Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ATAD3A	55210	broad.mit.edu	37	1	1459303	1459303	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1459303A>T	uc001afz.1	+	10	1286	c.1192A>T	c.(1192-1194)ATG>TTG	p.M398L	ATAD3A_uc001aga.1_Missense_Mutation_p.M350L|ATAD3A_uc001agb.1_Missense_Mutation_p.M271L	NM_018188	NP_060658	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A	398							ATP binding|nucleoside-triphosphatase activity|protein binding			skin(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		GAACATCCTGATGTACGGGCC	0.642													56	55	---	---	---	---	PASS
LOC649330	649330	broad.mit.edu	37	1	12907697	12907697	+	Nonsense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12907697G>C	uc009vno.2	-	1	541	c.446C>G	c.(445-447)TCA>TGA	p.S149*	HNRNPCL1_uc010obf.1_Nonsense_Mutation_p.S149*	NM_001146181	NP_001139653	B7ZW38	B7ZW38_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	149							nucleic acid binding|nucleotide binding				0						GGTGTTTCCTGATAGACGTTG	0.498													55	156	---	---	---	---	PASS
C1QA	712	broad.mit.edu	37	1	22965844	22965844	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22965844C>T	uc001bfy.2	+	3	767	c.682C>T	c.(682-684)CAG>TAG	p.Q228*	C1QA_uc001bfz.2_Nonsense_Mutation_p.Q228*	NM_015991	NP_057075	P02745	C1QA_HUMAN	complement component 1, q subcomponent, A chain	228	C1q.				cell-cell signaling|complement activation, classical pathway|innate immune response	collagen|complement component C1 complex					0		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.41e-27)|Colorectal(126;1.52e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.63e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000541)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TCACATTTACCAGGGCTCTGA	0.602													26	57	---	---	---	---	PASS
AIM1L	55057	broad.mit.edu	37	1	26672446	26672446	+	5'Flank	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26672446C>A	uc001bmd.3	-						uc009vsi.1_Missense_Mutation_p.V235L	NM_001039775	NP_001034864	Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like								sugar binding			pancreas(1)	1		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		AGCACTTTCACGGCCTGGCTG	0.716													14	15	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34042934	34042934	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34042934C>T	uc001bxn.1	-	50	7573	c.7544G>A	c.(7543-7545)GGC>GAC	p.G2515D	CSMD2_uc001bxm.1_Missense_Mutation_p.G2513D	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2515	Sushi 14.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CAGGTGGTAGCCCTGGGGGTG	0.617													31	94	---	---	---	---	PASS
DLGAP3	58512	broad.mit.edu	37	1	35350614	35350614	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35350614G>A	uc001byc.2	-	6	1965	c.1965C>T	c.(1963-1965)TTC>TTT	p.F655F		NM_001080418	NP_001073887	O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated	655					cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)				CAATAGAGTGGAACTCCCTCC	0.597													37	35	---	---	---	---	PASS
TRIT1	54802	broad.mit.edu	37	1	40319707	40319707	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40319707T>C	uc010oiz.1	-	3	363	c.349A>G	c.(349-351)ATT>GTT	p.I117V	TRIT1_uc001cec.3_RNA|TRIT1_uc001ced.3_5'UTR|TRIT1_uc001cee.3_RNA|TRIT1_uc001cef.3_RNA|TRIT1_uc001ceg.3_5'UTR|TRIT1_uc001ceh.3_5'UTR|TRIT1_uc009vvv.2_5'UTR|TRIT1_uc001cei.3_5'UTR|TRIT1_uc001ceq.2_Intron|TRIT1_uc001cek.2_Intron|TRIT1_uc009vvx.2_Intron|TRIT1_uc001cel.2_Intron|TRIT1_uc001cem.2_Intron|TRIT1_uc001cen.2_Intron|TRIT1_uc001ceo.2_Intron|TRIT1_uc001cep.2_Intron|TRIT1_uc010oja.1_RNA	NM_017646	NP_060116	Q9H3H1	MOD5_HUMAN	tRNA isopentenyltransferase 1 precursor	117					tRNA processing	mitochondrion	ATP binding|metal ion binding|tRNA dimethylallyltransferase activity			ovary(1)	1	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CCCACAACAATAGGAATTTTG	0.373													67	35	---	---	---	---	PASS
ZSWIM5	57643	broad.mit.edu	37	1	45501723	45501723	+	Silent	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45501723A>G	uc001cnd.2	-	9	2371	c.2143T>C	c.(2143-2145)TTA>CTA	p.L715L		NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5	715							zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					TCCAGCAGTAAGATGCATTGT	0.488													60	46	---	---	---	---	PASS
ROR1	4919	broad.mit.edu	37	1	64643964	64643964	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64643964G>A	uc001dbj.2	+	9	2639	c.2240G>A	c.(2239-2241)CGG>CAG	p.R747Q	uc001dbm.2_5'Flank	NM_005012	NP_005003	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	747	Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|central_nervous_system(1)|skin(1)|kidney(1)	19						GTCCGGCTTCGGTCCTGGGAG	0.512													19	70	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70397238	70397238	+	Silent	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70397238T>C	uc001dep.2	+	6	612	c.582T>C	c.(580-582)AAT>AAC	p.N194N	LRRC7_uc009wbg.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	194	LRR 8.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						TAGGCAATAATGAATTCGGTG	0.388													12	47	---	---	---	---	PASS
SLC44A5	204962	broad.mit.edu	37	1	75707753	75707753	+	Intron	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75707753T>A	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						GAGACTAAAATAGAAGGAAGA	0.328													61	70	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79404932	79404932	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79404932C>A	uc001diq.3	-	4	493	c.337G>T	c.(337-339)GCA>TCA	p.A113S		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	113	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TGGCAGTTTGCATTCACATTT	0.249													15	31	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86306958	86306958	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86306958A>T	uc001dlj.2	-	42	3616	c.3574T>A	c.(3574-3576)TAC>AAC	p.Y1192N	COL24A1_uc001dli.2_Missense_Mutation_p.Y328N|COL24A1_uc010osd.1_Missense_Mutation_p.Y492N|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	1192	Collagen-like 12.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		TCTCCTGGGTAGCCCTAAAAT	0.328													27	23	---	---	---	---	PASS
DPYD	1806	broad.mit.edu	37	1	98157303	98157303	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98157303C>A	uc001drv.2	-	7	869	c.732G>T	c.(730-732)GAG>GAT	p.E244D	DPYD_uc010oub.1_RNA	NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1	244					'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	TTAGCTCAATCTCAAAATTCA	0.368													43	48	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103380351	103380351	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103380351C>G	uc001dul.2	-	51	4151	c.3833G>C	c.(3832-3834)AGA>ACA	p.R1278T	COL11A1_uc001duk.2_Missense_Mutation_p.R474T|COL11A1_uc001dum.2_Missense_Mutation_p.R1290T|COL11A1_uc001dun.2_Missense_Mutation_p.R1239T|COL11A1_uc009weh.2_Missense_Mutation_p.R1162T	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1278	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTTCTCTCCTCTTTCTCCTTT	0.428													5	17	---	---	---	---	PASS
PHTF1	10745	broad.mit.edu	37	1	114269168	114269168	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114269168C>A	uc009wgp.1	-	5	812	c.360G>T	c.(358-360)ATG>ATT	p.M120I	PHTF1_uc001edn.2_Missense_Mutation_p.M120I|PHTF1_uc010own.1_Missense_Mutation_p.M120I|PHTF1_uc001edp.2_Missense_Mutation_p.M120I	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	120						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCACAATAGGCATCATCAAAT	0.328													46	38	---	---	---	---	PASS
SEC22B	9554	broad.mit.edu	37	1	145112467	145112467	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145112467G>C	uc001eml.1	+	6	581	c.441G>C	c.(439-441)AGG>AGC	p.R147S	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883	O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B	147	v-SNARE coiled-coil homology.|Cytoplasmic (Potential).				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0						ATGTGCAGAGGATCATGGTGG	0.408													14	273	---	---	---	---	PASS
NOTCH2NL	388677	broad.mit.edu	37	1	145273192	145273192	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145273192G>T	uc001emn.3	+	3	416	c.46G>T	c.(46-48)GAA>TAA	p.E16*	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'UTR|NOTCH2NL_uc001emm.3_Nonsense_Mutation_p.E16*|NOTCH2NL_uc001emo.2_Nonsense_Mutation_p.E16*|NOTCH2NL_uc010oyh.1_RNA	NM_203458	NP_982283	Q7Z3S9	NT2NL_HUMAN	Notch homolog 2 N-terminal like protein	16	EGF-like 1.				cell differentiation|multicellular organismal development|Notch signaling pathway	cytoplasm|extracellular region	calcium ion binding			ovary(1)	1						CAGATGTCCAGAAGGCTTCTT	0.463													11	299	---	---	---	---	PASS
ADAR	103	broad.mit.edu	37	1	154574628	154574628	+	Nonsense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154574628T>A	uc001ffh.2	-	2	690	c.490A>T	c.(490-492)AAA>TAA	p.K164*	ADAR_uc001ffj.2_Nonsense_Mutation_p.K164*|ADAR_uc001ffi.2_Nonsense_Mutation_p.K164*|ADAR_uc001ffk.2_5'UTR|ADAR_uc001ffl.1_5'UTR	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a	164	DRADA 1.				adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GTCCCAAGTTTCCCAGACAGA	0.473													331	418	---	---	---	---	PASS
ADAR	103	broad.mit.edu	37	1	154574810	154574810	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154574810C>T	uc001ffh.2	-	2	508	c.308G>A	c.(307-309)GGG>GAG	p.G103E	ADAR_uc001ffj.2_Missense_Mutation_p.G103E|ADAR_uc001ffi.2_Missense_Mutation_p.G103E|ADAR_uc001ffk.2_5'UTR|ADAR_uc001ffl.1_5'UTR|ADAR_uc001ffm.1_Intron|ADAR_uc001ffn.1_Intron	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a	103					adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		TCTCTGGAGCCCCTGACTTCT	0.567													107	144	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157772251	157772251	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157772251C>A	uc001frg.2	-	4	636	c.523G>T	c.(523-525)GAG>TAG	p.E175*	FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Nonsense_Mutation_p.E175*|FCRL1_uc001fri.2_Nonsense_Mutation_p.E175*|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	175	Ig-like C2-type 2.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCATCACTCTCCCTCACTGAA	0.488													198	198	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158645971	158645971	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158645971G>T	uc001fst.1	-	8	1271	c.1072C>A	c.(1072-1074)CTG>ATG	p.L358M		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	358	Spectrin 4.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CTGGTGGCCAGGGCACGAATA	0.488													278	264	---	---	---	---	PASS
OR6K2	81448	broad.mit.edu	37	1	158669554	158669554	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158669554C>A	uc001fsu.1	-	1	889	c.889G>T	c.(889-891)GAA>TAA	p.E297*		NM_001005279	NP_001005279	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K,	297	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					TCTTTTATTTCTTTATTCCTC	0.383													62	96	---	---	---	---	PASS
OR10J3	441911	broad.mit.edu	37	1	159283910	159283910	+	Nonsense_Mutation	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159283910A>T	uc010piu.1	-	1	540	c.540T>A	c.(538-540)TGT>TGA	p.C180*		NM_001004467	NP_001004467	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J,	180	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_hematologic(112;0.0429)					GTCTCACATCACAGAAGAAGT	0.502													70	93	---	---	---	---	PASS
OLFML2B	25903	broad.mit.edu	37	1	161976198	161976198	+	Silent	SNP	G	T	T	rs140833279		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161976198G>T	uc001gbu.2	-	4	1036	c.612C>A	c.(610-612)ACC>ACA	p.T204T	OLFML2B_uc010pkq.1_Silent_p.T204T	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	204	Potential.									skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			TATTCATCTCGGTTCGAATTT	0.433													131	194	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176738762	176738762	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176738762G>C	uc001gkz.2	+	16	5507	c.4343G>C	c.(4342-4344)TGT>TCT	p.C1448S	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1448	Sushi 1.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CTGCTCACATGTTCTTCTGGG	0.478													139	25	---	---	---	---	PASS
CFH	3075	broad.mit.edu	37	1	196682958	196682958	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196682958G>A	uc001gtj.3	+	10	1670	c.1430G>A	c.(1429-1431)TGC>TAC	p.C477Y		NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	477	Sushi 8.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						AAATATCAATGCAAACTAGGA	0.343													22	88	---	---	---	---	PASS
DENND1B	163486	broad.mit.edu	37	1	197522230	197522230	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197522230G>A	uc001guf.3	-	16	1500	c.1162C>T	c.(1162-1164)CGA>TGA	p.R388*	DENND1B_uc010ppe.1_Nonsense_Mutation_p.R368*|DENND1B_uc010ppf.1_Intron|DENND1B_uc001gue.3_Nonsense_Mutation_p.R358*	NM_144977	NP_659414	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 2	388	dDENN.					clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						TTTGCCAGTCGACCATCGATA	0.299													8	134	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200587391	200587391	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200587391T>C	uc010ppk.1	-	2	900	c.461A>G	c.(460-462)AAT>AGT	p.N154S	KIF14_uc010ppj.1_5'UTR	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	154	Required for PRC1-binding.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						AGAAACACCATTATTTTCTGT	0.358													91	109	---	---	---	---	PASS
KDM5B	10765	broad.mit.edu	37	1	202727647	202727647	+	Intron	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202727647A>G	uc001gyf.2	-						KDM5B_uc009xag.2_Intron|KDM5B_uc001gyg.1_Intron	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B						negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						TCCTGAAAATAAAGAAAATTA	0.378													30	45	---	---	---	---	PASS
PIK3C2B	5287	broad.mit.edu	37	1	204394051	204394051	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204394051G>A	uc001haw.2	-	34	5313	c.4834C>T	c.(4834-4836)CGA>TGA	p.R1612*	PIK3C2B_uc010pqv.1_Nonsense_Mutation_p.R1584*	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	1612					cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			TCCAGCTCTCGCAGGCGGATG	0.637													59	3	---	---	---	---	PASS
MAPKAPK2	9261	broad.mit.edu	37	1	206902762	206902762	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206902762G>T	uc001hem.1	+	4	792	c.506G>T	c.(505-507)AGC>ATC	p.S169I	MAPKAPK2_uc001hel.1_Missense_Mutation_p.S169I	NM_032960	NP_116584	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated	169	Protein kinase.				activation of MAPK activity|hormone biosynthetic process|innate immune response|leukotriene biosynthetic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|prostanoid metabolic process|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			ATCATGAAGAGCATCGGTGAG	0.522													235	41	---	---	---	---	PASS
MAPKAPK2	9261	broad.mit.edu	37	1	206902763	206902763	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206902763C>T	uc001hem.1	+	4	793	c.507C>T	c.(505-507)AGC>AGT	p.S169S	MAPKAPK2_uc001hel.1_Silent_p.S169S	NM_032960	NP_116584	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated	169	Protein kinase.				activation of MAPK activity|hormone biosynthetic process|innate immune response|leukotriene biosynthetic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|prostanoid metabolic process|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			TCATGAAGAGCATCGGTGAGG	0.522													233	40	---	---	---	---	PASS
CAMK1G	57172	broad.mit.edu	37	1	209785290	209785290	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209785290G>A	uc001hhd.2	+	11	1171	c.1069G>A	c.(1069-1071)GAG>AAG	p.E357K	CAMK1G_uc001hhf.3_Missense_Mutation_p.E357K|CAMK1G_uc001hhe.2_Missense_Mutation_p.E357K	NM_020439	NP_065172	Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	357						Golgi membrane|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			breast(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		CACCATCACCGAGGCACCTGT	0.647													76	116	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216270521	216270521	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216270521T>A	uc001hku.1	-	22	5049	c.4662A>T	c.(4660-4662)GAA>GAT	p.E1554D		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1554	Laminin G-like 1.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAATCAAACCTTCAGGCACTT	0.408										HNSCC(13;0.011)			100	26	---	---	---	---	PASS
NUP133	55746	broad.mit.edu	37	1	229631744	229631744	+	Silent	SNP	C	A	A	rs147071617	byFrequency	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229631744C>A	uc001htn.2	-	7	962	c.870G>T	c.(868-870)ACG>ACT	p.T290T		NM_018230	NP_060700	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	290					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			breast(4)|skin(2)|ovary(1)	7	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				TGTTTGAACTCGTCAGGCTAT	0.363													3	117	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947973	237947973	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947973G>A	uc001hyl.1	+	90	13081	c.12961G>A	c.(12961-12963)GGT>AGT	p.G4321S	RYR2_uc010pya.1_Missense_Mutation_p.G736S	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4321					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCTCGTCGAAGGTGCTAAAAA	0.522													94	11	---	---	---	---	PASS
CEP170	9859	broad.mit.edu	37	1	243329385	243329385	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243329385C>A	uc001hzs.2	-	13	2285	c.1877G>T	c.(1876-1878)AGA>ATA	p.R626I	CEP170_uc001hzt.2_Missense_Mutation_p.R528I|CEP170_uc001hzu.2_Missense_Mutation_p.R528I|CEP170_uc001hzv.1_Missense_Mutation_p.R4I	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	626						centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GCCAGTACTTCTCACTGTCAT	0.413													41	1	---	---	---	---	PASS
OR1C1	26188	broad.mit.edu	37	1	247921531	247921531	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247921531A>T	uc010pza.1	-	1	178	c.178T>A	c.(178-180)TAC>AAC	p.Y60N		NM_012353	NP_036485	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C,	60	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			AGGAAGAAGTACATAGGGGAA	0.463													50	7	---	---	---	---	PASS
OR2T8	343172	broad.mit.edu	37	1	248085208	248085208	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248085208G>A	uc010pzc.1	+	1	889	c.889G>A	c.(889-891)GGA>AGA	p.G297R		NM_001005522	NP_001005522	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T,	297	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGAGGTGAAGGGAGCCCTGAC	0.463													227	36	---	---	---	---	PASS
OR2M2	391194	broad.mit.edu	37	1	248344163	248344163	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248344163C>T	uc010pzf.1	+	1	876	c.876C>T	c.(874-876)CTC>CTT	p.L292L		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	292	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCTACAGCCTCCGCAACAAGG	0.463													75	230	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248525318	248525318	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525318C>G	uc001ieh.1	+	1	436	c.436C>G	c.(436-438)CTT>GTT	p.L146V		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	146	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGAATTTTTCCTTCTAGCCAC	0.522													294	38	---	---	---	---	PASS
KCNK3	3777	broad.mit.edu	37	2	26950669	26950669	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26950669C>T	uc002rhn.2	+	2	581	c.418C>T	c.(418-420)CTG>TTG	p.L140L		NM_002246	NP_002237	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	140	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGGTACCTGCTGCACCGCGC	0.622													110	19	---	---	---	---	PASS
KCNK3	3777	broad.mit.edu	37	2	26950670	26950670	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26950670T>G	uc002rhn.2	+	2	582	c.419T>G	c.(418-420)CTG>CGG	p.L140R		NM_002246	NP_002237	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	140	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGTACCTGCTGCACCGCGCC	0.622													111	18	---	---	---	---	PASS
FAM82A1	151393	broad.mit.edu	37	2	38178824	38178824	+	Intron	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38178824C>G	uc002rql.2	+						FAM82A1_uc002rqn.1_Missense_Mutation_p.L156V|FAM82A1_uc002rqk.1_Intron|FAM82A1_uc002rqm.2_Intron	NM_144713	NP_653314	Q96LZ7	RMD2_HUMAN	family with sequence similarity 82, member A1							cytoplasm|integral to membrane|microtubule|spindle pole	binding			ovary(1)	1						TGTGTTTAATCTAAATGAAAT	0.323													112	14	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43919696	43919696	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43919696C>G	uc010yny.1	+	4	313	c.230C>G	c.(229-231)ACC>AGC	p.T77S	PLEKHH2_uc002rte.3_Missense_Mutation_p.T77S|PLEKHH2_uc002rtf.3_Missense_Mutation_p.T77S	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	77	Potential.					cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AATATTCAAACCAGTGAATCA	0.308													37	55	---	---	---	---	PASS
LRPPRC	10128	broad.mit.edu	37	2	44184548	44184548	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44184548C>A	uc002rtr.2	-	14	1683	c.1625G>T	c.(1624-1626)AGT>ATT	p.S542I	LRPPRC_uc010yob.1_Missense_Mutation_p.S442I	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	542					mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CAGTAGGCTACTTCTTATAGA	0.388													95	112	---	---	---	---	PASS
LHCGR	3973	broad.mit.edu	37	2	48914948	48914948	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48914948C>G	uc002rwu.3	-	11	2058	c.1988G>C	c.(1987-1989)TGC>TCC	p.C663S	GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	663	Cytoplasmic (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	GCCATTTTTGCAGTTGGAGGT	0.423									Familial_Male-Limited_Precocious_Puberty				66	427	---	---	---	---	PASS
PUS10	150962	broad.mit.edu	37	2	61238926	61238926	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61238926G>C	uc010fci.2	-	2	160	c.100C>G	c.(100-102)CAT>GAT	p.H34D	PUS10_uc002sao.2_Missense_Mutation_p.H34D|PUS10_uc010ypk.1_5'UTR|PUS10_uc002sap.1_RNA|PUS10_uc002saq.1_RNA	NM_144709	NP_653310	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10	34					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(2)|large_intestine(1)|kidney(1)	4			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			TAAGGTGCATGAAAATCCACA	0.343													26	66	---	---	---	---	PASS
ATP6V1B1	525	broad.mit.edu	37	2	71188824	71188824	+	Splice_Site	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71188824G>T	uc002shj.2	+	8	872	c.785_splice	c.e8+1	p.T262_splice	ATP6V1B1_uc002shi.1_Silent_p.T262T|ATP6V1B1_uc010fdv.2_Splice_Site_p.T262_splice|ATP6V1B1_uc010fdw.2_Splice_Site|ATP6V1B1_uc010fdx.2_Splice_Site_p.T220_splice	NM_001692	NP_001683	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1						ATP hydrolysis coupled proton transport|calcium ion homeostasis|cellular iron ion homeostasis|excretion|inner ear morphogenesis|insulin receptor signaling pathway|ossification|pH reduction|sensory perception of sound|transferrin transport	apical plasma membrane|basolateral plasma membrane|cytosol|endomembrane system|lateral plasma membrane|microvillus|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			skin(1)	1						ATGACCCCACGTGAGCTTTCC	0.562													88	101	---	---	---	---	PASS
NAT8B	51471	broad.mit.edu	37	2	73928183	73928183	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73928183G>C	uc002sjk.1	-	2	285	c.250C>G	c.(250-252)CGG>GGG	p.R84G		NM_016347	NP_057431	Q9UHF3	NAT8B_HUMAN	N-acetyltransferase 8B	84	N-acetyltransferase.				gastrulation with mouth forming second	integral to membrane	N-acetyltransferase activity				0						TCTACATACCGCGTCCAGGGT	0.547													9	236	---	---	---	---	PASS
NAT8B	51471	broad.mit.edu	37	2	73928184	73928184	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73928184C>T	uc002sjk.1	-	2	284	c.249G>A	c.(247-249)ACG>ACA	p.T83T		NM_016347	NP_057431	Q9UHF3	NAT8B_HUMAN	N-acetyltransferase 8B	83	N-acetyltransferase.				gastrulation with mouth forming second	integral to membrane	N-acetyltransferase activity				0						CTACATACCGCGTCCAGGGTT	0.552													9	241	---	---	---	---	PASS
C2orf3	6936	broad.mit.edu	37	2	75921419	75921419	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75921419T>C	uc002sno.2	-	6	1098	c.968A>G	c.(967-969)TAT>TGT	p.Y323C	C2orf3_uc010ffs.2_5'UTR|C2orf3_uc002snn.2_Missense_Mutation_p.Y154C|C2orf3_uc010fft.2_5'UTR	NM_003203	NP_003194	P16383	GCF_HUMAN	hypothetical protein LOC6936	323					negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						CATGCTTTTATAGAATTTACA	0.303													115	149	---	---	---	---	PASS
IL1F7	27178	broad.mit.edu	37	2	113676172	113676172	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113676172A>G	uc002tij.2	+	5	485	c.443A>G	c.(442-444)GAA>GGA	p.E148G	IL1F7_uc002tik.2_Missense_Mutation_p.E127G|IL1F7_uc002til.2_Missense_Mutation_p.E108G|IL1F7_uc002tim.2_Missense_Mutation_p.E87G|IL1F7_uc002tin.2_Missense_Mutation_p.E122G	NM_014439	NP_055254	Q9NZH6	IL37_HUMAN	interleukin 1 family, member 7 isoform 1	148					immune response	cytosol|extracellular space|nucleus	cytokine activity|interleukin-1 receptor antagonist activity|interleukin-1 receptor binding				0						GCCCAAAAGGAATCAGCACGC	0.532													27	51	---	---	---	---	PASS
MARCO	8685	broad.mit.edu	37	2	119732098	119732098	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119732098C>T	uc002tln.1	+	6	702	c.570C>T	c.(568-570)GGC>GGT	p.G190G	MARCO_uc010yyf.1_Silent_p.G112G	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	190	Collagen-like.|Extracellular (Potential).				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity			ovary(3)|skin(2)|central_nervous_system(1)	6						CCCTTCCAGGCCCCTCGGGAC	0.542													31	25	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125660653	125660653	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125660653G>C	uc002tno.2	+	22	3992	c.3628G>C	c.(3628-3630)GTG>CTG	p.V1210L	CNTNAP5_uc010flu.2_Missense_Mutation_p.V1211L	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	1210	Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGTGAATGCAGTGACCACGGT	0.522													5	6	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136566451	136566451	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136566451G>T	uc002tuu.1	-	8	3477	c.3466C>A	c.(3466-3468)CAC>AAC	p.H1156N		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1156	3.|Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		AAAATGGGGTGAGCAAACCAG	0.567													73	80	---	---	---	---	PASS
TBR1	10716	broad.mit.edu	37	2	162280499	162280499	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162280499G>T	uc002ubw.1	+	6	2112	c.1810G>T	c.(1810-1812)GCC>TCC	p.A604S	TBR1_uc010foy.2_Missense_Mutation_p.A317S	NM_006593	NP_006584	Q16650	TBR1_HUMAN	T-box, brain, 1	604						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						CGCCGAGGACGCCAAGCCCAA	0.721													3	1	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162804167	162804167	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162804167T>A	uc002ubx.3	+	17	2379	c.2195T>A	c.(2194-2196)CTG>CAG	p.L732Q	SLC4A10_uc002uby.3_Missense_Mutation_p.L702Q|SLC4A10_uc010zcs.1_Missense_Mutation_p.L713Q	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	732	Helical; (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						TCTGTGATCCTGTTCTTTTCC	0.433													94	80	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	167760266	167760266	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167760266C>A	uc002udx.2	+	1	292	c.274C>A	c.(274-276)CGG>AGG	p.R92R	XIRP2_uc010fpn.2_Silent_p.R92R|XIRP2_uc010fpo.2_Silent_p.R92R|XIRP2_uc010fpp.2_Silent_p.R92R	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	Error:Variant_position_missing_in_A4UGR9_after_alignment					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GGAATATGGTCGGCCAGAAGT	0.522													35	28	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168096357	168096357	+	Intron	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168096357G>A	uc002udx.2	+						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Intron|XIRP2_uc010fpq.2_Intron|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						CTGTCTGTGTGCTTTCAGGAG	0.353													19	39	---	---	---	---	PASS
TLK1	9874	broad.mit.edu	37	2	171863104	171863104	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171863104G>A	uc002ugn.2	-	17	2120	c.1648C>T	c.(1648-1650)CTG>TTG	p.L550L	TLK1_uc002ugo.2_Silent_p.L571L|TLK1_uc002ugp.2_Silent_p.L502L|TLK1_uc002ugq.2_RNA|TLK1_uc010zdn.1_Silent_p.L454L	NM_012290	NP_036422	Q9UKI8	TLK1_HUMAN	tousled-like kinase 1 isoform 1	550	Protein kinase.				cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1						TGTTGCTTCAGATAGAAATCC	0.338													87	78	---	---	---	---	PASS
HOXD1	3231	broad.mit.edu	37	2	177054177	177054177	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177054177G>C	uc002ukv.3	+	1	871	c.648G>C	c.(646-648)AAG>AAC	p.K216N	HOXD1_uc010fqy.2_Missense_Mutation_p.K216N|HOXD1_uc010zez.1_Missense_Mutation_p.K216N	NM_024501	NP_078777	Q9GZZ0	HXD1_HUMAN	homeobox D1	216						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.0226)		ATGCCTCTAAGAAAGGTAAGT	0.652													19	15	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179436113	179436113	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179436113C>G	uc010zfg.1	-	275	67266	c.67042G>C	c.(67042-67044)GTT>CTT	p.V22348L	uc002umo.2_Intron|uc002ump.1_RNA|TTN_uc010zfh.1_Missense_Mutation_p.V16043L|TTN_uc010zfi.1_Missense_Mutation_p.V15976L|TTN_uc010zfj.1_Missense_Mutation_p.V15851L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	23275							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTGTGACAACTGGAGTGCCA	0.468													52	145	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179634606	179634606	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179634606A>T	uc010zfg.1	-	37	8926	c.8702T>A	c.(8701-8703)TTT>TAT	p.F2901Y	TTN_uc010zfh.1_Missense_Mutation_p.F2855Y|TTN_uc010zfi.1_Missense_Mutation_p.F2855Y|TTN_uc010zfj.1_Missense_Mutation_p.F2855Y|TTN_uc002unb.2_Missense_Mutation_p.F2901Y	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2901							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCACACTCAAAAGAGGCAGT	0.388													64	158	---	---	---	---	PASS
NCKAP1	10787	broad.mit.edu	37	2	183822296	183822296	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183822296A>G	uc002upc.2	-	19	2312	c.1910T>C	c.(1909-1911)ATC>ACC	p.I637T	NCKAP1_uc002upb.2_Missense_Mutation_p.I643T	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1	637					apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TGCTTGACTGATAGTTTTGGC	0.378													82	68	---	---	---	---	PASS
NRP2	8828	broad.mit.edu	37	2	206628623	206628623	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206628623G>A	uc002vaw.2	+	13	3061	c.2270G>A	c.(2269-2271)GGG>GAG	p.G757E	NRP2_uc002vau.2_Missense_Mutation_p.G757E|NRP2_uc002vav.2_Missense_Mutation_p.G757E|NRP2_uc002vax.2_Missense_Mutation_p.G757E|NRP2_uc002vay.2_Missense_Mutation_p.G757E	NM_201266	NP_957718	O60462	NRP2_HUMAN	neuropilin 2 isoform 1 precursor	757	Extracellular (Potential).|MAM.				angiogenesis|axon guidance|cell adhesion	integral to membrane|membrane fraction|plasma membrane	heparin binding|metal ion binding|semaphorin receptor activity|vascular endothelial growth factor receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4						TGGAAGCACGGGCGGATCATC	0.612											OREG0015155	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	55	44	---	---	---	---	PASS
MDH1B	130752	broad.mit.edu	37	2	207603204	207603204	+	3'UTR	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207603204C>G	uc002vbs.2	-	12					MDH1B_uc010ziw.1_Intron|MDH1B_uc010fui.2_3'UTR|MDH1B_uc010fuj.2_3'UTR|MDH1B_uc002vbt.2_RNA	NM_001039845	NP_001034934	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)						carbohydrate metabolic process|malate metabolic process|tricarboxylic acid cycle		binding|malate dehydrogenase activity			ovary(3)|kidney(1)	4				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		CCAATTTGATCTGTTAGGATT	0.249													21	37	---	---	---	---	PASS
PLEKHM3	389072	broad.mit.edu	37	2	208866361	208866361	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208866361C>T	uc002vcl.2	-	2	493	c.3G>A	c.(1-3)ATG>ATA	p.M1I	PLEKHM3_uc002vcm.2_Missense_Mutation_p.M1I	NM_001080475	NP_001073944	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M,	1					intracellular signal transduction		metal ion binding			ovary(1)	1						CCAAAGCTTCCATGTCACAGG	0.478													86	72	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211447374	211447374	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211447374C>A	uc002vee.3	+	6	694	c.562C>A	c.(562-564)CAG>AAG	p.Q188K	CPS1_uc010fur.2_Missense_Mutation_p.Q194K	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	188	Anthranilate phosphoribosyltransferase homolog.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		ATTTGAAGGTCAGCCTGTGGA	0.348													68	61	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211502530	211502530	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211502530T>G	uc002vee.3	+	22	2924	c.2792T>G	c.(2791-2793)CTG>CGG	p.L931R	CPS1_uc010fur.2_Missense_Mutation_p.L937R|CPS1_uc010fus.2_Missense_Mutation_p.L480R	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	931					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		ACAAGGGAGCTGAGGTTAAAG	0.473													58	57	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211542717	211542717	+	3'UTR	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211542717G>A	uc002vee.3	+	38					CPS1_uc010fur.2_3'UTR|CPS1_uc010fus.2_3'UTR	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b						carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		TAGAGATGCAGACACCCCAGC	0.413													93	72	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215802227	215802227	+	Intron	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215802227C>G	uc002vew.2	-						ABCA12_uc002vev.2_Intron|ABCA12_uc010zjn.1_Intron	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		cagccATCATCACTTACTTTT	0.189													39	22	---	---	---	---	PASS
USP37	57695	broad.mit.edu	37	2	219350415	219350415	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219350415C>A	uc002vie.2	-	16	2095	c.1642G>T	c.(1642-1644)GTC>TTC	p.V548F	USP37_uc010fvs.1_Missense_Mutation_p.V548F|USP37_uc010zkf.1_Missense_Mutation_p.V548F|USP37_uc002vif.2_Missense_Mutation_p.V548F|USP37_uc002vig.2_Missense_Mutation_p.V476F	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	548					ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		TTGTGCCTGACAAGAGCACAC	0.338													68	46	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227915752	227915752	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227915752G>T	uc010zlt.1	-	33	3745	c.3091C>A	c.(3091-3093)CCT>ACT	p.P1031T		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	1031	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		GAGCCTGGAGGGCCTGGGGGT	0.567													114	89	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227973298	227973298	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227973298G>A	uc010zlt.1	-	12	1388	c.734C>T	c.(733-735)CCG>CTG	p.P245L		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	245	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		AATTCTTACCGGGTCTCCCAT	0.418													54	128	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228883190	228883190	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228883190T>C	uc002vpq.2	-	7	2427	c.2380A>G	c.(2380-2382)AAA>GAA	p.K794E	SPHKAP_uc002vpp.2_Missense_Mutation_p.K794E|SPHKAP_uc010zlx.1_Missense_Mutation_p.K794E	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	794						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTGTCTTGTTTTGAATACATG	0.483													355	269	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238249727	238249727	+	Missense_Mutation	SNP	G	T	T	rs114806654	by1000genomes	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238249727G>T	uc002vwl.2	-	38	8117	c.7832C>A	c.(7831-7833)GCG>GAG	p.A2611E	COL6A3_uc002vwo.2_Missense_Mutation_p.A2405E|COL6A3_uc010znj.1_Missense_Mutation_p.A2004E|COL6A3_uc002vwj.2_5'UTR	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2611	Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCTCCCTGCCGCTCTCCTGTC	0.512													106	63	---	---	---	---	PASS
ATP2B2	491	broad.mit.edu	37	3	10392220	10392220	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10392220C>A	uc003bvt.2	-	15	2617	c.2178G>T	c.(2176-2178)ACG>ACT	p.T726T	ATP2B2_uc003bvv.2_Silent_p.T681T|ATP2B2_uc003bvw.2_Silent_p.T681T|ATP2B2_uc010hdo.2_Silent_p.T431T	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	726	Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						CCATGCGGACCGTGATGCCTG	0.652													42	14	---	---	---	---	PASS
LRRC2	79442	broad.mit.edu	37	3	46569047	46569047	+	Silent	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46569047G>C	uc010hji.2	-	7	1162	c.798C>G	c.(796-798)CTC>CTG	p.L266L	LRRC2_uc003cpu.3_Silent_p.L266L	NM_024512	NP_078788	Q9BYS8	LRRC2_HUMAN	leucine rich repeat containing 2	266	LRR 7.									ovary(1)	1		Ovarian(412;0.0563)		OV - Ovarian serous cystadenocarcinoma(275;6.37e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00133)|KIRC - Kidney renal clear cell carcinoma(197;0.0214)|Kidney(197;0.0254)		TTTTATACAAGAGAAAGCTCT	0.418													37	13	---	---	---	---	PASS
BSN	8927	broad.mit.edu	37	3	49691379	49691379	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49691379C>T	uc003cxe.3	+	5	4504	c.4390C>T	c.(4390-4392)CCT>TCT	p.P1464S		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	1464					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GGGTGGCACTCCTCAGCCTTC	0.612													88	19	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74570264	74570264	+	5'UTR	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74570264C>T	uc003dpm.1	-	1						NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor						cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		GAAACATCATCTTTAATTGCC	0.333													21	6	---	---	---	---	PASS
C3orf30	152405	broad.mit.edu	37	3	118866052	118866052	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118866052A>T	uc003ecb.1	+	1	1056	c.1016A>T	c.(1015-1017)CAC>CTC	p.H339L	IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Missense_Mutation_p.H339L	NM_152539	NP_689752	Q96M34	CC030_HUMAN	hypothetical protein LOC152405	339										ovary(2)	2				GBM - Glioblastoma multiforme(114;0.222)		GACAATGCTCACTACACTGAA	0.468													29	55	---	---	---	---	PASS
POPDC2	64091	broad.mit.edu	37	3	119361403	119361403	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119361403T>C	uc003ecx.1	-	4	1149	c.1015A>G	c.(1015-1017)AGA>GGA	p.R339G	POPDC2_uc010hqw.1_3'UTR|POPDC2_uc003ecy.1_3'UTR	NM_022135	NP_071418	Q9HBU9	POPD2_HUMAN	popeye protein 2	339				R -> K (in Ref. 1; AAG23406).		integral to membrane				central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.242)		AGAGGAATTCTAGAAGCTGTG	0.428													49	65	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121417551	121417551	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121417551C>A	uc003eei.3	-	13	1930	c.1804G>T	c.(1804-1806)GAG>TAG	p.E602*	GOLGB1_uc010hrc.2_Nonsense_Mutation_p.E607*|GOLGB1_uc003eej.3_Nonsense_Mutation_p.E568*|GOLGB1_uc011bjm.1_Nonsense_Mutation_p.E488*|GOLGB1_uc010hrd.1_Nonsense_Mutation_p.E566*	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	602	Cytoplasmic (Potential).				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		CCCTCACCCTCCATCTGTTTC	0.413													90	172	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121417552	121417552	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121417552C>G	uc003eei.3	-	13	1929	c.1803G>C	c.(1801-1803)ATG>ATC	p.M601I	GOLGB1_uc010hrc.2_Missense_Mutation_p.M606I|GOLGB1_uc003eej.3_Missense_Mutation_p.M567I|GOLGB1_uc011bjm.1_Missense_Mutation_p.M487I|GOLGB1_uc010hrd.1_Missense_Mutation_p.M565I	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	601	Cytoplasmic (Potential).				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		CCTCACCCTCCATCTGTTTCA	0.413													92	172	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124397156	124397156	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124397156T>C	uc003ehg.2	+	50	7440	c.7313T>C	c.(7312-7314)GTT>GCT	p.V2438A	KALRN_uc003ehk.2_Missense_Mutation_p.V741A	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	2437					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						AAAGTCTCTGTTAAAGTGAGT	0.498													53	64	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130311403	130311403	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130311403G>A	uc010htl.2	+	13	4322	c.4291G>A	c.(4291-4293)GGA>AGA	p.G1431R	COL6A6_uc003eni.3_5'UTR	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	1431	Triple-helical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						AGGAGCCCCTGGACCAGTGGG	0.408													16	24	---	---	---	---	PASS
PLSCR5	389158	broad.mit.edu	37	3	146307484	146307484	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146307484C>T	uc003ewb.2	-	6	1737	c.733G>A	c.(733-735)GAT>AAT	p.D245N	PLSCR5_uc010hvb.2_Missense_Mutation_p.D233N|PLSCR5_uc010hvc.2_Missense_Mutation_p.D245N	NM_001085420	NP_001078889	A0PG75	PLS5_HUMAN	phospholipid scramblase family, member 5	245											0						ACTGTTACATCTAGATCTGCA	0.383													137	237	---	---	---	---	PASS
HPS3	84343	broad.mit.edu	37	3	148885004	148885004	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148885004C>G	uc003ewu.1	+	15	2913	c.2773C>G	c.(2773-2775)CAT>GAT	p.H925D	CP_uc011bnr.1_Intron|HPS3_uc011bnq.1_Missense_Mutation_p.H760D|HPS3_uc003ewv.1_RNA	NM_032383	NP_115759	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3 protein	925						cytoplasm				ovary(5)|large_intestine(1)	6			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			ATATGCTAATCATGAACTGAA	0.353									Hermansky-Pudlak_syndrome				34	174	---	---	---	---	PASS
PTX3	5806	broad.mit.edu	37	3	157160481	157160481	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157160481G>C	uc003fbl.3	+	3	1002	c.859G>C	c.(859-861)GGT>CGT	p.G287R	VEPH1_uc003fbj.1_Intron|VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	NM_002852	NP_002843	P26022	PTX3_HUMAN	pentraxin 3 precursor	287	Pentaxin.				inflammatory response	extracellular region				central_nervous_system(1)	1			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			GTGGGTAAATGGTGAACTGGC	0.542													47	179	---	---	---	---	PASS
IFT80	57560	broad.mit.edu	37	3	160037573	160037573	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160037573G>C	uc011boy.1	-	9	1365	c.932C>G	c.(931-933)ACA>AGA	p.T311R	IFT80_uc003fda.2_RNA|IFT80_uc003fdb.1_Missense_Mutation_p.T174R|IFT80_uc003fdd.1_5'UTR|IFT80_uc003fde.1_Missense_Mutation_p.T174R	NM_020800	NP_065851	Q9P2H3	IFT80_HUMAN	WD repeat domain 56	311						cilium axoneme|microtubule basal body				ovary(1)	1			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TTTCGTTAATGTTACTTGAAA	0.373													59	325	---	---	---	---	PASS
KPNA4	3840	broad.mit.edu	37	3	160253340	160253340	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160253340T>C	uc003fdn.2	-	5	554	c.248A>G	c.(247-249)GAT>GGT	p.D83G		NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4	83	ARM 1; truncated.				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			TCCTTGGTTATCACTTGAAGC	0.308													89	27	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164735787	164735787	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164735787C>A	uc003fei.2	-	29	3553	c.3491G>T	c.(3490-3492)GGT>GTT	p.G1164V		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1164	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TAAGAAAACACCATGAGCATT	0.318										HNSCC(35;0.089)			55	239	---	---	---	---	PASS
EIF5A2	56648	broad.mit.edu	37	3	170624845	170624845	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170624845T>G	uc003fhd.2	-	3	333	c.203A>C	c.(202-204)AAA>ACA	p.K68T		NM_020390	NP_065123	Q9GZV4	IF5A2_HUMAN	eIF-5A2 protein	68					mRNA transport|peptidyl-lysine modification to hypusine|polyamine homeostasis|positive regulation of cell proliferation|positive regulation of translational elongation|positive regulation of translational termination|post-translational protein modification|protein transport|spermatogenesis|translational frameshifting|transmembrane transport	cytosol|endoplasmic reticulum membrane|nuclear pore	protein binding|ribosome binding|translation elongation factor activity				0	all_cancers(22;1.61e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;9.8e-16)|Lung(28;4.28e-15)			ATCTTCATATTTTTTGCCCGT	0.343													54	255	---	---	---	---	PASS
TNIK	23043	broad.mit.edu	37	3	170843853	170843853	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170843853C>T	uc003fhh.2	-	17	2206	c.1861G>A	c.(1861-1863)GGG>AGG	p.G621R	TNIK_uc003fhi.2_Missense_Mutation_p.G566R|TNIK_uc003fhj.2_Missense_Mutation_p.G592R|TNIK_uc003fhk.2_Missense_Mutation_p.G621R|TNIK_uc003fhl.2_Missense_Mutation_p.G537R|TNIK_uc003fhm.2_Missense_Mutation_p.G566R|TNIK_uc003fhn.2_Missense_Mutation_p.G592R|TNIK_uc003fho.2_Missense_Mutation_p.G537R	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	621	Mediates interaction with NEDD4.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			TCCTGAAACCCAGAGAGGCCC	0.572													52	363	---	---	---	---	PASS
CHRD	8646	broad.mit.edu	37	3	184105818	184105818	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184105818C>T	uc003fov.2	+	20	2797	c.2551C>T	c.(2551-2553)CCA>TCA	p.P851S	CHRD_uc003fow.2_Missense_Mutation_p.P481S|CHRD_uc003fox.2_Missense_Mutation_p.P851S|CHRD_uc003foy.2_Missense_Mutation_p.P481S|CHRD_uc010hyc.2_Missense_Mutation_p.P441S|CHRD_uc011brr.1_Missense_Mutation_p.P393S	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor	851					BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAAACAGTGTCCAGGTGAGAG	0.602													14	75	---	---	---	---	PASS
KNG1	3827	broad.mit.edu	37	3	186450437	186450437	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186450437G>T	uc011bsa.1	+	7	1116	c.904G>T	c.(904-906)GAC>TAC	p.D302Y	KNG1_uc003fqr.2_Missense_Mutation_p.D302Y	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1	302	Cystatin 3.				blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	TTTCAAGATTGACAATGTGAA	0.398													108	597	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186937970	186937970	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186937970C>T	uc003frh.1	-	16	2321	c.1989G>A	c.(1987-1989)GTG>GTA	p.V663V		NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	663	Peptidase S1.				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		ACACAGTGCCCACCAGGTACC	0.562											OREG0015972	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	58	169	---	---	---	---	PASS
COX7B2	170712	broad.mit.edu	37	4	46736955	46736955	+	3'UTR	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46736955C>A	uc003gxf.2	-	3					COX7B2_uc010ige.2_RNA	NM_130902	NP_570972	Q8TF08	CX7B2_HUMAN	cytochrome c oxidase subunit VIIb2 precursor							integral to membrane|mitochondrial respiratory chain	cytochrome-c oxidase activity				0						ATTACAGCAACTGTGATGGTT	0.358													49	61	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47667114	47667114	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47667114G>A	uc003gxm.2	-	11	1617	c.1524C>T	c.(1522-1524)TTC>TTT	p.F508F	CORIN_uc011bzf.1_Silent_p.F369F|CORIN_uc011bzg.1_Silent_p.F441F|CORIN_uc011bzh.1_Silent_p.F471F|CORIN_uc011bzi.1_Silent_p.F471F	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin	508	Extracellular (Potential).|FZ 2.				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						TGCAAGAAAAGAACATGAGGT	0.418													53	87	---	---	---	---	PASS
AASDH	132949	broad.mit.edu	37	4	57248730	57248730	+	Silent	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57248730G>T	uc003hbn.2	-	3	417	c.264C>A	c.(262-264)ATC>ATA	p.I88I	AASDH_uc010ihb.2_5'UTR|AASDH_uc011caa.1_Intron|AASDH_uc003hbo.2_5'UTR|AASDH_uc011cab.1_5'UTR|AASDH_uc010ihc.2_Silent_p.I88I|AASDH_uc003hbp.2_Silent_p.I88I|AASDH_uc003hbq.1_Silent_p.I88I	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	88					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				AATCTGGCTCGATAGGTACAT	0.323													3	48	---	---	---	---	PASS
UGT2B10	7365	broad.mit.edu	37	4	69696583	69696583	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69696583G>T	uc003hee.2	+	6	1598	c.1573G>T	c.(1573-1575)GGA>TGA	p.G525*	UGT2B10_uc011cam.1_Nonsense_Mutation_p.G441*	NM_001075	NP_001066	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2B10 isoform 1	525					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						AGGAAAGAAGGGAAAAAGGGA	0.378													35	295	---	---	---	---	PASS
UGT2B10	7365	broad.mit.edu	37	4	69696584	69696584	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69696584G>T	uc003hee.2	+	6	1599	c.1574G>T	c.(1573-1575)GGA>GTA	p.G525V	UGT2B10_uc011cam.1_Missense_Mutation_p.G441V	NM_001075	NP_001066	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2B10 isoform 1	525					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						GGAAAGAAGGGAAAAAGGGAT	0.378													38	290	---	---	---	---	PASS
RUFY3	22902	broad.mit.edu	37	4	71628293	71628293	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71628293G>T	uc003hfq.2	+	2	831	c.236G>T	c.(235-237)AGT>ATT	p.S79I	RUFY3_uc003hfp.3_Missense_Mutation_p.S139I|RUFY3_uc011cax.1_Missense_Mutation_p.S97I|RUFY3_uc003hfr.2_Missense_Mutation_p.S79I|RUFY3_uc011cay.1_Missense_Mutation_p.S15I	NM_014961	NP_055776	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3 isoform 2	79					negative regulation of axonogenesis	filopodium|growth cone					0		all_hematologic(202;0.248)	Lung(101;0.235)			GCCAAGCTGAGTATCAAGGGC	0.468													170	793	---	---	---	---	PASS
ADAMTS3	9508	broad.mit.edu	37	4	73280574	73280574	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73280574C>G	uc003hgk.1	-	4	656	c.619G>C	c.(619-621)GAA>CAA	p.E207Q		NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	207					collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GGAGCCTGTTCTACAGCTGAT	0.363													70	349	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79301038	79301038	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79301038C>A	uc003hlb.2	+	27	3891	c.3451C>A	c.(3451-3453)CTA>ATA	p.L1151I	FRAS1_uc003hkw.2_Missense_Mutation_p.L1151I	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1150	CSPG 1.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CAATGGTCAGCTAGTGCTCTC	0.473													35	183	---	---	---	---	PASS
DMP1	1758	broad.mit.edu	37	4	88578181	88578181	+	Intron	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88578181T>C	uc003hqv.2	+						DMP1_uc003hqw.2_Intron	NM_004407	NP_004398	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1 isoform 1						biomineral tissue development|ossification	cytoplasm|nucleus|proteinaceous extracellular matrix	calcium ion binding|integrin binding			pancreas(1)|skin(1)	2		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		CTAAATTTTCTAGGTAACCAG	0.254													56	141	---	---	---	---	PASS
FAM190A	401145	broad.mit.edu	37	4	91230018	91230018	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91230018G>T	uc003hsv.3	+	2	923	c.583G>T	c.(583-585)GTT>TTT	p.V195F	FAM190A_uc003hsu.3_Missense_Mutation_p.V195F|FAM190A_uc010ikv.2_RNA|FAM190A_uc003hsw.2_Missense_Mutation_p.V195F	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1	195										large_intestine(1)|ovary(1)	2						TTCTAAGCCAGTTCTACAGAG	0.398													74	61	---	---	---	---	PASS
DDIT4L	115265	broad.mit.edu	37	4	101109190	101109190	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101109190A>G	uc003hvq.2	-	3	429	c.226T>C	c.(226-228)TCA>CCA	p.S76P		NM_145244	NP_660287	Q96D03	DDT4L_HUMAN	DNA-damage-inducible transcript 4-like	76					negative regulation of signal transduction	cytoplasm				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;5.75e-09)		AGGACCTTTGAGCAACCAAGT	0.463													5	203	---	---	---	---	PASS
QRFPR	84109	broad.mit.edu	37	4	122250738	122250738	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122250738C>T	uc010inj.1	-	6	1406	c.1027G>A	c.(1027-1029)GTT>ATT	p.V343I	QRFPR_uc010ink.1_RNA|QRFPR_uc003ids.2_3'UTR	NM_198179	NP_937822	Q96P65	QRFPR_HUMAN	G protein-coupled receptor 103	343	Cytoplasmic (Potential).					plasma membrane	neuropeptide Y receptor activity				0						GCAGACAAAACATTTTTTTTG	0.328													67	22	---	---	---	---	PASS
ANKRD50	57182	broad.mit.edu	37	4	125593263	125593263	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125593263T>C	uc003ifg.3	-	3	1435	c.1169A>G	c.(1168-1170)GAT>GGT	p.D390G	ANKRD50_uc011cgo.1_Missense_Mutation_p.D211G|ANKRD50_uc010inw.2_Missense_Mutation_p.D390G	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	390										central_nervous_system(1)	1						GGAGAGGATATCTAACTTGCG	0.393													6	183	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126237699	126237699	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126237699C>T	uc003ifj.3	+	1	133	c.133C>T	c.(133-135)CCG>TCG	p.P45S		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	45	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						CGGGGCCGAGCCGCGCCAGGT	0.622											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	37	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153247289	153247289	+	Missense_Mutation	SNP	G	C	C	rs149680468		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153247289G>C	uc003ims.2	-	10	1662	c.1513C>G	c.(1513-1515)CGC>GGC	p.R505G	FBXW7_uc011cii.1_Missense_Mutation_p.R505G|FBXW7_uc003imt.2_Missense_Mutation_p.R505G|FBXW7_uc011cih.1_Missense_Mutation_p.R329G|FBXW7_uc003imq.2_Missense_Mutation_p.R425G|FBXW7_uc003imr.2_Missense_Mutation_p.R387G	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	505	WD 4.		R -> L (in an ovarian cancer cell line).		interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	p.R505C(36)|p.R505L(6)|p.R505G(4)|p.R425C(2)|p.R425G(2)|p.R266G(2)|p.R505H(2)|p.R505S(1)|p.R505P(1)|p.R266C(1)		haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGAACACAGCGGACTGCTGCA	0.468			Mis|N|D|F		colorectal|endometrial|T-ALL								78	21	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155278359	155278359	+	Intron	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155278359G>T	uc003inw.2	-						DCHS2_uc003inx.2_Intron	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		tttggagaaggctaacctcta	0.000													136	40	---	---	---	---	PASS
NPY1R	4886	broad.mit.edu	37	4	164246622	164246622	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164246622C>G	uc003iqm.1	-	3	1254	c.988G>C	c.(988-990)GAC>CAC	p.D330H	NPY1R_uc011cjj.1_Missense_Mutation_p.D87H	NM_000909	NP_000900	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	330	Cytoplasmic (Potential).				inhibition of adenylate cyclase activity by G-protein signaling pathway|outflow tract morphogenesis	integral to plasma membrane	protein binding			lung(1)|pancreas(1)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				AACTGCAAGTCTCTCTGGAAG	0.423													79	27	---	---	---	---	PASS
GPM6A	2823	broad.mit.edu	37	4	176556084	176556084	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176556084G>T	uc003iuf.2	-	7	1613	c.809C>A	c.(808-810)TCC>TAC	p.S270Y	GPM6A_uc011ckj.1_Missense_Mutation_p.S263Y|GPM6A_uc003iug.2_Missense_Mutation_p.S270Y|GPM6A_uc003iuh.2_Missense_Mutation_p.S259Y	NM_201591	NP_963885	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 2	270	Cytoplasmic (Potential).					cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		CCGCTCTTTGGAGCGAGTAGA	0.468													62	24	---	---	---	---	PASS
HELT	391723	broad.mit.edu	37	4	185940564	185940564	+	Silent	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185940564G>C	uc011ckq.1	+	2	183	c.183G>C	c.(181-183)GTG>GTC	p.V61V	HELT_uc011cko.1_Silent_p.V17V|HELT_uc003ixa.3_Silent_p.V17V|HELT_uc011ckp.1_5'UTR	NM_001029887	NP_001025058	A6NFD8	HELT_HUMAN	HES/HEY-like transcription factor	61	Basic motif.						DNA binding				0		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		CTCATAAAGTGATAGAAAAGC	0.572													12	2	---	---	---	---	PASS
SRD5A1	6715	broad.mit.edu	37	5	6652021	6652021	+	Silent	SNP	G	A	A	rs142854865	byFrequency	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6652021G>A	uc003jdw.2	+	2	550	c.360G>A	c.(358-360)GCG>GCA	p.A120A	SRD5A1_uc011cml.1_RNA|SRD5A1_uc011cmm.1_Intron	NM_001047	NP_001038	P18405	S5A1_HUMAN	steroid-5-alpha-reductase 1	120	Helical; (Potential).				androgen biosynthetic process|cell differentiation|sex determination|sex differentiation	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|electron carrier activity				0					Dutasteride(DB01126)|Finasteride(DB01216)	GTACAATGGCGATTATGTTCT	0.423													87	67	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11199612	11199612	+	Silent	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11199612C>G	uc003jfa.1	-	11	2068	c.1923G>C	c.(1921-1923)CTG>CTC	p.L641L	CTNND2_uc010itt.2_Silent_p.L550L|CTNND2_uc011cmy.1_Silent_p.L304L|CTNND2_uc011cmz.1_Silent_p.L208L|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Silent_p.L208L	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	641	ARM 4.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						GTAACCTCACCAGTGCTGGGA	0.453													92	86	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24535284	24535284	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24535284C>G	uc003jgr.1	-	5	1083	c.751G>C	c.(751-753)GGG>CGG	p.G251R	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	251	Cadherin 2.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		GTGGTTGTCCCCGATAAGCCT	0.512										HNSCC(23;0.051)			40	78	---	---	---	---	PASS
AMACR	23600	broad.mit.edu	37	5	34004781	34004781	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34004781C>A	uc003jig.2	-	3	532	c.450G>T	c.(448-450)CTG>CTT	p.L150L	AMACR_uc003jih.2_Intron|AMACR_uc003jii.2_Silent_p.L150L|AMACR_uc003jij.2_Silent_p.L150L|AMACR_uc003jil.1_Silent_p.L150L|AMACR_uc003jik.1_Intron	NM_014324	NP_055139	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase isoform 1	150				L -> V (in Ref. 1; CAB44062).	bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	mitochondrion|peroxisomal matrix	alpha-methylacyl-CoA racemase activity				0						CAAAGTCAGCCAGGAGATTCA	0.428													31	86	---	---	---	---	PASS
LMBRD2	92255	broad.mit.edu	37	5	36122994	36122994	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36122994T>C	uc003jkb.1	-	8	1307	c.892A>G	c.(892-894)AGT>GGT	p.S298G		NM_001007527	NP_001007528	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	298	Cytoplasmic (Potential).					integral to membrane					0	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGATAGATACTATGCTTTTCA	0.254													28	43	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41143068	41143068	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41143068G>T	uc003jmk.2	-	18	2874	c.2664C>A	c.(2662-2664)TGC>TGA	p.C888*	C6_uc003jml.1_Nonsense_Mutation_p.C888*	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	888	Complement control factor I module 2.|C5b-binding domain.|Kazal-like 2.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CACCCTTGAAGCACTGTGGGG	0.433													34	67	---	---	---	---	PASS
ATG10	83734	broad.mit.edu	37	5	81549141	81549141	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81549141A>G	uc003khs.2	+	8	989	c.560A>G	c.(559-561)AAC>AGC	p.N187S	ATG10_uc003khr.2_Missense_Mutation_p.N187S|ATG10_uc010jas.2_Missense_Mutation_p.N151S	NM_001131028	NP_001124500	Q9H0Y0	ATG10_HUMAN	APG10 autophagy 10-like	187					autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		AGGAATGTCAACTATATCACA	0.423													52	62	---	---	---	---	PASS
HAPLN1	1404	broad.mit.edu	37	5	82937507	82937507	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82937507C>A	uc003kim.2	-	4	944	c.873G>T	c.(871-873)CAG>CAT	p.Q291H	HAPLN1_uc003kin.2_Missense_Mutation_p.Q291H	NM_001884	NP_001875	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	291	Link 2.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			large_intestine(3)|ovary(1)|skin(1)	5		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)		CAGCAAATATCTGGCCCACTT	0.532													89	236	---	---	---	---	PASS
MCTP1	79772	broad.mit.edu	37	5	94224657	94224657	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94224657G>T	uc003kkx.2	-	12	1860	c.1860C>A	c.(1858-1860)CAC>CAA	p.H620Q	MCTP1_uc003kkv.2_Missense_Mutation_p.H399Q|MCTP1_uc003kkw.2_Missense_Mutation_p.H353Q|MCTP1_uc003kkz.2_Missense_Mutation_p.H281Q|MCTP1_uc003kku.2_Missense_Mutation_p.H136Q	NM_024717	NP_078993	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1 isoform L	620	C2 3.				calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		CTTTCAGGTTGTGAAATATCC	0.438													66	53	---	---	---	---	PASS
SLCO4C1	353189	broad.mit.edu	37	5	101599460	101599460	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101599460A>G	uc003knm.2	-	4	1114	c.827T>C	c.(826-828)TTA>TCA	p.L276S		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	276	Helical; Name=5; (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		AGCAGGGCCTAAGATTGACAT	0.368													77	61	---	---	---	---	PASS
GIN1	54826	broad.mit.edu	37	5	102440247	102440247	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102440247G>A	uc003koa.1	-	4	719	c.637C>T	c.(637-639)CAG>TAG	p.Q213*	GIN1_uc003kob.1_Nonsense_Mutation_p.Q66*|GIN1_uc003koc.1_Nonsense_Mutation_p.Q213*	NM_017676	NP_060146	Q9NXP7	GIN1_HUMAN	zinc finger, H2C2 domain containing	213	Integrase catalytic.				DNA integration		DNA binding			ovary(1)|skin(1)	2		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		TGTCTTACCTGTTGAATGAAT	0.338													8	28	---	---	---	---	PASS
TSLP	85480	broad.mit.edu	37	5	110407609	110407609	+	Silent	SNP	A	G	G	rs149732987	byFrequency	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110407609A>G	uc003kpb.2	+	1	220	c.21A>G	c.(19-21)CTA>CTG	p.L7L	TSLP_uc003kpa.2_Intron|TSLP_uc010jbt.1_5'Flank	NM_033035	NP_149024	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin isoform 1	7				MFPFALLYVLS -> MKCLGQSKKEE (in Ref. 3; AAH40592).		extracellular space	cytokine activity				0		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)		TTGCCTTACTATATGTTCTGT	0.418													119	77	---	---	---	---	PASS
WDR36	134430	broad.mit.edu	37	5	110443093	110443093	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110443093C>G	uc003kpd.2	+	12	1566	c.1449C>G	c.(1447-1449)TAC>TAG	p.Y483*	WDR36_uc010jbu.2_RNA	NM_139281	NP_644810	Q8NI36	WDR36_HUMAN	WD repeat domain 36	483					response to stimulus|rRNA processing|visual perception	small-subunit processome				ovary(1)|skin(1)	2		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TAGGCGCTTACTTTCTCAAGC	0.383													48	33	---	---	---	---	PASS
IL3	3562	broad.mit.edu	37	5	131396427	131396427	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131396427C>T	uc003kwe.1	+	1	81	c.28C>T	c.(28-30)CTC>TTC	p.L10F		NM_000588	NP_000579	P08700	IL3_HUMAN	interleukin 3 precursor	10					cell-cell signaling|immune response|nervous system development|positive regulation of cell proliferation|positive regulation of DNA replication|positive regulation of survival gene product expression|positive regulation of tyrosine phosphorylation of Stat5 protein	extracellular space	cytokine activity|growth factor activity|interleukin-3 receptor binding			ovary(2)|central_nervous_system(1)	3		all_cancers(142;7.42e-12)|Lung NSC(810;4.25e-07)|all_lung(232;1.93e-06)|Prostate(281;0.00741)|Breast(839;0.0544)|Lung SC(612;0.122)|Ovarian(839;0.223)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.0161)|Lung(113;0.105)	Amlexanox(DB01025)	CCTGCTCCTGCTCCAACTCCT	0.567													46	12	---	---	---	---	PASS
GABRA1	2554	broad.mit.edu	37	5	161318025	161318025	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161318025C>A	uc010jiw.2	+	9	1293	c.825C>A	c.(823-825)AAC>AAA	p.N275K	GABRA1_uc010jix.2_Missense_Mutation_p.N275K|GABRA1_uc010jiy.2_Missense_Mutation_p.N275K|GABRA1_uc003lyx.3_Missense_Mutation_p.N275K|GABRA1_uc010jiz.2_Missense_Mutation_p.N275K|GABRA1_uc010jja.2_Missense_Mutation_p.N275K|GABRA1_uc010jjb.2_Missense_Mutation_p.N275K	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	275					gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	TCTGGCTCAACAGAGAGTCTG	0.413													55	24	---	---	---	---	PASS
BNIP1	662	broad.mit.edu	37	5	172585748	172585748	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172585748A>C	uc003mcj.3	+	4	375	c.271A>C	c.(271-273)AAT>CAT	p.N91H	BNIP1_uc003mci.3_Missense_Mutation_p.N134H|BNIP1_uc003mck.3_Intron|BNIP1_uc003mcl.3_Intron	NM_001205	NP_001196	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 1	91	Cytoplasmic (Potential).				anti-apoptosis|apoptosis|endoplasmic reticulum membrane fusion|endoplasmic reticulum organization|induction of apoptosis|vesicle-mediated transport	integral to endoplasmic reticulum membrane|nuclear envelope|SNARE complex	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CAATTCCAGCAATCAGGCCTC	0.478													33	11	---	---	---	---	PASS
FAM8A1	51439	broad.mit.edu	37	6	17600920	17600920	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17600920G>C	uc003ncc.2	+	1	403	c.280G>C	c.(280-282)GAG>CAG	p.E94Q		NM_016255	NP_057339	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	94						integral to membrane					0	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			GGCGGGCTGCGAGGCGCCCGA	0.731													10	1	---	---	---	---	PASS
LRRC16A	55604	broad.mit.edu	37	6	25471400	25471400	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25471400A>G	uc011djw.1	+	10	1070	c.694A>G	c.(694-696)ACT>GCT	p.T232A	LRRC16A_uc010jpx.2_Missense_Mutation_p.T232A|LRRC16A_uc010jpy.2_Missense_Mutation_p.T232A|LRRC16A_uc003nez.1_Missense_Mutation_p.T71A	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	232					actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						GTTACAGTCCACTGATGTCTG	0.348													106	14	---	---	---	---	PASS
MAS1L	116511	broad.mit.edu	37	6	29455059	29455059	+	Silent	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29455059T>C	uc011dlq.1	-	1	621	c.621A>G	c.(619-621)GTA>GTG	p.V207V		NM_052967	NP_443199	P35410	MAS1L_HUMAN	MAS1 oncogene-like	207	Helical; Name=4; (Potential).					cytoplasm|integral to membrane|nucleus|plasma membrane	G-protein coupled receptor activity			ovary(7)|lung(2)	9						AAAGTGATTTTACTATGTTGA	0.438													98	11	---	---	---	---	PASS
TNF	7124	broad.mit.edu	37	6	31544973	31544973	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31544973G>A	uc003nui.2	+	4	530	c.361G>A	c.(361-363)GAT>AAT	p.D121N	TNF_uc003nuj.2_5'UTR	NM_000594	NP_000585	P01375	TNFA_HUMAN	tumor necrosis factor alpha	121	Extracellular (Potential).				activation of caspase activity|activation of MAPK activity|activation of MAPKKK activity|anti-apoptosis|cellular response to nicotine|chronic inflammatory response to antigenic stimulus|embryonic digestive tract development|induction of apoptosis via death domain receptors|induction of necroptosis by extracellular signals|leukocyte tethering or rolling|necrotic cell death|negative regulation of branching involved in lung morphogenesis|negative regulation of cytokine secretion involved in immune response|negative regulation of fat cell differentiation|negative regulation of interleukin-6 production|negative regulation of lipid catabolic process|negative regulation of lipid storage|negative regulation of viral genome replication|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of chemokine biosynthetic process|positive regulation of chemokine production|positive regulation of cytokine secretion|positive regulation of ERK1 and ERK2 cascade|positive regulation of fever generation|positive regulation of heterotypic cell-cell adhesion|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of membrane protein ectodomain proteolysis|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of NFAT protein import into nucleus|positive regulation of nitric oxide biosynthetic process|positive regulation of osteoclast differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of podosome assembly|positive regulation of protein complex disassembly|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D biosynthetic process|protein import into nucleus, translocation|receptor biosynthetic process|regulation of insulin secretion|response to glucocorticoid stimulus|response to salt stress|response to virus|sequestering of triglyceride|transformed cell apoptosis|tumor necrosis factor-mediated signaling pathway	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane raft|phagocytic cup|recycling endosome	cytokine activity|identical protein binding|protease binding|transcription regulatory region DNA binding|tumor necrosis factor receptor binding			ovary(1)|pancreas(1)|skin(1)	3		Ovarian(999;0.00556)			Adalimumab(DB00051)|Adenosine(DB00640)|Amrinone(DB01427)|Atorvastatin(DB01076)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Etanercept(DB00005)|Glucosamine(DB01296)|Infliximab(DB00065)|Naltrexone(DB00704)|Pranlukast(DB01411)|Procaterol(DB01366)|Saquinavir(DB01232)|Simvastatin(DB00641)|Thalidomide(DB01041)	GGAGCTGAGAGATAACCAGCT	0.632									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				19	220	---	---	---	---	PASS
OPN5	221391	broad.mit.edu	37	6	47775994	47775994	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47775994C>A	uc003ozc.2	+	5	866	c.861C>A	c.(859-861)CTC>CTA	p.L287L	OPN5_uc003ozd.2_Silent_p.L122L	NM_181744	NP_859528	Q6U736	OPN5_HUMAN	opsin 5 isoform 1	287	Extracellular (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to membrane	G-protein coupled receptor activity|photoreceptor activity			ovary(1)	1						CCATACAGCTCTCTGTGGTGC	0.458													314	47	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	70972972	70972972	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70972972C>G	uc003pfg.3	-	19	1529	c.1370G>C	c.(1369-1371)GGA>GCA	p.G457A	COL9A1_uc003pfe.3_Missense_Mutation_p.G30A|COL9A1_uc003pff.3_Missense_Mutation_p.G214A	NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor	457	Triple-helical region (COL2).				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						TCCAACTTCTCCGAGTTCTCC	0.328													30	7	---	---	---	---	PASS
IBTK	25998	broad.mit.edu	37	6	82909857	82909857	+	Splice_Site	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82909857C>A	uc003pjl.1	-	21	3552	c.3025_splice	c.e21+1	p.G1009_splice	IBTK_uc011dyu.1_Splice_Site|IBTK_uc011dyv.1_Splice_Site_p.E1009_splice|IBTK_uc011dyw.1_Splice_Site_p.G808_splice|IBTK_uc010kbi.1_Splice_Site_p.G703_splice|IBTK_uc003pjm.2_Splice_Site_p.G1009_splice	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase						negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		TTTCCACGAACCTGTAGATGA	0.378													114	67	---	---	---	---	PASS
CGA	1081	broad.mit.edu	37	6	87797827	87797827	+	Intron	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87797827G>T	uc003plj.1	-							NM_000735	NP_000726	P01215	GLHA_HUMAN	glycoprotein hormones, alpha polypeptide						hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity			ovary(1)	1		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)		BRCA - Breast invasive adenocarcinoma(108;0.0484)		ATTTGGTCACGCACCCTGCAC	0.398													19	5	---	---	---	---	PASS
LTV1	84946	broad.mit.edu	37	6	144181587	144181587	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144181587G>A	uc003qjs.2	+	7	927	c.820G>A	c.(820-822)GAA>AAA	p.E274K	LTV1_uc003qju.1_Missense_Mutation_p.E59K|C6orf94_uc010khj.2_5'UTR	NM_032860	NP_116249	Q96GA3	LTV1_HUMAN	LTV1 homolog	274										ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		TGATGATGATGAAATTGGAGC	0.328													109	41	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144843319	144843319	+	Intron	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144843319G>T	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TAGACCTCTGGGCACTGTGTT	0.408													80	26	---	---	---	---	PASS
FBXO30	84085	broad.mit.edu	37	6	146127417	146127417	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146127417T>A	uc003qla.2	-	2	324	c.125A>T	c.(124-126)CAT>CTT	p.H42L	uc003qky.1_Intron	NM_032145	NP_115521	Q8TB52	FBX30_HUMAN	F-box only protein 30	42							ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|large_intestine(1)	3		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		TTTACAAGAATGGAAAACTGC	0.433													111	31	---	---	---	---	PASS
PDE10A	10846	broad.mit.edu	37	6	165832185	165832185	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165832185G>T	uc003qun.2	-	12	1147	c.906C>A	c.(904-906)GAC>GAA	p.D302E	PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.D232E|PDE10A_uc003quo.2_Missense_Mutation_p.D312E	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2	302	GAF 2.				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	TATCAAAAAGGTCTGAATATA	0.388													56	22	---	---	---	---	PASS
DAGLB	221955	broad.mit.edu	37	7	6487437	6487437	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6487437T>C	uc003sqa.2	-	1	207	c.37A>G	c.(37-39)ATC>GTC	p.I13V	DAGLB_uc011jwu.1_Missense_Mutation_p.I13V|DAGLB_uc003sqb.2_5'UTR|DAGLB_uc003sqc.2_5'UTR|DAGLB_uc011jwv.1_RNA|DAGLB_uc003sqd.3_Intron|DAGLB_uc011jww.1_RNA	NM_139179	NP_631918	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta isoform 1	13	Cytoplasmic (Potential).				lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		TCGCTGGCGATGGCCCAGCGC	0.672													14	11	---	---	---	---	PASS
TMEM106B	54664	broad.mit.edu	37	7	12258089	12258089	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12258089G>A	uc011jxk.1	+	4	623	c.223G>A	c.(223-225)GAA>AAA	p.E75K	TMEM106B_uc003ssh.2_Missense_Mutation_p.E75K	NM_018374	NP_060844	Q9NUM4	T106B_HUMAN	transmembrane protein 106B	75						integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (126;0.185)		TTTAGGGCAAGAAAACCAACT	0.338													35	62	---	---	---	---	PASS
MEOX2	4223	broad.mit.edu	37	7	15666546	15666546	+	Intron	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15666546G>C	uc003stc.2	-						MEOX2_uc011jxw.1_Intron	NM_005924	NP_005915	P50222	MEOX2_HUMAN	mesenchyme homeobox 2						blood circulation|multicellular organismal development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		CTGGGAGTCTGAAAAAAAAGG	0.368													64	82	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21737761	21737761	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21737761T>A	uc003svc.2	+	37	6162	c.6131T>A	c.(6130-6132)GTG>GAG	p.V2044E		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2044	AAA 1 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GAAGGTTTTGTGGATGCGCGT	0.413									Kartagener_syndrome				39	45	---	---	---	---	PASS
BBS9	27241	broad.mit.edu	37	7	33192390	33192390	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33192390C>G	uc003tdn.1	+	3	703	c.190C>G	c.(190-192)CAA>GAA	p.Q64E	BBS9_uc003tdo.1_Missense_Mutation_p.Q64E|BBS9_uc003tdp.1_Missense_Mutation_p.Q64E|BBS9_uc003tdq.1_Missense_Mutation_p.Q64E|BBS9_uc010kwn.1_RNA|BBS9_uc011kan.1_Missense_Mutation_p.Q64E	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2	64					fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			AGATGGAGCTCAAGCCGAAGA	0.383									Bardet-Biedl_syndrome				64	96	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43519310	43519310	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43519310C>G	uc003tid.1	+	17	3806	c.3201C>G	c.(3199-3201)CAC>CAG	p.H1067Q	HECW1_uc011kbi.1_Missense_Mutation_p.H1033Q	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	1067					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						ACCGACAGCACCTCCAGAGGC	0.552													126	180	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82579563	82579563	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82579563C>A	uc003uhx.2	-	6	10630	c.10341G>T	c.(10339-10341)ACG>ACT	p.T3447T	PCLO_uc003uhv.2_Silent_p.T3447T|PCLO_uc010lec.2_Silent_p.T412T	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	3378					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CTTCGTCATCCGTTTGTACAC	0.438													53	86	---	---	---	---	PASS
TECPR1	25851	broad.mit.edu	37	7	97860615	97860615	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97860615G>T	uc003upg.2	-	14	2250	c.2045C>A	c.(2044-2046)GCC>GAC	p.A682D	TECPR1_uc003uph.1_Missense_Mutation_p.A612D	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	682	PH.					integral to membrane	protein binding			pancreas(1)	1						GGTGTACAGGGCAAAGGAGTG	0.617													11	21	---	---	---	---	PASS
C7orf52	375607	broad.mit.edu	37	7	100815720	100815720	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100815720C>A	uc003uxy.1	-	4	989	c.750G>T	c.(748-750)CGG>CGT	p.R250R	C7orf52_uc003uxz.1_Silent_p.R250R	NM_198571	NP_940973	Q8N8M0	CG052_HUMAN	hypothetical protein LOC375607	250							N-acetyltransferase activity			ovary(1)	1	Lung NSC(181;0.168)|all_lung(186;0.215)					TTTCGCTAGGCCGGTAGGGCT	0.731													6	10	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106509091	106509091	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106509091G>C	uc003vdv.3	+	2	1170	c.1085G>C	c.(1084-1086)AGG>ACG	p.R362T	PIK3CG_uc003vdu.2_Missense_Mutation_p.R362T|PIK3CG_uc003vdw.2_Missense_Mutation_p.R362T	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	362					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						CGCAAGTTCAGGGTCAAGATC	0.562													71	116	---	---	---	---	PASS
SLC26A4	5172	broad.mit.edu	37	7	107353040	107353040	+	Silent	SNP	G	T	T	rs139556627		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107353040G>T	uc003vep.2	+	20	2516	c.2292G>T	c.(2290-2292)ACG>ACT	p.T764T	SLC26A4_uc011kmb.1_Silent_p.T351T|SLC26A4_uc011kmc.1_Silent_p.T325T|SLC26A4_uc011kmd.1_Silent_p.T333T	NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin	764	Cytoplasmic (Potential).				regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						CAGAGCTGACGGAAGAAGAAC	0.323									Pendred_syndrome				53	76	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	120386051	120386051	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120386051G>C	uc003vjj.1	+	5	2650	c.1685G>C	c.(1684-1686)AGA>ACA	p.R562T		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	562	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					ATTCAGATCAGATGTGTGGAG	0.453													39	64	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128486185	128486185	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128486185C>T	uc003vnz.3	+	22	4141	c.3932C>T	c.(3931-3933)ACC>ATC	p.T1311I	FLNC_uc003voa.3_Missense_Mutation_p.T1311I	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1311	Filamin 11.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GGGGACGGCACCTACCGAGTG	0.637													35	35	---	---	---	---	PASS
LRGUK	136332	broad.mit.edu	37	7	133859319	133859319	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133859319G>A	uc003vrm.1	+	8	967	c.951G>A	c.(949-951)CTG>CTA	p.L317L		NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain	317	LRR 9.						ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						TTGCTGAGCTGAGAGAAATAG	0.333													65	98	---	---	---	---	PASS
TRIM24	8805	broad.mit.edu	37	7	138255744	138255744	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138255744C>T	uc003vuc.2	+	11	2089	c.1874C>T	c.(1873-1875)CCG>CTG	p.P625L	TRIM24_uc003vub.2_Missense_Mutation_p.P591L	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha	625					cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						CCCTCTCTTCCGGATGTAAGT	0.308													98	149	---	---	---	---	PASS
TAS2R40	259286	broad.mit.edu	37	7	142919923	142919923	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142919923A>G	uc011ksx.1	+	1	752	c.752A>G	c.(751-753)TAC>TGC	p.Y251C		NM_176882	NP_795363	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	251	Helical; Name=6; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			ovary(1)	1	Melanoma(164;0.059)					GCCACCAGCTACTTTCTCATC	0.468													114	143	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	144703038	144703038	+	IGR	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144703038C>G								TPK1 (169892 upstream) : None (None downstream)																							ATTCCTCTATCCTTGTTCTTT	0.488													212	308	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147815229	147815229	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147815229C>A	uc003weu.1	+	16	2919	c.2403C>A	c.(2401-2403)GCC>GCA	p.A801A		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	801	Laminin G-like 3.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GGAATGCCGCCTCTTTCCCAA	0.448										HNSCC(39;0.1)			91	108	---	---	---	---	PASS
GALNTL5	168391	broad.mit.edu	37	7	151680066	151680066	+	Intron	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151680066T>A	uc003wkp.2	+						GALNTL5_uc003wkq.2_Intron|GALNTL5_uc003wkr.2_RNA|GALNTL5_uc003wks.2_RNA|GALNTL5_uc010lqf.2_Missense_Mutation_p.C11S	NM_145292	NP_660335	Q7Z4T8	GLTL5_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		TGCTTCTGCCTGCAGGTGTCT	0.418													66	94	---	---	---	---	PASS
DEFA4	1669	broad.mit.edu	37	8	6793613	6793613	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6793613T>G	uc003wqu.1	-	3	274	c.223A>C	c.(223-225)ACA>CCA	p.T75P		NM_001925	NP_001916	P12838	DEF4_HUMAN	defensin, alpha 4 preproprotein	75					defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space				large_intestine(1)	1				COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		CGAAGTTCTGTTCGCCGGCAG	0.507													76	34	---	---	---	---	PASS
SPAG11B	10407	broad.mit.edu	37	8	7308655	7308655	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7308655C>A	uc003wrk.2	-	3	448	c.281G>T	c.(280-282)AGA>ATA	p.R94I	SPAG11B_uc003wrg.1_Intron|SPAG11B_uc003wrh.1_Intron|SPAG11B_uc003wri.2_Missense_Mutation_p.R41I|SPAG11B_uc003wrj.2_Intron|SPAG11B_uc003wrl.2_Intron	NM_016512	NP_057596	Q08648	SG11B_HUMAN	sperm associated antigen 11B isoform A	94					spermatogenesis	extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		CCTGGCCCATCTAGGCCCTAA	0.443													30	86	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10468457	10468457	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10468457C>T	uc003wtc.2	-	4	3380	c.3151G>A	c.(3151-3153)GTT>ATT	p.V1051I		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1051					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		GCCTCGGAAACTCCCTCTGGA	0.692													27	10	---	---	---	---	PASS
MSR1	4481	broad.mit.edu	37	8	16032698	16032698	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16032698G>T	uc003wwz.2	-	3	413	c.215C>A	c.(214-216)GCA>GAA	p.A72E	MSR1_uc010lsu.2_Missense_Mutation_p.A90E|MSR1_uc003wxa.2_Missense_Mutation_p.A72E|MSR1_uc003wxb.2_Missense_Mutation_p.A72E|MSR1_uc011kxz.1_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1	72	Helical; Signal-anchor for type II membrane protein; (Potential).				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		TACGTTACCTGCCACTATTCC	0.418													77	44	---	---	---	---	PASS
MSR1	4481	broad.mit.edu	37	8	16032820	16032820	+	Intron	SNP	A	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16032820A>C	uc003wwz.2	-						MSR1_uc010lsu.2_Intron|MSR1_uc003wxa.2_Intron|MSR1_uc003wxb.2_Intron|MSR1_uc011kxz.1_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1						cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		CTAATAAAACAAAAAAGCCCA	0.363													14	61	---	---	---	---	PASS
FGL1	2267	broad.mit.edu	37	8	17731522	17731522	+	Intron	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17731522C>T	uc003wxx.2	-						FGL1_uc003wxy.2_Intron|FGL1_uc003wxz.2_Intron|FGL1_uc003wya.2_Intron|FGL1_uc003wyb.2_Intron|FGL1_uc003wyc.2_Intron|FGL1_uc003wyd.2_Splice_Site|FGL1_uc003wye.2_Intron|FGL1_uc003wyf.2_Intron	NM_201553	NP_963847	Q08830	FGL1_HUMAN	fibrinogen-like 1 precursor						signal transduction	fibrinogen complex	receptor binding				0				Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)		ATCATTCAAACCTTACCTTGA	0.289													58	69	---	---	---	---	PASS
LZTS1	11178	broad.mit.edu	37	8	20110905	20110905	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20110905C>G	uc003wzr.2	-	2	648	c.537G>C	c.(535-537)ATG>ATC	p.M179I	LZTS1_uc010ltg.1_Missense_Mutation_p.M179I	NM_021020	NP_066300	Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	179					cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GCAGGCTGGACATGGAGTTCC	0.672													16	62	---	---	---	---	PASS
HR	55806	broad.mit.edu	37	8	21984877	21984877	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21984877C>A	uc003xas.2	-	3	1743	c.1078G>T	c.(1078-1080)GAG>TAG	p.E360*	HR_uc003xat.2_Nonsense_Mutation_p.E360*	NM_005144	NP_005135	O43593	HAIR_HUMAN	hairless protein isoform a	360							DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|ovary(1)	2		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		TTCACTTCCTCGCTGGGTTCG	0.627													6	259	---	---	---	---	PASS
KCTD9	54793	broad.mit.edu	37	8	25315739	25315739	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25315739C>T	uc003xeo.2	-	1	182	c.24G>A	c.(22-24)CTG>CTA	p.L8L	PPP2R2A_uc003xek.2_Intron|CDCA2_uc003xep.1_5'Flank|CDCA2_uc011lae.1_5'Flank|CDCA2_uc003xeq.1_5'Flank	NM_017634	NP_060104	Q7L273	KCTD9_HUMAN	potassium channel tetramerisation domain	8	KHA.					voltage-gated potassium channel complex	voltage-gated potassium channel activity				0		all_cancers(63;0.0164)|Ovarian(32;0.000878)|all_epithelial(46;0.00542)|Breast(100;0.0164)|Hepatocellular(4;0.114)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Epithelial(17;2.39e-12)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0438)		GGCTGCCGTTCAGGAACAGGG	0.423													6	31	---	---	---	---	PASS
GSR	2936	broad.mit.edu	37	8	30539537	30539537	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30539537C>G	uc003xih.1	-	11	1286	c.1195G>C	c.(1195-1197)GAA>CAA	p.E399Q		NM_000637	NP_000628	P00390	GSHR_HUMAN	glutathione reductase precursor	399					cell redox homeostasis|nucleobase, nucleoside and nucleotide interconversion	cytosol|mitochondrion	electron carrier activity|glutathione-disulfide reductase activity			ovary(2)|pancreas(2)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Glutathione(DB00143)|NADH(DB00157)	TCCTTATATTCAAAAAGTCGA	0.388													127	79	---	---	---	---	PASS
ADAM32	203102	broad.mit.edu	37	8	39018484	39018484	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39018484G>A	uc003xmt.3	+	7	839	c.594G>A	c.(592-594)TTG>TTA	p.L198L	ADAM32_uc011lch.1_Silent_p.L205L|ADAM32_uc003xmu.3_Silent_p.L198L	NM_145004	NP_659441	Q8TC27	ADA32_HUMAN	a disintegrin and metalloprotease domain 32	198	Peptidase M12B.|Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			ACAAAACTTTGGTATGTGTTT	0.323													6	26	---	---	---	---	PASS
PLAG1	5324	broad.mit.edu	37	8	57079300	57079300	+	Silent	SNP	C	T	T	rs150353769		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57079300C>T	uc003xsq.3	-	3	1456	c.1005G>A	c.(1003-1005)CCG>CCA	p.P335P	PLAG1_uc003xsr.3_Silent_p.P335P|PLAG1_uc010lyi.2_Silent_p.P335P|PLAG1_uc010lyj.2_Silent_p.P253P	NM_001114635	NP_001108107	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1 isoform b	335	Activates transcription; Inhibition of nuclear import due to lack of NLS and KPNA2 interaction.|Repression domain; contains 3 sumoylation motifs and massively decrease transcription activity.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding		CTNNB1/PLAG1(60)|FGFR1_ENST00000447712/PLAG1(28)|CHCHD7/PLAG1(12)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|COL1A2/PLAG1(3)|TCEA1_ENST00000521604/PLAG1(3)	salivary_gland(113)|soft_tissue(13)|lung(1)|central_nervous_system(1)|breast(1)	129		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			TAGAACTGAACGGATATTTGA	0.428			T	TCEA1|LIFR|CTNNB1|CHCHD7	salivary adenoma								132	93	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67579132	67579132	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67579132G>A	uc003xwn.2	-	1	321	c.62C>T	c.(61-63)CCA>CTA	p.P21L	SGK3_uc003xwp.2_5'Flank|C8orf44_uc003xwo.1_5'Flank	NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	21	Pro-rich.				protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			CGGAGTCTGTGGAGCCTCAGG	0.532													5	5	---	---	---	---	PASS
JPH1	56704	broad.mit.edu	37	8	75227315	75227315	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75227315T>C	uc003yae.2	-	2	960	c.920A>G	c.(919-921)GAG>GGG	p.E307G	JPH1_uc003yaf.2_Missense_Mutation_p.E307G|JPH1_uc003yag.1_Missense_Mutation_p.E171G	NM_020647	NP_065698	Q9HDC5	JPH1_HUMAN	junctophilin 1	307	Cytoplasmic (Potential).|MORN 7.				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane				ovary(1)	1	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			ATTTGCCCACTCCCCTTCATA	0.512													173	104	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77617186	77617186	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77617186G>T	uc003yav.2	+	2	1250	c.863G>T	c.(862-864)GGT>GTT	p.G288V	ZFHX4_uc003yat.1_Missense_Mutation_p.G288V|ZFHX4_uc003yau.1_Missense_Mutation_p.G288V|ZFHX4_uc003yaw.1_Missense_Mutation_p.G288V	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	288						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTGTCTTTTGGTTATATCAGG	0.433										HNSCC(33;0.089)			70	66	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87755792	87755792	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87755792G>T	uc003ydx.2	-	1	110	c.64C>A	c.(64-66)CAA>AAA	p.Q22K		NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	22	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						CGAGAACTTTGTTCATTCTCA	0.418													118	71	---	---	---	---	PASS
OTUD6B	51633	broad.mit.edu	37	8	92082567	92082567	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92082567C>G	uc003yeu.3	+	1	144	c.45C>G	c.(43-45)AGC>AGG	p.S15R	uc003yet.2_5'Flank|OTUD6B_uc011lgh.1_5'UTR	NM_016023	NP_057107	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	Error:Variant_position_missing_in_Q8N6M0_after_alignment										ovary(2)|lung(1)	3			BRCA - Breast invasive adenocarcinoma(11;0.0187)			TGCCTACTAGCCGGTGCAGGT	0.617													5	19	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110439382	110439382	+	Silent	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110439382A>T	uc003yne.2	+	25	3101	c.2997A>T	c.(2995-2997)CTA>CTT	p.L999L		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	999	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AGAATCTTCTACAGGTTCCCT	0.358										HNSCC(38;0.096)			30	24	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110535548	110535548	+	Silent	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110535548T>C	uc003yne.2	+	76	12521	c.12417T>C	c.(12415-12417)AGT>AGC	p.S4139S		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	4139	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATGGCCTTAGTGGAAATACAA	0.403										HNSCC(38;0.096)			39	120	---	---	---	---	PASS
ZHX2	22882	broad.mit.edu	37	8	123964728	123964728	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123964728G>A	uc003ypk.1	+	3	1545	c.978G>A	c.(976-978)GTG>GTA	p.V326V		NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	326	Required for interaction with NFYA.|Required for homodimerization.|Required for repressor activity.|Required for nuclear localization.					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			CAGAAGAGGTGGAGGAGGCCC	0.602													35	125	---	---	---	---	PASS
FER1L6	654463	broad.mit.edu	37	8	124987425	124987425	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124987425G>A	uc003yqw.2	+	8	768	c.562G>A	c.(562-564)GAC>AAC	p.D188N		NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	188	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CCTGCTCACAGACCCTGGTGA	0.532													42	121	---	---	---	---	PASS
PHF20L1	51105	broad.mit.edu	37	8	133790097	133790097	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133790097G>T	uc003ytt.2	+	2	348	c.23G>T	c.(22-24)CGC>CTC	p.R8L	PHF20L1_uc003ytr.2_Missense_Mutation_p.R8L|PHF20L1_uc010mdv.2_Missense_Mutation_p.R8L|PHF20L1_uc003yts.2_Missense_Mutation_p.R8L|PHF20L1_uc011lja.1_Missense_Mutation_p.R8L|PHF20L1_uc003ytu.1_RNA|PHF20L1_uc003ytq.2_Missense_Mutation_p.R8L	NM_016018	NP_057102	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1 isoform 1	8							nucleic acid binding|zinc ion binding			ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			CCCCCAAATCGCCCTGGAATC	0.363													97	62	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139163427	139163427	+	Intron	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139163427G>T	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron|FAM135B_uc003yva.2_Intron|FAM135B_uc003yvb.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AAGCCCGTCAGCCAGCTTACC	0.418										HNSCC(54;0.14)			37	21	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139163804	139163804	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139163804C>A	uc003yuy.2	-	13	3085	c.2914G>T	c.(2914-2916)GTG>TTG	p.V972L	FAM135B_uc003yux.2_Missense_Mutation_p.V873L|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.V534L|FAM135B_uc003yvb.2_Missense_Mutation_p.V534L	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	972										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AAGGCATTCACTCCTCTATTA	0.498										HNSCC(54;0.14)			32	134	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139164776	139164776	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139164776G>T	uc003yuy.2	-	13	2113	c.1942C>A	c.(1942-1944)CTG>ATG	p.L648M	FAM135B_uc003yux.2_Missense_Mutation_p.L549M|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.L210M|FAM135B_uc003yvb.2_Missense_Mutation_p.L210M	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	648										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GGCTCCCTCAGGGTAGAACTT	0.483										HNSCC(54;0.14)			111	70	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139323149	139323149	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139323149C>A	uc003yuy.2	-	3	263	c.92G>T	c.(91-93)CGA>CTA	p.R31L	FAM135B_uc003yux.2_5'UTR|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	31										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CAAGGTCACTCGGATCTGGTA	0.493										HNSCC(54;0.14)			77	59	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139323175	139323175	+	Intron	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139323175G>T	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TAAGAAAAGAGAAGAGGACAG	0.468										HNSCC(54;0.14)			56	37	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139737671	139737671	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139737671G>T	uc003yvd.2	-	24	2599	c.2152C>A	c.(2152-2154)CCC>ACC	p.P718T	COL22A1_uc011ljo.1_Missense_Mutation_p.P18T	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	718	Collagen-like 5.|Pro-rich.|Gly-rich.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			ACACCAGGGGGTCCTGGAGGG	0.582										HNSCC(7;0.00092)			147	72	---	---	---	---	PASS
FLJ43860	389690	broad.mit.edu	37	8	142500317	142500317	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142500317G>A	uc003ywi.2	-	5	678	c.597C>T	c.(595-597)CAC>CAT	p.H199H	FLJ43860_uc011ljs.1_RNA|FLJ43860_uc010meu.1_RNA	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690	199							binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			CCCGCCACGAGTGCCTGCAGA	0.647													20	8	---	---	---	---	PASS
ZNF250	58500	broad.mit.edu	37	8	146108175	146108175	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146108175C>T	uc003zeq.3	-	6	525	c.408G>A	c.(406-408)AAG>AAA	p.K136K	COMMD5_uc010mgf.2_Intron|ZNF250_uc003zer.3_Silent_p.K131K|ZNF250_uc010mgg.2_Silent_p.K131K	NM_021061	NP_066405	P15622	ZN250_HUMAN	zinc finger protein 250 isoform a	136					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		AAATTAATGGCTTCGGACTCA	0.383													62	271	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14816877	14816877	+	Intron	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14816877G>T	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		tacctgtggggataatatttg	0.075													10	1	---	---	---	---	PASS
ZCCHC7	84186	broad.mit.edu	37	9	37126821	37126821	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37126821G>C	uc003zzq.2	+	2	665	c.492G>C	c.(490-492)GAG>GAC	p.E164D	ZCCHC7_uc011lqh.1_Intron|ZCCHC7_uc011lqi.1_Missense_Mutation_p.E163D|ZCCHC7_uc010mlt.2_Missense_Mutation_p.E163D|ZCCHC7_uc003zzs.1_Missense_Mutation_p.E163D	NM_032226	NP_115602	Q8N3Z6	ZCHC7_HUMAN	zinc finger, CCHC domain containing 7	164							nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(29;0.0137)		AAGAGGAAGAGAGCACCATTT	0.413													128	43	---	---	---	---	PASS
C9orf95	54981	broad.mit.edu	37	9	77684836	77684836	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77684836C>T	uc004aju.2	-	5	890	c.292G>A	c.(292-294)GAA>AAA	p.E98K	C9orf95_uc004ajs.3_Missense_Mutation_p.E102K|C9orf95_uc004ajr.3_Missense_Mutation_p.E98K|C9orf95_uc004ajt.3_Missense_Mutation_p.E98K	NM_017881	NP_060351	Q9NWW6	NRK1_HUMAN	nicotinamide riboside kinase 1 isoform 1	98				E->A: Loss of activity.	pyridine nucleotide biosynthetic process		ATP binding|metal ion binding|ribosylnicotinamide kinase activity				0						AGAAAACCTTCGATGATTAAA	0.393													72	108	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84603768	84603768	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84603768C>A	uc004amn.2	+	1	82	c.35C>A	c.(34-36)ACT>AAT	p.T12N		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	12						integral to membrane					0						AACAGCTATACTGAGACAGGG	0.483													82	131	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84606980	84606980	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84606980T>A	uc004amn.2	+	4	1642	c.1595T>A	c.(1594-1596)TTC>TAC	p.F532Y		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	532						integral to membrane					0						TTTGTATTCTTCAATGGCATT	0.483													120	22	---	---	---	---	PASS
MURC	347273	broad.mit.edu	37	9	103340680	103340680	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103340680C>G	uc004bba.2	+	1	345	c.255C>G	c.(253-255)ATC>ATG	p.I85M		NM_001018116	NP_001018126	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	85					cell differentiation|muscle organ development|transcription, DNA-dependent					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0461)				CAGGGCATATCATTAACAAAT	0.388													227	36	---	---	---	---	PASS
GSN	2934	broad.mit.edu	37	9	124064369	124064369	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124064369G>A	uc004blf.1	+	2	334	c.273G>A	c.(271-273)ACG>ACA	p.T91T	GSN_uc004bld.1_Silent_p.T40T|GSN_uc010mvq.1_Silent_p.T51T|GSN_uc010mvr.1_Silent_p.T51T|GSN_uc010mvu.1_Silent_p.T40T|GSN_uc010mvt.1_Silent_p.T40T|GSN_uc010mvs.1_Silent_p.T40T|GSN_uc004ble.1_Silent_p.T40T|GSN_uc010mvv.1_Silent_p.T40T|GSN_uc011lyh.1_Silent_p.T57T|GSN_uc011lyi.1_Silent_p.T40T|GSN_uc011lyj.1_Silent_p.T64T	NM_000177	NP_000168	P06396	GELS_HUMAN	gelsolin isoform a precursor	91	Actin-severing (Potential).|Gelsolin-like 1.				actin filament polymerization|actin filament severing|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|cilium morphogenesis	actin cytoskeleton|cytosol	actin binding|calcium ion binding|protein binding			breast(2)|ovary(1)	3						ACTTCTTCACGGGCGACGCCT	0.597													6	224	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139912256	139912256	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139912256C>G	uc011mem.1	-	15	2339	c.2191G>C	c.(2191-2193)GAG>CAG	p.E731Q	ABCA2_uc011mel.1_Missense_Mutation_p.E732Q|ABCA2_uc004ckl.1_Missense_Mutation_p.E662Q|ABCA2_uc004ckm.1_Missense_Mutation_p.E762Q|ABCA2_uc004ckn.1_RNA	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	731					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		AGCCGGTGCTCCTTCTCCGCC	0.677													29	4	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139912311	139912311	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139912311C>T	uc011mem.1	-	15	2284	c.2136G>A	c.(2134-2136)GTG>GTA	p.V712V	ABCA2_uc011mel.1_Silent_p.V713V|ABCA2_uc004ckl.1_Silent_p.V643V|ABCA2_uc004ckm.1_Silent_p.V743V|ABCA2_uc004ckn.1_RNA	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	712	Helical; (Potential).				cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CCCAGGAGATCACCATGCACA	0.572													43	2	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139912624	139912624	+	Intron	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139912624C>G	uc011mem.1	-						ABCA2_uc011mel.1_Intron|ABCA2_uc004ckl.1_Intron|ABCA2_uc004ckm.1_Intron|ABCA2_uc004ckn.1_Intron	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2						cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CGGGCCTGCTCCTCACCCTGG	0.652													29	5	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7218019	7218019	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7218019C>T	uc009xio.1	-	17	2008	c.1917G>A	c.(1915-1917)TTG>TTA	p.L639L	SFMBT2_uc001ijn.1_Silent_p.L639L|SFMBT2_uc010qay.1_Silent_p.L474L	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	639					regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						CAGGACTAAACAAATTTGGAC	0.423													138	118	---	---	---	---	PASS
UPF2	26019	broad.mit.edu	37	10	12043711	12043711	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12043711C>T	uc001ila.2	-	5	2092	c.1618G>A	c.(1618-1620)GCT>ACT	p.A540T	UPF2_uc001ilb.2_Missense_Mutation_p.A540T|UPF2_uc001ilc.2_Missense_Mutation_p.A540T|UPF2_uc009xiz.1_Missense_Mutation_p.A540T	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog	540	Potential.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				AGATCTTCAGCTTCATCTCCA	0.353													7	52	---	---	---	---	PASS
DHTKD1	55526	broad.mit.edu	37	10	12123485	12123485	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12123485G>T	uc001ild.3	+	2	268	c.169G>T	c.(169-171)GCC>TCC	p.A57S		NM_018706	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain	57					glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			ovary(1)|central_nervous_system(1)	2		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			TCATGGCCTTGCCAGGTTGGT	0.413													135	108	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16967399	16967399	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16967399A>T	uc001ioo.2	-	43	6539	c.6487T>A	c.(6487-6489)TCT>ACT	p.S2163T		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	2163	CUB 15.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AAGGGTGGAGAACAGATATCA	0.388													32	34	---	---	---	---	PASS
SLC39A12	221074	broad.mit.edu	37	10	18250781	18250781	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18250781C>A	uc001ipo.2	+	3	806	c.533C>A	c.(532-534)TCT>TAT	p.S178Y	SLC39A12_uc001ipn.2_Missense_Mutation_p.S178Y|SLC39A12_uc001ipp.2_Missense_Mutation_p.S178Y|SLC39A12_uc010qck.1_Missense_Mutation_p.S44Y	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	178	Extracellular (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						TTTGACACTTCTCAAAGCCAG	0.418													35	80	---	---	---	---	PASS
SLC39A12	221074	broad.mit.edu	37	10	18280105	18280105	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18280105C>A	uc001ipo.2	+	8	1568	c.1295C>A	c.(1294-1296)GCC>GAC	p.A432D	SLC39A12_uc001ipn.2_Missense_Mutation_p.A432D|SLC39A12_uc001ipp.2_Missense_Mutation_p.A432D|SLC39A12_uc010qck.1_Missense_Mutation_p.A298D	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	432	Cytoplasmic (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						AAGCAGGAAGCCCCAGAATTT	0.348													58	55	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25886785	25886785	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25886785C>T	uc001isj.2	+	11	2290	c.2230C>T	c.(2230-2232)CGG>TGG	p.R744W	GPR158_uc001isk.2_Missense_Mutation_p.R119W	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	744	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						CCAGAAAAAGCGGTGCTCGAA	0.498													49	139	---	---	---	---	PASS
ZEB1	6935	broad.mit.edu	37	10	31810466	31810466	+	Missense_Mutation	SNP	C	T	T	rs138456617		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31810466C>T	uc001ivs.3	+	7	2266	c.2203C>T	c.(2203-2205)CTT>TTT	p.L735F	ZEB1_uc001ivr.3_Missense_Mutation_p.L517F|ZEB1_uc010qee.1_Missense_Mutation_p.L517F|ZEB1_uc010qef.1_Missense_Mutation_p.L517F|ZEB1_uc009xlj.1_Missense_Mutation_p.L661F|ZEB1_uc010qeg.1_Missense_Mutation_p.L594F|ZEB1_uc009xlk.1_Missense_Mutation_p.L517F|ZEB1_uc001ivt.3_Missense_Mutation_p.L517F|ZEB1_uc001ivu.3_Missense_Mutation_p.L736F|ZEB1_uc001ivv.3_Missense_Mutation_p.L715F|ZEB1_uc010qeh.1_Missense_Mutation_p.L668F|ZEB1_uc009xlo.1_Missense_Mutation_p.L718F|ZEB1_uc009xlp.2_Missense_Mutation_p.L719F	NM_030751	NP_110378	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b	735					cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)				AGTAGAACCTCTTGATCTTTC	0.428													36	92	---	---	---	---	PASS
ARHGAP12	94134	broad.mit.edu	37	10	32106816	32106816	+	Splice_Site	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32106816T>A	uc001ivz.1	-	13	1903	c.1633_splice	c.e13-1	p.L545_splice	ARHGAP12_uc001ivy.1_Splice_Site_p.L491_splice|ARHGAP12_uc009xls.2_Splice_Site_p.L496_splice|ARHGAP12_uc001iwb.1_Splice_Site_p.L538_splice|ARHGAP12_uc001iwc.1_Splice_Site_p.L513_splice|ARHGAP12_uc009xlq.1_Splice_Site_p.L466_splice|ARHGAP12_uc001iwd.1_Splice_Site_p.L513_splice|ARHGAP12_uc009xlr.1_Splice_Site_p.L543_splice	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)				AGTTTTCAGCTTTAGAGAAAA	0.338													23	72	---	---	---	---	PASS
GDF2	2658	broad.mit.edu	37	10	48414071	48414071	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48414071T>C	uc001jfa.1	-	2	960	c.797A>G	c.(796-798)AAG>AGG	p.K266R		NM_016204	NP_057288	Q9UK05	GDF2_HUMAN	growth differentiation factor 2 precursor	266					activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(2)|skin(1)	3						CCTGGTCTCCTTGGTCCCACT	0.572													19	56	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49392891	49392891	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49392891T>C	uc001jgi.2	-	19	2500	c.2393A>G	c.(2392-2394)CAA>CGA	p.Q798R	FRMPD2_uc001jgh.2_Missense_Mutation_p.Q766R|FRMPD2_uc001jgj.2_Missense_Mutation_p.Q776R	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	798	PDZ 1.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		AGGGTCAGCTTGGCCTGAATA	0.338													11	39	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61831882	61831882	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61831882C>A	uc001jky.2	-	37	8949	c.8757G>T	c.(8755-8757)ATG>ATT	p.M2919I	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	2919					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						ATTTTACAGTCATTTCTTTAA	0.403													46	57	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64944447	64944447	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64944447T>A	uc001jmn.2	-	21	7182	c.6882A>T	c.(6880-6882)GAA>GAT	p.E2294D	JMJD1C_uc001jml.2_Missense_Mutation_p.E2057D|JMJD1C_uc001jmm.2_Missense_Mutation_p.E2006D|JMJD1C_uc010qiq.1_Missense_Mutation_p.E2112D|JMJD1C_uc009xpi.2_Missense_Mutation_p.E2112D|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc001jmo.2_Missense_Mutation_p.E201D	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	2294	JmjC.				blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					TGAATTTTCCTTCTGGATTAC	0.363													35	89	---	---	---	---	PASS
H2AFY2	55506	broad.mit.edu	37	10	71851717	71851717	+	Intron	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71851717C>T	uc001jqm.2	+						H2AFY2_uc001jqn.2_Intron	NM_018649	NP_061119	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2						chromatin modification|dosage compensation|nucleosome assembly	Barr body|nucleosome	DNA binding			skin(1)	1						AAAGGTAGGCCGAGGCTGCGT	0.413													8	19	---	---	---	---	PASS
TTC18	118491	broad.mit.edu	37	10	75056899	75056899	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75056899G>T	uc009xrc.2	-	16	1876	c.1755C>A	c.(1753-1755)TAC>TAA	p.Y585*	TTC18_uc001jty.2_Nonsense_Mutation_p.Y585*|TTC18_uc009xrd.1_Nonsense_Mutation_p.Y399*|TTC18_uc001jtx.2_5'UTR	NM_145170	NP_660153	Q5T0N1	TTC18_HUMAN	tetratricopeptide repeat domain 18	585							binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)					TTGTCTTCAAGTATTTATCTC	0.438													31	79	---	---	---	---	PASS
SEC24C	9632	broad.mit.edu	37	10	75526283	75526283	+	Missense_Mutation	SNP	C	T	T	rs148361947	byFrequency	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75526283C>T	uc001juw.2	+	13	1962	c.1783C>T	c.(1783-1785)CGG>TGG	p.R595W	SEC24C_uc010qkn.1_RNA|SEC24C_uc009xrj.1_Missense_Mutation_p.R453W|SEC24C_uc001jux.2_Missense_Mutation_p.R595W|SEC24C_uc010qko.1_Missense_Mutation_p.R476W|SEC24C_uc010qkp.1_Intron|SEC24C_uc010qkq.1_Intron	NM_004922	NP_004913	P53992	SC24C_HUMAN	SEC24-related protein C	595					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|zinc ion binding			skin(2)|central_nervous_system(1)	3	Prostate(51;0.0112)					CAATGAGTCTCGGGCAGTTAT	0.517													24	50	---	---	---	---	PASS
MAT1A	4143	broad.mit.edu	37	10	82043802	82043802	+	Intron	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82043802G>A	uc001kbw.2	-							NM_000429	NP_000420	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha						methylation|S-adenosylmethionine biosynthetic process|xenobiotic metabolic process	cytosol	ATP binding|metal ion binding|methionine adenosyltransferase activity				0			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	TCTCTGAAAGGGAGCGGGGAG	0.577													17	13	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87373339	87373339	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87373339C>A	uc001kdl.1	-	15	2527	c.2426G>T	c.(2425-2427)GGC>GTC	p.G809V	GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.G380V	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	809	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	GTCACAGCGGCCCATGTGCGG	0.612										Multiple Myeloma(13;0.14)			19	39	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87373340	87373340	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87373340C>A	uc001kdl.1	-	15	2526	c.2425G>T	c.(2425-2427)GGC>TGC	p.G809C	GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.G380C	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	809	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	TCACAGCGGCCCATGTGCGGC	0.607										Multiple Myeloma(13;0.14)			19	42	---	---	---	---	PASS
PNLIPRP3	119548	broad.mit.edu	37	10	118215325	118215325	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118215325G>T	uc001lcl.3	+	5	649	c.548G>T	c.(547-549)GGC>GTC	p.G183V		NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3 precursor	183					lipid catabolic process	extracellular region	triglyceride lipase activity			ovary(1)	1				all cancers(201;0.0131)		AGGATACCAGGCCTTGGAAGA	0.443													24	66	---	---	---	---	PASS
PNLIPRP2	5408	broad.mit.edu	37	10	118385573	118385573	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118385573C>A	uc001lcq.2	+	6	347	c.324C>A	c.(322-324)GAC>GAA	p.D108E	PNLIPRP2_uc009xyu.1_RNA|PNLIPRP2_uc009xyv.1_RNA	NM_005396	NP_005387	P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2	107					galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity			large_intestine(1)	1				all cancers(201;0.015)		GGCCATCGGACATGTGCAAGG	0.542													12	14	---	---	---	---	PASS
NPS	594857	broad.mit.edu	37	10	129350859	129350859	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129350859G>C	uc001ljx.1	+	3	246	c.226G>C	c.(226-228)GGC>CGC	p.G76R		NM_001030013	NP_001025184	P0C0P6	NPS_HUMAN	neuropeptide S precursor	76					neuropeptide signaling pathway	extracellular region					0						CAATGGAGTTGGCACAGGGAT	0.423													60	198	---	---	---	---	PASS
INPP5A	3632	broad.mit.edu	37	10	134563057	134563057	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134563057G>T	uc001llp.2	+	10	1017	c.769G>T	c.(769-771)GCC>TCC	p.A257S	INPP5A_uc001llo.1_Missense_Mutation_p.A257S|INPP5A_uc001llq.2_Intron	NM_005539	NP_005530	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase A	257					cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		GACGGTCCGGGCCGCCGACAC	0.627													8	50	---	---	---	---	PASS
PAOX	196743	broad.mit.edu	37	10	135203156	135203156	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135203156A>C	uc001lmv.2	+	6	1377	c.1297A>C	c.(1297-1299)ACT>CCT	p.T433P	PAOX_uc001lmw.2_Intron|PAOX_uc001lmx.2_Intron|PAOX_uc001lmy.2_Intron|PAOX_uc001lmz.2_RNA|PAOX_uc001lna.2_RNA|PAOX_uc001lnb.2_RNA|PAOX_uc001lnc.2_RNA	NM_152911	NP_690875	Q6QHF9	PAOX_HUMAN	polyamine oxidase isoform 1	571					polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		CGCCCCGTACACTAGGGGGTC	0.672													55	47	---	---	---	---	PASS
UBQLNL	143630	broad.mit.edu	37	11	5536531	5536531	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5536531G>T	uc001maz.3	-	1	1426	c.1141C>A	c.(1141-1143)CCA>ACA	p.P381T	HBG2_uc001mak.1_Intron	NM_145053	NP_659490	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	381										large_intestine(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		GGTAAGGCTGGTATCCAAGCT	0.488													83	84	---	---	---	---	PASS
OR56A4	120793	broad.mit.edu	37	11	6023660	6023660	+	Missense_Mutation	SNP	G	A	A	rs116778909	by1000genomes	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6023660G>A	uc010qzv.1	-	1	719	c.719C>T	c.(718-720)TCC>TTC	p.S240F		NM_001005179	NP_001005179	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A,	188	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAGAGTTTGGACACAGACAG	0.443													15	87	---	---	---	---	PASS
CNGA4	1262	broad.mit.edu	37	11	6261348	6261348	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6261348C>T	uc001mco.2	+	4	431	c.324C>T	c.(322-324)CGC>CGT	p.R108R	CNGA4_uc010raa.1_Intron|CNGA4_uc001mcn.2_Silent_p.R68R	NM_001037329	NP_001032406	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	108	Cytoplasmic (Potential).				response to stimulus|sensory perception of smell		cAMP binding			skin(1)	1		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTCGAGTCGCTACGTTCGCA	0.602													134	131	---	---	---	---	PASS
LYVE1	10894	broad.mit.edu	37	11	10585798	10585798	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10585798C>T	uc001miv.2	-	2	495	c.209G>A	c.(208-210)GGC>GAC	p.G70D	uc001miu.2_Intron|LYVE1_uc010rca.1_Intron	NM_006691	NP_006682	Q9Y5Y7	LYVE1_HUMAN	lymphatic vessel endothelial hyaluronan receptor	70	Link.|Extracellular (Potential).				anatomical structure morphogenesis|cell-matrix adhesion|cellular component movement|response to wounding|transport	integral to plasma membrane|membrane fraction				central_nervous_system(1)|skin(1)	2				all cancers(16;7.22e-08)|Epithelial(150;1.03e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0609)		TTGGTCCTTGCCGGCCAAACT	0.473													4	108	---	---	---	---	PASS
SLC5A12	159963	broad.mit.edu	37	11	26743259	26743259	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26743259C>A	uc001mra.2	-	1	316	c.3G>T	c.(1-3)ATG>ATT	p.M1I	SLC5A12_uc001mrb.2_Intron|SLC5A12_uc001mrc.3_Missense_Mutation_p.M1I	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose	1	Extracellular (Potential).				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						TCTTCACCTCCATATTGGAAA	0.408													97	126	---	---	---	---	PASS
DDB2	1643	broad.mit.edu	37	11	47259387	47259387	+	Splice_Site	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47259387G>A	uc001neb.2	+	8	1219	c.1024_splice	c.e8-1	p.A342_splice	DDB2_uc001nec.2_Splice_Site|DDB2_uc009yli.1_Splice_Site_p.A278_splice|DDB2_uc001ned.2_Splice_Site|DDB2_uc001nee.2_Splice_Site_p.A153_splice|DDB2_uc001nef.2_Splice_Site_p.A139_splice|DDB2_uc001neg.2_Splice_Site_p.A201_splice|DDB2_uc001neh.2_Splice_Site	NM_000107	NP_000098	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2						nucleotide-excision repair, DNA damage removal|protein autoubiquitination|protein polyubiquitination|response to UV	nucleoplasm|protein complex	damaged DNA binding|protein binding			kidney(2)|ovary(1)	3						CCATCTCCTAGGCAGCCTGGC	0.453			Mis|N			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				65	21	---	---	---	---	PASS
PTPRJ	5795	broad.mit.edu	37	11	48145189	48145189	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48145189G>T	uc001ngp.3	+	5	996	c.641G>T	c.(640-642)CGT>CTT	p.R214L	PTPRJ_uc001ngo.3_Missense_Mutation_p.R214L	NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	214	Extracellular (Potential).|Fibronectin type-III 2.		R -> C (in a colon cancer sample; somatic mutation).		contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						TCTGATCTCCGTGTTGCCCTC	0.478													48	13	---	---	---	---	PASS
OR5D16	390144	broad.mit.edu	37	11	55606581	55606581	+	Silent	SNP	G	T	T	rs139231893	byFrequency	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55606581G>T	uc010rio.1	+	1	354	c.354G>T	c.(352-354)GCG>GCT	p.A118A		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	118	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.A118V(1)		ovary(4)|skin(1)	5		all_epithelial(135;0.208)				TTCTATTTGCGGTGATGGCCT	0.423													128	200	---	---	---	---	PASS
OR5F1	338674	broad.mit.edu	37	11	55761527	55761527	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55761527G>T	uc010riv.1	-	1	575	c.575C>A	c.(574-576)ACA>AAA	p.T192K		NM_003697	NP_003688	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F,	192	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)					TTTCAGGATTGTGTCAGAACA	0.448													31	69	---	---	---	---	PASS
PRG3	10394	broad.mit.edu	37	11	57146214	57146214	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57146214C>G	uc001njv.1	-	4	557	c.447G>C	c.(445-447)CAG>CAC	p.Q149H		NM_006093	NP_006084	Q9Y2Y8	PRG3_HUMAN	proteoglycan 3 precursor	149	C-type lectin.				basophil activation|histamine biosynthetic process|immune response|leukotriene biosynthetic process|negative regulation of translation|neutrophil activation|positive regulation of interleukin-8 biosynthetic process|superoxide anion generation		sugar binding				0						TAGTGCAGCACTGAATGCGAT	0.502													8	491	---	---	---	---	PASS
GLYATL1	92292	broad.mit.edu	37	11	58715445	58715445	+	Intron	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58715445A>G	uc001nnf.2	+						uc001nng.1_Intron|GLYATL1_uc001nnh.1_Intron|GLYATL1_uc001nni.1_Intron|GLYATL1_uc001nnj.1_Intron			Q969I3	GLYL1_HUMAN	SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;							mitochondrion	glycine N-acyltransferase activity			ovary(1)	1					Glycine(DB00145)	GCAGGTAGGCACACAGACAGG	0.527													33	37	---	---	---	---	PASS
CATSPER1	117144	broad.mit.edu	37	11	65786339	65786339	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65786339C>T	uc001ogt.2	-	10	2298	c.2160G>A	c.(2158-2160)CTG>CTA	p.L720L		NM_053054	NP_444282	Q8NEC5	CTSR1_HUMAN	sperm-associated cation channel 1	720	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	protein binding			ovary(2)	2						TGAGCCGCTTCAGCATGGTGC	0.587													39	66	---	---	---	---	PASS
SYT12	91683	broad.mit.edu	37	11	66816052	66816052	+	Intron	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66816052C>G	uc009yrl.2	+						SYT12_uc001oju.2_Intron	NM_177963	NP_808878	Q8IV01	SYT12_HUMAN	synaptotagmin XII							cell junction|integral to membrane|synaptic vesicle membrane				ovary(1)	1						GCCTCTTCCTCAGGACCTGTC	0.622													36	52	---	---	---	---	PASS
SAPS3	55291	broad.mit.edu	37	11	68305363	68305363	+	Intron	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68305363A>G	uc001onw.2	+						SAPS3_uc010rqb.1_Intron|SAPS3_uc001onv.2_Intron|SAPS3_uc001ony.3_Intron|SAPS3_uc001onx.2_Intron|SAPS3_uc009ysh.2_Intron|SAPS3_uc001onu.2_Intron|SAPS3_uc010rqc.1_Intron	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			GATACAAGTAAGACAATTCAA	0.373													56	38	---	---	---	---	PASS
TMPRSS4	56649	broad.mit.edu	37	11	117978579	117978579	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117978579G>A	uc010rxo.1	+	6	822	c.531G>A	c.(529-531)CGG>CGA	p.R177R	TMPRSS4_uc010rxp.1_Silent_p.R172R|TMPRSS4_uc010rxq.1_Silent_p.R30R|TMPRSS4_uc010rxr.1_Silent_p.R152R|TMPRSS4_uc010rxs.1_Silent_p.R137R|TMPRSS4_uc009yzu.2_RNA|TMPRSS4_uc010rxt.1_Silent_p.R152R	NM_019894	NP_063947	Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4 isoform 1	177	Extracellular (Potential).|SRCR.				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		TTCGCATGCGGAACTCAAGTG	0.547													27	6	---	---	---	---	PASS
OR8A1	390275	broad.mit.edu	37	11	124440209	124440209	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124440209A>G	uc010san.1	+	1	245	c.245A>G	c.(244-246)AAT>AGT	p.N82S		NM_001005194	NP_001005194	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A,	82	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		TTTCTCAGCAATCTGTCACTC	0.493													4	151	---	---	---	---	PASS
MRPL51	51258	broad.mit.edu	37	12	6601442	6601442	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6601442G>A	uc001qom.2	-	3	551	c.382C>T	c.(382-384)CGA>TGA	p.R128*	MRPL51_uc001qon.1_RNA|NCAPD2_uc009zen.1_5'Flank|NCAPD2_uc001qoo.2_5'Flank|NCAPD2_uc010sfd.1_5'Flank	NM_016497	NP_057581	Q4U2R6	RM51_HUMAN	mitochondrial ribosomal protein L51 precursor	128					translation	mitochondrial large ribosomal subunit	protein binding|structural constituent of ribosome				0						CTCTTCTATCGAAACTTCCCA	0.438													62	210	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	9009779	9009779	+	Silent	SNP	C	A	A	rs56179521	by1000genomes	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9009779C>A	uc001quz.3	+	24	2966	c.2868C>A	c.(2866-2868)GCC>GCA	p.A956A	A2ML1_uc001qva.1_Silent_p.A536A|A2ML1_uc010sgm.1_Silent_p.A456A	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor	800						extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						TGGGCACAGCCCTGCAGAACC	0.507													33	110	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13720031	13720031	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13720031G>A	uc001rbt.2	-	12	2705	c.2526C>T	c.(2524-2526)TTC>TTT	p.F842F		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	842	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	ACTGCCAATAGAAAAGGTGTT	0.498													72	47	---	---	---	---	PASS
GYS2	2998	broad.mit.edu	37	12	21690000	21690000	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21690000C>T	uc001rfb.2	-	16	2255	c.2000G>A	c.(1999-2001)AGA>AAA	p.R667K		NM_021957	NP_068776	P54840	GYS2_HUMAN	glycogen synthase 2	667					glucose metabolic process|glycogen biosynthetic process|response to glucose stimulus	cortical actin cytoskeleton|cytosol|ectoplasm|insoluble fraction|soluble fraction	glycogen (starch) synthase activity|protein homodimerization activity			lung(1)|skin(1)	2						CTCATCGTATCTCTCATCCTC	0.483													92	56	---	---	---	---	PASS
SOX5	6660	broad.mit.edu	37	12	23998945	23998945	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23998945C>T	uc001rfw.2	-	3	555	c.453G>A	c.(451-453)ATG>ATA	p.M151I	SOX5_uc001rfx.2_Missense_Mutation_p.M138I|SOX5_uc001rfy.2_Missense_Mutation_p.M138I|SOX5_uc010siv.1_Missense_Mutation_p.M138I|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Missense_Mutation_p.M103I|SOX5_uc001rga.2_Missense_Mutation_p.M116I	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	151					transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						TGAGCTCTTCCATTTTCCTCT	0.443													37	88	---	---	---	---	PASS
NELL2	4753	broad.mit.edu	37	12	44917246	44917246	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44917246C>A	uc001rog.2	-	17	2421	c.1826G>T	c.(1825-1827)GGG>GTG	p.G609V	NELL2_uc001rof.3_Missense_Mutation_p.G608V|NELL2_uc001roh.2_Missense_Mutation_p.G609V|NELL2_uc009zkd.2_Missense_Mutation_p.G561V|NELL2_uc010skz.1_Missense_Mutation_p.G659V|NELL2_uc010sla.1_Missense_Mutation_p.G632V|NELL2_uc001roi.1_Missense_Mutation_p.G609V	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	609	EGF-like 6; calcium-binding (Potential).				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		GCTGTGCCTCCCGGTCCCACA	0.448													70	55	---	---	---	---	PASS
CACNB3	784	broad.mit.edu	37	12	49218526	49218526	+	Intron	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49218526C>T	uc001rsl.1	+						CACNB3_uc010slx.1_Missense_Mutation_p.P148L|CACNB3_uc010sly.1_Intron|CACNB3_uc010slz.1_Intron|CACNB3_uc001rsk.1_5'UTR	NM_000725	NP_000716	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3						axon guidance|membrane depolarization|synaptic transmission	cytosol|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0					Verapamil(DB00661)	GGTAGCCTCCCCCCAACCCAC	0.562													31	25	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49424703	49424703	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49424703G>A	uc001rta.3	-	40	13644	c.13644C>T	c.(13642-13644)AGC>AGT	p.S4548S		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	4548					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GCAAGGCCTCGCTGGCCCTGA	0.627			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			28	11	---	---	---	---	PASS
TMPRSS12	283471	broad.mit.edu	37	12	51252600	51252600	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51252600C>T	uc001rwx.3	+	3	463	c.416C>T	c.(415-417)ACT>ATT	p.T139I	TMPRSS12_uc001rwy.2_Missense_Mutation_p.T139I	NM_182559	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane protease, serine 12 precursor	139	Peptidase S1.|Extracellular (Potential).				proteolysis	integral to membrane	serine-type endopeptidase activity				0						GTGATTGGAACTAATAATATA	0.279													6	19	---	---	---	---	PASS
POU6F1	5463	broad.mit.edu	37	12	51584082	51584082	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51584082C>T	uc001rxy.2	-	5	1046	c.854G>A	c.(853-855)CGG>CAG	p.R285Q	POU6F1_uc001rxz.2_Missense_Mutation_p.R285Q|POU6F1_uc001rya.2_Missense_Mutation_p.R285Q	NM_002702	NP_002693	Q14863	PO6F1_HUMAN	POU class 6 homeobox 1	285	Homeobox.				brain development|heart development|muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1						CGTCTGGCGCCGATTGCAGAA	0.542													57	57	---	---	---	---	PASS
KRT72	140807	broad.mit.edu	37	12	52992806	52992806	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52992806C>A	uc001sar.2	-	2	603	c.517G>T	c.(517-519)GAG>TAG	p.E173*	KRT72_uc001saq.2_Nonsense_Mutation_p.E173*|KRT72_uc010sns.1_Nonsense_Mutation_p.E173*|KRT72_uc010snt.1_5'UTR	NM_001146225	NP_001139697	Q14CN4	K2C72_HUMAN	keratin 72 isoform 1	173	Linker 1.|Rod.					keratin filament	structural molecule activity			ovary(5)|pancreas(1)	6				BRCA - Breast invasive adenocarcinoma(357;0.195)		TAAATGGGCTCCAGGTTCTTC	0.562													6	198	---	---	---	---	PASS
OR10A7	121364	broad.mit.edu	37	12	55615466	55615466	+	Missense_Mutation	SNP	C	T	T	rs138358769		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55615466C>T	uc010spf.1	+	1	658	c.658C>T	c.(658-660)CGC>TGC	p.R220C		NM_001005280	NP_001005280	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A,	220	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)	4						TTCCTACACCCGCATTATCAT	0.458													27	60	---	---	---	---	PASS
PAN2	9924	broad.mit.edu	37	12	56711394	56711394	+	Nonstop_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56711394C>A	uc001skx.2	-	26	3981	c.3608G>T	c.(3607-3609)TGA>TTA	p.*1203L	CNPY2_uc001sku.1_5'Flank|CNPY2_uc001skv.2_5'Flank|PAN2_uc001skw.2_Nonstop_Mutation_p.*351L|PAN2_uc001skz.2_Nonstop_Mutation_p.*1202L|PAN2_uc001sky.2_Nonstop_Mutation_p.*1199L	NM_001127460	NP_001120932	Q504Q3	PAN2_HUMAN	PAN2 polyA specific ribonuclease subunit homolog	1203					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|ubiquitin-dependent protein catabolic process	cytosol|nucleus	nucleic acid binding|poly(A)-specific ribonuclease activity|ubiquitin thiolesterase activity			ovary(2)|skin(2)|large_intestine(1)|breast(1)	6						GAAGGGTAGTCAGAGCGCCAG	0.488													15	12	---	---	---	---	PASS
PRIM1	5557	broad.mit.edu	37	12	57144981	57144981	+	Splice_Site	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57144981T>A	uc001smd.2	-	2	168	c.104_splice	c.e2-1	p.V35_splice	PRIM1_uc001sme.1_Splice_Site|PRIM1_uc009zoz.1_Splice_Site|PRIM1_uc001smf.2_Splice_Site_p.V35_splice	NM_000946	NP_000937	P49642	PRI1_HUMAN	DNA primase polypeptide 1						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	DNA primase activity|metal ion binding				0						TCTTTATCACTGCAAAATAAA	0.318													3	5	---	---	---	---	PASS
IRAK3	11213	broad.mit.edu	37	12	66638391	66638391	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66638391T>A	uc001sth.2	+	9	1115	c.1013T>A	c.(1012-1014)CTG>CAG	p.L338Q	IRAK3_uc010ssy.1_Missense_Mutation_p.L277Q	NM_007199	NP_009130	Q9Y616	IRAK3_HUMAN	interleukin-1 receptor-associated kinase 3	338	Protein kinase.				interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8				GBM - Glioblastoma multiforme(28;0.0203)		AGTAAACATCTGTGGTACATG	0.428													9	141	---	---	---	---	PASS
BEST3	144453	broad.mit.edu	37	12	70048959	70048959	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70048959C>T	uc001svg.2	-	10	1962	c.1735G>A	c.(1735-1737)GAA>AAA	p.E579K	BEST3_uc001svd.1_Intron|BEST3_uc001sve.1_Intron|BEST3_uc001svf.2_Missense_Mutation_p.E366K|BEST3_uc010stm.1_Missense_Mutation_p.E473K	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	vitelliform macular dystrophy 2-like 3 isoform	579	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			GGGTCTTCTTCACAGTTGAAT	0.537													54	30	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70934690	70934690	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70934690T>C	uc001swb.3	-	21	4918	c.4888A>G	c.(4888-4890)ATT>GTT	p.I1630V	PTPRB_uc010sto.1_Missense_Mutation_p.I1540V|PTPRB_uc010stp.1_Missense_Mutation_p.I1540V|PTPRB_uc001swc.3_Missense_Mutation_p.I1848V|PTPRB_uc001swa.3_Missense_Mutation_p.I1760V	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1630	Helical; (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			AGCATGCCAATTAAAAACAGA	0.413													3	15	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101336160	101336160	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101336160G>A	uc010svm.1	+	5	875	c.303G>A	c.(301-303)GTG>GTA	p.V101V	ANO4_uc010svl.1_RNA|ANO4_uc001thw.2_Silent_p.V66V|ANO4_uc001thx.2_Silent_p.V101V	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	101	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						TGCAGACAGTGCCAGAAAGAA	0.353										HNSCC(74;0.22)			77	59	---	---	---	---	PASS
MYBPC1	4604	broad.mit.edu	37	12	102064101	102064101	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102064101C>G	uc001tii.2	+	23	2608	c.2506C>G	c.(2506-2508)CCT>GCT	p.P836A	MYBPC1_uc001tig.2_Missense_Mutation_p.P843A|MYBPC1_uc010svq.1_Missense_Mutation_p.P805A|MYBPC1_uc001tih.2_Missense_Mutation_p.P843A|MYBPC1_uc001tij.2_Missense_Mutation_p.P818A|MYBPC1_uc010svr.1_Missense_Mutation_p.P818A|MYBPC1_uc010svs.1_Missense_Mutation_p.P836A|MYBPC1_uc010svt.1_Missense_Mutation_p.P806A|MYBPC1_uc010svu.1_Missense_Mutation_p.P799A|MYBPC1_uc001tik.2_Missense_Mutation_p.P792A|MYBPC1_uc001til.2_5'UTR|MYBPC1_uc001tim.2_5'UTR	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3	836					cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						TCTCTCAGAACCTCCAAAGAT	0.438													43	181	---	---	---	---	PASS
CCDC63	160762	broad.mit.edu	37	12	111342414	111342414	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111342414C>A	uc001trv.1	+	11	1560	c.1365C>A	c.(1363-1365)AAC>AAA	p.N455K	CCDC63_uc010sye.1_Missense_Mutation_p.N415K|CCDC63_uc001trw.1_Missense_Mutation_p.N370K	NM_152591	NP_689804	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	455										skin(6)|ovary(1)|pancreas(1)	8						AGAAGACCAACGACCTGCTGC	0.597													27	91	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112622092	112622092	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112622092C>T	uc009zwc.2	-	54	9430	c.9412G>A	c.(9412-9414)GAG>AAG	p.E3138K		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						GAGGCCGTCTCTGCATTGTCC	0.552													23	67	---	---	---	---	PASS
TBX3	6926	broad.mit.edu	37	12	115117299	115117299	+	Intron	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115117299C>A	uc001tvt.1	-						TBX3_uc001tvu.1_Intron	NM_016569	NP_057653	O15119	TBX3_HUMAN	T-box 3 protein isoform 2						anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	sequence-specific DNA binding			ovary(2)|skin(1)	3	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		AGGAAAGCCCCTTGAGTTTAC	0.408													80	71	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124397757	124397757	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124397757C>A	uc001uft.3	+	59	9918	c.9893C>A	c.(9892-9894)GCC>GAC	p.A3298D		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3298	Potential.|Stalk (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AAATATGAGGCCGCCATACTG	0.502													14	4	---	---	---	---	PASS
SCARB1	949	broad.mit.edu	37	12	125294743	125294743	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125294743C>T	uc001ugo.3	-	6	1072	c.819G>A	c.(817-819)GAG>GAA	p.E273E	SCARB1_uc001ugn.3_Silent_p.E273E|SCARB1_uc001ugm.3_Silent_p.E273E|SCARB1_uc010tbd.1_Silent_p.E273E|SCARB1_uc010tbe.1_Silent_p.E232E|SCARB1_uc001ugp.3_Silent_p.E273E	NM_005505	NP_005496	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 1	273	Extracellular (Potential).				adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	GGCTGTAGAACTCCAGCGAGG	0.572													6	36	---	---	---	---	PASS
UBC	7316	broad.mit.edu	37	12	125397880	125397880	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125397880C>A	uc001ugs.3	-	2	886	c.438G>T	c.(436-438)GTG>GTT	p.V146V	UBC_uc001ugr.2_5'Flank|UBC_uc001ugu.1_Silent_p.V146V|UBC_uc001ugt.2_Silent_p.V146V|UBC_uc001ugv.2_Intron|UBC_uc001ugw.2_5'UTR	NM_021009	NP_066289	P0CG48	UBC_HUMAN	ubiquitin C	146	Ubiquitin-like 2.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		TGAGACGGAGCACCAGGTGCA	0.557													189	140	---	---	---	---	PASS
C13orf30	144809	broad.mit.edu	37	13	43358264	43358264	+	Nonsense_Mutation	SNP	C	T	T	rs1853636		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43358264C>T	uc010tfk.1	+	2	184	c.61C>T	c.(61-63)CGA>TGA	p.R21*	C13orf30_uc010tfl.1_Nonsense_Mutation_p.R21*	NM_182508	NP_872314	Q8N7L0	CM030_HUMAN	hypothetical protein LOC144809	21											0		Lung NSC(96;0.000369)|Prostate(109;0.0305)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.000512)|OV - Ovarian serous cystadenocarcinoma(117;0.000563)|BRCA - Breast invasive adenocarcinoma(63;0.0677)		TCCTTTTATTCGAGTTCCTCC	0.373													30	47	---	---	---	---	PASS
SLITRK1	114798	broad.mit.edu	37	13	84455097	84455097	+	Silent	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84455097G>C	uc001vlk.2	-	1	1432	c.546C>G	c.(544-546)CTC>CTG	p.L182L		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	182	Extracellular (Potential).|LRR 6.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CCCGGAGGTCGAGGTGGGTGA	0.527													71	26	---	---	---	---	PASS
RNASE3	6037	broad.mit.edu	37	14	21360008	21360008	+	Silent	SNP	C	A	A	rs115812876	by1000genomes	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21360008C>A	uc001vyj.2	+	2	217	c.163C>A	c.(163-165)CGG>AGG	p.R55R		NM_002935	NP_002926	P12724	ECP_HUMAN	ribonuclease, RNase A family, 3 (eosinophil	55					defense response to bacterium|RNA catabolic process	extracellular region|soluble fraction	nucleic acid binding|pancreatic ribonuclease activity				0	all_cancers(95;0.00453)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	Pranlukast(DB01411)	CATTGCAATGCGGGCAATTAA	0.463													97	110	---	---	---	---	PASS
HAUS4	54930	broad.mit.edu	37	14	23420834	23420834	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23420834T>C	uc001whp.2	-	4	426	c.395A>G	c.(394-396)CAG>CGG	p.Q132R	HAUS4_uc001who.2_Intron|HAUS4_uc001whq.2_Intron|HAUS4_uc001whr.2_Missense_Mutation_p.Q132R|HAUS4_uc001whs.2_Intron|HAUS4_uc001wht.2_Missense_Mutation_p.Q132R|HAUS4_uc001whu.2_Intron|HAUS4_uc001whv.2_Missense_Mutation_p.Q8R|HAUS4_uc001whw.2_Missense_Mutation_p.Q132R|HAUS4_uc001whx.2_Intron	NM_017815	NP_060285	Q9H6D7	HAUS4_HUMAN	HAUS augmin-like complex, subunit 4	132					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle				ovary(1)	1						CTCCCTCTCCTGGCTAGGACC	0.498													43	45	---	---	---	---	PASS
ACIN1	22985	broad.mit.edu	37	14	23549970	23549970	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23549970C>A	uc001wit.3	-	6	1076	c.748G>T	c.(748-750)GAG>TAG	p.E250*	ACIN1_uc001wis.3_5'UTR|ACIN1_uc010akg.2_Nonsense_Mutation_p.E250*|ACIN1_uc010tnj.1_Nonsense_Mutation_p.E210*	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	250	Glu-rich.				apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TCTTGATCCTCTTCCTCCTCA	0.363													253	396	---	---	---	---	PASS
PABPN1	8106	broad.mit.edu	37	14	23777252	23777252	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23777252C>T	uc001wjh.3	+	3	464	c.276C>T	c.(274-276)AAC>AAT	p.N92N	BCL2L2_uc001wjg.3_Silent_p.N92N|BCL2L2_uc001wji.3_Silent_p.N92N	NM_004643	NP_004634	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1	Error:Variant_position_missing_in_Q86U42_after_alignment					modification by virus of host mRNA processing|mRNA 3'-end processing|muscle contraction|nuclear mRNA splicing, via spliceosome|poly(A)+ mRNA export from nucleus|termination of RNA polymerase II transcription|viral infectious cycle	cytoplasm|nucleoplasm|ribonucleoprotein complex	nucleotide binding|protein binding|RNA binding			ovary(2)	2	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)		GGGGCCCCAACTGGGGCCGCC	0.577													60	110	---	---	---	---	PASS
FBXO33	254170	broad.mit.edu	37	14	39900916	39900916	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39900916C>G	uc001wvk.2	-	1	789	c.451G>C	c.(451-453)GGC>CGC	p.G151R		NM_203301	NP_976046	Q7Z6M2	FBX33_HUMAN	F-box protein 33	151											0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)		GGGCCACCGCCGCTCAGATAG	0.672													27	41	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47351380	47351380	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47351380C>T	uc001wwj.3	-	11	2272	c.2076G>A	c.(2074-2076)GGG>GGA	p.G692G	MDGA2_uc001wwh.3_5'UTR|MDGA2_uc001wwi.3_Silent_p.G463G|MDGA2_uc010ani.2_Silent_p.G252G	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	692					spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						TTTGAATATTCCCATTTATTT	0.378													24	54	---	---	---	---	PASS
GPR137C	283554	broad.mit.edu	37	14	53066881	53066881	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53066881T>C	uc001wzu.3	+	3	539	c.539T>C	c.(538-540)GTG>GCG	p.V180A	GPR137C_uc001wzt.3_Missense_Mutation_p.V180A	NM_001099652	NP_001093122	Q8N3F9	G137C_HUMAN	G protein-coupled receptor 137C	180	Helical; (Potential).					integral to membrane					0	Breast(41;0.0716)					TTTTTAGTGGTGAACTTGACT	0.343													102	132	---	---	---	---	PASS
LTBP2	4053	broad.mit.edu	37	14	75052758	75052758	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75052758C>A	uc001xqa.2	-	3	1016	c.629G>T	c.(628-630)CGC>CTC	p.R210L		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	210	EGF-like 1.				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GAAACCAGAGCGGCAGACACA	0.657													7	5	---	---	---	---	PASS
ATXN3	4287	broad.mit.edu	37	14	92555162	92555162	+	Splice_Site	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92555162C>T	uc001yac.3	-	6	457	c.388_splice	c.e6-1	p.W130_splice	ATXN3_uc010aug.2_Splice_Site_p.W115_splice|ATXN3_uc001yad.3_Splice_Site_p.W75_splice|ATXN3_uc010auh.2_Splice_Site_p.W64_splice|ATXN3_uc001yae.3_Splice_Site_p.W32_splice|ATXN3_uc010twl.1_Splice_Site	NM_004993	NP_004984	P54252	ATX3_HUMAN	ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		AGTTAAACCACTGGAAAAAAA	0.323													143	232	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106208309	106208309	+	RNA	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106208309C>T	uc010tyt.1	-	3627		c.58905G>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Silent_p.L63L|uc001ysf.2_Silent_p.L63L					Parts of antibodies, mostly variable regions.												0						CCTTGCCATTCAGCCAGTCCT	0.592													224	308	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20649469	20649469	+	Intron	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20649469G>T	uc001ytg.2	-						uc010tyx.1_Intron|uc001yth.3_Intron|uc010tyy.1_Intron					RecName: Full=Putative HERC2-like protein 3;																		ACACCTTCCTGAGTCACCCAC	0.567													32	124	---	---	---	---	PASS
NDN	4692	broad.mit.edu	37	15	23931814	23931814	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23931814C>T	uc001ywk.2	-	1	637	c.551G>A	c.(550-552)CGC>CAC	p.R184H		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	184	MAGE.				negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		CATGGGCATGCGGTTGCTCAG	0.642									Prader-Willi_syndrome				27	40	---	---	---	---	PASS
PAR4	347745	broad.mit.edu	37	15	25451488	25451488	+	Intron	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25451488C>T	uc001yzk.1	+						PAR4_uc010ayo.1_Intron|SNORD115-20_uc001yzq.1_RNA					Homo sapiens clone Rt-13I SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						TATGCTGAGGCCCAGTCTAGG	0.478													137	166	---	---	---	---	PASS
ARHGAP11A	9824	broad.mit.edu	37	15	32929724	32929724	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32929724C>T	uc001zgy.1	+	12	3472	c.2750C>T	c.(2749-2751)TCA>TTA	p.S917L	ARHGAP11A_uc010ubw.1_Missense_Mutation_p.S728L|ARHGAP11A_uc010ubx.1_Missense_Mutation_p.S728L	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A isoform 1	917					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			skin(3)|breast(2)|urinary_tract(1)	6		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		GGTGCAATTTCAAAGTCAAGC	0.373													80	108	---	---	---	---	PASS
C15orf55	256646	broad.mit.edu	37	15	34649516	34649516	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34649516C>A	uc001zif.2	+	7	3378	c.3223C>A	c.(3223-3225)CGA>AGA	p.R1075R	C15orf55_uc010ucc.1_Silent_p.R1103R|C15orf55_uc010ucd.1_Silent_p.R1093R	NM_175741	NP_786883	Q86Y26	NUT_HUMAN	nuclear protein in testis	1075						cytoplasm|nucleus			BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	midline_organs(25)|ovary(2)|lung(2)|skin(1)	30		all_lung(180;2.78e-08)		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)		GTCTGGGAAGCGAGCTCTAGC	0.592			T	BRD3|BRD4	lethal midline carcinoma								22	61	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54825268	54825268	+	Intron	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54825268A>T	uc002ack.2	+							NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ACAAAACGTAAGTTTTTTTGC	0.338													6	10	---	---	---	---	PASS
BNIP2	663	broad.mit.edu	37	15	59971939	59971939	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59971939C>T	uc010uhc.1	-	4	513	c.510G>A	c.(508-510)GTG>GTA	p.V170V	BNIP2_uc010uhb.1_Silent_p.V111V	NM_004330	NP_004321	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 2	49					anti-apoptosis|apoptosis|positive regulation of muscle cell differentiation	nuclear envelope|perinuclear region of cytoplasm	calcium ion binding|GTPase activator activity|protein binding			ovary(1)	1						GTTTCTTTCTCACTTTATTTC	0.363													9	26	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	62944323	62944323	+	Silent	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62944323T>C	uc002alb.3	+	3	354	c.354T>C	c.(352-354)TGT>TGC	p.C118C		NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	118	FERM.				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						TCACTATTTGTAGCAGAATAG	0.428													71	90	---	---	---	---	PASS
KIAA1024	23251	broad.mit.edu	37	15	79749790	79749790	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79749790G>T	uc002bew.1	+	2	1376	c.1301G>T	c.(1300-1302)GGG>GTG	p.G434V	KIAA1024_uc010unk.1_Missense_Mutation_p.G434V	NM_015206	NP_056021	Q9UPX6	K1024_HUMAN	hypothetical protein LOC23251	434						integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4						AAACAAAATGGGCTCAAATCT	0.483													54	56	---	---	---	---	PASS
IL16	3603	broad.mit.edu	37	15	81585347	81585347	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81585347C>A	uc002bgh.3	+	12	2247	c.1871C>A	c.(1870-1872)TCT>TAT	p.S624Y	IL16_uc002bgc.2_RNA|IL16_uc010blq.1_Intron|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Missense_Mutation_p.S666Y|IL16_uc002bgg.2_Missense_Mutation_p.S624Y|IL16_uc002bgi.1_5'UTR|IL16_uc002bgj.2_Missense_Mutation_p.S118Y|IL16_uc002bgk.2_5'Flank	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2	624					immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						TCCTCATGCTCTTCTGGGCAC	0.512													40	48	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89398124	89398124	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89398124G>A	uc010upo.1	+	12	2682	c.2308G>A	c.(2308-2310)GAA>AAA	p.E770K	ACAN_uc010upp.1_Missense_Mutation_p.E770K|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	770					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGCAACAGAGGAAAGTACAGA	0.537													9	17	---	---	---	---	PASS
HAGHL	84264	broad.mit.edu	37	16	779062	779062	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:779062C>A	uc002cjl.1	+	7	1048	c.767C>A	c.(766-768)GCC>GAC	p.A256D	CCDC78_uc002cji.3_5'Flank|CCDC78_uc002cjg.2_5'Flank|CCDC78_uc002cjj.3_5'Flank|CCDC78_uc002cjh.2_5'Flank|CCDC78_uc010uuo.1_5'Flank|CCDC78_uc002cjk.2_5'Flank|HAGHL_uc002cjm.1_3'UTR|HAGHL_uc002cjn.1_3'UTR|HAGHL_uc002cjo.1_Silent_p.R218R|HAGHL_uc010uup.1_Silent_p.R218R	NM_207112	NP_996995	Q6PII5	HAGHL_HUMAN	hydroxyacylglutathione hydrolase-like isoform 1	256							hydrolase activity|metal ion binding				0		Hepatocellular(780;0.00335)				GCGAGGAGCGCCTCTACAACC	0.627													13	19	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2167522	2167522	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2167522G>A	uc002cos.1	-	6	1562	c.1353C>T	c.(1351-1353)GCC>GCT	p.A451A	PKD1_uc002cot.1_Silent_p.A451A	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	451	C-type lectin.|Extracellular (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						AGCGCTGCACGGCGGGACTGT	0.706													7	6	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2812332	2812332	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2812332G>T	uc002crk.2	+	11	2352	c.1803G>T	c.(1801-1803)AGG>AGT	p.R601S	SRRM2_uc002crj.1_Missense_Mutation_p.R505S|SRRM2_uc002crl.1_Missense_Mutation_p.R601S|SRRM2_uc010bsu.1_Missense_Mutation_p.R505S	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	601	Arg-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CTCCCACCAGGCGTAGGTCTC	0.617													36	66	---	---	---	---	PASS
BTBD12	84464	broad.mit.edu	37	16	3656624	3656624	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3656624C>T	uc002cvp.2	-	3	1238	c.611G>A	c.(610-612)CGC>CAC	p.R204H	BTBD12_uc002cvq.1_Missense_Mutation_p.R204H	NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	204	Interaction with C20orf94, ERCC4 and MSH2.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						TTGTGCTGTGCGGGGTTTGGA	0.557								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				185	184	---	---	---	---	PASS
UQCRC2	7385	broad.mit.edu	37	16	21983385	21983385	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21983385G>A	uc002djx.2	+	10	1044	c.908G>A	c.(907-909)AGC>AAC	p.S303N	UQCRC2_uc002djy.2_Missense_Mutation_p.S303N|UQCRC2_uc010bxa.2_RNA|UQCRC2_uc002djz.1_Missense_Mutation_p.S170N	NM_003366	NP_003357	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	303					aerobic respiration|oxidative phosphorylation|proteolysis|respiratory electron transport chain|transport		metalloendopeptidase activity|zinc ion binding			large_intestine(2)	2				GBM - Glioblastoma multiforme(48;0.0264)		AAGAGGGGCAGCAACACCACC	0.512													22	37	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27772789	27772789	+	Silent	SNP	T	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27772789T>G	uc002dow.2	+	19	3711	c.3687T>G	c.(3685-3687)ACT>ACG	p.T1229T		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	1229										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						TGGGGCTCACTGGCCTGGAAG	0.592													52	65	---	---	---	---	PASS
APOB48R	55911	broad.mit.edu	37	16	28507309	28507309	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28507309G>C	uc002dqb.1	+	2	957	c.947G>C	c.(946-948)GGG>GCG	p.G316A	uc010vct.1_Intron|APOB48R_uc010byg.1_5'UTR	NM_018690	NP_061160	Q0VD83	APOBR_HUMAN	apolipoprotein B48 receptor	316	Glu-rich.				cholesterol metabolic process|lipid transport	chylomicron|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle					0						GCCTCAGGCGGGGAGGAGGCT	0.672													7	17	---	---	---	---	PASS
ZNF785	146540	broad.mit.edu	37	16	30594536	30594536	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30594536G>T	uc002dyw.1	-	3	641	c.563C>A	c.(562-564)GCC>GAC	p.A188D	uc002dyu.2_RNA|ZNF785_uc002dyv.1_Missense_Mutation_p.A173D|ZNF785_uc010vez.1_Missense_Mutation_p.A153D	NM_152458	NP_689671	A8K8V0	ZN785_HUMAN	zinc finger protein 785	188	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CTGGTGGCTGGCCAGGAGGGA	0.642													4	38	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49670765	49670765	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49670765C>G	uc002efs.2	-	5	2596	c.2298G>C	c.(2296-2298)CAG>CAC	p.Q766H	ZNF423_uc010vgn.1_Missense_Mutation_p.Q649H	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	766	C2H2-type 18.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				TGACGTGCACCTGCAGGTCAG	0.602													39	49	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49672375	49672375	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49672375C>A	uc002efs.2	-	5	986	c.688G>T	c.(688-690)GGC>TGC	p.G230C	ZNF423_uc010vgn.1_Missense_Mutation_p.G113C	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	230	C2H2-type 5.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				GAGGAGAAGCCGCGCTTGCAC	0.592													49	75	---	---	---	---	PASS
NOD2	64127	broad.mit.edu	37	16	50733863	50733863	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50733863A>T	uc002egm.1	+	2	643	c.538A>T	c.(538-540)AGG>TGG	p.R180W	NOD2_uc010cbj.1_Missense_Mutation_p.R153W|NOD2_uc010cbk.1_Missense_Mutation_p.R153W|NOD2_uc002egl.1_5'UTR	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	180	CARD 2.				activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				ACCGTCCCAGAGGGTGAGGCA	0.532													30	28	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51172604	51172604	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51172604G>A	uc010vgs.1	-	2	3560	c.3529C>T	c.(3529-3531)CTT>TTT	p.L1177F	SALL1_uc010vgr.1_Missense_Mutation_p.L1080F|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	1177	C2H2-type 9.				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GGTACCTTAAGATTGCCTTTA	0.493													30	57	---	---	---	---	PASS
CHD9	80205	broad.mit.edu	37	16	53302009	53302009	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53302009G>T	uc002ehb.2	+	21	4852	c.4688G>T	c.(4687-4689)GGA>GTA	p.G1563V	CHD9_uc002egy.2_Missense_Mutation_p.G1563V|CHD9_uc002ehc.2_Missense_Mutation_p.G1563V|CHD9_uc002ehf.2_Missense_Mutation_p.G677V|CHD9_uc010cbw.2_5'UTR|CHD9_uc002ehd.2_Missense_Mutation_p.G1089V	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1563					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				ACTGAAGATGGACAGACACGA	0.338													16	15	---	---	---	---	PASS
RPGRIP1L	23322	broad.mit.edu	37	16	53720458	53720458	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53720458C>G	uc002ehp.2	-	6	727	c.663G>C	c.(661-663)CAG>CAC	p.Q221H	RPGRIP1L_uc002eho.3_Missense_Mutation_p.Q221H|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.Q221H|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.Q221H|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.Q221H|RPGRIP1L_uc002ehq.1_Missense_Mutation_p.Q221H	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	221	Potential.				negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)				ACTCCTCTATCTGGCCTCTTT	0.373													85	108	---	---	---	---	PASS
CNOT1	23019	broad.mit.edu	37	16	58583753	58583753	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58583753G>A	uc002env.2	-	25	3685	c.3392C>T	c.(3391-3393)TCA>TTA	p.S1131L	CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Missense_Mutation_p.S1126L|CNOT1_uc002enx.2_Missense_Mutation_p.S1131L|CNOT1_uc002enz.1_Missense_Mutation_p.S560L|CNOT1_uc010vik.1_Missense_Mutation_p.S127L|SNORA46_uc002eny.1_5'Flank	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1131					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CAGATACTGTGAAACCCAAGG	0.388													122	159	---	---	---	---	PASS
PLEKHG4	25894	broad.mit.edu	37	16	67314219	67314219	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67314219C>G	uc002eso.3	+	1	2807	c.272C>G	c.(271-273)TCA>TGA	p.S91*	PLEKHG4_uc002esp.3_5'UTR|PLEKHG4_uc002esq.3_Nonsense_Mutation_p.S91*|PLEKHG4_uc002esr.1_Intron|PLEKHG4_uc010cef.2_Nonsense_Mutation_p.S91*|PLEKHG4_uc002ess.3_Nonsense_Mutation_p.S91*|PLEKHG4_uc010ceg.2_Nonsense_Mutation_p.S91*	NM_015432	NP_056247	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G	91					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)|pancreas(1)	2				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		GAAAGCTCCTCAGTCCTGTCA	0.612													42	53	---	---	---	---	PASS
ZFP90	146198	broad.mit.edu	37	16	68592426	68592426	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68592426G>C	uc010cff.2	+	4	503	c.211G>C	c.(211-213)GAG>CAG	p.E71Q	ZFP90_uc002ewb.2_5'UTR|ZFP90_uc002ewc.2_5'UTR|ZFP90_uc002ewd.2_Missense_Mutation_p.E71Q|ZFP90_uc002ewe.2_Missense_Mutation_p.E71Q	NM_133458	NP_597715	Q8TF47	ZFP90_HUMAN	zinc finger protein 90	71	KRAB.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		GCAAGGAGAAGAGCCATGGAT	0.423													25	50	---	---	---	---	PASS
MBTPS1	8720	broad.mit.edu	37	16	84103622	84103622	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84103622T>G	uc002fhi.2	-	14	2306	c.1804A>C	c.(1804-1806)ACT>CCT	p.T602P	MBTPS1_uc002fhh.2_Missense_Mutation_p.T106P	NM_003791	NP_003782	Q14703	MBTP1_HUMAN	membrane-bound transcription factor site-1	602	Lumenal (Potential).				cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2						ACTGTTGAAGTCTGTTCTGCA	0.408													132	206	---	---	---	---	PASS
KIAA0513	9764	broad.mit.edu	37	16	85100945	85100945	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85100945G>T	uc002fiu.2	+	2	488	c.268G>T	c.(268-270)GAA>TAA	p.E90*	KIAA0513_uc002fis.3_Nonsense_Mutation_p.E90*|KIAA0513_uc010voj.1_Nonsense_Mutation_p.E90*|KIAA0513_uc002fit.2_Nonsense_Mutation_p.E90*	NM_014732	NP_055547	O60268	K0513_HUMAN	hypothetical protein LOC9764	90						cytoplasm				breast(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.234)		TACCCAGGATGAAGAGACCCT	0.617													28	56	---	---	---	---	PASS
CDK10	8558	broad.mit.edu	37	16	89761139	89761139	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89761139C>A	uc010cio.2	+	10	778	c.735C>A	c.(733-735)ATC>ATA	p.I245I	CDK10_uc002fob.2_3'UTR|CDK10_uc002fod.2_Silent_p.I174I|CDK10_uc002foe.2_Silent_p.I174I|CDK10_uc002fof.2_Silent_p.I174I|CDK10_uc002fog.3_Silent_p.I174I|CDK10_uc002foh.3_Silent_p.I174I|CDK10_uc002foi.2_5'Flank	NM_052988	NP_443714	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10 isoform a	245	Protein kinase.				negative regulation of cell proliferation|traversing start control point of mitotic cell cycle		ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		CTTCCGAGATCCACCAGATCG	0.592													3	9	---	---	---	---	PASS
FANCA	2175	broad.mit.edu	37	16	89836993	89836993	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89836993G>A	uc002fou.1	-	24	2243	c.2201C>T	c.(2200-2202)TCC>TTC	p.S734F	FANCA_uc010vpn.1_Missense_Mutation_p.S734F	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform	734					DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		AGCGACACTGGAGGCAGCCAT	0.642			D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				10	14	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578394	7578394	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578394T>C	uc002gim.2	-	5	730	c.536A>G	c.(535-537)CAT>CGT	p.H179R	TP53_uc002gig.1_Missense_Mutation_p.H179R|TP53_uc002gih.2_Missense_Mutation_p.H179R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H47R|TP53_uc010cng.1_Missense_Mutation_p.H47R|TP53_uc002gii.1_Missense_Mutation_p.H47R|TP53_uc010cnh.1_Missense_Mutation_p.H179R|TP53_uc010cni.1_Missense_Mutation_p.H179R|TP53_uc002gij.2_Missense_Mutation_p.H179R|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.H86R|TP53_uc002gio.2_Missense_Mutation_p.H47R|TP53_uc010vug.1_Missense_Mutation_p.H140R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	179	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).	Zinc.	H -> Q (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> D (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H179R(99)|p.H179Y(74)|p.H179L(31)|p.H179Q(17)|p.H179N(13)|p.H179D(10)|p.P177_C182delPHHERC(8)|p.0?(7)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H179P(3)|p.R175_E180delRCPHHE(3)|p.H179fs*68(2)|p.H179H(2)|p.P177fs*3(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.K164_P219del(1)|p.C176fs*65(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.H179del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.E171fs*1(1)|p.R174fs*3(1)|p.H178_H179>QY(1)|p.E171fs*61(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCAGCGCTCATGGTGGGGGCA	0.642		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			34	9	---	---	---	---	PASS
ARHGEF15	22899	broad.mit.edu	37	17	8215492	8215492	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8215492A>T	uc002glc.2	+	2	256	c.135A>T	c.(133-135)GAA>GAT	p.E45D	ARHGEF15_uc002glb.1_Missense_Mutation_p.E45D|ARHGEF15_uc002gld.2_Missense_Mutation_p.E45D|ARHGEF15_uc010vuw.1_Missense_Mutation_p.E45D	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	45	Pro-rich.				negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						CTCCACAAGAACTACCCCGAA	0.642													69	11	---	---	---	---	PASS
TOP3A	7156	broad.mit.edu	37	17	18212202	18212202	+	Nonsense_Mutation	SNP	A	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18212202A>C	uc002gsx.1	-	2	463	c.234T>G	c.(232-234)TAT>TAG	p.Y78*	TOP3A_uc002gsw.1_5'Flank|TOP3A_uc010vxs.1_Missense_Mutation_p.M1R|TOP3A_uc010cqa.1_Intron	NM_004618	NP_004609	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	78	Toprim.				DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(3)	3						CTACCTGGCCATACAGATGAT	0.279													14	17	---	---	---	---	PASS
SSH2	85464	broad.mit.edu	37	17	27959607	27959607	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27959607C>T	uc002heo.1	-	15	2524	c.2524G>A	c.(2524-2526)GAA>AAA	p.E842K	SSH2_uc010wbh.1_Missense_Mutation_p.E869K	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	842					actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						TCAGCTGGTTCCCCTTCTTCC	0.577													215	49	---	---	---	---	PASS
AP2B1	163	broad.mit.edu	37	17	33951435	33951435	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33951435C>T	uc002hjr.2	+	6	734	c.545C>T	c.(544-546)GCG>GTG	p.A182V	AP2B1_uc002hjq.2_Missense_Mutation_p.A182V|AP2B1_uc010wci.1_Missense_Mutation_p.A144V|AP2B1_uc002hjs.2_Missense_Mutation_p.A125V|AP2B1_uc002hjt.2_Missense_Mutation_p.A182V|AP2B1_uc010ctv.2_Missense_Mutation_p.A182V|AP2B1_uc010wcj.1_5'UTR	NM_001282	NP_001273	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1	182					axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|coated pit|cytosol|endocytic vesicle membrane|plasma membrane	clathrin binding|protein transporter activity			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		AATGCCGTAGCGGCATTATCT	0.463													113	122	---	---	---	---	PASS
RPL19	6143	broad.mit.edu	37	17	37357551	37357551	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37357551G>A	uc002hrq.1	+	2	153	c.91G>A	c.(91-93)GAA>AAA	p.E31K	RPL19_uc002hrr.1_Missense_Mutation_p.E29K	NM_000981	NP_000972	P84098	RL19_HUMAN	ribosomal protein L19	31					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	RNA binding|structural constituent of ribosome				0						TGAGACCAATGAAATCGCCAA	0.483													36	222	---	---	---	---	PASS
CDK12	51755	broad.mit.edu	37	17	37627540	37627540	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37627540G>A	uc010cvv.2	+	2	2041	c.1455G>A	c.(1453-1455)GAG>GAA	p.E485E	CDK12_uc010wef.1_Silent_p.E484E|CDK12_uc002hrw.3_Silent_p.E485E	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	485					mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						AGTTGGATGAGAACTCCGAGA	0.393										TCGA Ovarian(9;0.13)			309	221	---	---	---	---	PASS
MED24	9862	broad.mit.edu	37	17	38189317	38189317	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38189317G>A	uc002htt.2	-	8	1127	c.814C>T	c.(814-816)CGC>TGC	p.R272C	MED24_uc010wes.1_Missense_Mutation_p.R132C|MED24_uc010wet.1_Intron|MED24_uc002hts.2_Missense_Mutation_p.R297C|MED24_uc002htu.2_Missense_Mutation_p.R259C|MED24_uc010cwn.2_Missense_Mutation_p.R259C|MED24_uc010weu.1_Missense_Mutation_p.R182C|MED24_uc010wev.1_Missense_Mutation_p.R222C|MED24_uc010wew.1_Missense_Mutation_p.R201C|MED24_uc010wex.1_Intron|MED24_uc010wez.1_Missense_Mutation_p.R113C|MED24_uc010wfa.1_Missense_Mutation_p.R241C|MED24_uc010wfb.1_Missense_Mutation_p.R284C	NM_014815	NP_055630	O75448	MED24_HUMAN	mediator complex subunit 24 isoform 1	272					androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1	Colorectal(19;0.000442)					ACCTGCATGCGCTTCACCATC	0.642													13	143	---	---	---	---	PASS
KRT33A	3883	broad.mit.edu	37	17	39503477	39503477	+	Intron	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39503477G>A	uc002hwk.1	-							NM_004138	NP_004129	O76009	KT33A_HUMAN	keratin 33A							intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)				TTAACCTCCTGATGGAGAAAG	0.478													22	86	---	---	---	---	PASS
KRT33A	3883	broad.mit.edu	37	17	39504896	39504896	+	Intron	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39504896G>A	uc002hwk.1	-							NM_004138	NP_004129	O76009	KT33A_HUMAN	keratin 33A							intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)				TCATATCTGTGATCACAGGAG	0.552													23	98	---	---	---	---	PASS
ATP6V0A1	535	broad.mit.edu	37	17	40630546	40630546	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40630546G>T	uc002hzr.2	+	7	739	c.572G>T	c.(571-573)TGC>TTC	p.C191F	ATP6V0A1_uc002hzq.2_Missense_Mutation_p.C191F|ATP6V0A1_uc002hzs.2_Missense_Mutation_p.C198F|ATP6V0A1_uc010wgj.1_Missense_Mutation_p.C148F|ATP6V0A1_uc010wgk.1_Missense_Mutation_p.C148F|ATP6V0A1_uc010cyg.2_Intron|ATP6V0A1_uc010wgl.1_Missense_Mutation_p.C50F	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	191	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		TGGCGGGTATGCCGGGGAAAT	0.532													8	69	---	---	---	---	PASS
KIAA1267	284058	broad.mit.edu	37	17	44108963	44108963	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44108963C>A	uc002ikb.2	-	14	3282	c.3197G>T	c.(3196-3198)CGC>CTC	p.R1066L	KIAA1267_uc002ikc.2_Missense_Mutation_p.R1066L|KIAA1267_uc002ikd.2_Missense_Mutation_p.R1066L|KIAA1267_uc010dav.2_Missense_Mutation_p.R1065L|KIAA1267_uc010wkb.1_Missense_Mutation_p.R397L|KIAA1267_uc010wkc.1_Missense_Mutation_p.R334L	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058	1066						MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				GCCTGAGGTGCGTCGAGTGCA	0.687													36	3	---	---	---	---	PASS
MYCBPAP	84073	broad.mit.edu	37	17	48600955	48600955	+	Intron	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48600955C>T	uc010wmr.1	+						MYCBPAP_uc002iqz.2_Intron	NM_032133	NP_115509	Q8TBZ2	MYBPP_HUMAN	Myc-binding protein-associated protein						cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			CTGTCCCTCTCAGGTGTGATT	0.493													91	10	---	---	---	---	PASS
MAP2K6	5608	broad.mit.edu	37	17	67513001	67513001	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67513001C>A	uc002jij.2	+	3	377	c.89C>A	c.(88-90)CCT>CAT	p.P30H	MAP2K6_uc002jii.2_Missense_Mutation_p.P30H|MAP2K6_uc002jik.2_Missense_Mutation_p.P60H	NM_002758	NP_002749	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6	30					activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)					CTTAGACCACCTCGAGATTTA	0.373													95	14	---	---	---	---	PASS
GAA	2548	broad.mit.edu	37	17	78085891	78085891	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78085891C>T	uc002jxo.2	+	13	1928	c.1746C>T	c.(1744-1746)GCC>GCT	p.A582A	GAA_uc002jxp.2_Silent_p.A582A|GAA_uc002jxq.2_Silent_p.A582A	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	acid alpha-glucosidase preproprotein	582					cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)	AAGCCATCGCCTCCCACAGGT	0.652													77	14	---	---	---	---	PASS
ZNF750	79755	broad.mit.edu	37	17	80788546	80788546	+	Silent	SNP	G	A	A	rs138155684	byFrequency	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80788546G>A	uc002kga.2	-	3	1955	c.1644C>T	c.(1642-1644)GAC>GAT	p.D548D	TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kfz.2_Intron	NM_024702	NP_078978	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	548						intracellular	zinc ion binding			central_nervous_system(1)	1	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			TGAGTGGAAGGTCCTGCAGCT	0.607													163	26	---	---	---	---	PASS
LPIN2	9663	broad.mit.edu	37	18	2937714	2937714	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2937714C>A	uc002klo.2	-	7	1383	c.1144G>T	c.(1144-1146)GTA>TTA	p.V382L		NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2	382					fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GGCGAGTCTACTTTAGCTGCC	0.443													55	50	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5428401	5428401	+	Silent	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5428401G>T	uc002kmt.1	-	9	1062	c.976C>A	c.(976-978)CGG>AGG	p.R326R	EPB41L3_uc010wzh.1_Silent_p.R326R|EPB41L3_uc002kmu.1_Silent_p.R326R|EPB41L3_uc010dkq.1_Silent_p.R217R|EPB41L3_uc010dks.1_Silent_p.R348R	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	326	FERM.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						ATTCGCAGCCGGTCGCGATAT	0.418													135	152	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7037633	7037633	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7037633G>T	uc002knm.2	-	12	1775	c.1681C>A	c.(1681-1683)CAG>AAG	p.Q561K	LAMA1_uc010wzj.1_Missense_Mutation_p.Q37K	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	561	Laminin IV type A 1.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCCAGTCTCTGCATGACCGCG	0.577													60	82	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7037634	7037634	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7037634C>T	uc002knm.2	-	12	1774	c.1680G>A	c.(1678-1680)ATG>ATA	p.M560I	LAMA1_uc010wzj.1_Missense_Mutation_p.M36I	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	560	Laminin IV type A 1.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCAGTCTCTGCATGACCGCGG	0.577													59	83	---	---	---	---	PASS
ESCO1	114799	broad.mit.edu	37	18	19154258	19154258	+	Nonsense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19154258T>A	uc002kth.1	-	4	1481	c.547A>T	c.(547-549)AAG>TAG	p.K183*	ESCO1_uc002kti.1_RNA	NM_052911	NP_443143	Q5FWF5	ESCO1_HUMAN	establishment of cohesion 1 homolog 1	183					cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding				0						GAGTCAGACTTTACTTCCAGT	0.348													10	209	---	---	---	---	PASS
CCDC102B	79839	broad.mit.edu	37	18	66513560	66513560	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66513560G>T	uc002lkk.2	+	6	1061	c.838G>T	c.(838-840)GCT>TCT	p.A280S	CCDC102B_uc002lki.2_Missense_Mutation_p.A280S|CCDC102B_uc002lkj.1_Missense_Mutation_p.A280S	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	280	Potential.									ovary(1)|lung(1)|skin(1)	3		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				AATGCGCACAGCTTTGGAAAA	0.328													24	50	---	---	---	---	PASS
ADNP2	22850	broad.mit.edu	37	18	77875529	77875529	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77875529T>G	uc002lnw.2	+	2	559	c.104T>G	c.(103-105)CTG>CGG	p.L35R		NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	35					cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		AAGGAGTTACTGAAGGTAAGA	0.413													30	40	---	---	---	---	PASS
SPPL2B	56928	broad.mit.edu	37	19	2337594	2337594	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2337594C>A	uc002lvs.2	+	3	419	c.339C>A	c.(337-339)CGC>CGA	p.R113R	SPPL2B_uc010dsw.1_Silent_p.R85R|SPPL2B_uc010dsy.1_Silent_p.R85R|SPPL2B_uc010dsz.1_Silent_p.R113R|SPPL2B_uc002lvr.2_Silent_p.R113R|SPPL2B_uc010dta.1_5'Flank|SPPL2B_uc002lvu.2_5'Flank	NM_152988	NP_694533	Q8TCT7	PSL1_HUMAN	signal peptide peptidase-like 2B isoform 2	113	Cytoplasmic (Potential).|PA.					Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGAGCACGCGGGCTGCTCA	0.692													34	23	---	---	---	---	PASS
VAV1	7409	broad.mit.edu	37	19	6833552	6833552	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6833552C>G	uc002mfu.1	+	17	1721	c.1624C>G	c.(1624-1626)CAG>GAG	p.Q542E	VAV1_uc010xjh.1_Missense_Mutation_p.Q510E|VAV1_uc010dva.1_Missense_Mutation_p.Q542E|VAV1_uc002mfv.1_Missense_Mutation_p.Q487E	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	542	Phorbol-ester/DAG-type.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						TACCTTCTATCAGGGCTACCG	0.547													109	76	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9058161	9058161	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9058161A>T	uc002mkp.2	-	3	29489	c.29285T>A	c.(29284-29286)CTC>CAC	p.L9762H		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9764	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CAGGCCTGGGAGGATAAGTGA	0.488													11	39	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9075886	9075886	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9075886C>T	uc002mkp.2	-	3	11764	c.11560G>A	c.(11560-11562)GGG>AGG	p.G3854R		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3855	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GCTGTCTGCCCTTGTCTCTGA	0.483													68	73	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9089841	9089841	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9089841C>A	uc002mkp.2	-	1	2178	c.1974G>T	c.(1972-1974)ACG>ACT	p.T658T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	658	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGCCAGCAGCCGTCTTGCTCA	0.532													97	97	---	---	---	---	PASS
OR7G3	390883	broad.mit.edu	37	19	9236952	9236952	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9236952G>A	uc010xkl.1	-	1	675	c.675C>T	c.(673-675)GTC>GTT	p.V225V		NM_001001958	NP_001001958	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G,	225	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GAATTTTCATGACAGAGGAGA	0.423													40	93	---	---	---	---	PASS
ZNF559	84527	broad.mit.edu	37	19	9453741	9453741	+	Silent	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9453741G>T	uc002mlg.2	+	7	2261	c.1614G>T	c.(1612-1614)GTG>GTT	p.V538V	ZNF559_uc002mlf.2_Silent_p.V307V|ZNF559_uc010dwl.1_Silent_p.V307V|ZNF559_uc010xkn.1_Silent_p.V530V|ZNF559_uc010dwm.1_3'UTR|ZNF559_uc002mle.3_Silent_p.V602V|ZNF559_uc010dwk.1_Silent_p.V307V|ZNF559_uc002mld.2_3'UTR|ZNF559_uc010dwo.1_Intron|ZNF177_uc002mli.2_Intron|ZNF177_uc002mlj.2_Intron	NM_032497	NP_115886	Q9BR84	ZN559_HUMAN	zinc finger protein 559	538					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CTGAATGTGTGTGAATTGGGG	0.393													46	98	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10600417	10600417	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10600417C>A	uc002moq.1	-	4	1594	c.1438G>T	c.(1438-1440)GGG>TGG	p.G480W	KEAP1_uc002mop.1_Missense_Mutation_p.G198W|KEAP1_uc002mor.1_Missense_Mutation_p.G480W	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	480	Kelch 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			CGGTTTGTCCCGTCAAAGCCC	0.582													32	17	---	---	---	---	PASS
RGL3	57139	broad.mit.edu	37	19	11510944	11510944	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11510944G>T	uc002mrp.2	-	14	1578	c.1514C>A	c.(1513-1515)CCA>CAA	p.P505Q	RGL3_uc002mrn.2_Missense_Mutation_p.P269Q|RGL3_uc002mrm.2_Missense_Mutation_p.P269Q|RGL3_uc002mro.2_Missense_Mutation_p.P505Q	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation	505	Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						GGAGGCAGCTGGTGGCTCAAT	0.607													44	42	---	---	---	---	PASS
ZNF44	51710	broad.mit.edu	37	19	12383910	12383910	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12383910T>A	uc010xmj.1	-	5	1509	c.1304A>T	c.(1303-1305)CAC>CTC	p.H435L	ZNF44_uc002mtl.2_Intron|ZNF44_uc010dyr.1_Intron|ZNF44_uc010xmi.1_RNA|ZNF44_uc002mtn.3_RNA|ZNF44_uc010dys.2_Missense_Mutation_p.H387L	NM_001164276	NP_001157748	P15621	ZNF44_HUMAN	zinc finger protein 44 isoform 1	435	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		ATCTCCAGTGTGTGCCATCAT	0.428													58	47	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30934929	30934929	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30934929G>C	uc002nsu.1	+	2	598	c.460G>C	c.(460-462)GGC>CGC	p.G154R	ZNF536_uc010edd.1_Missense_Mutation_p.G154R	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	154					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					CACGCACACGGGCGAGAAGCC	0.642													32	48	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31040372	31040372	+	Silent	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31040372T>A	uc002nsu.1	+	4	3984	c.3846T>A	c.(3844-3846)CTT>CTA	p.L1282L	ZNF536_uc010edd.1_Silent_p.L1282L	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1282					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					TTAACGGACTTGCAAGTAGCA	0.502													63	99	---	---	---	---	PASS
ZNF30	90075	broad.mit.edu	37	19	35424541	35424541	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35424541G>T	uc010edp.1	+	4	548	c.170G>T	c.(169-171)CGT>CTT	p.R57L	ZNF30_uc002nxf.2_5'UTR|ZNF30_uc010edq.1_Missense_Mutation_p.R58L|ZNF30_uc010edr.1_Missense_Mutation_p.R58L	NM_194325	NP_919306	P17039	ZNF30_HUMAN	zinc finger protein 30 isoform b	57	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		GGACATTCCCGTTCTAAACCA	0.378													9	7	---	---	---	---	PASS
HPN	3249	broad.mit.edu	37	19	35551594	35551594	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35551594C>T	uc002nxq.1	+	10	929	c.684C>T	c.(682-684)CAC>CAT	p.H228H	HPN_uc002nxr.1_Silent_p.H228H|HPN_uc002nxs.1_Silent_p.H70H|HPN_uc010xsh.1_Silent_p.H197H|HPN_uc002nxt.1_Silent_p.H112H|LOC100128675_uc010xsi.1_Intron	NM_002151	NP_002142	P05981	HEPS_HUMAN	hepsin	228	Extracellular (Potential).|Peptidase S1.				cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	CCTCTCCCCACGGTCTGCAGC	0.662													4	110	---	---	---	---	PASS
CD22	933	broad.mit.edu	37	19	35837481	35837481	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35837481A>C	uc010edt.2	+	14	2502	c.2425A>C	c.(2425-2427)AAC>CAC	p.N809H	CD22_uc010xst.1_Missense_Mutation_p.N637H|CD22_uc010edu.2_Missense_Mutation_p.N721H|CD22_uc010edv.2_3'UTR|CD22_uc002nzb.3_Missense_Mutation_p.N632H|CD22_uc010edx.2_RNA	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	809	Cytoplasmic (Potential).				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	CGACTATGAGAACGTCATTCC	0.547													6	14	---	---	---	---	PASS
ARHGAP33	115703	broad.mit.edu	37	19	36277800	36277800	+	Silent	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36277800C>T	uc002obr.1	+	20	2513	c.2428C>T	c.(2428-2430)CTG>TTG	p.L810L	ARHGAP33_uc002obs.1_Silent_p.L649L|ARHGAP33_uc002obt.1_Silent_p.L674L|ARHGAP33_uc010eel.2_Silent_p.L398L|ARHGAP33_uc002obv.1_Silent_p.L398L	NM_052948	NP_443180	O14559	RHG33_HUMAN	sorting nexin 26	810					cell communication|protein transport|signal transduction	intracellular	GTPase activator activity|phosphatidylinositol binding|protein binding			skin(2)|ovary(1)|pancreas(1)	4						TGTCCTAGAACTGCTGGGGGC	0.706													3	23	---	---	---	---	PASS
ZFP14	57677	broad.mit.edu	37	19	36831374	36831374	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36831374A>G	uc002odx.1	-	4	1447	c.1354T>C	c.(1354-1356)TAT>CAT	p.Y452H	ZFP14_uc010xtd.1_Missense_Mutation_p.Y453H|ZFP14_uc010eex.1_Missense_Mutation_p.Y452H	NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN	zinc finger protein 14-like	452	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)					TTACATTCATAAGGTTTCTCA	0.398													41	193	---	---	---	---	PASS
ZNF607	84775	broad.mit.edu	37	19	38189345	38189345	+	Missense_Mutation	SNP	A	G	G	rs146672126		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38189345A>G	uc002ohc.1	-	5	2283	c.1687T>C	c.(1687-1689)TGT>CGT	p.C563R	ZNF607_uc002ohb.1_Missense_Mutation_p.C562R	NM_032689	NP_116078	Q96SK3	ZN607_HUMAN	zinc finger protein 607	563	C2H2-type 16.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			CATTCCTTACATTCGTAGGGT	0.418													58	58	---	---	---	---	PASS
PSG2	5670	broad.mit.edu	37	19	43579557	43579557	+	Missense_Mutation	SNP	G	A	A	rs146901045	byFrequency	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43579557G>A	uc002ovr.2	-	3	751	c.658C>T	c.(658-660)CGG>TGG	p.R220W	PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG2_uc002ovq.3_Missense_Mutation_p.R220W|PSG2_uc010eiq.1_Missense_Mutation_p.R220W|PSG2_uc002ovs.3_Missense_Mutation_p.R220W|PSG2_uc002ovt.3_Missense_Mutation_p.R220W	NM_031246	NP_112536	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	220	Ig-like C2-type 1.				cell migration|female pregnancy	extracellular region					0		Prostate(69;0.00682)				CCTGAGTTCCGTATTTCACAT	0.507													196	302	---	---	---	---	PASS
ZNF285	26974	broad.mit.edu	37	19	44891930	44891930	+	Silent	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44891930G>T	uc002ozd.3	-	4	564	c.477C>A	c.(475-477)CCC>CCA	p.P159P	ZFP112_uc010xwz.1_Intron|ZNF285_uc010xxa.1_Silent_p.P166P	NM_152354	NP_689567	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	159					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(2)	4						GAGAGTTCTGGGGCTCGGTCA	0.443													80	141	---	---	---	---	PASS
PPP1R13L	10848	broad.mit.edu	37	19	45899676	45899676	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45899676C>T	uc002pbn.2	-	5	808	c.731G>A	c.(730-732)CGG>CAG	p.R244Q	PPP1R13L_uc002pbo.2_Missense_Mutation_p.R244Q|PPP1R13L_uc002pbp.2_Missense_Mutation_p.R244Q	NM_006663	NP_006654	Q8WUF5	IASPP_HUMAN	protein phosphatase 1, regulatory subunit 13	244	Pro-rich.				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	transcription corepressor activity|transcription factor binding			skin(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)		CGGAGGCCGCCGGCGCAGCGT	0.652													32	51	---	---	---	---	PASS
SYMPK	8189	broad.mit.edu	37	19	46355645	46355645	+	Splice_Site	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46355645T>C	uc002pdn.2	-	5	471	c.226_splice	c.e5-1	p.E76_splice	SYMPK_uc002pdo.1_Splice_Site_p.E76_splice|SYMPK_uc002pdp.1_Splice_Site_p.E76_splice|SYMPK_uc002pdq.1_Splice_Site_p.E76_splice	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin						cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		GATGATCTCCTGCCAATGTTA	0.527													68	104	---	---	---	---	PASS
HIF3A	64344	broad.mit.edu	37	19	46834442	46834442	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46834442A>T	uc002peh.2	+	13	1771	c.1742A>T	c.(1741-1743)GAC>GTC	p.D581V	HIF3A_uc002peg.3_Missense_Mutation_p.D581V|HIF3A_uc002pei.3_Missense_Mutation_p.D525V|HIF3A_uc002pej.1_Intron|HIF3A_uc002pek.2_Missense_Mutation_p.D525V|HIF3A_uc010xxy.1_Missense_Mutation_p.D512V|HIF3A_uc002pel.2_Missense_Mutation_p.D579V|HIF3A_uc010xxz.1_Missense_Mutation_p.D530V	NM_152795	NP_690008	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	581	ODD.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		GAGGACGAGGACGAGGGAGTG	0.567													32	66	---	---	---	---	PASS
FAM83E	54854	broad.mit.edu	37	19	49107101	49107101	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49107101C>T	uc002pjn.2	-	4	891	c.826G>A	c.(826-828)GCC>ACC	p.A276T	SPACA4_uc002pjo.2_5'Flank	NM_017708	NP_060178	Q2M2I3	FA83E_HUMAN	hypothetical protein LOC54854	276										ovary(1)	1		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		AGGCTGAAGGCGTCAACAATT	0.672													26	40	---	---	---	---	PASS
ZNF836	162962	broad.mit.edu	37	19	52659713	52659713	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52659713T>C	uc010ydi.1	-	5	1597	c.1223A>G	c.(1222-1224)CAT>CGT	p.H408R	ZNF836_uc010ydj.1_Missense_Mutation_p.H408R	NM_001102657	NP_001096127	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	408	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTTTCCACTATGAACTGTCTG	0.418													6	165	---	---	---	---	PASS
NDUFA3	4696	broad.mit.edu	37	19	54606177	54606177	+	5'UTR	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54606177G>T	uc002qde.2	+	1					OSCAR_uc002qcy.2_5'Flank|OSCAR_uc002qcz.2_5'Flank|OSCAR_uc002qda.2_5'Flank|OSCAR_uc002qdb.2_5'Flank|OSCAR_uc010erc.2_5'Flank|OSCAR_uc002qdc.2_5'Flank|OSCAR_uc002qdd.2_5'Flank|NDUFA3_uc002qdf.2_RNA	NM_004542	NP_004533	O95167	NDUA3_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			breast(1)	1	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)				NADH(DB00157)	TCGCCGCCGCGGAGACAAAGA	0.692											OREG0003682|OREG0003632	type=REGULATORY REGION|Gene=NDUFA3|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=BC035023|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	10	---	---	---	---	PASS
TTYH1	57348	broad.mit.edu	37	19	54940526	54940526	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54940526G>A	uc002qfq.2	+	6	868	c.776G>A	c.(775-777)GGC>GAC	p.G259D	TTYH1_uc010yey.1_Missense_Mutation_p.G308D|TTYH1_uc002qfr.2_Missense_Mutation_p.G259D|TTYH1_uc002qft.2_Missense_Mutation_p.G259D|TTYH1_uc002qfu.1_Missense_Mutation_p.G171D	NM_020659	NP_065710	Q9H313	TTYH1_HUMAN	tweety 1 isoform 1	259	Helical; Name=4; (Potential).				cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		CTGAGCTGGGGCTCCATGGGC	0.622													62	81	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55485917	55485917	+	Intron	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55485917G>T	uc002qij.2	+						NLRP2_uc010yfp.1_Intron|NLRP2_uc010esn.2_Intron|NLRP2_uc010eso.2_Intron|NLRP2_uc010esp.2_Intron	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2						apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CATTAGGTAAGTTACCTCATT	0.378													53	75	---	---	---	---	PASS
RDH13	112724	broad.mit.edu	37	19	55559778	55559778	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55559778T>C	uc002qio.3	-	5	762	c.577A>G	c.(577-579)AAG>GAG	p.K193E	RDH13_uc002qip.2_Missense_Mutation_p.K122E|RDH13_uc010esr.1_RNA	NM_001145971	NP_001139443	Q8NBN7	RDH13_HUMAN	retinol dehydrogenase 13 isoform 1	193							binding|oxidoreductase activity			large_intestine(1)|ovary(1)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)	GTGTTATACTTCCTCGTCTGC	0.592													47	72	---	---	---	---	PASS
SAPS1	22870	broad.mit.edu	37	19	55743015	55743015	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55743015G>A	uc002qjw.3	-	20	2570	c.2328C>T	c.(2326-2328)CCC>CCT	p.P776P	TMEM86B_uc002qjt.2_5'Flank|TMEM86B_uc002qju.2_5'Flank|SAPS1_uc002qjv.2_Silent_p.P838P	NM_014931	NP_055746	Q9UPN7	PP6R1_HUMAN	SAPS domain family, member 1	776	Pro-rich.				regulation of phosphoprotein phosphatase activity	cytoplasm	protein phosphatase binding				0		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GAGGTGCTGAGGGGGGTGTGG	0.672													19	2	---	---	---	---	PASS
ZNF835	90485	broad.mit.edu	37	19	57175617	57175617	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57175617T>C	uc010ygo.1	-	2	1016	c.1016A>G	c.(1015-1017)CAG>CGG	p.Q339R	ZNF835_uc010ygn.1_Missense_Mutation_p.Q317R	NM_001005850	NP_001005850			zinc finger protein 835									p.G334fs*26(1)		pancreas(3)|skin(1)	4						AGAGGCGCTCTGGCTGAAGAG	0.701													4	8	---	---	---	---	PASS
DUXA	503835	broad.mit.edu	37	19	57669821	57669821	+	Missense_Mutation	SNP	G	A	A	rs145101590		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57669821G>A	uc002qoa.1	-	4	358	c.313C>T	c.(313-315)CGT>TGT	p.R105C		NM_001012729	NP_001012747	A6NLW8	DUXA_HUMAN	double homeobox A	105	Homeobox 2.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		TAGGTGGTACGACACCGTCTG	0.468													51	82	---	---	---	---	PASS
ZNF548	147694	broad.mit.edu	37	19	57910184	57910184	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57910184G>T	uc002qom.2	+	3	779	c.529G>T	c.(529-531)GAG>TAG	p.E177*	ZNF547_uc002qpm.3_Intron|ZNF548_uc002qon.2_Nonsense_Mutation_p.E180*	NM_152909	NP_690873	Q8NEK5	ZN548_HUMAN	zinc finger protein 548	177					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CCCTCAAAGCGAGTGGAAGCC	0.512													36	53	---	---	---	---	PASS
ZSCAN1	284312	broad.mit.edu	37	19	58549521	58549521	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58549521G>T	uc002qrc.1	+	3	564	c.317G>T	c.(316-318)TGC>TTC	p.C106F	ZSCAN1_uc002qra.1_Missense_Mutation_p.C106F|ZSCAN1_uc002qrb.1_Missense_Mutation_p.C106F	NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	106	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CCCCGAAGCTGCAGGGAGGCC	0.692													7	9	---	---	---	---	PASS
ZBTB45	84878	broad.mit.edu	37	19	59028370	59028370	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59028370T>A	uc002qtd.2	-	2	963	c.671A>T	c.(670-672)GAA>GTA	p.E224V	ZBTB45_uc002qte.2_Missense_Mutation_p.E224V|ZBTB45_uc002qtf.2_Missense_Mutation_p.E224V	NM_032792	NP_116181	Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	224					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		GCCGCCACCTTCGCCATCCTC	0.662											OREG0025700	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	118	339	---	---	---	---	PASS
TRIM28	10155	broad.mit.edu	37	19	59056785	59056785	+	Intron	SNP	C	T	T	rs146115909	by1000genomes	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59056785C>T	uc002qtg.1	+						TRIM28_uc010eut.1_Intron|TRIM28_uc002qth.1_5'Flank	NM_005762	NP_005753	Q13263	TIF1B_HUMAN	tripartite motif-containing 28 protein						epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent	nucleoplasm	chromo shadow domain binding|ligase activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		ATCCCTGCTTCTCGAAGTGGT	0.567													111	126	---	---	---	---	PASS
C20orf103	24141	broad.mit.edu	37	20	9510324	9510324	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9510324G>C	uc002wni.1	+	6	929	c.700G>C	c.(700-702)GAA>CAA	p.E234Q	C20orf103_uc010zrc.1_Missense_Mutation_p.E190Q	NM_012261	NP_036393	Q9UJQ1	CT103_HUMAN	chromosome 20 open reading frame 103 precursor	234	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|lung(1)|breast(1)	3			COAD - Colon adenocarcinoma(9;0.194)			GGAGCAACTGGAAGAAACCTT	0.483													46	87	---	---	---	---	PASS
TASP1	55617	broad.mit.edu	37	20	13509103	13509103	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13509103T>C	uc002woi.2	-	10	968	c.851A>G	c.(850-852)TAC>TGC	p.Y284C	TASP1_uc010zri.1_Intron|TASP1_uc002woh.2_Missense_Mutation_p.Y261C|TASP1_uc010zrj.1_RNA	NM_017714	NP_060184	Q9H6P5	TASP1_HUMAN	taspase 1 precursor	284					asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0						AGCTGTGGAGTAGGGGTTATG	0.368													11	23	---	---	---	---	PASS
GDF5	8200	broad.mit.edu	37	20	34041920	34041920	+	Intron	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34041920C>A	uc010zvc.1	-						CEP250_uc002xcm.2_5'Flank|MIR1289-1_hsa-mir-1289-1|MI0006350_5'Flank|CEP250_uc010gfe.1_5'Flank|CEP250_uc010zvd.1_5'Flank	NM_000557	NP_000548	P43026	GDF5_HUMAN	growth differentiation factor 5 preproprotein						cartilage development|cell-cell signaling|growth|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			aaattgagaaccactgagtgc	0.000													11	2	---	---	---	---	PASS
C20orf117	140710	broad.mit.edu	37	20	35444018	35444018	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35444018G>T	uc002xgd.1	-	5	1440	c.1113C>A	c.(1111-1113)TGC>TGA	p.C371*	C20orf117_uc002xge.1_RNA	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2	371											0		Myeloproliferative disorder(115;0.00874)				GCGTACTCTGGCAGGAGGCGA	0.667													6	11	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10952962	10952962	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10952962T>C	uc002yip.1	-	9	603	c.235A>G	c.(235-237)AGC>GGC	p.S79G	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.S61G|TPTE_uc002yir.1_Missense_Mutation_p.S41G|TPTE_uc010gkv.1_5'UTR	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	79					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTAATCTTGCTGCTGCAAAAA	0.259													12	82	---	---	---	---	PASS
HSPA13	6782	broad.mit.edu	37	21	15746135	15746135	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15746135C>T	uc002yjt.2	-	5	1288	c.1219G>A	c.(1219-1221)GGC>AGC	p.G407S	HSPA13_uc011abx.1_Missense_Mutation_p.G199S	NM_006948	NP_008879	P48723	HSP13_HUMAN	heat shock protein 70kDa family member 13	407						endoplasmic reticulum|microsome	ATP binding			kidney(1)	1						CGAGTGGAGCCCCCAACTAAA	0.448													65	140	---	---	---	---	PASS
ITSN1	6453	broad.mit.edu	37	21	35140086	35140086	+	Silent	SNP	A	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35140086A>G	uc002yta.1	+	11	1264	c.996A>G	c.(994-996)GAA>GAG	p.E332E	DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Silent_p.E332E|ITSN1_uc010gmg.2_Silent_p.E295E|ITSN1_uc010gmh.2_RNA|ITSN1_uc002ysw.2_Silent_p.E332E|ITSN1_uc010gmi.2_Silent_p.E295E|ITSN1_uc010gmj.2_Silent_p.E216E|ITSN1_uc002ysy.2_Silent_p.E332E|ITSN1_uc002ysx.2_Silent_p.E295E|ITSN1_uc002ytb.1_Silent_p.E332E|ITSN1_uc002ytc.1_Silent_p.E332E|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Silent_p.E295E|ITSN1_uc010gml.2_RNA|ITSN1_uc002ytj.2_Silent_p.E332E|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Silent_p.E266E	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	332	KLERQ.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						TACCAGAGGAACCAGTTTTAG	0.358													22	62	---	---	---	---	PASS
TTC3	7267	broad.mit.edu	37	21	38459620	38459620	+	Silent	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38459620T>A	uc002yvz.2	+	2	168	c.63T>A	c.(61-63)CCT>CCA	p.P21P	TTC3_uc011aee.1_Intron|TTC3_uc002ywa.2_Silent_p.P21P|TTC3_uc002ywb.2_Silent_p.P21P|TTC3_uc010gnf.2_5'UTR|TTC3_uc011aed.1_Intron|TTC3_uc010gne.1_Silent_p.P21P	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	21					protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				AAGATTGCCCTCACGTGGATG	0.428													238	176	---	---	---	---	PASS
ITGB2	3689	broad.mit.edu	37	21	46330676	46330676	+	Silent	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46330676G>A	uc002zgd.2	-	1	66	c.22C>T	c.(22-24)CTG>TTG	p.L8L	ITGB2_uc002zge.2_Silent_p.L8L|ITGB2_uc002zgf.3_Silent_p.L8L|ITGB2_uc011afl.1_5'UTR|ITGB2_uc010gpw.2_Silent_p.L8L|ITGB2_uc002zgg.2_Silent_p.L8L	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	8					apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)	AGGGCGAGCAGTGGGGGGCGC	0.662													11	5	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47549367	47549367	+	Intron	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47549367A>T	uc002zia.1	+						COL6A2_uc002zhy.1_3'UTR|COL6A2_uc002zhz.1_Missense_Mutation_p.I907F|COL6A2_uc002zib.1_Intron|COL6A2_uc002zic.1_Intron|COL6A2_uc010gqe.1_5'Flank	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GCACAGGGACATCGTGGGGGA	0.682													16	18	---	---	---	---	PASS
PRMT2	3275	broad.mit.edu	37	21	48068521	48068521	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:48068521G>T	uc002zjx.2	+	6	793	c.479G>T	c.(478-480)CGG>CTG	p.R160L	PRMT2_uc002zjw.2_Missense_Mutation_p.R160L|PRMT2_uc002zjy.2_Missense_Mutation_p.R160L|PRMT2_uc010gqm.2_Missense_Mutation_p.R160L|PRMT2_uc011aga.1_Missense_Mutation_p.R160L|PRMT2_uc011agb.1_Missense_Mutation_p.R160L|PRMT2_uc011agc.1_Missense_Mutation_p.R160L|PRMT2_uc002zjz.1_Missense_Mutation_p.R46L	NM_206962	NP_996845	P55345	ANM2_HUMAN	HMT1 hnRNP methyltransferase-like 1	160	Interaction with RB1 (By similarity).|Interaction with ESR1.				developmental cell growth|induction of apoptosis|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of androgen receptor signaling pathway	cytosol|nucleus	androgen receptor binding|estrogen receptor binding|histone-arginine N-methyltransferase activity|peroxisome proliferator activated receptor binding|progesterone receptor binding|protein homodimerization activity|retinoic acid receptor binding|signal transducer activity|thyroid hormone receptor binding|transcription coactivator activity			ovary(1)	1	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		CACTATGCGCGGCCTAGAGCG	0.577													40	119	---	---	---	---	PASS
PEX26	55670	broad.mit.edu	37	22	18567938	18567938	+	Missense_Mutation	SNP	C	T	T	rs149153003	byFrequency	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18567938C>T	uc002znp.3	+	5	937	c.728C>T	c.(727-729)GCG>GTG	p.A243V	TUBA8_uc002znr.2_Intron|PEX26_uc002znq.3_Missense_Mutation_p.A243V|PEX26_uc002znt.2_Intron	NM_017929	NP_060399	Q7Z412	PEX26_HUMAN	peroxisome biogenesis factor 26	243	Cytoplasmic (Potential).				protein import into peroxisome matrix|protein import into peroxisome membrane	integral to peroxisomal membrane	protein C-terminus binding|protein complex binding			skin(1)	1						TGGGACTCTGCGGTGAGCCAC	0.542													21	112	---	---	---	---	PASS
GAL3ST1	9514	broad.mit.edu	37	22	30952021	30952021	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30952021C>A	uc003aig.1	-	4	331	c.191G>T	c.(190-192)CGG>CTG	p.R64L	GAL3ST1_uc003aih.1_Missense_Mutation_p.R64L|GAL3ST1_uc003aii.1_Missense_Mutation_p.R64L|GAL3ST1_uc010gvz.1_Missense_Mutation_p.R64L	NM_004861	NP_004852	Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	64	Lumenal (Potential).				protein N-linked glycosylation	Golgi membrane|integral to plasma membrane|membrane fraction	galactosylceramide sulfotransferase activity				0						GCCGTTGGCCCGGATCACTGC	0.682													22	44	---	---	---	---	PASS
EIF4ENIF1	56478	broad.mit.edu	37	22	31836783	31836783	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31836783A>T	uc003akz.1	-	18	2787	c.2623T>A	c.(2623-2625)TAC>AAC	p.Y875N	EIF4ENIF1_uc003akx.1_Missense_Mutation_p.Y530N|EIF4ENIF1_uc003aky.1_Missense_Mutation_p.Y555N|EIF4ENIF1_uc003ala.1_Missense_Mutation_p.Y875N|EIF4ENIF1_uc003alb.1_Missense_Mutation_p.Y701N|EIF4ENIF1_uc003akw.1_Missense_Mutation_p.Y365N	NM_019843	NP_062817	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E	875						nucleus	protein binding|protein transporter activity			ovary(1)	1						GGTAAAGGGTAAAAGGGCTGA	0.527													57	97	---	---	---	---	PASS
C22orf33	339669	broad.mit.edu	37	22	37396035	37396035	+	Intron	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37396035G>C	uc003aqf.2	-						C22orf33_uc003aqe.2_Intron	NM_001163857	NP_001157329	O43247	EAN57_HUMAN	hypothetical protein LOC339669 isoform 1												0						CCTGAGCAGGGAGGCAGGGAT	0.577													50	94	---	---	---	---	PASS
BAIAP2L2	80115	broad.mit.edu	37	22	38503901	38503901	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38503901C>T	uc003auw.2	-	4	378	c.234G>A	c.(232-234)ATG>ATA	p.M78I		NM_025045	NP_079321	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	78	IMD.				filopodium assembly|signal transduction		cytoskeletal adaptor activity|SH3 domain binding			pancreas(1)	1	Melanoma(58;0.045)					GGGTGTCAGACATCTGCACCA	0.612													51	116	---	---	---	---	PASS
ATF4	468	broad.mit.edu	37	22	39917980	39917980	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39917980T>A	uc003axz.2	+	3	709	c.429T>A	c.(427-429)CAT>CAA	p.H143Q	ATF4_uc011aol.1_Missense_Mutation_p.H55Q|ATF4_uc003aya.2_Missense_Mutation_p.H143Q	NM_182810	NP_877962	P18848	ATF4_HUMAN	activating transcription factor 4	143					cellular amino acid metabolic process|gluconeogenesis|positive regulation of transcription from RNA polymerase II promoter|response to endoplasmic reticulum stress|transcription from RNA polymerase II promoter	cytoplasm|plasma membrane	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Melanoma(58;0.04)					CAATTGGCCATCTCCCAGAAA	0.532													270	220	---	---	---	---	PASS
PPPDE2	27351	broad.mit.edu	37	22	42003316	42003316	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42003316G>A	uc003ban.1	-	3	203	c.130C>T	c.(130-132)CAC>TAC	p.H44Y	PPPDE2_uc011apb.1_Intron	NM_015704	NP_056519	Q6ICB0	PPDE2_HUMAN	PPPDE peptidase domain containing 2	44	PPPDE peptidase.										0						TCATCCTTGTGCACAACTATG	0.493													47	37	---	---	---	---	PASS
TNFRSF13C	115650	broad.mit.edu	37	22	42322214	42322214	+	Silent	SNP	G	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42322214G>T	uc003bbl.2	-	2	302	c.258C>A	c.(256-258)GGC>GGA	p.G86G	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|TNFRSF13C_uc010gyp.1_Silent_p.G87G	NM_052945	NP_443177	Q96RJ3	TR13C_HUMAN	BAFF receptor	86	Helical; Signal-anchor for type III membrane protein; (Potential).					integral to membrane	receptor activity				0						ccagtgccaggcccagcAGCG	0.657													3	23	---	---	---	---	PASS
CERK	64781	broad.mit.edu	37	22	47108146	47108146	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47108146C>A	uc003bia.2	-	4	531	c.424G>T	c.(424-426)GGA>TGA	p.G142*	CERK_uc010hae.2_Translation_Start_Site	NM_022766	NP_073603	Q8TCT0	CERK1_HUMAN	ceramide kinase	142	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|ceramide metabolic process	integral to membrane of membrane fraction|membrane|nucleus	ATP binding|ceramide kinase activity|diacylglycerol kinase activity|magnesium ion binding			skin(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGTCCTTTTCCTCCAAACGGG	0.393													57	60	---	---	---	---	PASS
ASMT	438	broad.mit.edu	37	X	1755325	1755325	+	Intron	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1755325T>A	uc004cqd.2	+						ASMT_uc010ncy.2_Intron|ASMT_uc004cqe.2_Intron	NM_004043	NP_004034	P46597	HIOM_HUMAN	acetylserotonin O-methyltransferase						melatonin biosynthetic process|translation	cytosol	acetylserotonin O-methyltransferase activity|S-methyltransferase activity			skin(1)	1		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CTGCCCTGTGTTCCAGGGGAT	0.552													166	39	---	---	---	---	PASS
ASB9	140462	broad.mit.edu	37	X	15268561	15268561	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15268561G>C	uc004cwl.2	-	5	806	c.559C>G	c.(559-561)CTG>GTG	p.L187V	ASB9_uc004cwk.2_Missense_Mutation_p.L187V|ASB9_uc004cwm.2_Missense_Mutation_p.L177V|ASB9_uc010ner.2_Missense_Mutation_p.L187V|ASB9_uc004cwn.2_Missense_Mutation_p.L158V	NM_001031739	NP_001026909	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box-containing 9 isoform	187	ANK 5.				intracellular signal transduction						0	Hepatocellular(33;0.183)					CCTGACTCCAGAAGCTTCTTG	0.348													90	20	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32361367	32361367	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32361367T>G	uc004dda.1	-	40	5867	c.5623A>C	c.(5623-5625)ATT>CTT	p.I1875L	DMD_uc004dcw.2_Missense_Mutation_p.I531L|DMD_uc004dcx.2_Missense_Mutation_p.I534L|DMD_uc004dcz.2_Missense_Mutation_p.I1752L|DMD_uc004dcy.1_Missense_Mutation_p.I1871L|DMD_uc004ddb.1_Missense_Mutation_p.I1867L|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1875	Interaction with SYNM (By similarity).				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGATGAGAAATTTCTAGAGCC	0.393													76	10	---	---	---	---	PASS
PJA1	64219	broad.mit.edu	37	X	68382648	68382648	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68382648T>A	uc004dxh.2	-	2	720	c.434A>T	c.(433-435)AAG>ATG	p.K145M	PJA1_uc011mpi.1_Translation_Start_Site|PJA1_uc004dxg.2_Intron|PJA1_uc004dxi.2_Missense_Mutation_p.K90M	NM_145119	NP_660095	Q8NG27	PJA1_HUMAN	praja 1 isoform a	145							zinc ion binding				0						ATCTTTAAACTTGCCAGTTTT	0.517													17	1	---	---	---	---	PASS
TAF1	6872	broad.mit.edu	37	X	70597469	70597469	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70597469G>A	uc004dzu.3	+	6	779	c.728G>A	c.(727-729)CGT>CAT	p.R243H	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.R264H	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	243	Protein kinase 1.				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				CGTTTTCTACGTCTTTTTGGA	0.473													17	48	---	---	---	---	PASS
SLC16A2	6567	broad.mit.edu	37	X	73740856	73740856	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73740856C>A	uc004ebt.2	+	2	850	c.684C>A	c.(682-684)ATC>ATA	p.I228I		NM_006517	NP_006508	P36021	MOT8_HUMAN	solute carrier family 16, member 2	154	Helical; (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity			breast(2)|ovary(1)	3					Pyruvic acid(DB00119)	TGGGTATGATCTTCTTCTGTT	0.522													101	12	---	---	---	---	PASS
CPXCR1	53336	broad.mit.edu	37	X	88009119	88009119	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:88009119C>A	uc004efd.3	+	3	963	c.704C>A	c.(703-705)TCT>TAT	p.S235Y	CPXCR1_uc004efc.3_Missense_Mutation_p.S235Y	NM_033048	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	235						intracellular	zinc ion binding			ovary(3)	3						ATTGTGAGGTCTGTGCTCTTT	0.358													17	4	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91090590	91090590	+	Silent	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91090590C>A	uc004efk.1	+	1	932	c.87C>A	c.(85-87)ACC>ACA	p.T29T	PCDH11X_uc004efl.1_Silent_p.T29T|PCDH11X_uc004efo.1_Silent_p.T29T|PCDH11X_uc010nmv.1_Silent_p.T29T|PCDH11X_uc004efm.1_Silent_p.T29T|PCDH11X_uc004efn.1_Silent_p.T29T|PCDH11X_uc004efh.1_Silent_p.T29T|PCDH11X_uc004efj.1_Silent_p.T29T	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	29	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						AAAACTACACCATCCGAGAAG	0.493													79	10	---	---	---	---	PASS
DCAF12L2	340578	broad.mit.edu	37	X	125298566	125298566	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125298566C>G	uc004euk.1	-	1	1369	c.1342G>C	c.(1342-1344)GGG>CGG	p.G448R		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	448										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						GGGAGAGGCCCCCCAGCCACA	0.562													45	14	---	---	---	---	PASS
SLITRK4	139065	broad.mit.edu	37	X	142717087	142717087	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142717087C>A	uc004fbx.2	-	2	2214	c.1838G>T	c.(1837-1839)GGG>GTG	p.G613V	SLITRK4_uc004fby.2_Missense_Mutation_p.G613V	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	613	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					AGGCACTGGCCCACCAGGAGG	0.458													91	13	---	---	---	---	PASS
KLHL17	339451	broad.mit.edu	37	1	897476	897481	+	Intron	DEL	GTCTTT	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:897476_897481delGTCTTT	uc001aca.1	+						NOC2L_uc001abz.3_5'Flank|NOC2L_uc009vjq.2_5'Flank|NOC2L_uc009vjr.1_5'Flank|KLHL17_uc001acb.1_In_Frame_Del_p.VF132del|KLHL17_uc010nya.1_In_Frame_Del_p.VF132del|KLHL17_uc001acc.1_RNA|KLHL17_uc010nyb.1_5'Flank	NM_198317	NP_938073	Q6TDP4	KLH17_HUMAN	kelch-like 17						actin cytoskeleton organization	actin cytoskeleton|cell junction|postsynaptic density|postsynaptic membrane	protein complex scaffold				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.52e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.59e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ccccaccccaGTCTTTGTCTTTGACT	0.549													3	3	---	---	---	---	
HIVEP3	59269	broad.mit.edu	37	1	42011235	42011237	+	Intron	DEL	CAC	-	-	rs150183501		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42011235_42011237delCAC	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001cgy.2_Intron	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				tcactaccatcaccaccaccacc	0.000													4	2	---	---	---	---	
CCDC18	343099	broad.mit.edu	37	1	93692082	93692083	+	Intron	DEL	AT	-	-	rs71875718		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93692082_93692083delAT	uc001dpq.2	+						CCDC18_uc009wdl.1_Intron	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41											ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		GTAGGACAAAatatatatatat	0.124													4	2	---	---	---	---	
KCNT2	343450	broad.mit.edu	37	1	196227362	196227362	+	Frame_Shift_Del	DEL	T	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196227362delT	uc001gtd.1	-	26	3233	c.3173delA	c.(3172-3174)AATfs	p.N1058fs	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Frame_Shift_Del_p.N991fs|KCNT2_uc001gtf.1_Frame_Shift_Del_p.N1034fs|KCNT2_uc001gtg.1_RNA|KCNT2_uc001gth.1_Frame_Shift_Del_p.N562fs	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	1058	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						TTTCATTCTATTTTTCACAAG	0.393													32	181	---	---	---	---	
C1orf55	163859	broad.mit.edu	37	1	226180816	226180817	+	Intron	INS	-	T	T	rs66975923		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226180816_226180817insT	uc001hpu.3	-						C1orf55_uc001hpv.2_Intron	NM_152608	NP_689821	Q6IQ49	CA055_HUMAN	hypothetical protein LOC163859											lung(1)	1	Breast(184;0.197)					TACTTTCTTTCTTTTTTTTTTT	0.302													11	5	---	---	---	---	
B3GALNT2	148789	broad.mit.edu	37	1	235657766	235657766	+	Intron	DEL	T	-	-	rs34730227		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235657766delT	uc001hxc.2	-						B3GALNT2_uc001hxd.1_Intron	NM_152490	NP_689703	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2						protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			breast(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			TTTTCAGAACttttttttttt	0.179													3	3	---	---	---	---	
SNTG2	54221	broad.mit.edu	37	2	1241743	1241743	+	Frame_Shift_Del	DEL	G	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1241743delG	uc002qwq.2	+	10	931	c.803delG	c.(802-804)TGGfs	p.W268fs	SNTG2_uc010ewi.2_Frame_Shift_Del_p.W141fs	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	268					central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GGCACCGACTGGCTGCGGGCG	0.582													2	7	---	---	---	---	
ALMS1	7840	broad.mit.edu	37	2	73830581	73830582	+	Intron	INS	-	A	A	rs113408397		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73830581_73830582insA	uc002sje.1	+						ALMS1_uc002sjf.1_Intron|ALMS1_uc002sjh.1_3'UTR	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1						G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						TTATGGCACTGAAAAAAAAAAA	0.351													6	4	---	---	---	---	
PCDP1	200373	broad.mit.edu	37	2	120396143	120396143	+	Intron	DEL	C	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120396143delC	uc002tmb.2	+							NM_001029996	NP_001025167	Q4G0U5	PCDP1_HUMAN	primary ciliary dyskinesia protein 1							cilium	calmodulin binding				0	Colorectal(110;0.196)					ATACCGCCAGCCCTAAAGGGG	0.602													6	3	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179664389	179664397	+	In_Frame_Del	DEL	GCCCAGCGG	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179664389_179664397delGCCCAGCGG	uc002und.2	-	6	956_964	c.731_739delCCGCTGGGC	c.(730-741)GCCGCTGGGCAA>GAA	p.244_247AAGQ>E	TTN_uc010zfg.1_In_Frame_Del_p.244_247AAGQ>E|TTN_uc010zfh.1_In_Frame_Del_p.244_247AAGQ>E|TTN_uc010zfi.1_In_Frame_Del_p.244_247AAGQ>E|TTN_uc010zfj.1_In_Frame_Del_p.244_247AAGQ>E|TTN_uc002unb.2_In_Frame_Del_p.244_247AAGQ>E			Q8WZ42	TITIN_HUMAN	Homo sapiens cDNA FLJ32040 fis, clone NTONG2000858, highly similar to H.sapiens mRNA for titin protein.	244_247							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCAGCTGTTGCCCAGCGGCACCATCTAT	0.493													42	26	---	---	---	---	
GRIP2	80852	broad.mit.edu	37	3	14551459	14551459	+	Frame_Shift_Del	DEL	G	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14551459delG	uc011avi.1	-	18	2241	c.2241delC	c.(2239-2241)ACCfs	p.T747fs	GRIP2_uc010heh.2_RNA|GRIP2_uc011avh.1_Frame_Shift_Del_p.T278fs	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2	649					synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1						CGGCACCTGTGGTCTCCAGCT	0.547													4	2	---	---	---	---	
ULK4	54986	broad.mit.edu	37	3	41877484	41877485	+	Intron	INS	-	AAG	AAG			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41877484_41877485insAAG	uc003ckv.3	-						ULK4_uc003ckw.2_Intron	NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		AAAAAAAAAAAAAGTAAATTAT	0.302													30	15	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	168833655	168833656	+	Frame_Shift_Ins	INS	-	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168833655_168833656insA	uc003ffi.3	-	7	1709_1710	c.1440_1441insT	c.(1438-1443)ATTGCTfs	p.I480fs	MECOM_uc010hwk.1_Frame_Shift_Ins_p.I503fs|MECOM_uc003ffj.3_Frame_Shift_Ins_p.I545fs|MECOM_uc011bpi.1_Frame_Shift_Ins_p.I481fs|MECOM_uc003ffn.3_Frame_Shift_Ins_p.I480fs|MECOM_uc003ffk.2_Frame_Shift_Ins_p.I480fs|MECOM_uc003ffl.2_Frame_Shift_Ins_p.I640fs|MECOM_uc011bpj.1_Frame_Shift_Ins_p.I668fs|MECOM_uc011bpk.1_Frame_Shift_Ins_p.I470fs|MECOM_uc010hwn.2_Frame_Shift_Ins_p.I668fs	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	480_481					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						TATTTTTCAGCAATAGAAGCAA	0.426													449	216	---	---	---	---	
ST6GAL1	6480	broad.mit.edu	37	3	186704984	186704985	+	Intron	INS	-	A	A	rs59834484		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186704984_186704985insA	uc003frb.2	+						ST6GAL1_uc003frc.2_Intron	NM_173216	NP_775323	P15907	SIAT1_HUMAN	ST6 beta-galactosamide						humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		gggagggagggagggaaggaaa	0.099													4	2	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188295546	188295549	+	Intron	DEL	TTCG	-	-	rs72048204		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188295546_188295549delTTCG	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		ccttcgttccttcgttccttcctt	0.039			T	HMGA2|MLL|C12orf9	lipoma|leukemia								14	17	---	---	---	---	
PPP2R2C	5522	broad.mit.edu	37	4	6382713	6382713	+	Intron	DEL	G	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6382713delG	uc003gjc.2	-						PPP2R2C_uc003gjb.2_Intron|PPP2R2C_uc011bwd.1_Intron|PPP2R2C_uc011bwe.1_Intron|PPP2R2C_uc003gja.2_Intron|PPP2R2C_uc003gjd.1_Intron	NM_020416	NP_065149	Q9Y2T4	2ABG_HUMAN	gamma isoform of regulatory subunit B55, protein						signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						ACCAGACCCAGGGCTTCGCAC	0.637													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53614272	53614272	+	Intron	DEL	A	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53614272delA	uc003gzr.2	-						uc003gzs.2_Intron					RecName: Full=Uncharacterized protein LP9056; Flags: Precursor;																		CAAACCCTGTAAAAAAAAAAA	0.328													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	72004896	72004897	+	IGR	INS	-	TG	TG	rs138440407	by1000genomes	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72004896_72004897insTG								DCK (108269 upstream) : SLC4A4 (48106 downstream)																							TCCCTTTTCTTtgtgtgtgtgt	0.178													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	78879081	78879081	+	IGR	DEL	T	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78879081delT								MRPL1 (5137 upstream) : FRAS1 (99643 downstream)																							TTAAACATTGTATTCCTGATA	0.368													94	53	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	58287543	58287544	+	Intron	INS	-	A	A	rs3840338		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58287543_58287544insA	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jrt.2_Intron|PDE4D_uc003jru.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc003jrs.2_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	TTCAAAAAAAGAAAAAAAAAAA	0.317													4	2	---	---	---	---	
SEMA6A	57556	broad.mit.edu	37	5	115840700	115840701	+	Intron	INS	-	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115840700_115840701insT	uc010jck.2	-						SEMA6A_uc003krx.3_Intron	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and						apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		TAAAGAACAGATTTTTTTCCAA	0.376													3	4	---	---	---	---	
CNOT8	9337	broad.mit.edu	37	5	154251142	154251142	+	Intron	DEL	G	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154251142delG	uc003lvu.2	+						CNOT8_uc011ddf.1_Intron|CNOT8_uc011ddg.1_Intron|CNOT8_uc011ddh.1_Intron|CNOT8_uc003lvv.2_Intron|CNOT8_uc010jig.2_Intron|CNOT8_uc010jif.2_Intron|CNOT8_uc003lvw.2_Intron|CNOT8_uc011ddi.1_Intron|CNOT8_uc011ddj.1_Intron	NM_004779	NP_004770	Q9UFF9	CNOT8_HUMAN	CCR4-NOT transcription complex, subunit 8						negative regulation of cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			aaaaaaaaaaGATTCAGATTA	0.169								Direct_reversal_of_damage					4	2	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170668309	170668309	+	Intron	DEL	T	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170668309delT	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc003mbd.2_Intron|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTATAGTGGCTTTTTTTTTTT	0.338			T	TRD@	ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	167342833	167342834	+	IGR	INS	-	A	A	rs10694728		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167342833_167342834insA								RPS6KA2 (67062 upstream) : RNASET2 (174 downstream)																							GTTTAATAGAGAAAAAAAAAAA	0.480													3	4	---	---	---	---	
PHF14	9678	broad.mit.edu	37	7	11013895	11013895	+	5'UTR	DEL	G	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11013895delG	uc003sry.1	+	1					PHF14_uc011jxi.1_5'UTR|PHF14_uc003srz.2_5'UTR|PHF14_uc011jxj.1_5'UTR	NM_014660	NP_055475	O94880	PHF14_HUMAN	PHD finger protein 14 isoform 2								zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		GGCGCTGCCTGGGCTCCTGCA	0.612													6	4	---	---	---	---	
OSBPL3	26031	broad.mit.edu	37	7	24881631	24881631	+	Intron	DEL	A	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24881631delA	uc003sxf.2	-						OSBPL3_uc003sxd.2_Intron|OSBPL3_uc003sxe.2_Intron|OSBPL3_uc003sxg.2_Intron|OSBPL3_uc003sxh.2_Intron|OSBPL3_uc003sxi.2_Intron|OSBPL3_uc003sxj.1_Intron|OSBPL3_uc003sxk.1_Intron	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform						lipid transport		lipid binding|protein binding			skin(1)	1						ggctctgtttaaaaaaaaaaa	0.114													4	2	---	---	---	---	
SNX10	29887	broad.mit.edu	37	7	26411779	26411782	+	Intron	DEL	AATT	-	-	rs111896977		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26411779_26411782delAATT	uc003sxx.2	+						SNX10_uc011jzg.1_Intron|SNX10_uc010kuu.2_Intron|SNX10_uc010kuv.2_Intron|SNX10_uc010kuw.2_Intron	NM_013322	NP_037454	Q9Y5X0	SNX10_HUMAN	sorting nexin 10						cell communication|endosome organization|protein transport	extrinsic to endosome membrane	1-phosphatidylinositol binding				0						ATAATGAAAAAATTAATTGACTGA	0.211													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56231402	56231403	+	IGR	INS	-	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56231402_56231403insA								PSPH (47312 upstream) : DKFZp434L192 (332513 downstream)																							GTGCTGCTGCGAAAAAAAAAAA	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56357562	56357563	+	IGR	INS	-	AAA	AAA			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56357562_56357563insAAA								PSPH (173472 upstream) : DKFZp434L192 (206353 downstream)																							gactccatctcaaaaaaaaaaa	0.158													4	3	---	---	---	---	
SGCE	8910	broad.mit.edu	37	7	94252603	94252603	+	Intron	DEL	A	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94252603delA	uc003unl.2	-						SGCE_uc003unm.2_Intron|SGCE_uc003unn.2_Intron|SGCE_uc011kic.1_Intron|SGCE_uc011kid.1_Intron	NM_003919	NP_003910	O43556	SGCE_HUMAN	sarcoglycan, epsilon isoform 2						cell-matrix adhesion|muscle organ development	cytoplasm|cytoskeleton|integral to plasma membrane|sarcoglycan complex|sarcolemma	calcium ion binding			ovary(1)	1	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TACTTCTTATAAATAAGAAAT	0.274													27	32	---	---	---	---	
DGKI	9162	broad.mit.edu	37	7	137080217	137080218	+	Intron	INS	-	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137080217_137080218insT	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						TTTTTTCCTCCTTTTTCCAAAG	0.480													8	7	---	---	---	---	
HTR5A	3361	broad.mit.edu	37	7	154863449	154863450	+	Intron	INS	-	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154863449_154863450insT	uc003wlu.1	+						uc011kvt.1_5'Flank|uc003wlt.2_5'Flank	NM_024012	NP_076917	P47898	5HT5A_HUMAN	5-hydroxytryptamine receptor 5A							integral to plasma membrane	serotonin receptor activity			ovary(2)|large_intestine(1)	3	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		GAAAATGGAACTTTTTGTGTTT	0.475													14	15	---	---	---	---	
ZNF703	80139	broad.mit.edu	37	8	37554759	37554760	+	Frame_Shift_Del	DEL	GC	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37554759_37554760delGC	uc003xjy.1	+	2	537_538	c.340_341delGC	c.(340-342)GCGfs	p.A114fs		NM_025069	NP_079345	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	114	Poly-Ala.				adherens junction assembly|mammary gland epithelial cell differentiation|negative regulation of homotypic cell-cell adhesion|negative regulation of transcription, DNA-dependent|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of mammary gland epithelial cell proliferation|regulation of canonical Wnt receptor signaling pathway|regulation of cell cycle|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			breast(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			CAACTCGGTGGCGGCGGCGGCC	0.733													7	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	42538760	42538760	+	IGR	DEL	A	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42538760delA								C8orf40 (130621 upstream) : CHRNB3 (13802 downstream)																							aaactccatcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
JAK2	3717	broad.mit.edu	37	9	5080892	5080892	+	Intron	DEL	C	-	-	rs33925764		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5080892delC	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		AAGACCttttctttttttttt	0.139		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				4	2	---	---	---	---	
C9orf43	257169	broad.mit.edu	37	9	116186801	116186801	+	Intron	DEL	T	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116186801delT	uc004bho.3	+						C9orf43_uc004bhp.2_Intron	NM_152786	NP_689999	Q8TAL5	CI043_HUMAN	hypothetical protein LOC257169												0						TATttctttcttttttttttt	0.224													2	4	---	---	---	---	
CIZ1	25792	broad.mit.edu	37	9	130950345	130950347	+	Intron	DEL	CCC	-	-	rs67498296		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130950345_130950347delCCC	uc004btt.2	-						CIZ1_uc004btr.2_Intron|CIZ1_uc004bts.2_Intron|CIZ1_uc011maq.1_Intron|CIZ1_uc004btu.2_Intron|CIZ1_uc011mar.1_Intron|CIZ1_uc011mas.1_Intron|CIZ1_uc004btw.2_Intron|CIZ1_uc004btv.2_Intron|CIZ1_uc004btx.2_Intron	NM_001131016	NP_001124488	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1 isoform							nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4						aaaaaaaaaacccaaaacaaaac	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132547659	132547659	+	IGR	DEL	A	-	-	rs113674544		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132547659delA								PTGES (32315 upstream) : TOR1B (17773 downstream)																							agaaggaaggaaaggaagaaa	0.020													4	2	---	---	---	---	
ASCC1	51008	broad.mit.edu	37	10	73949582	73949582	+	Intron	DEL	G	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73949582delG	uc001jst.1	-						ASCC1_uc001jsr.1_Intron|ASCC1_uc001jss.1_Intron|ASCC1_uc001jsu.1_Intron|ASCC1_uc010qju.1_Intron			Q8N9N2	ASCC1_HUMAN	RecName: Full=Activating signal cointegrator 1 complex subunit 1; AltName: Full=ASC-1 complex subunit p50; AltName: Full=Trip4 complex subunit p50;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	RNA binding				0						aaaaaaaaaagaaCCAAAGAC	0.179													4	2	---	---	---	---	
DEAF1	10522	broad.mit.edu	37	11	678584	678585	+	Intron	INS	-	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:678584_678585insA	uc001lqq.1	-						DEAF1_uc009ycf.1_Intron	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1						embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		AATGCATCAACAAAAACAACAA	0.208													86	53	---	---	---	---	
ANO3	63982	broad.mit.edu	37	11	26677617	26677617	+	Intron	DEL	T	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26677617delT	uc001mqt.3	+						ANO3_uc010rdr.1_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						AATAAAATAATTAGGCTAGAA	0.323													41	26	---	---	---	---	
ABTB2	25841	broad.mit.edu	37	11	34174199	34174203	+	Intron	DEL	AATAC	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34174199_34174203delAATAC	uc001mvl.1	-							NM_145804	NP_665803	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing								DNA binding			central_nervous_system(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				CTCACCCCCAAATACTACCTACCCA	0.580													5	7	---	---	---	---	
OR8B8	26493	broad.mit.edu	37	11	124310284	124310284	+	Frame_Shift_Del	DEL	C	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124310284delC	uc010sal.1	-	1	698	c.698delG	c.(697-699)GGCfs	p.G233fs		NM_012378	NP_036510	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B,	233	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TTTGGACCTGCCCTCCGTGGA	0.463													33	108	---	---	---	---	
SFRS2IP	9169	broad.mit.edu	37	12	46315994	46315994	+	Intron	DEL	G	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46315994delG	uc001rox.2	-						SFRS2IP_uc001row.2_Intron	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,						spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		AAAAAGGGGTGGGGGGTAAAC	0.338													52	38	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	25420207	25420207	+	Intron	DEL	G	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25420207delG	uc001yys.1	+						SNORD115-4_uc001yyu.1_5'Flank					Homo sapiens clone Rt-5 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.																		GTCCCTGGCTGAGCTACTGTA	0.527													98	80	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27633513	27633514	+	Intron	INS	-	G	G	rs111935700		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27633513_27633514insG	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		gaaggaaggaagaaaggaagga	0.104													5	3	---	---	---	---	
SLC12A1	6557	broad.mit.edu	37	15	48521307	48521307	+	Intron	DEL	T	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48521307delT	uc001zwn.3	+						SLC12A1_uc010uew.1_Intron|SLC12A1_uc010bem.2_Intron|SLC12A1_uc010uex.1_Intron|SLC12A1_uc001zwq.3_Intron|SLC12A1_uc001zwr.3_5'UTR	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2						potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	ACACTGTAAATGTTCTCAGAT	0.358													6	3	---	---	---	---	
ARID3B	10620	broad.mit.edu	37	15	74865018	74865018	+	Intron	DEL	A	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74865018delA	uc002aye.2	+						ARID3B_uc002ayc.2_Intron|ARID3B_uc002ayd.2_Intron	NM_006465	NP_006456	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						ATCAAAAGCCAAAAAAAAAAA	0.388													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	101250575	101250580	+	IGR	DEL	GATGGA	-	-	rs111555768	by1000genomes	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101250575_101250580delGATGGA								ASB7 (58673 upstream) : ALDH1A3 (169429 downstream)																							tggaggtcatgatggaggtggaggtg	0.000													3	3	---	---	---	---	
TOP3A	7156	broad.mit.edu	37	17	18196311	18196311	+	Intron	DEL	A	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18196311delA	uc002gsx.1	-						TOP3A_uc010cpz.1_5'Flank|TOP3A_uc010vxr.1_Intron|TOP3A_uc002gsw.1_Intron|TOP3A_uc010vxs.1_Intron	NM_004618	NP_004609	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha						DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(3)	3						CCTGCTTCAGAAAAGTTCTGA	0.478													4	3	---	---	---	---	
SLC47A2	146802	broad.mit.edu	37	17	19608911	19608911	+	Intron	DEL	T	-	-	rs34629869		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19608911delT	uc002gwe.3	-						SLC47A2_uc002gwg.3_Intron|SLC47A2_uc002gwf.3_Intron|SLC47A2_uc002gwh.3_Intron|SLC47A2_uc002gwi.2_Intron|SLC47A2_uc010cqs.1_Intron|SLC47A2_uc010cqt.1_Intron	NM_152908	NP_690872	Q86VL8	S47A2_HUMAN	solute carrier family 47, member 2 isoform 1							integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)					ACTCAGGGGCttttttttttt	0.348													4	2	---	---	---	---	
PSMD11	5717	broad.mit.edu	37	17	30773823	30773823	+	Intron	DEL	T	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30773823delT	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806	O00231	PSD11_HUMAN	proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			TGGCTTAGAGTTTTTTTTTTT	0.274													11	6	---	---	---	---	
TMUB2	79089	broad.mit.edu	37	17	42267718	42267719	+	Intron	DEL	AA	-	-	rs142084473		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42267718_42267719delAA	uc002ifo.2	+						TMUB2_uc002ifp.2_Intron|TMUB2_uc010wiu.1_Intron|TMUB2_uc002ifq.2_Intron|TMUB2_uc002ifr.2_Intron|TMUB2_uc002ifs.2_Intron|TMUB2_uc002ift.2_Intron|TMUB2_uc002ifu.2_Intron|TMUB2_uc002ifv.2_Intron|TMUB2_uc002ifx.2_Intron|TMUB2_uc002ify.2_Intron	NM_001076674	NP_001070142	Q71RG4	TMUB2_HUMAN	transmembrane and ubiquitin-like domain							integral to membrane				lung(1)	1		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		actccgtctcaaaaaaaaaaaa	0.183													9	4	---	---	---	---	
ITGA2B	3674	broad.mit.edu	37	17	42449580	42449581	+	3'UTR	INS	-	G	G			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42449580_42449581insG	uc002igt.1	-	30						NM_000419	NP_000410	P08514	ITA2B_HUMAN	integrin alpha 2b preproprotein						axon guidance|integrin-mediated signaling pathway|platelet activation|platelet degranulation	integrin complex|platelet alpha granule membrane	identical protein binding|receptor activity			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Tirofiban(DB00775)	AGGCAGCAGGAGGGGGGGTAGC	0.564													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43663455	43663456	+	IGR	INS	-	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43663455_43663456insT								LRRC37A4 (67939 upstream) : LOC644172 (14035 downstream)																							TGAGCACCAGCTATCCTGCTGT	0.668													3	3	---	---	---	---	
GPRC5C	55890	broad.mit.edu	37	17	72437119	72437120	+	Intron	INS	-	T	T	rs141781708		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72437119_72437120insT	uc002jks.2	+						GPRC5C_uc002jkp.2_Intron|GPRC5C_uc002jkq.2_Intron|GPRC5C_uc002jkr.2_Intron|GPRC5C_uc002jkt.2_Intron|GPRC5C_uc002jku.2_5'Flank	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,							cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						TAATTTAAAGATTTTTTTTTTT	0.198													2	4	---	---	---	---	
RECQL5	9400	broad.mit.edu	37	17	73626934	73626934	+	Intron	DEL	T	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73626934delT	uc010dgl.2	-						RECQL5_uc010dgk.2_Intron|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1						DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			GGGGGGGGGGTGGTCCTTGGT	0.627								Other_identified_genes_with_known_or_suspected_DNA_repair_function					6	3	---	---	---	---	
RNF213	57674	broad.mit.edu	37	17	78349342	78349343	+	Intron	INS	-	A	A	rs145638043		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78349342_78349343insA	uc002jyh.1	+						uc002jyi.1_Intron|RNF213_uc010dhw.1_Intron	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213											ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			tctactaaaagaaaaaaaaaaa	0.000													3	3	---	---	---	---	
LMAN1	3998	broad.mit.edu	37	18	57000584	57000584	+	Intron	DEL	A	-	-	rs76213902		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57000584delA	uc002lhz.2	-							NM_005570	NP_005561	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1 precursor						blood coagulation|ER to Golgi vesicle-mediated transport|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	mannose binding|metal ion binding|unfolded protein binding			skin(1)	1		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	TACATCATTTAAAAAAAAAAA	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68893051	68893054	+	IGR	DEL	TCTT	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68893051_68893054delTCTT								SOCS6 (895617 upstream) : None (None downstream)																							CATCTGTCTCTCTTTTATTGTTGT	0.373													36	17	---	---	---	---	
ADAMTS10	81794	broad.mit.edu	37	19	8657127	8657128	+	Intron	DEL	AG	-	-	rs35800262		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8657127_8657128delAG	uc002mkj.1	-						ADAMTS10_uc002mki.1_5'Flank|ADAMTS10_uc002mkk.1_Intron	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						ACATGCGAACAGAGTCAGGTTA	0.619													4	2	---	---	---	---	
DLL3	10683	broad.mit.edu	37	19	39991071	39991072	+	Intron	INS	-	A	A	rs72234397		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39991071_39991072insA	uc002olx.2	+						DLL3_uc010egq.2_Intron|DLL3_uc002olw.2_Intron	NM_016941	NP_058637	Q9NYJ7	DLL3_HUMAN	delta-like 3 protein isoform 1 precursor						Notch signaling pathway|skeletal system development	integral to membrane	Notch binding			central_nervous_system(2)|breast(1)	3	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CCCCCCCCCCCCAAAAAAAAGC	0.332													4	2	---	---	---	---	
EMILIN3	90187	broad.mit.edu	37	20	39991783	39991784	+	Intron	INS	-	T	T			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39991783_39991784insT	uc002xjy.1	-							NM_052846	NP_443078	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3							proteinaceous extracellular matrix				ovary(1)	1		Myeloproliferative disorder(115;0.00425)				ACtttctgttcttttttttttt	0.272													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9865569	9865570	+	IGR	INS	-	A	A	rs77497487	by1000genomes	TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9865569_9865570insA								None (None upstream) : None (None downstream)																							CTGCTGAGTTTAAATCTTCCTT	0.490													4	2	---	---	---	---	
IGSF5	150084	broad.mit.edu	37	21	41137379	41137379	+	Intron	DEL	G	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41137379delG	uc002yyo.2	+							NM_001080444	NP_001073913	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily 5 like							integral to membrane|tight junction					0		Prostate(19;5.35e-06)				GGTTACCACTGGTAAATACAG	0.468													13	13	---	---	---	---	
CASK	8573	broad.mit.edu	37	X	41607755	41607755	+	Intron	DEL	C	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41607755delC	uc004dfl.3	-						CASK_uc004dfm.3_Intron|CASK_uc004dfn.3_Intron	NM_003688	NP_003679	O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein						cell adhesion	actin cytoskeleton|cytoplasm|nucleus|plasma membrane	ATP binding|calmodulin binding|guanylate kinase activity|protein serine/threonine kinase activity			ovary(3)|lung(2)|stomach(1)	6						CTGTTCCTATCCCACCAGTTT	0.433													2	18	---	---	---	---	
DIAPH2	1730	broad.mit.edu	37	X	96194492	96194515	+	Intron	DEL	TATATATGTATATATATATGTATG	-	-	rs72476044		TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96194492_96194515delTATATATGTATATATATATGTATG	uc004efu.3	+						DIAPH2_uc004eft.3_Intron	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156						cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						tgtatgtatatatatatgtatatatatatgtatgtatatatata	0.107													8	4	---	---	---	---	
GUCY2F	2986	broad.mit.edu	37	X	108684864	108684865	+	Intron	INS	-	A	A			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108684864_108684865insA	uc004eod.3	-						GUCY2F_uc011msq.1_Intron	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor						intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						TCCTTCTGAACTTTTTTTTTCA	0.347													8	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13483364	13483364	+	IGR	DEL	T	-	-			TCGA-60-2722-01	TCGA-60-2722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13483364delT								None (None upstream) : None (None downstream)																							tctgtcacaattcccctttag	0.000													6	4	---	---	---	---	
