.C38F|SP140_uc002vqm.2_Missense_Mutation_p.C38F|SP140_uc010fxl.2_Missense_Mutation_p.C38F	NM_007237	NP_009168	Q13342	LY10_HUMAN	SP140 nuclear body protein isoform 1	38	HSR.				defense response	cytoplasm|nuclear envelope|nucleolus|nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GAGCAGGTTTGCCCTGAGCCC	0.488													29	42	---	---	---	---	PASS
CNTN4	152330	broad.mit.edu	37	3	2861191	2861191	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2861191G>T	uc003bpc.2	+	6	601	c.380G>T	c.(379-381)AGA>ATA	p.R127I	CNTN4_uc003bpb.1_5'UTR|CNTN4_uc003bpd.1_Missense_Mutation_p.R127I	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	127	Ig-like C2-type 2.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		TTTAAAACAAGAACAAGAAGC	0.413													40	34	---	---	---	---	PASS
DCLK3	85443	broad.mit.edu	37	3	36756930	36756930	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36756930C>A	uc003cgi.2	-	5	2327	c.1836G>T	c.(1834-1836)TGG>TGT	p.W612C		NM_033403	NP_208382	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	612	Protein kinase.					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						CTGTTTCGATCCAGGGGTGCT	0.552													43	50	---	---	---	---	PASS
XYLB	9942	broad.mit.edu	37	3	38404512	38404512	+	Intron	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38404512C>A	uc003cic.2	+						XYLB_uc011ayp.1_Intron|XYLB_uc003cid.1_Intron	NM_005108	NP_005099	O75191	XYLB_HUMAN	xylulokinase						D-xylose metabolic process|generation of precursor metabolites and energy|xylulose catabolic process		ATP binding|xylulokinase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		GGGCCAGGTTCGTTTGCAGCA	0.542													3	88	---	---	---	---	PASS
LARS2	23395	broad.mit.edu	37	3	45530201	45530201	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45530201C>G	uc003cop.1	+	12	1321	c.1136C>G	c.(1135-1137)ACT>AGT	p.T379S	LARS2_uc010hit.1_Missense_Mutation_p.T336S	NM_015340	NP_056155	Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	379					leucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|leucine-tRNA ligase activity			upper_aerodigestive_tract(1)|ovary(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	ATTCCCAGTACTAGCTCAGAG	0.468													42	42	---	---	---	---	PASS
FAM19A4	151647	broad.mit.edu	37	3	68934335	68934335	+	Missense_Mutation	SNP	C	A	A	rs78056889	byFrequency	TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68934335C>A	uc003dnh.1	-	2	448	c.5G>T	c.(4-6)AGG>ATG	p.R2M	FAM19A4_uc003dni.1_Missense_Mutation_p.R2M	NM_182522	NP_872328	Q96LR4	F19A4_HUMAN	family with sequence similarity 19 (chemokine	2						extracellular region				skin(2)	2		Lung NSC(201;0.0198)		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)		CCTTGGGGACCTCATAAGATG	0.383													41	55	---	---	---	---	PASS
COL8A1	1295	broad.mit.edu	37	3	99509631	99509631	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99509631G>A	uc003dtg.1	+	4	350	c.105G>A	c.(103-105)CCG>CCA	p.P35P	COL8A1_uc003dth.1_Silent_p.P35P|COL8A1_uc003dti.1_Silent_p.P35P	NM_001850	NP_001841	P27658	CO8A1_HUMAN	alpha 1 type VIII collagen precursor	35	Nonhelical region (NC2).				angiogenesis|cell adhesion	basement membrane|collagen type VIII					0						GGATCAAGCCGCTGCCACCTC	0.557													40	75	---	---	---	---	PASS
NIT2	56954	broad.mit.edu	37	3	100064427	100064427	+	Splice_Site	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100064427A>G	uc003dtv.2	+	5	411	c.337_splice	c.e5-2	p.I113_splice	NIT2_uc011bha.1_Intron	NM_020202	NP_064587	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2						nitrogen compound metabolic process		omega-amidase activity			ovary(1)	1						TTTGTGATGCAGATCCATCTG	0.403													14	67	---	---	---	---	PASS
TRAT1	50852	broad.mit.edu	37	3	108568089	108568089	+	Silent	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108568089C>G	uc003dxi.1	+	5	435	c.291C>G	c.(289-291)ACC>ACG	p.T97T	TRAT1_uc010hpx.1_Silent_p.T60T	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN	T-cell receptor interacting molecule	97	Cytoplasmic (Potential).				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1						AGGAAGCCACCCCATCTGCAC	0.373													90	134	---	---	---	---	PASS
SIDT1	54847	broad.mit.edu	37	3	113327364	113327364	+	Silent	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113327364T>C	uc003eak.2	+	17	2352	c.1701T>C	c.(1699-1701)AAT>AAC	p.N567N	SIDT1_uc011bif.1_RNA|SIDT1_uc003eaj.1_Silent_p.N567N|SIDT1_uc011big.1_Silent_p.N320N|SIDT1_uc011bih.1_RNA|SIDT1_uc011bii.1_Silent_p.N20N	NM_017699	NP_060169	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1 precursor	567	Extracellular (Potential).					integral to membrane				ovary(3)|pancreas(1)|skin(1)	5						TCTGCCCTAATTATTCCAACT	0.433													316	286	---	---	---	---	PASS
STXBP5L	9515	broad.mit.edu	37	3	121137266	121137266	+	Silent	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121137266C>G	uc003eec.3	+	27	3521	c.3381C>G	c.(3379-3381)GGC>GGG	p.G1127G	STXBP5L_uc011bji.1_Silent_p.G1103G	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	1127	v-SNARE coiled-coil homology.				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		GGATGAAAGGCGCTGCTGGAG	0.527													18	81	---	---	---	---	PASS
DTX3L	151636	broad.mit.edu	37	3	122287963	122287963	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122287963C>T	uc003efk.2	+	3	1116	c.1027C>T	c.(1027-1029)CTC>TTC	p.L343F	DTX3L_uc010hrj.2_Intron	NM_138287	NP_612144	Q8TDB6	DTX3L_HUMAN	deltex 3-like	343					histone monoubiquitination|response to DNA damage stimulus	cytoplasm|nucleus	histone binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)	4				GBM - Glioblastoma multiforme(114;0.0459)		CGAATTAACTCTCCTTGGGAC	0.383													78	355	---	---	---	---	PASS
SEC22A	26984	broad.mit.edu	37	3	122942494	122942494	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122942494C>T	uc003ege.2	+	3	350	c.271C>T	c.(271-273)CAG>TAG	p.Q91*	SEC22A_uc003egf.2_Nonsense_Mutation_p.Q91*	NM_012430	NP_036562	Q96IW7	SC22A_HUMAN	SEC22 vesicle trafficking protein homolog A	91	Cytoplasmic (Potential).|Longin.				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane	transporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0548)		GGATGAGCTTCAGAAGGAGTT	0.378													135	454	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124141740	124141740	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124141740A>G	uc003ehg.2	+	15	2745	c.2618A>G	c.(2617-2619)CAT>CGT	p.H873R	KALRN_uc010hrv.1_Missense_Mutation_p.H873R|KALRN_uc003ehf.1_Missense_Mutation_p.H873R|KALRN_uc011bjy.1_Missense_Mutation_p.H873R|KALRN_uc003ehh.1_Missense_Mutation_p.H219R	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	873					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						GAGAAGCAGCATGAATTGGAG	0.453													26	128	---	---	---	---	PASS
C3orf37	56941	broad.mit.edu	37	3	129023673	129023673	+	3'UTR	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129023673G>T	uc003elt.2	+	7					C3orf37_uc003elu.2_3'UTR|C3orf37_uc003elv.2_3'UTR|C3orf37_uc003elw.2_3'UTR	NM_020187	NP_064572	Q96FZ2	CC037_HUMAN	hypothetical protein LOC56941											ovary(1)	1						CAGTGACACAGGACTTTCAGA	0.527													26	68	---	---	---	---	PASS
TMCC1	23023	broad.mit.edu	37	3	129389793	129389793	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129389793C>A	uc003emz.3	-	5	1392	c.891G>T	c.(889-891)AAG>AAT	p.K297N	TMCC1_uc003emy.3_5'UTR|TMCC1_uc011blc.1_Missense_Mutation_p.K118N|TMCC1_uc010htg.2_Missense_Mutation_p.K183N	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	297	Potential.					integral to membrane				skin(1)	1						GCTCAAGTTTCTTTTGCAGCT	0.522													91	328	---	---	---	---	PASS
DNAJC13	23317	broad.mit.edu	37	3	132211259	132211259	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132211259C>T	uc003eor.2	+	33	3690	c.3625C>T	c.(3625-3627)CGC>TGC	p.R1209C		NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1209							heat shock protein binding			ovary(1)|breast(1)	2						TGATTGTAGGCGCCTGATGAT	0.373													10	689	---	---	---	---	PASS
TOPBP1	11073	broad.mit.edu	37	3	133335770	133335770	+	Splice_Site	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133335770C>G	uc003eps.2	-	23	3892	c.3760_splice	c.e23-1	p.I1254_splice		NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1						DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						TCGTTATAATCTGGAATGAAA	0.279								Other_conserved_DNA_damage_response_genes					10	8	---	---	---	---	PASS
TF	7018	broad.mit.edu	37	3	133476704	133476704	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133476704T>A	uc003epu.1	+	13	2690	c.962T>A	c.(961-963)TTT>TAT	p.F321Y	TF_uc011blt.1_Missense_Mutation_p.F194Y|TF_uc003epw.1_Intron|TF_uc003epv.1_Missense_Mutation_p.F321Y	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor	321	Transferrin-like 1.				cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	GCCCACGGGTTTTTAAAAGTC	0.478													33	192	---	---	---	---	PASS
RAB6B	51560	broad.mit.edu	37	3	133560496	133560496	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133560496C>T	uc003epy.2	-	3	522	c.141G>A	c.(139-141)GGG>GGA	p.G47G	RAB6B_uc011blu.1_Silent_p.G34G	NM_016577	NP_057661	Q9NRW1	RAB6B_HUMAN	RAB6B, member RAS oncogene family	47	Effector region (By similarity).				protein transport|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle|Golgi membrane	GTP binding|GTPase activity|protein binding			pancreas(1)	1						AGAAGTCAATCCCAATGGTTG	0.512													36	166	---	---	---	---	PASS
RASA2	5922	broad.mit.edu	37	3	141295906	141295906	+	Silent	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141295906C>G	uc003etz.1	+	15	1548	c.1548C>G	c.(1546-1548)GCC>GCG	p.A516A	RASA2_uc010huq.1_Silent_p.A516A|RASA2_uc003eua.1_Silent_p.A516A|RASA2_uc011bnc.1_Silent_p.A108A	NM_006506	NP_006497	Q15283	RASA2_HUMAN	RAS p21 protein activator 2	516	Ras-GAP.				intracellular signal transduction|negative regulation of Ras protein signal transduction	intracellular membrane-bounded organelle|intrinsic to internal side of plasma membrane|perinuclear region of cytoplasm	metal ion binding|Ras GTPase activator activity			ovary(2)|lung(2)|breast(1)|skin(1)	6						TTGCTGTAGCCGTAGTATCAC	0.348													83	171	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142188925	142188925	+	Intron	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142188925T>C	uc003eux.3	-						ATR_uc003euy.1_5'Flank	NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein						cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						TGAAGAGTTATACCTTTTTCC	0.338								Other_conserved_DNA_damage_response_genes					21	70	---	---	---	---	PASS
CPB1	1360	broad.mit.edu	37	3	148552387	148552387	+	Nonsense_Mutation	SNP	A	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148552387A>T	uc003ewl.2	+	3	273	c.250A>T	c.(250-252)AAG>TAG	p.K84*		NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein	84					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			GAATGTTCTAAAGCAGAATGA	0.368													73	157	---	---	---	---	PASS
TM4SF18	116441	broad.mit.edu	37	3	149048162	149048162	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149048162G>T	uc003exa.2	-	3	359	c.222C>A	c.(220-222)AAC>AAA	p.N74K		NM_138786	NP_620141	Q96CE8	T4S18_HUMAN	transmembrane 4 L six family member 18	74	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ATTTATAGTTGTTATTATTCT	0.368													40	143	---	---	---	---	PASS
SUCNR1	56670	broad.mit.edu	37	3	151598764	151598764	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151598764G>C	uc003ezf.1	+	3	532	c.433G>C	c.(433-435)GCC>CCC	p.A145P		NM_033050	NP_149039	Q9BXA5	SUCR1_HUMAN	succinate receptor 1	145	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	AATCTCCTTGGCCATTTGGGT	0.363													112	486	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164735583	164735583	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164735583G>T	uc003fei.2	-	30	3661	c.3599C>A	c.(3598-3600)CCA>CAA	p.P1200Q		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1200	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TTCTGGAGTTGGGCCCAAAAA	0.333										HNSCC(35;0.089)			25	86	---	---	---	---	PASS
GHSR	2693	broad.mit.edu	37	3	172166132	172166132	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172166132G>A	uc003fib.1	-	1	72	c.72C>T	c.(70-72)TCC>TCT	p.S24S	GHSR_uc011bpv.1_Silent_p.S24S	NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a	24	Extracellular (Potential).				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CGTTGCCGGGGGAAGCATCCC	0.687													17	32	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186943206	186943206	+	Missense_Mutation	SNP	G	T	T	rs72549170	byFrequency	TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186943206G>T	uc003frh.1	-	13	1979	c.1647C>A	c.(1645-1647)TTC>TTA	p.F549L		NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	549	Peptidase S1.				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CGTCATTCTCGAATGTGTTGG	0.557													276	222	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	189625228	189625228	+	IGR	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189625228G>T								TP63 (10160 upstream) : LEPREL1 (49291 downstream)																							GCATGGTTTAGAGTTTGGGAG	0.408													10	59	---	---	---	---	PASS
LIMCH1	22998	broad.mit.edu	37	4	41682081	41682081	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41682081A>T	uc003gvu.3	+	19	2480	c.2426A>T	c.(2425-2427)GAG>GTG	p.E809V	LIMCH1_uc003gvv.3_Missense_Mutation_p.E809V|LIMCH1_uc003gvw.3_Missense_Mutation_p.E808V|LIMCH1_uc003gvx.3_Missense_Mutation_p.E821V|LIMCH1_uc003gwe.3_Missense_Mutation_p.E732V|LIMCH1_uc003gvy.3_Missense_Mutation_p.E637V|LIMCH1_uc003gwa.3_Missense_Mutation_p.E649V|LIMCH1_uc003gvz.3_Missense_Mutation_p.E1193V|LIMCH1_uc011byu.1_Missense_Mutation_p.E642V|LIMCH1_uc003gwc.3_Missense_Mutation_p.E654V|LIMCH1_uc003gwd.3_Missense_Mutation_p.E642V|LIMCH1_uc011byv.1_Missense_Mutation_p.E559V|LIMCH1_uc011byw.1_Missense_Mutation_p.E108V	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a	809	Glu-rich.				actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						GCCCAAAAGGAGGTGGAAGAG	0.448													4	3	---	---	---	---	PASS
GUF1	60558	broad.mit.edu	37	4	44692729	44692729	+	Intron	SNP	T	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44692729T>G	uc003gww.3	+							NM_021927	NP_068746	Q8N442	GUF1_HUMAN	GUF1 GTPase homolog						translation	mitochondrial inner membrane	GTP binding|GTPase activity			upper_aerodigestive_tract(1)	1						TTTTCTAATTTTTAGGAACAT	0.279													20	38	---	---	---	---	PASS
SGCB	6443	broad.mit.edu	37	4	52895916	52895916	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52895916G>C	uc003gzj.2	-	3	417	c.357C>G	c.(355-357)ATC>ATG	p.I119M	SGCB_uc011bzp.1_Missense_Mutation_p.I49M	NM_000232	NP_000223	Q16585	SGCB_HUMAN	sarcoglycan, beta	119	Extracellular (Potential).|Cys-rich.		I -> F (in LGMD2E).		cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to plasma membrane|sarcoglycan complex|sarcolemma					0			GBM - Glioblastoma multiforme(4;7.63e-12)|LUSC - Lung squamous cell carcinoma(32;0.00204)			AAAGAGGGTGGATCACTCCCA	0.433													46	98	---	---	---	---	PASS
REST	5978	broad.mit.edu	37	4	57796299	57796299	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57796299G>A	uc003hch.2	+	4	1622	c.1275G>A	c.(1273-1275)GTG>GTA	p.V425V	REST_uc003hci.2_Silent_p.V425V|REST_uc010ihf.2_Silent_p.V99V	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	425	Lys-rich.				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)					TCTCAAAAGTGAAACTAAAGA	0.348													5	155	---	---	---	---	PASS
CENPE	1062	broad.mit.edu	37	4	104044211	104044211	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104044211T>G	uc003hxb.1	-	43	7050	c.6960A>C	c.(6958-6960)AGA>AGC	p.R2320S	CENPE_uc003hxc.1_Missense_Mutation_p.R2199S	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	2320	Kinetochore-binding domain.|Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TGGTAGCACTTCTTTCCTCAA	0.299													56	91	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123094218	123094218	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123094218T>C	uc003ieh.2	+	2	170	c.125T>C	c.(124-126)ATT>ACT	p.I42T		NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	42	Helical; (Potential).				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						GGATGGATTATTTACCTCACA	0.328													6	244	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134072811	134072811	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134072811C>A	uc003iha.2	+	1	2342	c.1516C>A	c.(1516-1518)CAG>AAG	p.Q506K	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.Q506K	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	506	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		CCTCGAGTGCCAGATCCAGGG	0.577													48	127	---	---	---	---	PASS
PCDH18	54510	broad.mit.edu	37	4	138442370	138442370	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138442370C>A	uc003ihe.3	-	4	3608	c.3221G>T	c.(3220-3222)GGA>GTA	p.G1074V	PCDH18_uc003ihf.3_Missense_Mutation_p.G1066V|PCDH18_uc011cgz.1_Missense_Mutation_p.G285V|PCDH18_uc003ihg.3_Missense_Mutation_p.G853V|PCDH18_uc011cha.1_Missense_Mutation_p.G254V	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN	protocadherin 18 precursor	1074	Interaction with DAB1 (By similarity).|Cytoplasmic (Potential).				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			pancreas(3)|skin(2)	5	all_hematologic(180;0.24)					GGAGTGAGTTCCAAGTGGCGG	0.527													25	20	---	---	---	---	PASS
USP38	84640	broad.mit.edu	37	4	144135239	144135239	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144135239A>G	uc003ijb.2	+	9	2644	c.2110A>G	c.(2110-2112)AAA>GAA	p.K704E	USP38_uc003ija.3_Missense_Mutation_p.K704E|USP38_uc003ijc.2_RNA	NM_032557	NP_115946	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	704					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_hematologic(180;0.158)					TCTTGTTAATAAAGATGTACC	0.368													52	81	---	---	---	---	PASS
ARHGAP10	79658	broad.mit.edu	37	4	148867866	148867866	+	Intron	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148867866C>G	uc003ilf.2	+						ARHGAP10_uc003ilg.2_Intron|ARHGAP10_uc003ilh.2_Intron	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN	Rho GTPase activating protein 10						apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		GTAAGCTCCTCTCAGTAGCAA	0.348													20	36	---	---	---	---	PASS
TLR2	7097	broad.mit.edu	37	4	154624999	154624999	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154624999A>G	uc003inq.2	+	3	1159	c.940A>G	c.(940-942)ATC>GTC	p.I314V	TLR2_uc003inr.2_Missense_Mutation_p.I314V|TLR2_uc003ins.2_Missense_Mutation_p.I314V	NM_003264	NP_003255	O60603	TLR2_HUMAN	toll-like receptor 2 precursor	314	Extracellular (Potential).				cellular response to diacyl bacterial lipopeptide|cellular response to lipoteichoic acid|cellular response to triacyl bacterial lipopeptide|detection of diacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|I-kappaB phosphorylation|induction of apoptosis|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of interferon-beta production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of Wnt receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|integral to plasma membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	Gram-positive bacterial cell surface binding|lipopolysaccharide receptor activity|peptidoglycan binding|protein heterodimerization activity|transmembrane receptor activity|triacyl lipopeptide binding			ovary(1)|lung(1)|breast(1)	3	all_hematologic(180;0.093)	Renal(120;0.117)				AACGTTAACAATCCGGAGGCT	0.338													4	154	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155287483	155287483	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155287483C>A	uc003inw.2	-	5	573	c.573G>T	c.(571-573)CAG>CAT	p.Q191H	DCHS2_uc003inx.2_Missense_Mutation_p.Q785H	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	191	Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CGGTGCCTGGCTGGGTCTCAT	0.498													32	41	---	---	---	---	PASS
TLL1	7092	broad.mit.edu	37	4	166996093	166996093	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166996093G>A	uc003irh.1	+	17	2899	c.2252G>A	c.(2251-2253)AGC>AAC	p.S751N	TLL1_uc011cjn.1_Missense_Mutation_p.S774N|TLL1_uc011cjo.1_Missense_Mutation_p.S575N	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	751	EGF-like 2; calcium-binding (Potential).				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		ACGATGGGGAGCTACATGTGT	0.398													75	122	---	---	---	---	PASS
MTMR12	54545	broad.mit.edu	37	5	32239230	32239230	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32239230C>T	uc003jhq.2	-	13	1391	c.1221G>A	c.(1219-1221)CTG>CTA	p.L407L	MTMR12_uc010iuk.2_Silent_p.L407L|MTMR12_uc010iul.2_Silent_p.L407L	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	407	Myotubularin phosphatase.					cytoplasm	phosphatase activity			ovary(1)	1						GGTCCATCATCAGTTGCACCA	0.527													36	97	---	---	---	---	PASS
ZFR	51663	broad.mit.edu	37	5	32400290	32400290	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32400290G>A	uc003jhr.1	-	9	1615	c.1535C>T	c.(1534-1536)TCA>TTA	p.S512L		NM_016107	NP_057191	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	512					multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding				0				STAD - Stomach adenocarcinoma(35;0.19)		ATTTCCTGTTGACTGCAGCTT	0.318													16	84	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33576387	33576387	+	Silent	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33576387C>G	uc003jia.1	-	19	3907	c.3744G>C	c.(3742-3744)CTG>CTC	p.L1248L	ADAMTS12_uc010iuq.1_Silent_p.L1163L	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1248	Spacer 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CCAGAGGGAGCAGAGTGTTGG	0.522										HNSCC(64;0.19)			6	373	---	---	---	---	PASS
RAI14	26064	broad.mit.edu	37	5	34687070	34687070	+	Intron	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34687070C>T	uc003jir.2	+						RAI14_uc010iur.2_Intron|RAI14_uc011coj.1_Intron|RAI14_uc010ius.1_Intron|RAI14_uc003jis.2_Intron|RAI14_uc003jit.2_Intron|RAI14_uc011cok.1_5'Flank	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					CGTGAGTATGCGGTGACTCAC	0.478													4	167	---	---	---	---	PASS
C5orf28	64417	broad.mit.edu	37	5	43446645	43446645	+	Silent	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43446645G>C	uc003jny.2	-	3	470	c.327C>G	c.(325-327)CTC>CTG	p.L109L	C5orf28_uc003jnv.3_Silent_p.L109L|C5orf28_uc003jnx.2_Silent_p.L109L	NM_022483	NP_071928	Q0VDI3	CE028_HUMAN	hypothetical protein LOC64417	109						integral to membrane					0	Lung NSC(6;2.07e-05)					GTCTTCGCGGGAGAGTCAAAG	0.383													35	90	---	---	---	---	PASS
SKIV2L2	23517	broad.mit.edu	37	5	54640937	54640937	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54640937G>C	uc003jpy.3	+	10	1287	c.1021G>C	c.(1021-1023)GAT>CAT	p.D341H	SKIV2L2_uc011cqi.1_Missense_Mutation_p.D240H	NM_015360	NP_056175	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2	341					maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(1)|skin(1)	2		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				CTTCAGAGAAGATAATTTTAA	0.368													17	17	---	---	---	---	PASS
GIN1	54826	broad.mit.edu	37	5	102440400	102440400	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102440400T>C	uc003koa.1	-	4	566	c.484A>G	c.(484-486)ATA>GTA	p.I162V	GIN1_uc003kob.1_Missense_Mutation_p.I15V|GIN1_uc003koc.1_Missense_Mutation_p.I162V	NM_017676	NP_060146	Q9NXP7	GIN1_HUMAN	zinc finger, H2C2 domain containing	162	Integrase catalytic.				DNA integration		DNA binding			ovary(1)|skin(1)	2		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		GTCATGATTATAGCATATACA	0.358													44	50	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140515935	140515935	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140515935G>T	uc003liq.2	+	1	1136	c.919G>T	c.(919-921)GAT>TAT	p.D307Y		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	307	Cadherin 3.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAGGGCATTGGATTTCGAGGC	0.438													130	113	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140725166	140725166	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140725166C>T	uc003ljm.1	+	1	1566	c.1566C>T	c.(1564-1566)TAC>TAT	p.Y522Y	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Silent_p.Y282Y|PCDHGA3_uc011dap.1_Silent_p.Y522Y	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	522	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTCGACTACGAGCAATTTA	0.562													63	67	---	---	---	---	PASS
JAKMIP2	9832	broad.mit.edu	37	5	146991901	146991901	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146991901G>T	uc003loq.1	-	20	2762	c.2380C>A	c.(2380-2382)CAG>AAG	p.Q794K	JAKMIP2_uc011dbx.1_Missense_Mutation_p.Q752K|JAKMIP2_uc003lor.1_Missense_Mutation_p.Q773K|uc003lop.1_Intron|JAKMIP2_uc010jgo.1_Missense_Mutation_p.Q794K	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein	794	Potential.					Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCTTTTCTGGATGTCTGTT	0.303													6	18	---	---	---	---	PASS
ANXA6	309	broad.mit.edu	37	5	150484827	150484827	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150484827G>C	uc003ltl.1	-	24	1970	c.1818C>G	c.(1816-1818)GAC>GAG	p.D606E	ANXA6_uc011dcp.1_Missense_Mutation_p.D574E|ANXA6_uc003ltm.1_Missense_Mutation_p.D600E|ANXA6_uc003ltn.1_Missense_Mutation_p.D393E|ANXA6_uc003lto.1_Missense_Mutation_p.D193E	NM_001155	NP_001146	P08133	ANXA6_HUMAN	annexin VI isoform 1	606						melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGTAAAGTTTGTCGGCAAAGA	0.478													17	26	---	---	---	---	PASS
OR2B2	81697	broad.mit.edu	37	6	27880034	27880034	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27880034A>G	uc011dkw.1	-	1	64	c.64T>C	c.(64-66)TGG>CGG	p.W22R		NM_033057	NP_149046	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATCTCTAGCCATGGTTGATCT	0.363													38	112	---	---	---	---	PASS
STK38	11329	broad.mit.edu	37	6	36485579	36485579	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36485579C>A	uc003omg.2	-	5	1017	c.429G>T	c.(427-429)GAG>GAT	p.E143D	STK38_uc003omh.2_Missense_Mutation_p.E143D|STK38_uc003omi.2_Missense_Mutation_p.E143D	NM_007271	NP_009202	Q15208	STK38_HUMAN	serine/threonine kinase 38	143	Protein kinase.				intracellular protein kinase cascade|negative regulation of MAP kinase activity	cytoplasm|MLL5-L complex	ATP binding|magnesium ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6						AACTGTCTGCCTCCACTAGAA	0.413													58	125	---	---	---	---	PASS
FGD2	221472	broad.mit.edu	37	6	36982742	36982742	+	Silent	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36982742C>G	uc010jwp.1	+	8	1128	c.957C>G	c.(955-957)ACC>ACG	p.T319T	FGD2_uc003ong.2_Silent_p.T41T|FGD2_uc011dtv.1_5'UTR|FGD2_uc003oni.1_Silent_p.T125T	NM_173558	NP_775829	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	319	PH 1.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			upper_aerodigestive_tract(1)|lung(1)|pancreas(1)	3						CCTCTAACACCCTGCTCCGTG	0.632													23	61	---	---	---	---	PASS
UBR2	23304	broad.mit.edu	37	6	42613251	42613251	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42613251A>G	uc011dur.1	+	21	2332	c.2332A>G	c.(2332-2334)ATC>GTC	p.I778V	UBR2_uc011dus.1_Missense_Mutation_p.I423V|UBR2_uc003osh.2_RNA	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin	778					cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TACAGATGAAATCAAGCGAGA	0.343													54	117	---	---	---	---	PASS
CRIP3	401262	broad.mit.edu	37	6	43275417	43275417	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43275417G>A	uc010jyn.1	-	4	261	c.261C>T	c.(259-261)ACC>ACT	p.T87T	CRIP3_uc003ouu.1_Silent_p.T87T	NM_206922	NP_996805	Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	87						cytoplasm	zinc ion binding			skin(1)	1			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			TGAGAGGAGTGGTGCAGCCAG	0.612													39	93	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51798958	51798958	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51798958G>A	uc003pah.1	-	37	6347	c.6071C>T	c.(6070-6072)CCC>CTC	p.P2024L	PKHD1_uc010jzn.1_Missense_Mutation_p.P49L|PKHD1_uc003pai.2_Missense_Mutation_p.P2024L	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2024	Extracellular (Potential).|G8 1.				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GACTCCATAGGGAAAGAAGGG	0.507											OREG0017491	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	39	92	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51890901	51890901	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51890901G>T	uc003pah.1	-	32	3983	c.3707C>A	c.(3706-3708)TCC>TAC	p.S1236Y	PKHD1_uc003pai.2_Missense_Mutation_p.S1236Y	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1236	Extracellular (Potential).|IPT/TIG 7.				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					AATGTCACAGGACCGATTGCC	0.562													37	66	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	71003996	71003996	+	Silent	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71003996A>G	uc003pfg.3	-	5	729	c.570T>C	c.(568-570)AGT>AGC	p.S190S		NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor	190	Nonhelical region (NC4).|TSP N-terminal.				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						GAGTAGCACTACTCCTCTCCA	0.448													92	230	---	---	---	---	PASS
DOPEY1	23033	broad.mit.edu	37	6	83869602	83869602	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83869602A>C	uc003pjs.1	+	37	7145	c.6885A>C	c.(6883-6885)TTA>TTC	p.L2295F	DOPEY1_uc011dyy.1_Missense_Mutation_p.L2286F|DOPEY1_uc010kbl.1_Missense_Mutation_p.L2286F|DOPEY1_uc003pjt.2_RNA	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1	2295					protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		AGCGGTGGTTAAACCTCTATC	0.458													30	87	---	---	---	---	PASS
RIPPLY2	134701	broad.mit.edu	37	6	84563453	84563453	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84563453C>T	uc003pke.2	+	2	286	c.135C>T	c.(133-135)GGC>GGT	p.G45G		NM_001009994	NP_001009994	Q5TAB7	RIPP2_HUMAN	ripply2 protein	45					somite rostral/caudal axis specification	nucleus					0						ACGCCGGAGGCAAGAAAGAAG	0.672													6	22	---	---	---	---	PASS
GPR63	81491	broad.mit.edu	37	6	97247000	97247000	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97247000C>A	uc010kcl.2	-	3	1086	c.608G>T	c.(607-609)TGG>TTG	p.W203L	GPR63_uc003pou.2_Missense_Mutation_p.W203L	NM_001143957	NP_001137429	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	203	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		GGAAGTTGCCCAAGAAACTGC	0.463													55	126	---	---	---	---	PASS
C6orf174	387104	broad.mit.edu	37	6	127767607	127767607	+	3'UTR	SNP	A	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127767607A>T	uc003qbd.2	-	11					C6orf174_uc003qbc.2_Silent_p.A619A|C6orf174_uc003qba.2_Intron|C6orf174_uc003qbb.2_Silent_p.A502A|KIAA0408_uc011ebs.1_Silent_p.A619A	NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor							integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		CCCCCCACACAGCTGTCTTTT	0.393													7	654	---	---	---	---	PASS
C6orf191	253582	broad.mit.edu	37	6	130154674	130154674	+	Missense_Mutation	SNP	C	G	G	rs148503789	byFrequency	TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130154674C>G	uc003qbs.2	-	4	333	c.250G>C	c.(250-252)GTT>CTT	p.V84L		NM_001010876	NP_001010876	Q5VVB8	CF191_HUMAN	hypothetical protein LOC253582	84	Helical; (Potential).					integral to membrane				large_intestine(1)	1				GBM - Glioblastoma multiforme(226;0.0387)|all cancers(137;0.115)|OV - Ovarian serous cystadenocarcinoma(155;0.131)		TCTTCCACAACTGGAACAAAA	0.348													30	134	---	---	---	---	PASS
TMEM200A	114801	broad.mit.edu	37	6	130762304	130762304	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130762304T>G	uc003qca.2	+	3	1608	c.737T>G	c.(736-738)TTG>TGG	p.L246W	TMEM200A_uc010kfh.2_Missense_Mutation_p.L246W|TMEM200A_uc010kfi.2_Missense_Mutation_p.L246W|TMEM200A_uc003qcb.2_Missense_Mutation_p.L246W	NM_052913	NP_443145	Q86VY9	T200A_HUMAN	transmembrane protein 200A	246	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		ATGCCCCCTTTGCTCTCTGAC	0.473													48	109	---	---	---	---	PASS
TAAR5	9038	broad.mit.edu	37	6	132909864	132909864	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132909864C>A	uc003qdk.2	-	1	1014	c.962G>T	c.(961-963)AGC>ATC	p.S321I		NM_003967	NP_003958	O14804	TAAR5_HUMAN	trace amine associated receptor 5	321	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			skin(1)	1	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		GACCTTCTGGCTCAGTGTGAG	0.458													34	66	---	---	---	---	PASS
VNN2	8875	broad.mit.edu	37	6	133078687	133078687	+	Splice_Site	SNP	T	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133078687T>A	uc003qdt.2	-	2	225	c.214_splice	c.e2-1	p.G72_splice	VNN2_uc003qds.2_Splice_Site|VNN2_uc010kgb.2_Splice_Site_p.G72_splice|VNN2_uc003qdv.2_Splice_Site_p.G19_splice	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor						cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		TCGAGCACCCTGTTCAAAACA	0.433													52	124	---	---	---	---	PASS
VNN2	8875	broad.mit.edu	37	6	133078907	133078907	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133078907T>C	uc003qdt.2	-	1	127	c.116A>G	c.(115-117)AAT>AGT	p.N39S	VNN2_uc003qds.2_5'Flank|VNN2_uc010kgb.2_Missense_Mutation_p.N39S|VNN2_uc003qdv.2_Intron	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor	39	CN hydrolase.				cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		TTCTGTTTTATTTGGCAAAAT	0.438													8	286	---	---	---	---	PASS
VTA1	51534	broad.mit.edu	37	6	142539763	142539763	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142539763A>G	uc003qiw.2	+	8	922	c.907A>G	c.(907-909)ACG>GCG	p.T303A	VTA1_uc011edt.1_RNA|VTA1_uc011edu.1_Missense_Mutation_p.T218A	NM_016485	NP_057569	Q9NP79	VTA1_HUMAN	Vps20-associated 1 homolog	303	Interaction with VPS4B (By similarity).				cellular membrane organization|endosome transport|protein transport	cytosol|endosome membrane	protein binding				0	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		CAAGTTACTGACGACAGGCAG	0.438													50	93	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152546946	152546946	+	Silent	SNP	A	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152546946A>C	uc010kiw.2	-	116	21863	c.21261T>G	c.(21259-21261)GCT>GCG	p.A7087A	SYNE1_uc010kiv.2_Silent_p.A1611A|SYNE1_uc003qos.3_Silent_p.A1611A|SYNE1_uc003qot.3_Silent_p.A7016A|SYNE1_uc003qou.3_Silent_p.A7087A|SYNE1_uc003qor.3_5'UTR	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7087	Cytoplasmic (Potential).|Spectrin 22.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTGAATCAAAGCAAGTCCAT	0.363										HNSCC(10;0.0054)			61	143	---	---	---	---	PASS
PARK2	5071	broad.mit.edu	37	6	162394383	162394383	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162394383T>A	uc003qtx.3	-	6	819	c.685A>T	c.(685-687)ATC>TTC	p.I229F	PARK2_uc003qtv.3_RNA|PARK2_uc010kkd.2_Missense_Mutation_p.I38F|PARK2_uc003qtw.3_Missense_Mutation_p.I38F|PARK2_uc003qty.3_Missense_Mutation_p.I201F|PARK2_uc003qtz.3_Missense_Mutation_p.I80F|PARK2_uc010kke.1_Missense_Mutation_p.I229F	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1	229	SYT11 binding 1.				aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		TTTGTTGCGATCAGGTGCAAA	0.428													6	135	---	---	---	---	PASS
OSBPL3	26031	broad.mit.edu	37	7	24881927	24881927	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24881927G>C	uc003sxf.2	-	13	1777	c.1372C>G	c.(1372-1374)CTG>GTG	p.L458V	OSBPL3_uc003sxd.2_RNA|OSBPL3_uc003sxe.2_RNA|OSBPL3_uc003sxg.2_Missense_Mutation_p.L422V|OSBPL3_uc003sxh.2_Missense_Mutation_p.L427V|OSBPL3_uc003sxi.2_Missense_Mutation_p.L391V|OSBPL3_uc003sxj.1_Missense_Mutation_p.L187V|OSBPL3_uc003sxk.1_Missense_Mutation_p.L156V	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform	458					lipid transport		lipid binding|protein binding			skin(1)	1						GGAGATAACAGAACTTCCTGA	0.403													21	668	---	---	---	---	PASS
BBS9	27241	broad.mit.edu	37	7	33423374	33423374	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33423374T>C	uc003tdn.1	+	18	2399	c.1886T>C	c.(1885-1887)GTC>GCC	p.V629A	BBS9_uc003tdo.1_Missense_Mutation_p.V594A|BBS9_uc003tdp.1_Missense_Mutation_p.V624A|BBS9_uc003tdq.1_Missense_Mutation_p.V589A|BBS9_uc010kwn.1_RNA|BBS9_uc003tdr.1_Missense_Mutation_p.V153A|BBS9_uc003tds.1_Missense_Mutation_p.V52A|BBS9_uc003tdt.2_RNA|BBS9_uc011kao.1_Missense_Mutation_p.V507A	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2	629					fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			AAACAGGGAGTCAAAGATTTT	0.353									Bardet-Biedl_syndrome				30	93	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38295956	38295956	+	5'Flank	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38295956G>A	uc003tfu.3	-						uc003tfv.2_5'UTR|uc003tfw.2_RNA|uc003tfx.1_RNA|uc003tfz.1_RNA|uc003tga.1_5'Flank					SubName: Full=TARP protein;																		GTTACTATGAGCCTAGTCCCT	0.353													17	31	---	---	---	---	PASS
TARP	445347	broad.mit.edu	37	7	38357052	38357052	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38357052C>T	uc003tge.1	-	2	419	c.42G>A	c.(40-42)GGG>GGA	p.G14G	uc003tfz.1_5'Flank|TARP_uc003tgf.1_5'Flank|TARP_uc003tgj.1_5'Flank|TARP_uc003tgh.1_5'Flank|TARP_uc003tgi.1_5'Flank|TARP_uc003tgg.1_5'Flank			A2JGV3	A2JGV3_HUMAN	Homo sapiens TCRgamma alternate reading frame protein (TCRg) mRNA, complete cds.	Error:Variant_position_missing_in_A2JGV3_after_alignment											0						ACTTACGAGCCCCAAGGACTG	0.458													10	11	---	---	---	---	PASS
VSTM2A	222008	broad.mit.edu	37	7	54617718	54617718	+	Silent	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54617718G>T	uc010kzf.2	+	4	894	c.489G>T	c.(487-489)TCG>TCT	p.S163S	VSTM2A_uc010kze.2_Silent_p.S163S|VSTM2A_uc003tqc.3_Silent_p.S163S	NM_182546	NP_872352	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2	163						extracellular region					0			STAD - Stomach adenocarcinoma(5;0.0525)			TCGAAGCCTCGCCCATGTGGC	0.592													7	11	---	---	---	---	PASS
C7orf64	84060	broad.mit.edu	37	7	92164118	92164118	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92164118G>A	uc003ulz.2	+	4	892	c.851G>A	c.(850-852)CGC>CAC	p.R284H	C7orf64_uc003uma.2_Missense_Mutation_p.R284H	NM_032120	NP_115496	Q5RL73	CG064_HUMAN	hypothetical protein LOC84060	284							nucleotide binding			ovary(2)	2						CTGCAGGAGCGCAAAAGAAGA	0.428													4	68	---	---	---	---	PASS
HEPACAM2	253012	broad.mit.edu	37	7	92838131	92838131	+	Silent	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92838131A>G	uc003umm.2	-	4	797	c.774T>C	c.(772-774)TTT>TTC	p.F258F	HEPACAM2_uc003uml.2_Silent_p.F246F|HEPACAM2_uc010lff.2_Silent_p.F246F|HEPACAM2_uc011khy.1_Silent_p.F281F	NM_001039372	NP_001034461	A8MVW5	HECA2_HUMAN	HEPACAM family member 2 isoform 1	258	Ig-like C2-type 2.|Extracellular (Potential).					integral to membrane				ovary(3)|breast(1)|kidney(1)	5						GGTCAACAGTAAACACTTCCC	0.383													7	189	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103338356	103338356	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103338356T>C	uc003vca.2	-	10	1247	c.1087A>G	c.(1087-1089)AGT>GGT	p.S363G	RELN_uc010liz.2_Missense_Mutation_p.S363G	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	363					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GGGTCGAGACTATCTTCTAAA	0.428													132	80	---	---	---	---	PASS
IMPDH1	3614	broad.mit.edu	37	7	128034978	128034978	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128034978C>T	uc011kol.1	-	11	1366	c.1260G>A	c.(1258-1260)ATG>ATA	p.M420I	IMPDH1_uc011kom.1_Missense_Mutation_p.M415I|IMPDH1_uc003vmt.2_Missense_Mutation_p.M395I|IMPDH1_uc003vmu.2_Missense_Mutation_p.M505I|IMPDH1_uc003vmw.2_Missense_Mutation_p.M495I|IMPDH1_uc011kon.1_Missense_Mutation_p.M472I|IMPDH1_uc003vmv.2_Missense_Mutation_p.M469I|IMPDH1_uc003vmx.2_Missense_Mutation_p.M428I|IMPDH1_uc003vmy.2_Missense_Mutation_p.M436I|uc011koo.1_5'Flank	NM_001142573	NP_001136045	P20839	IMDH1_HUMAN	inosine monophosphate dehydrogenase 1 isoform e	420					GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	DNA binding|IMP dehydrogenase activity|metal ion binding			skin(2)|lung(1)|central_nervous_system(1)	4					Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)|Ribavirin(DB00811)|Thioguanine(DB00352)	TGCTCTTCTCCATGGCATCCA	0.637													84	41	---	---	---	---	PASS
PARP12	64761	broad.mit.edu	37	7	139754535	139754535	+	Silent	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139754535G>C	uc003vvl.1	-	4	1663	c.789C>G	c.(787-789)TCC>TCG	p.S263S	PARP12_uc003vvk.1_Silent_p.S49S|PARP12_uc010lnf.1_RNA	NM_022750	NP_073587	Q9H0J9	PAR12_HUMAN	poly ADP-ribose polymerase 12	263						nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)	3	Melanoma(164;0.0142)					GAGTGTTTGGGGACACAGAAC	0.418													79	58	---	---	---	---	PASS
ABCF2	10061	broad.mit.edu	37	7	150923535	150923535	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150923535C>G	uc003wjp.2	-	2	121	c.10G>C	c.(10-12)GAC>CAC	p.D4H	ABCF2_uc003wjo.1_Missense_Mutation_p.D4H	NM_007189	NP_009120	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F, member 2	4						ATP-binding cassette (ABC) transporter complex|mitochondrial envelope	ATP binding|ATPase activity|transporter activity			central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTGGCCAGGTCGGAGGGCATG	0.502													6	108	---	---	---	---	PASS
PRKAG2	51422	broad.mit.edu	37	7	151273477	151273477	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151273477C>A	uc003wkk.2	-	7	1537	c.926G>T	c.(925-927)AGT>ATT	p.S309I	PRKAG2_uc003wki.2_Missense_Mutation_p.S68I|PRKAG2_uc011kvl.1_Missense_Mutation_p.S184I|PRKAG2_uc003wkj.2_Missense_Mutation_p.S265I|PRKAG2_uc003wkl.2_Intron|PRKAG2_uc010lqe.1_RNA	NM_016203	NP_057287	Q9UGJ0	AAKG2_HUMAN	AMP-activated protein kinase gamma2 subunit	309	CBS 1.				ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)		TTGTTTTTTACTCTCCCACAG	0.413													27	23	---	---	---	---	PASS
RBM33	155435	broad.mit.edu	37	7	155471376	155471376	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155471376C>T	uc010lqk.1	+	4	614	c.246C>T	c.(244-246)TTC>TTT	p.F82F	RBM33_uc003wme.2_Silent_p.F82F	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	82							nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		AAGAAAATTTCAGGTACTCAA	0.249													6	4	---	---	---	---	PASS
MTUS1	57509	broad.mit.edu	37	8	17611496	17611496	+	Silent	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17611496G>C	uc003wxv.2	-	2	2295	c.1821C>G	c.(1819-1821)GCC>GCG	p.A607A	MTUS1_uc010lsy.2_RNA|MTUS1_uc003wxw.2_Silent_p.A607A|MTUS1_uc010lsz.2_Silent_p.A607A	NM_001001924	NP_001001924	Q9ULD2	MTUS1_HUMAN	mitochondrial tumor suppressor 1 isoform 1	607						Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)		TCGATTTCACGGCAGATGTTG	0.433													208	165	---	---	---	---	PASS
NPBWR1	2831	broad.mit.edu	37	8	53852603	53852603	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53852603G>A	uc011ldu.1	+	1	136	c.136G>A	c.(136-138)GTG>ATG	p.V46M		NM_005285	NP_005276	P48145	NPBW1_HUMAN	G protein-coupled receptor 7	46	Helical; Name=1; (Potential).				synaptic transmission	plasma membrane	opioid receptor activity|protein binding			ovary(2)|breast(1)	3		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				TGTCTACGCGGTGATCTGCGC	0.687													10	31	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55539638	55539638	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55539638G>C	uc003xsd.1	+	4	3344	c.3196G>C	c.(3196-3198)GAG>CAG	p.E1066Q	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1066					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GCAAAGTGTAGAGGCTGCCAT	0.388													44	136	---	---	---	---	PASS
HNF4G	3174	broad.mit.edu	37	8	76476304	76476304	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76476304G>T	uc003yaq.2	+	11	1470	c.1200G>T	c.(1198-1200)CAG>CAT	p.Q400H	HNF4G_uc003yar.2_Missense_Mutation_p.Q437H	NM_004133	NP_004124	Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	400					endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			TTTCACACCAGCATCTCTCCA	0.423													74	167	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77617281	77617281	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77617281G>T	uc003yav.2	+	2	1345	c.958G>T	c.(958-960)GCC>TCC	p.A320S	ZFHX4_uc003yat.1_Missense_Mutation_p.A320S|ZFHX4_uc003yau.1_Missense_Mutation_p.A320S|ZFHX4_uc003yaw.1_Missense_Mutation_p.A320S	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	320						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATGCGTCTCCGCCATAATACA	0.413										HNSCC(33;0.089)			72	143	---	---	---	---	PASS
ZNF704	619279	broad.mit.edu	37	8	81733701	81733701	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81733701G>A	uc003yby.1	-	2	361	c.129C>T	c.(127-129)ATC>ATT	p.I43I		NM_001033723	NP_001028895	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	43						intracellular	zinc ion binding				0	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			CATGGTCAAGGATCCGGCTGG	0.428													239	495	---	---	---	---	PASS
TMEM67	91147	broad.mit.edu	37	8	94821290	94821290	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94821290T>G	uc011lgk.1	+	25	2633	c.2562T>G	c.(2560-2562)AAT>AAG	p.N854K	TMEM67_uc010maw.2_Missense_Mutation_p.N560K|TMEM67_uc003yga.3_Missense_Mutation_p.N773K|TMEM67_uc011lgl.1_Missense_Mutation_p.N253K	NM_153704	NP_714915	Q5HYA8	MKS3_HUMAN	meckelin isoform 1	854					cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding			ovary(2)	2	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			ATTAGAAAAATGGTCCTGCTA	0.303													63	145	---	---	---	---	PASS
TMEM74	157753	broad.mit.edu	37	8	109797102	109797102	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109797102G>C	uc003ymy.1	-	2	331	c.226C>G	c.(226-228)CTT>GTT	p.L76V	TMEM74_uc003ymx.2_Intron	NM_153015	NP_694560	Q96NL1	TMM74_HUMAN	transmembrane protein 74	76					autophagy	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane|lysosomal membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			TCTGGCTGAAGAGTACTGTTT	0.498													71	161	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110461643	110461643	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110461643T>G	uc003yne.2	+	40	6206	c.6102T>G	c.(6100-6102)TGT>TGG	p.C2034W		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2034	Extracellular (Potential).|IPT/TIG 13.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TATTAGTTTGTGGCTCAGAAT	0.373										HNSCC(38;0.096)			8	21	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113988344	113988344	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113988344C>A	uc003ynu.2	-	7	1223	c.1064G>T	c.(1063-1065)GGT>GTT	p.G355V	CSMD3_uc003ynt.2_Missense_Mutation_p.G315V|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	355	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CTCTAACTCACCAGTGGAGGT	0.413										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			37	123	---	---	---	---	PASS
TRPS1	7227	broad.mit.edu	37	8	116616439	116616439	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116616439C>A	uc003ynz.2	-	3	2177	c.1718G>T	c.(1717-1719)AGC>ATC	p.S573I	TRPS1_uc011lhy.1_Missense_Mutation_p.S577I|TRPS1_uc003yny.2_Missense_Mutation_p.S586I|TRPS1_uc010mcy.2_Missense_Mutation_p.S573I	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	573					negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			CTTTTCTGGGCTGCAAAGTCC	0.453									Langer-Giedion_syndrome				35	74	---	---	---	---	PASS
FER1L6	654463	broad.mit.edu	37	8	125131175	125131175	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125131175G>T	uc003yqw.2	+	40	5586	c.5380G>T	c.(5380-5382)GCC>TCC	p.A1794S	uc003yqy.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	1794	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AGAGCCCCTGGCCAAGCCCAA	0.502													15	47	---	---	---	---	PASS
CYP11B2	1585	broad.mit.edu	37	8	143996584	143996584	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143996584A>G	uc003yxk.1	-	3	476	c.473T>C	c.(472-474)CTC>CCC	p.L158P		NM_000498	NP_000489	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B,	158					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity				0	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Candesartan(DB00796)|Metyrapone(DB01011)	CACCATCGGGAGGAACCTCTG	0.637									Familial_Hyperaldosteronism_type_I				12	38	---	---	---	---	PASS
IL33	90865	broad.mit.edu	37	9	6254481	6254481	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6254481G>T	uc003zjt.2	+	7	597	c.540G>T	c.(538-540)AAG>AAT	p.K180N	IL33_uc011lmg.1_Missense_Mutation_p.K138N|IL33_uc011lmh.1_Missense_Mutation_p.K54N|IL33_uc003zju.1_Missense_Mutation_p.K180N	NM_033439	NP_254274	O95760	IL33_HUMAN	interleukin 33 precursor	180					positive regulation of chemokine secretion|positive regulation of inflammatory response|positive regulation of macrophage activation|positive regulation of transcription from RNA polymerase II promoter	extracellular space	cytokine activity				0		Acute lymphoblastic leukemia(23;0.158)|Prostate(43;0.167)		GBM - Glioblastoma multiforme(50;0.0161)|Lung(218;0.105)		TTGATGGTAAGATGTTAATGG	0.323													11	15	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90502488	90502488	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90502488C>G	uc004app.3	+	4	3121	c.3086C>G	c.(3085-3087)GCT>GGT	p.A1029G		NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	1029						integral to membrane				ovary(3)	3						TGGGCAAGGGCTGAAGATGCC	0.597													37	73	---	---	---	---	PASS
SPIN1	10927	broad.mit.edu	37	9	91077445	91077445	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91077445G>C	uc010mqj.2	+	4	636	c.136G>C	c.(136-138)GTT>CTT	p.V46L	SPIN1_uc004apy.2_Missense_Mutation_p.V46L|SPIN1_uc004apz.2_Missense_Mutation_p.V46L|SPIN1_uc010mqk.2_Missense_Mutation_p.V46L	NM_006717	NP_006708	Q9Y657	SPIN1_HUMAN	spindlin	46					cell cycle|gamete generation|multicellular organismal development	nucleus	methylated histone residue binding				0						GAGCAAACCTGTTTCCCAGCC	0.488													26	109	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113312235	113312235	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113312235G>T	uc010mtz.2	-	2	1018	c.681C>A	c.(679-681)AAC>AAA	p.N227K	SVEP1_uc010mua.1_Missense_Mutation_p.N227K|SVEP1_uc004beu.2_Missense_Mutation_p.N227K|SVEP1_uc004bev.2_5'UTR	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	227	VWFA.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						GCTCTCGAATGTTCCCTTGCC	0.498													35	97	---	---	---	---	PASS
C9orf84	158401	broad.mit.edu	37	9	114484874	114484874	+	Intron	SNP	A	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114484874A>C	uc004bfr.2	-						C9orf84_uc011lwt.1_Intron|C9orf84_uc004bfq.2_Intron|C9orf84_uc010mug.2_Intron	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1											ovary(2)	2						ATCTGCAAAAATAAAAGCATT	0.373													37	53	---	---	---	---	PASS
SNX30	401548	broad.mit.edu	37	9	115598673	115598673	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115598673C>G	uc004bgj.3	+	5	946	c.798C>G	c.(796-798)ATC>ATG	p.I266M	SNX30_uc004bgi.3_5'Flank	NM_001012994	NP_001013012	Q5VWJ9	SNX30_HUMAN	sorting nexin family member 30	266					cell communication|protein transport	cytoplasm	phosphatidylinositol binding				0						CCCAGCGGATCATCAAAGAAG	0.468													50	63	---	---	---	---	PASS
FKBP15	23307	broad.mit.edu	37	9	115964868	115964868	+	Silent	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115964868T>C	uc004bgs.2	-	6	559	c.441A>G	c.(439-441)AGA>AGG	p.R147R	FKBP15_uc010muu.1_Silent_p.R211R|FKBP15_uc011lxd.1_Silent_p.R79R|FKBP15_uc010mut.1_Silent_p.R15R|FKBP15_uc004bgt.2_Silent_p.R147R	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	147	Important for function in growth cone organization (By similarity).				endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						ACCAGTTCTGTCTCTGGTCAT	0.403													6	6	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119977009	119977009	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119977009C>G	uc004bjs.1	-	3	744	c.643G>C	c.(643-645)GCG>CCG	p.A215P	ASTN2_uc004bjr.1_Missense_Mutation_p.A215P|ASTN2_uc004bjt.1_Missense_Mutation_p.A215P	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	215	Helical; (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						AGCAGCAGCGCGATGAGGCCA	0.612													13	43	---	---	---	---	PASS
LRRC8A	56262	broad.mit.edu	37	9	131671419	131671419	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131671419G>C	uc004bwl.3	+	3	2230	c.1976G>C	c.(1975-1977)GGC>GCC	p.G659A	LRRC8A_uc010myp.2_Missense_Mutation_p.G659A|LRRC8A_uc010myq.2_Missense_Mutation_p.G659A	NM_019594	NP_062540	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member	659	LRR 12.				pre-B cell differentiation	integral to membrane					0						ATCCAGATCGGCAACCTCACC	0.577													24	46	---	---	---	---	PASS
LAMC3	10319	broad.mit.edu	37	9	133936418	133936418	+	Intron	SNP	T	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133936418T>G	uc004caa.1	+							NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor						cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GTCTTGCCCCTCAGGGATCTG	0.607													19	46	---	---	---	---	PASS
SARDH	1757	broad.mit.edu	37	9	136536678	136536678	+	Missense_Mutation	SNP	C	T	T	rs150998618	byFrequency	TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136536678C>T	uc004cep.3	-	18	2439	c.2305G>A	c.(2305-2307)GAC>AAC	p.D769N	SARDH_uc004ceo.2_Missense_Mutation_p.D769N|SARDH_uc011mdn.1_Missense_Mutation_p.D769N|SARDH_uc011mdo.1_Missense_Mutation_p.D601N|SARDH_uc004cen.2_Missense_Mutation_p.D197N	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	769					glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CTCAGGGAGTCGATGGCGCGG	0.672													5	16	---	---	---	---	PASS
GPSM1	26086	broad.mit.edu	37	9	139229007	139229007	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139229007G>A	uc004chd.2	+	2	392	c.172G>A	c.(172-174)GGC>AGC	p.G58S	GPSM1_uc004chc.2_Missense_Mutation_p.G58S	NM_001145638	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1 (AGS3-like, C.	58	TPR 1.|Mediates association with membranes (By similarity).				cell differentiation|nervous system development|signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|plasma membrane	binding|GTPase activator activity				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		TGTGCAGGTGGGCACCGAGGA	0.632													15	28	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7205846	7205846	+	Silent	SNP	A	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7205846A>T	uc009xio.1	-	21	2662	c.2571T>A	c.(2569-2571)CTT>CTA	p.L857L	SFMBT2_uc001ijn.1_Silent_p.L857L|SFMBT2_uc010qay.1_Silent_p.L692L	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	857	SAM.				regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						GAAGGGTCAGAAGCAGGAGTG	0.567													24	54	---	---	---	---	PASS
DHTKD1	55526	broad.mit.edu	37	10	12123630	12123630	+	Intron	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12123630T>C	uc001ild.3	+							NM_018706	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain						glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			ovary(1)|central_nervous_system(1)	2		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			ACGGCAGGTATGGCTTCTGCA	0.607													40	76	---	---	---	---	PASS
C10orf111	221060	broad.mit.edu	37	10	15138369	15138369	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15138369T>A	uc001inw.2	-	2	729	c.455A>T	c.(454-456)TAT>TTT	p.Y152F	RPP38_uc001iny.3_5'Flank|RPP38_uc009xjm.2_5'Flank|RPP38_uc001inx.3_5'Flank	NM_153244	NP_694976	Q8N326	CJ111_HUMAN	hypothetical protein LOC221060	152						integral to membrane					0						TACCAGAAAATAGGATACAAA	0.284													10	27	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15573126	15573126	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15573126C>G	uc001ioc.1	-	28	2905	c.2905G>C	c.(2905-2907)GCA>CCA	p.A969P	ITGA8_uc010qcb.1_Missense_Mutation_p.A954P	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	969	Extracellular (Potential).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						ACCAGGGATGCAAGAGCATAG	0.308													56	132	---	---	---	---	PASS
MLLT10	8028	broad.mit.edu	37	10	21962303	21962303	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21962303G>T	uc001iqs.2	+	11	1424	c.1076G>T	c.(1075-1077)AGT>ATT	p.S359I	MLLT10_uc001iqt.2_Missense_Mutation_p.S359I|MLLT10_uc001iqv.2_RNA|MLLT10_uc001iqy.2_Missense_Mutation_p.S359I|MLLT10_uc001ira.2_Intron|MLLT10_uc001irb.2_5'Flank|MLLT10_uc001iqz.2_Missense_Mutation_p.S114I	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	359	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						ACTCCAGGCAGTGTAAAGTCA	0.428			T	MLL|PICALM|CDK6	AL								80	214	---	---	---	---	PASS
GAD2	2572	broad.mit.edu	37	10	26534925	26534925	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26534925G>C	uc001isp.2	+	8	1419	c.916G>C	c.(916-918)GAG>CAG	p.E306Q	GAD2_uc001isq.2_Missense_Mutation_p.E306Q	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2	306					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	TAAATGTGATGAGAGGTGAGC	0.428													13	38	---	---	---	---	PASS
PDSS1	23590	broad.mit.edu	37	10	26998618	26998618	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26998618G>T	uc001isv.2	+	5	434	c.388G>T	c.(388-390)GAT>TAT	p.D130Y	PDSS1_uc001isw.2_Missense_Mutation_p.D130Y	NM_014317	NP_055132	Q5T2R2	DPS1_HUMAN	prenyl diphosphate synthase, subunit 1	130					isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	metal ion binding|protein heterodimerization activity				0						GTACTACTTTGATGGGAAAGG	0.403													98	205	---	---	---	---	PASS
CUL2	8453	broad.mit.edu	37	10	35324157	35324157	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35324157C>T	uc001ixv.2	-	10	1155	c.945G>A	c.(943-945)CTG>CTA	p.L315L	CUL2_uc009xma.2_Silent_p.L184L|CUL2_uc010qer.1_Silent_p.L334L|CUL2_uc001ixw.2_Silent_p.L315L|CUL2_uc010qes.1_Silent_p.L252L	NM_003591	NP_003582	Q13617	CUL2_HUMAN	cullin 2	315					cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding			ovary(3)	3						TGTGGTTTTGCAGCTCCTGAA	0.458													15	93	---	---	---	---	PASS
RET	5979	broad.mit.edu	37	10	43596173	43596173	+	Intron	SNP	A	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43596173A>T	uc001jal.2	+						RET_uc001jak.1_Intron	NM_020975	NP_066124	P07949	RET_HUMAN	ret proto-oncogene isoform a						homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity			thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451		Ovarian(717;0.0423)			Sunitinib(DB01268)	TGTCCGCAGTAAGGGAGCCGC	0.627		1	T|Mis|N|F	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma	Hirschsprung disease		Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma				3	5	---	---	---	---	PASS
OGDHL	55753	broad.mit.edu	37	10	50944484	50944484	+	Silent	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50944484C>A	uc001jie.2	-	21	2815	c.2673G>T	c.(2671-2673)ACG>ACT	p.T891T	OGDHL_uc009xog.2_Silent_p.T918T|OGDHL_uc010qgt.1_Silent_p.T834T|OGDHL_uc010qgu.1_Silent_p.T682T	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	891					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						ACACCTTTCCCGTGCAGAAGA	0.627													55	88	---	---	---	---	PASS
SLC16A12	387700	broad.mit.edu	37	10	91198522	91198522	+	Silent	SNP	G	C	C	rs142419410		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91198522G>C	uc001kgm.2	-	6	1168	c.777C>G	c.(775-777)TCC>TCG	p.S259S	SLC16A12_uc001kgl.2_5'Flank	NM_213606	NP_998771	Q6ZSM3	MOT12_HUMAN	solute carrier family 16 (monocarboxylic acid	259	Helical; (Potential).					integral to membrane|plasma membrane	symporter activity			skin(1)	1						TAAACAGAACGGAGACGGCTA	0.448													27	33	---	---	---	---	PASS
PIK3AP1	118788	broad.mit.edu	37	10	98416601	98416601	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98416601G>A	uc001kmq.2	-	3	649	c.521C>T	c.(520-522)TCA>TTA	p.S174L	PIK3AP1_uc001kmp.2_5'UTR	NM_152309	NP_689522	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	174						cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		GTTCCCAGGTGAAGTCACCGT	0.552													59	69	---	---	---	---	PASS
DNMBP	23268	broad.mit.edu	37	10	101668899	101668899	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101668899C>T	uc001kqj.2	-	5	2357	c.2265G>A	c.(2263-2265)ATG>ATA	p.M755I	DNMBP_uc001kqg.2_Missense_Mutation_p.M43I|DNMBP_uc001kqh.2_Missense_Mutation_p.M387I	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	755	Potential.				intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		AGAGGAGCGTCATTTCTAGAA	0.512													20	35	---	---	---	---	PASS
TRIM8	81603	broad.mit.edu	37	10	104404932	104404932	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104404932G>C	uc001kvz.2	+	1	681	c.558G>C	c.(556-558)AGG>AGC	p.R186S		NM_030912	NP_112174	Q9BZR9	TRIM8_HUMAN	tripartite motif-containing 8	186	Potential.					cytoplasm|PML body	ligase activity|protein homodimerization activity|zinc ion binding			ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		AGATCCGAAGGAATGAAATCC	0.582													12	12	---	---	---	---	PASS
SH3PXD2A	9644	broad.mit.edu	37	10	105484070	105484070	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105484070C>G	uc001kxj.1	-	5	496	c.356G>C	c.(355-357)CGG>CCG	p.R119P	SH3PXD2A_uc010qqu.1_Missense_Mutation_p.R49P	NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1	119	PX.				cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CTCGAAGAACCGGAAGACTTC	0.557													9	8	---	---	---	---	PASS
DPYSL4	10570	broad.mit.edu	37	10	134015564	134015564	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134015564C>A	uc009ybb.2	+	11	1379	c.1225C>A	c.(1225-1227)CTG>ATG	p.L409M		NM_006426	NP_006417	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	409					axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			central_nervous_system(2)	2		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		TGACGCTGACCTGGTCATATG	0.542													19	135	---	---	---	---	PASS
TSSC4	10078	broad.mit.edu	37	11	2424286	2424286	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2424286T>A	uc001lwj.2	+	4	784	c.423T>A	c.(421-423)CAT>CAA	p.H141Q	TSSC4_uc001lwi.2_Missense_Mutation_p.H77Q|TSSC4_uc001lwk.2_Missense_Mutation_p.H141Q|TSSC4_uc001lwl.2_Missense_Mutation_p.H141Q	NM_005706	NP_005697	Q9Y5U2	TSSC4_HUMAN	tumor suppressing subtransferable candidate 4	141											0		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.00145)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCAGGGCCCATCGGAGCCCTG	0.667													5	9	---	---	---	---	PASS
OR51A7	119687	broad.mit.edu	37	11	4928829	4928829	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4928829C>A	uc010qyq.1	+	1	230	c.230C>A	c.(229-231)TCC>TAC	p.S77Y		NM_001004749	NP_001004749	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A,	77	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCCCTCTCCTCCCTTCCTACC	0.453													71	157	---	---	---	---	PASS
OR51B2	79345	broad.mit.edu	37	11	5344663	5344663	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5344663T>A	uc001mao.1	-	1	920	c.865A>T	c.(865-867)ATC>TTC	p.I289F	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033180	NP_149420	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B,	289	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATGCTGTAGATGACAGGGTTC	0.378													10	163	---	---	---	---	PASS
PRKCDBP	112464	broad.mit.edu	37	11	6340741	6340741	+	Silent	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6340741G>C	uc001mcu.1	-	2	472	c.438C>G	c.(436-438)GGC>GGG	p.G146G		NM_145040	NP_659477	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	146											0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GGTCCGCCGGGCCCAAGGGCT	0.677													7	16	---	---	---	---	PASS
PRKCDBP	112464	broad.mit.edu	37	11	6340742	6340742	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6340742C>A	uc001mcu.1	-	2	471	c.437G>T	c.(436-438)GGC>GTC	p.G146V		NM_145040	NP_659477	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	146											0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GTCCGCCGGGCCCAAGGGCTC	0.677													7	15	---	---	---	---	PASS
USP47	55031	broad.mit.edu	37	11	11962033	11962033	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11962033T>G	uc001mjq.1	+	20	3074	c.2311T>G	c.(2311-2313)TTG>GTG	p.L771V	USP47_uc001mjr.2_Missense_Mutation_p.L683V|USP47_uc001mjs.2_Missense_Mutation_p.L751V|USP47_uc001mjt.1_Missense_Mutation_p.L57V	NM_017944	NP_060414	Q96K76	UBP47_HUMAN	ubiquitin specific protease 47	771					base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)		CTACAATGATTTGCGTCTTCT	0.338													60	121	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	20057511	20057511	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20057511C>T	uc010rdm.1	+	13	3205	c.2844C>T	c.(2842-2844)GAC>GAT	p.D948D	NAV2_uc001mpp.2_Silent_p.D861D|NAV2_uc001mpr.3_Silent_p.D925D|NAV2_uc001mpt.2_Silent_p.D11D|NAV2_uc009yhx.2_Silent_p.D11D|NAV2_uc009yhy.1_Translation_Start_Site	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	948						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						GCAGCTGGGACGACAGCAGCT	0.537													10	38	---	---	---	---	PASS
OR4C12	283093	broad.mit.edu	37	11	50003189	50003189	+	Silent	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50003189C>G	uc010ria.1	-	1	849	c.849G>C	c.(847-849)GTG>GTC	p.V283V		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						GTGTGTAGACCACGGGATTTA	0.398													53	77	---	---	---	---	PASS
OR4A15	81328	broad.mit.edu	37	11	55135622	55135622	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55135622A>T	uc010rif.1	+	1	263	c.263A>T	c.(262-264)TAC>TTC	p.Y88F		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	88	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TCCCCCATGTACTTTTTTCTG	0.413													17	284	---	---	---	---	PASS
OR5D18	219438	broad.mit.edu	37	11	55587510	55587510	+	Silent	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587510T>C	uc010rin.1	+	1	405	c.405T>C	c.(403-405)GTT>GTC	p.V135V		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	135	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				TCTACACAGTTAACATGTCCC	0.468													137	288	---	---	---	---	PASS
SPRYD5	84767	broad.mit.edu	37	11	55655725	55655725	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55655725T>A	uc010rip.1	+	4	817	c.725T>A	c.(724-726)GTG>GAG	p.V242E	SPRYD5_uc010riq.1_Missense_Mutation_p.V99E	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	242						intracellular	zinc ion binding				0		all_epithelial(135;0.226)				AAAGCAGATGTGGAGCTACTC	0.448													21	64	---	---	---	---	PASS
OR4D6	219983	broad.mit.edu	37	11	59224895	59224895	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59224895G>A	uc010rku.1	+	1	462	c.462G>A	c.(460-462)TTG>TTA	p.L154L		NM_001004708	NP_001004708	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D,	154	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GTGGTGGTTTGCATTCAATCA	0.512													94	199	---	---	---	---	PASS
INTS5	80789	broad.mit.edu	37	11	62416509	62416509	+	Nonsense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62416509G>C	uc001nud.2	-	2	1096	c.1043C>G	c.(1042-1044)TCA>TGA	p.S348*	GANAB_uc001nua.2_5'Flank|GANAB_uc001nub.2_5'Flank|GANAB_uc001nuc.2_5'Flank|GANAB_uc010rma.1_5'Flank|GANAB_uc010rmb.1_5'Flank	NM_030628	NP_085131	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	348					snRNA processing	integral to membrane|integrator complex	protein binding			ovary(2)	2						CAAAGCTGGTGACATGACTGC	0.607													92	132	---	---	---	---	PASS
PPP1R14B	26472	broad.mit.edu	37	11	64013996	64013996	+	Silent	SNP	C	T	T	rs12787613		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64013996C>T	uc001nza.2	-	1	418	c.150G>A	c.(148-150)GTG>GTA	p.V50V		NM_138689	NP_619634	Q96C90	PP14B_HUMAN	protein phosphatase 1 regulatory subunit 14B	50					regulation of phosphorylation	cytoplasm	protein phosphatase inhibitor activity				0						CTTGGCGCCTCACTGGGCCCT	0.642													7	16	---	---	---	---	PASS
SHANK2	22941	broad.mit.edu	37	11	70333107	70333107	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70333107C>T	uc001oqc.2	-	21	3369	c.3291G>A	c.(3289-3291)AGG>AGA	p.R1097R	SHANK2_uc010rqn.1_Silent_p.R509R|SHANK2_uc001opz.2_Silent_p.R502R|uc009ysn.1_Intron|SHANK2_uc001opy.2_Intron	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	718					intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CCGGGGAGTTCCTCCTGGCTT	0.716													20	33	---	---	---	---	PASS
MYO7A	4647	broad.mit.edu	37	11	76900494	76900494	+	Silent	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76900494C>G	uc001oyb.2	+	28	3881	c.3609C>G	c.(3607-3609)GCC>GCG	p.A1203A	MYO7A_uc010rsm.1_Silent_p.A1192A|MYO7A_uc001oyc.2_Silent_p.A1203A|MYO7A_uc009yus.1_RNA|MYO7A_uc009yut.1_Silent_p.A414A	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1	1203	MyTH4 1.				actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						GCTGTTTCGCCCCCTCCGAGA	0.607													40	90	---	---	---	---	PASS
FOLH1B	219595	broad.mit.edu	37	11	89424278	89424278	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89424278C>G	uc001pda.2	+	11	1454	c.928C>G	c.(928-930)CAT>GAT	p.H310D		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	310					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						TTCTATGAAACATCCACAGGA	0.328													48	151	---	---	---	---	PASS
NAALAD2	10003	broad.mit.edu	37	11	89911209	89911209	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89911209G>A	uc001pdf.3	+	16	1891	c.1782G>A	c.(1780-1782)TTG>TTA	p.L594L	NAALAD2_uc009yvx.2_Silent_p.L561L|NAALAD2_uc009yvy.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	594	Extracellular (Potential).				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				CAGAAGCTTTGAAAAACTATG	0.338													76	149	---	---	---	---	PASS
MMP20	9313	broad.mit.edu	37	11	102479831	102479831	+	Splice_Site	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102479831T>C	uc001phc.2	-	5	663	c.650_splice	c.e5-1	p.G217_splice		NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein						proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)		AATTAAAACCTAGACAATATG	0.398													37	61	---	---	---	---	PASS
TTC12	54970	broad.mit.edu	37	11	113209554	113209554	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113209554A>G	uc001pnu.2	+	9	740	c.635A>G	c.(634-636)AAA>AGA	p.K212R	TTC12_uc001pnv.2_Missense_Mutation_p.K218R|TTC12_uc001pnw.2_RNA|TTC12_uc001pnx.2_Missense_Mutation_p.K62R	NM_017868	NP_060338	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12	212							binding			pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		ACCCAGGTGAAAGGTGAGCAC	0.488													45	98	---	---	---	---	PASS
HTR3A	3359	broad.mit.edu	37	11	113857739	113857739	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113857739C>T	uc010rxb.1	+	7	1456	c.1223C>T	c.(1222-1224)TCC>TTC	p.S408F	HTR3A_uc010rxa.1_Missense_Mutation_p.S376F|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_Missense_Mutation_p.S355F	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	370	Cytoplasmic (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	CCAGCCACCTCCCAAGCCACC	0.577													13	41	---	---	---	---	PASS
CADM1	23705	broad.mit.edu	37	11	115080343	115080343	+	Silent	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115080343G>T	uc001ppi.3	-	8	1158	c.1029C>A	c.(1027-1029)ACC>ACA	p.T343T	CADM1_uc001ppf.3_Intron|CADM1_uc001ppk.3_Intron|CADM1_uc001ppj.3_Intron|CADM1_uc001pph.3_Silent_p.T95T	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1	343	Extracellular (Potential).			PPTTIPPPTTTTTTTTTTTTTILTIIT -> TTATTEPAVH GLTQLPNSAEELDSEDLS (in Ref. 3; BAC11657).	adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		tggtggtggtggttgttgtgg	0.269													6	89	---	---	---	---	PASS
KIRREL3	84623	broad.mit.edu	37	11	126299112	126299112	+	Silent	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126299112G>T	uc001qea.2	-	15	2129	c.1768C>A	c.(1768-1770)CGG>AGG	p.R590R	KIRREL3_uc001qeb.2_Silent_p.R578R|ST3GAL4_uc001qdx.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1	590	Cytoplasmic (Potential).				hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TCACCCTCCCGACCAGAGGCT	0.488													20	45	---	---	---	---	PASS
ETS1	2113	broad.mit.edu	37	11	128360362	128360362	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128360362C>T	uc010sbs.1	-	2	508	c.192G>A	c.(190-192)GGG>GGA	p.G64G	ETS1_uc001qej.2_Silent_p.G108G|ETS1_uc009zch.2_Intron|ETS1_uc009zcg.2_Silent_p.G64G	NM_005238	NP_005229	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene	64	PNT.				cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		CTTTTGGGATCCCCAGTCGTT	0.443													40	158	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	994619	994619	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:994619C>G	uc001qio.3	+	19	5156	c.4649C>G	c.(4648-4650)TCT>TGT	p.S1550C	WNK1_uc001qip.3_Missense_Mutation_p.S1303C|WNK1_uc001qir.3_Missense_Mutation_p.S723C	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1550					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CCATCTTCCTCTTCCTCTCCT	0.473													356	365	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6076765	6076765	+	Missense_Mutation	SNP	C	T	T	rs142316324	byFrequency	TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6076765C>T	uc001qnn.1	-	47	8024	c.7774G>A	c.(7774-7776)GGG>AGG	p.G2592R	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	2592	VWFC 3.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	ACAGTCTTCCCGGGCTGGAAG	0.617													92	135	---	---	---	---	PASS
C1RL	51279	broad.mit.edu	37	12	7249253	7249253	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7249253C>T	uc001qsn.2	-	6	1215	c.1198G>A	c.(1198-1200)GAG>AAG	p.E400K	C1RL_uc009zft.2_3'UTR	NM_016546	NP_057630	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	400	Peptidase S1.				complement activation, classical pathway|innate immune response|proteolysis		serine-type endopeptidase activity			pancreas(1)	1						TTGCAGGCCTCCCTGGGAGCT	0.562													88	214	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7636217	7636217	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7636217C>T	uc001qsz.3	-	12	2962	c.2834G>A	c.(2833-2835)TGG>TAG	p.W945*	CD163_uc001qta.3_Nonsense_Mutation_p.W945*|CD163_uc009zfw.2_Nonsense_Mutation_p.W978*	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	945	SRCR 9.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						ACCTCCATGCCAGATCTCCAC	0.478													40	97	---	---	---	---	PASS
PIK3C2G	5288	broad.mit.edu	37	12	18691231	18691231	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18691231G>A	uc001rdt.2	+	24	3458	c.3342G>A	c.(3340-3342)TTG>TTA	p.L1114L	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Silent_p.L1155L|PIK3C2G_uc010sic.1_Silent_p.L933L	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	1114	PI3K/PI4K.				cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				AACTGCTCTTGAACCTGCTGG	0.373													44	87	---	---	---	---	PASS
FAM113B	91523	broad.mit.edu	37	12	47628923	47628923	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47628923A>G	uc001rpn.2	+	4	808	c.77A>G	c.(76-78)CAT>CGT	p.H26R	FAM113B_uc010slj.1_Intron|FAM113B_uc001rpq.2_Missense_Mutation_p.H26R	NM_138371	NP_612380	Q96HM7	F113B_HUMAN	hypothetical protein LOC91523	26							hydrolase activity			skin(3)|ovary(2)	5	Renal(347;0.138)|Lung SC(27;0.192)					GACTCTGTGCATAGGGCAGTA	0.592													37	49	---	---	---	---	PASS
SCN8A	6334	broad.mit.edu	37	12	52163735	52163735	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52163735G>T	uc001ryw.2	+	18	3634	c.3456G>T	c.(3454-3456)GAG>GAT	p.E1152D	SCN8A_uc010snl.1_Missense_Mutation_p.E1017D	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	1152					axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	AACAGCCTGAGGAATACTTGG	0.512													6	12	---	---	---	---	PASS
ESPL1	9700	broad.mit.edu	37	12	53680386	53680386	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53680386C>T	uc001sck.2	+	18	3957	c.3866C>T	c.(3865-3867)GCA>GTA	p.A1289V	ESPL1_uc001scj.2_Missense_Mutation_p.A964V|ESPL1_uc010soe.1_Intron	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	1289					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						CAACTTTTTGCAAGCTCCTGG	0.562													47	71	---	---	---	---	PASS
PDE1B	5153	broad.mit.edu	37	12	54970489	54970489	+	Intron	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54970489G>A	uc001sgd.1	+						PDE1B_uc010soz.1_Intron|PDE1B_uc010spa.1_Intron|PDE1B_uc001sgf.2_Intron|PDE1B_uc001sge.2_Intron|PDE1B_uc009znq.2_Intron	NM_000924	NP_000915	Q01064	PDE1B_HUMAN	phosphodiesterase 1B isoform 1						activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						GCAAGTGGTGGGTACCATGGC	0.557													14	15	---	---	---	---	PASS
LRIG3	121227	broad.mit.edu	37	12	59276795	59276795	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59276795G>C	uc001sqr.2	-	12	1582	c.1336C>G	c.(1336-1338)CTT>GTT	p.L446V	LRIG3_uc009zqh.2_Missense_Mutation_p.L386V|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	446	LRRCT.					integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			TCGCACAAAAGGCTTGATGTA	0.393													26	65	---	---	---	---	PASS
PPM1H	57460	broad.mit.edu	37	12	63225888	63225888	+	Intron	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63225888T>C	uc001srk.3	-							NM_020700	NP_065751	Q9ULR3	PPM1H_HUMAN	protein phosphatase 1H (PP2C domain containing)								phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		TCGAGAAGGGTCTTACCGAGT	0.532													12	45	---	---	---	---	PASS
NR1H4	9971	broad.mit.edu	37	12	100928734	100928734	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100928734A>T	uc001tht.1	+	4	723	c.695A>T	c.(694-696)CAG>CTG	p.Q232L	NR1H4_uc001thp.1_Missense_Mutation_p.Q218L|NR1H4_uc001thq.1_Missense_Mutation_p.Q222L|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_Missense_Mutation_p.Q222L|NR1H4_uc010svk.1_Missense_Mutation_p.Q171L|NR1H4_uc001ths.1_Missense_Mutation_p.Q228L	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	232					bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						CATGCAGATCAGACCGTGAAT	0.418													21	88	---	---	---	---	PASS
GPN3	51184	broad.mit.edu	37	12	110902989	110902989	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110902989A>C	uc001tqr.2	-	2	135	c.79T>G	c.(79-81)TGT>GGT	p.C27G	GPN3_uc001tqs.2_Missense_Mutation_p.C37G	NM_016301	NP_057385	Q9UHW5	GPN3_HUMAN	GPN-loop GTPase 3 isoform 1	27						protein complex	GTP binding				0						AGGGCTTCACAGTGCTGGACC	0.502													20	99	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112686205	112686205	+	Silent	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112686205T>C	uc009zwc.2	-	19	2814	c.2796A>G	c.(2794-2796)GAA>GAG	p.E932E		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						CTTCAGCATGTTCTTCTTGAT	0.373													23	35	---	---	---	---	PASS
CCDC62	84660	broad.mit.edu	37	12	123276602	123276602	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123276602C>A	uc001udc.2	+	6	851	c.706C>A	c.(706-708)CAA>AAA	p.Q236K	CCDC62_uc010tah.1_RNA|CCDC62_uc001udf.2_Missense_Mutation_p.Q236K|CCDC62_uc001ude.2_Intron	NM_201435	NP_958843	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62 isoform b	236	Potential.					cytoplasm|nucleus				ovary(2)|large_intestine(1)|pancreas(1)|skin(1)	5	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		AAATAATGAGCAACGAGAAGA	0.378													4	197	---	---	---	---	PASS
RAN	5901	broad.mit.edu	37	12	131359283	131359283	+	Intron	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131359283G>T	uc001uir.2	+						RAN_uc010tbk.1_Intron|RAN_uc010tbl.1_Intron|RAN_uc001uis.2_Intron	NM_006325	NP_006316	P62826	RAN_HUMAN	ras-related nuclear protein						androgen receptor signaling pathway|cell division|DNA metabolic process|mitosis|mitotic spindle organization|positive regulation of transcription, DNA-dependent|protein export from nucleus|RNA export from nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|melanosome|nuclear pore|nucleoplasm	androgen receptor binding|chromatin binding|GTP binding|GTPase activity|transcription coactivator activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	Lung NSC(355;7.46e-07)|all_epithelial(31;7.36e-06)		OV - Ovarian serous cystadenocarcinoma(86;9.18e-49)|Epithelial(86;1.42e-45)|all cancers(50;6.28e-40)		CTTCAGGTGTGTAAAATTAAA	0.343													39	88	---	---	---	---	PASS
POLE	5426	broad.mit.edu	37	12	133202806	133202806	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133202806T>A	uc001uks.1	-	46	6472	c.6428A>T	c.(6427-6429)CAG>CTG	p.Q2143L	POLE_uc001ukq.1_Missense_Mutation_p.Q353L|POLE_uc001ukr.1_Missense_Mutation_p.Q947L|POLE_uc010tbq.1_RNA	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	2143					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)		GTCTCGGAACTGGGCCTCCTC	0.582								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					12	28	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133363004	133363004	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133363004G>A	uc001ukz.1	-	15	3603	c.3044C>T	c.(3043-3045)GCG>GTG	p.A1015V	GOLGA3_uc001ula.1_Missense_Mutation_p.A1015V|GOLGA3_uc001ulb.2_Missense_Mutation_p.A1015V	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	1015	Potential.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CTCCTTGGCCGCGAGGGCCTC	0.652													3	32	---	---	---	---	PASS
SCEL	8796	broad.mit.edu	37	13	78192138	78192138	+	Splice_Site	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78192138G>A	uc001vki.2	+	27	1742	c.1572_splice	c.e27-1	p.S524_splice	SCEL_uc001vkj.2_Splice_Site_p.S504_splice|SCEL_uc010thx.1_Splice_Site_p.S482_splice	NM_144777	NP_659001	O95171	SCEL_HUMAN	sciellin isoform 1						embryo development|keratinocyte differentiation	cornified envelope|cytoplasm|membrane	protein binding|zinc ion binding			ovary(4)|breast(1)	5		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		CTTTTAAACAGCCAAGACTTG	0.358													71	110	---	---	---	---	PASS
ABHD13	84945	broad.mit.edu	37	13	108882501	108882501	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108882501A>G	uc001vqq.2	+	2	1200	c.935A>G	c.(934-936)GAA>GGA	p.E312G		NM_032859	NP_116248	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	312						integral to membrane	hydrolase activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					ACTGCACTTGAACAGTTCATC	0.383													45	55	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42356319	42356319	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42356319G>C	uc001wvm.2	+	3	1689	c.491G>C	c.(490-492)TGG>TCG	p.W164S	LRFN5_uc010ana.2_Missense_Mutation_p.W164S	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	164	Extracellular (Potential).|LRR 5.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		ACCATTCCTTGGGATGCTGTT	0.413										HNSCC(30;0.082)			45	46	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42356320	42356320	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42356320G>T	uc001wvm.2	+	3	1690	c.492G>T	c.(490-492)TGG>TGT	p.W164C	LRFN5_uc010ana.2_Missense_Mutation_p.W164C	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	164	Extracellular (Potential).|LRR 5.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CCATTCCTTGGGATGCTGTTG	0.413										HNSCC(30;0.082)			44	46	---	---	---	---	PASS
C14orf37	145407	broad.mit.edu	37	14	58605845	58605845	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58605845A>T	uc001xdc.2	-	2	343	c.232T>A	c.(232-234)TCA>ACA	p.S78T	C14orf37_uc010tro.1_Missense_Mutation_p.S116T|C14orf37_uc001xdd.2_Missense_Mutation_p.S78T|C14orf37_uc001xde.2_Missense_Mutation_p.S78T	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor	78	Extracellular (Potential).					integral to membrane	binding				0						GGTACTGCTGACATCATCATT	0.468													9	200	---	---	---	---	PASS
DLST	1743	broad.mit.edu	37	14	75361058	75361058	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75361058A>C	uc001xqv.2	+	10	779	c.716A>C	c.(715-717)AAG>ACG	p.K239T	DLST_uc001xqu.2_Missense_Mutation_p.K151T|DLST_uc001xqt.2_Missense_Mutation_p.K155T|DLST_uc010tuw.1_Missense_Mutation_p.K153T|DLST_uc001xqs.2_RNA|DLST_uc010tuv.1_Missense_Mutation_p.K239T	NM_001933	NP_001924	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2	239					lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	dihydrolipoyllysine-residue succinyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00698)		CAGCGTCTGAAGGAGGCCCAG	0.463													47	101	---	---	---	---	PASS
KCNK10	54207	broad.mit.edu	37	14	88652016	88652016	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88652016A>G	uc001xwo.2	-	7	1937	c.1480T>C	c.(1480-1482)TGT>CGT	p.C494R	KCNK10_uc001xwm.2_Missense_Mutation_p.C499R|KCNK10_uc001xwn.2_Missense_Mutation_p.C499R	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	494	Cytoplasmic (Potential).				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						TCTGAGTTACACATCTTTTCC	0.517													68	57	---	---	---	---	PASS
EML5	161436	broad.mit.edu	37	14	89123748	89123748	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89123748G>A	uc001xxg.2	-	28	4162	c.3976C>T	c.(3976-3978)CAA>TAA	p.Q1326*	EML5_uc001xxf.2_Nonsense_Mutation_p.Q121*|EML5_uc001xxh.1_Nonsense_Mutation_p.Q465*	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	1326						cytoplasm|microtubule				ovary(3)	3						TCTTTTTGTTGTAAATGAGGC	0.313													5	7	---	---	---	---	PASS
SERPINA13	388007	broad.mit.edu	37	14	95111287	95111287	+	Intron	SNP	T	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95111287T>G	uc001ydt.2	+							NR_015340				RecName: Full=Serpin A13; Flags: Precursor;											lung(1)|skin(1)	2						TTTCTGTCTCTCCGCAGAGAA	0.542													36	41	---	---	---	---	PASS
DICER1	23405	broad.mit.edu	37	14	95556996	95556996	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95556996C>A	uc001ydw.2	-	28	5790	c.5608G>T	c.(5608-5610)GCT>TCT	p.A1870S	DICER1_uc010avh.1_Missense_Mutation_p.A768S|DICER1_uc001ydv.2_Missense_Mutation_p.A1860S|DICER1_uc001ydx.2_Missense_Mutation_p.A1870S	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	1870	DRBM.				negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		GTTCTCTCAGCCGGGCTGTAA	0.433			Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				125	119	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	101526089	101526089	+	5'Flank	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101526089C>G	uc010awg.2	+						MIR154_hsa-mir-154|MI0000480_5'Flank|MIR496_hsa-mir-496|MI0003136_5'Flank|uc010awh.1_5'Flank|MIR377_hsa-mir-377|MI0000785_5'Flank					DM004429																		TCTGCGCTAGCGTGTGGTACT	0.498													80	86	---	---	---	---	PASS
PPP2R5C	5527	broad.mit.edu	37	14	102375969	102375969	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102375969G>C	uc001yko.2	+	11	1335	c.1195G>C	c.(1195-1197)GAG>CAG	p.E399Q	PPP2R5C_uc010txr.1_Missense_Mutation_p.E430Q|PPP2R5C_uc001ykk.2_Missense_Mutation_p.E454Q|PPP2R5C_uc001ykn.2_Missense_Mutation_p.E399Q|PPP2R5C_uc001ykp.2_Missense_Mutation_p.E399Q|PPP2R5C_uc001ykq.2_Missense_Mutation_p.G254A	NM_002719	NP_002710	Q13362	2A5G_HUMAN	gamma isoform of regulatory subunit B56, protein	399					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of cell proliferation|proteasomal ubiquitin-dependent protein catabolic process|signal transduction	chromosome, centromeric region|nucleus|protein phosphatase type 2A complex	protein binding|protein binding|protein phosphatase type 2A regulator activity|protein phosphatase type 2A regulator activity			ovary(1)|breast(1)	2						GCTCTTCATGGAGATGAACCA	0.443													74	89	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28520140	28520140	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28520140G>A	uc001zbj.2	-	6	660	c.554C>T	c.(553-555)GCG>GTG	p.A185V	HERC2_uc001zbl.1_5'UTR	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	185					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACCTTTGCCCGCAGGCCGGGA	0.577													3	47	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34021227	34021227	+	Silent	SNP	A	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34021227A>C	uc001zhi.2	+	47	7273	c.7203A>C	c.(7201-7203)ACA>ACC	p.T2401T	RYR3_uc010bar.2_Silent_p.T2401T	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2401	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CTCTAGATACAGTAAGTTGCA	0.363													18	52	---	---	---	---	PASS
PLCB2	5330	broad.mit.edu	37	15	40594337	40594337	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40594337T>G	uc001zld.2	-	6	807	c.506A>C	c.(505-507)AAC>ACC	p.N169T	PLCB2_uc010bbo.2_Missense_Mutation_p.N169T|PLCB2_uc010ucm.1_Missense_Mutation_p.N169T|PLCB2_uc001zle.3_Missense_Mutation_p.N169T	NM_004573	NP_004564	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	169					activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)|breast(3)|kidney(1)|pancreas(1)	8		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		GGGGGCTCACTTCTTCACCGG	0.592													97	248	---	---	---	---	PASS
NDUFAF1	51103	broad.mit.edu	37	15	41679764	41679764	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41679764C>G	uc001znx.2	-	5	1244	c.862G>C	c.(862-864)GAT>CAT	p.D288H	NDUFAF1_uc010bcf.2_RNA	NM_016013	NP_057097	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	288					mitochondrial electron transport, NADH to ubiquinone|protein complex assembly	mitochondrial respiratory chain complex I	unfolded protein binding			ovary(1)	1		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		TCCACTTTATCAGCCAAGGTG	0.348													39	71	---	---	---	---	PASS
PYGO1	26108	broad.mit.edu	37	15	55838348	55838348	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55838348G>T	uc010bfl.1	-	3	1189	c.1133C>A	c.(1132-1134)GCT>GAT	p.A378D	PYGO1_uc002adf.1_Missense_Mutation_p.A378D	NM_015617	NP_056432	Q9Y3Y4	PYGO1_HUMAN	pygopus homolog 1	378	PHD-type.				Wnt receptor signaling pathway	nucleus	zinc ion binding			ovary(1)|skin(1)	2				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		GAGGCCATAAGCTGTTTCAGT	0.438													59	120	---	---	---	---	PASS
LINGO1	84894	broad.mit.edu	37	15	77907010	77907010	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77907010C>T	uc002bct.1	-	2	1291	c.1239G>A	c.(1237-1239)GTG>GTA	p.V413V	LINGO1_uc002bcu.1_Silent_p.V407V	NM_032808	NP_116197	Q96FE5	LIGO1_HUMAN	leucine-rich repeat neuronal 6A	413	Extracellular (Potential).|LRRCT.|Ig-like C2-type.				negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)|lung(1)	2						TGGGCAGTAGCACATCAGGGA	0.652													3	4	---	---	---	---	PASS
VPS33B	26276	broad.mit.edu	37	15	91550786	91550786	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91550786C>T	uc002bqp.1	-	8	870	c.516G>A	c.(514-516)TGG>TGA	p.W172*	VPS33B_uc002bqq.1_Nonsense_Mutation_p.W81*|VPS33B_uc010uqu.1_Nonsense_Mutation_p.W145*	NM_018668	NP_061138	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33B (yeast homolog))	172					cellular membrane fusion|lysosome localization|melanosome localization|platelet alpha granule organization|protein transport|vesicle docking involved in exocytosis	late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm|platelet alpha granule	protein binding			ovary(2)	2	Lung NSC(78;0.0987)|all_lung(78;0.175)					CAGTGTTGATCCAACGCTGAT	0.522													32	79	---	---	---	---	PASS
PKMYT1	9088	broad.mit.edu	37	16	3026838	3026838	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3026838G>A	uc002csn.2	-	3	648	c.205C>T	c.(205-207)CCT>TCT	p.P69S	PKMYT1_uc010uwn.1_RNA|PKMYT1_uc002csm.2_Missense_Mutation_p.P69S|PKMYT1_uc002cso.2_Intron|PKMYT1_uc002csp.2_Missense_Mutation_p.P60S|PKMYT1_uc002csq.2_Missense_Mutation_p.P60S|PKMYT1_uc010bsy.1_Missense_Mutation_p.P60S	NM_004203	NP_004194	Q99640	PMYT1_HUMAN	protein kinase Myt1 isoform 1	69	Pro-rich.				G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of mitosis	endoplasmic reticulum membrane|Golgi membrane|membrane fraction|nucleoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)	1						GGGGTCCGAGGAGGGAAGAGG	0.692													6	0	---	---	---	---	PASS
CLEC16A	23274	broad.mit.edu	37	16	11217769	11217769	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11217769C>T	uc002dao.2	+	21	2669	c.2439C>T	c.(2437-2439)ATC>ATT	p.I813I	CLEC16A_uc002dan.3_Silent_p.I795I|CLEC16A_uc002dap.2_5'Flank	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A	813										ovary(1)|central_nervous_system(1)	2						AAGGCCGCATCCAGGCAAGGC	0.597													25	11	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	20975048	20975048	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20975048C>T	uc010vbe.1	-	53	10158	c.10158G>A	c.(10156-10158)AAG>AAA	p.K3386K	DNAH3_uc010vbd.1_Silent_p.K821K	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3386					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		CCGTAATTTCCTTCTTCTGTT	0.512													35	104	---	---	---	---	PASS
OTOA	146183	broad.mit.edu	37	16	21702908	21702908	+	Silent	SNP	T	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21702908T>A	uc002djh.2	+	8	640	c.639T>A	c.(637-639)TCT>TCA	p.S213S	uc002diq.3_Intron|OTOA_uc010vbj.1_Silent_p.S134S	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1	213					sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		CATTTAGATCTGCAGTGTTCA	0.468													49	61	---	---	---	---	PASS
HS3ST2	9956	broad.mit.edu	37	16	22926300	22926300	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22926300C>T	uc002dli.2	+	2	593	c.521C>T	c.(520-522)ACG>ATG	p.T174M	HS3ST2_uc002dlj.2_RNA	NM_006043	NP_006034	Q9Y278	HS3S2_HUMAN	heparan sulfate D-glucosaminyl	174	Lumenal (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(48;0.0299)		AGCCAGATCACGCTGGAGAAG	0.572													119	133	---	---	---	---	PASS
ABCC11	85320	broad.mit.edu	37	16	48264455	48264455	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48264455C>T	uc002eff.1	-	2	479	c.129G>A	c.(127-129)TGG>TGA	p.W43*	ABCC11_uc002efg.1_Nonsense_Mutation_p.W43*|ABCC11_uc002efh.1_Nonsense_Mutation_p.W43*|ABCC11_uc010vgl.1_Nonsense_Mutation_p.W43*	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	43	Cytoplasmic (Potential).					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				CTTGCTGACTCCAGGGGCCAT	0.493									Cerumen_Type				24	17	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49669764	49669764	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49669764G>C	uc002efs.2	-	5	3597	c.3299C>G	c.(3298-3300)GCC>GGC	p.A1100G	ZNF423_uc010vgn.1_Missense_Mutation_p.A983G	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1100					cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				CTGTCCGTTGGCGCTGCGGGC	0.692													4	6	---	---	---	---	PASS
SLC12A3	6559	broad.mit.edu	37	16	56928501	56928501	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56928501G>A	uc010ccm.2	+	22	2609	c.2580G>A	c.(2578-2580)AAG>AAA	p.K860K	SLC12A3_uc002ekd.3_Silent_p.K869K|SLC12A3_uc010ccn.2_Silent_p.K868K	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	860	Cytoplasmic (Potential).				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	GCAAATGCAAGATCCGTGTGT	0.572													21	21	---	---	---	---	PASS
NLRC5	84166	broad.mit.edu	37	16	57059739	57059739	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57059739T>C	uc002ekk.1	+	6	1109	c.884T>C	c.(883-885)CTG>CCG	p.L295P	NLRC5_uc010ccq.1_RNA|NLRC5_uc002ekn.2_Missense_Mutation_p.L100P|NLRC5_uc002ekl.2_Missense_Mutation_p.L100P|NLRC5_uc002ekm.2_Missense_Mutation_p.L100P|NLRC5_uc010ccr.1_RNA	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	295	NACHT.				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				TTCCAGTACCTGGAGAAGAAC	0.562													11	129	---	---	---	---	PASS
TMCO7	79613	broad.mit.edu	37	16	69074235	69074235	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69074235G>T	uc002ewi.3	+	17	3031	c.3019G>T	c.(3019-3021)GCC>TCC	p.A1007S		NM_024562	NP_078838	Q9C0B7	TMCO7_HUMAN	transmembrane and coiled-coil domains 7	1007						integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)		GATTGCTGTGGCCAAAACAGA	0.473													5	9	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	71096233	71096233	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71096233A>T	uc002ezr.2	-	17	2343	c.2215T>A	c.(2215-2217)TGT>AGT	p.C739S	HYDIN_uc010cfz.1_Missense_Mutation_p.C484S|HYDIN_uc002ezv.2_Missense_Mutation_p.C739S|HYDIN_uc010vmc.1_Missense_Mutation_p.C756S|HYDIN_uc010vmd.1_Missense_Mutation_p.C766S	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	739										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				ACCTCCTCACACACCTGGGGG	0.542													8	11	---	---	---	---	PASS
VAT1L	57687	broad.mit.edu	37	16	77850862	77850862	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77850862A>G	uc002ffg.1	+	2	375	c.278A>G	c.(277-279)GAC>GGC	p.D93G		NM_020927	NP_065978	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport protein 1 homolog (T.	93							oxidoreductase activity|zinc ion binding			central_nervous_system(1)	1						GGGAATATTGACAACCCTCCC	0.438													58	65	---	---	---	---	PASS
ZMYND15	84225	broad.mit.edu	37	17	4644148	4644148	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4644148C>T	uc002fyt.2	+	2	344	c.305C>T	c.(304-306)CCC>CTC	p.P102L	CXCL16_uc002fyr.3_5'Flank|CXCL16_uc002fys.3_5'Flank|ZMYND15_uc002fyv.2_Missense_Mutation_p.P102L|ZMYND15_uc002fyu.2_Missense_Mutation_p.P102L	NM_032265	NP_115641	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15 isoform 2	102							zinc ion binding				0						GACCTGAGCCCCTACATCAGC	0.453													12	10	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7637984	7637984	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7637984G>A	uc002giu.1	+	6	950	c.936G>A	c.(934-936)TCG>TCA	p.S312S	DNAH2_uc002git.2_Silent_p.S312S|DNAH2_uc010vuk.1_Silent_p.S312S	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	312	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TTGCCAAGTCGTCCTACTTGG	0.522													41	31	---	---	---	---	PASS
ARHGEF15	22899	broad.mit.edu	37	17	8215685	8215685	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8215685C>A	uc002glc.2	+	2	449	c.328C>A	c.(328-330)CCA>ACA	p.P110T	ARHGEF15_uc002glb.1_Missense_Mutation_p.P110T|ARHGEF15_uc002gld.2_Missense_Mutation_p.P110T|ARHGEF15_uc010vuw.1_Missense_Mutation_p.P110T	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	110	Pro-rich.				negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						CTCCGCCTCCCCAGAACCTGC	0.672													91	109	---	---	---	---	PASS
PIK3R6	146850	broad.mit.edu	37	17	8770917	8770917	+	5'UTR	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8770917C>A	uc002glq.1	-	1					PIK3R6_uc002glr.1_RNA|PIK3R6_uc002gls.1_RNA	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6						platelet activation	cytosol					0						GCGAGGTCCCCAGTCCCAGAG	0.577													23	25	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11648123	11648123	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11648123G>A	uc002gne.2	+	31	6189	c.6121G>A	c.(6121-6123)GAC>AAC	p.D2041N	DNAH9_uc010coo.2_Missense_Mutation_p.D1335N	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2041	AAA 1 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGATCACTACGACTGGGGCCT	0.552													30	49	---	---	---	---	PASS
HNF1B	6928	broad.mit.edu	37	17	36093800	36093800	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36093800C>A	uc002hok.3	-	3	780	c.559G>T	c.(559-561)GTC>TTC	p.V187F	HNF1B_uc010wdi.1_Intron|HNF1B_uc010cve.1_5'UTR	NM_000458	NP_000449	P35680	HNF1B_HUMAN	hepatocyte nuclear factor 1-beta isoform 1	187					endocrine pancreas development|genitalia development|kidney development|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric nephron tubule development|regulation of pronephros size	nucleus	DNA binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			GAACTCTGGACTGTCTGGTTG	0.428									Hereditary_Prostate_Cancer				30	62	---	---	---	---	PASS
VEZF1	7716	broad.mit.edu	37	17	56052036	56052036	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56052036G>A	uc002ivf.1	-	6	1507	c.1364C>T	c.(1363-1365)ACC>ATC	p.T455I		NM_007146	NP_009077	Q14119	VEZF1_HUMAN	zinc finger protein 161	455	4 X 7 AA repeats of P-[LV]-T-[IL]-T-[ST]- P.				cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						TAAAGGAGAGGTCATGGATAA	0.463													56	235	---	---	---	---	PASS
C17orf77	146723	broad.mit.edu	37	17	72588710	72588710	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72588710G>A	uc002jla.1	+	3	887	c.525G>A	c.(523-525)ACG>ACA	p.T175T	CD300LD_uc002jkz.2_5'Flank	NM_152460	NP_689673	Q96MU5	CQ077_HUMAN	hypothetical protein LOC146723	175						extracellular region					0						AGGAGAGGACGGACAAGGCCA	0.607													8	43	---	---	---	---	PASS
SLC26A11	284129	broad.mit.edu	37	17	78221984	78221984	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78221984G>T	uc002jyb.1	+	14	1619	c.1350G>T	c.(1348-1350)CAG>CAT	p.Q450H	SLC26A11_uc002jyc.1_Missense_Mutation_p.Q450H|SLC26A11_uc002jyd.1_Missense_Mutation_p.Q450H|SLC26A11_uc010dhv.1_Missense_Mutation_p.Q450H	NM_173626	NP_775897	Q86WA9	S2611_HUMAN	solute carrier family 26, member 11	450	Helical; (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|plasma membrane	anion:anion antiporter activity|secondary active sulfate transmembrane transporter activity				0	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GGGAGGTGCAGTACGGCATCC	0.662													29	14	---	---	---	---	PASS
METRNL	284207	broad.mit.edu	37	17	81043114	81043114	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:81043114G>A	uc002kgh.2	+	2	596	c.471G>A	c.(469-471)CCG>CCA	p.P157P	METRNL_uc002kgi.2_Silent_p.P75P	NM_001004431	NP_001004431	Q641Q3	METRL_HUMAN	meteorin, glial cell differentiation	157						extracellular region					0	Breast(20;0.000443)|all_neural(118;0.0779)		BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			AGGCCACGCCGCAGCAGGATA	0.662													4	112	---	---	---	---	PASS
YES1	7525	broad.mit.edu	37	18	743305	743305	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:743305G>A	uc002kky.2	-	7	1056	c.835C>T	c.(835-837)CTA>TTA	p.L279L	YES1_uc002kkz.2_Silent_p.L279L	NM_005433	NP_005424	P07947	YES_HUMAN	viral oncogene yes-1 homolog 1	279	Protein kinase.				blood coagulation|leukocyte migration|regulation of vascular permeability|T cell costimulation	cytosol|plasma membrane	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|ovary(1)	3					Dasatinib(DB01254)	TTAACCTCTAGTCGCAAAGAT	0.428													66	164	---	---	---	---	PASS
SMCHD1	23347	broad.mit.edu	37	18	2656269	2656269	+	Intron	SNP	A	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2656269A>C	uc002klm.3	+							NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible						chromosome organization		ATP binding				0						AGGTACGCGAAGGGGCGAGGA	0.637													5	12	---	---	---	---	PASS
FAM38B	63895	broad.mit.edu	37	18	10677834	10677834	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10677834T>C	uc002kor.3	-	11	1663	c.1523A>G	c.(1522-1524)GAT>GGT	p.D508G	FAM38B_uc002koq.2_Missense_Mutation_p.D343G	NM_022068	NP_071351	Q9H5I5	PIEZ2_HUMAN	family with sequence similarity 38, member B	2551						integral to membrane	ion channel activity			ovary(1)	1						AGAAAGCTTATCTGTTGCTAT	0.328													35	62	---	---	---	---	PASS
CCDC68	80323	broad.mit.edu	37	18	52609983	52609983	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52609983C>A	uc002lfs.2	-	3	212	c.40G>T	c.(40-42)GAT>TAT	p.D14Y	CCDC68_uc002lft.2_Missense_Mutation_p.D14Y	NM_001143829	NP_001137301	Q9H2F9	CCD68_HUMAN	coiled-coil domain containing 68	14										skin(1)	1				Colorectal(16;0.0256)|READ - Rectum adenocarcinoma(59;0.21)		TCCATCTTATCCCTTGGGGGA	0.388													60	162	---	---	---	---	PASS
CDH20	28316	broad.mit.edu	37	18	59166691	59166691	+	Silent	SNP	T	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59166691T>A	uc010dps.1	+	2	531	c.519T>A	c.(517-519)ACT>ACA	p.T173T	CDH20_uc002lif.2_Silent_p.T167T	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	173	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)				ATGTGGCCACTGTGCCAGAAA	0.418													25	49	---	---	---	---	PASS
VPS4B	9525	broad.mit.edu	37	18	61067385	61067385	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61067385G>C	uc002lix.2	-	7	946	c.686C>G	c.(685-687)TCC>TGC	p.S229C	VPS4B_uc010dpx.2_Missense_Mutation_p.S229C|VPS4B_uc010dpy.2_Missense_Mutation_p.S111C|VPS4B_uc010dpz.1_Missense_Mutation_p.S111C	NM_004869	NP_004860	O75351	VPS4B_HUMAN	vacuolar protein sorting factor 4B	229					cell cycle|cell division|cellular membrane organization|endosome to lysosome transport via multivesicular body sorting pathway|intracellular cholesterol transport|protein transport|response to lipid	cytosol|early endosome|late endosome membrane|lysosome|nucleus|vacuolar membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding			ovary(1)	1						GAAGATAATGGAGGGCTTGTT	0.328													54	126	---	---	---	---	PASS
C18orf22	79863	broad.mit.edu	37	18	77798498	77798498	+	Intron	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77798498G>T	uc002lns.2	+						C18orf22_uc010drh.2_Intron|C18orf22_uc010dri.1_Intron|C18orf22_uc002lnt.2_5'Flank	NM_024805	NP_079081	Q8N0V3	RBFA_HUMAN	hypothetical protein LOC79863 precursor						rRNA processing	mitochondrion					0		all_cancers(4;3.21e-14)|all_epithelial(4;7.11e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0545)|all_hematologic(56;0.15)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;6.46e-08)|BRCA - Breast invasive adenocarcinoma(31;0.00376)		GAGGGGCGGGGTCTCAGGTTT	0.552													21	82	---	---	---	---	PASS
INSR	3643	broad.mit.edu	37	19	7172392	7172392	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7172392C>A	uc002mgd.1	-	5	1286	c.1177G>T	c.(1177-1179)GGG>TGG	p.G393W	INSR_uc002mge.1_Missense_Mutation_p.G393W|INSR_uc002mgf.2_Missense_Mutation_p.G393W	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	393			G -> R (in LEPRCH; Verona-1).		activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTTAGATACCCTGAAATTTCT	0.463													4	182	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8174207	8174207	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8174207C>A	uc002mjf.2	-	35	4543	c.4522G>T	c.(4522-4524)GCC>TCC	p.A1508S		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1508	TB 6.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CCGATCTCGGCACTGCAGGAA	0.602													35	90	---	---	---	---	PASS
ADAMTS10	81794	broad.mit.edu	37	19	8662213	8662213	+	Intron	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8662213G>T	uc002mkj.1	-						ADAMTS10_uc002mkk.1_Intron	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						TGACCTCCAAGAAACAAGAGA	0.403													8	20	---	---	---	---	PASS
DNM2	1785	broad.mit.edu	37	19	10904484	10904484	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10904484C>T	uc002mps.1	+	8	1245	c.1081C>T	c.(1081-1083)CGA>TGA	p.R361*	DNM2_uc010dxk.2_RNA|DNM2_uc002mpt.1_Nonsense_Mutation_p.R361*|DNM2_uc002mpv.1_Nonsense_Mutation_p.R361*|DNM2_uc002mpu.1_Nonsense_Mutation_p.R361*|DNM2_uc010dxl.1_Nonsense_Mutation_p.R361*|DNM2_uc002mpw.2_Nonsense_Mutation_p.R94*	NM_001005361	NP_001005361	P50570	DYN2_HUMAN	dynamin 2 isoform 2	361					G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding			central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			CGGGGGCGCCCGAATCAATCG	0.602													70	157	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17722649	17722649	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17722649T>C	uc002nhd.2	-	41	4838	c.4838A>G	c.(4837-4839)GAC>GGC	p.D1613G		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	1525					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						ACCCACAGGGTCTTCTACACC	0.582													5	121	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30935683	30935683	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30935683C>T	uc002nsu.1	+	2	1352	c.1214C>T	c.(1213-1215)TCC>TTC	p.S405F	ZNF536_uc010edd.1_Missense_Mutation_p.S405F	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	405					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					AAGAACAAGTCCCCCAGCGAC	0.627													16	79	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39008173	39008173	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39008173G>A	uc002oit.2	+	66	9990	c.9860G>A	c.(9859-9861)CGC>CAC	p.R3287H	RYR1_uc002oiu.2_Missense_Mutation_p.R3287H|RYR1_uc002oiv.1_Missense_Mutation_p.R207H|RYR1_uc010xuf.1_Missense_Mutation_p.R207H	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	3287					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	TGGTGGGAGCGCGGGCCCGAG	0.687													16	17	---	---	---	---	PASS
DLL3	10683	broad.mit.edu	37	19	39989646	39989646	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39989646C>A	uc002olx.2	+	1	90	c.32C>A	c.(31-33)TCC>TAC	p.S11Y	DLL3_uc010egq.2_Missense_Mutation_p.S11Y|DLL3_uc002olw.2_Missense_Mutation_p.S11Y	NM_016941	NP_058637	Q9NYJ7	DLL3_HUMAN	delta-like 3 protein isoform 1 precursor	11					Notch signaling pathway|skeletal system development	integral to membrane	Notch binding			central_nervous_system(2)|breast(1)	3	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GGGCTCCTCTCCCAGACTGTG	0.622													64	118	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41074173	41074173	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41074173G>A	uc002ony.2	+	31	7027	c.6941G>A	c.(6940-6942)GGA>GAA	p.G2314E	SPTBN4_uc002onz.2_Missense_Mutation_p.G2314E|SPTBN4_uc010egx.2_Missense_Mutation_p.G1057E	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	2314					actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCCATCAGAGGAGACCTGGTC	0.642													5	6	---	---	---	---	PASS
CEACAM19	56971	broad.mit.edu	37	19	45179577	45179577	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45179577C>T	uc002ozo.3	+	3	939	c.459C>T	c.(457-459)CCC>CCT	p.P153P	CEACAM19_uc002ozp.3_Silent_p.P153P	NM_020219	NP_064604	Q7Z692	CEA19_HUMAN	carcinoembryonic antigen-related cell adhesion	153	Extracellular (Potential).					integral to membrane					0	Lung NSC(12;0.00308)|all_lung(12;0.00806)	Prostate(69;0.0376)				CACACCTGCCCACCAACGCTG	0.577													49	133	---	---	---	---	PASS
ERCC2	2068	broad.mit.edu	37	19	45864870	45864870	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45864870C>T	uc002pbj.2	-	12	1196	c.1149G>A	c.(1147-1149)CTG>CTA	p.L383L	ERCC2_uc002pbh.2_5'Flank|ERCC2_uc002pbi.2_Silent_p.L76L|ERCC2_uc010ejz.2_Silent_p.L305L|ERCC2_uc002pbk.2_Silent_p.L359L|ERCC2_uc002pbl.3_Silent_p.L359L	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent	383					cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CCAGAGTATGCAGCAGGGACC	0.622			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				26	55	---	---	---	---	PASS
TEAD2	8463	broad.mit.edu	37	19	49846506	49846506	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49846506C>G	uc002pnj.2	-	10	1150	c.1059G>C	c.(1057-1059)CAG>CAC	p.Q353H	uc002pnb.1_5'Flank|TEAD2_uc002png.2_Missense_Mutation_p.Q356H|TEAD2_uc002pnh.2_Missense_Mutation_p.Q357H|TEAD2_uc002pni.2_Missense_Mutation_p.Q356H|TEAD2_uc010yao.1_Missense_Mutation_p.Q225H|TEAD2_uc010emw.2_Missense_Mutation_p.Q356H	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2	353	Transcriptional activation (Potential).				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		TCTCCACCACCTGCTTGCCAA	0.577													28	74	---	---	---	---	PASS
LRRC4B	94030	broad.mit.edu	37	19	51021853	51021853	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51021853G>C	uc002pss.2	-	3	1254	c.1117C>G	c.(1117-1119)CTC>GTC	p.L373V		NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor	373	Extracellular (Potential).|Ig-like C2-type.					cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		GTGACGTTGAGGTCCGTGGGC	0.657													17	34	---	---	---	---	PASS
KLK5	25818	broad.mit.edu	37	19	51452339	51452339	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51452339A>T	uc002pue.2	-	5	586	c.368T>A	c.(367-369)CTG>CAG	p.L123Q	KLK5_uc002puf.2_Missense_Mutation_p.L123Q|KLK5_uc002pug.2_Missense_Mutation_p.L123Q	NM_001077491	NP_001070959	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5 preproprotein	123	Peptidase S1.				epidermis development|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		AACTGGTGACAGGGAGTAGTG	0.537													48	108	---	---	---	---	PASS
ZNF813	126017	broad.mit.edu	37	19	53994933	53994933	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53994933G>C	uc002qbu.2	+	4	1575	c.1447G>C	c.(1447-1449)GTA>CTA	p.V483L	ZNF813_uc010eqq.1_Intron	NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	483	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		TTCAGCCCTCGTAATTCATAC	0.398													41	66	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55144573	55144573	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55144573C>T	uc002qgj.2	+	8	1405	c.1065C>T	c.(1063-1065)TTC>TTT	p.F355F	LILRB1_uc010erp.1_Intron|LILRB1_uc002qgl.2_Silent_p.F355F|LILRB1_uc002qgk.2_Silent_p.F355F|LILRB1_uc002qgm.2_Silent_p.F355F|LILRB1_uc010erq.2_Silent_p.F355F|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	355	Ig-like C2-type 4.|Extracellular (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		TGCAAACTTTCCTTCTGACCA	0.557										HNSCC(37;0.09)			46	113	---	---	---	---	PASS
KIR3DL1	3811	broad.mit.edu	37	19	55331449	55331449	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55331449C>A	uc002qhk.3	+	4	700	c.637C>A	c.(637-639)CTG>ATG	p.L213M	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Missense_Mutation_p.L155M|KIR3DL1_uc010esf.2_Missense_Mutation_p.L118M|KIR3DL1_uc010yfo.1_Missense_Mutation_p.L155M|KIR3DL1_uc002qhl.3_Missense_Mutation_p.L213M	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	213	Extracellular (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		CAGTGATCCCCTGGACATCGT	0.527													75	173	---	---	---	---	PASS
TGM3	7053	broad.mit.edu	37	20	2308867	2308867	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2308867C>A	uc002wfx.3	+	9	1286	c.1189C>A	c.(1189-1191)CGC>AGC	p.R397S		NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor	397					cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)|skin(1)	9					L-Glutamine(DB00130)	TAATGCCGACCGCATCACCTG	0.562													39	90	---	---	---	---	PASS
TMC2	117532	broad.mit.edu	37	20	2591193	2591193	+	Silent	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2591193G>T	uc002wgf.1	+	12	1557	c.1542G>T	c.(1540-1542)CTG>CTT	p.L514L	TMC2_uc002wgg.1_Silent_p.L498L|TMC2_uc010zpw.1_Silent_p.L346L|TMC2_uc010zpx.1_Silent_p.L345L	NM_080751	NP_542789	Q8TDI7	TMC2_HUMAN	transmembrane cochlear-expressed protein 2	514	Helical; (Potential).					integral to membrane				ovary(3)	3						CACTCTTCCTGGGGAACCTCT	0.542													41	65	---	---	---	---	PASS
HAO1	54363	broad.mit.edu	37	20	7886836	7886836	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7886836G>T	uc002wmw.1	-	4	710	c.686C>A	c.(685-687)ACA>AAA	p.T229K	HAO1_uc010gbu.2_Missense_Mutation_p.T229K	NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1	229	FMN hydroxy acid dehydrogenase.				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3						TGGCAATGATGTCAGTCTTCT	0.398													85	201	---	---	---	---	PASS
TASP1	55617	broad.mit.edu	37	20	13463945	13463945	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13463945T>C	uc002woi.2	-	11	1031	c.914A>G	c.(913-915)GAA>GGA	p.E305G	TASP1_uc010zri.1_RNA|TASP1_uc002woh.2_Missense_Mutation_p.E282G|TASP1_uc010zrj.1_RNA	NM_017714	NP_060184	Q9H6P5	TASP1_HUMAN	taspase 1 precursor	305					asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0						ATGTGAACATTCTCTAGCCAG	0.418													64	119	---	---	---	---	PASS
TM9SF4	9777	broad.mit.edu	37	20	30737566	30737566	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30737566A>T	uc002wxj.2	+	10	1319	c.1084A>T	c.(1084-1086)ATC>TTC	p.I362F	TM9SF4_uc010zts.1_Missense_Mutation_p.I269F|TM9SF4_uc002wxk.2_Missense_Mutation_p.I345F|TM9SF4_uc010gdz.2_Missense_Mutation_p.I269F	NM_014742	NP_055557	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	362	Helical; (Potential).					integral to membrane				central_nervous_system(1)|pancreas(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CCTCATCGTCATCTGTGAGTG	0.617													30	56	---	---	---	---	PASS
KCNS1	3787	broad.mit.edu	37	20	43723628	43723628	+	Silent	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43723628G>A	uc002xnc.2	-	5	1861	c.1464C>T	c.(1462-1464)AGC>AGT	p.S488S	KCNS1_uc002xnd.2_Silent_p.S488S	NM_002251	NP_002242	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel	488	Cytoplasmic (Potential).					voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity|protein binding				0		Myeloproliferative disorder(115;0.0122)				CCCCATCAATGCTGCTCAGCA	0.577													100	199	---	---	---	---	PASS
WFDC11	259239	broad.mit.edu	37	20	44277374	44277374	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44277374G>A	uc002xpa.2	-	5	443	c.248C>T	c.(247-249)ACC>ATC	p.T83I		NM_147197	NP_671730	Q8NEX6	WFD11_HUMAN	WAP four-disulfide core domain 11 precursor	83						extracellular region					0		Myeloproliferative disorder(115;0.0122)				ATCTCCACTGGTTTCCTGTAA	0.433													25	61	---	---	---	---	PASS
ZNF217	7764	broad.mit.edu	37	20	52198011	52198011	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52198011C>G	uc002xwq.3	-	1	1626	c.1355G>C	c.(1354-1356)GGA>GCA	p.G452A	ZNF217_uc010gij.1_Missense_Mutation_p.G444A	NM_006526	NP_006517	O75362	ZN217_HUMAN	zinc finger protein 217	452					negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			CAGATGGATTCCTTCGGGAAG	0.592													38	74	---	---	---	---	PASS
PRIC285	85441	broad.mit.edu	37	20	62191884	62191884	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62191884G>A	uc002yfm.2	-	17	8340	c.7448C>T	c.(7447-7449)ACG>ATG	p.T2483M	PRIC285_uc002yfl.1_Missense_Mutation_p.T1914M	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	2483					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			CCCTTCGTCCGTGGACACCAG	0.642													4	212	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	10863036	10863036	+	IGR	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10863036C>G								None (None upstream) : TPTE (43707 downstream)																							GAGGACACGGCCATGTATTAC	0.502													80	758	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10971318	10971318	+	Silent	SNP	G	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10971318G>C	uc002yip.1	-	5	407	c.39C>G	c.(37-39)GTC>GTG	p.V13V	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Silent_p.V13V|TPTE_uc002yir.1_Silent_p.V13V|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	13					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GCTCAATGATGACTCCCGCCA	0.328													12	97	---	---	---	---	PASS
USP25	29761	broad.mit.edu	37	21	17214842	17214842	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17214842G>T	uc002yjy.1	+	18	2537	c.2320G>T	c.(2320-2322)GAA>TAA	p.E774*	USP25_uc011aby.1_Nonsense_Mutation_p.E774*|USP25_uc002yjz.1_Nonsense_Mutation_p.E774*|USP25_uc010gla.1_Intron	NM_013396	NP_037528	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	774					protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)|liver(2)	5				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TAAAAGTCCTGAAACAGTTTT	0.343													193	173	---	---	---	---	PASS
ADAMTS5	11096	broad.mit.edu	37	21	28305361	28305361	+	Silent	SNP	C	T	T	rs141311682		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28305361C>T	uc002ymg.2	-	5	2421	c.1692G>A	c.(1690-1692)ACG>ACA	p.T564T		NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1	564	Disintegrin.				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						CATGGCTTGACGTCTGAAATA	0.433													12	67	---	---	---	---	PASS
TIAM1	7074	broad.mit.edu	37	21	32638871	32638871	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32638871T>A	uc002yow.1	-	5	890	c.418A>T	c.(418-420)ACA>TCA	p.T140S	TIAM1_uc011adk.1_Missense_Mutation_p.T140S|TIAM1_uc011adl.1_Missense_Mutation_p.T140S|TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	140					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						GCCAAATATGTAGCGTCATCC	0.542													52	97	---	---	---	---	PASS
DOPEY2	9980	broad.mit.edu	37	21	37649359	37649359	+	Silent	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37649359G>T	uc002yvg.2	+	28	5752	c.5673G>T	c.(5671-5673)CCG>CCT	p.P1891P	DOPEY2_uc011aeb.1_Silent_p.P1840P	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	1891					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						CATCCGCCCCGTCGGTGTACA	0.493													47	65	---	---	---	---	PASS
RRP1B	23076	broad.mit.edu	37	21	45095037	45095037	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45095037G>T	uc002zdk.2	+	6	656	c.542G>T	c.(541-543)GGG>GTG	p.G181V		NM_015056	NP_055871	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1 homolog B	181					rRNA processing	cytosol|nucleolus|preribosome, small subunit precursor	protein binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.178)		AAAGTCGGGGGGAAGGAGGTA	0.572													36	60	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23063547	23063547	+	RNA	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23063547C>G	uc011aim.1	+	167		c.9746C>G								Parts of antibodies, mostly variable regions.												0						GGCTCCAGCTCAGGAAACACA	0.542													21	45	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41573348	41573348	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41573348C>A	uc003azl.3	+	31	6028	c.5633C>A	c.(5632-5634)ACC>AAC	p.T1878N		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	1878					apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						CCTCAGCCTACCCCTCCCAAT	0.652			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				4	190	---	---	---	---	PASS
ARSH	347527	broad.mit.edu	37	X	2947377	2947377	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2947377A>G	uc011mhj.1	+	8	1289	c.1289A>G	c.(1288-1290)TAT>TGT	p.Y430C		NM_001011719	NP_001011719	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	430						integral to membrane	arylsulfatase activity|metal ion binding			lung(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TGTGGGGTCTATCTGCACACG	0.567													65	34	---	---	---	---	PASS
GPR143	4935	broad.mit.edu	37	X	9727362	9727362	+	Intron	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9727362C>A	uc004cst.1	-							NM_000273	NP_000264	P51810	GP143_HUMAN	G protein-coupled receptor 143						calcium-mediated signaling using intracellular calcium source|eye pigment biosynthetic process|melanosome organization|melanosome transport|phosphatidylinositol-mediated signaling|regulation of calcium-mediated signaling|visual perception	apical plasma membrane|Golgi apparatus|integral to membrane|lysosomal membrane|melanosome membrane|membrane fraction	dopamine binding|L-DOPA receptor activity|protein binding|tyrosine binding			ovary(1)	1		Hepatocellular(5;0.000888)				CCCATTTCCTCGGTGAATACC	0.473													8	5	---	---	---	---	PASS
RAB9A	9367	broad.mit.edu	37	X	13727147	13727147	+	Silent	SNP	C	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13727147C>T	uc004cvm.2	+	3	464	c.282C>T	c.(280-282)AGC>AGT	p.S94S	RAB9A_uc010neh.2_Silent_p.S94S	NM_004251	NP_004242	P51151	RAB9A_HUMAN	RAB9A, member RAS oncogene family	94					protein transport|small GTPase mediated signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome|lysosome|plasma membrane	GDP binding|GTP binding|GTPase activity|protein binding			ovary(1)	1						ATTCACAAAGCTTCCAGAACT	0.438													124	69	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32398798	32398798	+	Splice_Site	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32398798C>A	uc004dda.1	-	34	4919	c.4675_splice	c.e34-1	p.V1559_splice	DMD_uc004dcw.2_Splice_Site_p.V215_splice|DMD_uc004dcx.2_Splice_Site_p.V218_splice|DMD_uc004dcz.2_Splice_Site_p.V1436_splice|DMD_uc004dcy.1_Splice_Site_p.V1555_splice|DMD_uc004ddb.1_Splice_Site_p.V1551_splice|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTTCTGTTACCTGAAAAGAAT	0.299													4	110	---	---	---	---	PASS
RGAG4	340526	broad.mit.edu	37	X	71350235	71350235	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71350235C>A	uc010nlh.1	-	1	1517	c.1156G>T	c.(1156-1158)GAA>TAA	p.E386*	NHSL2_uc011mqa.1_Intron|RGAG4_uc004eaj.1_RNA	NM_001024455	NP_001019626	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	386	Glu-rich.									ovary(2)|skin(1)	3	Renal(35;0.156)					ttcttcatttcttcctccttc	0.239													10	9	---	---	---	---	PASS
RBM41	55285	broad.mit.edu	37	X	106331793	106331793	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106331793C>G	uc004emz.2	-	5	831	c.800G>C	c.(799-801)GGG>GCG	p.G267A	RBM41_uc004emy.1_Missense_Mutation_p.G267A	NM_018301	NP_060771	Q96IZ5	RBM41_HUMAN	RNA binding motif protein 41	267							nucleotide binding|RNA binding			ovary(1)	1						CTTCTTAGGCCCAGTCCAACA	0.448													68	49	---	---	---	---	PASS
HPRT1	3251	broad.mit.edu	37	X	133632689	133632689	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133632689A>G	uc004exl.3	+	8	751	c.584A>G	c.(583-585)TAT>TGT	p.Y195C	HPRT1_uc010nrs.2_RNA	NM_000194	NP_000185	P00492	HPRT_HUMAN	hypoxanthine phosphoribosyltransferase 1	195			Y -> C (in GOUT-HPRT; Dirranbandi).		adenine salvage|central nervous system neuron development|cerebral cortex neuron differentiation|cytolysis|dendrite morphogenesis|GMP catabolic process|GMP salvage|grooming behavior|guanine salvage|hypoxanthine salvage|IMP salvage|lymphocyte proliferation|positive regulation of dopamine metabolic process|protein homotetramerization|purine ribonucleoside salvage|response to amphetamine|striatum development	cytosol	guanine phosphoribosyltransferase activity|hypoxanthine phosphoribosyltransferase activity|magnesium ion binding|nucleotide binding|protein homodimerization activity				0	Acute lymphoblastic leukemia(192;0.000127)				Mercaptopurine(DB01033)|Thioguanine(DB00352)	GCCCTTGACTATAATGAATAC	0.289													41	22	---	---	---	---	PASS
SAGE1	55511	broad.mit.edu	37	X	134987483	134987483	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134987483C>G	uc004ezh.2	+	5	553	c.386C>G	c.(385-387)TCA>TGA	p.S129*	SAGE1_uc010nry.1_Nonsense_Mutation_p.S98*|SAGE1_uc011mvv.1_Nonsense_Mutation_p.S129*	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	129										ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)					AAAGTCTTGTCAACTGCTCCA	0.463													71	29	---	---	---	---	PASS
UTS2	10911	broad.mit.edu	37	1	7960523	7960523	+	Intron	DEL	G	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7960523delG	uc001aoq.2	-							NM_006786	NP_006777	O95399	UTS2_HUMAN	urotensin 2 isoform b preproprotein						muscle contraction|regulation of blood pressure|synaptic transmission	extracellular space	hormone activity				0	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)		AATAATGTGTGGGCATGAAAC	0.100													4	2	---	---	---	---	
CDCA8	55143	broad.mit.edu	37	1	38168623	38168624	+	Intron	INS	-	A	A	rs111491879		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38168623_38168624insA	uc001cbr.2	+						CDCA8_uc001cbs.2_Intron|CDCA8_uc010oih.1_Intron	NM_018101	NP_060571	Q53HL2	BOREA_HUMAN	cell division cycle associated 8						cell division|chromosome organization|mitotic metaphase|mitotic prometaphase	chromosome passenger complex|chromosome, centromeric region|cytosol|nucleolus|spindle	protein binding			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				gactccgtctcaaaaaaaaaaa	0.005													4	2	---	---	---	---	
EFCAB7	84455	broad.mit.edu	37	1	64017263	64017263	+	Intron	DEL	A	-	-	rs141911490		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64017263delA	uc001dbf.2	+							NM_032437	NP_115813	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7								calcium ion binding				0						ctccgtcttgaaaaaaaaaaa	0.104													4	5	---	---	---	---	
BCAR3	8412	broad.mit.edu	37	1	94219100	94219107	+	Intron	DEL	ACACACAC	-	-	rs71700576		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94219100_94219107delACACACAC	uc001dqb.2	-							NM_003567	NP_003558	O75815	BCAR3_HUMAN	breast cancer antiestrogen resistance 3						response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		GCACGCGGGTacacacacacacacacac	0.404													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	203873270	203873270	+	IGR	DEL	A	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203873270delA								SNRPE (32992 upstream) : C1orf157 (128305 downstream)																							tctttttgttaaaaaaaaaaa	0.075													4	2	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	216363840	216363841	+	Intron	INS	-	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216363840_216363841insT	uc001hku.1	-						USH2A_uc001hkv.2_Intron	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TAGGAAAAGGGTTTTTTTTTTT	0.337										HNSCC(13;0.011)			4	3	---	---	---	---	
OR2T12	127064	broad.mit.edu	37	1	248458341	248458342	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248458341_248458342delGG	uc010pzj.1	-	1	539_540	c.539_540delCC	c.(538-540)CCCfs	p.P180fs		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	180	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			GCACCAACACGGGGGCCTCGCA	0.559													93	53	---	---	---	---	
OR2T11	127077	broad.mit.edu	37	1	248790367	248790367	+	Frame_Shift_Del	DEL	G	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248790367delG	uc001ier.1	-	1	63	c.63delC	c.(61-63)GCCfs	p.A21fs		NM_001001964	NP_001001964	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T,	21	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATACAATCCCGGCAGCCTCAC	0.532													83	55	---	---	---	---	
ZNF638	27332	broad.mit.edu	37	2	71632977	71632999	+	Intron	DEL	GTGCATATTAAGTGGTCTAATAG	-	-	rs67651141		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71632977_71632999delGTGCATATTAAGTGGTCTAATAG	uc002shx.2	+						ZNF638_uc010yqw.1_Intron|ZNF638_uc002shy.2_Intron|ZNF638_uc002shz.2_Intron|ZNF638_uc002sia.2_Intron|ZNF638_uc002sib.1_Intron|ZNF638_uc010fed.2_Intron|ZNF638_uc002sic.2_Intron	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638						RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						AGGTACTGGAGTGCATATTAAGTGGTCTAATAGGTCAATATCT	0.336													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92296752	92296753	+	IGR	INS	-	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92296752_92296753insC								FKSG73 (166258 upstream) : None (None downstream)																							atgtcagaaatttttcatgatg	0.000													4	2	---	---	---	---	
PRKRA	8575	broad.mit.edu	37	2	179306614	179306615	+	Intron	INS	-	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179306614_179306615insT	uc002umf.2	-						PRKRA_uc002umc.2_Intron|PRKRA_uc002umd.2_Intron|PRKRA_uc002ume.2_Intron|PRKRA_uc002umg.2_Intron	NM_003690	NP_003681	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double						immune response|negative regulation of cell proliferation|production of siRNA involved in RNA interference|response to virus	perinuclear region of cytoplasm	double-stranded RNA binding|enzyme activator activity|protein homodimerization activity			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			GCTATTAAttcttttttttttt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	90167658	90167659	+	IGR	DEL	AA	-	-	rs139949740		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90167658_90167659delAA								EPHA3 (636376 upstream) : None (None downstream)																							actctatctcaaaaaaaaaaaa	0.000													9	6	---	---	---	---	
NPHP3	27031	broad.mit.edu	37	3	132404892	132404893	+	Intron	INS	-	A	A	rs78161722		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132404892_132404893insA	uc003epe.1	-						NPHP3_uc003eoz.1_5'Flank|NPHP3_uc003epd.1_Intron	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3						maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						gactccgtctcaaaaaaaaaaa	0.144													6	3	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195490839	195490845	+	Intron	DEL	TCCAGAT	-	-	rs63306962		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195490839_195490845delTCCAGAT	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTACTCCTTATCCAGATGCCACCTCCC	0.628													6	5	---	---	---	---	
ATP10D	57205	broad.mit.edu	37	4	47574662	47574667	+	Intron	DEL	GTGTGT	-	-	rs143303182		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47574662_47574667delGTGTGT	uc003gxk.1	+						ATP10D_uc003gxl.1_Intron	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D						ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						TTGTGCGCACgtgtgtgtgtgtgtgt	0.189													4	2	---	---	---	---	
ADH5	128	broad.mit.edu	37	4	100009952	100009953	+	5'Flank	INS	-	GG	GG	rs145470085	by1000genomes	TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100009952_100009953insGG	uc003hui.2	-						ADH5_uc003huk.1_5'Flank|uc003hum.1_5'Flank|uc003hul.1_5'Flank	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	GGGCGGGGCGTGGGGGGGGCTT	0.723													10	5	---	---	---	---	
LEF1	51176	broad.mit.edu	37	4	108991632	108991632	+	Intron	DEL	A	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108991632delA	uc003hyt.1	-						LEF1_uc011cfj.1_Intron|LEF1_uc011cfk.1_Intron|LEF1_uc003hyu.1_Intron|LEF1_uc003hyv.1_Intron|LEF1_uc010imb.1_Intron|LEF1_uc003hys.1_Intron|LEF1_uc010ima.1_Intron	NM_016269	NP_057353	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1 isoform 1						canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding			large_intestine(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		cacccatagcaaaaaaaaaaa	0.134													4	2	---	---	---	---	
CBR4	84869	broad.mit.edu	37	4	169911113	169911113	+	3'UTR	DEL	A	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169911113delA	uc003iry.2	-	5					CBR4_uc011cjy.1_Intron	NM_032783	NP_116172	Q8N4T8	CBR4_HUMAN	carbonic reductase 4						fatty acid biosynthetic process|protein homotetramerization	mitochondrial matrix	NADPH binding|NADPH dehydrogenase (quinone) activity|protein binding|quinone binding				0		Prostate(90;0.00263)|Renal(120;0.0183)|Melanoma(52;0.123)		GBM - Glioblastoma multiforme(119;0.0321)		AACTTAGACCAAAAAAAAAAA	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	187396516	187396517	+	Intron	INS	-	AA	AA	rs75413796	by1000genomes	TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187396516_187396517insAA	uc003izb.1	-						uc003izc.2_Intron					Homo sapiens coagulation factor XI (plasma thromboplastin antecedent), mRNA (cDNA clone IMAGE:4831055).																		aagaaagaaagaaagaaagaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	834404	834411	+	IGR	DEL	CCTTCCTA	-	-	rs74201014		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:834404_834411delCCTTCCTA								EXOC2 (141295 upstream) : LOC285768 (126831 downstream)																							ttccttccttccttcctaccttccttcc	0.120													6	4	---	---	---	---	
MDN1	23195	broad.mit.edu	37	6	90422673	90422674	+	Intron	DEL	AA	-	-	rs5878107		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90422673_90422674delAA	uc003pnn.1	-							NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog						protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ATGTAAGTTTAAAAAAAAAAAA	0.327													2	4	---	---	---	---	
ZUFSP	221302	broad.mit.edu	37	6	116982067	116982068	+	Intron	INS	-	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116982067_116982068insT	uc003pxf.1	-						ZUFSP_uc010kef.1_Intron	NM_145062	NP_659499	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain							intracellular	zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		tttttctttgcttttttttttt	0.129													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	126964680	126964681	+	Intron	INS	-	C	C			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126964680_126964681insC	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																		GCTACGAGCCTGGCGGAGGGTG	0.708													4	2	---	---	---	---	
MTHFD1L	25902	broad.mit.edu	37	6	151421170	151421170	+	Intron	DEL	C	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151421170delC	uc003qob.2	+						MTHFD1L_uc003qoc.2_Intron	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		tctttcttttctttttttttt	0.129													5	3	---	---	---	---	
PMS2CL	441194	broad.mit.edu	37	7	6774809	6774809	+	Intron	DEL	A	-	-	rs79351634		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6774809delA	uc011jxb.1	+						PMS2CL_uc003squ.2_Intron|PMS2CL_uc003sqv.1_5'Flank					SubName: Full=cDNA FLJ60281, highly similar to PMS1 protein homolog 2;												0						accttgtctcaaaaaaaaaac	0.164													4	2	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	71114598	71114599	+	Intron	DEL	AC	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71114598_71114599delAC	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				tcaggattaaacacacacacac	0.000													4	2	---	---	---	---	
ZNF394	84124	broad.mit.edu	37	7	99097021	99097022	+	Intron	INS	-	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99097021_99097022insA	uc003uqs.2	-						ZNF394_uc003uqt.2_Intron|ZNF394_uc003uqu.1_Intron	NM_032164	NP_115540	Q53GI3	ZN394_HUMAN	zinc finger protein 394						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					agaacaacaagaaaaaaaaaaa	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131438392	131438392	+	IGR	DEL	T	-	-	rs144638874		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131438392delT								PODXL (197016 upstream) : PLXNA4 (369700 downstream)																							GCAAGCTTTCTTTTTTTTTTT	0.174													5	4	---	---	---	---	
MSR1	4481	broad.mit.edu	37	8	16035612	16035613	+	Intron	INS	-	TTT	TTT			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16035612_16035613insTTT	uc003wwz.2	-						MSR1_uc010lsu.2_Intron|MSR1_uc003wxa.2_Intron|MSR1_uc003wxb.2_Intron|MSR1_uc011kxz.1_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1						cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		TTCAGTTTTTCttttttttttt	0.139													4	4	---	---	---	---	
CA1	759	broad.mit.edu	37	8	86250862	86250889	+	Intron	DEL	TTTCTTTCTTTCTTTCTTTCTTTCTTTC	-	-	rs56255763	by1000genomes	TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86250862_86250889delTTTCTTTCTTTCTTTCTTTCTTTCTTTC	uc003ydh.2	-						CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Intron|CA1_uc003ydi.2_Intron	NM_001738	NP_001729	P00915	CAH1_HUMAN	carbonic anhydrase I						one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)	tttccttctttttctttctttctttctttctttctttctttctttctt	0.092													6	3	---	---	---	---	
LRRC6	23639	broad.mit.edu	37	8	133673952	133673953	+	Intron	INS	-	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133673952_133673953insT	uc003ytk.2	-						LRRC6_uc003ytl.2_Intron	NM_012472	NP_036604	Q86X45	LRRC6_HUMAN	leucine rich repeat containing 6							cytoplasm				ovary(1)|kidney(1)	2	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			ACGCATTTGTGTTTTTTTTGTT	0.351													28	14	---	---	---	---	
C9orf114	51490	broad.mit.edu	37	9	131586559	131586560	+	Intron	DEL	GT	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131586559_131586560delGT	uc004bwd.2	-						C9orf114_uc004bwe.2_Intron|C9orf114_uc010mym.2_Intron	NM_016390	NP_057474	Q5T280	CI114_HUMAN	hypothetical protein LOC51490												0						GAGCtgtgtggtgtgtgtgtgt	0.500													4	2	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140268130	140268132	+	Intron	DEL	TTT	-	-	rs66959515		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140268130_140268132delTTT	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncg.1_Intron|EXD3_uc004cmr.2_Intron|EXD3_uc004cms.2_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						CGCAGAGAGGTTTTTTAAAATTT	0.571													5	4	---	---	---	---	
TET1	80312	broad.mit.edu	37	10	70392609	70392610	+	Intron	DEL	AG	-	-	rs71019043	by1000genomes	TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70392609_70392610delAG	uc001jok.3	+							NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6						DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						aaaaaaaaaaagaaagaaaaca	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	81632875	81632877	+	IGR	DEL	TCC	-	-	rs4039338		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81632875_81632877delTCC								LOC650623 (184227 upstream) : MBL1P (31777 downstream)																							CATCTTCACGTCCTTCTCTCACA	0.389													4	2	---	---	---	---	
MUC5B	727897	broad.mit.edu	37	11	1260556	1260556	+	Intron	DEL	C	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1260556delC	uc009ycr.1	+						MUC5B_uc009yct.1_3'UTR|MUC5B_uc001ltb.2_Intron|MUC5B_uc001lta.2_Intron	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTGGGACAAGCCCGGGTCTGG	0.697													3	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	33451583	33451584	+	IGR	INS	-	CCTC	CCTC	rs111256373		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33451583_33451584insCCTC								HIPK3 (75644 upstream) : C11orf41 (112293 downstream)																							cttccttccttccttccttcct	0.030													4	2	---	---	---	---	
CTNND1	1500	broad.mit.edu	37	11	57571186	57571187	+	Frame_Shift_Del	DEL	AT	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57571186_57571187delAT	uc001nmc.3	+	8	2085_2086	c.1514_1515delAT	c.(1513-1515)CATfs	p.H505fs	CTNND1_uc001nlh.1_Frame_Shift_Del_p.H505fs|CTNND1_uc001nlu.3_Frame_Shift_Del_p.H404fs|CTNND1_uc001nlt.3_Frame_Shift_Del_p.H404fs|CTNND1_uc001nls.3_Frame_Shift_Del_p.H404fs|CTNND1_uc001nlw.3_Frame_Shift_Del_p.H404fs|CTNND1_uc001nmf.3_Frame_Shift_Del_p.H505fs|CTNND1_uc001nmd.3_Frame_Shift_Del_p.H451fs|CTNND1_uc001nlk.3_Frame_Shift_Del_p.H451fs|CTNND1_uc001nme.3_Frame_Shift_Del_p.H505fs|CTNND1_uc001nll.3_Frame_Shift_Del_p.H451fs|CTNND1_uc001nmg.3_Frame_Shift_Del_p.H451fs|CTNND1_uc001nlj.3_Frame_Shift_Del_p.H451fs|CTNND1_uc001nlr.3_Frame_Shift_Del_p.H451fs|CTNND1_uc001nlp.3_Frame_Shift_Del_p.H451fs|CTNND1_uc001nlx.3_Frame_Shift_Del_p.H182fs|CTNND1_uc001nlz.3_Frame_Shift_Del_p.H182fs|CTNND1_uc009ymn.2_Frame_Shift_Del_p.H182fs|CTNND1_uc001nlm.3_Frame_Shift_Del_p.H505fs|CTNND1_uc001nly.3_Frame_Shift_Del_p.H182fs|CTNND1_uc001nmb.3_Frame_Shift_Del_p.H182fs|CTNND1_uc001nma.3_Frame_Shift_Del_p.H182fs|CTNND1_uc001nmi.3_Frame_Shift_Del_p.H404fs|CTNND1_uc001nmh.3_Frame_Shift_Del_p.H505fs|CTNND1_uc001nlq.3_Frame_Shift_Del_p.H404fs|CTNND1_uc001nln.3_Frame_Shift_Del_p.H505fs|CTNND1_uc001nli.3_Frame_Shift_Del_p.H505fs|CTNND1_uc001nlo.3_Frame_Shift_Del_p.H404fs|CTNND1_uc001nlv.3_Frame_Shift_Del_p.H404fs	NM_001085458	NP_001078927	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1ABC	505	ARM 4.				adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				ATCATTCCTCATTCTGGTTGGG	0.495													41	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	62814709	62814709	+	IGR	DEL	C	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62814709delC								SLC22A8 (31398 upstream) : SLC22A24 (32705 downstream)																							TCACCTCACTCCGCATGGAGT	0.502													6	3	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69971958	69971959	+	Intron	DEL	AC	-	-	rs10792912		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69971958_69971959delAC	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						tcaaaaaaaaacaaaaaaagag	0.262													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	90017337	90017337	+	IGR	DEL	A	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90017337delA								CHORDC1 (60805 upstream) : MIR1261 (584952 downstream)																							TCATTAACATAAAAAAAAaag	0.164													5	3	---	---	---	---	
DLAT	1737	broad.mit.edu	37	11	111916411	111916412	+	Intron	INS	-	A	A			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111916411_111916412insA	uc001pmo.2	+						DLAT_uc009yyk.1_Intron|DLAT_uc010rwr.1_Intron	NM_001931	NP_001922	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase precursor						glycolysis|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial pyruvate dehydrogenase complex	dihydrolipoyllysine-residue acetyltransferase activity|protein binding				0		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)	NADH(DB00157)	gactccatctcaaaaaaaaaaa	0.158													3	3	---	---	---	---	
HNF1A	6927	broad.mit.edu	37	12	121435155	121435155	+	Intron	DEL	C	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121435155delC	uc001tzg.2	+						HNF1A_uc001tzf.2_Intron|HNF1A_uc010szn.1_Intron	NM_000545	NP_000536	P20823	HNF1A_HUMAN	hepatic nuclear factor-1-alpha						glucose homeostasis|glucose import|insulin secretion|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|protein complex	DNA binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			liver(92)|large_intestine(15)|endometrium(6)|breast(2)|lung(1)	116	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					tgtttcctgaccaccctgccc	0.279									Hepatic_Adenoma_Familial_Clustering_of				2	5	---	---	---	---	
IRS2	8660	broad.mit.edu	37	13	110435612	110435613	+	Frame_Shift_Ins	INS	-	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110435612_110435613insG	uc001vqv.2	-	1	3302_3303	c.2788_2789insC	c.(2788-2790)CGCfs	p.R930fs		NM_003749	NP_003740	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	930					fibroblast growth factor receptor signaling pathway|glucose metabolic process|insulin receptor signaling pathway|lipid homeostasis|negative regulation of B cell apoptosis|negative regulation of kinase activity|negative regulation of plasma membrane long-chain fatty acid transport|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of B cell proliferation|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|response to glucose stimulus	cytosol|plasma membrane	insulin receptor binding|signal transducer activity			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|skin(1)|ovary(1)|kidney(1)	8	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			CGGCGACAGGCGGGCCCCGGGC	0.738													4	2	---	---	---	---	
ERO1L	30001	broad.mit.edu	37	14	53150869	53150870	+	Intron	DEL	AG	-	-	rs144715857		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53150869_53150870delAG	uc001wzv.2	-						ERO1L_uc001wzw.2_Intron|ERO1L_uc010aof.2_Intron	NM_014584	NP_055399	Q96HE7	ERO1A_HUMAN	ERO1-like precursor						chaperone mediated protein folding requiring cofactor|electron transport chain|protein thiol-disulfide exchange|response to temperature stimulus|transport	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome	disulfide oxidoreductase activity|flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor				0	Breast(41;0.226)					acacacacacaGAGAGAGTTGG	0.223													6	3	---	---	---	---	
DYNC1H1	1778	broad.mit.edu	37	14	102504685	102504686	+	Intron	INS	-	G	G	rs140348429	by1000genomes	TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102504685_102504686insG	uc001yks.2	+							NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						ACGCAAGTGGCGGGTGGCTTTT	0.277													5	4	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48054097	48054099	+	Intron	DEL	AAG	-	-	rs149404019		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48054097_48054099delAAG	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvx.1_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TTTCCAAAAAAAGAAGAAATTAA	0.291													5	3	---	---	---	---	
CNTNAP4	85445	broad.mit.edu	37	16	76482606	76482606	+	Intron	DEL	T	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76482606delT	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						GAAGGGAACCTTTTTTTTTTT	0.393													5	3	---	---	---	---	
TP53	7157	broad.mit.edu	37	17	7579470	7579470	+	Frame_Shift_Del	DEL	C	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7579470delC	uc002gim.2	-	4	411	c.217delG	c.(217-219)GTGfs	p.V73fs	TP53_uc002gig.1_Frame_Shift_Del_p.V73fs|TP53_uc002gih.2_Frame_Shift_Del_p.V73fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Frame_Shift_Del_p.V73fs|TP53_uc010cni.1_Frame_Shift_Del_p.V73fs|TP53_uc002gij.2_Frame_Shift_Del_p.V73fs|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Frame_Shift_Del_p.V34fs|TP53_uc010cnk.1_Frame_Shift_Del_p.V88fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	73	Interaction with WWOX.|Interaction with HRMT1L2.		V -> M (in sporadic cancers; somatic mutation).|V -> E (in a sporadic cancer; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.V73L(3)|p.G59fs*23(3)|p.V73fs*50(2)|p.V73fs*76(2)|p.V73M(2)|p.V73fs*9(1)|p.R65fs*38(1)|p.E68fs*76(1)|p.D48fs*55(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.D57_A76del20(1)|p.V73E(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCAGGGGCCACGGGGGGAGCA	0.602		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			68	55	---	---	---	---	
CA10	56934	broad.mit.edu	37	17	49711149	49711150	+	Intron	INS	-	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49711149_49711150insT	uc002itw.3	-						CA10_uc002itu.3_Intron|CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			CACAGAGTCCCTTTTTTCCATG	0.391													4	9	---	---	---	---	
ABCA5	23461	broad.mit.edu	37	17	67248157	67248158	+	Intron	INS	-	T	T	rs71144665		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67248157_67248158insT	uc002jif.2	-						ABCA5_uc002jib.2_Intron|ABCA5_uc002jic.2_Intron|ABCA5_uc002jid.2_Intron|ABCA5_uc002jie.2_Intron|ABCA5_uc002jig.2_Intron	NM_018672	NP_061142	Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A , member 5						cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)					CCCAACTATGAttttttttttt	0.149													3	3	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544277	80544278	+	Intron	INS	-	A	A	rs149999499	by1000genomes	TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544277_80544278insA	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			gaaaggtgggcgggggggaaag	0.000													4	3	---	---	---	---	
VAV1	7409	broad.mit.edu	37	19	6856887	6856888	+	Intron	DEL	GT	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6856887_6856888delGT	uc002mfu.1	+						VAV1_uc010xjh.1_Intron|VAV1_uc010dva.1_Intron|VAV1_uc002mfv.1_Intron	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						gaggtaatgggtgtgtgtgtgt	0.000													4	3	---	---	---	---	
FBN3	84467	broad.mit.edu	37	19	8150965	8150966	+	Intron	INS	-	G	G			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8150965_8150966insG	uc002mjf.2	-						FBN3_uc002mje.2_Intron	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						gaacaggcagtgggagggacag	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8890373	8890374	+	IGR	DEL	GT	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8890373_8890374delGT								OR2Z1 (48039 upstream) : ZNF558 (30008 downstream)																							CTGTGAAAGCgtgtgtgtgtgt	0.371													4	2	---	---	---	---	
ZNF561	93134	broad.mit.edu	37	19	9727575	9727575	+	Intron	DEL	T	-	-			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9727575delT	uc002mlu.2	-						ZNF561_uc010dwu.2_Intron|ZNF561_uc010xkr.1_Intron	NM_152289	NP_689502	Q8N587	ZN561_HUMAN	zinc finger protein 561						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						cggccTAGAAtttttttttta	0.005													3	3	---	---	---	---	
LCA5L	150082	broad.mit.edu	37	21	40792448	40792449	+	Intron	INS	-	AAAAAAA	AAAAAAA	rs67801996		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40792448_40792449insAAAAAAA	uc002yxu.2	-						LCA5L_uc002yxv.2_Intron	NM_152505	NP_689718	O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like												0		Prostate(19;1.2e-06)				gattctatctcaaaaaaaaaaa	0.168													4	2	---	---	---	---	
EIF2S3	1968	broad.mit.edu	37	X	24095041	24095043	+	3'UTR	DEL	CTC	-	-	rs5949273	by1000genomes	TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24095041_24095043delCTC	uc004dbc.2	+	12						NM_001415	NP_001406	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2,							cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			lung(1)	1						TAAGGTTAttctctttttttttt	0.286													5	3	---	---	---	---	
PAGE1	8712	broad.mit.edu	37	X	49458624	49458625	+	Intron	INS	-	AC	AC	rs34808373		TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49458624_49458625insAC	uc004dom.2	-							NM_003785	NP_003776	O75459	GAGB1_HUMAN	P antigen family, member 1						cellular defense response					skin(1)	1	Ovarian(276;0.236)					CAATGCATGAGacacacacaca	0.366													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	92643878	92643879	+	IGR	INS	-	T	T			TCGA-60-2713-01	TCGA-60-2713-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92643878_92643879insT								PCDH11X (765652 upstream) : NAP1L3 (282050 downstream)																							CCAtttttttcttttttttttt	0.312													15	8	---	---	---	---	
