Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CHD5	26038	broad.mit.edu	37	1	6196612	6196612	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6196612G>A	uc001amb.1	-	17	2761	c.2661C>T	c.(2659-2661)TTC>TTT	p.F887F	CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA|CHD5_uc009vlx.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	887	Helicase ATP-binding.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TGAGGAGATGGAACAGCTCCT	0.542													11	216	---	---	---	---	PASS
CA6	765	broad.mit.edu	37	1	9017275	9017275	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9017275C>A	uc001apm.2	+	3	363	c.339C>A	c.(337-339)CAC>CAA	p.H113Q	CA6_uc009vmn.2_Missense_Mutation_p.H53Q	NM_001215	NP_001206	P23280	CAH6_HUMAN	carbonic anhydrase VI precursor	113		Zinc; catalytic.			one-carbon metabolic process	extracellular region	carbonate dehydratase activity|zinc ion binding			ovary(2)	2	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)		TGCACTTTCACTGGGGAGGTG	0.592													16	72	---	---	---	---	PASS
EXOSC10	5394	broad.mit.edu	37	1	11151198	11151198	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11151198G>C	uc001asa.2	-	5	566	c.516C>G	c.(514-516)TTC>TTG	p.F172L	EXOSC10_uc001asb.2_Missense_Mutation_p.F172L|EXOSC10_uc009vmy.1_Missense_Mutation_p.F172L	NM_001001998	NP_001001998	Q01780	EXOSX_HUMAN	exosome component 10 isoform 1	172					CUT catabolic process|histone mRNA catabolic process|maturation of 5.8S rRNA|nuclear polyadenylation-dependent rRNA catabolic process|nuclear retention of unspliced pre-mRNA at the site of transcription|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasm|nuclear exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5' exonuclease activity|exoribonuclease activity|identical protein binding|nucleotide binding|protein serine/threonine kinase activity|RNA binding			upper_aerodigestive_tract(1)	1	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		GAAGCAGCCGGAAAGTTTCAG	0.343													32	225	---	---	---	---	PASS
C1QC	714	broad.mit.edu	37	1	22974057	22974057	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22974057G>A	uc001bgc.3	+	3	622	c.519G>A	c.(517-519)TCG>TCA	p.S173S	C1QC_uc001bga.3_Silent_p.S173S|C1QC_uc001bgb.2_Silent_p.S173S	NM_172369	NP_758957	P02747	C1QC_HUMAN	complement component 1, q subcomponent, C chain	173	C1q.				complement activation, classical pathway|innate immune response|negative regulation of granulocyte differentiation|negative regulation of macrophage differentiation	collagen					0		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.21e-27)|Colorectal(126;1.5e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.61e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000538)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.196)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	ACCACGCGTCGCATACAGCCA	0.582													4	112	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24400709	24400709	+	Nonsense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24400709G>C	uc001bin.3	-	23	3072	c.2909C>G	c.(2908-2910)TCA>TGA	p.S970*	MYOM3_uc001bim.3_Nonsense_Mutation_p.S627*|MYOM3_uc001bio.2_Nonsense_Mutation_p.S970*	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	970										skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GACTATGACTGAGTAGGTGCC	0.582													22	90	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24400768	24400768	+	Intron	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24400768G>A	uc001bin.3	-						MYOM3_uc001bim.3_Intron|MYOM3_uc001bio.2_Intron	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3											skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		ACCTGGCAGAGAGAGGAGAGC	0.587													19	70	---	---	---	---	PASS
RHCE	6006	broad.mit.edu	37	1	25715488	25715488	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25715488G>A	uc001bkf.2	-	6	1004	c.918C>T	c.(916-918)ATC>ATT	p.I306I	RHCE_uc001bkg.2_Silent_p.I306I|RHCE_uc001bkh.2_Silent_p.I201I|RHCE_uc001bki.2_Intron|RHCE_uc001bkj.2_Silent_p.I290I	NM_020485	NP_065231	P18577	RHCE_HUMAN	Rhesus blood group, CcEe antigens isoform 1	306	Helical; (Potential).					integral to plasma membrane					0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)		TGGCTCCCCCGATGGAGATCA	0.607													7	43	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27099425	27099425	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27099425T>C	uc001bmv.1	+	14	4035	c.3662T>C	c.(3661-3663)ATG>ACG	p.M1221T	ARID1A_uc001bmt.1_Missense_Mutation_p.M1220T|ARID1A_uc001bmu.1_Missense_Mutation_p.M1221T|ARID1A_uc001bmw.1_Missense_Mutation_p.M838T|ARID1A_uc001bmx.1_Missense_Mutation_p.M67T|ARID1A_uc009vsm.1_5'UTR|ARID1A_uc009vsn.1_5'Flank	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1221					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	p.M1220fs*9(1)|p.M1220fs*2(1)		ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TCTGACATGATGGGGCGCATG	0.473			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								10	79	---	---	---	---	PASS
HIVEP3	59269	broad.mit.edu	37	1	41976541	41976541	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41976541C>G	uc001cgz.3	-	9	8015	c.6802G>C	c.(6802-6804)GAG>CAG	p.E2268Q	HIVEP3_uc001cha.3_Missense_Mutation_p.E2267Q|HIVEP3_uc001cgy.2_RNA	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer	2268					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CCCTCCAGCTCTGAGGAGAGT	0.687													10	53	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43895778	43895778	+	Intron	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43895778A>G	uc001cjk.1	+							NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334							peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GCGAGAAGTGAGTGGCTCTCT	0.557													36	150	---	---	---	---	PASS
PTCH2	8643	broad.mit.edu	37	1	45307547	45307547	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45307547C>G	uc010olf.1	-	2	249	c.237G>C	c.(235-237)GAG>GAC	p.E79D	PTCH2_uc010olg.1_5'UTR	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	79	Extracellular (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)					CCAAGTTTGTCTCAATAATGG	0.547									Basal_Cell_Nevus_syndrome				22	132	---	---	---	---	PASS
UQCRH	7388	broad.mit.edu	37	1	46775820	46775820	+	Intron	SNP	A	G	G	rs144503839	by1000genomes	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46775820A>G	uc001cpp.2	+						UQCRH_uc001cpq.2_Intron	NM_006004	NP_005995	P07919	QCR6_HUMAN	ubiquinol-cytochrome c reductase hinge protein						aerobic respiration|mitochondrial electron transport, ubiquinol to cytochrome c		ubiquinol-cytochrome-c reductase activity				0	Acute lymphoblastic leukemia(166;0.155)					TTCTGTTTCTACATCAGGATC	0.458													12	79	---	---	---	---	PASS
TTC4	7268	broad.mit.edu	37	1	55207145	55207145	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55207145A>C	uc001cxx.3	+	10	1176	c.1123A>C	c.(1123-1125)AAG>CAG	p.K375Q	C1orf175_uc001cxq.2_RNA|TTC4_uc001cxw.3_Missense_Mutation_p.K276Q|TTC4_uc001cxv.2_Missense_Mutation_p.K386Q	NM_004623	NP_004614	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	375							binding				0						TCCTTTTTGCAAGAATTTTCT	0.488													41	208	---	---	---	---	PASS
BSND	7809	broad.mit.edu	37	1	55464892	55464892	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55464892C>T	uc001cye.2	+	1	276	c.33C>T	c.(31-33)TTC>TTT	p.F11F		NM_057176	NP_476517	Q8WZ55	BSND_HUMAN	barttin	11	Helical; (Potential).					basolateral plasma membrane|cytoplasm|integral to plasma membrane|protein complex				ovary(1)|skin(1)	2						GGATCGGCTTCATTGTGCTGG	0.622													9	121	---	---	---	---	PASS
DOCK7	85440	broad.mit.edu	37	1	63090929	63090929	+	Splice_Site	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63090929C>A	uc001daq.2	-	12	1459	c.1425_splice	c.e12+1	p.Q475_splice	DOCK7_uc001dan.2_Splice_Site_p.Q367_splice|DOCK7_uc001dao.2_Splice_Site_p.Q367_splice|DOCK7_uc001dap.2_Splice_Site_p.Q475_splice|DOCK7_uc009wah.1_Splice_Site_p.Q475_splice	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7						activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						CAGAACAATACCTGCTTAAAA	0.383													31	203	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70257790	70257790	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70257790C>A	uc001dep.2	+	2	284	c.254C>A	c.(253-255)CCA>CAA	p.P85Q	LRRC7_uc001deo.1_Missense_Mutation_p.P123Q|LRRC7_uc009wbg.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	85	LRR 3.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						TCAAATCTGCCAACCACTATT	0.294													20	166	---	---	---	---	PASS
PTGER3	5733	broad.mit.edu	37	1	71513140	71513140	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71513140G>C	uc001dfg.1	-	1	352	c.121C>G	c.(121-123)CCA>GCA	p.P41A	PTGER3_uc001dfh.1_RNA|PTGER3_uc001dfi.1_RNA|PTGER3_uc001dfj.1_RNA|PTGER3_uc001dfk.1_Missense_Mutation_p.P41A|PTGER3_uc001dfl.1_Missense_Mutation_p.P41A|PTGER3_uc009wbm.1_Missense_Mutation_p.P41A|PTGER3_uc001dfm.1_RNA|PTGER3_uc001dfn.2_Missense_Mutation_p.P41A|PTGER3_uc009wbn.1_Missense_Mutation_p.P41A|PTGER3_uc009wbo.2_Missense_Mutation_p.P41A|PTGER3_uc001dfo.2_Missense_Mutation_p.P41A|PTGER3_uc001dfp.1_Missense_Mutation_p.P41A|PTGER3_uc001dfq.2_Missense_Mutation_p.P41A|uc001dfr.2_RNA	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform	41	Extracellular (Potential).				cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)	CCAGACCCTGGAGGGCGCGTG	0.677													3	16	---	---	---	---	PASS
SLC44A5	204962	broad.mit.edu	37	1	75693535	75693535	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75693535C>T	uc001dgu.2	-	13	1005	c.861G>A	c.(859-861)TGG>TGA	p.W287*	SLC44A5_uc001dgt.2_Nonsense_Mutation_p.W287*|SLC44A5_uc001dgs.2_Nonsense_Mutation_p.W245*|SLC44A5_uc001dgr.2_Nonsense_Mutation_p.W245*|SLC44A5_uc010oqz.1_Nonsense_Mutation_p.W326*|SLC44A5_uc010ora.1_Nonsense_Mutation_p.W281*|SLC44A5_uc010orb.1_Nonsense_Mutation_p.W157*	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	287	Extracellular (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						GGTAACAGTGCCATATTCCTT	0.333													9	55	---	---	---	---	PASS
FUBP1	8880	broad.mit.edu	37	1	78432443	78432443	+	Intron	SNP	T	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78432443T>G	uc001dii.2	-						FUBP1_uc001dih.3_Intron|FUBP1_uc010orm.1_Intron	NM_003902	NP_003893	Q96AE4	FUBP1_HUMAN	far upstream element-binding protein						transcription from RNA polymerase II promoter	nucleus	protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			central_nervous_system(2)|lung(1)	3						TGTCTACAATTTAAAACAAAC	0.318													7	76	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82409190	82409190	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82409190C>T	uc001dit.3	+	6	1116	c.935C>T	c.(934-936)TCA>TTA	p.S312L	LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Missense_Mutation_p.S312L|LPHN2_uc001div.2_Missense_Mutation_p.S312L|LPHN2_uc009wcd.2_Missense_Mutation_p.S312L	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	312	Extracellular (Potential).|Olfactomedin-like.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		CGTGCCGCATCAAATGCTTTT	0.383													14	178	---	---	---	---	PASS
CCBL2	56267	broad.mit.edu	37	1	89430565	89430565	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89430565C>T	uc001dmp.2	-	5	777	c.400G>A	c.(400-402)GCA>ACA	p.A134T	CCBL2_uc001dmq.2_Missense_Mutation_p.A100T|CCBL2_uc001dmr.2_5'UTR	NM_001008661	NP_001008661	Q6YP21	KAT3_HUMAN	kynurenine aminotransferase III isoform 1	134					biosynthetic process|kynurenine metabolic process|tryptophan catabolic process		cysteine-S-conjugate beta-lyase activity|kynurenine-glyoxylate transaminase activity|kynurenine-oxoglutarate transaminase activity|pyridoxal phosphate binding			ovary(1)	1		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	GATCCATATGCTCCTACTGTC	0.328													16	107	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92181880	92181880	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92181880G>C	uc001doh.2	-	12	2245	c.1779C>G	c.(1777-1779)TTC>TTG	p.F593L	TGFBR3_uc009wde.2_Missense_Mutation_p.F370L|TGFBR3_uc010osy.1_Missense_Mutation_p.F551L|TGFBR3_uc001doi.2_Missense_Mutation_p.F592L|TGFBR3_uc001doj.2_Missense_Mutation_p.F592L	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	593	ZP.|Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		GCTCCATGTTGAAGGTGATGT	0.493													6	83	---	---	---	---	PASS
RPAP2	79871	broad.mit.edu	37	1	92846357	92846357	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92846357G>A	uc001dot.2	+	12	1874	c.1765G>A	c.(1765-1767)GAA>AAA	p.E589K	RPAP2_uc009wdh.2_RNA	NM_024813	NP_079089	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	589						integral to membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)	1		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		CACCCTCCTTGAAGAATTACA	0.363													41	200	---	---	---	---	PASS
ARHGAP29	9411	broad.mit.edu	37	1	94640064	94640064	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94640064C>G	uc001dqj.3	-	23	3516	c.3147G>C	c.(3145-3147)AAG>AAC	p.K1049N	ARHGAP29_uc009wdq.1_Intron	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1	1049					Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		AGGCAGGATTCTTGCAAAACT	0.378													20	248	---	---	---	---	PASS
SLC35A3	23443	broad.mit.edu	37	1	100472722	100472722	+	Intron	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100472722C>G	uc001dsp.1	+						SLC35A3_uc001dsq.1_Intron|SLC35A3_uc009wdy.1_Intron|SLC35A3_uc001dsr.1_Intron|SLC35A3_uc001dss.1_Intron	NM_012243	NP_036375	Q9Y2D2	S35A3_HUMAN	solute carrier family 35 member 3A						UDP-N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	sugar:hydrogen symporter activity|UDP-N-acetylglucosamine transmembrane transporter activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.124)|all cancers(265;0.198)|Lung(183;0.199)		GGTAACTATTCAAGATAAGTA	0.299													7	93	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103343604	103343604	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103343604C>T	uc001dul.2	-	67	5710	c.5392G>A	c.(5392-5394)GAA>AAA	p.E1798K	COL11A1_uc001duk.2_Missense_Mutation_p.E994K|COL11A1_uc001dum.2_Missense_Mutation_p.E1810K|COL11A1_uc001dun.2_Missense_Mutation_p.E1759K|COL11A1_uc009weh.2_Missense_Mutation_p.E1682K	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1798	Fibrillar collagen NC1.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GGACCAACTTCAAATCCGAAC	0.353													23	152	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103488453	103488453	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103488453C>T	uc001dul.2	-	8	1408	c.1090G>A	c.(1090-1092)GAA>AAA	p.E364K	COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Missense_Mutation_p.E376K|COL11A1_uc001dun.2_Missense_Mutation_p.E325K|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	364	Nonhelical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCGTCTATTTCTTTGTTTTCA	0.358													19	129	---	---	---	---	PASS
PRMT6	55170	broad.mit.edu	37	1	107600266	107600266	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107600266C>T	uc010ous.1	+	1	1000	c.929C>T	c.(928-930)TCG>TTG	p.S310L		NM_018137	NP_060607	Q96LA8	ANM6_HUMAN	protein arginine methyltransferase 6	310					base-excision repair|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone binding|histone methyltransferase activity (H2A-R3 specific)|histone methyltransferase activity (H3-R2 specific)|histone methyltransferase activity (H4-R3 specific)|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity				0		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)		CTGTCCACCTCGCCTTTTCAC	0.607													12	101	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109795405	109795405	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109795405C>T	uc001dxa.3	+	1	2765	c.2704C>T	c.(2704-2706)CGC>TGC	p.R902C		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	902	Extracellular (Potential).|Cadherin 7.				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GCCCCCAGCCCGCACACCTAT	0.552													4	105	---	---	---	---	PASS
RAP1A	5906	broad.mit.edu	37	1	112246973	112246973	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112246973G>A	uc001ebi.2	+	6	437	c.333G>A	c.(331-333)ATG>ATA	p.M111I	RAP1A_uc001ebk.2_Missense_Mutation_p.M111I|RAP1A_uc001ebl.2_Missense_Mutation_p.M111I|RAP1A_uc001ebm.2_RNA	NM_002884	NP_002875	P62834	RAP1A_HUMAN	RAP1A, member of RAS oncogene family precursor	111					activation of MAPKK activity|blood coagulation|energy reserve metabolic process|nerve growth factor receptor signaling pathway|regulation of insulin secretion	cytosol|plasma membrane	GTP binding|GTPase activity				0		all_cancers(81;6.79e-06)|all_epithelial(167;2.42e-05)|all_lung(203;0.000105)|Lung NSC(277;0.00021)		Lung(183;0.0183)|Colorectal(144;0.0418)|LUSC - Lung squamous cell carcinoma(189;0.0966)|all cancers(265;0.098)|Epithelial(280;0.0981)|COAD - Colon adenocarcinoma(174;0.141)		AGGTTCCAATGATTTTGGTTG	0.373													17	92	---	---	---	---	PASS
TTF2	8458	broad.mit.edu	37	1	117631574	117631574	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117631574A>G	uc001egy.2	+	13	2332	c.2312A>G	c.(2311-2313)AAC>AGC	p.N771S		NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase	771	Helicase ATP-binding.				mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		CCCATTCAAAACAACTTATTG	0.438													31	206	---	---	---	---	PASS
HSD3B2	3284	broad.mit.edu	37	1	119962195	119962195	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119962195C>T	uc001ehs.2	+	2	1070	c.297C>T	c.(295-297)GTC>GTT	p.V99V	HSD3B2_uc001eht.2_Silent_p.V99V|HSD3B2_uc001ehu.2_Silent_p.V99V	NM_000198	NP_000189	P26439	3BHS2_HUMAN	3 beta-hydroxysteroid dehydrogenase 2	99					androgen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	NADH(DB00157)|Trilostane(DB01108)	TCATGAATGTCAATGTGAAAG	0.458													17	58	---	---	---	---	PASS
C1orf56	54964	broad.mit.edu	37	1	151020396	151020396	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151020396G>A	uc001ewn.2	+	1	138	c.73G>A	c.(73-75)GGC>AGC	p.G25S		NM_017860	NP_060330	Q9BUN1	CA056_HUMAN	hypothetical protein LOC54964 precursor	25						extracellular region					0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGGGGCCCAAGGCCTGACCCA	0.711													5	23	---	---	---	---	PASS
RPTN	126638	broad.mit.edu	37	1	152127601	152127601	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152127601G>T	uc001ezs.1	-	3	2039	c.1974C>A	c.(1972-1974)CAC>CAA	p.H658Q		NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin	658	Gln-rich.					proteinaceous extracellular matrix	calcium ion binding				0						GTTTGTGTTGGTGATGTTGGC	0.522													25	177	---	---	---	---	PASS
ADAR	103	broad.mit.edu	37	1	154574268	154574268	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154574268T>C	uc001ffh.2	-	2	1050	c.850A>G	c.(850-852)ACA>GCA	p.T284A	ADAR_uc001ffj.2_Missense_Mutation_p.T284A|ADAR_uc001ffi.2_Missense_Mutation_p.T284A|ADAR_uc001ffk.2_5'UTR|ADAR_uc001ffl.1_5'UTR	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a	284					adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		AAGGCAGATGTGGAGTTGCTG	0.498													45	259	---	---	---	---	PASS
PKLR	5313	broad.mit.edu	37	1	155261636	155261636	+	Missense_Mutation	SNP	C	T	T	rs113403872	byFrequency	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155261636C>T	uc001fkb.3	-	10	1568	c.1529G>A	c.(1528-1530)CGA>CAA	p.R510Q	RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_Missense_Mutation_p.R479Q	NM_000298	NP_000289	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC isoform 1	510			R -> Q (in PKRD; the most common mutation in European population).		endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity			skin(4)|ovary(1)	5	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	GAAGACTCCTCGGCATAAGTG	0.587													5	136	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155408743	155408743	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155408743C>G	uc009wqq.2	-	5	5683	c.5203G>C	c.(5203-5205)GAT>CAT	p.D1735H	ASH1L_uc001fkt.2_Missense_Mutation_p.D1735H	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	1735	Ser-rich.				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			ATCACAGCATCAATACTTTTC	0.517													7	107	---	---	---	---	PASS
NES	10763	broad.mit.edu	37	1	156641556	156641556	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156641556C>G	uc001fpq.2	-	4	2557	c.2424G>C	c.(2422-2424)AAG>AAC	p.K808N		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	808	Tail.				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTTTGAGTGACTTTAAGAACT	0.413													22	135	---	---	---	---	PASS
ISG20L2	81875	broad.mit.edu	37	1	156693248	156693248	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156693248T>C	uc001fps.1	-	3	1216	c.955A>G	c.(955-957)AAG>GAG	p.K319E	ISG20L2_uc001fpt.1_Missense_Mutation_p.K319E	NM_030980	NP_112242	Q9H9L3	I20L2_HUMAN	interferon stimulated exonuclease gene	319	Exonuclease.				ribosome biogenesis	nucleolus	exonuclease activity|nucleic acid binding|protein binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGTCCGCTCTTCCCAACCTGA	0.532													26	201	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158615169	158615169	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158615169G>C	uc001fst.1	-	29	4202	c.4003C>G	c.(4003-4005)CGT>GGT	p.R1335G		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1335	Spectrin 13.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					ATGTCAGCACGGTGCTCCTGT	0.488													13	87	---	---	---	---	PASS
MAEL	84944	broad.mit.edu	37	1	166974348	166974348	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166974348G>A	uc001gdy.1	+	7	755	c.684G>A	c.(682-684)AAG>AAA	p.K228K	MAEL_uc001gdz.1_Silent_p.K197K|MAEL_uc009wvf.1_RNA	NM_032858	NP_116247	Q96JY0	MAEL_HUMAN	maelstrom homolog	228					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|multicellular organismal development|piRNA metabolic process|spermatogenesis	piP-body	DNA binding			skin(1)	1						GGTGTTTGAAGCATATGGCAA	0.353													9	65	---	---	---	---	PASS
BAT2L2	23215	broad.mit.edu	37	1	171509532	171509532	+	Missense_Mutation	SNP	G	T	T	rs149366991	by1000genomes	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171509532G>T	uc010pmg.1	+	16	3187	c.2921G>T	c.(2920-2922)CGA>CTA	p.R974L	BAT2L2_uc010pmh.1_5'UTR	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	974							protein C-terminus binding				0						GGCTTTATACGATCTTCTGAA	0.403													5	41	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176659322	176659322	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176659322C>A	uc001gkz.2	+	5	3351	c.2187C>A	c.(2185-2187)GAC>GAA	p.D729E	PAPPA2_uc001gky.1_Missense_Mutation_p.D729E|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	729	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						GCCACACCGACACCATGATCC	0.483													33	218	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177250107	177250107	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177250107G>A	uc001glf.2	+	8	2107	c.1795G>A	c.(1795-1797)GAG>AAG	p.E599K	FAM5B_uc001glg.2_Missense_Mutation_p.E494K	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	599						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						CAGCCACTCTGAGAGCTGGTT	0.557													6	58	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181548209	181548209	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181548209C>G	uc001gow.2	+	5	783	c.618C>G	c.(616-618)AGC>AGG	p.S206R	CACNA1E_uc009wxr.2_Missense_Mutation_p.S113R|CACNA1E_uc009wxs.2_Missense_Mutation_p.S113R	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	206	Cytoplasmic (Potential).|I.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						TCCTTCTAGGCCTGCAGATTG	0.478													10	142	---	---	---	---	PASS
TROVE2	6738	broad.mit.edu	37	1	193038376	193038376	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193038376G>T	uc001gss.2	+	2	367	c.192G>T	c.(190-192)TTG>TTT	p.L64F	TROVE2_uc001gst.1_Intron|TROVE2_uc001gsu.1_Intron|TROVE2_uc001gsv.1_Missense_Mutation_p.L64F|TROVE2_uc001gsw.2_Missense_Mutation_p.L64F|TROVE2_uc009wyp.2_Missense_Mutation_p.L64F|TROVE2_uc009wyq.2_Missense_Mutation_p.L64F|TROVE2_uc001gsx.1_Missense_Mutation_p.L64F	NM_004600	NP_004591	P10155	RO60_HUMAN	TROVE domain family, member 2 isoform 2	64	TROVE.				transcription from RNA polymerase III promoter	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|RNA binding				0						TAATTAGATTGATTGAAGATG	0.398													16	88	---	---	---	---	PASS
CFH	3075	broad.mit.edu	37	1	196712697	196712697	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196712697G>T	uc001gtj.3	+	20	3489	c.3249G>T	c.(3247-3249)ATG>ATT	p.M1083I		NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	1083	Sushi 18.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						CTTATGAAATGTTTGGGGATG	0.388													28	321	---	---	---	---	PASS
CFHR4	10877	broad.mit.edu	37	1	196881977	196881977	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196881977G>T	uc001gto.2	+	3	433	c.364G>T	c.(364-366)GCA>TCA	p.A122S	CFHR4_uc009wyy.2_Missense_Mutation_p.A368S|CFHR4_uc001gtp.2_Missense_Mutation_p.A369S	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	122	Sushi 2.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						ACCAGGATATGCAACAGCAGA	0.284													29	185	---	---	---	---	PASS
IKBKE	9641	broad.mit.edu	37	1	206651597	206651597	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206651597A>T	uc001hdz.1	+	9	1275	c.907A>T	c.(907-909)AGT>TGT	p.S303C	IKBKE_uc009xbu.1_3'UTR|IKBKE_uc009xbv.1_Missense_Mutation_p.S303C|IKBKE_uc001hea.1_Missense_Mutation_p.S218C	NM_014002	NP_054721	Q14164	IKKE_HUMAN	IKK-related kinase epsilon	303	Protein kinase.				DNA damage response, signal transduction resulting in induction of apoptosis|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane|PML body	ATP binding|IkappaB kinase activity|NF-kappaB-inducing kinase activity|protein binding			ovary(3)|lung(3)|central_nervous_system(1)|skin(1)	8	Breast(84;0.137)					TGCGGAGACCAGTGACATCCT	0.612													28	176	---	---	---	---	PASS
SYT14	255928	broad.mit.edu	37	1	210329086	210329086	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210329086C>A	uc009xcv.2	+	7	1257	c.1185C>A	c.(1183-1185)AGC>AGA	p.S395R	SYT14_uc001hhs.3_Missense_Mutation_p.S440R|SYT14_uc001hht.3_Missense_Mutation_p.S395R|SYT14_uc001hhu.3_RNA|SYT14_uc010psn.1_Missense_Mutation_p.S440R|SYT14_uc010pso.1_Missense_Mutation_p.S357R	NM_153262	NP_694994	Q8NB59	SYT14_HUMAN	synaptotagmin XIV isoform 4	395	Cytoplasmic (Potential).					integral to membrane				ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.085)		CCCAAATGAGCGTGTCAGAAA	0.353													21	93	---	---	---	---	PASS
KCNH1	3756	broad.mit.edu	37	1	211093411	211093411	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211093411C>A	uc001hib.2	-	7	1203	c.1033G>T	c.(1033-1035)GGC>TGC	p.G345C	KCNH1_uc001hic.2_Missense_Mutation_p.G318C	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	345	Extracellular (Potential).				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		CTGCTGATGCCCTGGGAGAAG	0.527													15	73	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215987192	215987192	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215987192C>T	uc001hku.1	-	49	10012	c.9625G>A	c.(9625-9627)GAA>AAA	p.E3209K		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3209	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATATACTTTTCTTCACAACAG	0.413										HNSCC(13;0.011)			5	145	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220184343	220184343	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220184343G>A	uc001hly.1	-	13	1820	c.1550C>T	c.(1549-1551)CCA>CTA	p.P517L	EPRS_uc010puf.1_Missense_Mutation_p.P268L|EPRS_uc001hlz.1_Missense_Mutation_p.P524L|EPRS_uc009xdt.1_Missense_Mutation_p.P220L	NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	517	Glutamyl-tRNA synthetase.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	TACATTCACTGGGATCACTTC	0.403													27	253	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222712020	222712020	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222712020C>T	uc001hnh.1	-	5	1605	c.1547G>A	c.(1546-1548)GGC>GAC	p.G516D		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	516					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		GATATACAGGCCATTGAGATT	0.378													8	69	---	---	---	---	PASS
CNIH3	149111	broad.mit.edu	37	1	224918248	224918248	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224918248G>C	uc001hos.1	+	4	981	c.283G>C	c.(283-285)GTC>CTC	p.V95L		NM_152495	NP_689708	Q8TBE1	CNIH3_HUMAN	cornichon homolog 3	95	Cytoplasmic (Potential).				intracellular signal transduction|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic shaft|postsynaptic membrane					0	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		GGGGCTGAATGTCCCTCTACT	0.517													3	5	---	---	---	---	PASS
ACTA1	58	broad.mit.edu	37	1	229568794	229568794	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229568794G>A	uc001htm.2	-	2	174	c.69C>T	c.(67-69)TTC>TTT	p.F23F		NM_001100	NP_001091	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	23					muscle filament sliding|skeletal muscle fiber development|skeletal muscle thin filament assembly	actin filament|cytosol|stress fiber|striated muscle thin filament	ADP binding|ATP binding|myosin binding|structural constituent of cytoskeleton				0	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)			Dornase Alfa(DB00003)	CATCCCCGGCGAAGCCGGCTT	0.682													30	123	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237656289	237656289	+	Missense_Mutation	SNP	C	A	A	rs17686573	by1000genomes	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237656289C>A	uc001hyl.1	+	19	1983	c.1863C>A	c.(1861-1863)CAC>CAA	p.H621Q		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	621	Cytoplasmic (By similarity).|B30.2/SPRY 1.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTGTTTGCCACGGGGTTGCAG	0.378													6	33	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237870313	237870313	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237870313G>T	uc001hyl.1	+	68	9765	c.9645G>T	c.(9643-9645)ATG>ATT	p.M3215I	RYR2_uc010pxz.1_Missense_Mutation_p.M170I	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3215					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGAAACTCATGGAAGAAATCG	0.423													30	192	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237870314	237870314	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237870314G>T	uc001hyl.1	+	68	9766	c.9646G>T	c.(9646-9648)GAA>TAA	p.E3216*	RYR2_uc010pxz.1_Nonsense_Mutation_p.E171*	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3216					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAAACTCATGGAAGAAATCGT	0.428													30	190	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947443	237947443	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947443G>A	uc001hyl.1	+	90	12551	c.12431G>A	c.(12430-12432)CGC>CAC	p.R4144H	RYR2_uc010pya.1_Missense_Mutation_p.R559H	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4144					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGCGCCAAACGCATCGAGAGG	0.498													4	127	---	---	---	---	PASS
CHRM3	1131	broad.mit.edu	37	1	240071750	240071750	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240071750C>G	uc001hyp.2	+	5	1778	c.999C>G	c.(997-999)AGC>AGG	p.S333R		NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	333	Cytoplasmic (By similarity).				cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	ACCACAGCAGCAGTGACAGTT	0.567													6	55	---	---	---	---	PASS
KMO	8564	broad.mit.edu	37	1	241724047	241724047	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241724047G>A	uc009xgp.2	+	6	509	c.444G>A	c.(442-444)GTG>GTA	p.V148V	KMO_uc001hyy.2_Silent_p.V148V|KMO_uc009xgo.1_Silent_p.V148V	NM_003679	NP_003670	O15229	KMO_HUMAN	kynurenine 3-monooxygenase	148					pyridine nucleotide biosynthetic process|response to salt stress	cytosol|integral to membrane|mitochondrial outer membrane	electron carrier activity|flavin adenine dinucleotide binding|kynurenine 3-monooxygenase activity|NAD(P)H oxidase activity			ovary(2)	2	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			TGATCACAGTGCTTGGGTAAC	0.428													5	64	---	---	---	---	PASS
AHCTF1	25909	broad.mit.edu	37	1	247025290	247025290	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247025290C>G	uc001ibu.1	-	27	3713	c.3706G>C	c.(3706-3708)GAA>CAA	p.E1236Q	AHCTF1_uc001ibv.1_Missense_Mutation_p.E1245Q|AHCTF1_uc009xgs.1_Missense_Mutation_p.E97Q|AHCTF1_uc001ibw.1_RNA	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	1236	Necessary for nuclear localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TGGACATCTTCTTCCACAAAT	0.383													5	71	---	---	---	---	PASS
OR14A16	284532	broad.mit.edu	37	1	247978248	247978248	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247978248C>G	uc001idm.1	-	1	784	c.784G>C	c.(784-786)GAG>CAG	p.E262Q		NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A,	262	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GAAGGAGACTCTGAAGCTGGC	0.413													4	92	---	---	---	---	PASS
OR2W3	343171	broad.mit.edu	37	1	248058999	248058999	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248058999G>T	uc001idp.1	+	3	380	c.111G>T	c.(109-111)CTG>CTT	p.L37L	OR2W3_uc010pzb.1_Silent_p.L37L	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W,	37	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|pancreas(1)	3	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CGTACCTCCTGACCCTCGTAG	0.582													31	189	---	---	---	---	PASS
OR2T12	127064	broad.mit.edu	37	1	248458890	248458890	+	5'Flank	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248458890T>A	uc010pzj.1	-							NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			TAATTTCCCCTGGTGTGATGG	0.413													19	138	---	---	---	---	PASS
OR2M7	391196	broad.mit.edu	37	1	248487405	248487405	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248487405C>T	uc010pzk.1	-	1	466	c.466G>A	c.(466-468)GGA>AGA	p.G156R		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	156	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCAATGATTCCATCTGTAGAG	0.478													32	508	---	---	---	---	PASS
OR2T1	26696	broad.mit.edu	37	1	248569970	248569970	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248569970C>A	uc010pzm.1	+	1	675	c.675C>A	c.(673-675)AAC>AAA	p.N225K		NM_030904	NP_112166	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T,	225	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGGAGATTAACCACTTCTTCT	0.512													25	126	---	---	---	---	PASS
TPO	7173	broad.mit.edu	37	2	1520679	1520679	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1520679C>A	uc002qww.2	+	15	2634	c.2543C>A	c.(2542-2544)ACT>AAT	p.T848N	TPO_uc010ewj.2_RNA|TPO_uc002qwu.2_Missense_Mutation_p.T791N|TPO_uc002qwr.2_Missense_Mutation_p.T848N|TPO_uc002qwx.2_Missense_Mutation_p.T791N|TPO_uc010yio.1_Missense_Mutation_p.T675N|TPO_uc010yip.1_Missense_Mutation_p.T804N|TPO_uc002qwy.1_Missense_Mutation_p.T144N|TPO_uc002qwz.2_RNA	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	848	Helical; (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CCTCGGGTGACTTGGATCTCC	0.582													13	72	---	---	---	---	PASS
MATN3	4148	broad.mit.edu	37	2	20201770	20201770	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20201770G>C	uc002rdl.2	-	4	1051	c.988C>G	c.(988-990)CAT>GAT	p.H330D	MATN3_uc010exu.1_Missense_Mutation_p.H288D	NM_002381	NP_002372	O15232	MATN3_HUMAN	matrilin 3 precursor	330	EGF-like 2.				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACTCACAATGATAAGAGCCA	0.418													19	46	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21228375	21228375	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21228375C>T	uc002red.2	-	26	11493	c.11365G>A	c.(11365-11367)GTA>ATA	p.V3789I		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3789					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GGGAATTTTACCTCGGGGAGT	0.398													56	260	---	---	---	---	PASS
DPYSL5	56896	broad.mit.edu	37	2	27157544	27157544	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27157544G>A	uc002rhu.3	+	8	1047	c.889G>A	c.(889-891)GTG>ATG	p.V297M	DPYSL5_uc002rhv.3_Missense_Mutation_p.V297M	NM_020134	NP_064519	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	297					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTATGTCACGGTGCCTCCCCT	0.577													62	352	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32823032	32823032	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32823032G>C	uc010ezu.2	+	69	13961	c.13827G>C	c.(13825-13827)ATG>ATC	p.M4609I		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	4609	Ubiquitin-conjugating.				anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TTGATATCATGAAGGTAAAAA	0.393													3	34	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33246033	33246033	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33246033T>C	uc002ros.2	+	3	623	c.623T>C	c.(622-624)GTG>GCG	p.V208A		NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	208	EGF-like 1.				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CAACTCTGTGTGTGTAAACCA	0.532													91	447	---	---	---	---	PASS
SOS1	6654	broad.mit.edu	37	2	39250320	39250320	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39250320G>C	uc002rrk.3	-	10	1290	c.1249C>G	c.(1249-1251)CTA>GTA	p.L417V	SOS1_uc010ynr.1_RNA|SOS1_uc002rrj.3_Missense_Mutation_p.L31V|SOS1_uc002rrl.2_Missense_Mutation_p.L149V	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	417					apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				TTGATTGCTAGTTGTTTCCCC	0.358									Noonan_syndrome				36	157	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40656111	40656111	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40656111G>T	uc002rrx.2	-	1	1334	c.1310C>A	c.(1309-1311)ACT>AAT	p.T437N	SLC8A1_uc002rry.2_Missense_Mutation_p.T437N|SLC8A1_uc002rrz.2_Missense_Mutation_p.T437N|SLC8A1_uc002rsa.2_Missense_Mutation_p.T437N|SLC8A1_uc002rsd.3_Missense_Mutation_p.T437N|SLC8A1_uc002rsb.1_Missense_Mutation_p.T437N|SLC8A1_uc010fan.1_Missense_Mutation_p.T437N|SLC8A1_uc002rsc.1_Missense_Mutation_p.T437N	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	437	Calx-beta 1.|Cytoplasmic (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CACAGTGTTAGTCAAATCACC	0.443													25	132	---	---	---	---	PASS
DYNC2LI1	51626	broad.mit.edu	37	2	44021646	44021646	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44021646G>T	uc002rtk.2	+	6	467	c.371G>T	c.(370-372)TGG>TTG	p.W124L	DYNC2LI1_uc002rth.2_Missense_Mutation_p.W124L|DYNC2LI1_uc002rti.2_3'UTR|DYNC2LI1_uc002rtj.2_Missense_Mutation_p.W124L|DYNC2LI1_uc002rtl.2_Missense_Mutation_p.W124L|DYNC2LI1_uc010ynz.1_5'UTR	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1	124						apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				AATGATCTCTGGCCCACCATG	0.348													7	102	---	---	---	---	PASS
DYNC2LI1	51626	broad.mit.edu	37	2	44021647	44021647	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44021647G>C	uc002rtk.2	+	6	468	c.372G>C	c.(370-372)TGG>TGC	p.W124C	DYNC2LI1_uc002rth.2_Missense_Mutation_p.W124C|DYNC2LI1_uc002rti.2_3'UTR|DYNC2LI1_uc002rtj.2_Missense_Mutation_p.W124C|DYNC2LI1_uc002rtl.2_Missense_Mutation_p.W124C|DYNC2LI1_uc010ynz.1_5'UTR	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1	124						apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				ATGATCTCTGGCCCACCATGG	0.353													7	100	---	---	---	---	PASS
SIX2	10736	broad.mit.edu	37	2	45235921	45235921	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45235921C>A	uc002ruo.2	-	1	622	c.329G>T	c.(328-330)CGC>CTC	p.R110L	SIX2_uc002rup.2_Missense_Mutation_p.R110L	NM_016932	NP_058628	Q9NPC8	SIX2_HUMAN	SIX homeobox 2	110						nucleus	sequence-specific DNA binding transcription factor activity			pancreas(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GCGGCGCACGCGGTATTTGCC	0.657													17	105	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50724617	50724617	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50724617G>A	uc010fbq.2	-	14	4330	c.2853C>T	c.(2851-2853)ACC>ACT	p.T951T	NRXN1_uc002rxb.3_Silent_p.T583T|NRXN1_uc002rxe.3_Silent_p.T911T|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AGCTCGATTTGGTCTTGAAGG	0.398													11	61	---	---	---	---	PASS
PSME4	23198	broad.mit.edu	37	2	54147397	54147397	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54147397C>G	uc002rxp.2	-	19	2409	c.2353G>C	c.(2353-2355)GAC>CAC	p.D785H	PSME4_uc010yop.1_Missense_Mutation_p.D671H|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.D160H|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	785					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AGAAAGGAGTCCAAAAGATAA	0.428													6	325	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55562301	55562301	+	Splice_Site	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55562301C>G	uc002ryv.2	-	15	2499	c.1657_splice	c.e15-1	p.I553_splice	CCDC88A_uc010yoz.1_Splice_Site_p.I553_splice|CCDC88A_uc010ypa.1_Splice_Site_p.I553_splice|CCDC88A_uc010ypb.1_Intron|CCDC88A_uc002ryu.2_Splice_Site|CCDC88A_uc002ryw.2_Splice_Site	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1						activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						GTATCTTAATCTAATTTGAAA	0.348													10	43	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61575411	61575411	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61575411C>T	uc002sbe.2	-	15	1901	c.1879G>A	c.(1879-1881)GAT>AAT	p.D627N		NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	627					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			CCATGATCATCGTCTTCATCT	0.488													15	91	---	---	---	---	PASS
ARHGAP25	9938	broad.mit.edu	37	2	69049822	69049822	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69049822C>T	uc002seu.2	+	10	1912	c.1548C>T	c.(1546-1548)GCC>GCT	p.A516A	ARHGAP25_uc010fdg.2_Silent_p.A517A|ARHGAP25_uc010yql.1_Silent_p.A477A|ARHGAP25_uc002sew.2_Silent_p.A509A|ARHGAP25_uc002sex.2_Silent_p.A510A|ARHGAP25_uc002sey.2_Silent_p.A243A	NM_001007231	NP_001007232	P42331	RHG25_HUMAN	Rho GTPase activating protein 25 isoform a	516					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|breast(2)	4						GGGAGGAAGCCAGTGCACTCT	0.537													17	146	---	---	---	---	PASS
STAMBP	10617	broad.mit.edu	37	2	74074661	74074661	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74074661G>C	uc002sjs.2	+	5	573	c.523G>C	c.(523-525)GAA>CAA	p.E175Q	STAMBP_uc002sjt.2_Missense_Mutation_p.E175Q|STAMBP_uc002sju.2_Missense_Mutation_p.E175Q|STAMBP_uc002sjv.2_Missense_Mutation_p.E175Q	NM_201647	NP_964010	O95630	STABP_HUMAN	STAM binding protein	175	Glu-rich.				JAK-STAT cascade|positive regulation of cell proliferation	early endosome|membrane|nucleus	metal ion binding|metallopeptidase activity|protein binding			ovary(1)|lung(1)|breast(1)|pancreas(1)	4						CCAGGAGCTAGAAAAAGAGCG	0.507													9	66	---	---	---	---	PASS
SLC4A5	57835	broad.mit.edu	37	2	74480125	74480125	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74480125T>C	uc002sko.1	-	10	1246	c.1244A>G	c.(1243-1245)AAG>AGG	p.K415R	SLC4A5_uc002skl.2_RNA|SLC4A5_uc002skn.2_Missense_Mutation_p.K415R|SLC4A5_uc010ffc.1_Missense_Mutation_p.K415R|SLC4A5_uc002skp.1_Missense_Mutation_p.K351R|SLC4A5_uc002sks.1_Missense_Mutation_p.K415R	NM_021196	NP_067019	Q9BY07	S4A5_HUMAN	sodium bicarbonate transporter 4 isoform a	415	Cytoplasmic (Potential).					apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						GGGCACCTTCTTGGGGGGCTC	0.468													27	119	---	---	---	---	PASS
LRRTM1	347730	broad.mit.edu	37	2	80530489	80530489	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80530489G>T	uc002sok.1	-	2	726	c.456C>A	c.(454-456)CTC>CTA	p.L152L	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	152	LRR 3.|Lumenal (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						GGTCGGGCGCGAGCGCCTGCA	0.642										HNSCC(69;0.2)			21	82	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90060888	90060888	+	Intron	SNP	T	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90060888T>G	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		AGGGGTCCCCTCGAGGTTCAG	0.502													22	202	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90060889	90060889	+	Intron	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90060889C>A	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		GGGGTCCCCTCGAGGTTCAGT	0.502													19	204	---	---	---	---	PASS
INPP4A	3631	broad.mit.edu	37	2	99149956	99149956	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99149956G>C	uc002syy.2	+	5	661	c.268G>C	c.(268-270)GAG>CAG	p.E90Q	INPP4A_uc010yvj.1_Missense_Mutation_p.E90Q|INPP4A_uc010yvk.1_Missense_Mutation_p.E90Q|INPP4A_uc002syx.2_Missense_Mutation_p.E90Q|INPP4A_uc010fik.2_Intron	NM_001134224	NP_001127696	Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type 1	90	C2.				signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			kidney(1)	1						GGAGATCATTGAGGTGGGTGC	0.517													17	71	---	---	---	---	PASS
ANKRD57	65124	broad.mit.edu	37	2	110373630	110373630	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110373630A>G	uc002tfb.2	+	1	1720	c.1564A>G	c.(1564-1566)AAT>GAT	p.N522D	SEPT10_uc010ywu.1_5'Flank|SEPT10_uc002tew.2_5'Flank|SEPT10_uc002tex.2_5'Flank|SEPT10_uc002tey.2_5'Flank|SEPT10_uc010ywv.1_5'Flank	NM_023016	NP_075392	Q53LP3	ANR57_HUMAN	ankyrin repeat domain 57	522											0						ACCAAAGTCCAATGTATTTGG	0.473													11	33	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125555884	125555884	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125555884G>T	uc002tno.2	+	19	3565	c.3201G>T	c.(3199-3201)CTG>CTT	p.L1067L	CNTNAP5_uc010flu.2_Silent_p.L1068L	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	1067	Extracellular (Potential).|Laminin G-like 4.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGGTTGTTCTGCTCTGCAAGA	0.498													7	76	---	---	---	---	PASS
PLEKHB2	55041	broad.mit.edu	37	2	131897811	131897811	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131897811G>T	uc002tsg.3	+	7	1055	c.495G>T	c.(493-495)GGG>GGT	p.G165G	PLEKHB2_uc002tsh.2_Intron|PLEKHB2_uc002tsj.3_Silent_p.G164G|PLEKHB2_uc002tsf.3_Silent_p.G173G|PLEKHB2_uc010zao.1_Silent_p.G115G|PLEKHB2_uc010zap.1_Intron|PLEKHB2_uc010zaq.1_Missense_Mutation_p.G121V|PLEKHB2_uc002tsi.3_Silent_p.G206G	NM_001100623	NP_001094093	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B	165						membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)		CTGCGAATGGGCAGGCGTATG	0.527													4	41	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141083359	141083359	+	Silent	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141083359A>G	uc002tvj.1	-	80	13284	c.12312T>C	c.(12310-12312)AAT>AAC	p.N4104N		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4104	Extracellular (Potential).|LDL-receptor class B 36.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGACTACTGAATTAGAGCCAT	0.363										TSP Lung(27;0.18)			6	75	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141201953	141201953	+	Silent	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141201953A>G	uc002tvj.1	-	65	11212	c.10240T>C	c.(10240-10242)TTA>CTA	p.L3414L		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3414	Extracellular (Potential).|LDL-receptor class A 23.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTACATCTTAAGTTTACTGGG	0.398										TSP Lung(27;0.18)			32	207	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163292047	163292047	+	Missense_Mutation	SNP	T	A	A	rs79852917		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163292047T>A	uc002uch.1	-	8	1827	c.1615A>T	c.(1615-1617)AGG>TGG	p.R539W	KCNH7_uc002uci.2_Missense_Mutation_p.R532W	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	539	Helical; Voltage-sensor; Name=Segment S4; (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	TCCAGTTTCCTGGCCACGCGC	0.463													20	83	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166183444	166183444	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166183444C>G	uc002udc.2	+	13	2389	c.2099C>G	c.(2098-2100)TCA>TGA	p.S700*	SCN2A_uc002udd.2_Nonsense_Mutation_p.S700*|SCN2A_uc002ude.2_Nonsense_Mutation_p.S700*	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	700					myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	GATCCTACATCAAGGCAAAGA	0.393													29	180	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166903458	166903458	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166903458A>T	uc010zcz.1	-	9	1217	c.1199T>A	c.(1198-1200)ATG>AAG	p.M400K	SCN1A_uc002udo.3_Missense_Mutation_p.M269K|SCN1A_uc010fpk.2_Missense_Mutation_p.M269K	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	400	Helical; Name=S6 of repeat I; (By similarity).|I.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	AAAAAATATCATGTACGTTTT	0.383													12	161	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168099807	168099807	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168099807C>G	uc002udx.2	+	8	1923	c.1905C>G	c.(1903-1905)GAC>GAG	p.D635E	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.D460E|XIRP2_uc010fpq.2_Missense_Mutation_p.D413E|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	460					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						ATTCTTCTGACACTGTAGAAA	0.433													20	98	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168115003	168115003	+	3'UTR	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168115003G>A	uc002udx.2	+	10					XIRP2_uc010fpn.2_Silent_p.K682K|XIRP2_uc010fpo.2_Silent_p.K649K|XIRP2_uc010fpp.2_Silent_p.K649K|XIRP2_uc010fpq.2_3'UTR|XIRP2_uc010fpr.2_Silent_p.K427K	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						AAGACACAAAGAGTAACAGGA	0.299													6	61	---	---	---	---	PASS
KBTBD10	10324	broad.mit.edu	37	2	170366466	170366466	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170366466G>C	uc002ueu.1	+	1	255	c.178G>C	c.(178-180)GAG>CAG	p.E60Q	KBTBD10_uc010zdh.1_Intron	NM_006063	NP_006054	O60662	KBTBA_HUMAN	kelch repeat and BTB (POZ) domain containing 10	60	BTB.				striated muscle contraction	centrosome|nucleolus|plasma membrane|pseudopodium|ruffle					0						TTACTTCCGTGAGTACTTTTT	0.388													58	269	---	---	---	---	PASS
PDE11A	50940	broad.mit.edu	37	2	178545563	178545563	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178545563T>C	uc002ulq.2	-	16	2732	c.2414A>G	c.(2413-2415)GAT>GGT	p.D805G	PDE11A_uc002ulp.2_Missense_Mutation_p.D361G|PDE11A_uc002ulr.2_Missense_Mutation_p.D555G|PDE11A_uc002uls.1_Missense_Mutation_p.D447G|PDE11A_uc002ult.1_Missense_Mutation_p.D555G|PDE11A_uc002ulu.1_Missense_Mutation_p.D447G	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4	805	Catalytic (By similarity).				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			CCGAAATATATCACGATGGTT	0.328									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				11	61	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179413051	179413051	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179413051G>T	uc010zfg.1	-	288	85822	c.85598C>A	c.(85597-85599)CCC>CAC	p.P28533H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P22228H|TTN_uc010zfi.1_Missense_Mutation_p.P22161H|TTN_uc010zfj.1_Missense_Mutation_p.P22036H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29460							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATTTCATAGGGCTCACCAAC	0.468													46	212	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179417146	179417146	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179417146G>T	uc010zfg.1	-	284	83001	c.82777C>A	c.(82777-82779)CCA>ACA	p.P27593T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P21288T|TTN_uc010zfi.1_Missense_Mutation_p.P21221T|TTN_uc010zfj.1_Missense_Mutation_p.P21096T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	28520							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGATGGATGGTTTGGGTTTT	0.408													10	55	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179452497	179452497	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179452497A>G	uc010zfg.1	-	255	56059	c.55835T>C	c.(55834-55836)ATG>ACG	p.M18612T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.M12307T|TTN_uc010zfi.1_Missense_Mutation_p.M12240T|TTN_uc010zfj.1_Missense_Mutation_p.M12115T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	19539							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGTTTCCTCATGCTGGCATC	0.423													7	69	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179457391	179457391	+	Intron	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179457391G>T	uc010zfg.1	-						uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGGGTTCTAGAATAAAGAGA	0.383													26	141	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179479391	179479391	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179479391C>T	uc010zfg.1	-	210	41370	c.41146G>A	c.(41146-41148)GGA>AGA	p.G13716R	uc002ump.1_RNA|TTN_uc010zfh.1_Missense_Mutation_p.G7411R|TTN_uc010zfi.1_Missense_Mutation_p.G7344R|TTN_uc010zfj.1_Missense_Mutation_p.G7219R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14643							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGGTTTTCCGGTTACGGTG	0.438													15	71	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179482119	179482119	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179482119C>T	uc010zfg.1	-	203	40213	c.39989G>A	c.(39988-39990)CGA>CAA	p.R13330Q	TTN_uc010zfh.1_Missense_Mutation_p.R7025Q|TTN_uc010zfi.1_Missense_Mutation_p.R6958Q|TTN_uc010zfj.1_Missense_Mutation_p.R6833Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14257							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTTCGCATCGCTCAATTAT	0.383													7	28	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179596050	179596050	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179596050C>T	uc010zfg.1	-	56	13935	c.13711G>A	c.(13711-13713)GCA>ACA	p.A4571T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.A1232T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5498							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGAGTAATGCAGAACATCTT	0.433													78	565	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185801203	185801203	+	Silent	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185801203C>A	uc002uph.2	+	4	1674	c.1080C>A	c.(1078-1080)TCC>TCA	p.S360S		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	360						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						GAAATAAATCCACAGTTCTTG	0.363													12	111	---	---	---	---	PASS
GULP1	51454	broad.mit.edu	37	2	189387534	189387534	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189387534G>T	uc010fru.2	+	5	603	c.142G>T	c.(142-144)GAT>TAT	p.D48Y	GULP1_uc002uqc.3_Missense_Mutation_p.D48Y|GULP1_uc002uqd.2_Missense_Mutation_p.D48Y|GULP1_uc010zfw.1_Intron|GULP1_uc002uqe.2_Missense_Mutation_p.D48Y|GULP1_uc002uqf.2_Missense_Mutation_p.D48Y|GULP1_uc002uqg.2_Missense_Mutation_p.D48Y	NM_016315	NP_057399	Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing	48	PID.				apoptosis|lipid transport|phagocytosis, engulfment	cytoplasm|intracellular membrane-bounded organelle	signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			AGTTGTGAGAGATGCTGTAAG	0.383													15	103	---	---	---	---	PASS
BOLL	66037	broad.mit.edu	37	2	198631324	198631324	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198631324G>T	uc002uus.2	-	7	794	c.484C>A	c.(484-486)CGT>AGT	p.R162S	uc002uup.2_Intron|BOLL_uc002uur.2_Missense_Mutation_p.R168S|BOLL_uc002uut.2_Missense_Mutation_p.R174S|BOLL_uc010zha.1_Missense_Mutation_p.R53S|BOLL_uc002uuu.1_Missense_Mutation_p.R168S	NM_033030	NP_149019	Q8N9W6	BOLL_HUMAN	boule isoform 2	162					cell differentiation|meiosis|multicellular organismal development|positive regulation of translational initiation|spermatogenesis	cytoplasm	nucleotide binding|protein binding|RNA binding|translation activator activity			ovary(2)	2						CATACAGAACGTGACTATAAA	0.343													6	43	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201501731	201501731	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201501731G>C	uc002uvx.2	+	22	2545	c.2444G>C	c.(2443-2445)GGA>GCA	p.G815A	AOX1_uc010zhf.1_Missense_Mutation_p.G371A|AOX1_uc010fsu.2_Missense_Mutation_p.G181A	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	815					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TTAAAAACCGGAATCATTGCA	0.458													17	66	---	---	---	---	PASS
ALS2CR11	151254	broad.mit.edu	37	2	202400915	202400915	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202400915C>G	uc002uye.2	-	13	1383	c.1335G>C	c.(1333-1335)TTG>TTC	p.L445F	ALS2CR11_uc002uyf.2_Missense_Mutation_p.L445F|ALS2CR11_uc010fti.2_Intron	NM_152525	NP_689738	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	445										large_intestine(1)|ovary(1)|skin(1)	3						AAATAGTGCACAATGAGTGCA	0.383													52	260	---	---	---	---	PASS
C2orf67	151050	broad.mit.edu	37	2	210888922	210888922	+	Silent	SNP	A	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210888922A>C	uc002vds.2	-	14	2776	c.2568T>G	c.(2566-2568)GCT>GCG	p.A856A	C2orf67_uc002vdt.2_Silent_p.A814A	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050	856										ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		TTTTACTGTAAGCTCTAGCAA	0.373													16	85	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211473090	211473090	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211473090C>T	uc002vee.3	+	19	2330	c.2198C>T	c.(2197-2199)CCA>CTA	p.P733L	CPS1_uc010fur.2_Missense_Mutation_p.P739L|CPS1_uc010fus.2_Missense_Mutation_p.P282L	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	733	ATP-grasp 1.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		TATAGCTACCCATTGGCATTC	0.358													18	172	---	---	---	---	PASS
VIL1	7429	broad.mit.edu	37	2	219297587	219297587	+	Silent	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219297587T>C	uc002via.2	+	13	1478	c.1413T>C	c.(1411-1413)AAT>AAC	p.N471N	VIL1_uc010zke.1_Silent_p.N160N|VIL1_uc002vib.2_Silent_p.N471N	NM_007127	NP_009058	P09327	VILI_HUMAN	villin 1	471	Core.				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGAAGTACAATGGTGAACCAG	0.557													17	52	---	---	---	---	PASS
CCL20	6364	broad.mit.edu	37	2	228681066	228681066	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228681066C>A	uc002vpl.2	+	3	305	c.235C>A	c.(235-237)CAG>AAG	p.Q79K	CCL20_uc002vpm.2_Missense_Mutation_p.Q78K	NM_004591	NP_004582	P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20 isoform 1	79					cell-cell signaling|chemotaxis|defense response to bacterium|immune response|inflammatory response|signal transduction	extracellular space	chemokine activity				0		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		AAATCCAAAACAGACTTGGGT	0.383													17	104	---	---	---	---	PASS
DNER	92737	broad.mit.edu	37	2	230453205	230453205	+	Splice_Site	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230453205C>A	uc002vpv.2	-	3	733	c.586_splice	c.e3-1	p.V196_splice	DNER_uc010zly.1_5'Flank	NM_139072	NP_620711	Q8NFT8	DNER_HUMAN	delta-notch-like EGF repeat-containing						central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			lung(5)|ovary(2)|skin(1)	8		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		CTGGGATCACCTGGGAAGGGA	0.433													9	41	---	---	---	---	PASS
SH3BP4	23677	broad.mit.edu	37	2	235950606	235950606	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235950606C>G	uc002vvp.2	+	4	1586	c.1193C>G	c.(1192-1194)TCA>TGA	p.S398*	SH3BP4_uc010fym.2_Nonsense_Mutation_p.S398*|SH3BP4_uc002vvq.2_Nonsense_Mutation_p.S398*	NM_014521	NP_055336	Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	398					endocytosis	clathrin-coated vesicle|coated pit|nucleus	protein binding			skin(3)|ovary(1)	4		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		ATGAAAGTGTCAGCCGAGATA	0.527													6	71	---	---	---	---	PASS
RNPEPL1	57140	broad.mit.edu	37	2	241515974	241515974	+	Silent	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241515974C>G	uc002vzi.2	+	9	1433	c.840C>G	c.(838-840)CTC>CTG	p.L280L	RNPEPL1_uc010fzf.2_Silent_p.L186L|RNPEPL1_uc002vzj.2_Intron	NM_018226	NP_060696	Q9HAU8	RNPL1_HUMAN	arginyl aminopeptidase (aminopeptidase B)-like	280					leukotriene biosynthetic process|proteolysis		aminopeptidase activity|metallopeptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2		all_epithelial(40;1.13e-11)|Breast(86;0.000169)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.204)|Melanoma(123;0.238)		Epithelial(32;3.05e-31)|all cancers(36;8.2e-29)|OV - Ovarian serous cystadenocarcinoma(60;8.55e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.12e-06)|Lung(119;0.00168)|Colorectal(34;0.005)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.0322)		AGCGCTGGCTCAATGCCACAG	0.667													6	25	---	---	---	---	PASS
SYN2	6854	broad.mit.edu	37	3	12198881	12198881	+	Intron	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12198881G>C	uc003bwm.2	+						SYN2_uc003bwl.1_Intron|SYN2_uc003bwn.2_Intron|TIMP4_uc003bwo.2_Intron	NM_133625	NP_598328	Q92777	SYN2_HUMAN	synapsin II isoform IIa						neurotransmitter secretion	synaptic vesicle	ATP binding|ligase activity			ovary(1)|central_nervous_system(1)	2						CTGCCCCCATGTACCTTTATC	0.522													4	37	---	---	---	---	PASS
TGM4	7047	broad.mit.edu	37	3	44943025	44943025	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44943025G>C	uc003coc.3	+	7	740	c.667G>C	c.(667-669)GAG>CAG	p.E223Q	TGM4_uc003cob.2_RNA	NM_003241	NP_003232	P49221	TGM4_HUMAN	transglutaminase 4 (prostate)	223					peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	GATGAGCTTTGAGAAAGGCCA	0.607													4	11	---	---	---	---	PASS
CACNA2D2	9254	broad.mit.edu	37	3	50404011	50404011	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50404011C>G	uc003daq.2	-	31	2694	c.2656G>C	c.(2656-2658)GAG>CAG	p.E886Q	CACNA2D2_uc003dap.2_Missense_Mutation_p.E879Q|CACNA2D2_uc003dao.2_5'Flank	NM_006030	NP_006021	Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha	886	Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)	ACACACACCTCATTGTTAACC	0.597													10	47	---	---	---	---	PASS
DNAH1	25981	broad.mit.edu	37	3	52398929	52398929	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52398929C>T	uc011bef.1	+	34	5673	c.5412C>T	c.(5410-5412)ATC>ATT	p.I1804I		NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1804					ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TCTCTGGCATCGTGTCCGACC	0.607													26	87	---	---	---	---	PASS
ITIH4	3700	broad.mit.edu	37	3	52851038	52851038	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52851038G>A	uc003dfz.2	-	21	2369	c.2333C>T	c.(2332-2334)GCT>GTT	p.A778V	ITIH4_uc011bel.1_Missense_Mutation_p.A492V|ITIH4_uc003dfy.2_Missense_Mutation_p.A573V|ITIH4_uc011bem.1_Missense_Mutation_p.A783V|ITIH4_uc011ben.1_Missense_Mutation_p.A748V	NM_002218	NP_002209	Q14624	ITIH4_HUMAN	inter-alpha (globulin) inhibitor H4	778					acute-phase response|hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		TGAGAACCCAGCCTTCTCCCT	0.592													32	131	---	---	---	---	PASS
CACNA2D3	55799	broad.mit.edu	37	3	54930847	54930847	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54930847C>T	uc003dhf.2	+	26	2366	c.2318C>T	c.(2317-2319)GCC>GTC	p.A773V	CACNA2D3_uc003dhg.1_Missense_Mutation_p.A679V|CACNA2D3_uc003dhh.1_RNA|uc003dhk.1_RNA	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	773	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		TACCGAAGAGCCGCTGAGCAG	0.527													5	154	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62501727	62501727	+	Intron	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62501727G>T	uc003dll.2	-						CADPS_uc003dlk.1_Intron|CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GCAGAAGGGAGCCTTACCTTC	0.458													16	95	---	---	---	---	PASS
ROBO1	6091	broad.mit.edu	37	3	78683154	78683154	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78683154A>G	uc003dqe.2	-	24	3620	c.3412T>C	c.(3412-3414)TAC>CAC	p.Y1138H	ROBO1_uc003dqb.2_Missense_Mutation_p.Y1099H|ROBO1_uc003dqc.2_Missense_Mutation_p.Y1038H|ROBO1_uc003dqd.2_Missense_Mutation_p.Y1093H|ROBO1_uc010hoh.2_Missense_Mutation_p.Y330H|ROBO1_uc011bgl.1_Missense_Mutation_p.Y710H	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	1138	Cytoplasmic (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GATTGGTTGTATGGGATAGTT	0.398													17	84	---	---	---	---	PASS
KIAA2018	205717	broad.mit.edu	37	3	113375001	113375001	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113375001T>C	uc003eam.2	-	7	5939	c.5528A>G	c.(5527-5529)CAG>CGG	p.Q1843R	KIAA2018_uc003eal.2_Missense_Mutation_p.Q1787R	NM_001009899	NP_001009899	Q68DE3	K2018_HUMAN	hypothetical protein LOC205717	1843					regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3						TGTATTCCTCTGATGTTCTGA	0.443													19	209	---	---	---	---	PASS
ZNF148	7707	broad.mit.edu	37	3	124951424	124951424	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124951424C>G	uc003ehx.3	-	9	2632	c.2146G>C	c.(2146-2148)GAG>CAG	p.E716Q	SLC12A8_uc003ehw.3_Intron|ZNF148_uc003ehz.3_Missense_Mutation_p.E716Q|ZNF148_uc010hsa.2_Missense_Mutation_p.E716Q|ZNF148_uc003eia.3_Missense_Mutation_p.E716Q|ZNF148_uc003ehy.2_Missense_Mutation_p.E53Q	NM_021964	NP_068799	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	716					cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4						GGCTGGGCCTCAGCTTTCTTC	0.473													21	182	---	---	---	---	PASS
TPRA1	131601	broad.mit.edu	37	3	127295676	127295676	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127295676C>A	uc003ejl.2	-	4	697	c.406G>T	c.(406-408)GGC>TGC	p.G136C	TPRA1_uc003ejm.2_RNA|TPRA1_uc003ejo.2_Missense_Mutation_p.G136C|TPRA1_uc010hsk.2_Missense_Mutation_p.G136C|TPRA1_uc003ejn.2_Missense_Mutation_p.G136C	NM_016372	NP_057456	Q86W33	TPRA1_HUMAN	G protein-coupled receptor 175 isoform 1	136	Helical; Name=3; (Potential).				aging|lipid metabolic process	integral to membrane	G-protein coupled receptor activity				0						AAGGCCAGGCCCAGGATGATC	0.642													9	59	---	---	---	---	PASS
CCRL1	51554	broad.mit.edu	37	3	132320083	132320083	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132320083T>C	uc003eow.2	+	2	925	c.842T>C	c.(841-843)ATG>ACG	p.M281T	ACAD11_uc003eov.3_Intron|ACAD11_uc011blr.1_Intron|CCRL1_uc003eox.2_Missense_Mutation_p.M281T	NM_016557	NP_057641	Q9NPB9	CCRL1_HUMAN	chemokine (C-C motif) receptor-like 1	281	Extracellular (Potential).				chemotaxis|immune response	integral to plasma membrane	C-C chemokine receptor activity				0						AGCAAACGCATGGACATCGCC	0.443													19	207	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134670815	134670815	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134670815G>A	uc003eqt.2	+	3	946	c.726G>A	c.(724-726)GGG>GGA	p.G242G	EPHB1_uc010htz.1_RNA|EPHB1_uc011bly.1_Intron	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	242	Extracellular (Potential).|Cys-rich.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						ACTGCAACGGGGATGGGGAAT	0.572													45	283	---	---	---	---	PASS
PLS1	5357	broad.mit.edu	37	3	142408474	142408474	+	Silent	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142408474G>C	uc010huv.2	+	10	1155	c.996G>C	c.(994-996)CTG>CTC	p.L332L	PLS1_uc003euz.2_Silent_p.L332L|PLS1_uc003eva.2_Silent_p.L332L	NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1	332	Actin-binding 1.|CH 2.					cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1						CAAATGACCTGAAGCGTGCTG	0.338													8	117	---	---	---	---	PASS
SELT	51714	broad.mit.edu	37	3	150344895	150344895	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150344895G>C	uc011bnx.1	+	6	646	c.562G>C	c.(562-564)GAT>CAT	p.D188H		NM_016275	NP_057359	P62341	SELT_HUMAN	selenoprotein T precursor	188					cell redox homeostasis|selenocysteine incorporation		selenium binding				0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TGTGCATATGGATTCAATCCC	0.383													38	186	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164905811	164905811	+	Silent	SNP	G	T	T	rs150831053	byFrequency	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164905811G>T	uc003fej.3	-	2	3252	c.2808C>A	c.(2806-2808)CTC>CTA	p.L936L	SLITRK3_uc003fek.2_Silent_p.L936L	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	936	Cytoplasmic (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						CAGCCGAGAAGAGAAGGGTTT	0.498										HNSCC(40;0.11)			42	286	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164907492	164907492	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164907492C>T	uc003fej.3	-	2	1571	c.1127G>A	c.(1126-1128)GGG>GAG	p.G376E	SLITRK3_uc003fek.2_Missense_Mutation_p.G376E	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	376	LRRNT.|Extracellular (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						ACAGGTACACCCAGTGGGGCA	0.478										HNSCC(40;0.11)			45	261	---	---	---	---	PASS
WDR49	151790	broad.mit.edu	37	3	167245649	167245649	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167245649C>A	uc003fev.1	-	11	1813	c.1507G>T	c.(1507-1509)GTG>TTG	p.V503L	WDR49_uc003feu.1_Missense_Mutation_p.V328L|WDR49_uc011bpd.1_Intron|WDR49_uc003few.1_Intron	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN	WD repeat domain 49	503	WD 8.									large_intestine(1)|ovary(1)|skin(1)	3						ACACCAGTCACACAAATACTG	0.403													13	77	---	---	---	---	PASS
LEPREL1	55214	broad.mit.edu	37	3	189712013	189712013	+	Missense_Mutation	SNP	C	A	A	rs138997029		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189712013C>A	uc011bsk.1	-	3	1081	c.693G>T	c.(691-693)AGG>AGT	p.R231S	LEPREL1_uc003fsg.2_Missense_Mutation_p.R50S	NM_018192	NP_060662	Q8IVL5	P3H2_HUMAN	leprecan-like 1 isoform a	231	TPR 3.				collagen metabolic process|negative regulation of cell proliferation|peptidyl-proline hydroxylation	basement membrane|endoplasmic reticulum|Golgi apparatus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			breast(3)|ovary(1)	4	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GTTCGAAGTGCCTGATAGCCA	0.378													23	103	---	---	---	---	PASS
ATP13A3	79572	broad.mit.edu	37	3	194177845	194177845	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194177845T>C	uc003fty.3	-	6	940	c.538A>G	c.(538-540)ACA>GCA	p.T180A		NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3	180					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		ATCCCCTTTGTCAGTCCTGCA	0.328													23	117	---	---	---	---	PASS
BDH1	622	broad.mit.edu	37	3	197238966	197238966	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197238966C>T	uc003fxr.2	-	8	1234	c.832G>A	c.(832-834)GAT>AAT	p.D278N	BDH1_uc003fxs.2_Missense_Mutation_p.D278N|BDH1_uc003fxt.2_Missense_Mutation_p.D191N|BDH1_uc003fxu.2_Missense_Mutation_p.D278N	NM_203314	NP_976059	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1	278					cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity			ovary(1)	1	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	NADH(DB00157)	ATCTTTTCATCAAAGTACTTC	0.577													14	134	---	---	---	---	PASS
KIAA0226	9711	broad.mit.edu	37	3	197428728	197428728	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197428728C>G	uc003fyc.2	-	6	761	c.578G>C	c.(577-579)AGA>ACA	p.R193T	KIAA0226_uc003fyd.3_Missense_Mutation_p.R133T|KIAA0226_uc003fye.1_5'UTR|KIAA0226_uc003fyf.2_Missense_Mutation_p.R26T|KIAA0226_uc003fyg.2_Missense_Mutation_p.R186T	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.	193					autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		CTCGTGCTTTCTGGCAAACTA	0.502													6	58	---	---	---	---	PASS
SLC2A9	56606	broad.mit.edu	37	4	9836629	9836629	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9836629C>T	uc003gmc.2	-	11	1356	c.1295G>A	c.(1294-1296)GGC>GAC	p.G432D	SLC2A9_uc003gmd.2_Missense_Mutation_p.G403D	NM_020041	NP_064425	Q9NRM0	GTR9_HUMAN	solute carrier family 2, member 9 protein	432	Helical; Name=10; (Potential).				glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3						GAACGGGATGCCACCTGCAGT	0.542													3	56	---	---	---	---	PASS
ZNF518B	85460	broad.mit.edu	37	4	10447079	10447079	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10447079G>T	uc003gmn.2	-	3	1361	c.874C>A	c.(874-876)CCA>ACA	p.P292T		NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	292					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4						ATTTTATTTGGAATACAAACT	0.373													53	282	---	---	---	---	PASS
SLIT2	9353	broad.mit.edu	37	4	20619273	20619273	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20619273G>T	uc003gpr.1	+	36	4552	c.4348G>T	c.(4348-4350)GAA>TAA	p.E1450*	SLIT2_uc003gps.1_Nonsense_Mutation_p.E1442*	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	1450					apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						CTGTGATCGAGGTAAGCCAGC	0.468													5	20	---	---	---	---	PASS
SLIT2	9353	broad.mit.edu	37	4	20619274	20619274	+	Splice_Site	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20619274G>T	uc003gpr.1	+	36	4552	c.4348_splice	c.e36+1	p.E1450_splice	SLIT2_uc003gps.1_Splice_Site_p.E1442_splice	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						TGTGATCGAGGTAAGCCAGCC	0.463													5	20	---	---	---	---	PASS
KLB	152831	broad.mit.edu	37	4	39436170	39436170	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39436170G>C	uc003gua.2	+	2	1263	c.1166G>C	c.(1165-1167)GGA>GCA	p.G389A	KLB_uc011byj.1_Missense_Mutation_p.G389A	NM_175737	NP_783864	Q86Z14	KLOTB_HUMAN	klotho beta	389	Extracellular (Potential).|Glycosyl hydrolase-1 1.				carbohydrate metabolic process	integral to membrane|plasma membrane	cation binding|fibroblast growth factor binding|hydrolase activity, hydrolyzing O-glycosyl compounds			skin(1)	1						GCTAAAATGGGACAAAATGTT	0.423													34	148	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48575205	48575205	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48575205C>G	uc003gyh.1	-	26	3507	c.2902G>C	c.(2902-2904)GAG>CAG	p.E968Q	FRYL_uc003gyk.2_Missense_Mutation_p.E968Q	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	968					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						CAGCTCACCTCTGGCCTTCTT	0.343													5	95	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56846395	56846395	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56846395A>T	uc003hbi.2	+	12	1794	c.1560A>T	c.(1558-1560)GAA>GAT	p.E520D	CEP135_uc003hbj.2_Missense_Mutation_p.E226D	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	520	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					AATATATGGAAGATATACAGT	0.284													35	104	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57180260	57180260	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57180260G>C	uc003hbk.2	+	8	983	c.592G>C	c.(592-594)GGA>CGA	p.G198R	KIAA1211_uc010iha.2_Missense_Mutation_p.G191R|KIAA1211_uc011bzz.1_Missense_Mutation_p.G108R|KIAA1211_uc003hbm.1_Missense_Mutation_p.G84R	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	198										ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					GGACCAGAACGGACACCCAGG	0.542													8	47	---	---	---	---	PASS
AGPAT9	84803	broad.mit.edu	37	4	84519333	84519333	+	Splice_Site	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84519333G>C	uc003how.2	+	11	1343	c.1125_splice	c.e11+1	p.E375_splice	AGPAT9_uc003hox.2_Splice_Site_p.E375_splice|AGPAT9_uc003hoy.2_Splice_Site_p.E375_splice	NM_032717	NP_116106	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9						phospholipid biosynthetic process|regulation of TOR signaling cascade|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	glycerol-3-phosphate O-acyltransferase activity			skin(1)	1		Hepatocellular(203;0.114)				GACCAGAGAGGTATTCCTTAG	0.473													16	84	---	---	---	---	PASS
NPY1R	4886	broad.mit.edu	37	4	164247564	164247564	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164247564C>A	uc003iqm.1	-	2	409	c.143G>T	c.(142-144)GGA>GTA	p.G48V	NPY1R_uc011cjj.1_Intron	NM_000909	NP_000900	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	48	Helical; Name=1; (Potential).				inhibition of adenylate cyclase activity by G-protein signaling pathway|outflow tract morphogenesis	integral to plasma membrane	protein binding			lung(1)|pancreas(1)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GATCACAGCTCCATAAGCAAG	0.408													28	118	---	---	---	---	PASS
CCDC110	256309	broad.mit.edu	37	4	186379310	186379310	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186379310G>C	uc003ixu.3	-	6	2507	c.2431C>G	c.(2431-2433)CAG>GAG	p.Q811E	CCDC110_uc003ixv.3_Missense_Mutation_p.Q774E|CCDC110_uc011ckt.1_Missense_Mutation_p.Q811E	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a	811						nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		GGCCTACTCTGAGGACTAGAA	0.373													15	73	---	---	---	---	PASS
CCDC110	256309	broad.mit.edu	37	4	186380438	186380438	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186380438G>T	uc003ixu.3	-	6	1379	c.1303C>A	c.(1303-1305)CTA>ATA	p.L435I	CCDC110_uc003ixv.3_Missense_Mutation_p.L398I|CCDC110_uc011ckt.1_Missense_Mutation_p.L435I	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a	435	Potential.					nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		GATTCTTTTAGGTAATTCTGT	0.323													38	220	---	---	---	---	PASS
FRG1	2483	broad.mit.edu	37	4	190878666	190878666	+	Intron	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190878666G>A	uc003izs.2	+							NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1						rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AGGTAATGATGACATTTTATA	0.343													3	49	---	---	---	---	PASS
CMBL	134147	broad.mit.edu	37	5	10286599	10286599	+	Silent	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10286599A>G	uc003jes.2	-	4	784	c.333T>C	c.(331-333)AGT>AGC	p.S111S		NM_138809	NP_620164	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase	111						cytosol	hydrolase activity|protein binding			skin(1)	1						TCAAGATAGCACTGATCTCTC	0.413													13	73	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10417441	10417441	+	Silent	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10417441G>C	uc003jet.1	+	22	2391	c.2208G>C	c.(2206-2208)GGG>GGC	p.G736G	MARCH6_uc011cmu.1_Silent_p.G688G|MARCH6_uc003jeu.1_Silent_p.G434G|MARCH6_uc011cmv.1_Silent_p.G631G	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	736	Helical; (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						TCCTTCTGGGGCTCCTGTTTG	0.468													11	444	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13766220	13766220	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13766220G>C	uc003jfd.2	-	59	10008	c.9966C>G	c.(9964-9966)ATC>ATG	p.I3322M	DNAH5_uc003jfc.2_Translation_Start_Site	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3322	Stalk (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CGCAATCCATGATCCGCATGA	0.527									Kartagener_syndrome				76	172	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13871115	13871115	+	Intron	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13871115T>C	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AAGTCAGCTGTAAAAACCCAA	0.403									Kartagener_syndrome				23	136	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13922215	13922215	+	Splice_Site	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13922215C>T	uc003jfd.2	-	5	702	c.660_splice	c.e5+1	p.K220_splice	DNAH5_uc003jfe.1_Splice_Site	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TTCGTCCTCACCTTCTCCTTC	0.478									Kartagener_syndrome				8	81	---	---	---	---	PASS
C5orf22	55322	broad.mit.edu	37	5	31534424	31534424	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31534424G>A	uc003jhj.3	+	2	254	c.127G>A	c.(127-129)GCC>ACC	p.A43T	RNASEN_uc003jhh.2_5'Flank|RNASEN_uc003jhg.2_5'Flank|RNASEN_uc003jhi.2_5'Flank|C5orf22_uc011cnw.1_RNA|C5orf22_uc003jhk.3_5'UTR	NM_018356	NP_060826	Q49AR2	CE022_HUMAN	hypothetical protein LOC55322	43										ovary(2)	2						GCATCTTCCTGCCAGTAATGT	0.423													14	224	---	---	---	---	PASS
RXFP3	51289	broad.mit.edu	37	5	33938115	33938115	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33938115C>A	uc003jic.1	+	1	1627	c.1270C>A	c.(1270-1272)CCG>ACG	p.P424T		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	424	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1						CACTACCAAGCCGGAGCACGA	0.567													10	24	---	---	---	---	PASS
PRLR	5618	broad.mit.edu	37	5	35084623	35084623	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35084623G>T	uc003jjm.2	-	5	852	c.322C>A	c.(322-324)CAG>AAG	p.Q108K	PRLR_uc003jjg.1_Missense_Mutation_p.Q108K|PRLR_uc003jjh.1_Missense_Mutation_p.Q108K|PRLR_uc003jji.1_Missense_Mutation_p.Q37K|PRLR_uc003jjj.1_Missense_Mutation_p.Q108K|PRLR_uc003jjk.1_Missense_Mutation_p.Q37K|PRLR_uc003jjl.3_Intron|PRLR_uc010iuw.1_Missense_Mutation_p.Q37K	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor	108	Fibronectin type-III 1.|Extracellular (Potential).				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CTTCCCATCTGGTTAGTGGCA	0.468													163	345	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41155154	41155154	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41155154G>T	uc003jmk.2	-	14	2231	c.2021C>A	c.(2020-2022)ACT>AAT	p.T674N	C6_uc003jml.1_Missense_Mutation_p.T674N	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	674	Sushi 1.|C5b-binding domain.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TTCAAAGCCAGTAAGGCATGA	0.398													24	174	---	---	---	---	PASS
PLCXD3	345557	broad.mit.edu	37	5	41382263	41382263	+	Silent	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41382263G>C	uc003jmm.1	-	2	579	c.477C>G	c.(475-477)GTC>GTG	p.V159V		NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X	159	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						TCAGCATTTGGACCAGTTTTT	0.418													45	348	---	---	---	---	PASS
GHR	2690	broad.mit.edu	37	5	42718770	42718770	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42718770C>T	uc003jmt.2	+	10	1204	c.1161C>T	c.(1159-1161)ACC>ACT	p.T387T	GHR_uc011cpq.1_Silent_p.T200T	NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor	387	Cytoplasmic (Potential).				2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CTGGACGTACCAGCTGTTGTG	0.468													45	246	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45462025	45462025	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45462025C>T	uc003jok.2	-	3	959	c.934G>A	c.(934-936)GAT>AAT	p.D312N		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	312	Helical; Name=Segment S5; (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						AGACAACCATCCCAGTGGCAC	0.413													5	84	---	---	---	---	PASS
SKIV2L2	23517	broad.mit.edu	37	5	54706356	54706356	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54706356G>C	uc003jpy.3	+	23	2916	c.2650G>C	c.(2650-2652)GAT>CAT	p.D884H	SKIV2L2_uc011cqi.1_Missense_Mutation_p.D783H	NM_015360	NP_056175	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2	884					maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(1)|skin(1)	2		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TTGTAGTGCTGATGAGCTCCT	0.343													32	131	---	---	---	---	PASS
RAB3C	115827	broad.mit.edu	37	5	57913583	57913583	+	Silent	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57913583T>C	uc003jrp.2	+	2	235	c.138T>C	c.(136-138)TTT>TTC	p.F46F		NM_138453	NP_612462	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family	46					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			ovary(1)|central_nervous_system(1)	2		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		AAACATCTTTTCTATTCCGTT	0.393													23	65	---	---	---	---	PASS
WDR41	55255	broad.mit.edu	37	5	76732210	76732210	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76732210T>C	uc003kff.1	-	12	1390	c.1103A>G	c.(1102-1104)AAC>AGC	p.N368S	WDR41_uc011csy.1_Missense_Mutation_p.N310S|WDR41_uc011csz.1_Missense_Mutation_p.N313S	NM_018268	NP_060738	Q9HAD4	WDR41_HUMAN	WD repeat domain 41	368											0		all_lung(232;0.000961)|Lung NSC(167;0.0011)|Ovarian(174;0.0105)|Prostate(461;0.059)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-50)|Epithelial(54;2.04e-44)|all cancers(79;6.84e-40)		TCCCCACATGTTAAAAAAACC	0.353													15	98	---	---	---	---	PASS
SLCO6A1	133482	broad.mit.edu	37	5	101816026	101816026	+	Silent	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101816026C>A	uc003knn.2	-	2	643	c.471G>T	c.(469-471)CTG>CTT	p.L157L	SLCO6A1_uc003kno.2_Silent_p.L157L|SLCO6A1_uc003knp.2_Silent_p.L157L|SLCO6A1_uc003knq.2_Silent_p.L157L	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	157	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		ATATTGCTACCAGGCCAGATG	0.353													23	129	---	---	---	---	PASS
FTMT	94033	broad.mit.edu	37	5	121187661	121187661	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121187661G>A	uc003kss.2	+	1	12	c.3G>A	c.(1-3)ATG>ATA	p.M1I		NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial precursor	1					cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity			ovary(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GCGGCGCTATGCTGTCCTGCT	0.687													10	65	---	---	---	---	PASS
PCDHA1	56147	broad.mit.edu	37	5	140166707	140166707	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140166707G>A	uc003lhb.2	+	1	832	c.832G>A	c.(832-834)GTC>ATC	p.V278I	PCDHA1_uc003lha.2_Missense_Mutation_p.V278I|PCDHA1_uc003lgz.2_Missense_Mutation_p.V278I	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	278	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTGAAGTCGTCTTTTCCTT	0.388													21	144	---	---	---	---	PASS
PCDHB12	56124	broad.mit.edu	37	5	140589822	140589822	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140589822C>A	uc003liz.2	+	1	1532	c.1343C>A	c.(1342-1344)GCC>GAC	p.A448D	PCDHB12_uc011dak.1_Missense_Mutation_p.A111D	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	448	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AATGACAACGCCCCCGCCTTC	0.607													17	84	---	---	---	---	PASS
PCDHGB6	56100	broad.mit.edu	37	5	140789620	140789620	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140789620C>T	uc003lkj.1	+	1	1851	c.1851C>T	c.(1849-1851)TTC>TTT	p.F617F	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lki.1_Silent_p.F617F	NM_018926	NP_061749	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6 isoform 1	617	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGGACTCTTCAGCCTGGGGC	0.687													5	26	---	---	---	---	PASS
PCDHGB6	56100	broad.mit.edu	37	5	140789936	140789936	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140789936A>G	uc003lkj.1	+	1	2167	c.2167A>G	c.(2167-2169)ACT>GCT	p.T723A	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lki.1_Missense_Mutation_p.T723A|PCDHGA10_uc011day.1_5'Flank|PCDHGA10_uc003lkl.1_5'Flank	NM_018926	NP_061749	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6 isoform 1	723	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCCCTGCTACTTGGGACTG	0.537													24	151	---	---	---	---	PASS
WWC1	23286	broad.mit.edu	37	5	167855776	167855776	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167855776A>G	uc003lzu.2	+	13	2077	c.1984A>G	c.(1984-1986)ATT>GTT	p.I662V	WWC1_uc003lzv.2_Missense_Mutation_p.I662V|WWC1_uc011den.1_Missense_Mutation_p.I662V|WWC1_uc003lzw.2_Missense_Mutation_p.I461V|WWC1_uc010jjf.1_5'Flank	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3	662	C2.				cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		TGCGACCCGAATTCAGATTGC	0.547													13	48	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168119667	168119667	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168119667C>G	uc003mab.2	-	29	3541	c.3121G>C	c.(3121-3123)GAG>CAG	p.E1041Q	SLIT3_uc010jjg.2_Missense_Mutation_p.E1048Q	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	1041	EGF-like 4.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGTTCAGCTCAGGCACACAG	0.577													11	105	---	---	---	---	PASS
BTNL8	79908	broad.mit.edu	37	5	180377429	180377429	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180377429C>A	uc003mmp.2	+	8	1622	c.1388C>A	c.(1387-1389)ACC>AAC	p.T463N	BTNL8_uc003mmq.2_3'UTR|BTNL8_uc011dhg.1_Missense_Mutation_p.T338N|BTNL8_uc010jll.2_3'UTR|BTNL8_uc010jlm.2_Missense_Mutation_p.T347N|BTNL8_uc011dhh.1_Missense_Mutation_p.T279N	NM_001040462	NP_001035552	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8 isoform 2 precursor	463	B30.2/SPRY.|Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|skin(1)	2	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGCCCAGTCACCCAGGAATCA	0.517													47	242	---	---	---	---	PASS
FOXC1	2296	broad.mit.edu	37	6	1612301	1612301	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1612301C>T	uc003mtp.2	+	1	1621	c.1621C>T	c.(1621-1623)CGC>TGC	p.R541C		NM_001453	NP_001444	Q12948	FOXC1_HUMAN	forkhead box C1	541					anti-apoptosis|artery morphogenesis|blood vessel remodeling|brain development|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|germ cell migration|glycosaminoglycan metabolic process|lacrimal gland development|lymphangiogenesis|metanephros development|negative regulation of mitotic cell cycle|neural crest cell fate commitment|Notch signaling pathway|odontogenesis of dentine-containing tooth|ossification|ovarian follicle development|paraxial mesodermal cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|regulation of blood vessel size|regulation of organ growth|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|ureteric bud development|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	nuclear heterochromatin|transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		GTCTCTGTACCGCACGTCCGG	0.512													13	62	---	---	---	---	PASS
PHACTR1	221692	broad.mit.edu	37	6	12934015	12934015	+	Intron	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12934015C>G	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron|PHACTR1_uc003nai.2_Nonsense_Mutation_p.S134*	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			CACATCTGCTCAGGCCCCAGT	0.552													9	76	---	---	---	---	PASS
TBC1D7	51256	broad.mit.edu	37	6	13327088	13327088	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13327088C>T	uc003naj.2	-	2	134	c.43G>A	c.(43-45)GAG>AAG	p.E15K	TBC1D7_uc011dis.1_RNA|TBC1D7_uc003nan.2_Missense_Mutation_p.E15K|TBC1D7_uc003nal.2_Missense_Mutation_p.E15K|TBC1D7_uc003nam.2_Missense_Mutation_p.E15K|TBC1D7_uc003nao.2_Missense_Mutation_p.E15K|TBC1D7_uc010jpd.2_Missense_Mutation_p.E15K|TBC1D7_uc003nap.2_Missense_Mutation_p.E15K|TBC1D7_uc003naq.2_Missense_Mutation_p.E15K	NM_016495	NP_057579	Q9P0N9	TBCD7_HUMAN	TBC1 domain family, member 7 isoform a	15					positive regulation of protein ubiquitination	cytoplasmic membrane-bounded vesicle	protein binding|Rab GTPase activator activity			ovary(1)	1	Breast(50;0.0296)|Ovarian(93;0.0339)	all_hematologic(90;0.135)	Epithelial(50;0.0784)|BRCA - Breast invasive adenocarcinoma(129;0.13)|all cancers(50;0.21)			CCCACTTTCTCATAATATACT	0.378													13	130	---	---	---	---	PASS
HIST1H2BG	8339	broad.mit.edu	37	6	26216643	26216643	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26216643C>G	uc003ngz.2	-	1	230	c.229G>C	c.(229-231)GAG>CAG	p.E77Q	HIST1H2AE_uc003nha.1_5'Flank	NM_003518	NP_003509	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	77					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			ovary(1)	1		all_hematologic(11;0.196)				CGGGAAGCCTCGCCTGCGATG	0.572													39	184	---	---	---	---	PASS
FLOT1	10211	broad.mit.edu	37	6	30707977	30707977	+	Silent	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30707977G>C	uc003nrm.2	-	8	845	c.681C>G	c.(679-681)GTC>GTG	p.V227V	FLOT1_uc011dmr.1_Silent_p.V179V	NM_005803	NP_005794	O75955	FLOT1_HUMAN	flotillin 1	227						centriolar satellite|endosome|integral to membrane|melanosome|membrane fraction					0						GGCGGGTGTTGACCTCGATGT	0.572													18	52	---	---	---	---	PASS
HLA-C	3107	broad.mit.edu	37	6	31237800	31237800	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31237800C>A	uc003nsy.2	-	5	965	c.958G>T	c.(958-960)GTC>TTC	p.V320F	HLA-C_uc011dnj.1_Missense_Mutation_p.V292F|HLA-C_uc003nsx.2_Missense_Mutation_p.V199F|HLA-C_uc003nsz.2_Missense_Mutation_p.V320F|HLA-C_uc010jsl.2_Missense_Mutation_p.V320F|HLA-C_uc003nta.2_Missense_Mutation_p.V320F|HLA-C_uc003ntb.2_RNA|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron|HLA-C_uc011dnl.1_Missense_Mutation_p.V199F	NM_002117	NP_002108	Q9TNN7	1C05_HUMAN	major histocompatibility complex, class I, C	320	Helical; (Potential).				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex					0						ACAGCTAGGACAACCAGGACA	0.597													10	39	---	---	---	---	PASS
LY6G5B	58496	broad.mit.edu	37	6	31639832	31639832	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31639832C>T	uc003nvt.1	+	3	379	c.379C>T	c.(379-381)CCT>TCT	p.P127S	CSNK2B_uc003nvs.1_3'UTR	NM_021221	NP_067044	Q8NDX9	LY65B_HUMAN	lymphocyte antigen 6 complex G5B precursor	127						extracellular region					0						CCTGGCCCTGCCTCTGTCTGA	0.612													22	64	---	---	---	---	PASS
UHRF1BP1	54887	broad.mit.edu	37	6	34804081	34804081	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34804081G>T	uc003oju.3	+	8	1223	c.989G>T	c.(988-990)CGC>CTC	p.R330L	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	330										ovary(3)	3						CTCATCTCCCGCCTGGACCTG	0.582													44	179	---	---	---	---	PASS
C6orf127	340204	broad.mit.edu	37	6	35755727	35755727	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35755727C>G	uc003old.3	+	3	363	c.306C>G	c.(304-306)ATC>ATG	p.I102M		NM_001010886	NP_001010886	A2RUU4	CF127_HUMAN	hypothetical protein LOC340204 precursor	102					digestion|lipid catabolic process	extracellular region	enzyme activator activity			skin(1)	1						GGCTTAGCATCGCCTATGGCC	0.483													13	122	---	---	---	---	PASS
SLC26A8	116369	broad.mit.edu	37	6	35945136	35945136	+	Intron	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35945136A>G	uc003olm.2	-						SLC26A8_uc003oln.2_Intron|SLC26A8_uc003oll.2_Intron	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a						cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						AAGCTGGAATAGAATAGTGGA	0.393													10	83	---	---	---	---	PASS
PGK2	5232	broad.mit.edu	37	6	49754754	49754754	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49754754G>T	uc003ozu.2	-	1	254	c.147C>A	c.(145-147)TAC>TAA	p.Y49*		NM_138733	NP_620061	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	49					glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			ovary(1)	1	Lung NSC(77;0.0402)					TGTCCAGGCAGTACTTGATGC	0.473													25	185	---	---	---	---	PASS
DEFB112	245915	broad.mit.edu	37	6	50011472	50011472	+	Nonsense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50011472G>C	uc011dws.1	-	2	158	c.158C>G	c.(157-159)TCA>TGA	p.S53*		NM_001037498	NP_001032587	Q30KQ8	DB112_HUMAN	beta-defensin 112 precursor	53					defense response to bacterium	extracellular region				central_nervous_system(1)	1	Lung NSC(77;0.042)					CGCTGTACATGACTTCCACCT	0.418													24	170	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51934297	51934297	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51934297T>C	uc003pah.1	-	11	1012	c.736A>G	c.(736-738)ATC>GTC	p.I246V	PKHD1_uc003pai.2_Missense_Mutation_p.I246V	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	246	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TTAGCACTGATCAGCCATGCC	0.448													19	200	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75833800	75833800	+	Silent	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75833800T>C	uc003phs.2	-	42	6901	c.6735A>G	c.(6733-6735)GGA>GGG	p.G2245G	COL12A1_uc003pht.2_Silent_p.G1081G	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	2245	Fibronectin type-III 18.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TAATTTCTTGTCCCCTTGTTC	0.383													27	114	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75875447	75875447	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75875447G>A	uc003phs.2	-	14	2925	c.2759C>T	c.(2758-2760)TCA>TTA	p.S920L	COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	920	Fibronectin type-III 6.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						AGCCCCAATTGATGTGTCAGT	0.378													21	160	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75887482	75887482	+	Silent	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75887482T>C	uc003phs.2	-	12	2500	c.2334A>G	c.(2332-2334)ACA>ACG	p.T778T	COL12A1_uc003pht.2_Intron|COL12A1_uc003phu.1_Silent_p.T436T	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	778	Fibronectin type-III 4.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						AGTTCTCCAGTGTTCTCCTCC	0.433													100	596	---	---	---	---	PASS
IMPG1	3617	broad.mit.edu	37	6	76728496	76728496	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76728496G>A	uc003pik.1	-	7	876	c.746C>T	c.(745-747)GCA>GTA	p.A249V		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	249	SEA 1.				visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				AGCGAGCTCTGCCTTGAACTT	0.493													24	136	---	---	---	---	PASS
AKD1	221264	broad.mit.edu	37	6	109819062	109819062	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109819062C>G	uc003ptn.2	-	37	5230	c.5153G>C	c.(5152-5154)CGA>CCA	p.R1718P	AKD1_uc011eas.1_Missense_Mutation_p.R103P	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1	1718					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						CTTAGGGAATCGACTCTTCAG	0.493													17	155	---	---	---	---	PASS
WASF1	8936	broad.mit.edu	37	6	110423414	110423414	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110423414G>A	uc003ptv.1	-	10	1736	c.899C>T	c.(898-900)GCT>GTT	p.A300V	WASF1_uc003ptw.1_Missense_Mutation_p.A300V|WASF1_uc003ptx.1_Missense_Mutation_p.A300V|WASF1_uc003pty.1_Missense_Mutation_p.A300V	NM_003931	NP_003922	Q92558	WASF1_HUMAN	Wiskott-Aldrich syndrome protein family member	300					actin filament polymerization|cellular component movement	actin cytoskeleton	actin binding				0		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		CAAACCTGTAGCAGAACTGAA	0.418													34	178	---	---	---	---	PASS
WISP3	8838	broad.mit.edu	37	6	112375509	112375509	+	Intron	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112375509G>C	uc003pvm.2	+						WISP3_uc003pvn.2_Intron|WISP3_uc003pvo.2_Missense_Mutation_p.M1I	NM_003880	NP_003871	O95389	WISP3_HUMAN	WNT1 inducible signaling pathway protein 3						cell-cell signaling|regulation of cell growth|signal transduction	extracellular region|soluble fraction	growth factor activity|insulin-like growth factor binding				0		all_cancers(87;0.000196)|Acute lymphoblastic leukemia(125;1.18e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0283)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0827)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)		CCGGAGCAATGAACAAGCGGC	0.592													47	255	---	---	---	---	PASS
RFX6	222546	broad.mit.edu	37	6	117198459	117198459	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117198459G>T	uc003pxm.2	+	1	84	c.21G>T	c.(19-21)CTG>CTT	p.L7L		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	7					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						TCCCGGAGCTGGAAGACACCT	0.642													3	31	---	---	---	---	PASS
RFX6	222546	broad.mit.edu	37	6	117237368	117237368	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117237368A>G	uc003pxm.2	+	9	926	c.863A>G	c.(862-864)CAG>CGG	p.Q288R		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	288					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						AACTAGATCCAGCATTTTTTA	0.323													29	204	---	---	---	---	PASS
GOPC	57120	broad.mit.edu	37	6	117896345	117896345	+	Silent	SNP	T	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117896345T>G	uc003pxu.2	-	4	875	c.645A>C	c.(643-645)GCA>GCC	p.A215A	GOPC_uc003pxq.1_5'Flank|GOPC_uc003pxv.2_Silent_p.A207A	NM_020399	NP_065132	Q9HD26	GOPC_HUMAN	golgi associated PDZ and coiled-coil motif	215					apical protein localization|cytoplasmic sequestering of CFTR protein|ER to Golgi vesicle-mediated transport|Golgi to plasma membrane transport|protein homooligomerization|protein transport	cell junction|dendrite|Golgi membrane|postsynaptic density|postsynaptic membrane|trans-Golgi network transport vesicle	cystic fibrosis transmembrane conductance regulator binding			ovary(1)	1		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)		CACACCTTCCTGCCAGTTCCT	0.353			O	ROS1	glioblastoma								27	124	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152650936	152650936	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152650936C>A	uc010kiw.2	-	78	15486	c.14884G>T	c.(14884-14886)GAT>TAT	p.D4962Y	SYNE1_uc003qot.3_Missense_Mutation_p.D4891Y|SYNE1_uc003qou.3_Missense_Mutation_p.D4962Y|SYNE1_uc010kiz.2_Missense_Mutation_p.D717Y	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4962	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGTTCTAAATCCGCAGAAATC	0.483										HNSCC(10;0.0054)			45	362	---	---	---	---	PASS
NOX3	50508	broad.mit.edu	37	6	155728352	155728352	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155728352C>T	uc003qqm.2	-	12	1595	c.1492G>A	c.(1492-1494)GAC>AAC	p.D498N		NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	498	Cytoplasmic (Potential).						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		GTAATCACGTCAGTATTTTCG	0.388													14	90	---	---	---	---	PASS
MIR1202	100302259	broad.mit.edu	37	6	156267981	156267981	+	RNA	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156267981C>A	hsa-mir-1202|MI0006334	+			c.51C>A																				0						cagggctgcccactctgctta	0.035													4	19	---	---	---	---	PASS
TULP4	56995	broad.mit.edu	37	6	158882724	158882724	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158882724G>T	uc003qrf.2	+	6	2346	c.989G>T	c.(988-990)CGT>CTT	p.R330L	TULP4_uc011efo.1_Missense_Mutation_p.R330L|TULP4_uc003qrg.2_Missense_Mutation_p.R330L	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1	330					intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		TACAATGTTCGTGGGGAGCAC	0.483													25	131	---	---	---	---	PASS
TULP4	56995	broad.mit.edu	37	6	158924188	158924188	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158924188C>T	uc003qrf.2	+	13	4850	c.3493C>T	c.(3493-3495)CGA>TGA	p.R1165*	TULP4_uc003qrg.2_Intron	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1	1165					intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GGACGTGTCCCGACTGCCCTT	0.557													16	155	---	---	---	---	PASS
SLC22A2	6582	broad.mit.edu	37	6	160664782	160664782	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160664782C>G	uc003qtf.2	-	7	1271	c.1101G>C	c.(1099-1101)ATG>ATC	p.M367I	SLC22A2_uc003qte.1_Missense_Mutation_p.M367I	NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2	367	Helical; (Potential).				body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		GGCCCATGTGCATGATGAGGC	0.517													8	81	---	---	---	---	PASS
FBXL18	80028	broad.mit.edu	37	7	5545180	5545180	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5545180C>T	uc003soo.2	-	2	194	c.100G>A	c.(100-102)GAG>AAG	p.E34K	FBXL18_uc003son.3_Missense_Mutation_p.E34K	NM_024963	NP_079239	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	34	F-box.									central_nervous_system(2)|ovary(1)	3		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		AGGAGGATCTCATCAGAGAAC	0.552													24	118	---	---	---	---	PASS
USP42	84132	broad.mit.edu	37	7	6187427	6187427	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6187427G>C	uc011jwo.1	+	12	1413	c.1290G>C	c.(1288-1290)CAG>CAC	p.Q430H	USP42_uc010kth.1_Missense_Mutation_p.Q363H|USP42_uc011jwp.1_Missense_Mutation_p.Q430H|USP42_uc011jwq.1_Missense_Mutation_p.Q237H|USP42_uc011jwr.1_Missense_Mutation_p.Q275H	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	430					cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		GCCCCGGCCAGTCCTCTCCCC	0.542													20	120	---	---	---	---	PASS
ITGB8	3696	broad.mit.edu	37	7	20403298	20403298	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20403298G>A	uc003suu.2	+	2	871	c.166G>A	c.(166-168)GCC>ACC	p.A56T	ITGB8_uc011jyh.1_5'UTR|ITGB8_uc003sut.2_Missense_Mutation_p.A56T	NM_002214	NP_002205	P26012	ITB8_HUMAN	integrin, beta 8 precursor	56	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3						AGCATCCTGTGCCAGGTGCCT	0.393													8	64	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21639650	21639650	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21639650T>A	uc003svc.2	+	15	2944	c.2913T>A	c.(2911-2913)GAT>GAA	p.D971E		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	971	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GCTTCTATGATCTTGTAGAAG	0.393									Kartagener_syndrome				5	57	---	---	---	---	PASS
TRA2A	29896	broad.mit.edu	37	7	23547029	23547029	+	Intron	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23547029G>A	uc003swi.2	-						TRA2A_uc011jzb.1_Intron|TRA2A_uc011jzc.1_Intron|TRA2A_uc011jzd.1_Intron	NM_013293	NP_037425	Q13595	TRA2A_HUMAN	transformer-2 alpha						nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding			ovary(1)	1						TAGGAAACTTGAACTCTTACT	0.383													35	138	---	---	---	---	PASS
JAZF1	221895	broad.mit.edu	37	7	27934861	27934861	+	Silent	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27934861T>C	uc003szn.2	-	3	604	c.363A>G	c.(361-363)TCA>TCG	p.S121S	JAZF1_uc003szm.2_Silent_p.S57S	NM_175061	NP_778231	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1	121					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131						TGCTGCGGAATGAAGAGGAGG	0.612			T	SUZ12	endometrial stromal tumours								5	32	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43484409	43484409	+	Silent	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43484409C>A	uc003tid.1	+	11	2243	c.1638C>A	c.(1636-1638)ATC>ATA	p.I546I	HECW1_uc011kbi.1_Silent_p.I546I	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	546					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						AGACGGTGATCGCGTCAGCCT	0.687													4	68	---	---	---	---	PASS
SEMA3C	10512	broad.mit.edu	37	7	80378307	80378307	+	Silent	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80378307T>C	uc003uhj.2	-	17	2311	c.1749A>G	c.(1747-1749)GTA>GTG	p.V583V	SEMA3C_uc011kgw.1_Silent_p.V601V	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	583	Ig-like C2-type.				immune response|response to drug	membrane	receptor activity			ovary(1)	1						TGTTATTTTTTACTCCATACT	0.423													18	102	---	---	---	---	PASS
SEMA3A	10371	broad.mit.edu	37	7	83636776	83636776	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83636776T>C	uc003uhz.2	-	10	1348	c.1033A>G	c.(1033-1035)ATG>GTG	p.M345V		NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor	345	Sema.				axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						ACATCACTCATGCTATACATA	0.433													20	109	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86468931	86468931	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86468931G>T	uc003uid.2	+	4	3200	c.2101G>T	c.(2101-2103)GTG>TTG	p.V701L	GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Missense_Mutation_p.V573L|GRM3_uc010leh.2_Missense_Mutation_p.V293L	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	701	Helical; Name=4; (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	GGTGCAAATTGTGATGGTGTC	0.522													9	100	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91630969	91630969	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91630969G>C	uc003ulg.2	+	8	1963	c.1738G>C	c.(1738-1740)GAA>CAA	p.E580Q	AKAP9_uc003ule.2_Missense_Mutation_p.E592Q|AKAP9_uc003ulf.2_Missense_Mutation_p.E580Q|AKAP9_uc003uli.2_Missense_Mutation_p.E205Q	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	592	Glu-rich.|Potential.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TTCTGCATCTGAATCCAGAAA	0.333			T	BRAF	papillary thyroid								23	147	---	---	---	---	PASS
PON1	5444	broad.mit.edu	37	7	94937332	94937332	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94937332G>T	uc003uns.2	-	6	786	c.689C>A	c.(688-690)CCC>CAC	p.P230H	PON1_uc011kih.1_Missense_Mutation_p.P230H	NM_000446	NP_000437	P27169	PON1_HUMAN	paraoxonase 1 precursor	230					aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)	CTTGCCATCGGGTGAAATGTT	0.358													15	106	---	---	---	---	PASS
PON1	5444	broad.mit.edu	37	7	94937345	94937345	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94937345T>A	uc003uns.2	-	6	773	c.676A>T	c.(676-678)ATC>TTC	p.I226F	PON1_uc011kih.1_Missense_Mutation_p.I226F	NM_000446	NP_000437	P27169	PON1_HUMAN	paraoxonase 1 precursor	226					aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)	GAAATGTTGATTCCATTAGCA	0.383													16	107	---	---	---	---	PASS
CYP3A4	1576	broad.mit.edu	37	7	99358583	99358583	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99358583G>T	uc003urv.1	-	12	1379	c.1275C>A	c.(1273-1275)GAC>GAA	p.D425E	CYP3A4_uc003urw.1_Missense_Mutation_p.D424E|CYP3A4_uc011kiz.1_Missense_Mutation_p.D384E|CYP3A4_uc011kja.1_Missense_Mutation_p.D376E|CYP3A4_uc011kjb.1_Missense_Mutation_p.D275E	NM_017460	NP_059488	P08684	CP3A4_HUMAN	cytochrome P450, family 3, subfamily A,	425					alkaloid catabolic process|androgen metabolic process|exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|oxidative demethylation|steroid catabolic process|xenobiotic metabolic process	cell surface|endoplasmic reticulum membrane|integral to membrane|microsome	albendazole monooxygenase activity|caffeine oxidase activity|electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding|quinine 3-monooxygenase activity|steroid binding|taurochenodeoxycholate 6alpha-hydroxylase activity|testosterone 6-beta-hydroxylase activity|vitamin D 24-hydroxylase activity|vitamin D3 25-hydroxylase activity			central_nervous_system(3)|ovary(1)	4	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Albendazole(DB00518)|Alclometasone(DB00240)|Alfentanil(DB00802)|Alfuzosin(DB00346)|Aliskiren(DB01258)|Almotriptan(DB00918)|Alosetron(DB00969)|Alprazolam(DB00404)|Amlodipine(DB00381)|Amprenavir(DB00701)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Benazepril(DB00542)|Bepridil(DB01244)|Betamethasone(DB00443)|Bexarotene(DB00307)|Bortezomib(DB00188)|Bosentan(DB00559)|Bromocriptine(DB01200)|Budesonide(DB01222)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Buspirone(DB00490)|Busulfan(DB01008)|Carbamazepine(DB00564)|Cevimeline(DB00185)|Chlorpheniramine(DB01114)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cinacalcet(DB01012)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clindamycin(DB01190)|Clofibrate(DB00636)|Clonazepam(DB01068)|Clopidogrel(DB00758)|Cocaine(DB00907)|Conivaptan(DB00872)|Conjugated Estrogens(DB00286)|Cyproterone(DB04839)|Darifenacin(DB00496)|Darunavir(DB01264)|Dasatinib(DB01254)|Delavirdine(DB00705)|Desogestrel(DB00304)|Dexamethasone(DB01234)|Diazepam(DB00829)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dofetilide(DB00204)|Dolasetron(DB00757)|Domperidone(DB01184)|Donepezil(DB00843)|Doxorubicin(DB00997)|Drospirenone(DB01395)|Dutasteride(DB01126)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enalapril(DB00584)|Epirubicin(DB00445)|Eplerenone(DB00700)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Ethosuximide(DB00593)|Etonogestrel(DB00294)|Etoposide(DB00773)|Etoricoxib(DB01628)|Exemestane(DB00990)|Felodipine(DB01023)|Fentanyl(DB00813)|Fexofenadine(DB00950)|Finasteride(DB01216)|Fluconazole(DB00196)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Fosamprenavir(DB01319)|Fulvestrant(DB00947)|Galantamine(DB00674)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Granisetron(DB00889)|Grepafloxacin(DB00365)|Halofantrine(DB01218)|Hydrocodone(DB00956)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Hydromorphone(DB00327)|Imatinib(DB00619)|Indinavir(DB00224)|Ipratropium(DB00332)|Irinotecan(DB00762)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Isradipine(DB00270)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Letrozole(DB01006)|Levobupivacaine(DB01002)|Levomethadyl Acetate(DB01227)|Levothyroxine(DB00451)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Maraviroc(DB04835)|Marinol(DB00470)|Mebendazole(DB00643)|Medroxyprogesterone(DB00603)|Methadone(DB00333)|Methylprednisolone(DB00959)|Metyrapone(DB01011)|Mibefradil(DB01388)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirtazapine(DB00370)|Modafinil(DB00745)|Mometasone(DB00764)|Montelukast(DB00471)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norgestrel(DB00506)|Nystatin(DB00646)|Ondansetron(DB00904)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Paricalcitol(DB00910)|Phenmetrazine(DB00830)|Pimecrolimus(DB00337)|Pimozide(DB01100)|Pioglitazone(DB01132)|Posaconazole(DB01263)|Pranlukast(DB01411)|Prednisolone(DB00860)|Prednisone(DB00635)|Prochlorperazine(DB00433)|Quetiapine(DB01224)|Quinapril(DB00881)|Quinine(DB00468)|Rabeprazole(DB01129)|Ranolazine(DB00243)|Reboxetine(DB00234)|Retapamulin(DB01256)|Rifabutin(DB00615)|Rifampin(DB01045)|Rimonabant(DB06155)|Ritonavir(DB00503)|Rofecoxib(DB00533)|Roxithromycin(DB00778)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sertindole(DB06144)|Sibutramine(DB01105)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|Solifenacin(DB01591)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tadalafil(DB00820)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Terconazole(DB00251)|Terfenadine(DB00342)|Testosterone(DB00624)|Tiagabine(DB00906)|Ticlopidine(DB00208)|Tinidazole(DB00911)|Tiotropium(DB01409)|Tipranavir(DB00932)|Toremifene(DB00539)|Triazolam(DB00897)|Trimetrexate(DB01157)|Troglitazone(DB00197)|Valdecoxib(DB00580)|Vardenafil(DB00862)|Vinblastine(DB00570)|Vincristine(DB00541)|Vindesine(DB00309)|Vinorelbine(DB00361)|Voriconazole(DB00582)|Zaleplon(DB00962)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolpidem(DB00425)|Zonisamide(DB00909)	GATCTATGTTGTCCTTGTTCT	0.388													49	347	---	---	---	---	PASS
ZSCAN21	7589	broad.mit.edu	37	7	99661526	99661526	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99661526C>G	uc003uso.2	+	4	852	c.708C>G	c.(706-708)AGC>AGG	p.S236R	ZSCAN21_uc003usn.1_Missense_Mutation_p.S235R	NM_145914	NP_666019	Q9Y5A6	ZSC21_HUMAN	zinc finger protein 38	236					positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			CTGAGGCCAGCTTAGAGAGGC	0.463													5	159	---	---	---	---	PASS
GATS	352954	broad.mit.edu	37	7	99831237	99831237	+	Silent	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99831237T>C	uc003uua.3	-	2	456	c.207A>G	c.(205-207)GAA>GAG	p.E69E	GATS_uc003uty.3_RNA|GATS_uc003utz.3_RNA|GATS_uc010lgt.2_RNA|GATS_uc010lgu.2_RNA	NM_178831	NP_849153	Q8NAP1	GATS_HUMAN	GATS, stromal antigen 3 opposite strand	69											0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTAGGAATCCTTCCTCATCGA	0.517													25	185	---	---	---	---	PASS
COG5	10466	broad.mit.edu	37	7	106938787	106938787	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106938787C>T	uc003ved.2	-	12	1731	c.1206G>A	c.(1204-1206)TCG>TCA	p.S402S	COG5_uc003vec.2_Silent_p.S402S|COG5_uc003vee.2_Silent_p.S402S	NM_181733	NP_859422	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5 isoform	402					intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4						TCAAAAACATCGAAGCTGCCA	0.318													19	71	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120906456	120906456	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120906456C>T	uc003vjq.3	+	19	2933	c.2486C>T	c.(2485-2487)TCA>TTA	p.S829L		NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	829						endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					ATAAGCCCTTCATTGAGACCA	0.393													40	228	---	---	---	---	PASS
GCC1	79571	broad.mit.edu	37	7	127224785	127224785	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127224785C>A	uc003vma.2	-	1	870	c.452G>T	c.(451-453)GGT>GTT	p.G151V		NM_024523	NP_078799	Q96CN9	GCC1_HUMAN	Golgi coiled-coil protein 1	151						Golgi membrane|plasma membrane	protein binding			ovary(2)	2						CACCTCCCCACCTGCAAATGG	0.572													29	181	---	---	---	---	PASS
SND1	27044	broad.mit.edu	37	7	127727088	127727088	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127727088C>T	uc003vmi.2	+	21	2629	c.2403C>T	c.(2401-2403)ATC>ATT	p.I801I	SND1_uc010lle.2_Silent_p.I454I	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1	801					gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						TCGCCTTCATCCAGGTGCCCC	0.592													10	57	---	---	---	---	PASS
COPG2	26958	broad.mit.edu	37	7	130149597	130149597	+	Intron	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130149597T>C	uc003vqh.1	-							NM_012133	NP_036265	Q9UBF2	COPG2_HUMAN	coatomer protein complex, subunit gamma 2						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)					GGGCTGTGTGTGTGTGTGATC	0.274													5	45	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	132193188	132193188	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132193188C>G	uc003vra.3	-	2	494	c.265G>C	c.(265-267)GAC>CAC	p.D89H	PLXNA4_uc003vrc.2_Missense_Mutation_p.D89H|PLXNA4_uc003vrb.2_Missense_Mutation_p.D89H	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	89	Extracellular (Potential).|Sema.					integral to membrane|intracellular|plasma membrane		p.D89Y(1)		ovary(1)	1						TTGTCCTCGTCCGGCCCTGTC	0.552													8	97	---	---	---	---	PASS
LRGUK	136332	broad.mit.edu	37	7	133812405	133812405	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133812405G>T	uc003vrm.1	+	1	301	c.285G>T	c.(283-285)ATG>ATT	p.M95I		NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain	95							ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						AGTCCGAAATGCTGAATTTGG	0.642													11	51	---	---	---	---	PASS
TMEM140	55281	broad.mit.edu	37	7	134849576	134849576	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134849576C>T	uc003vsi.2	+	2	664	c.383C>T	c.(382-384)GCA>GTA	p.A128V	C7orf49_uc003vsh.2_Intron	NM_018295	NP_060765	Q9NV12	TM140_HUMAN	transmembrane protein 140	128	Helical; (Potential).					integral to membrane				large_intestine(1)	1						GTGCTGCTGGCAGGCGGCCTG	0.652													8	46	---	---	---	---	PASS
OR6V1	346517	broad.mit.edu	37	7	142749826	142749826	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142749826A>T	uc011ksv.1	+	1	389	c.389A>T	c.(388-390)TAT>TTT	p.Y130F		NM_001001667	NP_001001667	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V,	130	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.059)					CCACTGCGCTATGGCACTCTG	0.592													38	172	---	---	---	---	PASS
ZNF425	155054	broad.mit.edu	37	7	148802388	148802388	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148802388C>A	uc003wfj.2	-	4	648	c.575G>T	c.(574-576)TGC>TTC	p.C192F		NM_001001661	NP_001001661	Q6IV72	ZN425_HUMAN	zinc finger protein 425	192	C2H2-type 1.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			ACAGACATAGCAGGAATAGCA	0.498													16	120	---	---	---	---	PASS
NCAPG2	54892	broad.mit.edu	37	7	158455040	158455040	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158455040G>A	uc003wnv.1	-	16	1980	c.1835C>T	c.(1834-1836)TCA>TTA	p.S612L	NCAPG2_uc010lqu.1_Missense_Mutation_p.S404L|NCAPG2_uc003wnw.1_RNA|NCAPG2_uc003wnx.1_Missense_Mutation_p.S612L|NCAPG2_uc011kwe.1_Missense_Mutation_p.S612L|NCAPG2_uc011kwc.1_Missense_Mutation_p.S113L|NCAPG2_uc011kwd.1_Intron	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5	612					cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		ATCGTTTACTGACAGTGTTTT	0.338													16	114	---	---	---	---	PASS
MFHAS1	9258	broad.mit.edu	37	8	8750069	8750069	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8750069A>G	uc003wsj.1	-	1	1063	c.500T>C	c.(499-501)TTT>TCT	p.F167S		NM_004225	NP_004216	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified	167	LRR 5.										0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CAGCCGGTTAAAGCTGACATC	0.677													3	15	---	---	---	---	PASS
MTMR9	66036	broad.mit.edu	37	8	11167123	11167123	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11167123G>A	uc003wtm.2	+	6	1295	c.897G>A	c.(895-897)TTG>TTA	p.L299L	MTMR9_uc010lrx.2_Silent_p.L192L|MTMR9_uc011kxa.1_Silent_p.L214L	NM_015458	NP_056273	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	299	Myotubularin phosphatase.					cytoplasm	phosphatase activity|protein binding				0			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		TCAGTAAATTGGAGGCCTCTA	0.443													14	90	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35402012	35402012	+	Intron	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35402012C>G	uc003xjr.1	+						UNC5D_uc003xjs.1_Missense_Mutation_p.T16S	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGTGCTGGGACTTCCGGGTTC	0.423													5	104	---	---	---	---	PASS
ADAM2	2515	broad.mit.edu	37	8	39606913	39606913	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39606913G>T	uc003xnj.2	-	18	2007	c.1932C>A	c.(1930-1932)TGC>TGA	p.C644*	ADAM2_uc003xnk.2_Nonsense_Mutation_p.C625*|ADAM2_uc011lck.1_Nonsense_Mutation_p.C581*|ADAM2_uc003xnl.2_Nonsense_Mutation_p.C488*	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein	644	Extracellular (Potential).|EGF-like.				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		ATTGAACTGAGCAATCTGGAG	0.383													10	187	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41798770	41798770	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41798770C>A	uc010lxb.2	-	16	3173	c.2629G>T	c.(2629-2631)GAA>TAA	p.E877*	MYST3_uc010lxc.2_Nonsense_Mutation_p.E877*|MYST3_uc003xon.3_Nonsense_Mutation_p.E877*	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	877					histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			CCAAAACGTTCCTGGGTTTTT	0.483													13	108	---	---	---	---	PASS
POTEA	340441	broad.mit.edu	37	8	43152602	43152602	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43152602G>T	uc003xpz.1	+	3	631	c.588G>T	c.(586-588)AAG>AAT	p.K196N	POTEA_uc003xqa.1_Missense_Mutation_p.K196N	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	196										ovary(1)	1						CAAAAAACAAGGTACAGATCT	0.338													6	93	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52321575	52321575	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52321575G>C	uc003xqu.3	-	17	2710	c.2609C>G	c.(2608-2610)GCC>GGC	p.A870G	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	870					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				ACGGCCGCTGGCACACGCGGG	0.647													3	36	---	---	---	---	PASS
LYPLA1	10434	broad.mit.edu	37	8	54974895	54974895	+	Intron	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54974895A>T	uc003xry.2	-						LYPLA1_uc011ldx.1_Intron|LYPLA1_uc003xrz.2_Intron	NM_006330	NP_006321	O75608	LYPA1_HUMAN	lysophospholipase 1						fatty acid metabolic process|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytosol	lysophospholipase activity|palmitoyl-(protein) hydrolase activity			central_nervous_system(1)	1		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;8.48e-07)|Epithelial(17;9.29e-05)|all cancers(17;0.000689)			CTGTAAAATAAGGCAAAATCT	0.308													15	91	---	---	---	---	PASS
CLVS1	157807	broad.mit.edu	37	8	62212755	62212755	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62212755C>G	uc003xuh.2	+	2	693	c.369C>G	c.(367-369)ATC>ATG	p.I123M	CLVS1_uc003xug.2_Missense_Mutation_p.I123M|CLVS1_uc003xui.2_Intron|CLVS1_uc010lyp.2_Missense_Mutation_p.I123M	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN	retinaldehyde binding protein 1-like 1	123	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5						GGGCTCTGATCGATGGGTTCC	0.488													28	75	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	68968096	68968096	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68968096G>T	uc003xxv.1	+	10	1152	c.1125G>T	c.(1123-1125)TGG>TGT	p.W375C	PREX2_uc003xxu.1_Missense_Mutation_p.W375C|PREX2_uc011lez.1_Missense_Mutation_p.W310C	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	375					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						AAGATACCTGGGTCATGATCT	0.353													57	109	---	---	---	---	PASS
PRDM14	63978	broad.mit.edu	37	8	70967523	70967523	+	Intron	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70967523G>T	uc003xym.2	-							NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	PR domain containing 14						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			CTTAGTAAGAGGTTCCATTTA	0.413													7	113	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77618685	77618685	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77618685A>T	uc003yav.2	+	2	2749	c.2362A>T	c.(2362-2364)AGC>TGC	p.S788C	ZFHX4_uc003yat.1_Missense_Mutation_p.S788C|ZFHX4_uc003yau.1_Missense_Mutation_p.S788C|ZFHX4_uc003yaw.1_Missense_Mutation_p.S788C	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	788	C2H2-type 4; degenerate.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCATATGACCAGCGAAAAGCA	0.493										HNSCC(33;0.089)			3	35	---	---	---	---	PASS
DPY19L4	286148	broad.mit.edu	37	8	95751682	95751682	+	Nonsense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95751682A>T	uc003ygx.2	+	5	509	c.385A>T	c.(385-387)AAG>TAG	p.K129*	DPY19L4_uc003ygy.2_Nonsense_Mutation_p.K66*	NM_181787	NP_861452	Q7Z388	D19L4_HUMAN	dpy-19-like 4	129						integral to membrane				ovary(2)	2	Breast(36;3.85e-06)					TGTATCTCTGAAGACTATAAA	0.348													59	130	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104898074	104898074	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104898074G>T	uc003yls.2	+	2	822	c.581G>T	c.(580-582)CGA>CTA	p.R194L	RIMS2_uc003ylp.2_Missense_Mutation_p.R416L|RIMS2_uc003ylw.2_Missense_Mutation_p.R224L|RIMS2_uc003ylq.2_Missense_Mutation_p.R224L|RIMS2_uc003ylr.2_Missense_Mutation_p.R224L	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	447					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GAAAGAACTCGAGAGGCTCAG	0.463										HNSCC(12;0.0054)			30	84	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110455350	110455350	+	Intron	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110455350G>C	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTTATGGTAAGATGGTTAAAG	0.333										HNSCC(38;0.096)			109	279	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110477264	110477264	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110477264G>T	uc003yne.2	+	49	8307	c.8203G>T	c.(8203-8205)GGC>TGC	p.G2735C		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2735	Extracellular (Potential).|PbH1 4.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATTTAGTGAAGGCTTGACTGT	0.458										HNSCC(38;0.096)			61	196	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110497410	110497410	+	Intron	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110497410G>A	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTGGTAAGTGGATGCTTTTTA	0.289										HNSCC(38;0.096)			32	128	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113323290	113323290	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113323290C>T	uc003ynu.2	-	50	7961	c.7802G>A	c.(7801-7803)CGA>CAA	p.R2601Q	CSMD3_uc003yns.2_Missense_Mutation_p.R1803Q|CSMD3_uc003ynt.2_Missense_Mutation_p.R2561Q|CSMD3_uc011lhx.1_Missense_Mutation_p.R2497Q|CSMD3_uc003ynw.1_Missense_Mutation_p.R312Q	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2601	Extracellular (Potential).|Sushi 14.					integral to membrane|plasma membrane		p.R2601L(1)		ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TCCAACAAGTCGGAATCCTCG	0.493										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			8	154	---	---	---	---	PASS
C8orf76	84933	broad.mit.edu	37	8	124253547	124253547	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124253547C>G	uc003yqc.1	-	1	71	c.40G>C	c.(40-42)GAC>CAC	p.D14H	C8orf76_uc003yqd.2_Intron	NM_032847	NP_116236	Q96K31	CH076_HUMAN	hypothetical protein LOC84933	14							binding			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			AACACCGAGTCCTCGAACTCG	0.711													3	28	---	---	---	---	PASS
OC90	729330	broad.mit.edu	37	8	133044247	133044247	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133044247C>T	uc003ytg.2	-	11	912	c.912G>A	c.(910-912)GTG>GTA	p.V304V	OC90_uc011lix.1_Silent_p.V304V	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90	320					lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			GCTGTGGCATCACCTGCATGT	0.537													8	181	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139601598	139601598	+	Silent	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139601598A>T	uc003yvd.2	-	65	5226	c.4779T>A	c.(4777-4779)CCT>CCA	p.P1593P	COL22A1_uc011ljo.1_Silent_p.P873P	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1593	Pro-rich.|Gly-rich.|Collagen-like 16.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTGGGAGGCCAGGATGTCCAG	0.637										HNSCC(7;0.00092)			5	47	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139610962	139610962	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139610962C>A	uc003yvd.2	-	61	4812	c.4365G>T	c.(4363-4365)AGG>AGT	p.R1455S	COL22A1_uc011ljo.1_Missense_Mutation_p.R735S	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1455	Pro-rich.|Gly-rich.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCATCCTTACCCTCAGTCCTG	0.493										HNSCC(7;0.00092)			4	162	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139629157	139629157	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139629157C>T	uc003yvd.2	-	54	4317	c.3870G>A	c.(3868-3870)CGG>CGA	p.R1290R	COL22A1_uc011ljo.1_Silent_p.R570R	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1290	Pro-rich.|Gly-rich.|Collagen-like 12.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCCCACTTACCCGGGGACCGG	0.572										HNSCC(7;0.00092)			40	81	---	---	---	---	PASS
TRAPPC9	83696	broad.mit.edu	37	8	141370151	141370151	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141370151T>C	uc003yvj.2	-	9	1627	c.1493A>G	c.(1492-1494)CAG>CGG	p.Q498R	TRAPPC9_uc003yvh.2_Missense_Mutation_p.Q596R|TRAPPC9_uc003yvi.1_Missense_Mutation_p.Q489R	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform	498					cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						TCACTCACCCTGATCCGACAA	0.498													55	84	---	---	---	---	PASS
CYC1	1537	broad.mit.edu	37	8	145151528	145151528	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145151528A>T	uc003zaz.3	+	5	696	c.653A>T	c.(652-654)TAC>TTC	p.Y218F	CYC1_uc003zay.2_Missense_Mutation_p.Y159F	NM_001916	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	218					respiratory electron transport chain|transport	cell junction|integral to membrane|mitochondrial inner membrane|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTCACGGGCTACTGCGAGCCA	0.587											OREG0019052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	152	---	---	---	---	PASS
KIFC2	90990	broad.mit.edu	37	8	145698044	145698044	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145698044C>T	uc003zcz.2	+	16	1881	c.1816C>T	c.(1816-1818)CTG>TTG	p.L606L	KIFC2_uc003zda.2_5'UTR	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	kinesin family member C2	606	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CCTGGTCACGCTGACGCTGCG	0.731													13	29	---	---	---	---	PASS
IFNB1	3456	broad.mit.edu	37	9	21077471	21077471	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21077471G>A	uc003zok.2	-	1	473	c.398C>T	c.(397-399)ACC>ATC	p.T133I		NM_002176	NP_002167	P01574	IFNB_HUMAN	interferon, beta 1, fibroblast precursor	133					activation of caspase activity|B cell proliferation|blood coagulation|cellular response to exogenous dsRNA|defense response to virus|induction of apoptosis|natural killer cell activation|negative regulation of cell proliferation|negative regulation of T cell differentiation|negative regulation of T-helper 2 cell cytokine production|negative regulation of viral genome replication|negative regulation of viral transcription|negative regulation of virion penetration into host cell|positive regulation of innate immune response|positive regulation of transcription from RNA polymerase II promoter|regulation of MHC class I biosynthetic process|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding|transcription corepressor activity			ovary(1)|breast(1)|kidney(1)	3				GBM - Glioblastoma multiforme(5;7.45e-142)|Lung(24;2.42e-17)|LUSC - Lung squamous cell carcinoma(38;7.17e-11)	Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)	TTTTCCCCTGGTGAAATCTTC	0.438													57	301	---	---	---	---	PASS
FXN	2395	broad.mit.edu	37	9	71687670	71687670	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71687670G>C	uc004aha.2	+	5	845	c.625G>C	c.(625-627)GAT>CAT	p.D209H	FXN_uc011lrr.1_Intron|FXN_uc004agz.2_3'UTR	NM_000144	NP_000135	Q16595	FRDA_HUMAN	frataxin isoform 1 preproprotein	209					cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding				0						TTCCGGAAAAGATGCTTGATG	0.473													12	76	---	---	---	---	PASS
KIF27	55582	broad.mit.edu	37	9	86498736	86498736	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86498736T>C	uc004ana.2	-	10	2581	c.2437A>G	c.(2437-2439)AGA>GGA	p.R813G	KIF27_uc010mpw.2_Missense_Mutation_p.R813G|KIF27_uc010mpx.2_Missense_Mutation_p.R813G	NM_017576	NP_060046	Q86VH2	KIF27_HUMAN	kinesin family member 27	813	Potential.				cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity			lung(4)|skin(1)	5						ACCTGAACTCTCAGCTTTGCA	0.348													22	86	---	---	---	---	PASS
EPB41L4B	54566	broad.mit.edu	37	9	111979247	111979247	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111979247C>G	uc004bdz.1	-	16	1883	c.1588G>C	c.(1588-1590)GAG>CAG	p.E530Q		NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	530						cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3						AGAGGCCCCTCTTTGTTCTCC	0.463													36	153	---	---	---	---	PASS
PAPPA	5069	broad.mit.edu	37	9	119033699	119033699	+	Intron	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119033699C>T	uc004bjn.2	+						PAPPA_uc011lxp.1_Intron|PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A						cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						TGTATTGGTACGTCTTTTTCA	0.398													39	201	---	---	---	---	PASS
PAPPA	5069	broad.mit.edu	37	9	119115100	119115100	+	Silent	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119115100C>A	uc004bjn.2	+	16	4461	c.4080C>A	c.(4078-4080)GCC>GCA	p.A1360A	PAPPA_uc011lxq.1_Silent_p.A735A	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	1360	Sushi 3.				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						TCCAGACCGCCCGGTGCCGAG	0.572													12	83	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135224757	135224757	+	Missense_Mutation	SNP	C	A	A	rs79740039	byFrequency	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135224757C>A	uc004cbk.2	-	3	242	c.59G>T	c.(58-60)CGC>CTC	p.R20L		NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	20					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GGAAGCATAGCGCTTTAGGAA	0.483													17	64	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139905173	139905173	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139905173T>A	uc011mem.1	-	39	6218	c.6070A>T	c.(6070-6072)ACC>TCC	p.T2024S	ABCA2_uc011mel.1_Missense_Mutation_p.T2025S|ABCA2_uc004ckl.1_Missense_Mutation_p.T1955S|ABCA2_uc004ckm.1_Missense_Mutation_p.T2055S	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	2024					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACAGGCTTGGTAGACACAGGC	0.632													18	59	---	---	---	---	PASS
EXD3	54932	broad.mit.edu	37	9	140246640	140246640	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140246640C>G	uc004cmp.2	-	12	1247	c.1051G>C	c.(1051-1053)GAC>CAC	p.D351H	C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Missense_Mutation_p.D31H|EXD3_uc004cmq.1_RNA	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3	351					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						AGCCTCGAGTCAGCCTCAGTC	0.647													16	94	---	---	---	---	PASS
GDF2	2658	broad.mit.edu	37	10	48413671	48413671	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48413671G>T	uc001jfa.1	-	2	1360	c.1197C>A	c.(1195-1197)AGC>AGA	p.S399R		NM_016204	NP_057288	Q9UK05	GDF2_HUMAN	growth differentiation factor 2 precursor	399					activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(2)|skin(1)	3						CGGAGATGGGGCTCAGTTTGG	0.582													5	47	---	---	---	---	PASS
ASAH2	56624	broad.mit.edu	37	10	52008313	52008313	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52008313T>A	uc001jjd.2	-	1	58	c.58A>T	c.(58-60)ATG>TTG	p.M20L	ASAH2_uc009xos.2_Missense_Mutation_p.M20L	NM_019893	NP_063946	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase 2 isoform a	20	Helical; Signal-anchor for type II membrane protein; (Potential).				apoptosis|ceramide metabolic process|signal transduction	integral to membrane|mitochondrion|plasma membrane	ceramidase activity				0						ATGGCACTCATCATTACAAGG	0.448													16	117	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55782810	55782810	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55782810C>A	uc001jju.1	-	19	2763	c.2368G>T	c.(2368-2370)GTG>TTG	p.V790L	PCDH15_uc010qhq.1_Missense_Mutation_p.V795L|PCDH15_uc010qhr.1_Missense_Mutation_p.V790L|PCDH15_uc010qhs.1_Missense_Mutation_p.V802L|PCDH15_uc010qht.1_Missense_Mutation_p.V797L|PCDH15_uc010qhu.1_Missense_Mutation_p.V790L|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.V790L|PCDH15_uc010qhw.1_Missense_Mutation_p.V753L|PCDH15_uc010qhx.1_Missense_Mutation_p.V719L|PCDH15_uc010qhy.1_Missense_Mutation_p.V795L|PCDH15_uc010qhz.1_Missense_Mutation_p.V790L|PCDH15_uc010qia.1_Missense_Mutation_p.V768L|PCDH15_uc010qib.1_Missense_Mutation_p.V768L|PCDH15_uc001jjw.2_Missense_Mutation_p.V790L	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	790	Extracellular (Potential).|Cadherin 7.				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				TCTGTTGCCACAACAACAAGT	0.418										HNSCC(58;0.16)			23	151	---	---	---	---	PASS
ZNF365	22891	broad.mit.edu	37	10	64415325	64415325	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64415325G>T	uc001jmd.1	+	4	659	c.325G>T	c.(325-327)GCA>TCA	p.A109S	ZNF365_uc001jmc.2_Intron|ZNF365_uc001jme.1_Intron|ZNF365_uc001jmf.1_Intron|ZNF365_uc009xpg.1_Intron	NM_199452	NP_955524	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform D	109										ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					GAATACACTTGCAGAGTCGTG	0.507													22	98	---	---	---	---	PASS
SEC24C	9632	broad.mit.edu	37	10	75519797	75519797	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75519797C>T	uc001juw.2	+	6	682	c.503C>T	c.(502-504)TCA>TTA	p.S168L	SEC24C_uc010qkn.1_RNA|SEC24C_uc009xrj.1_Missense_Mutation_p.S26L|SEC24C_uc001jux.2_Missense_Mutation_p.S168L|SEC24C_uc010qko.1_Missense_Mutation_p.S26L|SEC24C_uc010qkp.1_Intron|SEC24C_uc010qkq.1_Intron	NM_004922	NP_004913	P53992	SC24C_HUMAN	SEC24-related protein C	168					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|zinc ion binding			skin(2)|central_nervous_system(1)	3	Prostate(51;0.0112)					TCGCTGGCTTCAGCCTCAGGA	0.532													44	190	---	---	---	---	PASS
CYP26A1	1592	broad.mit.edu	37	10	94837069	94837069	+	3'UTR	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94837069G>C	uc001kil.2	+	7					CYP26A1_uc001kik.1_3'UTR|CYP26A1_uc001kim.1_3'UTR	NM_000783	NP_000774	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A,						negative regulation of retinoic acid receptor signaling pathway|retinoic acid catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|oxygen binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		Colorectal(252;0.122)				TGATGAGCTTGAATGTTCAAA	0.348													9	59	---	---	---	---	PASS
GPR120	338557	broad.mit.edu	37	10	95326724	95326724	+	Missense_Mutation	SNP	T	G	G	rs150044710	by1000genomes	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95326724T>G	uc010qnt.1	+	1	303	c.247T>G	c.(247-249)TGC>GGC	p.C83G	GPR120_uc010qnu.1_Missense_Mutation_p.C83G	NM_181745	NP_859529	Q5NUL3	O3FA1_HUMAN	G protein-coupled receptor 120	83	Helical; Name=2; (Potential).				negative regulation of cytokine secretion|negative regulation of inflammatory response|regulation of glucose transport	integral to membrane|plasma membrane	fatty acid binding				0		Colorectal(252;0.122)				CAACCTCTTCTGCGCGGACCT	0.672													8	32	---	---	---	---	PASS
ABCC2	1244	broad.mit.edu	37	10	101591877	101591877	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101591877A>T	uc001kqf.2	+	23	3386	c.3247A>T	c.(3247-3249)AGG>TGG	p.R1083W		NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),	1083	ABC transmembrane type-1 2.|Cytoplasmic (By similarity).					apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	GATTGTGAACAGGTTTGCCGG	0.443													29	112	---	---	---	---	PASS
CPN1	1369	broad.mit.edu	37	10	101835705	101835705	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101835705G>A	uc001kql.2	-	2	643	c.383C>T	c.(382-384)TCC>TTC	p.S128F		NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor	128	Catalytic.				proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		GGGGTTCATGGATGGCAGGAT	0.582													15	78	---	---	---	---	PASS
PPRC1	23082	broad.mit.edu	37	10	103898521	103898521	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103898521C>G	uc001kum.2	+	3	527	c.488C>G	c.(487-489)TCT>TGT	p.S163C	PPRC1_uc001kun.2_Missense_Mutation_p.S43C|PPRC1_uc010qqj.1_Missense_Mutation_p.S163C|PPRC1_uc009xxa.2_5'Flank	NM_015062	NP_055877	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor	163					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		GAGGGCTCCTCTGTGAGTGTG	0.507													19	138	---	---	---	---	PASS
ELOVL3	83401	broad.mit.edu	37	10	103986409	103986409	+	Intron	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103986409G>T	uc001kut.2	+							NM_152310	NP_689523	Q9HB03	ELOV3_HUMAN	elongation of very long chain fatty acids like						fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding			ovary(2)	2		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		GAGTATTGGTGAGACTTTGGG	0.428													11	133	---	---	---	---	PASS
ELOVL3	83401	broad.mit.edu	37	10	103987391	103987391	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103987391C>G	uc001kut.2	+	2	273	c.110C>G	c.(109-111)TCA>TGA	p.S37*		NM_152310	NP_689523	Q9HB03	ELOV3_HUMAN	elongation of very long chain fatty acids like	37	Helical; (Potential).				fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding			ovary(2)	2		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		AGGGCAACCTCATTCCCCATA	0.532													29	302	---	---	---	---	PASS
ELOVL3	83401	broad.mit.edu	37	10	103987488	103987488	+	Silent	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103987488C>G	uc001kut.2	+	2	370	c.207C>G	c.(205-207)CTC>CTG	p.L69L		NM_152310	NP_689523	Q9HB03	ELOV3_HUMAN	elongation of very long chain fatty acids like	69	Helical; (Potential).				fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding			ovary(2)	2		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		CTCTCATCCTCTGGTCCTTCT	0.527													29	237	---	---	---	---	PASS
INA	9118	broad.mit.edu	37	10	105037298	105037298	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105037298G>A	uc001kws.2	+	1	379	c.330G>A	c.(328-330)GAG>GAA	p.E110E	uc001kwr.2_5'Flank|INA_uc009xxj.2_Silent_p.E110E	NM_032727	NP_116116	Q16352	AINX_HUMAN	internexin neuronal intermediate filament	110	Coil 1A.|Rod.		E -> Q (in a breast cancer sample; somatic mutation).		cell differentiation|nervous system development	neurofilament	structural constituent of cytoskeleton	p.E110Q(1)		ovary(1)|breast(1)	2				Epithelial(162;3.45e-09)|all cancers(201;9.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		TGTTCATCGAGAAGGTGCATC	0.672													8	31	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124402788	124402788	+	Silent	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124402788C>A	uc001lgk.1	+	53	7222	c.7116C>A	c.(7114-7116)TCC>TCA	p.S2372S	DMBT1_uc001lgl.1_Silent_p.S2362S|DMBT1_uc001lgm.1_Silent_p.S1744S|DMBT1_uc009xzz.1_Silent_p.S2371S|DMBT1_uc010qtx.1_Silent_p.S1092S|DMBT1_uc009yab.1_Silent_p.S1075S|DMBT1_uc009yac.1_Silent_p.S666S	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	2372	ZP.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ACCCCTCTTCCCGCTGCTACC	0.607													38	166	---	---	---	---	PASS
ZRANB1	54764	broad.mit.edu	37	10	126631520	126631520	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126631520G>A	uc001lic.2	+	1	829	c.458G>A	c.(457-459)TGG>TAG	p.W153*	ZRANB1_uc010qug.1_Nonsense_Mutation_p.W179*	NM_017580	NP_060050	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	153	RanBP2-type 3.				positive regulation of Wnt receptor signaling pathway|protein K63-linked deubiquitination|Wnt receptor signaling pathway	aggresome|centrosome|intermediate filament cytoskeleton|nucleolus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		ACACAGCACTGGACTTGCTCT	0.418													57	184	---	---	---	---	PASS
HBE1	3046	broad.mit.edu	37	11	5291102	5291102	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5291102C>T	uc001mal.1	-	1	272	c.19G>A	c.(19-21)GAG>AAG	p.E7K	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Missense_Mutation_p.E7K	NM_005330	NP_005321	P02100	HBE_HUMAN	epsilon globin	7					blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCCTTCTCCTCAGCAGTAAAA	0.527													7	46	---	---	---	---	PASS
OR52E4	390081	broad.mit.edu	37	11	5905882	5905882	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5905882G>T	uc010qzs.1	+	1	360	c.360G>T	c.(358-360)ATG>ATT	p.M120I	TRIM5_uc001mbq.1_Intron	NM_001005165	NP_001005165	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E,	120	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGTGGTCATGGCTTATGACC	0.458													37	133	---	---	---	---	PASS
RRP8	23378	broad.mit.edu	37	11	6622567	6622567	+	Silent	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6622567T>A	uc001med.2	-	3	808	c.729A>T	c.(727-729)GCA>GCT	p.A243A	ILK_uc001mee.2_5'Flank|ILK_uc001mef.2_5'Flank|ILK_uc010rap.1_5'Flank|ILK_uc010raq.1_5'Flank|ILK_uc001meg.2_5'Flank|ILK_uc001meh.2_5'Flank	NM_015324	NP_056139	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase,	243					chromatin modification|chromatin silencing at rDNA|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	methylated histone residue binding|S-adenosylmethionine-dependent methyltransferase activity				0						CCAGCCGCTGTGCCATGCGGG	0.622													5	26	---	---	---	---	PASS
AMPD3	272	broad.mit.edu	37	11	10514974	10514974	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10514974G>C	uc001mio.1	+	7	1353	c.1018G>C	c.(1018-1020)GAG>CAG	p.E340Q	AMPD3_uc010rbz.1_Missense_Mutation_p.E181Q|AMPD3_uc001min.1_Missense_Mutation_p.E349Q|AMPD3_uc009yfw.1_RNA|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_Missense_Mutation_p.E347Q|AMPD3_uc009yfy.2_Missense_Mutation_p.E340Q	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B	340					AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		ATACCAGACGGAGCCTGACAG	0.607													27	115	---	---	---	---	PASS
MYOD1	4654	broad.mit.edu	37	11	17741680	17741680	+	Silent	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17741680C>A	uc001mni.2	+	1	571	c.351C>A	c.(349-351)CGC>CGA	p.R117R		NM_002478	NP_002469	P15172	MYOD1_HUMAN	myogenic differentiation 1	117	Basic motif.				muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|skeletal muscle tissue development	nuclear chromatin|transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity			breast(2)|ovary(1)	3						CCACCATGCGCGAGCGGCGCC	0.662													7	14	---	---	---	---	PASS
NELL1	4745	broad.mit.edu	37	11	21592335	21592335	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21592335C>G	uc001mqe.2	+	18	2159	c.2006C>G	c.(2005-2007)ACA>AGA	p.T669R	NELL1_uc001mqf.2_Missense_Mutation_p.T622R|NELL1_uc009yid.2_Missense_Mutation_p.T697R|NELL1_uc010rdo.1_Missense_Mutation_p.T612R|NELL1_uc010rdp.1_Missense_Mutation_p.T382R|NELL1_uc001mqh.2_Missense_Mutation_p.T214R	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	669	VWFC 3.				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						TGCCGACGGACAGCTTGTGAT	0.428													26	130	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26677983	26677983	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26677983C>A	uc001mqt.3	+	26	2863	c.2718C>A	c.(2716-2718)TAC>TAA	p.Y906*	ANO3_uc010rdr.1_Nonsense_Mutation_p.Y890*|ANO3_uc010rds.1_Nonsense_Mutation_p.Y745*|ANO3_uc010rdt.1_Nonsense_Mutation_p.Y760*	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	906	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CTTTACAATACTGGCATATCC	0.378													38	179	---	---	---	---	PASS
DCDC1	341019	broad.mit.edu	37	11	31329246	31329246	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31329246G>A	uc001msv.2	-	4	576	c.374C>T	c.(373-375)TCT>TTT	p.S125F	DCDC1_uc001msu.1_5'UTR	NM_181807	NP_861523	P59894	DCDC1_HUMAN	doublecortin domain containing 1	125					intracellular signal transduction					skin(1)	1	Lung SC(675;0.225)					TATAGAACAAGAATTGTTTTT	0.393													54	343	---	---	---	---	PASS
FOLH1	2346	broad.mit.edu	37	11	49168478	49168478	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49168478T>C	uc001ngy.2	-	19	2344	c.2083A>G	c.(2083-2085)AGC>GGC	p.S695G	FOLH1_uc001ngx.2_Silent_p.Q94Q|FOLH1_uc001ngz.2_Missense_Mutation_p.S664G|FOLH1_uc009yly.2_Missense_Mutation_p.S680G|FOLH1_uc009ylz.2_Missense_Mutation_p.S649G|FOLH1_uc009yma.2_Missense_Mutation_p.S387G	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	695	Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	TTGTGGCTGCTTGGAGCATAG	0.438													73	126	---	---	---	---	PASS
FOLH1	2346	broad.mit.edu	37	11	49178328	49178328	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49178328C>G	uc001ngy.2	-	15	1825	c.1564G>C	c.(1564-1566)GAG>CAG	p.E522Q	FOLH1_uc001ngx.2_5'Flank|FOLH1_uc001ngz.2_Missense_Mutation_p.E522Q|FOLH1_uc009yly.2_Missense_Mutation_p.E507Q|FOLH1_uc009ylz.2_Missense_Mutation_p.E507Q|FOLH1_uc009yma.2_Missense_Mutation_p.E214Q	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	522	NAALADase.|Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	AAGAACACCTCAAAATCATTT	0.318													33	184	---	---	---	---	PASS
OR4A16	81327	broad.mit.edu	37	11	55110699	55110699	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55110699C>G	uc010rie.1	+	1	23	c.23C>G	c.(22-24)ACA>AGA	p.T8R		NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A,	8	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(2)|pancreas(1)	3						AGCAATGTTACAGAATTTGTC	0.373													12	80	---	---	---	---	PASS
OR4A16	81327	broad.mit.edu	37	11	55111057	55111057	+	Silent	SNP	G	C	C	rs76791457	byFrequency	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55111057G>C	uc010rie.1	+	1	381	c.381G>C	c.(379-381)CCG>CCC	p.P127P		NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A,	127	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(2)|pancreas(1)	3						TCTCTAAGCCGCTGCACTATT	0.468													52	291	---	---	---	---	PASS
OR8I2	120586	broad.mit.edu	37	11	55861587	55861587	+	Silent	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55861587C>A	uc010rix.1	+	1	804	c.804C>A	c.(802-804)ACC>ACA	p.T268T		NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I,	268	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1	Esophageal squamous(21;0.00693)					CATCGCTGACCCAGGCGCAGG	0.458													23	154	---	---	---	---	PASS
OR8H1	219469	broad.mit.edu	37	11	56057843	56057843	+	Silent	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56057843T>C	uc010rje.1	-	1	696	c.696A>G	c.(694-696)GGA>GGG	p.G232G		NM_001005199	NP_001005199	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H,	232	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	Esophageal squamous(21;0.00448)					CTTTCTGCTTTCCTGAAGTGG	0.378													23	171	---	---	---	---	PASS
TNKS1BP1	85456	broad.mit.edu	37	11	57069961	57069961	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57069961G>A	uc001njr.2	-	6	4967	c.4655C>T	c.(4654-4656)TCC>TTC	p.S1552F	TNKS1BP1_uc001njp.2_Missense_Mutation_p.S124F|TNKS1BP1_uc001njq.2_Missense_Mutation_p.S124F|TNKS1BP1_uc001njs.2_Missense_Mutation_p.S1552F	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	1552	Acidic.				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				CTGACTGGGGGATCTGGCAGG	0.632													10	39	---	---	---	---	PASS
DAK	26007	broad.mit.edu	37	11	61112930	61112930	+	Intron	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61112930C>T	uc001nre.2	+						DDB1_uc010rlf.1_5'Flank|DAK_uc009ynm.1_Intron	NM_015533	NP_056348	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2						glycerol metabolic process	cytosol	ATP binding|FAD-AMP lyase (cyclizing) activity|glycerone kinase activity|metal ion binding				0						GTCATCTTCCCCAGCTCTATG	0.667													4	60	---	---	---	---	PASS
TUT1	64852	broad.mit.edu	37	11	62348921	62348921	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62348921C>T	uc001nto.2	-	3	678	c.640G>A	c.(640-642)GAG>AAG	p.E214K		NM_022830	NP_073741	Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6	176					mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2						AGCTGCCGCTCGGCCTCGGAC	0.607													4	58	---	---	---	---	PASS
SLC22A6	9356	broad.mit.edu	37	11	62747414	62747414	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62747414G>T	uc001nwk.2	-	7	1351	c.1044C>A	c.(1042-1044)GCC>GCA	p.A348A	SLC22A6_uc001nwl.2_Silent_p.A348A|SLC22A6_uc001nwj.2_Silent_p.A348A|SLC22A6_uc001nwm.2_Silent_p.A348A	NM_004790	NP_004781	Q4U2R8	S22A6_HUMAN	solute carrier family 22 member 6 isoform a	348	Helical; (Potential).				alpha-ketoglutarate transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|protein binding				0						CAAAGCTAGTGGCAAACCTAG	0.353													11	72	---	---	---	---	PASS
RTN3	10313	broad.mit.edu	37	11	63519975	63519975	+	Intron	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63519975G>C	uc001nxq.2	+						RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Intron|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Intron|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b						apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						TCTTCTTCTGGAAGAGCCTAC	0.363													37	219	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64419630	64419630	+	Intron	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64419630C>T	uc001oar.2	-						NRXN2_uc001oas.2_Intron|NRXN2_uc001oaq.2_Intron	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor						cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						CCTTTACCTGCGGCACCAAGG	0.587													6	39	---	---	---	---	PASS
KDM2A	22992	broad.mit.edu	37	11	66983428	66983428	+	Intron	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66983428C>G	uc001ojw.2	+						KDM2A_uc001ojx.2_Intron|KDM2A_uc001ojy.2_Intron	NM_012308	NP_036440	Q9Y2K7	KDM2A_HUMAN	F-box and leucine-rich repeat protein 11						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9						AAGGTATGGTCATAGTTGTGA	0.413													67	271	---	---	---	---	PASS
NDUFS8	4728	broad.mit.edu	37	11	67800460	67800460	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67800460G>T	uc001onc.2	+	4	287	c.180G>T	c.(178-180)CTG>CTT	p.L60L	NDUFS8_uc010rpz.1_Silent_p.L60L|NDUFS8_uc009ysb.1_Intron|NDUFS8_uc009ysc.1_Silent_p.L60L	NM_002496	NP_002487	O00217	NDUS8_HUMAN	NADH dehydrogenase ubiquinone Fe-S 8 precursor	60					mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|response to oxidative stress|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity			skin(1)	1					NADH(DB00157)	GCACCCTGCTGTGGACTGAGC	0.657													12	89	---	---	---	---	PASS
PDE2A	5138	broad.mit.edu	37	11	72316271	72316271	+	Splice_Site	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72316271C>T	uc010rrc.1	-	4	478	c.235_splice	c.e4-1	p.E79_splice	PDE2A_uc001oso.2_Splice_Site_p.E58_splice|PDE2A_uc010rra.1_Splice_Site_p.E72_splice|PDE2A_uc001osn.2_Splice_Site_p.E72_splice|PDE2A_uc010rrb.1_Splice_Site_p.E70_splice|PDE2A_uc010rrd.1_Intron	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	AGACAGTTTCCTAGGACAGAA	0.577													13	54	---	---	---	---	PASS
PRKRIR	5612	broad.mit.edu	37	11	76062339	76062339	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76062339T>A	uc001oxh.1	-	5	1855	c.1855A>T	c.(1855-1857)ACG>TCG	p.T619S	PRKRIR_uc010rrz.1_Missense_Mutation_p.T444S	NM_004705	NP_004696	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double	619					negative regulation of cell proliferation|response to stress|signal transduction		DNA binding|metal ion binding|protein dimerization activity			ovary(2)|pancreas(1)	3						TCCTCCGACGTATTGAATTTG	0.418													46	293	---	---	---	---	PASS
AMOTL1	154810	broad.mit.edu	37	11	94554932	94554932	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94554932G>C	uc001pfb.2	+	4	1528	c.1358G>C	c.(1357-1359)CGG>CCG	p.R453P	AMOTL1_uc001pfc.2_Missense_Mutation_p.R403P	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN	angiomotin like 1	453	Potential.					cytoplasm|tight junction	identical protein binding			ovary(1)|breast(1)	2		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				GAGGAGAACCGGGTGCTTCAC	0.572													4	110	---	---	---	---	PASS
CWC15	51503	broad.mit.edu	37	11	94704613	94704613	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94704613C>A	uc001pfd.3	-	3	293	c.170G>T	c.(169-171)CGT>CTT	p.R57L	CWC15_uc009ywl.1_Missense_Mutation_p.R57L|KDM4D_uc001pfe.2_5'Flank	NM_016403	NP_057487	Q9P013	CWC15_HUMAN	CWC15 homolog	57	Potential.				nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome	protein binding|RNA binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CCTGAAGTCACGGTTACGAAC	0.403													5	32	---	---	---	---	PASS
ZNF259	8882	broad.mit.edu	37	11	116649706	116649706	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116649706C>T	uc001ppp.2	-	14	1348	c.1315G>A	c.(1315-1317)GAG>AAG	p.E439K	ZNF259_uc009yzd.2_Missense_Mutation_p.E410K|ZNF259_uc001ppq.2_Missense_Mutation_p.E369K	NM_003904	NP_003895	O75312	ZPR1_HUMAN	zinc finger protein 259	439					cell proliferation|signal transduction	cytoplasm|nucleolus					0	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		CCTAGCTCCTCATTTTGGTCA	0.562													15	111	---	---	---	---	PASS
MFRP	83552	broad.mit.edu	37	11	119216246	119216246	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119216246C>A	uc001pwj.2	-	5	685	c.525G>T	c.(523-525)CAG>CAT	p.Q175H	MFRP_uc010rzf.1_RNA|MFRP_uc010rzg.1_Missense_Mutation_p.Q175H	NM_031433	NP_113621	Q9BXJ0	C1QT5_HUMAN	membrane frizzled-related protein	Error:Variant_position_missing_in_Q9BXJ0_after_alignment						collagen					0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		CTGTGGCCACCTGGATATGCC	0.582													12	91	---	---	---	---	PASS
GRIK4	2900	broad.mit.edu	37	11	120852808	120852808	+	Intron	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120852808C>T	uc001pxn.2	+						GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	TTATCACTTTCTTACAGGCCT	0.328													50	436	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	863029	863029	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:863029C>G	uc001qio.3	+	1	805	c.298C>G	c.(298-300)CTT>GTT	p.L100V	WNK1_uc001qin.2_Missense_Mutation_p.L100V|WNK1_uc001qip.3_Missense_Mutation_p.L100V	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	100					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CGGCCTTCCTCTTTCCCTGCC	0.682													9	32	---	---	---	---	PASS
ART4	420	broad.mit.edu	37	12	14993526	14993526	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14993526C>T	uc001rcl.1	-	2	1072	c.706G>A	c.(706-708)GTA>ATA	p.V236I	ART4_uc009zid.1_Intron|ART4_uc009zie.1_Intron|ART4_uc001rcm.1_Missense_Mutation_p.V236I	NM_021071	NP_066549	Q93070	NAR4_HUMAN	ADP-ribosyltransferase 4 precursor	236					arginine metabolic process|protein ADP-ribosylation	anchored to membrane|plasma membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity				0						AAGTACTGTACAGGTGCACCC	0.468													19	110	---	---	---	---	PASS
SLCO1B3	28234	broad.mit.edu	37	12	21068990	21068990	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21068990T>C	uc001rek.2	+	15	2044	c.1918T>C	c.(1918-1920)TAT>CAT	p.Y640H	SLCO1B3_uc001rel.2_Missense_Mutation_p.Y640H|SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Intron	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	640	Helical; Name=12; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					ACTTGTTTTATATATTGTTTT	0.303													14	75	---	---	---	---	PASS
TMTC1	83857	broad.mit.edu	37	12	29725064	29725064	+	Silent	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29725064C>A	uc001rjb.2	-	9	1656	c.1182G>T	c.(1180-1182)GCG>GCT	p.A394A	TMTC1_uc001riz.2_Silent_p.A151A|TMTC1_uc001rja.2_Silent_p.A238A|TMTC1_uc001rjc.1_Silent_p.A456A	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	502	TPR 1.					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					AGTGGTAGATCGCTTCCTTGT	0.478													12	86	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43821158	43821158	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43821158A>T	uc010skx.1	-	27	4060	c.4060T>A	c.(4060-4062)TGT>AGT	p.C1354S	ADAMTS20_uc001rno.1_Missense_Mutation_p.C472S	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1354	TSP type-1 9.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CCTGGACCACATTGCTGTAAC	0.458													18	92	---	---	---	---	PASS
SENP1	29843	broad.mit.edu	37	12	48440158	48440158	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48440158C>G	uc001rqx.2	-	17	2299	c.1853G>C	c.(1852-1854)AGA>ACA	p.R618T	SENP1_uc001rqw.2_Missense_Mutation_p.R617T|SENP1_uc001rqy.2_Missense_Mutation_p.R419T|SENP1_uc001rqz.2_Missense_Mutation_p.R419T|SENP1_uc009zkx.2_Missense_Mutation_p.R618T	NM_014554	NP_055369	Q9P0U3	SENP1_HUMAN	sentrin/SUMO-specific protease 1	618					activation of caspase activity|induction of apoptosis by extracellular signals|protein desumoylation|proteolysis	cytoplasm|nucleus	endopeptidase activity|SUMO-specific protease activity			pancreas(2)|lung(1)	3		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				GTTGATTGGTCTGTCTTTGGT	0.443													35	178	---	---	---	---	PASS
DDX23	9416	broad.mit.edu	37	12	49231121	49231121	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49231121C>G	uc001rsm.2	-	8	900	c.809G>C	c.(808-810)CGG>CCG	p.R270P		NM_004818	NP_004809	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	270						catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent RNA helicase activity|nucleic acid binding|protein binding			kidney(3)|ovary(1)|lung(1)|skin(1)	6						AACAAATTTCCGGTCATTGAG	0.512													12	130	---	---	---	---	PASS
RHEBL1	121268	broad.mit.edu	37	12	49460814	49460814	+	Nonsense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49460814G>C	uc001rtc.1	-	3	336	c.129C>G	c.(127-129)TAC>TAG	p.Y43*	RHEBL1_uc001rtd.1_Nonsense_Mutation_p.Y39*|RHEBL1_uc009zlc.1_Intron	NM_144593	NP_653194	Q8TAI7	REBL1_HUMAN	Ras homolog enriched in brain like 1 precursor	43	Effector region (By similarity).				positive regulation of NF-kappaB transcription factor activity|small GTPase mediated signal transduction|TOR signaling cascade	cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding			lung(1)|breast(1)	2						CTATCTTGCTGTAAGCTGAAA	0.393													21	119	---	---	---	---	PASS
HOXC12	3228	broad.mit.edu	37	12	54348956	54348956	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54348956C>T	uc010soq.1	+	1	243	c.243C>T	c.(241-243)CGC>CGT	p.R81R		NM_173860	NP_776272	P31275	HXC12_HUMAN	homeobox C12	81					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						CCTTCGGCCGCACGTGCGAGC	0.721													3	9	---	---	---	---	PASS
HOXC12	3228	broad.mit.edu	37	12	54348957	54348957	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54348957A>T	uc010soq.1	+	1	244	c.244A>T	c.(244-246)ACG>TCG	p.T82S		NM_173860	NP_776272	P31275	HXC12_HUMAN	homeobox C12	82					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						CTTCGGCCGCACGTGCGAGCT	0.721													3	9	---	---	---	---	PASS
OR6C1	390321	broad.mit.edu	37	12	55715190	55715190	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55715190C>A	uc010spi.1	+	1	807	c.807C>A	c.(805-807)AGC>AGA	p.S269R		NM_001005182	NP_001005182	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C,	269	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2						TGTCCTTGAGCAAGGGAGTGG	0.423													26	230	---	---	---	---	PASS
IKZF4	64375	broad.mit.edu	37	12	56426419	56426419	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56426419G>C	uc001sjb.1	+	7	949	c.790G>C	c.(790-792)GAG>CAG	p.E264Q	IKZF4_uc010sqa.1_Missense_Mutation_p.E217Q|IKZF4_uc001sjc.1_Missense_Mutation_p.E264Q|IKZF4_uc001sjd.1_Missense_Mutation_p.E162Q|IKZF4_uc009zoi.1_Missense_Mutation_p.E219Q|IKZF4_uc001sje.1_Missense_Mutation_p.E223Q	NM_022465	NP_071910	Q9H2S9	IKZF4_HUMAN	zinc finger protein, subfamily 1A, 4	264	C2H2-type 4.				negative regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)			GAGTACCCTGGAGGAGCACAA	0.547													16	54	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57573625	57573625	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57573625G>A	uc001snd.2	+	30	5493	c.5027G>A	c.(5026-5028)AGC>AAC	p.S1676N		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	1676	Extracellular (Potential).|LDL-receptor class B 14.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TTCTGGACAAGCTATGACACC	0.582													39	197	---	---	---	---	PASS
PIP4K2C	79837	broad.mit.edu	37	12	57994223	57994223	+	Intron	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57994223G>T	uc001sou.2	+						PIP4K2C_uc001sot.2_Intron|PIP4K2C_uc010srs.1_Intron|PIP4K2C_uc010srt.1_Intron	NM_001146258	NP_001139730	Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type							cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding			central_nervous_system(2)|lung(1)	3	Melanoma(17;0.122)					ATGTGGAGGTGATGATTGGGT	0.438													4	47	---	---	---	---	PASS
IL22	50616	broad.mit.edu	37	12	68646350	68646350	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68646350C>A	uc001sty.1	-	3	383	c.330G>T	c.(328-330)AGG>AGT	p.R110S	IL22_uc010stb.1_Missense_Mutation_p.R110S	NM_020525	NP_065386	Q9GZX6	IL22_HUMAN	interleukin 22 precursor	110					acute-phase response	extracellular space	cytokine activity|interleukin-22 receptor binding				0		Myeloproliferative disorder(1001;0.0255)	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;5.06e-05)|BRCA - Breast invasive adenocarcinoma(357;0.00104)		AAGGCTGGAACCTATCAGATT	0.527													16	95	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78516094	78516094	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78516094C>A	uc001syp.2	+	16	4297	c.4124C>A	c.(4123-4125)TCC>TAC	p.S1375Y	NAV3_uc001syo.2_Missense_Mutation_p.S1375Y|NAV3_uc010sub.1_Missense_Mutation_p.S875Y|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1375	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AGCTCTGAGTCCATTGACCTC	0.572										HNSCC(70;0.22)			22	175	---	---	---	---	PASS
PPFIA2	8499	broad.mit.edu	37	12	81777827	81777827	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81777827G>C	uc001szo.1	-	9	1120	c.959C>G	c.(958-960)ACC>AGC	p.T320S	PPFIA2_uc010sue.1_Missense_Mutation_p.T220S|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	246										ovary(3)|lung(2)|pancreas(1)	6						TTGATACTTGGTGTTCATTTC	0.423													9	66	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104106206	104106206	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104106206G>A	uc001tjw.2	+	41	4582	c.4396G>A	c.(4396-4398)GGG>AGG	p.G1466R	STAB2_uc009zug.2_RNA	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1466	Extracellular (Potential).|EGF-like 11.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						CCAAGGAAACGGGACCATCTG	0.512													22	121	---	---	---	---	PASS
KIAA1033	23325	broad.mit.edu	37	12	105543402	105543402	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105543402A>T	uc001tld.2	+	25	2611	c.2524A>T	c.(2524-2526)ACC>TCC	p.T842S	KIAA1033_uc010swr.1_Missense_Mutation_p.T843S|KIAA1033_uc010sws.1_Missense_Mutation_p.T654S	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	842					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						GGTTAATTTCACCTACCAGTT	0.189													8	84	---	---	---	---	PASS
ALDH2	217	broad.mit.edu	37	12	112229892	112229892	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112229892G>A	uc001tst.2	+	8	1264	c.823G>A	c.(823-825)GGG>AGG	p.G275R	ALDH2_uc010syi.1_Missense_Mutation_p.G228R|ALDH2_uc009zvy.2_Missense_Mutation_p.G199R	NM_000690	NP_000681	P05091	ALDH2_HUMAN	mitochondrial aldehyde dehydrogenase 2	275					carbohydrate metabolic process|ethanol oxidation|neurotransmitter biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase|electron carrier activity			skin(2)|ovary(1)|central_nervous_system(1)	4					Disulfiram(DB00822)|Guanidine(DB00536)|NADH(DB00157)|Nitroglycerin(DB00727)	GGTTGCTGCTGGGAGCAGCAA	0.542			T	HMGA2	leiomyoma								12	77	---	---	---	---	PASS
CIT	11113	broad.mit.edu	37	12	120159103	120159103	+	Intron	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120159103C>A	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		ATTCCCTCTGCCAGTCCTCAC	0.308													5	41	---	---	---	---	PASS
TMEM120B	144404	broad.mit.edu	37	12	122181597	122181597	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122181597C>T	uc001ubc.3	+	2	276	c.132C>T	c.(130-132)AGC>AGT	p.S44S	TMEM120B_uc009zxh.2_Silent_p.S44S	NM_001080825	NP_001074294	A0PK00	T120B_HUMAN	transmembrane protein 120B	44	Potential.					integral to membrane					0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		CGCTGTGTAGCAGTTCCATCA	0.552													14	103	---	---	---	---	PASS
GPR109B	8843	broad.mit.edu	37	12	123200969	123200969	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123200969T>A	uc001ucy.3	-	1	471	c.316A>T	c.(316-318)ATG>TTG	p.M106L	GPR81_uc001ucw.1_Intron	NM_006018	NP_006009	P49019	HCAR3_HUMAN	G protein-coupled receptor 109B	106	Helical; Name=3; (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)|skin(1)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.12e-05)|Epithelial(86;3.19e-05)|BRCA - Breast invasive adenocarcinoma(302;0.196)	Mepenzolate(DB04843)|Niacin(DB00627)	ATGGCAAACATGAAGAGCACC	0.552													5	41	---	---	---	---	PASS
PIWIL1	9271	broad.mit.edu	37	12	130840128	130840128	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130840128C>A	uc001uik.2	+	12	1410	c.1320C>A	c.(1318-1320)GAC>GAA	p.D440E	PIWIL1_uc001uij.1_Missense_Mutation_p.D440E	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	440					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		AGCTTCGAGACTGGGGTTTGA	0.378													35	287	---	---	---	---	PASS
STX2	2054	broad.mit.edu	37	12	131311740	131311740	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131311740G>A	uc001uio.2	-	2	270	c.103C>T	c.(103-105)CAG>TAG	p.Q35*	STX2_uc001uip.2_Nonsense_Mutation_p.Q35*|STX2_uc010tbj.1_Nonsense_Mutation_p.Q35*	NM_194356	NP_919337	P32856	STX2_HUMAN	syntaxin 2 isoform 2	35	Potential.|Cytoplasmic (Potential).				acrosome reaction|ectoderm development|intracellular protein transport|organ morphogenesis|signal transduction	basolateral plasma membrane|integral to membrane|microsome|soluble fraction	calcium-dependent protein binding|SNAP receptor activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.79e-06)|all cancers(50;5.27e-05)|Epithelial(86;5.29e-05)		GCTCTTACCTGATGGAAGAAA	0.274													10	124	---	---	---	---	PASS
ELF1	1997	broad.mit.edu	37	13	41524010	41524010	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41524010T>A	uc001uxs.2	-	5	834	c.461A>T	c.(460-462)CAG>CTG	p.Q154L	ELF1_uc010tfc.1_Missense_Mutation_p.Q130L|ELF1_uc010acd.2_Missense_Mutation_p.Q47L	NM_172373	NP_758961	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription	154					positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		TTGCACCTGCTGTGTTTCCAT	0.448													38	212	---	---	---	---	PASS
SLITRK1	114798	broad.mit.edu	37	13	84454819	84454819	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84454819G>C	uc001vlk.2	-	1	1710	c.824C>G	c.(823-825)CCT>CGT	p.P275R		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	275	Extracellular (Potential).					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TTCTTGGGCAGGGGGCGCCGG	0.552													18	73	---	---	---	---	PASS
TPP2	7174	broad.mit.edu	37	13	103301254	103301254	+	Intron	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103301254C>T	uc001vpi.3	+							NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II						proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTTTCTTTTTCAGTATTCTTT	0.348													12	63	---	---	---	---	PASS
OR4K14	122740	broad.mit.edu	37	14	20482746	20482746	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20482746C>A	uc010tky.1	-	1	607	c.607G>T	c.(607-609)GAC>TAC	p.D203Y		NM_001004712	NP_001004712	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K,	203	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		AACCCACTGTCTGAGATCATA	0.512													9	54	---	---	---	---	PASS
OR10G3	26533	broad.mit.edu	37	14	22038006	22038006	+	Silent	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22038006A>G	uc010tmb.1	-	1	870	c.870T>C	c.(868-870)ACT>ACC	p.T290T		NM_001005465	NP_001005465	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G,	290	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|central_nervous_system(1)	2	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)		GGTTCCGCAGAGTGTAGATAA	0.552													23	108	---	---	---	---	PASS
PRMT5	10419	broad.mit.edu	37	14	23398450	23398450	+	Intron	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23398450C>A	uc001whm.1	-						PRMT5_uc001whl.1_5'UTR|PRMT5_uc010akd.1_Intron|PRMT5_uc010tnf.1_5'UTR|PRMT5_uc010tng.1_5'UTR|PRMT5_uc010tnh.1_Intron|PRMT5_uc001whn.1_5'UTR	NM_006109	NP_006100	O14744	ANM5_HUMAN	protein arginine methyltransferase 5 isoform a						cell proliferation|histone H4-R3 methylation|ncRNA metabolic process|regulation of mitosis|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	histone-arginine N-methyltransferase activity|protein binding|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding			ovary(1)	1	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		TCGTGGAGGTCCGGCCCTCAC	0.662													17	93	---	---	---	---	PASS
ACIN1	22985	broad.mit.edu	37	14	23562722	23562722	+	Nonsense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23562722G>C	uc001wit.3	-	2	672	c.344C>G	c.(343-345)TCA>TGA	p.S115*	ACIN1_uc010akg.2_Nonsense_Mutation_p.S115*|ACIN1_uc010tnj.1_Nonsense_Mutation_p.S115*|C14orf119_uc001wiu.2_5'Flank	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	115					apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		ATGGGGTGTTGAGTGTTTCTG	0.438													16	125	---	---	---	---	PASS
ZFP36L1	677	broad.mit.edu	37	14	69256636	69256636	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69256636C>A	uc001xkh.1	-	2	761	c.631G>T	c.(631-633)GCT>TCT	p.A211S	ZFP36L1_uc001xki.1_Missense_Mutation_p.A211S	NM_004926	NP_004917	Q07352	TISB_HUMAN	butyrate response factor 1	211					regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		gcggtggcagcggcACTGGGA	0.587											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	102	---	---	---	---	PASS
FLRT2	23768	broad.mit.edu	37	14	86088661	86088661	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86088661C>T	uc001xvr.2	+	2	1570	c.803C>T	c.(802-804)CCT>CTT	p.P268L	FLRT2_uc010atd.2_Missense_Mutation_p.P268L	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	268	Extracellular (Potential).|LRR 9.				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)		AACCACATTCCTTTGACAGCC	0.473													68	256	---	---	---	---	PASS
CCDC88C	440193	broad.mit.edu	37	14	91792395	91792395	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91792395C>T	uc010aty.2	-	11	1155	c.1056G>A	c.(1054-1056)CTG>CTA	p.L352L		NM_001080414	NP_001073883	Q9P219	DAPLE_HUMAN	DVL-binding protein DAPLE	352	Potential.				microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association			ovary(3)	3		all_cancers(154;0.0468)				TATCTTCTCTCAGCTCCTGGT	0.458													6	20	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94088420	94088420	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94088420C>T	uc001ybv.1	+	28	4459	c.4376C>T	c.(4375-4377)TCA>TTA	p.S1459L	KIAA1409_uc001ybs.1_Missense_Mutation_p.S1437L	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1614						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		TCCTCAGATTCAACCTCGGGG	0.463													27	120	---	---	---	---	PASS
MEG8	79104	broad.mit.edu	37	14	101364329	101364329	+	Intron	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101364329C>G	uc010txl.1	+							NR_024149				Homo sapiens maternally expressed 8 (non-protein coding) (MEG8), non-coding RNA.												0						acactgaggtccattagaaga	0.035													18	80	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28419668	28419668	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28419668C>G	uc001zbj.2	-	65	10036	c.9930G>C	c.(9928-9930)AAG>AAC	p.K3310N		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	3310	RCC1 12.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CGCGTGTGATCTTCTGGCCTT	0.602													12	68	---	---	---	---	PASS
CASC5	57082	broad.mit.edu	37	15	40951662	40951662	+	Intron	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40951662G>C	uc010bbs.1	+						CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AACACTAGGTGAGTAAAGGGC	0.294													22	87	---	---	---	---	PASS
DLL4	54567	broad.mit.edu	37	15	41228522	41228522	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41228522G>T	uc001zng.1	+	9	1657	c.1337G>T	c.(1336-1338)CGT>CTT	p.R446L		NM_019074	NP_061947	Q9NR61	DLL4_HUMAN	delta-like 4 protein precursor	446	EGF-like 7.|Extracellular (Potential).				blood circulation|cell communication|cell differentiation|Notch receptor processing|Notch signaling pathway	integral to membrane|plasma membrane	calcium ion binding|Notch binding			breast(2)	2		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GACTGTGCCCGTAACCCTTGC	0.642													5	17	---	---	---	---	PASS
CATSPER2	117155	broad.mit.edu	37	15	43922915	43922915	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43922915T>G	uc001zsh.2	-	13	1792	c.1577A>C	c.(1576-1578)AAC>ACC	p.N526T	STRC_uc010udz.1_Intron|CATSPER2_uc010bdm.2_RNA|CATSPER2_uc001zsi.2_Missense_Mutation_p.N524T|CATSPER2_uc001zsj.2_Missense_Mutation_p.N524T	NM_172095	NP_742093	Q96P56	CTSR2_HUMAN	sperm-associated cation channel 2 isoform 2	526	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|protein binding|voltage-gated ion channel activity			ovary(1)	1		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		GTCTTCCAAGTTCATCAGTGC	0.383													13	64	---	---	---	---	PASS
MAPK6	5597	broad.mit.edu	37	15	52356574	52356574	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52356574G>A	uc002abp.2	+	6	2337	c.1543G>A	c.(1543-1545)GCT>ACT	p.A515T		NM_002748	NP_002739	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	515					cell cycle		ATP binding|MAP kinase activity			lung(3)|ovary(1)	4				all cancers(107;0.0028)		ACAGCAACTGGCTGGAAAAGA	0.393													3	39	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54305124	54305124	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54305124C>A	uc002ack.2	+	1	24	c.24C>A	c.(22-24)AGC>AGA	p.S8R		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	8					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TTTTCAAGAGCTTGATTTTAC	0.358													10	56	---	---	---	---	PASS
ALDH1A2	8854	broad.mit.edu	37	15	58302913	58302913	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58302913C>T	uc002aex.2	-	4	485	c.427G>A	c.(427-429)GTC>ATC	p.V143I	ALDH1A2_uc002aey.2_Missense_Mutation_p.V143I|ALDH1A2_uc010ugv.1_Missense_Mutation_p.V122I|ALDH1A2_uc010ugw.1_Missense_Mutation_p.V114I|ALDH1A2_uc002aew.2_Missense_Mutation_p.V47I	NM_003888	NP_003879	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1A2 isoform 1	143					negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	GTTTTGATGACGCCCTGCAAA	0.433													23	88	---	---	---	---	PASS
MYO1E	4643	broad.mit.edu	37	15	59516905	59516905	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59516905C>A	uc002aga.2	-	8	1132	c.760G>T	c.(760-762)GAG>TAG	p.E254*		NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE	254	Myosin head-like.				actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)		TCCTGAAACTCCCGCCTGTCG	0.522													13	48	---	---	---	---	PASS
SPESP1	246777	broad.mit.edu	37	15	69238497	69238497	+	Silent	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69238497A>T	uc002arn.1	+	2	752	c.624A>T	c.(622-624)ATA>ATT	p.I208I	NOX5_uc002arp.1_Intron|NOX5_uc002arq.1_Intron|NOX5_uc010bid.1_Intron|NOX5_uc002aro.2_Intron	NM_145658	NP_663633	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1 precursor	208					multicellular organismal development	acrosomal vesicle					0						AAACTGCGATAGAAAAACCCG	0.403													44	167	---	---	---	---	PASS
HCN4	10021	broad.mit.edu	37	15	73616009	73616009	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73616009G>C	uc002avp.2	-	8	3419	c.2425C>G	c.(2425-2427)CCC>GCC	p.P809A		NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic	809	Cytoplasmic (Potential).				blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)		GATCCTGGGGGAGGGCGGAAG	0.692													10	24	---	---	---	---	PASS
CSPG4	1464	broad.mit.edu	37	15	75982045	75982045	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75982045G>C	uc002baw.2	-	3	1454	c.1361C>G	c.(1360-1362)CCC>CGC	p.P454R		NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor	454	Extracellular (Potential).|CSPG 1.|Globular or compact configuration stabilized by disulfide bonds.|Neurite growth inhibition (By similarity).				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3						GTCCAGCGTGGGCTGCACATG	0.642													12	95	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85382199	85382199	+	Intron	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85382199C>T	uc002ble.2	+							NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3						heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CAGTCTCCTGCTTCTTTCTCA	0.363													4	24	---	---	---	---	PASS
IQGAP1	8826	broad.mit.edu	37	15	91027569	91027569	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91027569C>T	uc002bpl.1	+	30	4007	c.3906C>T	c.(3904-3906)ATC>ATT	p.I1302I		NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1302	C2.				energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TTGGTGAAATCATCAACACCC	0.373													22	143	---	---	---	---	PASS
CLUAP1	23059	broad.mit.edu	37	16	3576429	3576429	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3576429C>T	uc002cvk.1	+	9	978	c.873C>T	c.(871-873)CTC>CTT	p.L291L	CLUAP1_uc002cvj.1_Silent_p.L291L|CLUAP1_uc002cvl.1_Silent_p.L291L|CLUAP1_uc002cvm.1_Silent_p.L125L	NM_015041	NP_055856	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1 isoform 1	291	Potential.					nucleus	protein binding			ovary(1)|breast(1)|pancreas(1)	3						AAAACACTCTCTGCCTGATAC	0.478													4	29	---	---	---	---	PASS
CLEC16A	23274	broad.mit.edu	37	16	11272305	11272305	+	Missense_Mutation	SNP	G	T	T	rs74163628		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11272305G>T	uc002dao.2	+	24	3150	c.2920G>T	c.(2920-2922)GTG>TTG	p.V974L	CLEC16A_uc002dap.2_Missense_Mutation_p.V61L	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A	974										ovary(1)|central_nervous_system(1)	2						GAGCGCAGCCGTGGAGACAGC	0.617													9	39	---	---	---	---	PASS
MYH11	4629	broad.mit.edu	37	16	15797886	15797886	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15797886G>C	uc002ddy.2	-	41	5988	c.5881C>G	c.(5881-5883)CGA>GGA	p.R1961G	MYH11_uc002ddv.2_3'UTR|MYH11_uc002ddw.2_3'UTR|MYH11_uc002ddx.2_Missense_Mutation_p.R1968G|MYH11_uc010bvg.2_3'UTR|NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	1961	Carboxyl-terminal.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						TCTGCGTCTCGAGTGTCCGTT	0.448			T	CBFB	AML								51	177	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30736362	30736362	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30736362C>G	uc002dze.1	+	25	6002	c.5617C>G	c.(5617-5619)CGA>GGA	p.R1873G	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.R1668G|SRCAP_uc010bzz.1_Missense_Mutation_p.R1443G	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	1873	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			CCCCCGGCCTCGACGCCAGCC	0.582													20	118	---	---	---	---	PASS
TGFB1I1	7041	broad.mit.edu	37	16	31485212	31485212	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31485212C>T	uc002ecd.1	+	4	265	c.239C>T	c.(238-240)TCC>TTC	p.S80F	TGFB1I1_uc002ece.1_Missense_Mutation_p.S63F|TGFB1I1_uc010caq.1_5'UTR	NM_001042454	NP_001035919	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced	80	Transcription activation (By similarity).|Interaction with PTK2B.				androgen receptor signaling pathway|cell adhesion|negative regulation of cell proliferation|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor beta receptor signaling pathway|transcription from RNA polymerase II promoter|ubiquitin-dependent SMAD protein catabolic process|Wnt receptor signaling pathway	cytoplasm|cytoskeleton|focal adhesion|nuclear matrix	androgen receptor binding|I-SMAD binding|Roundabout binding|transcription coactivator activity|zinc ion binding				0						CCTCCATTCTCCTCTTCCAGC	0.597													9	144	---	---	---	---	PASS
C16orf78	123970	broad.mit.edu	37	16	49433113	49433113	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49433113A>T	uc002efr.2	+	5	765	c.722A>T	c.(721-723)GAT>GTT	p.D241V		NM_144602	NP_653203	Q8WTQ4	CP078_HUMAN	hypothetical protein LOC123970	241										central_nervous_system(1)	1						ATGAATGTGGATATCCACCCC	0.488													23	105	---	---	---	---	PASS
NOD2	64127	broad.mit.edu	37	16	50745449	50745449	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50745449C>T	uc002egm.1	+	4	1732	c.1627C>T	c.(1627-1629)CGC>TGC	p.R543C	NOD2_uc010cbk.1_Missense_Mutation_p.R516C|NOD2_uc002egl.1_Missense_Mutation_p.R321C|NOD2_uc010cbl.1_Missense_Mutation_p.R321C|NOD2_uc010cbm.1_Missense_Mutation_p.R321C|NOD2_uc010cbn.1_RNA|NOD2_uc010cbo.1_RNA|NOD2_uc010cbp.1_5'Flank|NOD2_uc010cbq.1_5'Flank|NOD2_uc010cbr.1_5'Flank	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	543	NACHT.				activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				TCTTCGGGGCCGCCTCCCCAC	0.617													4	85	---	---	---	---	PASS
CMTM3	123920	broad.mit.edu	37	16	66642254	66642254	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66642254G>A	uc002epu.2	+	3	449	c.190G>A	c.(190-192)GCA>ACA	p.A64T	CMTM3_uc002epv.2_Missense_Mutation_p.A64T|CMTM3_uc002epw.2_Missense_Mutation_p.A64T|CMTM3_uc002epx.2_Missense_Mutation_p.A64T|CMTM3_uc002epy.2_RNA	NM_001048251	NP_001041716	Q96MX0	CKLF3_HUMAN	chemokine-like factor superfamily 3	64	MARVEL.|Helical; (Potential).				chemotaxis	extracellular space|integral to membrane	cytokine activity			central_nervous_system(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0671)|Epithelial(162;0.164)		GGCGTCCTCAGCATCTGCCTT	0.527											OREG0023859	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	30	166	---	---	---	---	PASS
CDH16	1014	broad.mit.edu	37	16	66944338	66944338	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66944338G>T	uc002eql.2	-	15	2065	c.1992C>A	c.(1990-1992)GCC>GCA	p.A664A	CDH16_uc010cdy.2_Silent_p.A642A|CDH16_uc002eqm.2_Silent_p.A567A	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor	664	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		CAAGAGTCAGGGCTGGGGCAG	0.632													31	93	---	---	---	---	PASS
ZDHHC1	29800	broad.mit.edu	37	16	67432782	67432782	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67432782T>A	uc010vjm.1	-	6	900	c.596A>T	c.(595-597)TAT>TTT	p.Y199F		NM_013304	NP_037436	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	199	Helical; (Potential).					integral to membrane	DNA binding|zinc ion binding				0		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		CACGAAGACATATGTGGCCAC	0.592													9	23	---	---	---	---	PASS
ADAT1	23536	broad.mit.edu	37	16	75646552	75646552	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75646552C>A	uc002feo.1	-	7	734	c.632G>T	c.(631-633)GGA>GTA	p.G211V	ADAT1_uc002fep.1_Missense_Mutation_p.G62V	NM_012091	NP_036223	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	211	A to I editase.				tRNA processing		metal ion binding|RNA binding|tRNA-specific adenosine deaminase activity			ovary(1)|skin(1)	2						GTGAGCTGCTCCGTTGGTGAC	0.522													28	154	---	---	---	---	PASS
WWOX	51741	broad.mit.edu	37	16	79245607	79245607	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79245607G>A	uc002ffk.2	+	9	1284	c.1159G>A	c.(1159-1161)GAA>AAA	p.E387K	WWOX_uc010vnk.1_Missense_Mutation_p.E274K|WWOX_uc002ffl.2_Missense_Mutation_p.E207K|WWOX_uc010che.2_Missense_Mutation_p.R171K	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1	387	Interaction with MAPT (By similarity).				apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		GCCCTCACCAGAAGCTCAGAG	0.622													23	82	---	---	---	---	PASS
PKD1L2	114780	broad.mit.edu	37	16	81190635	81190635	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81190635G>A	uc002fgh.1	-	24	3954	c.3954C>T	c.(3952-3954)TTC>TTT	p.F1318F	PKD1L2_uc002fgg.1_RNA	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	1318	GPS.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						ACGTGCTTCCGAAGAAAGTGA	0.577													5	14	---	---	---	---	PASS
OR3A4	390756	broad.mit.edu	37	17	3214573	3214573	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3214573C>T	uc002fvi.2	+	1	1035	c.969C>T	c.(967-969)TGC>TGT	p.C323C		NR_024128				RecName: Full=Olfactory receptor 3A4; AltName: Full=Olfactory receptor 17-24;          Short=OR17-24;											ovary(1)	1						GTTCCCTATGCTGCCTGCAGT	0.572													26	94	---	---	---	---	PASS
DVL2	1856	broad.mit.edu	37	17	7130726	7130726	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7130726G>A	uc002gez.1	-	12	1642	c.1360C>T	c.(1360-1362)CTG>TTG	p.L454L	DVL2_uc010vtr.1_Silent_p.L448L	NM_004422	NP_004413	O14641	DVL2_HUMAN	dishevelled 2	454	DEP.				canonical Wnt receptor signaling pathway involved in regulation of cell proliferation|intracellular signal transduction|neural tube closure|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|segment specification|transcription from RNA polymerase II promoter	cytosol|nucleus|plasma membrane	frizzled binding|identical protein binding|signal transducer activity			lung(1)|kidney(1)	2						GCCATACCCAGAAAGGCATTA	0.597													17	69	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	C	C	rs121912666		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578190T>C	uc002gim.2	-	6	853	c.659A>G	c.(658-660)TAT>TGT	p.Y220C	TP53_uc002gig.1_Missense_Mutation_p.Y220C|TP53_uc002gih.2_Missense_Mutation_p.Y220C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y88C|TP53_uc010cng.1_Missense_Mutation_p.Y88C|TP53_uc002gii.1_Missense_Mutation_p.Y88C|TP53_uc010cnh.1_Missense_Mutation_p.Y220C|TP53_uc010cni.1_Missense_Mutation_p.Y220C|TP53_uc002gij.2_Missense_Mutation_p.Y220C|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.Y127C|TP53_uc002gio.2_Missense_Mutation_p.Y88C|TP53_uc010vug.1_Missense_Mutation_p.Y181C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	220	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> N (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y220C(205)|p.Y220N(12)|p.Y220H(9)|p.Y220S(9)|p.0?(7)|p.Y220fs*27(4)|p.Y220*(3)|p.Y220D(2)|p.Y127C(2)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.?(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*1(1)|p.Y220fs*2(1)|p.V218fs*26(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AGGCGGCTCATAGGGCACCAC	0.557		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			11	36	---	---	---	---	PASS
C17orf59	54785	broad.mit.edu	37	17	8093017	8093017	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8093017C>T	uc010vut.1	-	1	548	c.442G>A	c.(442-444)GAG>AAG	p.E148K		NM_017622	NP_060092	Q96GS4	CQ059_HUMAN	hypothetical protein LOC54785	148											0						GCGGCCGCCTCCTCGTCGTTG	0.731													3	27	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10322129	10322129	+	Intron	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10322129C>A	uc002gmm.2	-						uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,						muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						CTGGGAAGATCAGAACATTTA	0.488									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				18	127	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10322130	10322130	+	Intron	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10322130A>G	uc002gmm.2	-						uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,						muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						TGGGAAGATCAGAACATTTAT	0.493									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				18	126	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10354133	10354133	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10354133C>G	uc002gmn.2	-	29	4056	c.3945G>C	c.(3943-3945)CAG>CAC	p.Q1315H	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1315	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						ATTCTTCAATCTGTTGTGTAA	0.403													30	167	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10404771	10404771	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10404771A>C	uc002gmo.2	-	27	3488	c.3394T>G	c.(3394-3396)TCC>GCC	p.S1132A	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1132	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TTGGCCCGGGAGGCCCGCTCT	0.567													13	100	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26967595	26967595	+	Silent	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26967595G>C	uc002hbu.2	-	8	972	c.873C>G	c.(871-873)TCC>TCG	p.S291S	KIAA0100_uc002hbv.2_Silent_p.S291S|KIAA0100_uc010crr.1_Silent_p.S148S	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor	291						extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					GACTATTCATGGACAATACCA	0.478													20	104	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29509539	29509539	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29509539G>C	uc002hgg.2	+	8	1077	c.744G>C	c.(742-744)AAG>AAC	p.K248N	NF1_uc002hge.1_Missense_Mutation_p.K248N|NF1_uc002hgf.1_Missense_Mutation_p.K248N|NF1_uc002hgh.2_Missense_Mutation_p.K248N|NF1_uc010csn.1_Missense_Mutation_p.K108N	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	248					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GTGCAGAAAAGCTATTTGACT	0.358			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			4	69	---	---	---	---	PASS
RHOT1	55288	broad.mit.edu	37	17	30533963	30533963	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30533963A>C	uc002hgz.2	+	17	1690	c.1451A>C	c.(1450-1452)GAA>GCA	p.E484A	RHOT1_uc002hgw.2_Missense_Mutation_p.E484A|RHOT1_uc002hgy.2_Missense_Mutation_p.E484A|RHOT1_uc002hha.2_Missense_Mutation_p.E357A|RHOT1_uc010csv.2_RNA|RHOT1_uc002hgx.2_Missense_Mutation_p.E357A|RHOT1_uc010wby.1_Missense_Mutation_p.E484A|RHOT1_uc002hhb.2_Missense_Mutation_p.E463A|RHOT1_uc002hgv.2_Missense_Mutation_p.E484A	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN	ras homolog gene family, member T1 isoform 3	484	Miro 2.|Mitochondrial intermembrane (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				TTTCTAACTGAAGCTGAAATC	0.318													26	112	---	---	---	---	PASS
ZNF207	7756	broad.mit.edu	37	17	30696607	30696607	+	Intron	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30696607C>G	uc002hhh.3	+						ZNF207_uc002hhj.3_Intron|ZNF207_uc002hhi.3_Intron|ZNF207_uc010csz.2_Intron|ZNF207_uc002hhk.1_Intron|ZNF207_uc002hhl.1_Intron	NM_003457	NP_003448	O43670	ZN207_HUMAN	zinc finger protein 207 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			GTTTGAAATTCTTGATTTTAG	0.413													9	50	---	---	---	---	PASS
KRT9	3857	broad.mit.edu	37	17	39726126	39726126	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39726126C>G	uc002hxe.3	-	3	933	c.867G>C	c.(865-867)AAG>AAC	p.K289N	JUP_uc010wfs.1_Intron	NM_000226	NP_000217	P35527	K1C9_HUMAN	keratin 9	289	Rod.|Coil 1B.				intermediate filament organization|skin development		protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Breast(137;0.000307)				TATGATTCTTCTTGAGGGCCA	0.537													49	212	---	---	---	---	PASS
G6PC	2538	broad.mit.edu	37	17	41052951	41052951	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41052951C>T	uc002icb.1	+	1	137	c.58C>T	c.(58-60)CAG>TAG	p.Q20*	LOC388387_uc002ibz.2_5'Flank|LOC388387_uc002iby.2_5'Flank|LOC388387_uc002ica.2_5'Flank|LOC388387_uc010whe.1_5'Flank|G6PC_uc010whf.1_Nonsense_Mutation_p.Q22*	NM_000151	NP_000142	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	20	Lumenal (Potential).		Q -> R (in GSD1A).		gluconeogenesis|glucose homeostasis|transmembrane transport	integral to endoplasmic reticulum membrane	glucose-6-phosphatase activity|phosphate binding			ovary(1)|breast(1)|kidney(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		ACATTACCTCCAGGTGAATTA	0.502									Glycogen_Storage_Disease_type_Ia				23	109	---	---	---	---	PASS
UBTF	7343	broad.mit.edu	37	17	42287485	42287485	+	Intron	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42287485T>C	uc002igb.2	-						UBTF_uc002igc.2_Intron|UBTF_uc010czs.2_Intron|UBTF_uc002igd.2_Intron|UBTF_uc010czt.2_Intron|UBTF_uc002ige.2_Intron	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA						positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CCCAGCCCCATTCCTACCTCA	0.348											OREG0024456	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	51	200	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51901872	51901872	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51901872C>T	uc002iua.2	+	1	1634	c.1478C>T	c.(1477-1479)CCA>CTA	p.P493L	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	493					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						CCTCACACCCCATTCAGAGCC	0.527													12	58	---	---	---	---	PASS
MAP2K6	5608	broad.mit.edu	37	17	67513758	67513758	+	Intron	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67513758G>C	uc002jij.2	+						MAP2K6_uc002jii.2_Intron|MAP2K6_uc002jik.2_Intron	NM_002758	NP_002749	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6						activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)					AGTGAAGGTAGAGTTGACATT	0.488													8	29	---	---	---	---	PASS
TTYH2	94015	broad.mit.edu	37	17	72245212	72245212	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72245212C>T	uc002jkc.2	+	7	898	c.867C>T	c.(865-867)ATC>ATT	p.I289I	TTYH2_uc010wqw.1_Silent_p.I268I|TTYH2_uc002jkd.2_5'UTR	NM_032646	NP_116035	Q9BSA4	TTYH2_HUMAN	tweety 2 isoform 1	289	Extracellular (Potential).					chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4						AGGGCCAGATCAGCACAGGTA	0.572													16	53	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5423483	5423483	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5423483C>A	uc002kmt.1	-	11	1319	c.1233G>T	c.(1231-1233)AGG>AGT	p.R411S	EPB41L3_uc010wzh.1_Missense_Mutation_p.R411S|EPB41L3_uc002kmu.1_Missense_Mutation_p.R411S|EPB41L3_uc010dkq.1_Missense_Mutation_p.R302S|EPB41L3_uc010dkr.2_5'UTR	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	411	Hydrophilic.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						GCGCTTGTGTCCTGCCACTAT	0.458													8	60	---	---	---	---	PASS
ANKRD12	23253	broad.mit.edu	37	18	9254883	9254883	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9254883A>T	uc002knv.2	+	9	1875	c.1618A>T	c.(1618-1620)ACT>TCT	p.T540S	ANKRD12_uc002knw.2_Missense_Mutation_p.T517S|ANKRD12_uc002knx.2_Missense_Mutation_p.T517S|ANKRD12_uc010dkx.1_Missense_Mutation_p.T247S	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	540						nucleus				ovary(2)|central_nervous_system(1)	3						TCATATTTCCACTGGTAAATC	0.348													7	84	---	---	---	---	PASS
CEP192	55125	broad.mit.edu	37	18	13113642	13113642	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13113642G>C	uc010xac.1	+	41	7185	c.7105G>C	c.(7105-7107)GAA>CAA	p.E2369Q	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.E1894Q|CEP192_uc002kru.2_Intron|CEP192_uc002krv.2_Missense_Mutation_p.E791Q|CEP192_uc002krw.2_Missense_Mutation_p.E518Q|CEP192_uc002krx.2_Missense_Mutation_p.E373Q|CEP192_uc002kry.2_Intron	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	2369										ovary(4)|pancreas(1)	5						TTGGGATGTTGAATGTCACCC	0.398													26	148	---	---	---	---	PASS
FAM59A	64762	broad.mit.edu	37	18	29867683	29867683	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29867683G>A	uc002kxl.2	-	4	933	c.877C>T	c.(877-879)CTC>TTC	p.L293F	FAM59A_uc002kxk.1_Missense_Mutation_p.L293F	NM_022751	NP_073588	Q9H706	FA59A_HUMAN	family with sequence similarity 59, member A	293	CABIT.									ovary(1)|skin(1)	2						TGCATGGGGAGGATCTTGTTG	0.547													25	109	---	---	---	---	PASS
PIK3C3	5289	broad.mit.edu	37	18	39637940	39637940	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39637940G>T	uc002lap.2	+	22	2415	c.2357G>T	c.(2356-2358)GGA>GTA	p.G786V	PIK3C3_uc010xcl.1_Missense_Mutation_p.G723V|PIK3C3_uc002laq.2_Missense_Mutation_p.G271V	NM_002647	NP_002638	Q8NEB9	PK3C3_HUMAN	catalytic phosphatidylinositol 3-kinase 3	786	PI3K/PI4K.				cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding			lung(8)|ovary(1)|breast(1)	10						ATGGTAGAAGGAATGGGGGGC	0.473										TSP Lung(28;0.18)			13	72	---	---	---	---	PASS
WDR7	23335	broad.mit.edu	37	18	54423947	54423947	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54423947C>T	uc002lgk.1	+	15	2334	c.2123C>T	c.(2122-2124)TCT>TTT	p.S708F	WDR7_uc010dpk.1_RNA|WDR7_uc002lgl.1_Missense_Mutation_p.S708F	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1	708										ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		GAAGAAGCCTCTAGGCCGAAT	0.428													18	140	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56247398	56247398	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56247398C>T	uc002lhj.3	-	4	824	c.610G>A	c.(610-612)GAT>AAT	p.D204N		NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	204							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						TTACTTGGATCATAAGCCTCT	0.398													13	347	---	---	---	---	PASS
PTPRS	5802	broad.mit.edu	37	19	5243974	5243974	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5243974G>A	uc002mbv.2	-	11	1742	c.1508C>T	c.(1507-1509)GCC>GTC	p.A503V	PTPRS_uc002mbu.1_Missense_Mutation_p.A490V|PTPRS_uc010xin.1_Missense_Mutation_p.A490V|PTPRS_uc002mbw.2_Missense_Mutation_p.A490V|PTPRS_uc002mbx.2_Missense_Mutation_p.A494V|PTPRS_uc002mby.2_Missense_Mutation_p.A490V	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	503	Extracellular (Potential).|Fibronectin type-III 2.				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		GGAGGTGAAGGCGAGCACCCG	0.706													8	21	---	---	---	---	PASS
DUS3L	56931	broad.mit.edu	37	19	5785396	5785396	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5785396G>C	uc002mdc.2	-	12	1975	c.1878C>G	c.(1876-1878)ATC>ATG	p.I626M	PRR22_uc002mdb.1_5'Flank|PRR22_uc010xiv.1_5'Flank|DUS3L_uc002mdd.2_Missense_Mutation_p.I384M|DUS3L_uc010duk.2_Missense_Mutation_p.I291M	NM_020175	NP_064560	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like isoform 1	626					tRNA processing		flavin adenine dinucleotide binding|nucleic acid binding|tRNA dihydrouridine synthase activity|zinc ion binding				0						CCAGGCACCTGATGCGGATCC	0.672													4	10	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9006672	9006672	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9006672G>C	uc002mkp.2	-	44	39780	c.39576C>G	c.(39574-39576)TTC>TTG	p.F13192L	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.F9L|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13194	SEA 8.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCGTGATGTTGAACTTCCTGG	0.532													35	175	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9033667	9033667	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9033667G>A	uc002mkp.2	-	9	36474	c.36270C>T	c.(36268-36270)GAC>GAT	p.D12090D		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12092	SEA 1.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGTGCCGCATGTCCTCCTCGT	0.587													14	63	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9083649	9083649	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9083649G>T	uc002mkp.2	-	1	8370	c.8166C>A	c.(8164-8166)CTC>CTA	p.L2722L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2722	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AAGAAGGATGGAGTGGACTTT	0.468													20	121	---	---	---	---	PASS
ZNF443	10224	broad.mit.edu	37	19	12541212	12541212	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12541212G>A	uc002mtu.2	-	4	1972	c.1774C>T	c.(1774-1776)CAA>TAA	p.Q592*		NM_005815	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	592	C2H2-type 17.				induction of apoptosis|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						TTACCACATTGTGGACATTCA	0.408													39	175	---	---	---	---	PASS
OR7A10	390892	broad.mit.edu	37	19	14952021	14952021	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14952021G>A	uc002mzx.1	-	1	669	c.669C>T	c.(667-669)TCC>TCT	p.S223S		NM_001005190	NP_001005190	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A,	223	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					CACGTATGGAGGAAACTATCT	0.458													9	81	---	---	---	---	PASS
ZNF585A	199704	broad.mit.edu	37	19	37644315	37644315	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37644315T>A	uc002ofo.1	-	5	717	c.486A>T	c.(484-486)GAA>GAT	p.E162D	ZNF585A_uc002ofm.1_Missense_Mutation_p.E107D|ZNF585A_uc002ofn.1_Missense_Mutation_p.E107D	NM_199126	NP_954577	Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	162	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCTTCCCACATTCAATGCATA	0.373													34	249	---	---	---	---	PASS
ZNF383	163087	broad.mit.edu	37	19	37733871	37733871	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37733871C>G	uc002oft.1	+	8	1313	c.733C>G	c.(733-735)CAG>GAG	p.Q245E	ZNF383_uc002ofs.1_Missense_Mutation_p.Q180E|ZNF383_uc002ofu.1_Missense_Mutation_p.Q245E	NM_152604	NP_689817	Q8NA42	ZN383_HUMAN	zinc finger protein 383	245	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTCTCAACATCAGAGAATCCA	0.408													27	101	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38985056	38985056	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38985056C>A	uc002oit.2	+	39	6469	c.6339C>A	c.(6337-6339)AGC>AGA	p.S2113R	RYR1_uc002oiu.2_Missense_Mutation_p.S2113R|RYR1_uc002oiv.1_5'Flank	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2113	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	TCGTGCAGAGCCCCGAGCTGG	0.662													13	56	---	---	---	---	PASS
NFKBIB	4793	broad.mit.edu	37	19	39398189	39398189	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39398189C>G	uc002ojw.2	+	5	917	c.859C>G	c.(859-861)CCC>GCC	p.P287A	NFKBIB_uc002ojx.2_Missense_Mutation_p.P255A|NFKBIB_uc002ojy.2_Missense_Mutation_p.P287A	NM_002503	NP_002494	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene	287	ANK 6.				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleus	protein binding|signal transducer activity|transcription coactivator activity			lung(1)|kidney(1)	2	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CCGGCCCAACCCCATCCTCGC	0.701													12	48	---	---	---	---	PASS
QPCTL	54814	broad.mit.edu	37	19	46205165	46205165	+	Silent	SNP	C	G	G	rs140632651		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46205165C>G	uc010xxr.1	+	6	1217	c.996C>G	c.(994-996)CTC>CTG	p.L332L	QPCTL_uc010ekn.2_Silent_p.L238L	NM_017659	NP_060129	Q9NXS2	QPCTL_HUMAN	glutaminyl-peptide cyclotransferase-like isoform	332					peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase|proteolysis	Golgi membrane|integral to membrane	acyltransferase activity|glutaminyl-peptide cyclotransferase activity|peptidase activity|protein binding|zinc ion binding			skin(1)	1		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0059)|GBM - Glioblastoma multiforme(486;0.0882)|Epithelial(262;0.208)		TCCCCTTCCTCCGCAGAGGTA	0.597													10	64	---	---	---	---	PASS
QPCTL	54814	broad.mit.edu	37	19	46206205	46206205	+	Silent	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46206205C>G	uc010xxr.1	+	7	1268	c.1047C>G	c.(1045-1047)GTC>GTG	p.V349V	QPCTL_uc010ekn.2_Silent_p.V255V	NM_017659	NP_060129	Q9NXS2	QPCTL_HUMAN	glutaminyl-peptide cyclotransferase-like isoform	349					peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase|proteolysis	Golgi membrane|integral to membrane	acyltransferase activity|glutaminyl-peptide cyclotransferase activity|peptidase activity|protein binding|zinc ion binding			skin(1)	1		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0059)|GBM - Glioblastoma multiforme(486;0.0882)|Epithelial(262;0.208)		TCCCTGCTGTCTGGCACACCC	0.602													39	200	---	---	---	---	PASS
IRF2BP1	26145	broad.mit.edu	37	19	46388288	46388288	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46388288C>A	uc002pds.1	-	1	1089	c.745G>T	c.(745-747)GAT>TAT	p.D249Y		NM_015649	NP_056464	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein	249					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		AGCCCGTGATCCTTCTTGAAG	0.632													23	93	---	---	---	---	PASS
HRC	3270	broad.mit.edu	37	19	49654551	49654551	+	3'UTR	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49654551G>T	uc002pmv.2	-	6						NM_002152	NP_002143	P23327	SRCH_HUMAN	histidine rich calcium binding protein						muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			ovary(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		CGAGCGACTGGGTCAGGGTTC	0.527													3	5	---	---	---	---	PASS
PRR12	57479	broad.mit.edu	37	19	50097967	50097967	+	Silent	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50097967A>T	uc002poo.3	+	4	375	c.375A>T	c.(373-375)CCA>CCT	p.P125P		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	539	Pro-rich.						DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		TGCACACGCCAGGCCCCACGG	0.652													7	21	---	---	---	---	PASS
KCNC3	3748	broad.mit.edu	37	19	50827098	50827098	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50827098G>C	uc002pru.1	-	2	1407	c.1112C>G	c.(1111-1113)CCA>CGA	p.P371R	KCNC3_uc002prt.1_Missense_Mutation_p.P7R	NM_004977	NP_004968	Q14003	KCNC3_HUMAN	Shaw-related voltage-gated potassium channel	371	Cytoplasmic (Potential).				cell death	voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)		CACCTTGTCTGGGCAGAAGGT	0.582													13	77	---	---	---	---	PASS
ZNF649	65251	broad.mit.edu	37	19	52395145	52395145	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52395145C>G	uc002pxy.2	-	5	512	c.244G>C	c.(244-246)GAG>CAG	p.E82Q	ZNF577_uc010ydf.1_5'Flank	NM_023074	NP_075562	Q9BS31	ZN649_HUMAN	zinc finger protein 649	82					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		TCAGCTTTCTCAATTTCTAAG	0.413													17	112	---	---	---	---	PASS
ZNF616	90317	broad.mit.edu	37	19	52627196	52627196	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52627196T>C	uc002pym.2	-	3	402	c.119A>G	c.(118-120)TAT>TGT	p.Y40C	ZNF616_uc002pyn.2_RNA	NM_178523	NP_848618	Q08AN1	ZN616_HUMAN	zinc finger protein 616	40	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		CAGGTTCCTATAGTTCTCCAA	0.433													24	127	---	---	---	---	PASS
PPP2R1A	5518	broad.mit.edu	37	19	52723126	52723126	+	Intron	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52723126G>A	uc002pyp.2	+						PPP2R1A_uc010ydk.1_Intron|PPP2R1A_uc002pyq.2_Intron	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein						ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		TGGTGAGTGAGGAGGCCTGGG	0.632			Mis		clear cell ovarian carcinoma								3	44	---	---	---	---	PASS
ZNF600	162966	broad.mit.edu	37	19	53269954	53269954	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53269954T>A	uc002qab.3	-	3	1341	c.1055A>T	c.(1054-1056)CAC>CTC	p.H352L		NM_198457	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	352	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		CTCTCCAGTGTGAATTCTTTT	0.398													34	200	---	---	---	---	PASS
ZNF665	79788	broad.mit.edu	37	19	53669219	53669219	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53669219C>T	uc010eqm.1	-	4	624	c.524G>A	c.(523-525)GGA>GAA	p.G175E		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	110					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)		ATAATGTTTTCCTCGATTATT	0.383													42	242	---	---	---	---	PASS
LILRB2	10288	broad.mit.edu	37	19	54782843	54782843	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54782843C>T	uc002qfb.2	-	6	1045	c.779G>A	c.(778-780)GGG>GAG	p.G260E	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Missense_Mutation_p.G260E|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Missense_Mutation_p.G260E|LILRB2_uc010yet.1_Missense_Mutation_p.G144E|LILRB2_uc010yeu.1_RNA	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	260	Extracellular (Potential).|Ig-like C2-type 3.				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTCACGTTCCCCCTCCTTGTA	0.652													24	94	---	---	---	---	PASS
KIR2DL3	3804	broad.mit.edu	37	19	55253692	55253692	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55253692G>A	uc002qgv.2	+	3	355	c.337G>A	c.(337-339)GCT>ACT	p.A113T	KIR2DL3_uc002qgx.2_Missense_Mutation_p.A113T|KIR2DL3_uc002qgy.2_Missense_Mutation_p.A113T|KIR2DL3_uc010erw.1_Missense_Mutation_p.A113T|KIR2DL1_uc002qgz.1_Missense_Mutation_p.A23T|KIR2DL3_uc002qha.1_RNA	NM_015868	NP_056952	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two	113	Extracellular (Potential).				immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		TCAGTTGTCAGCTCCCAGTGA	0.532													39	377	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56223865	56223865	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56223865G>C	uc002qly.2	-	7	2621	c.2593C>G	c.(2593-2595)CAT>GAT	p.H865D		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	865	LRR 5.					cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		ATTTCATTATGCCCAAGTTTC	0.458													11	94	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56487670	56487670	+	Splice_Site	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56487670G>C	uc002qmh.2	+	8	2947	c.2876_splice	c.e8+1	p.E959_splice	NLRP8_uc010etg.2_Splice_Site_p.E940_splice	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8							cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		AGATCCTGGAGTAAGTGGCCC	0.453													14	81	---	---	---	---	PASS
ZNF471	57573	broad.mit.edu	37	19	57036767	57036767	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57036767C>T	uc002qnh.2	+	5	1464	c.1331C>T	c.(1330-1332)GCA>GTA	p.A444V		NM_020813	NP_065864	Q9BX82	ZN471_HUMAN	zinc finger protein 471	444	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		AGCCATCATGCATCACTCACT	0.418													8	160	---	---	---	---	PASS
NOP56	10528	broad.mit.edu	37	20	2638797	2638797	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2638797G>C	uc002wgh.2	+	12	1695	c.1642G>C	c.(1642-1644)GAG>CAG	p.E548Q	NOP56_uc010zpy.1_RNA|NOP56_uc002wgi.2_Missense_Mutation_p.E382Q|NOP56_uc002wgm.1_3'UTR	NM_006392	NP_006383	O00567	NOP56_HUMAN	nucleolar protein 5A	548	Lys-rich.				rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding			ovary(1)|pancreas(1)	2						TAATGACCCTGAGGAGGCAGG	0.537													9	22	---	---	---	---	PASS
SLC4A11	83959	broad.mit.edu	37	20	3218260	3218260	+	Silent	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3218260A>G	uc002wig.2	-	1	114	c.66T>C	c.(64-66)GCT>GCC	p.A22A	SLC4A11_uc010zqe.1_Intron|SLC4A11_uc002wih.2_Intron|SLC4A11_uc010zqf.1_Intron	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	22	Cytoplasmic (Potential).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1						AAAGGTCACCAGCCCCATGGA	0.592													37	177	---	---	---	---	PASS
PLCB4	5332	broad.mit.edu	37	20	9459642	9459642	+	3'UTR	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9459642C>A	uc002wnf.2	+	37					PLCB4_uc010gbx.2_3'UTR|PLCB4_uc002wne.2_Missense_Mutation_p.Q1191K|PLCB4_uc002wnh.2_3'UTR	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						TATGAAACTCCAAAATGCAAA	0.433													7	37	---	---	---	---	PASS
JAG1	182	broad.mit.edu	37	20	10639146	10639146	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10639146C>A	uc002wnw.2	-	4	1180	c.664G>T	c.(664-666)GAA>TAA	p.E222*		NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor	222	Extracellular (Potential).|DSL.				angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						ATCCAGCCTTCCATGCAAGTT	0.498									Alagille_Syndrome				48	184	---	---	---	---	PASS
C20orf12	55184	broad.mit.edu	37	20	18379240	18379240	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18379240G>C	uc010zsa.1	-	14	1729	c.1520C>G	c.(1519-1521)TCT>TGT	p.S507C	C20orf12_uc010zrz.1_Missense_Mutation_p.S26C|C20orf12_uc002wqp.3_Missense_Mutation_p.S198C|C20orf12_uc002wqr.3_RNA|C20orf12_uc002wqs.3_Missense_Mutation_p.S374C|C20orf12_uc002wqq.3_Missense_Mutation_p.S488C	NM_001099407	NP_001092877	Q9NVP4	CT012_HUMAN	hypothetical protein LOC55184	315						intracellular	zinc ion binding			ovary(1)	1		Myeloproliferative disorder(85;0.0122)				GAGGTGAGCAGAGATGTGATC	0.433													46	185	---	---	---	---	PASS
BPIL3	128859	broad.mit.edu	37	20	31622639	31622639	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31622639G>T	uc010zuc.1	+	4	373	c.373G>T	c.(373-375)GAG>TAG	p.E125*	BPIL3_uc010zud.1_Nonsense_Mutation_p.E64*	NM_174897	NP_777557	Q8NFQ5	BPIL3_HUMAN	bactericidal/permeability-increasing	125						extracellular region	lipid binding			ovary(1)|pancreas(1)	2						TCTGCGGGATGAGGAGACAGG	0.592													20	114	---	---	---	---	PASS
PLUNC	51297	broad.mit.edu	37	20	31825567	31825567	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31825567C>A	uc002wyv.2	+	2	120	c.50C>A	c.(49-51)ACC>AAC	p.T17N	PLUNC_uc002wyt.3_Missense_Mutation_p.T17N|PLUNC_uc002wyu.3_Missense_Mutation_p.T17N	NM_130852	NP_570913	Q9NP55	PLUNC_HUMAN	palate, lung and nasal epithelium associated	17					innate immune response	extracellular region	lipid binding				0						TTAGCCCAGACCATGGCCCAG	0.562													14	107	---	---	---	---	PASS
LBP	3929	broad.mit.edu	37	20	36975032	36975032	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36975032G>C	uc002xic.1	+	1	148	c.113G>C	c.(112-114)GGA>GCA	p.G38A		NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor	38					acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				ACCGACAAGGGACTGCAGTAT	0.622													8	60	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40730766	40730766	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40730766C>G	uc002xkg.2	-	26	3896	c.3712G>C	c.(3712-3714)GAT>CAT	p.D1238H	PTPRT_uc010ggj.2_Missense_Mutation_p.D1257H|PTPRT_uc010ggi.2_Missense_Mutation_p.D441H	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1238	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CGGCTTACATCCATCAGTGCT	0.557													11	88	---	---	---	---	PASS
C20orf85	128602	broad.mit.edu	37	20	56735872	56735872	+	Silent	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56735872G>C	uc002xyv.2	+	4	446	c.408G>C	c.(406-408)GTG>GTC	p.V136V		NM_178456	NP_848551	Q9H1P6	CT085_HUMAN	hypothetical protein LOC128602	136										ovary(1)	1	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)			AGCAGGGCGTGCACTGAATCC	0.607													8	45	---	---	---	---	PASS
TH1L	51497	broad.mit.edu	37	20	57569689	57569689	+	Intron	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57569689C>G	uc002yag.2	+						TH1L_uc002yaf.1_Intron|TH1L_uc002yah.2_Intron	NM_198976	NP_945327	Q8IXH7	NELFD_HUMAN	TH1-like protein						negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	all_lung(29;0.00711)		Colorectal(105;0.109)			CTGTTTTCCTCGTTAAAGCTC	0.303													13	119	---	---	---	---	PASS
OSBPL2	9885	broad.mit.edu	37	20	60866755	60866755	+	Intron	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60866755C>T	uc002yck.1	+						OSBPL2_uc002ycl.1_Intron|OSBPL2_uc011aah.1_Intron	NM_144498	NP_653081	Q9H1P3	OSBL2_HUMAN	oxysterol-binding protein-like protein 2 isoform						lipid transport		lipid binding			ovary(1)|central_nervous_system(1)	2	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			TGCTTGGATCCTAGATCTGGC	0.587													14	66	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22881368	22881368	+	Silent	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22881368T>A	uc002yld.1	+	16	2523	c.2274T>A	c.(2272-2274)GCT>GCA	p.A758A	NCAM2_uc011acb.1_Silent_p.A616A	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	758	Cytoplasmic (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AAGGAAAAGCTGCATACCTGT	0.453													13	87	---	---	---	---	PASS
HLCS	3141	broad.mit.edu	37	21	38309503	38309503	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38309503G>C	uc010gnb.2	-	4	1443	c.242C>G	c.(241-243)TCT>TGT	p.S81C	HLCS_uc002yvs.2_Missense_Mutation_p.S81C|HLCS_uc010gnc.1_Missense_Mutation_p.S228C	NM_000411	NP_000402	P50747	BPL1_HUMAN	holocarboxylase synthetase	81					cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	CTCACTCCCAGAGGCACTGCC	0.547													10	110	---	---	---	---	PASS
RGL4	266747	broad.mit.edu	37	22	24034931	24034931	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24034931T>C	uc002zxn.2	+	3	1619	c.449T>C	c.(448-450)CTG>CCG	p.L150P	LOC91316_uc002zxh.3_RNA|LOC91316_uc002zxi.3_RNA|LOC91316_uc002zxk.3_Intron|LOC91316_uc010gua.2_Intron|LOC91316_uc002zxl.3_Intron|LOC91316_uc011aiz.1_Intron|LOC91316_uc002zxm.3_Intron|RGL4_uc002zxo.2_Missense_Mutation_p.L150P|RGL4_uc002zxp.1_Missense_Mutation_p.L14P|RGL4_uc002zxq.2_Missense_Mutation_p.L14P	NM_153615	NP_705843	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation	150	Pro-rich.				small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle	guanyl-nucleotide exchange factor activity			ovary(1)	1						CTGGCGGACCTGGGGCCTGCT	0.627													19	95	---	---	---	---	PASS
ASPHD2	57168	broad.mit.edu	37	22	26829924	26829924	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26829924C>T	uc003acg.2	+	2	740	c.343C>T	c.(343-345)CGC>TGC	p.R115C		NM_020437	NP_065170	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	115	Lumenal (Potential).				peptidyl-amino acid modification	integral to endoplasmic reticulum membrane	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity			ovary(1)	1						TGAGTGCGTGCGCTGCACCCA	0.642													8	44	---	---	---	---	PASS
NEFH	4744	broad.mit.edu	37	22	29884889	29884889	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29884889C>T	uc003afo.2	+	4	1331	c.1260C>T	c.(1258-1260)TTC>TTT	p.F420F	NEFH_uc003afp.2_5'Flank	NM_021076	NP_066554	P12036	NFH_HUMAN	neurofilament, heavy polypeptide 200kDa	420	Tail.				cell death|nervous system development	neurofilament					0						CAATTCCTTTCTCGCTTCCAG	0.448													31	134	---	---	---	---	PASS
LIMK2	3985	broad.mit.edu	37	22	31661978	31661978	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31661978G>C	uc003akh.2	+	8	1046	c.901G>C	c.(901-903)GAG>CAG	p.E301Q	LIMK2_uc003akg.2_Missense_Mutation_p.E218Q|LIMK2_uc003aki.2_Missense_Mutation_p.E55Q|LIMK2_uc003akj.2_Missense_Mutation_p.E280Q|LIMK2_uc003akk.2_Missense_Mutation_p.E280Q|LIMK2_uc011aln.1_Missense_Mutation_p.E218Q	NM_005569	NP_005560	P53671	LIMK2_HUMAN	LIM domain kinase 2 isoform 2a	301						mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2						CTCCCCAAAGGAGCCCCTGCT	0.567													13	95	---	---	---	---	PASS
MCM5	4174	broad.mit.edu	37	22	35799254	35799254	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35799254G>A	uc003anu.3	+	3	316	c.222G>A	c.(220-222)ATG>ATA	p.M74I	MCM5_uc010gwr.2_5'UTR|MCM5_uc003anv.3_Missense_Mutation_p.M74I	NM_006739	NP_006730	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	74					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)	1						AGGTGGAGATGGAGGATCTGG	0.587													9	84	---	---	---	---	PASS
MICALL1	85377	broad.mit.edu	37	22	38322053	38322053	+	Intron	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38322053G>T	uc003aui.2	+							NM_033386	NP_203744	Q8N3F8	MILK1_HUMAN	molecule interacting with Rab13							cytoplasm|cytoskeleton	protein binding|zinc ion binding			breast(1)	1	Melanoma(58;0.045)					CCCACTGGGTGAGTGCCTTTC	0.622													8	48	---	---	---	---	PASS
ACO2	50	broad.mit.edu	37	22	41918985	41918985	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41918985C>A	uc003bac.2	+	10	1312	c.1290C>A	c.(1288-1290)GAC>GAA	p.D430E	ACO2_uc003bad.2_Missense_Mutation_p.D455E	NM_001098	NP_001089	Q99798	ACON_HUMAN	aconitase 2, mitochondrial precursor	430					citrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron ion binding|isocitrate hydro-lyase (cis-aconitate-forming) activity			breast(2)|ovary(1)|lung(1)	4						TTGAGCGGGACGGCTATGTGA	0.642													3	120	---	---	---	---	PASS
CYP2D6	1565	broad.mit.edu	37	22	42522959	42522959	+	Silent	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42522959C>T	uc003bce.2	-	8	1299	c.1209G>A	c.(1207-1209)CTG>CTA	p.L403L	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_Silent_p.L97L|CYP2D6_uc003bcf.2_Silent_p.L352L	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	403							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						CCTCATCCTTCAGCACCGATG	0.602													9	12	---	---	---	---	PASS
CYP2D6	1565	broad.mit.edu	37	22	42523955	42523955	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42523955C>T	uc003bce.2	-	6	964	c.874G>A	c.(874-876)GAT>AAT	p.D292N	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_Intron|CYP2D6_uc003bcf.2_Missense_Mutation_p.D241N	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	292							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						AGGTTCTCATCATTGAAGCTG	0.597													14	96	---	---	---	---	PASS
KIAA1644	85352	broad.mit.edu	37	22	44696781	44696781	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44696781G>A	uc003bet.2	-	2	178	c.45C>T	c.(43-45)CTC>CTT	p.L15L		NM_001099294	NP_001092764	Q3SXP7	K1644_HUMAN	hypothetical protein LOC85352 precursor	15						integral to membrane				ovary(1)	1		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				GCAATGAGAAGAGGACGGCGA	0.597													7	50	---	---	---	---	PASS
BRD1	23774	broad.mit.edu	37	22	50217446	50217446	+	Nonsense_Mutation	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50217446T>A	uc003biv.2	-	1	1007	c.520A>T	c.(520-522)AAG>TAG	p.K174*	BRD1_uc011arf.1_5'UTR|BRD1_uc011arg.1_Nonsense_Mutation_p.K174*|BRD1_uc011arh.1_Nonsense_Mutation_p.K174*|BRD1_uc003biu.3_Nonsense_Mutation_p.K174*	NM_014577	NP_055392	O95696	BRD1_HUMAN	bromodomain containing protein 1	174					histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CAGTCGCCCTTGCGCTTCTCA	0.582													6	64	---	---	---	---	PASS
CPT1B	1375	broad.mit.edu	37	22	51009322	51009322	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51009322C>T	uc003bmk.3	-	15	2188	c.2026G>A	c.(2026-2028)GAG>AAG	p.E676K	CPT1B_uc003bml.2_Missense_Mutation_p.E676K|CPT1B_uc003bmm.2_Missense_Mutation_p.E676K|CPT1B_uc003bmo.2_Missense_Mutation_p.E676K|CPT1B_uc011asa.1_Missense_Mutation_p.E642K|CPT1B_uc003bmn.2_Missense_Mutation_p.E676K|CPT1B_uc011asb.1_Missense_Mutation_p.E595K|CHKB-CPT1B_uc003bmp.2_Missense_Mutation_p.E471K|uc003bmr.1_5'Flank	NM_001145137	NP_001138609	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B isoform a	676	Cytoplasmic (Potential).				carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)	2		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		GTGCTGACCTCAGCAAGGAAA	0.577													29	225	---	---	---	---	PASS
WWC3	55841	broad.mit.edu	37	X	10109498	10109498	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10109498G>T	uc004csx.3	+	23	3434	c.3236G>T	c.(3235-3237)AGG>ATG	p.R1079M	WWC3_uc010nds.2_Missense_Mutation_p.R743M|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	1079										ovary(4)	4						TTCTTCACAAGGCCAAGGATC	0.463													9	101	---	---	---	---	PASS
ASB11	140456	broad.mit.edu	37	X	15311321	15311321	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15311321G>T	uc004cwp.1	-	4	491	c.491C>A	c.(490-492)GCC>GAC	p.A164D	ASB11_uc004cwo.1_Missense_Mutation_p.A143D|ASB11_uc010nes.1_RNA|ASB11_uc010net.1_Missense_Mutation_p.A147D	NM_080873	NP_543149	Q8WXH4	ASB11_HUMAN	ankyrin repeat and SOCS box-containing protein	164	ANK 4.				intracellular signal transduction					breast(2)|skin(1)	3	Hepatocellular(33;0.183)					GATGGGCGAGGCCAGGTGCAC	0.542													24	284	---	---	---	---	PASS
TMEM27	57393	broad.mit.edu	37	X	15657880	15657880	+	Splice_Site	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15657880C>G	uc004cxc.1	-	5	574	c.318_splice	c.e5-1	p.R106_splice		NM_020665	NP_065716	Q9HBJ8	TMM27_HUMAN	transmembrane protein 27 precursor						proteolysis	integral to membrane	metallopeptidase activity|peptidyl-dipeptidase activity			ovary(1)	1	Hepatocellular(33;0.183)					CTTGTTCATTCTAAAATGCAA	0.313													16	215	---	---	---	---	PASS
SCML2	10389	broad.mit.edu	37	X	18283874	18283874	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18283874G>T	uc004cyl.2	-	8	936	c.779C>A	c.(778-780)GCA>GAA	p.A260E	SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Missense_Mutation_p.A260E|SCML2_uc011miz.1_Missense_Mutation_p.A194E|SCML2_uc010nfc.2_5'UTR	NM_006089	NP_006080	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2	260					anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(33;0.183)					ATGCTGGCTTGCTTCGGAAGG	0.368													24	177	---	---	---	---	PASS
PHKA2	5256	broad.mit.edu	37	X	18919706	18919706	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18919706G>C	uc004cyv.3	-	27	3354	c.2924C>G	c.(2923-2925)TCC>TGC	p.S975C	PHKA2_uc004cyu.3_Missense_Mutation_p.S273C|PHKA2_uc010nfe.1_Missense_Mutation_p.S25C|PHKA2_uc010nff.1_Intron	NM_000292	NP_000283	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	975					glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)					GGATGTGGAGGAGTGGATAGG	0.557													11	61	---	---	---	---	PASS
GPR64	10149	broad.mit.edu	37	X	19021157	19021157	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19021157G>A	uc004cyx.2	-	24	2201	c.2037C>T	c.(2035-2037)TTC>TTT	p.F679F	GPR64_uc004cyy.2_Silent_p.F676F|GPR64_uc004cyz.2_Silent_p.F665F|GPR64_uc004czb.2_Silent_p.F679F|GPR64_uc004czc.2_Silent_p.F663F|GPR64_uc004czd.2_Silent_p.F655F|GPR64_uc004cze.2_Silent_p.F649F|GPR64_uc004czf.2_Silent_p.F641F|GPR64_uc004cza.2_Silent_p.F657F|GPR64_uc004cyw.2_Silent_p.F663F|GPR64_uc010nfj.2_Silent_p.F560F	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64 isoform 1	679	Helical; Name=2; (Potential).				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity				0	Hepatocellular(33;0.183)					AGTCCAGGAGGAAGACCAGGT	0.463													14	136	---	---	---	---	PASS
DDX53	168400	broad.mit.edu	37	X	23018387	23018387	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23018387A>G	uc004daj.2	+	1	301	c.213A>G	c.(211-213)ATA>ATG	p.I71M		NM_182699	NP_874358	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	71	KH.					nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			large_intestine(1)|ovary(1)|kidney(1)	3						GATCAAAAATAAAAGATCTAC	0.398													9	129	---	---	---	---	PASS
FAM48B1	100130302	broad.mit.edu	37	X	24380969	24380969	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24380969G>C	uc011mjx.1	+	1	92	c.92G>C	c.(91-93)AGG>ACG	p.R31T		NM_001136234	NP_001129706			hypothetical protein LOC100130302											kidney(1)	1						TACTCACCTAGGGCGGGAAAA	0.423													13	167	---	---	---	---	PASS
FAM48B1	100130302	broad.mit.edu	37	X	24380970	24380970	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24380970G>T	uc011mjx.1	+	1	93	c.93G>T	c.(91-93)AGG>AGT	p.R31S		NM_001136234	NP_001129706			hypothetical protein LOC100130302											kidney(1)	1						ACTCACCTAGGGCGGGAAAAA	0.423													12	164	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34148947	34148947	+	Silent	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148947G>C	uc004ddg.2	-	1	1482	c.1449C>G	c.(1447-1449)CCC>CCG	p.P483P		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	483										ovary(4)|central_nervous_system(1)	5						GACGTGTCTTGGGATGTTCCG	0.617													18	95	---	---	---	---	PASS
CXorf36	79742	broad.mit.edu	37	X	45013207	45013207	+	Silent	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45013207C>A	uc004dgg.2	-	4	984	c.909G>T	c.(907-909)GGG>GGT	p.G303G		NM_176819	NP_789789	Q9H7Y0	CX036_HUMAN	hypothetical protein LOC79742 isoform 1	303						extracellular region				lung(1)	1						TGAACAGATGCCCGTTGTTAA	0.537													7	80	---	---	---	---	PASS
ZNF81	347344	broad.mit.edu	37	X	47775612	47775612	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47775612G>C	uc010nhy.1	+	6	1935	c.1567G>C	c.(1567-1569)GAA>CAA	p.E523Q		NM_007137	NP_009068	P51508	ZNF81_HUMAN	zinc finger protein 81	523						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(315;0.0973)				TCATACTGGAGAAAAGTCTTA	0.418													15	121	---	---	---	---	PASS
GPKOW	27238	broad.mit.edu	37	X	48973958	48973958	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48973958T>C	uc004dmr.2	-	5	780	c.773A>G	c.(772-774)TAT>TGT	p.Y258C		NM_015698	NP_056513	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	258	KOW 1.					nucleus	nucleic acid binding			ovary(2)	2						TACCTTCCCATAGAGGCCTCG	0.478													11	101	---	---	---	---	PASS
CACNA1F	778	broad.mit.edu	37	X	49066420	49066420	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49066420C>A	uc004dnb.2	-	40	4766	c.4704G>T	c.(4702-4704)GAG>GAT	p.E1568D	CACNA1F_uc010nip.2_Missense_Mutation_p.E1557D	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,	1568	Cytoplasmic (Potential).				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	GGGGGATGACCTCATCTAGCA	0.592													8	97	---	---	---	---	PASS
CCDC22	28952	broad.mit.edu	37	X	49105371	49105371	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49105371G>T	uc004dnd.1	+	13	1681	c.1525G>T	c.(1525-1527)GAA>TAA	p.E509*	CCDC22_uc004dnc.1_RNA	NM_014008	NP_054727	O60826	CCD22_HUMAN	coiled-coil domain containing 22	509	Potential.									central_nervous_system(1)	1						GAAGCAGAAGGAAGAGATCAC	0.607													5	39	---	---	---	---	PASS
SHROOM4	57477	broad.mit.edu	37	X	50350966	50350966	+	Nonsense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50350966G>C	uc004dpe.2	-	6	3202	c.3176C>G	c.(3175-3177)TCA>TGA	p.S1059*	SHROOM4_uc004dpd.3_RNA	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	1059					actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					GTGACTCTCTGAGAAGGCACG	0.557													10	87	---	---	---	---	PASS
SHROOM4	57477	broad.mit.edu	37	X	50377427	50377427	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50377427C>G	uc004dpe.2	-	4	1672	c.1646G>C	c.(1645-1647)GGC>GCC	p.G549A	SHROOM4_uc004dpd.3_RNA|SHROOM4_uc004dpf.1_Missense_Mutation_p.G433A	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	549					actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					TGCCTCTGTGCCACTAGCTGC	0.602													8	35	---	---	---	---	PASS
BMP15	9210	broad.mit.edu	37	X	50659053	50659053	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50659053T>G	uc011mnw.1	+	2	625	c.625T>G	c.(625-627)TGT>GGT	p.C209G		NM_005448	NP_005439	O95972	BMP15_HUMAN	bone morphogenetic protein 15 precursor	209					female gamete generation|granulosa cell development|ovarian follicle development	extracellular space	cytokine activity|growth factor activity			ovary(2)	2	Ovarian(276;0.236)					CCGTTTTATGTGTCAGCAGCA	0.428													19	172	---	---	---	---	PASS
SPANXN5	494197	broad.mit.edu	37	X	52825663	52825663	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52825663C>G	uc004drc.1	-	2	84	c.84G>C	c.(82-84)GAG>GAC	p.E28D		NM_001009616	NP_001009616	Q5MJ07	SPXN5_HUMAN	SPANX family, member N5	28											0	Ovarian(276;0.236)					TGTTTGGTGTCTCCTGCATCT	0.408													16	145	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53240962	53240962	+	Intron	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53240962C>A	uc004drz.2	-						KDM5C_uc011moc.1_Intron|KDM5C_uc011mod.1_Intron|KDM5C_uc004dsa.2_Intron	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						AGCCCTCCATCACCTACATGC	0.537			N|F|S		clear cell renal carcinoma								8	56	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53616585	53616585	+	Silent	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53616585C>A	uc004dsp.2	-	36	4785	c.4383G>T	c.(4381-4383)GTG>GTT	p.V1461V	HUWE1_uc004dsn.2_Silent_p.V286V	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	1461					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TCAGGTCACACACACGGTATA	0.473													18	165	---	---	---	---	PASS
GNL3L	54552	broad.mit.edu	37	X	54578751	54578751	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54578751C>T	uc004dth.1	+	13	1347	c.1208C>T	c.(1207-1209)CCA>CTA	p.P403L	GNL3L_uc004dti.2_RNA	NM_019067	NP_061940	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3	403					ribosome biogenesis	nucleolus	GTP binding			ovary(1)	1						TATATACCACCACCAGCCACT	0.502													12	126	---	---	---	---	PASS
ITIH5L	347365	broad.mit.edu	37	X	54776515	54776515	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54776515C>A	uc004dtj.2	-	13	3785	c.3755G>T	c.(3754-3756)CGA>CTA	p.R1252L		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	1252					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						TGTCACCAGTCGGATGTCTGC	0.592													9	50	---	---	---	---	PASS
ITIH5L	347365	broad.mit.edu	37	X	54783527	54783527	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54783527G>A	uc004dtj.2	-	8	3010	c.2980C>T	c.(2980-2982)CCT>TCT	p.P994S		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	994	Pro-rich.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						ATGGCCTCAGGGAGGATGCTA	0.542													5	62	---	---	---	---	PASS
PFKFB1	5207	broad.mit.edu	37	X	54975540	54975540	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54975540C>G	uc004dty.1	-	9	1032	c.961G>C	c.(961-963)GAG>CAG	p.E321Q	PFKFB1_uc010nkd.1_Intron|PFKFB1_uc011mol.1_Missense_Mutation_p.E256Q	NM_002625	NP_002616	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,	321	Fructose-2,6-bisphosphatase.				energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(1)	1						TTCCACTGCTCATAGGGGACA	0.567													14	123	---	---	---	---	PASS
APEX2	27301	broad.mit.edu	37	X	55028721	55028721	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55028721G>T	uc004dtz.2	+	3	355	c.279G>T	c.(277-279)GTG>GTT	p.V93V	APEX2_uc011mom.1_Intron	NM_014481	NP_055296	Q9UBZ4	APEX2_HUMAN	apurinic/apyrimidinic endonuclease 2	93					cell cycle|DNA recombination|DNA repair	nucleus	DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|endonuclease activity|exonuclease activity|zinc ion binding			breast(1)	1						CTACCCCAGTGGCTGCTGAAG	0.552								Other_BER_factors					10	29	---	---	---	---	PASS
APEX2	27301	broad.mit.edu	37	X	55028722	55028722	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55028722G>T	uc004dtz.2	+	3	356	c.280G>T	c.(280-282)GCT>TCT	p.A94S	APEX2_uc011mom.1_Intron	NM_014481	NP_055296	Q9UBZ4	APEX2_HUMAN	apurinic/apyrimidinic endonuclease 2	94					cell cycle|DNA recombination|DNA repair	nucleus	DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|endonuclease activity|exonuclease activity|zinc ion binding			breast(1)	1						TACCCCAGTGGCTGCTGAAGA	0.547								Other_BER_factors					10	31	---	---	---	---	PASS
FAAH2	158584	broad.mit.edu	37	X	57318921	57318921	+	Intron	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57318921T>A	uc004dvc.2	+							NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2							integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3						TAAAGTATTGTATTTTGCAGG	0.254										HNSCC(52;0.14)			10	105	---	---	---	---	PASS
FAM123B	139285	broad.mit.edu	37	X	63412770	63412770	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63412770C>A	uc004dvo.2	-	2	670	c.397G>T	c.(397-399)GCC>TCC	p.A133S		NM_152424	NP_689637	Q5JTC6	F123B_HUMAN	family with sequence similarity 123B	133					Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		p.0?(40)		kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						GCCCCATGGGCACTCTGAGAG	0.542													13	101	---	---	---	---	PASS
MTMR8	55613	broad.mit.edu	37	X	63445504	63445504	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63445504C>G	uc011mou.1	-	10	1220	c.1152G>C	c.(1150-1152)AAG>AAC	p.K384N	ASB12_uc004dvp.1_Splice_Site_p.M1_splice|ASB12_uc004dvq.1_Missense_Mutation_p.K9N|ASB12_uc004dvr.1_Missense_Mutation_p.K9N	NM_017677	NP_060147	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	Error:Variant_position_missing_in_Q96EF0_after_alignment						nuclear envelope	protein tyrosine phosphatase activity			ovary(2)|breast(2)	4						TGAGGTTCATCTTGGCTAATT	0.493													3	18	---	---	---	---	PASS
KIF4A	24137	broad.mit.edu	37	X	69637726	69637726	+	Intron	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69637726C>A	uc004dyg.2	+						KIF4A_uc010nkw.2_Intron	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4						anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4						TTTCTGCAAACCTGTTTTGCA	0.428													5	78	---	---	---	---	PASS
FOXO4	4303	broad.mit.edu	37	X	70320607	70320607	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70320607C>G	uc004dys.1	+	2	880	c.527C>G	c.(526-528)TCT>TGT	p.S176C	FOXO4_uc010nkz.2_Missense_Mutation_p.S176C|FOXO4_uc004dyt.1_Missense_Mutation_p.S121C	NM_005938	NP_005929	P98177	FOXO4_HUMAN	forkhead box O4	176	Fork-head.				cell cycle arrest|cell differentiation|embryo development|G1 phase of mitotic cell cycle|insulin receptor signaling pathway|mitotic cell cycle G2/M transition DNA damage checkpoint|muscle organ development|negative regulation of angiogenesis|negative regulation of cell proliferation|negative regulation of smooth muscle cell differentiation|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			central_nervous_system(2)|prostate(1)	3	Renal(35;0.156)					GGCAAAAGCTCTTGGTGGATG	0.527											OREG0019856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	33	---	---	---	---	PASS
PIN4	5303	broad.mit.edu	37	X	71416654	71416654	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71416654A>G	uc004eam.2	+	3	247	c.212A>G	c.(211-213)GAA>GGA	p.E71G	PIN4_uc004eao.1_Missense_Mutation_p.E71G	NM_006223	NP_006214	Q9Y237	PIN4_HUMAN	protein (peptidyl-prolyl cis/trans isomerase)	46	PpiC.				protein folding|rRNA processing	cytoplasm|mitochondrial matrix|mitochondrial matrix|nucleolus|nucleolus|preribosome|spindle|spindle	bent DNA binding|DNA binding|double-stranded DNA binding|peptidyl-prolyl cis-trans isomerase activity				0	Renal(35;0.156)					ATTCTATGTGAAAAACATGGC	0.408													19	122	---	---	---	---	PASS
TSIX	9383	broad.mit.edu	37	X	73046929	73046929	+	RNA	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73046929G>T	uc004ebn.2	+	1		c.34890G>T			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0						TATACTTTGGGCCTTCTATCC	0.468													41	239	---	---	---	---	PASS
SLC16A2	6567	broad.mit.edu	37	X	73744338	73744338	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73744338C>A	uc004ebt.2	+	3	1108	c.942C>A	c.(940-942)AGC>AGA	p.S314R	SLC16A2_uc010nlr.1_5'UTR	NM_006517	NP_006508	P36021	MOT8_HUMAN	solute carrier family 16, member 2	240	Helical; (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity			breast(2)|ovary(1)	3					Pyruvic acid(DB00119)	CTGGGAGTAGCATTTTCTCCA	0.537													8	70	---	---	---	---	PASS
MAGEE1	57692	broad.mit.edu	37	X	75650413	75650413	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75650413G>T	uc004ecm.1	+	1	2297	c.2090G>T	c.(2089-2091)AGA>ATA	p.R697I		NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	697						dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane				breast(3)|ovary(1)|pancreas(1)|skin(1)	6						GATGCTGCCAGAGCCTTTGCT	0.473													6	33	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76920166	76920166	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76920166C>A	uc004ecp.3	-	11	4143	c.3911G>T	c.(3910-3912)GGA>GTA	p.G1304V	ATRX_uc004ecq.3_Missense_Mutation_p.G1266V|ATRX_uc004eco.3_Missense_Mutation_p.G1089V|ATRX_uc004ecr.2_Missense_Mutation_p.G1236V	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1304					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	ATTTTGTTTTCCAGTTCTTTT	0.373			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						26	243	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76938172	76938172	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76938172C>A	uc004ecp.3	-	9	2808	c.2576G>T	c.(2575-2577)GGA>GTA	p.G859V	ATRX_uc004ecq.3_Missense_Mutation_p.G821V|ATRX_uc004eco.3_Missense_Mutation_p.G644V|ATRX_uc004ecr.2_Missense_Mutation_p.G791V|ATRX_uc010nlx.1_Missense_Mutation_p.G830V|ATRX_uc010nly.1_Missense_Mutation_p.G804V	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	859					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	ATTATCCATTCCTTTTTTGCT	0.318			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						82	758	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76938658	76938658	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76938658T>C	uc004ecp.3	-	9	2322	c.2090A>G	c.(2089-2091)AAA>AGA	p.K697R	ATRX_uc004ecq.3_Missense_Mutation_p.K659R|ATRX_uc004eco.3_Missense_Mutation_p.K482R|ATRX_uc004ecr.2_Missense_Mutation_p.K629R|ATRX_uc010nlx.1_Missense_Mutation_p.K668R|ATRX_uc010nly.1_Missense_Mutation_p.K642R	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	697					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	CTTATCCTTTTTTCTCACTGG	0.353			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						36	507	---	---	---	---	PASS
ZCCHC5	203430	broad.mit.edu	37	X	77912921	77912921	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77912921A>C	uc004edc.1	-	2	1293	c.997T>G	c.(997-999)TGC>GGC	p.C333G		NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	333							nucleic acid binding|zinc ion binding			ovary(1)	1						TCCCCTTGGCAGAGTTGATGG	0.468													9	76	---	---	---	---	PASS
CYLC1	1538	broad.mit.edu	37	X	83128432	83128432	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83128432C>G	uc004eei.1	+	4	737	c.716C>G	c.(715-717)TCA>TGA	p.S239*	CYLC1_uc004eeh.1_Nonsense_Mutation_p.S238*	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	239					cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5						GAGATTTGCTCAGAAAATAGT	0.333													17	61	---	---	---	---	PASS
HDX	139324	broad.mit.edu	37	X	83577023	83577023	+	Intron	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83577023C>A	uc004eek.1	-						HDX_uc011mqv.1_Intron|HDX_uc004eel.1_Intron	NM_144657	NP_653258	Q7Z353	HDX_HUMAN	highly divergent homeobox							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)	2						ACAGCAGTGCCTGaataaaaa	0.348													10	43	---	---	---	---	PASS
DACH2	117154	broad.mit.edu	37	X	85906092	85906092	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85906092A>G	uc004eew.2	+	4	864	c.694A>G	c.(694-696)ATG>GTG	p.M232V	DACH2_uc004eex.2_Missense_Mutation_p.M219V|DACH2_uc010nmq.2_Missense_Mutation_p.M98V|DACH2_uc011mra.1_Missense_Mutation_p.M65V|DACH2_uc010nmr.2_Missense_Mutation_p.M13V	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	232					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						GATGAAGCTTATGGCTATGAA	0.388													7	39	---	---	---	---	PASS
TGIF2LX	90316	broad.mit.edu	37	X	89177476	89177476	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89177476A>T	uc004efe.2	+	2	441	c.392A>T	c.(391-393)CAT>CTT	p.H131L		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	131						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						AAAGATGCCCATGCCACCCAC	0.567													13	113	---	---	---	---	PASS
ARMCX3	51566	broad.mit.edu	37	X	100880489	100880489	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100880489A>T	uc004ehz.1	+	5	1053	c.520A>T	c.(520-522)ACT>TCT	p.T174S	ARMCX3_uc004eia.1_Missense_Mutation_p.T174S|ARMCX3_uc004eib.1_Missense_Mutation_p.T174S|ARMCX3_uc004eic.1_Missense_Mutation_p.T174S	NM_016607	NP_057691	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	174	ARM 2.					integral to membrane	binding			ovary(1)|lung(1)	2						GATTCTCAATACTCGGGATCC	0.393													26	256	---	---	---	---	PASS
ZMAT1	84460	broad.mit.edu	37	X	101138538	101138538	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101138538C>G	uc004eim.2	-	2	4846	c.1348G>C	c.(1348-1350)GTT>CTT	p.V450L	ZMAT1_uc011mrl.1_Missense_Mutation_p.V621L|ZMAT1_uc004ein.2_Missense_Mutation_p.V450L|ZMAT1_uc011mrm.1_Missense_Mutation_p.V450L	NM_032441	NP_115817	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin type 1 isoform 3	450						nucleus	zinc ion binding			ovary(1)	1						CTTTCTTCAACAGATTTCTTT	0.358													25	178	---	---	---	---	PASS
GLRA4	441509	broad.mit.edu	37	X	102962450	102962450	+	Intron	SNP	T	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102962450T>A	uc011mse.1	-							NM_001024452	NP_001019623	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4 precursor							cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity				0						CTCCTGGAATTACAAGGAAGA	0.468													8	92	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	106844066	106844066	+	IGR	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106844066C>A								CXorf41 (356594 upstream) : PRPS1 (27588 downstream)																							GAGGGACAACCTGCCCAAGGA	0.582													8	30	---	---	---	---	PASS
RGAG1	57529	broad.mit.edu	37	X	109694590	109694590	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109694590G>C	uc004eor.1	+	3	991	c.745G>C	c.(745-747)GCT>CCT	p.A249P	RGAG1_uc011msr.1_Missense_Mutation_p.A249P	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	249										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GCTAATGACTGCTCTAGCCTC	0.488													19	151	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111025199	111025199	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111025199G>T	uc004epl.1	-	8	2983	c.2064C>A	c.(2062-2064)GAC>GAA	p.D688E	TRPC5_uc004epm.1_Missense_Mutation_p.D688E	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	688	Cytoplasmic (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						TCCGTCTACCGTCAGGGTCTC	0.368													45	218	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111195319	111195319	+	Silent	SNP	G	C	C	rs139867130		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111195319G>C	uc004epl.1	-	2	1249	c.330C>G	c.(328-330)GGC>GGG	p.G110G	TRPC5_uc004epm.1_Silent_p.G110G	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	110	ANK 3.|Cytoplasmic (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						GCTCCACAGCGCCCACCACTT	0.547													44	196	---	---	---	---	PASS
KLHL13	90293	broad.mit.edu	37	X	117033294	117033294	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117033294C>A	uc004eql.2	-	7	1607	c.1545G>T	c.(1543-1545)TGG>TGT	p.W515C	KLHL13_uc004eqk.2_Missense_Mutation_p.W464C|KLHL13_uc011mtn.1_Missense_Mutation_p.W355C|KLHL13_uc011mto.1_Missense_Mutation_p.W509C|KLHL13_uc011mtp.1_Missense_Mutation_p.W517C|KLHL13_uc004eqm.2_Missense_Mutation_p.W464C|KLHL13_uc011mtq.1_Missense_Mutation_p.W499C	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	515	Kelch 4.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2						CCTTCTGGATCCATTTGTCAG	0.413													107	542	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117815708	117815708	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117815708G>T	uc004eqp.2	+	51	5977	c.5914G>T	c.(5914-5916)GCT>TCT	p.A1972S	DOCK11_uc004eqq.2_Missense_Mutation_p.A1751S	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1972	DHR-2.				blood coagulation	cytosol	GTP binding			ovary(3)	3						TGACAGCCAAGCTAGCAAGTA	0.363													19	195	---	---	---	---	PASS
ATP1B4	23439	broad.mit.edu	37	X	119500453	119500453	+	Missense_Mutation	SNP	C	A	A	rs147823363	byFrequency	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119500453C>A	uc004esr.2	+	2	221	c.137C>A	c.(136-138)ACG>AAG	p.T46K	ATP1B4_uc004esq.2_Missense_Mutation_p.T46K|ATP1B4_uc011mtx.1_Missense_Mutation_p.T46K|ATP1B4_uc011mty.1_Missense_Mutation_p.T46K	NM_001142447	NP_001135919	Q9UN42	AT1B4_HUMAN	ATPase, (Na+)/K+ transporting, beta 4	46	Glu-rich.|Nuclear (Potential).				ATP biosynthetic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to plasma membrane|nuclear inner membrane	sodium:potassium-exchanging ATPase activity			ovary(1)|skin(1)	2						GCTCGGGTGACGGTGGTGCCC	0.353													9	102	---	---	---	---	PASS
HS6ST2	90161	broad.mit.edu	37	X	131803156	131803156	+	Intron	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131803156G>T	uc011mve.1	-						HS6ST2_uc011mvb.1_Missense_Mutation_p.T205K|HS6ST2_uc011mvc.1_Intron|HS6ST2_uc011mvd.1_Missense_Mutation_p.T351K|HS6ST2_uc011mva.1_Intron	NM_147175	NP_671704	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2 isoform							integral to membrane	sulfotransferase activity				0	Acute lymphoblastic leukemia(192;0.000127)					actcttagatgtgttccgggt	0.249													7	45	---	---	---	---	PASS
PHF6	84295	broad.mit.edu	37	X	133549058	133549058	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133549058G>T	uc004exj.2	+	8	944	c.742G>T	c.(742-744)GGC>TGC	p.G248C	PHF6_uc004exk.2_Missense_Mutation_p.G248C|PHF6_uc011mvk.1_Missense_Mutation_p.G214C|PHF6_uc004exh.2_Missense_Mutation_p.G249C|PHF6_uc010nrr.2_Missense_Mutation_p.G248C|PHF6_uc004exi.2_Missense_Mutation_p.G249C	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1	248					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					GTTTTCTTCTGGCACAGTCCA	0.328													13	96	---	---	---	---	PASS
SAGE1	55511	broad.mit.edu	37	X	134991916	134991916	+	Silent	SNP	G	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134991916G>A	uc004ezh.2	+	14	1868	c.1701G>A	c.(1699-1701)CCG>CCA	p.P567P	SAGE1_uc010nry.1_Silent_p.P536P|SAGE1_uc011mvv.1_Silent_p.P191P	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	567										ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)					CTGGTATTCCGGCCATGAGTA	0.418													31	267	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135430018	135430018	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135430018G>T	uc004ezu.1	+	6	4444	c.4153G>T	c.(4153-4155)GCC>TCC	p.A1385S	GPR112_uc010nsb.1_Missense_Mutation_p.A1180S|GPR112_uc010nsc.1_Missense_Mutation_p.A1152S	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1385	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					AAGCACGAGTGCCCTTCCAGC	0.448													33	345	---	---	---	---	PASS
ATP11C	286410	broad.mit.edu	37	X	138869408	138869408	+	Intron	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138869408C>G	uc004faz.2	-						ATP11C_uc004fay.2_Intron|ATP11C_uc004fba.2_Intron	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a						ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					CCGTACCTATCAAAAACAATA	0.224													15	76	---	---	---	---	PASS
CXorf66	347487	broad.mit.edu	37	X	139038712	139038712	+	Silent	SNP	T	C	C			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139038712T>C	uc004fbb.2	-	3	451	c.429A>G	c.(427-429)CTA>CTG	p.L143L		NM_001013403	NP_001013421	Q5JRM2	CX066_HUMAN	hypothetical protein LOC347487 precursor	143	Ser-rich.|Cytoplasmic (Potential).					integral to membrane					0						ATGGCTTTTGTAGACTTGAGG	0.413													62	544	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140994934	140994934	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140994934C>G	uc004fbt.2	+	4	2030	c.1744C>G	c.(1744-1746)CAG>GAG	p.Q582E	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	582							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CTACTTTCCTCAGAGCCCTCA	0.592										HNSCC(15;0.026)			160	738	---	---	---	---	PASS
TMEM185A	84548	broad.mit.edu	37	X	148685689	148685689	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148685689G>T	uc011mxq.1	-	5	782	c.471C>A	c.(469-471)GCC>GCA	p.A157A	HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|TMEM185A_uc011mxp.1_Silent_p.A98A|TMEM185A_uc004fdo.2_Intron|TMEM185A_uc004fdp.3_Silent_p.A74A	NM_032508	NP_115897	Q8NFB2	T185A_HUMAN	transmembrane protein 185A	157	Helical; (Potential).					integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CCAGTCTTAAGGCAATGAATA	0.264													5	96	---	---	---	---	PASS
TMEM185A	84548	broad.mit.edu	37	X	148685690	148685690	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148685690G>T	uc011mxq.1	-	5	781	c.470C>A	c.(469-471)GCC>GAC	p.A157D	HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|TMEM185A_uc011mxp.1_Missense_Mutation_p.A98D|TMEM185A_uc004fdo.2_Intron|TMEM185A_uc004fdp.3_Missense_Mutation_p.A74D	NM_032508	NP_115897	Q8NFB2	T185A_HUMAN	transmembrane protein 185A	157	Helical; (Potential).					integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CAGTCTTAAGGCAATGAATAT	0.269													5	96	---	---	---	---	PASS
CNGA2	1260	broad.mit.edu	37	X	150909321	150909321	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150909321C>A	uc004fey.1	+	5	654	c.430C>A	c.(430-432)CTA>ATA	p.L144I		NM_005140	NP_005131	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	144	Helical; Name=H1; (Potential).				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CTACTGCTGGCTATTTGTCAT	0.552													35	304	---	---	---	---	PASS
MAGEA4	4103	broad.mit.edu	37	X	151092696	151092696	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151092696A>G	uc004fez.2	+	3	716	c.560A>G	c.(559-561)TAT>TGT	p.Y187C	MAGEA4_uc004ffa.2_Missense_Mutation_p.Y187C|MAGEA4_uc004ffb.2_Missense_Mutation_p.Y187C|MAGEA4_uc004ffc.2_Missense_Mutation_p.Y187C|MAGEA4_uc004ffd.2_Missense_Mutation_p.Y187C	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	187	MAGE.						protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GGCCTTTCCTATGATGGCCTG	0.542													36	181	---	---	---	---	PASS
GABRQ	55879	broad.mit.edu	37	X	151817747	151817747	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151817747G>T	uc004ffp.1	+	5	581	c.561G>T	c.(559-561)CTG>CTT	p.L187L		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	187	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CCCTGGATCTGCATAAATTCC	0.502													16	215	---	---	---	---	PASS
ZNF185	7739	broad.mit.edu	37	X	152087623	152087623	+	Silent	SNP	G	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152087623G>T	uc010ntv.1	+	7	565	c.528G>T	c.(526-528)CGG>CGT	p.R176R	ZNF185_uc011myg.1_Silent_p.R176R|ZNF185_uc011myh.1_Silent_p.R176R|ZNF185_uc011myi.1_Silent_p.R176R|ZNF185_uc011myj.1_Silent_p.R176R|ZNF185_uc011myk.1_Silent_p.R176R|ZNF185_uc004fgw.3_Silent_p.R41R|ZNF185_uc004fgu.2_5'UTR|ZNF185_uc004fgv.2_5'Flank	NM_007150	NP_009081	O15231	ZN185_HUMAN	zinc finger protein 185	176						cytoplasm|cytoskeleton|focal adhesion	zinc ion binding			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					AACAGAAACGGAGGTAATGGA	0.478													4	30	---	---	---	---	PASS
DNASE1L1	1774	broad.mit.edu	37	X	153631282	153631282	+	Splice_Site	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153631282C>A	uc004fks.1	-	7	965	c.774_splice	c.e7+1	p.E258_splice	RPL10_uc004fkq.1_Intron|RPL10_uc004fkr.1_Intron|DNASE1L1_uc004fkt.1_Splice_Site_p.E258_splice|DNASE1L1_uc004fku.1_Splice_Site_p.E258_splice|DNASE1L1_uc004fkv.1_Splice_Site_p.E258_splice|DNASE1L1_uc004fkw.1_Splice_Site_p.E258_splice	NM_006730	NP_006721	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1 precursor						DNA catabolic process	endoplasmic reticulum	DNA binding|endodeoxyribonuclease activity, producing 5'-phosphomonoesters				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CATCCCTTCACCTCCTCCTCG	0.677													9	87	---	---	---	---	PASS
DNASE1L1	1774	broad.mit.edu	37	X	153631283	153631283	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153631283C>A	uc004fks.1	-	7	965	c.774G>T	c.(772-774)GAG>GAT	p.E258D	RPL10_uc004fkq.1_Intron|RPL10_uc004fkr.1_Intron|DNASE1L1_uc004fkt.1_Missense_Mutation_p.E258D|DNASE1L1_uc004fku.1_Missense_Mutation_p.E258D|DNASE1L1_uc004fkv.1_Missense_Mutation_p.E258D|DNASE1L1_uc004fkw.1_Missense_Mutation_p.E258D	NM_006730	NP_006721	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1 precursor	258					DNA catabolic process	endoplasmic reticulum	DNA binding|endodeoxyribonuclease activity, producing 5'-phosphomonoesters				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ATCCCTTCACCTCCTCCTCGG	0.677													9	87	---	---	---	---	PASS
PRKCZ	5590	broad.mit.edu	37	1	1986737	1986737	+	Intron	DEL	A	-	-	rs35052584		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1986737delA	uc001aiq.2	+							NM_002744	NP_002735	Q05513	KPCZ_HUMAN	protein kinase C, zeta isoform 1						anti-apoptosis|intracellular signal transduction|negative regulation of insulin receptor signaling pathway|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein complex assembly|peptidyl-serine phosphorylation|platelet activation	endosome	ATP binding|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(2)	6	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)		TGTGTGTGGGAGGGGGGAGGG	0.284													4	4	---	---	---	---	
PGD	5226	broad.mit.edu	37	1	10479232	10479232	+	Intron	DEL	T	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10479232delT	uc001arc.2	+						PGD_uc001ard.2_Intron|PGD_uc010oak.1_Intron|PGD_uc010oal.1_Intron	NM_002631	NP_002622	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase						pentose-phosphate shunt, oxidative branch	cytosol	NADP binding|phosphogluconate dehydrogenase (decarboxylating) activity|protein binding			ovary(1)	1	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)		acctggctaattttttttttt	0.000													5	3	---	---	---	---	
NECAP2	55707	broad.mit.edu	37	1	16785155	16785155	+	Intron	DEL	A	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16785155delA	uc001ayo.2	+						NECAP2_uc001ayp.3_Intron|NECAP2_uc010ocd.1_Intron|NECAP2_uc001ayq.2_Intron	NM_018090	NP_060560	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2 isoform 1						endocytosis|protein transport	clathrin vesicle coat|coated pit|plasma membrane					0		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		TTAACTATTTAAAAAAAAAAA	0.249													9	4	---	---	---	---	
USP48	84196	broad.mit.edu	37	1	22027858	22027859	+	Intron	INS	-	A	A	rs35780642		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22027858_22027859insA	uc001bfb.2	-						USP48_uc001bfa.2_Intron|USP48_uc010odq.1_Intron|USP48_uc009vqc.2_Intron|USP48_uc001bfc.2_Intron|USP48_uc001bfd.1_Intron	NM_032236	NP_115612	Q86UV5	UBP48_HUMAN	ubiquitin specific protease 48 isoform a						ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		gactccatctcaaaaaaaaaaa	0.183													9	4	---	---	---	---	
ERMAP	114625	broad.mit.edu	37	1	43301022	43301023	+	Intron	DEL	CC	-	-	rs33921251		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43301022_43301023delCC	uc001cic.1	+						ERMAP_uc010ojw.1_Intron|ERMAP_uc001cid.1_Intron|ERMAP_uc001cie.1_Intron|ERMAP_uc001cif.1_Intron	NM_001017922	NP_001017922	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein							integral to membrane|plasma membrane				ovary(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TGCAGAAAGGCCCCTGGGCAGA	0.436													4	3	---	---	---	---	
ADAMTSL4	54507	broad.mit.edu	37	1	150528196	150528197	+	Intron	DEL	CA	-	-	rs9730075	by1000genomes	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150528196_150528197delCA	uc001eux.2	+						ADAMTSL4_uc001euw.2_Intron|ADAMTSL4_uc009wlw.2_Intron|ADAMTSL4_uc010pcg.1_Intron|ADAMTSL4_uc009wlx.2_5'Flank	NM_019032	NP_061905	Q6UY14	ATL4_HUMAN	thrombospondin repeat containing 1 isoform 1						apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding			ovary(1)|skin(1)	2	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			tgcacacacgcacacacacaca	0.000													4	2	---	---	---	---	
KDM5B	10765	broad.mit.edu	37	1	202701170	202701171	+	Intron	INS	-	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202701170_202701171insA	uc001gyf.2	-						KDM5B_uc009xag.2_Intron|KDM5B_uc001gyg.1_Intron	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B						negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						GCAACCAGGGGAAAAAAAAAAA	0.386													6	4	---	---	---	---	
DYSF	8291	broad.mit.edu	37	2	71697926	71697927	+	Intron	INS	-	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71697926_71697927insT	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						ttccttccttcttttttttttt	0.020													4	2	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225719572	225719579	+	Intron	DEL	CCAACCAA	-	-	rs72305904		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225719572_225719579delCCAACCAA	uc010fwz.1	-						DOCK10_uc002vob.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		aaccaactagccaaccaaccaaccaacc	0.236													3	4	---	---	---	---	
UGT1A8	54576	broad.mit.edu	37	2	234536302	234536303	+	Intron	INS	-	T	T			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234536302_234536303insT	uc002vup.2	+						UGT1A8_uc010zmv.1_Intron	NM_019076	NP_061949	Q9HAW9	UD18_HUMAN	UDP glycosyltransferase 1 family, polypeptide A8						drug metabolic process|fatty acid metabolic process|flavone metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme inhibitor activity|fatty acid binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|steroid binding			ovary(2)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;2.56e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000482)|Lung(119;0.00404)|LUSC - Lung squamous cell carcinoma(224;0.008)		ttccttccttccttccttcctt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	234699319	234699319	+	IGR	DEL	T	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234699319delT								UGT1A10 (17370 upstream) : HJURP (46168 downstream)																							cctccctccctcccttccttc	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	242523790	242523790	+	IGR	DEL	A	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242523790delA								BOK (10239 upstream) : THAP4 (31 downstream)																							ATCAGCAGATAAAAAAAAAAT	0.249													4	2	---	---	---	---	
CASR	846	broad.mit.edu	37	3	122004218	122004219	+	3'UTR	INS	-	A	A	rs141145862	by1000genomes	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122004218_122004219insA	uc003eev.3	+	7					CASR_uc003eew.3_3'UTR	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor						anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CCTTTAAAATTAAAAAAAAGAA	0.401													4	4	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21305653	21305654	+	Intron	INS	-	GAGAGAGAGA	GAGAGAGAGA	rs11271450		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21305653_21305654insGAGAGAGAGA	uc003gqh.1	-						KCNIP4_uc003gqf.1_5'Flank|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				GGAGAGCGTATgagagagagag	0.243													4	2	---	---	---	---	
WDR19	57728	broad.mit.edu	37	4	39280429	39280429	+	Intron	DEL	T	-	-	rs5857667		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39280429delT	uc003gtv.2	+						WDR19_uc011byi.1_Intron	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						TTTTGATGTATTTTTTTTAAT	0.388													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	72742023	72742039	+	IGR	DEL	TTCCTTCCTTGCCTTCG	-	-	rs77638707		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72742023_72742039delTTCCTTCCTTGCCTTCG								GC (72265 upstream) : NPFFR2 (155482 downstream)																							cttccttgttttccttccttgccttcgttccttcctt	0.000													4	4	---	---	---	---	
ANKRD17	26057	broad.mit.edu	37	4	73963151	73963152	+	Intron	INS	-	T	T	rs55834843		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73963151_73963152insT	uc003hgp.2	-						ANKRD17_uc003hgo.2_Intron|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Intron	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a						interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TATAGAGAGCCttttttttttt	0.134													4	2	---	---	---	---	
MUT	4594	broad.mit.edu	37	6	49399240	49399240	+	3'UTR	DEL	T	-	-	rs71809455		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49399240delT	uc003ozg.3	-	13						NM_000255	NP_000246	P22033	MUTA_HUMAN	methylmalonyl Coenzyme A mutase precursor						fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity				0	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTTTTAGGGATTTTTTTTTTA	0.279													2	4	---	---	---	---	
LAMA4	3910	broad.mit.edu	37	6	112463694	112463695	+	Intron	INS	-	A	A	rs141758766	by1000genomes	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112463694_112463695insA	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TGAAAGAAAGCAAAAAAAAAGT	0.391													5	3	---	---	---	---	
DEPDC6	64798	broad.mit.edu	37	8	121061618	121061618	+	Intron	DEL	T	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121061618delT	uc003yow.3	+						DEPDC6_uc011lid.1_Intron	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			actaaaacgattttttttttt	0.129													4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8331407	8331416	+	Intron	DEL	TTATTTTCAC	-	-	rs10976963		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8331407_8331416delTTATTTTCAC	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTTCCTCTGATTATTTTCACTTATTTTCAC	0.276										TSP Lung(15;0.13)			6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66545695	66545695	+	Intron	DEL	A	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66545695delA	uc010mnh.1	-						uc004aef.2_Intron					Homo sapiens cDNA FLJ20444 fis, clone KAT05128.																		CTGTAAGAGGAAAAAAAAACA	0.373													8	4	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	91986851	91986852	+	Intron	INS	-	GT	GT			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91986851_91986852insGT	uc011ltm.1	-						SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqm.2_5'Flank	NM_001142287	NP_001135759	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 2						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						gtgtgtgtggggtgtggtgtgt	0.000													4	2	---	---	---	---	
C9orf5	23731	broad.mit.edu	37	9	111869016	111869017	+	Intron	INS	-	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111869016_111869017insA	uc004bdt.3	-						C9orf5_uc004bds.3_Intron|C9orf5_uc004bdr.3_Intron	NM_032012	NP_114401	Q9H330	CI005_HUMAN	hypothetical protein LOC23731							integral to membrane				central_nervous_system(1)	1		Myeloproliferative disorder(63;0.204)		OV - Ovarian serous cystadenocarcinoma(323;3.08e-05)|STAD - Stomach adenocarcinoma(157;0.0823)		ACTTATCAGGCAAAAAAAAAAA	0.307													4	2	---	---	---	---	
PHYH	5264	broad.mit.edu	37	10	13320112	13320112	+	3'UTR	DEL	T	-	-	rs149348982		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13320112delT	uc001imf.2	-	9					PHYH_uc001ime.2_3'UTR|PHYH_uc001img.2_3'UTR	NM_006214	NP_006205	O14832	PAHX_HUMAN	phytanoyl-CoA 2-hydroxylase isoform a precursor						fatty acid alpha-oxidation|nervous system development	peroxisomal matrix	electron carrier activity|L-ascorbic acid binding|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|phytanoyl-CoA dioxygenase activity|protein binding				0		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)	ACTTTTACTGTTTTTTTTTTC	0.308													4	4	---	---	---	---	
IPMK	253430	broad.mit.edu	37	10	60028838	60028839	+	5'Flank	INS	-	C	C	rs140962691	by1000genomes	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60028838_60028839insC	uc001jkb.2	-						CISD1_uc001jkc.3_5'Flank	NM_152230	NP_689416	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase							nucleus	ATP binding|inositol trisphosphate 6-kinase activity			ovary(1)	1						CTTCCTTATGGCCAGGACAGCT	0.634													3	6	---	---	---	---	
IDE	3416	broad.mit.edu	37	10	94268316	94268317	+	Intron	INS	-	A	A	rs144722232		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94268316_94268317insA	uc001kia.2	-							NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	atctaaaaaagaaaaaaaaAAA	0.188													5	4	---	---	---	---	
NFKB2	4791	broad.mit.edu	37	10	104158973	104158973	+	Intron	DEL	A	-	-	rs146186127		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104158973delA	uc001kvb.2	+						NFKB2_uc001kva.2_Intron|NFKB2_uc001kvd.2_Intron|NFKB2_uc009xxc.2_Intron	NM_001077494	NP_001070962	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	Bcl3/NF-kappaB2 complex|cytosol|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			lung(3)	3		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)		actccgtctcaaaaaaaaaaa	0.264			T	IGH@	B-NHL								6	3	---	---	---	---	
LGR4	55366	broad.mit.edu	37	11	27403982	27403982	+	Intron	DEL	C	-	-	rs5790650		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27403982delC	uc001mrj.3	-						LGR4_uc001mrk.3_Intron	NM_018490	NP_060960	Q9BXB1	LGR4_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			ovary(1)	1						CCTTTTCTTACAATAATGAAT	0.279													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	28608939	28608939	+	IGR	DEL	T	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28608939delT								METT5D1 (253885 upstream) : None (None downstream)																							ccttcctttcttttttttccc	0.000													4	2	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76892820	76892825	+	Intron	DEL	TTTTTG	-	-	rs12794459		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76892820_76892825delTTTTTG	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						CAAGtttttttttttgtttttttttt	0.291													8	4	---	---	---	---	
KCTD14	65987	broad.mit.edu	37	11	77728498	77728498	+	Intron	DEL	T	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77728498delT	uc001oyw.3	-							NM_023930	NP_076419	Q9BQ13	KCD14_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1e-24)			gggggtgggcttttttttttt	0.000													4	2	---	---	---	---	
ATM	472	broad.mit.edu	37	11	108206869	108206869	+	Intron	DEL	A	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108206869delA	uc001pkb.1	+						ATM_uc009yxr.1_Intron|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Intron	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1						cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		acaaaaagttaaaaaaaaaaa	0.000			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			5	3	---	---	---	---	
ZW10	9183	broad.mit.edu	37	11	113621741	113621742	+	Intron	INS	-	T	T	rs34836136		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113621741_113621742insT	uc001poe.2	-						ZW10_uc009yyv.2_Intron	NM_004724	NP_004715	O43264	ZW10_HUMAN	centromere/kinetochore protein zw10						cell division|ER to Golgi vesicle-mediated transport|establishment of mitotic spindle orientation|meiosis|mitotic cell cycle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|protein complex assembly|protein localization to kinetochore|protein transport|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|endoplasmic reticulum membrane|kinetochore microtubule|nucleus|spindle pole	centromeric DNA binding|protein binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		actgcaaatacttttttttTTT	0.149													4	3	---	---	---	---	
ENO2	2026	broad.mit.edu	37	12	7030553	7030554	+	Intron	INS	-	A	A			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7030553_7030554insA	uc001qru.1	+						ENO2_uc009zfi.1_Intron|ENO2_uc010sfq.1_Intron|ENO2_uc001qrv.1_Intron	NM_001975	NP_001966	P09104	ENOG_HUMAN	enolase 2						gluconeogenesis|glycolysis	phosphopyruvate hydratase complex|plasma membrane	magnesium ion binding|phosphopyruvate hydratase activity				0						gaggctctgtcaaaaaaaaaaa	0.208													4	3	---	---	---	---	
DUSP16	80824	broad.mit.edu	37	12	12640307	12640307	+	Intron	DEL	T	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12640307delT	uc001rao.1	-						DUSP16_uc001ran.1_Intron	NM_030640	NP_085143	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16						inactivation of MAPK activity|MAPK export from nucleus|MAPK phosphatase export from nucleus, leptomycin B sensitive	cytoplasmic membrane-bounded vesicle|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		AAAAAAAAAATTTAAGGACAA	0.313													4	2	---	---	---	---	
ERGIC2	51290	broad.mit.edu	37	12	29494269	29494270	+	Intron	DEL	TC	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29494269_29494270delTC	uc001riv.2	-						ERGIC2_uc001riw.2_Intron	NM_016570	NP_057654	Q96RQ1	ERGI2_HUMAN	PTX1 protein						vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane|nucleus				ovary(1)	1	Lung NSC(12;2.02e-08)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)|Lung SC(9;0.184)				Arsenic trioxide(DB01169)	AGCTACTATTtctctctctctc	0.153													4	2	---	---	---	---	
CALCOCO1	57658	broad.mit.edu	37	12	54108601	54108602	+	Intron	DEL	AC	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54108601_54108602delAC	uc001sef.2	-						CALCOCO1_uc001see.2_5'Flank|CALCOCO1_uc010som.1_Intron|CALCOCO1_uc010son.1_Intron|CALCOCO1_uc001seh.2_Intron|CALCOCO1_uc009znd.2_Intron|CALCOCO1_uc001seg.2_Intron|CALCOCO1_uc010soo.1_Intron	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform						steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1						CCCTGCTCTGACACACACACAC	0.510													4	2	---	---	---	---	
LOC283392	283392	broad.mit.edu	37	12	72666481	72666483	+	Intron	DEL	AAG	-	-	rs111457826		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72666481_72666483delAAG	uc010stv.1	-						TRHDE_uc001sxa.2_5'Flank	NR_026836				Homo sapiens thyrotropin-releasing hormone degrading enzyme, mRNA (cDNA clone IMAGE:4992272).												0						gaagaagaaaaagaagaggaaga	0.488													6	3	---	---	---	---	
SDCCAG1	9147	broad.mit.edu	37	14	50176231	50176231	+	Intron	DEL	T	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50176231delT	uc010anj.1	-						KLHDC1_uc001www.2_Intron|KLHDC1_uc010tqg.1_Intron|KLHDC1_uc010tqh.1_Intron	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1							cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)		ATTTTTGTGATTTTTTTTTTT	0.318													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79217771	79217772	+	Intron	INS	-	T	T	rs149588375	by1000genomes	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79217771_79217772insT	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc010asv.1_Intron|uc001xuo.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GCTGCTAATTCTTTTTTTTCTC	0.470													3	3	---	---	---	---	
NLRC3	197358	broad.mit.edu	37	16	3594163	3594163	+	Intron	DEL	A	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3594163delA	uc010btn.2	-							NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN	NOD3 protein						I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						tgtctcgaggaaaaaaaaaaa	0.229													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	27088704	27088705	+	IGR	INS	-	CTTT	CTTT	rs143025532	by1000genomes	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27088704_27088705insCTTT								C16orf82 (8218 upstream) : JMJD5 (126102 downstream)																							ctccttccttccttccttcctt	0.000													4	4	---	---	---	---	
EFCAB3	146779	broad.mit.edu	37	17	60475386	60475387	+	Intron	INS	-	A	A	rs146811952		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60475386_60475387insA	uc002izu.1	+						EFCAB3_uc010wpc.1_Intron	NM_173503	NP_775774	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3 isoform b								calcium ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			gactccatctcaaaaaaaaaaa	0.183													10	7	---	---	---	---	
LRP3	4037	broad.mit.edu	37	19	33694048	33694051	+	Intron	DEL	TGAG	-	-	rs3065441		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33694048_33694051delTGAG	uc010edh.2	+						LRP3_uc010xrp.1_Intron|LRP3_uc002nuk.3_5'Flank	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein						receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					tgtgagcatatgagtgaggcgtgt	0.044													4	2	---	---	---	---	
BCAM	4059	broad.mit.edu	37	19	45318164	45318165	+	Intron	DEL	TG	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45318164_45318165delTG	uc002ozu.2	+						BCAM_uc002ozt.1_Intron	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1						cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				TTTTTTTGGttgtttttttttt	0.262													4	3	---	---	---	---	
ZNF321	399669	broad.mit.edu	37	19	53431606	53431606	+	3'UTR	DEL	A	-	-	rs35140094		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53431606delA	uc010eqj.2	-	4					ZNF321_uc002qaj.1_3'UTR|ZNF321_uc002qak.1_3'UTR	NM_203307	NP_976052			zinc finger protein 321												0				GBM - Glioblastoma multiforme(134;0.0305)		ACTCCGTCTTAAAAAAAAAAA	0.149													4	4	---	---	---	---	
COL9A3	1299	broad.mit.edu	37	20	61463679	61463689	+	Intron	DEL	AGTCGCCCTTT	-	-	rs143006001		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61463679_61463689delAGTCGCCCTTT	uc002ydm.2	+							NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor						axon guidance	collagen type IX					0	Breast(26;5.68e-08)					CGTGTCTGTCAGTCGCCCTTTCTGGCTCCTG	0.645													5	5	---	---	---	---	
DSCAM	1826	broad.mit.edu	37	21	41505545	41505545	+	Intron	DEL	A	-	-	rs67478168		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41505545delA	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				aacaaaaaacaaaaaaaaaga	0.264													4	2	---	---	---	---	
RAB36	9609	broad.mit.edu	37	22	23498332	23498333	+	Intron	INS	-	AA	AA	rs56254210		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23498332_23498333insAA	uc002zwv.1	+						RAB36_uc010gtw.1_Intron	NM_004914	NP_004905	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		TGTCCTCCAAGACCCACTGAGA	0.594													4	2	---	---	---	---	
TTLL1	25809	broad.mit.edu	37	22	43435575	43435576	+	3'UTR	INS	-	AAA	AAA	rs143546633	by1000genomes	TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43435575_43435576insAAA	uc003bdi.2	-	11					TTLL1_uc010gzh.2_3'UTR|TTLL1_uc003bdj.2_3'UTR|TTLL1_uc003bdh.2_3'UTR	NM_012263	NP_036395	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1						protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		GGTTAAAAATTAAAAAAAAAAG	0.312													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	36507744	36507745	+	IGR	INS	-	T	T	rs66602609		TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36507744_36507745insT								CXorf30 (104311 upstream) : FAM47C (518725 downstream)																							tttcttTCGGGttttttttttt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	52613556	52613557	+	IGR	DEL	AC	-	-			TCGA-60-2720-01	TCGA-60-2720-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52613556_52613557delAC								XAGE1D (369605 upstream) : SSX8 (38428 downstream)																							acacacacagacacacacacac	0.361													4	2	---	---	---	---	
