Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
C1orf159	54991	broad.mit.edu	37	1	1019531	1019531	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1019531C>A	uc001act.2	-	11	1298	c.812G>T	c.(811-813)TGG>TTG	p.W271L	C1orf159_uc001acu.2_Intron|C1orf159_uc001acr.2_Intron|C1orf159_uc001acs.2_Intron|C1orf159_uc010nyd.1_Intron|C1orf159_uc001acm.2_Intron|C1orf159_uc009vju.1_Intron|C1orf159_uc001acn.2_Missense_Mutation_p.W235L|C1orf159_uc001acp.2_Intron	NM_017891	NP_060361	Q96HA4	CA159_HUMAN	hypothetical protein LOC54991	271	Pro-rich.					integral to membrane					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.96e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.77e-22)|Colorectal(212;6.51e-05)|COAD - Colon adenocarcinoma(227;0.000214)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		GGGCGCCGGCCAAATCCAGCT	0.672													12	46	---	---	---	---	PASS
AJAP1	55966	broad.mit.edu	37	1	4834483	4834483	+	Intron	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4834483G>C	uc001alm.1	+						AJAP1_uc001aln.2_Intron	NM_001042478	NP_001035943	Q9UKB5	AJAP1_HUMAN	adherens junction associated protein 1						cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		TCTGTTCACCGCAGACCCTCC	0.522													21	98	---	---	---	---	PASS
NOL9	79707	broad.mit.edu	37	1	6592658	6592658	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6592658C>G	uc001ans.2	-	8	1419	c.1400G>C	c.(1399-1401)CGA>CCA	p.R467P	NOL9_uc010nzs.1_RNA	NM_024654	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	467					maturation of 5.8S rRNA	nucleolus	ATP binding|polynucleotide 5'-hydroxyl-kinase activity|RNA binding			skin(1)	1	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGAAACGTCGATTTCTCAT	0.423													58	217	---	---	---	---	PASS
UBE4B	10277	broad.mit.edu	37	1	10197268	10197268	+	Intron	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10197268G>T	uc001aqs.3	+						UBE4B_uc001aqr.3_Intron|UBE4B_uc010oai.1_Intron|UBE4B_uc010oaj.1_Intron|UBE4B_uc001aqt.1_Intron	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1						apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CAATAGGTATGTGCCATGATA	0.512													46	157	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10336408	10336408	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10336408G>T	uc001aqx.3	+	12	1190	c.988G>T	c.(988-990)GCT>TCT	p.A330S	KIF1B_uc001aqv.3_Missense_Mutation_p.A324S|KIF1B_uc001aqw.3_Missense_Mutation_p.A324S|KIF1B_uc001aqy.2_Missense_Mutation_p.A330S|KIF1B_uc001aqz.2_Missense_Mutation_p.A330S|KIF1B_uc001ara.2_Missense_Mutation_p.A330S|KIF1B_uc001arb.2_Missense_Mutation_p.A330S	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	330	Kinesin-motor.|Interaction with KBP.				anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AATGGTTGCTGCTCTGAGCCC	0.398													14	62	---	---	---	---	PASS
TNFRSF8	943	broad.mit.edu	37	1	12175713	12175713	+	Silent	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12175713A>G	uc001atq.2	+	8	1095	c.873A>G	c.(871-873)ACA>ACG	p.T291T	TNFRSF8_uc010obc.1_Silent_p.T180T	NM_001243	NP_001234	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily,	291	Extracellular (Potential).|TNFR-Cys 6.				cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGTGCCACATCAGCCACCA	0.592													28	122	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12401886	12401886	+	Silent	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12401886G>C	uc001atv.2	+	41	8817	c.8676G>C	c.(8674-8676)CTG>CTC	p.L2892L	VPS13D_uc001atw.2_Silent_p.L2867L|VPS13D_uc001atx.2_Silent_p.L2079L	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	2891					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CCTTTGCTCTGAGGAACCACA	0.552													38	171	---	---	---	---	PASS
PRAMEF2	65122	broad.mit.edu	37	1	12921377	12921377	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12921377T>C	uc001aum.1	+	4	1255	c.1168T>C	c.(1168-1170)TCT>CCT	p.S390P		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	390											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CAATTGCATGTCTATTGACGC	0.562													52	185	---	---	---	---	PASS
CNR2	1269	broad.mit.edu	37	1	24201704	24201704	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24201704A>T	uc001bif.2	-	2	531	c.404T>A	c.(403-405)CTG>CAG	p.L135Q		NM_001841	NP_001832	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	135	Cytoplasmic (Potential).				behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity			skin(2)|central_nervous_system(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Nabilone(DB00486)	TGGATAGCGCAGGCAGAGGTA	0.582													27	112	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34401428	34401428	+	Silent	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34401428G>A	uc001bxn.1	-	4	554	c.525C>T	c.(523-525)GCC>GCT	p.A175A	CSMD2_uc001bxm.1_Silent_p.A215A	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	175	Sushi 1.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AGGTGAGCACGGCGTGGCCCT	0.632													23	69	---	---	---	---	PASS
GJA4	2701	broad.mit.edu	37	1	35260622	35260622	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35260622G>T	uc001bya.2	+	2	896	c.808G>T	c.(808-810)GGC>TGC	p.G270C	GJA4_uc009vul.2_Missense_Mutation_p.G346C|GJA4_uc009vum.1_Missense_Mutation_p.G270C	NM_002060	NP_002051	P35212	CXA4_HUMAN	connexin 37	270	Cytoplasmic (Potential).				cell-cell junction assembly	integral to plasma membrane				central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				CCTCCCCGTGGGCCAGGGGCC	0.652													12	31	---	---	---	---	PASS
ZMYM1	79830	broad.mit.edu	37	1	35580300	35580300	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35580300A>T	uc001bym.2	+	11	3017	c.2869A>T	c.(2869-2871)ACT>TCT	p.T957S	ZMYM1_uc001byn.2_Missense_Mutation_p.T957S|ZMYM1_uc010ohu.1_Missense_Mutation_p.T938S|ZMYM1_uc001byo.2_Missense_Mutation_p.T597S|ZMYM1_uc009vut.2_Missense_Mutation_p.T882S	NM_024772	NP_079048	Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM domain containing 1	957						nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GTTTTTTCCTACTTCAACAGA	0.259													10	41	---	---	---	---	PASS
KIAA0754	643314	broad.mit.edu	37	1	39878642	39878642	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39878642C>G	uc009vvt.1	+	1	3467	c.2705C>G	c.(2704-2706)TCA>TGA	p.S902*	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	NM_015038	NP_055853	O94854	K0754_HUMAN	hypothetical protein LOC643314	766	Ala-rich.										0	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCTGCAGTATCAGCCCCAGAG	0.537													3	18	---	---	---	---	PASS
HIVEP3	59269	broad.mit.edu	37	1	42048060	42048060	+	Silent	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42048060G>A	uc001cgz.3	-	4	3622	c.2409C>T	c.(2407-2409)ACC>ACT	p.T803T	HIVEP3_uc001cha.3_Silent_p.T803T|HIVEP3_uc001cgy.2_RNA	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer	803	Ser-rich.|No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN (By similarity).				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CAAAGGAGCTGGTGTGCTGGA	0.567													40	95	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43777413	43777413	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43777413G>C	uc001ciu.2	+	10	1484	c.1405G>C	c.(1405-1407)GTC>CTC	p.V469L	TIE1_uc010okd.1_Missense_Mutation_p.V469L|TIE1_uc010oke.1_Missense_Mutation_p.V424L|TIE1_uc009vwq.2_Missense_Mutation_p.V425L|TIE1_uc010okf.1_Missense_Mutation_p.V114L|TIE1_uc010okg.1_Missense_Mutation_p.V114L	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	469	Extracellular (Potential).|Fibronectin type-III 1.				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTCCCCGCTGGTCTCGTTCTC	0.647													16	90	---	---	---	---	PASS
FAM159A	348378	broad.mit.edu	37	1	53122610	53122610	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53122610C>T	uc001cuf.2	+	3	571	c.471C>T	c.(469-471)CTC>CTT	p.L157L	FAM159A_uc001cug.1_Intron|FAM159A_uc001cuh.2_Intron	NM_001042693	NP_001036158	Q6UWV7	F159A_HUMAN	hypothetical protein LOC348378	157						integral to membrane					0						CCAAACGCCTCCTCCATCATT	0.572													79	247	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67147612	67147612	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67147612A>G	uc001dcr.2	+	15	1092	c.875A>G	c.(874-876)GAC>GGC	p.D292G	SGIP1_uc010opd.1_Intron|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron|SGIP1_uc009wat.2_Missense_Mutation_p.D59G	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	292	Pro-rich.				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						AATGACTTGGACAGCATTTTT	0.403													50	247	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75107037	75107037	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75107037C>T	uc001dgg.2	-	5	641	c.422G>A	c.(421-423)GGA>GAA	p.G141E		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	141										ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						ACTGGAATGTCCTTCATCAAC	0.423													43	140	---	---	---	---	PASS
TTLL7	79739	broad.mit.edu	37	1	84403661	84403661	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84403661G>T	uc001djc.2	-	8	1158	c.762C>A	c.(760-762)AAC>AAA	p.N254K	TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_RNA|TTLL7_uc001dje.2_RNA|TTLL7_uc001djf.2_Intron|TTLL7_uc001djg.2_RNA	NM_024686	NP_078962	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	254	TTL.				cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity			ovary(1)	1				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		CATTATGCTTGTTCACGGAGT	0.398													53	166	---	---	---	---	PASS
SAMD13	148418	broad.mit.edu	37	1	84791331	84791331	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84791331A>G	uc001djr.2	+	3	299	c.107A>G	c.(106-108)AAT>AGT	p.N36S	SAMD13_uc010orw.1_Missense_Mutation_p.N22S|SAMD13_uc010orx.1_Missense_Mutation_p.N22S	NM_001010971	NP_001010971	Q5VXD3	SAM13_HUMAN	sterile alpha motif domain containing 13 isoform	42											0				all cancers(265;0.00667)|Epithelial(280;0.0219)|OV - Ovarian serous cystadenocarcinoma(397;0.136)		TCCATGGAAAATGGGAGACCA	0.517													19	76	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91779026	91779026	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91779026T>C	uc001doa.3	-	30	3371	c.3271A>G	c.(3271-3273)ACA>GCA	p.T1091A	HFM1_uc009wdb.2_RNA|HFM1_uc010osu.1_Missense_Mutation_p.T770A|HFM1_uc001dob.3_Missense_Mutation_p.T279A|HFM1_uc010osv.1_Missense_Mutation_p.T775A	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	1091	SEC63.						ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TAAAAGACTGTAAGTTTCTGC	0.308													31	119	---	---	---	---	PASS
FNBP1L	54874	broad.mit.edu	37	1	94016691	94016691	+	3'UTR	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94016691G>T	uc001dpw.2	+	14					FNBP1L_uc001dpv.2_Intron|FNBP1L_uc010otk.1_Intron|FNBP1L_uc010otl.1_Intron	NM_001024948	NP_001020119	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like isoform 1						endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	lipid binding				0		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		AAACTAACCAGGCACCTTTGT	0.378													6	27	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94490552	94490552	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94490552G>A	uc001dqh.2	-	31	4696	c.4592C>T	c.(4591-4593)TCC>TTC	p.S1531F		NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	1531	Extracellular.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CAAGAAGTCGGAGATGTTCCT	0.428													32	131	---	---	---	---	PASS
SARS	6301	broad.mit.edu	37	1	109779943	109779943	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109779943G>C	uc001dwu.1	+	10	1410	c.1335G>C	c.(1333-1335)CAG>CAC	p.Q445H	SARS_uc001dwv.1_Missense_Mutation_p.Q470H|SARS_uc001dww.1_Missense_Mutation_p.Q378H|SARS_uc001dwx.1_Missense_Mutation_p.Q397H|SARS_uc009wfa.1_Intron|SARS_uc001dwy.1_Missense_Mutation_p.Q270H|SARS_uc001dwz.1_Missense_Mutation_p.Q270H	NM_006513	NP_006504	P49591	SYSC_HUMAN	seryl-tRNA synthetase	445					seryl-tRNA aminoacylation|tRNA processing	cytosol	ATP binding|protein binding|RNA binding|serine-tRNA ligase activity			central_nervous_system(1)	1		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	AGAACTACCAGACAGAGAAGG	0.522													28	117	---	---	---	---	PASS
AHCYL1	10768	broad.mit.edu	37	1	110557398	110557398	+	Silent	SNP	C	T	T	rs144479834	byFrequency	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110557398C>T	uc001dyx.2	+	6	961	c.594C>T	c.(592-594)TTC>TTT	p.F198F	AHCYL1_uc010ovw.1_Silent_p.F151F|AHCYL1_uc001dyy.2_Silent_p.F151F|AHCYL1_uc010ovx.1_Silent_p.F151F	NM_006621	NP_006612	O43865	SAHH2_HUMAN	S-adenosylhomocysteine hydrolase-like 1	198					one-carbon metabolic process	endoplasmic reticulum	adenosylhomocysteinase activity			ovary(1)	1		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		TTGCAGTGTTCGCTTGGAAGG	0.458													21	82	---	---	---	---	PASS
C1orf103	55791	broad.mit.edu	37	1	111494237	111494237	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111494237C>G	uc001eaa.2	-	2	1525	c.1269G>C	c.(1267-1269)CAG>CAC	p.Q423H	C1orf103_uc001dzz.2_Intron|C1orf103_uc001eab.2_Intron|C1orf103_uc001eac.1_Intron	NM_018372	NP_060842	Q5T3J3	LRIF1_HUMAN	receptor-interacting factor 1 isoform 1	423					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	protein binding				0		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)		TTGTCTCCATCTGGGAAGATT	0.403													106	371	---	---	---	---	PASS
PHGDH	26227	broad.mit.edu	37	1	120254795	120254795	+	Intron	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120254795G>C	uc001ehz.2	+						PHGDH_uc009whl.2_Intron|PHGDH_uc009whm.2_Intron|PHGDH_uc001eia.2_Intron|PHGDH_uc009whn.2_Intron	NM_006623	NP_006614	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase						brain development|L-serine biosynthetic process		electron carrier activity|NAD binding|phosphoglycerate dehydrogenase activity			ovary(1)	1	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)	NADH(DB00157)	TAAGGCGAGAGAGAGAAAATT	0.572													12	23	---	---	---	---	PASS
HMGCS2	3158	broad.mit.edu	37	1	120295926	120295926	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120295926C>A	uc001eid.2	-	7	1322	c.1271G>T	c.(1270-1272)CGA>CTA	p.R424L	HMGCS2_uc010oxj.1_Missense_Mutation_p.R382L|HMGCS2_uc001eie.2_Missense_Mutation_p.R332L	NM_005518	NP_005509	P54868	HMCS2_HUMAN	hydroxymethylglutaryl-CoA synthase 2 isoform 1	424					acetoacetic acid biosynthetic process|cholesterol biosynthetic process|isoprenoid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA synthase activity			ovary(2)	2	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		CTGGGATACTCGAAATGAAAA	0.478													10	39	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152191986	152191986	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152191986A>T	uc001ezt.1	-	3	2195	c.2119T>A	c.(2119-2121)TCA>ACA	p.S707T		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	707	7.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACTGCCCTGAGCCAGACTTG	0.562													51	204	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152282838	152282838	+	Silent	SNP	T	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152282838T>G	uc001ezu.1	-	3	4560	c.4524A>C	c.(4522-4524)TCA>TCC	p.S1508S		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1508	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCTATCTACTGATTGCTCGT	0.582									Ichthyosis				141	150	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152284000	152284000	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152284000A>G	uc001ezu.1	-	3	3398	c.3362T>C	c.(3361-3363)GTG>GCG	p.V1121A	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1121	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGAGTGCTCACCTGGTAGAT	0.607									Ichthyosis				137	146	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152325501	152325501	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152325501C>T	uc001ezw.3	-	3	4834	c.4761G>A	c.(4759-4761)GGG>GGA	p.G1587G	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1587							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTGTGAGCCCCCTGAGTGCA	0.517													117	359	---	---	---	---	PASS
CHRNB2	1141	broad.mit.edu	37	1	154544213	154544213	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154544213T>C	uc001ffg.2	+	5	1178	c.914T>C	c.(913-915)ATG>ACG	p.M305T		NM_000748	NP_000739	P17787	ACHB2_HUMAN	neuronal nicotinic acetylcholine receptor beta 2	305	Helical; (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Nicotine(DB00184)	ATGTTCACCATGGTGCTTGTC	0.632													17	95	---	---	---	---	PASS
ADAR	103	broad.mit.edu	37	1	154560745	154560745	+	Intron	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154560745G>A	uc001ffh.2	-						ADAR_uc001ffj.2_Intron|ADAR_uc001ffi.2_Intron|ADAR_uc001ffk.2_Intron	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a						adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		CTGAAAAACAGGGGTGGCTGT	0.517													41	195	---	---	---	---	PASS
FCRL2	79368	broad.mit.edu	37	1	157716699	157716699	+	Intron	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157716699A>T	uc001fre.2	-						FCRL2_uc001frd.2_Intron|FCRL2_uc010phz.1_Intron|FCRL2_uc009wsp.2_Intron	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor						cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCTGTTAAGGAAAAAGTAATA	0.408													34	103	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157771929	157771929	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157771929A>T	uc001frg.2	-	5	775	c.662T>A	c.(661-663)GTG>GAG	p.V221E	FCRL1_uc001frf.2_RNA|FCRL1_uc001frh.2_Missense_Mutation_p.V221E|FCRL1_uc001fri.2_Missense_Mutation_p.V221E|FCRL1_uc001frj.2_RNA	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	221	Ig-like C2-type 3.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CACATCCTCCACTGCAGCCTG	0.592													22	62	---	---	---	---	PASS
PBX1	5087	broad.mit.edu	37	1	164769081	164769081	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164769081C>T	uc001gct.2	+	4	914	c.656C>T	c.(655-657)ACG>ATG	p.T219M	PBX1_uc010pku.1_Missense_Mutation_p.T219M|PBX1_uc010pkv.1_Missense_Mutation_p.T136M|PBX1_uc001gcs.2_Missense_Mutation_p.T219M|PBX1_uc010pkw.1_Missense_Mutation_p.T109M	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	219					negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						AAGCAGAGCACGTGCGAGGCG	0.607			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								14	38	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169529825	169529825	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169529825C>T	uc001ggg.1	-	4	698	c.553G>A	c.(553-555)GGG>AGG	p.G185R	F5_uc010plr.1_RNA	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	185	F5/8 type A 1.|Plastocyanin-like 1.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	CCAATCAGCCCCGAGTTGAAA	0.468													34	150	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	180063614	180063614	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180063614G>C	uc001gnt.2	+	34	8757	c.8374G>C	c.(8374-8376)GAC>CAC	p.D2792H	CEP350_uc009wxl.2_Missense_Mutation_p.D2791H|CEP350_uc001gnv.2_Missense_Mutation_p.D927H|CEP350_uc001gnw.1_Missense_Mutation_p.D549H|CEP350_uc001gnx.1_Missense_Mutation_p.D549H	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	2792						centrosome|nucleus|spindle				ovary(4)	4						TCTTGGTGATGACCAAAAGAA	0.383													15	49	---	---	---	---	PASS
RGS1	5996	broad.mit.edu	37	1	192548421	192548421	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192548421T>G	uc001gsi.1	+	5	665	c.599T>G	c.(598-600)CTA>CGA	p.L200R		NM_002922	NP_002913	Q08116	RGS1_HUMAN	regulator of G-protein signalling 1	200	RGS.				immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|negative regulation of signal transduction	cytoplasm|plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity				0		Breast(1374;0.188)				TTAAATCTTCTAAATGACCTG	0.418													17	103	---	---	---	---	PASS
B3GALT2	8707	broad.mit.edu	37	1	193150016	193150016	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193150016T>G	uc001gtc.3	-	2	1392	c.677A>C	c.(676-678)AAT>ACT	p.N226T	CDC73_uc001gtb.2_Intron	NM_003783	NP_003774	O43825	B3GT2_HUMAN	UDP-Gal:betaGlcNAc beta	226	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)	1						AATGGTCAAATTATAGTACGT	0.343													35	105	---	---	---	---	PASS
CFHR4	10877	broad.mit.edu	37	1	196871618	196871618	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196871618C>A	uc001gto.2	+	2	198	c.129C>A	c.(127-129)TAC>TAA	p.Y43*	CFHR4_uc009wyy.2_Nonsense_Mutation_p.Y42*|CFHR4_uc001gtp.2_Nonsense_Mutation_p.Y43*	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	43	Sushi 1.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						GTAGACTATACTTTCCAGCAG	0.338													46	194	---	---	---	---	PASS
F13B	2165	broad.mit.edu	37	1	197021830	197021830	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197021830G>A	uc001gtt.1	-	9	1533	c.1489C>T	c.(1489-1491)CCA>TCA	p.P497S		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	497	Sushi 8.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TCAGACAATGGGGTTAATGGA	0.318													33	104	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197390692	197390692	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197390692G>T	uc001gtz.2	+	6	1869	c.1734G>T	c.(1732-1734)GTG>GTT	p.V578V	CRB1_uc010poz.1_Silent_p.V509V|CRB1_uc010ppa.1_Intron|CRB1_uc009wza.2_Silent_p.V466V|CRB1_uc010ppb.1_Silent_p.V578V|CRB1_uc010ppc.1_Intron|CRB1_uc010ppd.1_Silent_p.V59V|CRB1_uc001gub.1_Silent_p.V227V	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	578	Extracellular (Potential).|Laminin G-like 1.		V -> E (in RP12).		cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						CAGAGGCTGTGACCCTTACCT	0.443													43	181	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198704329	198704329	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198704329A>G	uc001gur.1	+	23	2525	c.2345A>G	c.(2344-2346)AAC>AGC	p.N782S	PTPRC_uc001gus.1_Missense_Mutation_p.N734S|PTPRC_uc001gut.1_Missense_Mutation_p.N621S|PTPRC_uc010ppg.1_Missense_Mutation_p.N718S	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	782	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						GTAAAGATCAACCAGCACAAA	0.308													16	37	---	---	---	---	PASS
DDX59	83479	broad.mit.edu	37	1	200635655	200635655	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200635655C>G	uc009wzk.2	-	2	457	c.214G>C	c.(214-216)GTT>CTT	p.V72L	DDX59_uc010ppl.1_Missense_Mutation_p.V72L	NM_001031725	NP_001026895	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	72						intracellular	ATP binding|ATP-dependent helicase activity|metal ion binding|RNA binding			ovary(2)|breast(1)|central_nervous_system(1)	4						ACTGAATGAACCTCTGCCAAC	0.542													33	143	---	---	---	---	PASS
MYOG	4656	broad.mit.edu	37	1	203054989	203054989	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203054989C>G	uc001gzd.2	-	1	389	c.101G>C	c.(100-102)GGC>GCC	p.G34A		NM_002479	NP_002470	P15173	MYOG_HUMAN	myogenin	34					muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter	transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity			skin(2)	2						CCGCTCGTAGCCTGGTGGTTC	0.642													30	76	---	---	---	---	PASS
ADORA1	134	broad.mit.edu	37	1	203134447	203134447	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203134447C>T	uc001gze.1	+	4	833	c.400C>T	c.(400-402)CTC>TTC	p.L134F	FMOD_uc010pqi.1_Intron|ADORA1_uc001gzf.1_Missense_Mutation_p.L134F|ADORA1_uc010pqg.1_Missense_Mutation_p.L66F|ADORA1_uc009xak.1_Missense_Mutation_p.P59L|ADORA1_uc010pqh.1_Missense_Mutation_p.L167F	NM_000674	NP_000665	P30542	AA1R_HUMAN	adenosine A1 receptor	134	Helical; Name=4; (Potential).				induction of apoptosis by extracellular signals|inflammatory response|nervous system development|phagocytosis	integral to plasma membrane				large_intestine(1)	1					Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Gabapentin(DB00996)|Imipramine(DB00458)|Pegademase bovine(DB00061)|Theophylline(DB00277)	CTGCTGGATCCTCTCCTTCGT	0.657													10	36	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204955131	204955131	+	Intron	SNP	G	A	A	rs138795461	byFrequency	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204955131G>A	uc001hbj.2	+						NFASC_uc010pra.1_Missense_Mutation_p.V890M|NFASC_uc001hbi.2_Missense_Mutation_p.V890M|NFASC_uc010prb.1_Missense_Mutation_p.V905M|NFASC_uc010prc.1_Missense_Mutation_p.V461M|NFASC_uc001hbk.1_Missense_Mutation_p.V700M|NFASC_uc001hbl.1_Intron|NFASC_uc001hbm.1_5'Flank|NFASC_uc001hbn.1_5'Flank	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor						axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCTCCGTGGCGTGGTGTCCCG	0.587													14	50	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215813994	215813994	+	Silent	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215813994G>A	uc001hku.1	-	68	15261	c.14874C>T	c.(14872-14874)AAC>AAT	p.N4958N		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4958	Fibronectin type-III 35.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCAGTTGGCCGTTCAGGAGGA	0.547										HNSCC(13;0.011)			25	64	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215848658	215848658	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215848658C>G	uc001hku.1	-	63	12982	c.12595G>C	c.(12595-12597)GCT>CCT	p.A4199P		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4199	Extracellular (Potential).|Fibronectin type-III 27.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTTCCCCAAGCTTTTCCCTCG	0.418										HNSCC(13;0.011)			42	160	---	---	---	---	PASS
IARS2	55699	broad.mit.edu	37	1	220298569	220298569	+	Intron	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220298569C>T	uc001hmc.2	+							NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN	mitochondrial isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	CCATGTCCCCCCTGAAATAGC	0.353													7	73	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228563434	228563434	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228563434C>A	uc009xez.1	+	98	22739	c.22695C>A	c.(22693-22695)ATC>ATA	p.I7565I	OBSCN_uc001hsr.1_Silent_p.I2194I	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	7565	Fibronectin type-III 4.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GCCCGGATATCGGGGAGGTGT	0.617													8	18	---	---	---	---	PASS
EGLN1	54583	broad.mit.edu	37	1	231503323	231503323	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231503323T>C	uc001huv.2	-	4	4364	c.1208A>G	c.(1207-1209)TAT>TGT	p.Y403C	EGLN1_uc001huu.3_Missense_Mutation_p.Y105C	NM_022051	NP_071334	Q9GZT9	EGLN1_HUMAN	egl nine homolog 1	403					negative regulation of sequence-specific DNA binding transcription factor activity|oxygen homeostasis|response to hypoxia	cytosol	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptidyl-proline dioxygenase activity|protein binding|zinc ion binding				0		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)			Vitamin C(DB00126)	ACCTGTTAGATATTTTACTTT	0.373													40	173	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236908036	236908036	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236908036G>T	uc001hyf.2	+	12	1570	c.1366G>T	c.(1366-1368)GAC>TAC	p.D456Y	ACTN2_uc001hyg.2_Missense_Mutation_p.D248Y|ACTN2_uc009xgi.1_Missense_Mutation_p.D456Y|ACTN2_uc010pxu.1_Missense_Mutation_p.D145Y|ACTN2_uc001hyh.2_Missense_Mutation_p.D144Y	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	456	Spectrin 2.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			AGCGCACCAGGACCGCGTGGA	0.647													17	49	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236920893	236920893	+	Silent	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236920893G>A	uc001hyf.2	+	18	2466	c.2262G>A	c.(2260-2262)CAG>CAA	p.Q754Q	ACTN2_uc001hyg.2_Silent_p.Q546Q|ACTN2_uc009xgi.1_Silent_p.Q754Q|ACTN2_uc010pxu.1_Silent_p.Q443Q|ACTN2_uc001hyh.2_Silent_p.Q442Q	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	754	EF-hand 1.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CCCAGGAGCAGATGAATGAGT	0.483													28	88	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240370951	240370951	+	Missense_Mutation	SNP	C	T	T	rs150891575	byFrequency	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240370951C>T	uc010pyd.1	+	5	3064	c.2839C>T	c.(2839-2841)CCT>TCT	p.P947S	FMN2_uc010pye.1_Missense_Mutation_p.P951S	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	947	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TCCTCCGCCCCCTCTACCCGG	0.692													17	45	---	---	---	---	PASS
TRIM58	25893	broad.mit.edu	37	1	248031147	248031147	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248031147G>T	uc001ido.2	+	4	796	c.748G>T	c.(748-750)GGT>TGT	p.G250C	OR2W3_uc001idp.1_5'Flank	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58	250						intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TCCTTTTCAGGGTGTGAGAGG	0.463													22	82	---	---	---	---	PASS
OR2W3	343171	broad.mit.edu	37	1	248059533	248059533	+	Silent	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248059533G>C	uc001idp.1	+	3	914	c.645G>C	c.(643-645)CTG>CTC	p.L215L	OR2W3_uc010pzb.1_Silent_p.L215L	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W,	215	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|pancreas(1)	3	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGTTTATCCTGCTCTCTTACA	0.582													68	231	---	---	---	---	PASS
GRHL1	29841	broad.mit.edu	37	2	10130886	10130886	+	Intron	SNP	T	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10130886T>G	uc002raa.2	+						GRHL1_uc002rab.2_RNA|GRHL1_uc002rad.2_Intron|GRHL1_uc010yjb.1_Intron	NM_198182	NP_937825	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1						cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding			pancreas(1)|skin(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		GCAAGTGTCCTGACCCCAGCT	0.468													26	28	---	---	---	---	PASS
WDR35	57539	broad.mit.edu	37	2	20174337	20174337	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20174337T>G	uc002rdi.2	-	7	736	c.628A>C	c.(628-630)ATT>CTT	p.I210L	WDR35_uc002rdj.2_Missense_Mutation_p.I210L|WDR35_uc010ext.2_RNA|WDR35_uc002rdh.2_5'UTR	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	210										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TACCAATGAATTCCAGCAATG	0.368													40	38	---	---	---	---	PASS
PUM2	23369	broad.mit.edu	37	2	20463042	20463042	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20463042C>A	uc002rds.1	-	13	2160	c.2137G>T	c.(2137-2139)GAT>TAT	p.D713Y	PUM2_uc002rdq.1_Missense_Mutation_p.D90Y|PUM2_uc002rdt.1_Missense_Mutation_p.D713Y|PUM2_uc002rdr.2_Missense_Mutation_p.D573Y|PUM2_uc010yjy.1_Missense_Mutation_p.D634Y|PUM2_uc002rdu.1_Missense_Mutation_p.D713Y|PUM2_uc010yjz.1_Missense_Mutation_p.D652Y	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2	713	PUM-HD.				regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTCTGAAATCTTCCAATAAT	0.438													62	65	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32730095	32730095	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32730095A>T	uc010ezu.2	+	50	9657	c.9523A>T	c.(9523-9525)ACT>TCT	p.T3175S		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	3175					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TAGCAGTCCTACTGCCCAACC	0.408													20	33	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43927520	43927520	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43927520G>T	uc010yny.1	+	8	1506	c.1423G>T	c.(1423-1425)GCT>TCT	p.A475S	PLEKHH2_uc002rte.3_Missense_Mutation_p.A475S|PLEKHH2_uc002rtf.3_Missense_Mutation_p.A474S	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	475						cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AAATAGAAACGCTATAAGCAT	0.408													150	165	---	---	---	---	PASS
REG1A	5967	broad.mit.edu	37	2	79350273	79350273	+	Splice_Site	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79350273G>C	uc002snz.2	+	6	537	c.434_splice	c.e6-1	p.G145_splice	REG1A_uc010ysd.1_Splice_Site_p.G145_splice	NM_002909	NP_002900	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha precursor						positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding				0						TTGACTTATAGGATTCCAGAA	0.413													54	58	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	79971590	79971590	+	Silent	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79971590A>G	uc010ysh.1	+	2	185	c.180A>G	c.(178-180)CTA>CTG	p.L60L	CTNNA2_uc010yse.1_Silent_p.L60L|CTNNA2_uc010ysf.1_Silent_p.L60L|CTNNA2_uc010ysg.1_Silent_p.L60L	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	60					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						CCCATGTACTAGCTGCCTCTG	0.438													23	29	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90108944	90108944	+	Intron	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90108944A>T	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		CTCATCAAGTATGCTTCCCAG	0.517													73	66	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90260137	90260137	+	RNA	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90260137C>T	uc010fhm.2	+	30		c.4120C>T								Parts of antibodies, mostly variable regions.																		AAAGTGGGGTCCCATCAAGGT	0.468													149	168	---	---	---	---	PASS
ADRA2B	151	broad.mit.edu	37	2	96781149	96781149	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96781149T>C	uc002svi.2	-	1	740	c.740A>G	c.(739-741)AAC>AGC	p.N247S		NM_000682	NP_000673	P18089	ADA2B_HUMAN	alpha-2B-adrenergic receptor	247	Cytoplasmic (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation	integral to plasma membrane	alpha2-adrenergic receptor activity|epinephrine binding|protein binding			ovary(2)|lung(1)	3					Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)	CGAGTGTCCGTTGACCTCTCT	0.647													6	29	---	---	---	---	PASS
TMEM182	130827	broad.mit.edu	37	2	103414439	103414439	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103414439G>A	uc010fjb.2	+	4	636	c.449G>A	c.(448-450)GGA>GAA	p.G150E	TMEM182_uc002tcc.3_Missense_Mutation_p.G107E|TMEM182_uc002tcd.3_Missense_Mutation_p.G54E|TMEM182_uc010ywe.1_RNA	NM_144632	NP_653233	Q6ZP80	TM182_HUMAN	transmembrane protein 182 precursor	150	Cytoplasmic (Potential).					integral to membrane					0						AAAGCTGGGGGAGGCTCATAT	0.478													22	140	---	---	---	---	PASS
IL1A	3552	broad.mit.edu	37	2	113537242	113537242	+	Silent	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113537242T>C	uc002tig.2	-	5	1281	c.321A>G	c.(319-321)GAA>GAG	p.E107E		NM_000575	NP_000566	P01583	IL1A_HUMAN	interleukin 1, alpha proprotein	107					anti-apoptosis|apoptosis|cell proliferation|cellular response to heat|cytokine-mediated signaling pathway|fever generation|immune response|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of cell division|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of mitosis|positive regulation vascular endothelial growth factor production|response to copper ion	cytosol|extracellular space	copper ion binding|cytokine activity|interleukin-1 receptor binding			lung(1)	1						GCTTGATGATTTCTAAAACCA	0.383													25	73	---	---	---	---	PASS
IL1F7	27178	broad.mit.edu	37	2	113670672	113670672	+	Splice_Site	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113670672G>A	uc002tij.2	+	1	124	c.82_splice	c.e1+1	p.D28_splice	IL1F7_uc002tik.2_Splice_Site_p.G28_splice|IL1F7_uc002til.2_Splice_Site_p.D28_splice|IL1F7_uc002tim.2_Splice_Site_p.E28_splice|IL1F7_uc002tin.2_5'Flank	NM_014439	NP_055254	Q9NZH6	IL37_HUMAN	interleukin 1 family, member 7 isoform 1						immune response	cytosol|extracellular space|nucleus	cytokine activity|interleukin-1 receptor antagonist activity|interleukin-1 receptor binding				0						TGCTTAGAAGGTAAGGTTCTT	0.463													17	65	---	---	---	---	PASS
PAX8	7849	broad.mit.edu	37	2	113993138	113993138	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113993138A>G	uc010yxt.1	-	9	1086	c.920T>C	c.(919-921)ATA>ACA	p.I307T	PAX8_uc010yxu.1_Intron|PAX8_uc010yxv.1_Intron|PAX8_uc002tjm.2_Intron|PAX8_uc002tjn.2_Intron|uc002tjp.2_RNA|LOC654433_uc002tjq.3_RNA|LOC654433_uc010fks.2_RNA|LOC654433_uc010fkt.2_RNA|LOC654433_uc002tjr.3_5'Flank	NM_003466	NP_003457	Q06710	PAX8_HUMAN	paired box 8 isoform PAX8A	307					branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2						TTCCTGCTTTATGGCGAAGGG	0.602			T	PPARG	follicular thyroid		Thyroid dysgenesis 						9	41	---	---	---	---	PASS
TMEM177	80775	broad.mit.edu	37	2	120438821	120438821	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120438821G>T	uc010flg.1	+	2	865	c.392G>T	c.(391-393)TGG>TTG	p.W131L	TMEM177_uc002tme.2_Intron|TMEM177_uc002tmc.1_Missense_Mutation_p.W131L|TMEM177_uc002tmd.2_Missense_Mutation_p.W131L|TMEM177_uc010flh.2_Intron	NM_001105198	NP_001098668	Q53S58	TM177_HUMAN	transmembrane protein 177	131						integral to membrane				ovary(1)	1	Colorectal(110;0.196)					ACAGTGGACTGGCGGAGCCCA	0.602													56	417	---	---	---	---	PASS
RND3	390	broad.mit.edu	37	2	151328205	151328205	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151328205C>T	uc002txe.2	-	4	663	c.419G>A	c.(418-420)CGG>CAG	p.R140Q	RND3_uc002txf.2_Missense_Mutation_p.R139Q|RND3_uc002txg.2_Missense_Mutation_p.R140Q|RND3_uc010zbv.1_Intron|RND3_uc010zbw.1_Missense_Mutation_p.R11Q	NM_005168	NP_005159	P61587	RND3_HUMAN	ras homolog gene family, member E precursor	140					actin cytoskeleton organization|cell adhesion|small GTPase mediated signal transduction	Golgi membrane	GTP binding|GTPase activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.106)		AACATCTGTCCGCAGATCAGA	0.403													18	100	---	---	---	---	PASS
DPP4	1803	broad.mit.edu	37	2	162851470	162851470	+	Splice_Site	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162851470C>T	uc002ubz.2	-	25	2760	c.2199_splice	c.e25+1	p.M733_splice	DPP4_uc010fpb.2_Splice_Site_p.M409_splice	NM_001935	NP_001926	P27487	DPP4_HUMAN	dipeptidylpeptidase IV						cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)	TTTTTCTATACCATTGCCTGG	0.463													15	62	---	---	---	---	PASS
GRB14	2888	broad.mit.edu	37	2	165383656	165383656	+	Intron	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165383656T>A	uc002ucl.2	-						GRB14_uc010zcv.1_Intron|GRB14_uc002ucm.2_Intron	NM_004490	NP_004481	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14						blood coagulation|leukocyte migration	cytosol|endosome membrane|Golgi membrane|microsome|plasma membrane	SH3/SH2 adaptor activity			ovary(5)|upper_aerodigestive_tract(1)|lung(1)	7						CTGTAAAGAATGTTTCAATGA	0.264													9	70	---	---	---	---	PASS
TTC21B	79809	broad.mit.edu	37	2	166771833	166771833	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166771833C>A	uc002udk.2	-	15	2149	c.2016G>T	c.(2014-2016)CGG>CGT	p.R672R		NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	672						cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						TGCTTAAAGCCCGTTCAATAT	0.398													40	309	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167301443	167301443	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167301443C>G	uc002udu.1	-	12	1582	c.1455G>C	c.(1453-1455)TGG>TGC	p.W485C	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	485					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						GAGAACAATTCCAGATCAAGA	0.303													5	59	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168074672	168074672	+	Intron	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168074672C>A	uc002udx.2	+						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Intron|XIRP2_uc010fpq.2_Intron|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TTAAATCATCCTAGATGATGG	0.373													30	75	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170061990	170061990	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170061990G>C	uc002ues.2	-	41	7927	c.7714C>G	c.(7714-7716)CTG>GTG	p.L2572V		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	2572	LDL-receptor class B 28.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GACACCTACAGACTAGCATCC	0.468													24	123	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170070273	170070273	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170070273T>A	uc002ues.2	-	36	6147	c.5934A>T	c.(5932-5934)GAA>GAT	p.E1978D		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1978	LDL-receptor class B 19.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CCTCATACTGTTCATCAGTAT	0.433													46	181	---	---	---	---	PASS
PDE11A	50940	broad.mit.edu	37	2	178576540	178576540	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178576540G>A	uc002ulq.2	-	13	2428	c.2110C>T	c.(2110-2112)CAT>TAT	p.H704Y	PDE11A_uc002ulp.2_Missense_Mutation_p.H260Y|PDE11A_uc002ulr.2_Missense_Mutation_p.H454Y|PDE11A_uc002uls.1_Missense_Mutation_p.H346Y|PDE11A_uc002ult.1_Missense_Mutation_p.H454Y|PDE11A_uc002ulu.1_Missense_Mutation_p.H346Y	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4	704	Catalytic (By similarity).	Divalent metal cation 1 (By similarity).			platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			TCGAGGTCATGACACAGGCAT	0.453									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				9	59	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179433541	179433541	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179433541G>A	uc010zfg.1	-	275	69838	c.69614C>T	c.(69613-69615)GCT>GTT	p.A23205V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.A16900V|TTN_uc010zfi.1_Missense_Mutation_p.A16833V|TTN_uc010zfj.1_Missense_Mutation_p.A16708V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24132							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCATTTACAGCAACAACTCT	0.418													37	93	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179499517	179499517	+	Silent	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179499517C>G	uc010zfg.1	-	178	34604	c.34380G>C	c.(34378-34380)CTG>CTC	p.L11460L	TTN_uc010zfh.1_Silent_p.L5155L|TTN_uc010zfi.1_Silent_p.L5088L|TTN_uc010zfj.1_Silent_p.L4963L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12387							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGCTTGGTCCAGTTTGACTT	0.398													38	173	---	---	---	---	PASS
GLS	2744	broad.mit.edu	37	2	191760377	191760377	+	Silent	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191760377G>A	uc002usf.2	+	3	795	c.531G>A	c.(529-531)GAG>GAA	p.E177E	GLS_uc002usd.2_3'UTR|GLS_uc002use.2_Silent_p.E177E	NM_014905	NP_055720	O94925	GLSK_HUMAN	glutaminase precursor	177					cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GGTTGAAAGAGTGTATGGATA	0.313													13	98	---	---	---	---	PASS
SLC39A10	57181	broad.mit.edu	37	2	196545509	196545509	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196545509C>G	uc002utg.3	+	2	957	c.743C>G	c.(742-744)ACA>AGA	p.T248R	SLC39A10_uc002uth.3_Missense_Mutation_p.T248R|SLC39A10_uc010zgp.1_Intron	NM_001127257	NP_001120729	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter),	248					zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			pancreas(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.221)			GAGGTTATTACACCAGGTTTT	0.408													19	72	---	---	---	---	PASS
PLCL1	5334	broad.mit.edu	37	2	198950309	198950309	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198950309G>T	uc010fsp.2	+	2	2359	c.2068G>T	c.(2068-2070)GGA>TGA	p.G690*	PLCL1_uc002uuv.3_Nonsense_Mutation_p.G611*	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	690	PI-PLC Y-box.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	TCAAAACGGGGGATGTGGTTA	0.463													29	203	---	---	---	---	PASS
SATB2	23314	broad.mit.edu	37	2	200137379	200137379	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200137379T>A	uc002uuy.1	-	11	2574	c.1757A>T	c.(1756-1758)CAG>CTG	p.Q586L	SATB2_uc010fsq.1_Missense_Mutation_p.Q468L|SATB2_uc002uuz.1_Missense_Mutation_p.Q586L|SATB2_uc002uva.1_Missense_Mutation_p.Q586L	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	586						cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						TGGCTGAGACTGCTGTCTATG	0.478													13	118	---	---	---	---	PASS
SGOL2	151246	broad.mit.edu	37	2	201436332	201436332	+	Silent	SNP	A	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201436332A>C	uc002uvw.2	+	7	1376	c.1263A>C	c.(1261-1263)TCA>TCC	p.S421S	SGOL2_uc010zhd.1_Silent_p.S421S|SGOL2_uc010zhe.1_Silent_p.S421S	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	421					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						AAAATAGTTCAGATGTCGATA	0.348													11	125	---	---	---	---	PASS
SGOL2	151246	broad.mit.edu	37	2	201436333	201436333	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201436333G>T	uc002uvw.2	+	7	1377	c.1264G>T	c.(1264-1266)GAT>TAT	p.D422Y	SGOL2_uc010zhd.1_Missense_Mutation_p.D422Y|SGOL2_uc010zhe.1_Missense_Mutation_p.D422Y	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	422					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						AAATAGTTCAGATGTCGATAT	0.348													11	124	---	---	---	---	PASS
SGOL2	151246	broad.mit.edu	37	2	201436386	201436386	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201436386G>T	uc002uvw.2	+	7	1430	c.1317G>T	c.(1315-1317)CTG>CTT	p.L439L	SGOL2_uc010zhd.1_Silent_p.L439L|SGOL2_uc010zhe.1_Silent_p.L439L	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	439					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						CTGATGTCCTGGATGGCAAAA	0.383													51	128	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207170059	207170059	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207170059G>T	uc002vbp.2	+	5	1057	c.807G>T	c.(805-807)TTG>TTT	p.L269F		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	269							nucleic acid binding|zinc ion binding			ovary(3)	3						CAGATAAGTTGGTTTTGTGGA	0.363													4	30	---	---	---	---	PASS
DGKD	8527	broad.mit.edu	37	2	234371076	234371076	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234371076C>T	uc002vui.1	+	25	3076	c.3064C>T	c.(3064-3066)CGT>TGT	p.R1022C	DGKD_uc002vuj.1_Missense_Mutation_p.R978C|DGKD_uc010fyi.1_RNA	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	1022					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GTCCATGGACCGTGTGTATGG	0.577													14	64	---	---	---	---	PASS
UGT1A10	54575	broad.mit.edu	37	2	234545877	234545877	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234545877A>G	uc002vur.2	+	1	755	c.709A>G	c.(709-711)ACC>GCC	p.T237A	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Missense_Mutation_p.T237A	NM_019075	NP_061948	Q9HAW8	UD110_HUMAN	UDP glycosyltransferase 1 family, polypeptide	237					flavone metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding			ovary(2)|skin(1)	3		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)		AATTCTCCAAACCCCTGTCAC	0.438													164	522	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238277605	238277605	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238277605C>T	uc002vwl.2	-	10	4786	c.4501G>A	c.(4501-4503)GAC>AAC	p.D1501N	COL6A3_uc002vwo.2_Missense_Mutation_p.D1295N|COL6A3_uc010znj.1_Missense_Mutation_p.D894N	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1501	VWFA 8.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CGTATGGCGTCCAGCACCGGG	0.557													17	78	---	---	---	---	PASS
HES6	55502	broad.mit.edu	37	2	239147898	239147898	+	Intron	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239147898C>T	uc002vxz.2	-						HES6_uc002vya.2_Intron|HES6_uc002vyb.2_Silent_p.G160G	NM_018645	NP_061115	Q96HZ4	HES6_HUMAN	hairy and enhancer of split 6 isoform a						cell differentiation	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			skin(1)	1		Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.23e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.29e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.19e-08)|BRCA - Breast invasive adenocarcinoma(100;5.98e-05)|Lung(119;0.0086)|LUSC - Lung squamous cell carcinoma(224;0.0148)		GCGCTCTGGGCCCGAGGGTGG	0.736													4	24	---	---	---	---	PASS
C3orf32	51066	broad.mit.edu	37	3	8671372	8671372	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8671372C>T	uc003bqu.2	-	7	746	c.500G>A	c.(499-501)AGC>AAC	p.S167N	C3orf32_uc003bqz.2_Missense_Mutation_p.S167N|C3orf32_uc003bqt.2_Missense_Mutation_p.S116N|C3orf32_uc011atg.1_Missense_Mutation_p.S189N|C3orf32_uc003bqv.2_Missense_Mutation_p.S116N|C3orf32_uc003bqw.2_RNA|C3orf32_uc003bqx.2_RNA|C3orf32_uc003bqy.2_Missense_Mutation_p.S167N	NM_015931	NP_057015	Q9Y2M2	CC032_HUMAN	hypothetical protein LOC51066	167	Cys-rich.									skin(1)	1						GTGGCAGCCGCTGCACTTGTA	0.428													9	56	---	---	---	---	PASS
TOP2B	7155	broad.mit.edu	37	3	25662311	25662311	+	Intron	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25662311T>C	uc011awn.1	-						TOP2B_uc003cdj.2_Intron|TOP2B_uc011awm.1_5'Flank|TOP2B_uc010hff.1_5'Flank	NM_001068	NP_001059	Q02880	TOP2B_HUMAN	DNA topoisomerase II, beta isozyme						DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						TTGGAAGCTGTAGAGAAAAAG	0.373													6	35	---	---	---	---	PASS
C3orf62	375341	broad.mit.edu	37	3	49314221	49314221	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49314221C>A	uc003cwn.2	-	1	288	c.85G>T	c.(85-87)GAC>TAC	p.D29Y	C3orf62_uc003cwm.2_5'Flank	NM_198562	NP_940964	Q6ZUJ4	CC062_HUMAN	hypothetical protein LOC375341	29											0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AAGGCCCGGTCAATGGCTGCA	0.517													32	63	---	---	---	---	PASS
CCDC80	151887	broad.mit.edu	37	3	112337807	112337807	+	Intron	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112337807A>T	uc003dzf.2	-						CCDC80_uc011bhv.1_Intron|CCDC80_uc003dzg.2_Intron|CCDC80_uc003dzh.1_Intron	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor											ovary(2)	2						CAGAATAAGAAACTGTACCTT	0.363													31	153	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126734135	126734135	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126734135G>T	uc003ejg.2	+	14	2921	c.2917G>T	c.(2917-2919)GTC>TTC	p.V973F		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	996	IPT/TIG 2.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		GGCTGTGTCGGTCGGTGGCCG	0.657													14	49	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140275475	140275475	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140275475C>T	uc003etn.2	+	11	1985	c.1795C>T	c.(1795-1797)CGG>TGG	p.R599W	CLSTN2_uc003etm.2_Missense_Mutation_p.R599W	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	599	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GGCGGGTGTGCGGCGCCTCAA	0.577										HNSCC(16;0.037)			5	110	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128840	147128840	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128840C>G	uc003ewe.2	+	1	1660	c.941C>G	c.(940-942)GCG>GGG	p.A314G		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	314	C2H2-type 3.				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						AAGGTCTTCGCGCGCTCCGAG	0.562													18	61	---	---	---	---	PASS
KPNA4	3840	broad.mit.edu	37	3	160232932	160232932	+	Intron	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160232932A>T	uc003fdn.2	-						SCARNA7_uc003fdo.2_RNA	NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			TACCTATAAAACACTAAACTT	0.363													35	107	---	---	---	---	PASS
BCHE	590	broad.mit.edu	37	3	165548316	165548316	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165548316A>G	uc003fem.3	-	2	666	c.506T>C	c.(505-507)GTA>GCA	p.V169A	BCHE_uc003fen.3_Intron	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor	169					choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)	CATTGACACTACAATAACTCT	0.418													31	148	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178952079	178952079	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178952079A>T	uc003fjk.2	+	21	3291	c.3134A>T	c.(3133-3135)GAT>GTT	p.D1045V		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1045	PI3K/PI4K.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.D1045N(2)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			CAAATGAATGATGCACATCAT	0.368		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			19	118	---	---	---	---	PASS
CCDC39	339829	broad.mit.edu	37	3	180334353	180334353	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180334353A>G	uc010hxe.2	-	18	2652	c.2537T>C	c.(2536-2538)ATA>ACA	p.I846T	CCDC39_uc003fkn.2_RNA|TTC14_uc003fkm.2_Intron	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	846					axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			ATTTTCTTCTATGATATCAAC	0.284													11	48	---	---	---	---	PASS
DLG1	1739	broad.mit.edu	37	3	196793577	196793577	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196793577T>A	uc003fxo.3	-	21	2319	c.2129A>T	c.(2128-2130)GAA>GTA	p.E710V	DLG1_uc011bub.1_Missense_Mutation_p.E606V|DLG1_uc011buc.1_Missense_Mutation_p.E594V|DLG1_uc011bud.1_Missense_Mutation_p.E393V|DLG1_uc003fxn.3_Missense_Mutation_p.E732V|DLG1_uc011bue.1_Missense_Mutation_p.E698V|DLG1_uc010ial.2_Missense_Mutation_p.E710V	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1	710					actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		TCACAAACCTTCTTGTTGATT	0.308													12	128	---	---	---	---	PASS
ZNF721	170960	broad.mit.edu	37	4	437083	437083	+	Silent	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:437083A>G	uc003gag.2	-	3	1864	c.1173T>C	c.(1171-1173)TGT>TGC	p.C391C	ABCA11P_uc003gac.2_Intron|ABCA11P_uc003gad.2_Intron|ABCA11P_uc011buv.1_Intron|ABCA11P_uc003gae.2_Intron|ABCA11P_uc010ibd.1_Intron|ZNF721_uc003gaf.3_Silent_p.C423C|ZNF721_uc010ibe.2_Silent_p.C379C	NM_133474	NP_597731	D9N162	D9N162_HUMAN	zinc finger protein 721	391						intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						CACACTCTTCACATTTGTAAG	0.423													9	137	---	---	---	---	PASS
STK32B	55351	broad.mit.edu	37	4	5141686	5141686	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5141686A>T	uc003gih.1	+	2	171	c.107A>T	c.(106-108)AAG>ATG	p.K36M	STK32B_uc010ida.1_Translation_Start_Site	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B	36	ATP (By similarity).|Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						AGTTTTGGAAAGGTAAGAATA	0.403													34	217	---	---	---	---	PASS
FBXL5	26234	broad.mit.edu	37	4	15627424	15627424	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15627424T>C	uc003goc.1	-	9	1404	c.1301A>G	c.(1300-1302)AAA>AGA	p.K434R	FBXL5_uc010idw.1_Missense_Mutation_p.K347R|FBXL5_uc003gob.1_Missense_Mutation_p.K308R|FBXL5_uc010idx.1_Missense_Mutation_p.K433R|FBXL5_uc003god.1_Missense_Mutation_p.K417R|FBXL5_uc010idy.1_Missense_Mutation_p.K434R	NM_012161	NP_036293	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5 isoform	434					iron ion homeostasis|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|SCF ubiquitin ligase complex	iron ion binding|protein binding|ubiquitin-protein ligase activity				0						GGTAATGTCTTTATTTTTCCA	0.393													33	197	---	---	---	---	PASS
GRXCR1	389207	broad.mit.edu	37	4	42964979	42964979	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42964979C>T	uc003gwt.2	+	2	455	c.455C>T	c.(454-456)ACC>ATC	p.T152I		NM_001080476	NP_001073945	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	152	Glutaredoxin.				cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1						GTCCGGACAACCTTTGAAAGA	0.388													40	281	---	---	---	---	PASS
KCTD8	386617	broad.mit.edu	37	4	44177016	44177016	+	Missense_Mutation	SNP	C	A	A	rs146165410		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44177016C>A	uc003gwu.2	-	2	1497	c.1213G>T	c.(1213-1215)GAC>TAC	p.D405Y		NM_198353	NP_938167	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerisation domain	405						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(2)|ovary(1)	3						CTGCGTTTGTCTGGTGGGGGT	0.478										HNSCC(17;0.042)			108	319	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57173815	57173815	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57173815A>T	uc003hbk.2	+	5	626	c.235A>T	c.(235-237)ATG>TTG	p.M79L	KIAA1211_uc010iha.2_Missense_Mutation_p.M72L|KIAA1211_uc011bzz.1_5'Flank|KIAA1211_uc003hbl.2_5'Flank|KIAA1211_uc003hbm.1_5'Flank	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	79										ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					GACCAGTCCCATGGAAATTGT	0.502													7	49	---	---	---	---	PASS
SRP72	6731	broad.mit.edu	37	4	57350915	57350915	+	Missense_Mutation	SNP	G	T	T	rs149517121		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57350915G>T	uc003hbv.2	+	10	1011	c.971G>T	c.(970-972)CGC>CTC	p.R324L	SRP72_uc010ihe.2_Missense_Mutation_p.R263L|SRP72_uc003hbw.1_Missense_Mutation_p.R85L	NM_006947	NP_008878	O76094	SRP72_HUMAN	signal recognition particle 72kDa	324					response to drug|SRP-dependent cotranslational protein targeting to membrane	cytosol|nucleolus|plasma membrane|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding			ovary(1)	1	Glioma(25;0.08)|all_neural(26;0.101)					GAACAATGCCGCAAAATATCT	0.418													65	135	---	---	---	---	PASS
PPP3CA	5530	broad.mit.edu	37	4	101984428	101984428	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101984428C>A	uc011cen.1	-	9	1717	c.1042G>T	c.(1042-1044)GAT>TAT	p.D348Y	PPP3CA_uc003hvu.2_Missense_Mutation_p.D348Y|PPP3CA_uc010ilj.2_Intron|PPP3CA_uc003hvt.2_Missense_Mutation_p.D335Y|PPP3CA_uc003hvs.2_Missense_Mutation_p.D281Y|PPP3CA_uc010ilk.2_Missense_Mutation_p.D116Y	NM_000944	NP_000935	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha	348					protein dephosphorylation	calcineurin complex|cytosol|nucleus	calcium ion binding|calmodulin binding			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		GTAAAAACATCCATGAAATTT	0.363													23	47	---	---	---	---	PASS
BANK1	55024	broad.mit.edu	37	4	102946403	102946403	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102946403G>T	uc003hvy.3	+	9	1605	c.1331G>T	c.(1330-1332)GGG>GTG	p.G444V	BANK1_uc003hvx.3_Missense_Mutation_p.G429V|BANK1_uc010ill.2_Missense_Mutation_p.G311V|BANK1_uc003hvz.3_Missense_Mutation_p.G414V	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	444					B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		AAGACATACGGGCAGAGTGCA	0.453													43	133	---	---	---	---	PASS
ELOVL6	79071	broad.mit.edu	37	4	110980846	110980846	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110980846G>T	uc003hzz.2	-	4	412	c.286C>A	c.(286-288)CAG>AAG	p.Q96K	ELOVL6_uc003iaa.2_Missense_Mutation_p.Q96K	NM_001130721	NP_001124193	Q9H5J4	ELOV6_HUMAN	elongation of very long chain fatty acids-like	96					fatty acid elongation, saturated fatty acid|long-chain fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process		fatty acid elongase activity|protein binding			haematopoietic_and_lymphoid_tissue(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.00462)		CAAACTGACTGCTTCAGGCCT	0.413													31	45	---	---	---	---	PASS
ENPEP	2028	broad.mit.edu	37	4	111427862	111427862	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111427862T>A	uc003iab.3	+	4	1330	c.988T>A	c.(988-990)TTT>ATT	p.F330I		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	330	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	TAAAAGTGTGTTTGATTATTT	0.279													9	34	---	---	---	---	PASS
TRAM1L1	133022	broad.mit.edu	37	4	118005974	118005974	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118005974G>T	uc003ibv.3	-	1	763	c.576C>A	c.(574-576)GAC>GAA	p.D192E		NM_152402	NP_689615	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like	192	Cytoplasmic (Potential).|TLC.				protein transport|transmembrane transport	endoplasmic reticulum membrane|integral to membrane				central_nervous_system(1)	1						GACGAGGGATGTCTTGTTTTT	0.393													43	120	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126238488	126238488	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126238488C>T	uc003ifj.3	+	1	922	c.922C>T	c.(922-924)CGG>TGG	p.R308W		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	308	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						TATCACGGTGCGGGAGCCCCT	0.667											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	29	---	---	---	---	PASS
FHDC1	85462	broad.mit.edu	37	4	153897162	153897162	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153897162C>T	uc003inf.2	+	11	2794	c.2719C>T	c.(2719-2721)CCC>TCC	p.P907S		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	907					actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					CAAGGTCATGCCCATCACCAA	0.682													3	44	---	---	---	---	PASS
NPY5R	4889	broad.mit.edu	37	4	164271888	164271888	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164271888C>G	uc003iqn.2	+	4	645	c.463C>G	c.(463-465)CAT>GAT	p.H155D		NM_006174	NP_006165	Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	155	Cytoplasmic (Potential).				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane				lung(6)|skin(1)	7	all_hematologic(180;0.166)	Prostate(90;0.109)				AACAGCAAACCATGGCTACTT	0.363													107	219	---	---	---	---	PASS
SPOCK3	50859	broad.mit.edu	37	4	167656242	167656242	+	Intron	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167656242C>A	uc003iri.1	-						SPOCK3_uc011cjp.1_Intron|SPOCK3_uc011cjq.1_Intron|SPOCK3_uc011cjr.1_Intron|SPOCK3_uc003irj.1_Intron|SPOCK3_uc011cjs.1_Intron|SPOCK3_uc011cjt.1_Intron|SPOCK3_uc011cju.1_Intron|SPOCK3_uc011cjv.1_Intron	NM_016950	NP_058646	Q9BQ16	TICN3_HUMAN	testican 3 isoform 2						signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		AAATCTATAGCTTAAAACAAG	0.159													10	35	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177032832	177032832	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177032832C>A	uc003iuj.2	+	3	329	c.173C>A	c.(172-174)ACC>AAC	p.T58N	WDR17_uc003iuk.2_Missense_Mutation_p.T34N|WDR17_uc003ium.3_Missense_Mutation_p.T34N|WDR17_uc003iul.1_Missense_Mutation_p.T34N	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	58										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TATTGTGCGACCCTGGCTATC	0.363													22	60	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177032833	177032833	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177032833C>A	uc003iuj.2	+	3	330	c.174C>A	c.(172-174)ACC>ACA	p.T58T	WDR17_uc003iuk.2_Silent_p.T34T|WDR17_uc003ium.3_Silent_p.T34T|WDR17_uc003iul.1_Silent_p.T34T	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	58										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		ATTGTGCGACCCTGGCTATCT	0.363													21	62	---	---	---	---	PASS
SPATA4	132851	broad.mit.edu	37	4	177116559	177116559	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177116559G>C	uc003iuo.1	-	1	264	c.155C>G	c.(154-156)TCT>TGT	p.S52C		NM_144644	NP_653245	Q8NEY3	SPAT4_HUMAN	spermatogenesis associated 4	52					apoptosis|spermatogenesis						0		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.9e-20)|Epithelial(43;1.99e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.58e-09)|GBM - Glioblastoma multiforme(59;0.000162)|STAD - Stomach adenocarcinoma(60;0.000543)|LUSC - Lung squamous cell carcinoma(193;0.096)		AACGGAACGAGACAAGCGGGA	0.592													26	81	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183245314	183245314	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183245314G>T	uc003ivd.1	+	1	178	c.141G>T	c.(139-141)TTG>TTT	p.L47F	ODZ3_uc010irv.1_Missense_Mutation_p.L47F	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	47	Cytoplasmic (Potential).|Teneurin N-terminal.				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		GCGAGACATTGAAAGCTTTTG	0.507													28	71	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187628794	187628794	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187628794G>A	uc003izf.2	-	2	2376	c.2188C>T	c.(2188-2190)CAG>TAG	p.Q730*	FAT1_uc010iso.1_Nonsense_Mutation_p.Q730*	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	730	Extracellular (Potential).|Cadherin 6.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						CCCACAGGCTGGTTTTCCTTT	0.453										HNSCC(5;0.00058)			26	62	---	---	---	---	PASS
ZDHHC11	79844	broad.mit.edu	37	5	822005	822005	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:822005C>A	uc011cma.1	-	9	1413	c.1029G>T	c.(1027-1029)GGG>GGT	p.G343G	ZDHHC11_uc010itc.2_RNA|ZDHHC11_uc003jbj.2_RNA	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	343						integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GGTCTTCATCCCCTTCCTGTG	0.358													6	65	---	---	---	---	PASS
NSUN2	54888	broad.mit.edu	37	5	6620367	6620367	+	Silent	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6620367G>A	uc003jdu.2	-	7	732	c.667C>T	c.(667-669)CTG>TTG	p.L223L	NSUN2_uc003jdt.2_5'UTR|NSUN2_uc011cmk.1_Silent_p.L188L|NSUN2_uc003jdv.2_5'UTR	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2	223						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						TGGACGAGCAGGTAGCAGCGC	0.527													156	110	---	---	---	---	PASS
MYO10	4651	broad.mit.edu	37	5	16680051	16680051	+	Intron	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16680051C>T	uc003jft.3	-						MYO10_uc011cnb.1_Intron|MYO10_uc011cnc.1_Intron|MYO10_uc011cnd.1_Intron|MYO10_uc011cne.1_Intron|MYO10_uc010itx.2_Intron	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						CTTGTCTTGGCTTACCTTGAT	0.502													17	80	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23527441	23527441	+	Silent	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23527441T>C	uc003jgo.2	+	11	2426	c.2244T>C	c.(2242-2244)TAT>TAC	p.Y748Y		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	748	C2H2-type 10.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						AGAAGCCCTATGTCTGCAGGG	0.587										HNSCC(3;0.000094)			43	245	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38425120	38425120	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38425120C>T	uc003jlc.1	+	13	2060	c.1736C>T	c.(1735-1737)ACC>ATC	p.T579I	EGFLAM_uc003jlb.1_Missense_Mutation_p.T579I|EGFLAM_uc003jle.1_Missense_Mutation_p.T345I|EGFLAM_uc003jlf.1_5'UTR	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	579	EGF-like 2.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					CATGGTGGCACCTGCACAGCA	0.502													75	477	---	---	---	---	PASS
SLCO6A1	133482	broad.mit.edu	37	5	101735267	101735267	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101735267G>T	uc003knn.2	-	10	1978	c.1806C>A	c.(1804-1806)GCC>GCA	p.A602A	SLCO6A1_uc003kno.2_Silent_p.A349A|SLCO6A1_uc003knp.2_Silent_p.A602A|SLCO6A1_uc003knq.2_Silent_p.A540A	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	602	Helical; Name=10; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		ACCGCGTCATGGCCAAGACGA	0.279													18	30	---	---	---	---	PASS
PCDHA1	56147	broad.mit.edu	37	5	140168155	140168155	+	Silent	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140168155T>C	uc003lhb.2	+	1	2280	c.2280T>C	c.(2278-2280)TCT>TCC	p.S760S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Silent_p.S760S	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	760	Cytoplasmic (Potential).|5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGTGTGCTCTAGCGAGGGCC	0.587													6	25	---	---	---	---	PASS
TSPAN17	26262	broad.mit.edu	37	5	176084550	176084550	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176084550T>C	uc003met.2	+	9	1079	c.850T>C	c.(850-852)TGG>CGG	p.W284R	TSPAN17_uc003mes.3_3'UTR|TSPAN17_uc003meu.2_Missense_Mutation_p.W281R|TSPAN17_uc003mev.2_3'UTR|TSPAN17_uc003mew.2_3'UTR	NM_012171	NP_036303	Q96FV3	TSN17_HUMAN	transmembrane 4 superfamily member 17 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						integral to membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			tgaaaacCACTGGCTTACGCC	0.169													8	13	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176678730	176678730	+	Splice_Site	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176678730G>C	uc003mfr.3	+	12	4780	c.4642_splice	c.e12-1	p.N1548_splice	NSD1_uc003mft.3_Splice_Site_p.N1279_splice|NSD1_uc003mfs.1_Splice_Site_p.N1445_splice|NSD1_uc011dfx.1_Splice_Site_p.N1196_splice	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TCTCTTAACAGAATTGTGAAA	0.289			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			31	77	---	---	---	---	PASS
FLT4	2324	broad.mit.edu	37	5	180049733	180049733	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180049733G>T	uc003mma.3	-	12	1734	c.1655C>A	c.(1654-1656)ACC>AAC	p.T552N	FLT4_uc003mlz.3_Missense_Mutation_p.T552N|FLT4_uc003mmb.1_Missense_Mutation_p.T85N|FLT4_uc011dgy.1_Missense_Mutation_p.T552N	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	552	Ig-like C2-type 5.|Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	TCACTCACTGGTCACATAGAA	0.577									Congenital_Hereditary_Lymphedema				14	23	---	---	---	---	PASS
SLC17A1	6568	broad.mit.edu	37	6	25830752	25830752	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25830752C>G	uc003nfh.3	-	2	150	c.34G>C	c.(34-36)GTT>CTT	p.V12L	SLC17A1_uc011djy.1_RNA|SLC17A1_uc010jqb.1_Missense_Mutation_p.V10L|SLC17A1_uc010jqc.1_Missense_Mutation_p.V10L	NM_005074	NP_005065	Q14916	NPT1_HUMAN	solute carrier family 17 (sodium phosphate),	12					sodium ion transport|urate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(3)|pancreas(1)	4						AAAGTGCTACCTTTTTTGGGA	0.398													41	201	---	---	---	---	PASS
HLA-DMA	3108	broad.mit.edu	37	6	32917165	32917165	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32917165C>A	uc003ocm.2	-	4	750	c.664G>T	c.(664-666)GCA>TCA	p.A222S		NM_006120	NP_006111	Q31604	Q31604_HUMAN	major histocompatibility complex, class II, DM	222						integral to membrane|MHC class II protein complex					0						GAGGGCAGTGCGTTCCGGGGT	0.587													7	33	---	---	---	---	PASS
HLA-DMA	3108	broad.mit.edu	37	6	32917166	32917166	+	Silent	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32917166G>A	uc003ocm.2	-	4	749	c.663C>T	c.(661-663)AAC>AAT	p.N221N		NM_006120	NP_006111	Q31604	Q31604_HUMAN	major histocompatibility complex, class II, DM	221						integral to membrane|MHC class II protein complex					0						AGGGCAGTGCGTTCCGGGGTA	0.582													7	33	---	---	---	---	PASS
TJAP1	93643	broad.mit.edu	37	6	43466779	43466779	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43466779G>T	uc003ovd.2	+	4	416	c.40G>T	c.(40-42)GCA>TCA	p.A14S	TJAP1_uc003ovf.2_Missense_Mutation_p.A14S|TJAP1_uc003ove.2_Missense_Mutation_p.A14S|TJAP1_uc003ovc.2_Missense_Mutation_p.A14S|TJAP1_uc010jyp.2_5'UTR|TJAP1_uc011dvh.1_Missense_Mutation_p.A14S|TJAP1_uc003ovg.2_5'UTR|TJAP1_uc010jyq.2_Missense_Mutation_p.A14S|TJAP1_uc011dvi.1_Missense_Mutation_p.A14S|TJAP1_uc011dvj.1_5'Flank	NM_001146016	NP_001139488	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 isoform a	14						Golgi apparatus|tight junction	protein binding				0	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CTACCGTAAGGCACCACCAGA	0.587													7	64	---	---	---	---	PASS
ICK	22858	broad.mit.edu	37	6	52874359	52874359	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52874359C>T	uc003pbh.2	-	13	1989	c.1499G>A	c.(1498-1500)AGT>AAT	p.S500N	ICK_uc003pbi.2_Missense_Mutation_p.S500N	NM_016513	NP_057597	Q9UPZ9	ICK_HUMAN	intestinal cell kinase	500					intracellular protein kinase cascade|multicellular organismal development	cytosol|nucleus	ATP binding|cyclin-dependent protein kinase activity|magnesium ion binding			ovary(1)|large_intestine(1)|lung(1)|kidney(1)|central_nervous_system(1)	5	Lung NSC(77;0.103)					atttcttatactgatccctga	0.269													37	130	---	---	---	---	PASS
LCA5	167691	broad.mit.edu	37	6	80196890	80196890	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80196890C>A	uc003pix.2	-	8	2360	c.1925G>T	c.(1924-1926)GGG>GTG	p.G642V	LCA5_uc003piy.2_Missense_Mutation_p.G642V	NM_001122769	NP_001116241	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	642					protein transport	cilium axoneme|microtubule basal body	protein binding				0		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		GCCTTTATTCCCAGGGAGAAA	0.428													48	249	---	---	---	---	PASS
TBX18	9096	broad.mit.edu	37	6	85472389	85472389	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85472389G>T	uc003pkl.1	-	2	370	c.370C>A	c.(370-372)CGC>AGC	p.R124S	TBX18_uc010kbq.1_5'UTR	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	124					multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		GCCAGGGAGCGCGCCGGAGAC	0.697													10	53	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87925771	87925771	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87925771G>T	uc003plm.3	+	2	360	c.319G>T	c.(319-321)GCA>TCA	p.A107S	ZNF292_uc003pll.1_Missense_Mutation_p.A107S	NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	107					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GGAACGCTTGGCATTGTGAGT	0.284													9	79	---	---	---	---	PASS
BVES	11149	broad.mit.edu	37	6	105573354	105573354	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105573354T>A	uc003pqw.2	-	4	608	c.451A>T	c.(451-453)ATG>TTG	p.M151L	BVES_uc003pqx.2_Missense_Mutation_p.M151L|BVES_uc003pqy.2_Missense_Mutation_p.M151L	NM_147147	NP_671488	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance isoform 5	151	Cytoplasmic (Potential).				epithelial cell-cell adhesion|muscle organ development|positive regulation of locomotion|positive regulation of receptor recycling|regulation of Cdc42 GTPase activity|regulation of cell shape|regulation of Rac GTPase activity|substrate adhesion-dependent cell spreading|vesicle-mediated transport	integral to membrane|lateral plasma membrane|tight junction	structural molecule activity				0		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				GTTTGGATCATGCAAAACTGT	0.438													71	296	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117706942	117706942	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117706942G>T	uc003pxp.1	-	15	2407	c.2208C>A	c.(2206-2208)ATC>ATA	p.I736I	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	736	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AATTCTCTGAGATATCCGTCC	0.463			T	GOPC|ROS1	glioblastoma|NSCLC								43	120	---	---	---	---	PASS
ENPP3	5169	broad.mit.edu	37	6	131996260	131996260	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131996260C>A	uc003qcu.3	+	10	1150	c.803C>A	c.(802-804)ACC>AAC	p.T268N	ENPP3_uc010kfn.1_RNA|ENPP3_uc011ecc.1_Missense_Mutation_p.T234N|ENPP3_uc010kfo.1_RNA|ENPP3_uc010kfp.1_RNA|ENPP3_uc010kfq.2_RNA|ENPP3_uc003qcv.2_Missense_Mutation_p.T268N	NM_005021	NP_005012	O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	268	Extracellular (Potential).|Phosphodiesterase.				immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity			ovary(3)|skin(1)	4	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		AAAGCCGCTACCTACTTTTGG	0.423													29	96	---	---	---	---	PASS
MAP3K5	4217	broad.mit.edu	37	6	136923061	136923061	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136923061C>T	uc003qhc.2	-	20	3097	c.2736G>A	c.(2734-2736)AAG>AAA	p.K912K	MAP3K5_uc011edj.1_Silent_p.K159K|MAP3K5_uc011edk.1_Silent_p.K757K	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase	912	Protein kinase.				activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		GTATGAATGCCTTGGCCTCTG	0.403													17	119	---	---	---	---	PASS
TNFAIP3	7128	broad.mit.edu	37	6	138200446	138200446	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138200446G>T	uc003qhr.2	+	7	1930	c.1864G>T	c.(1864-1866)GGC>TGC	p.G622C	TNFAIP3_uc003qhs.2_Missense_Mutation_p.G622C	NM_006290	NP_006281	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	622	Interaction with NAF1 (By similarity).|A20-type 4.				anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding	p.0?(22)		haematopoietic_and_lymphoid_tissue(133)|lung(3)|ovary(1)	137	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		AGAAAACAAGGGCTTTTGCAC	0.527			D|N|F		marginal zone B-cell lymphomas|Hodgkin's lymphoma|primary mediastinal B cell lymphoma								15	125	---	---	---	---	PASS
IYD	389434	broad.mit.edu	37	6	150710499	150710499	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150710499T>A	uc003qnu.1	+	2	330	c.190T>A	c.(190-192)TGG>AGG	p.W64R	IYD_uc003qnv.1_Missense_Mutation_p.W64R|IYD_uc003qnw.1_RNA|IYD_uc003qnx.1_Missense_Mutation_p.W64R|IYD_uc010kik.1_Missense_Mutation_p.N4K	NM_203395	NP_981932	Q6PHW0	IYD1_HUMAN	iodotyrosine dehalogenase 1 isoform 2	64	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process	integral to membrane|plasma membrane				ovary(2)	2		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		TGCTGATGAATGGCAAGAATC	0.383													22	64	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152605113	152605113	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152605113C>A	uc010kiw.2	-	96	18809	c.18207G>T	c.(18205-18207)GAG>GAT	p.E6069D	SYNE1_uc010kiv.2_Missense_Mutation_p.E593D|SYNE1_uc003qos.3_Missense_Mutation_p.E593D|SYNE1_uc003qot.3_Missense_Mutation_p.E5998D|SYNE1_uc003qou.3_Missense_Mutation_p.E6069D|SYNE1_uc010kiy.1_Missense_Mutation_p.E248D	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6069	Spectrin 20.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TATTGGTTACCTCCAAAAGCT	0.478										HNSCC(10;0.0054)			7	74	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152655162	152655162	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152655162C>T	uc010kiw.2	-	77	13377	c.12775G>A	c.(12775-12777)GAA>AAA	p.E4259K	SYNE1_uc003qot.3_Missense_Mutation_p.E4188K|SYNE1_uc003qou.3_Missense_Mutation_p.E4259K|SYNE1_uc010kiz.2_Missense_Mutation_p.E14K	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4259	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTATCCCATTCTGTAGTAAAT	0.358										HNSCC(10;0.0054)			42	279	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152784642	152784642	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152784642C>A	uc010kiw.2	-	19	2545	c.1943G>T	c.(1942-1944)CGA>CTA	p.R648L	SYNE1_uc003qot.3_Missense_Mutation_p.R655L|SYNE1_uc003qou.3_Missense_Mutation_p.R648L|SYNE1_uc010kjb.1_Missense_Mutation_p.R631L|SYNE1_uc003qpa.1_Missense_Mutation_p.R648L|SYNE1_uc003qow.2_5'Flank|SYNE1_uc003qox.1_Missense_Mutation_p.R164L|SYNE1_uc003qoz.2_Missense_Mutation_p.R80L|SYNE1_uc003qoy.2_Missense_Mutation_p.R215L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	648	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGGTAAATTTCGAAAAAAATC	0.343										HNSCC(10;0.0054)			17	39	---	---	---	---	PASS
RNASET2	8635	broad.mit.edu	37	6	167347621	167347621	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167347621C>T	uc003qve.2	-	7	857	c.450G>A	c.(448-450)GTG>GTA	p.V150V	RNASET2_uc003qvh.2_Intron|RNASET2_uc003qvf.2_Silent_p.V58V|RNASET2_uc003qvg.2_Silent_p.V87V|RNASET2_uc003qvi.1_3'UTR	NM_003730	NP_003721	O00584	RNT2_HUMAN	ribonuclease T2 precursor	150					RNA catabolic process	extracellular region	ribonuclease T2 activity|RNA binding				0		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;1.53e-19)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00665)		ATTTTAGAAGCACACTAAAAT	0.358													13	79	---	---	---	---	PASS
MLLT4	4301	broad.mit.edu	37	6	168351866	168351866	+	Missense_Mutation	SNP	C	T	T	rs144621028		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168351866C>T	uc003qwd.2	+	29	3950	c.3808C>T	c.(3808-3810)CGT>TGT	p.R1270C	MLLT4_uc003qwb.1_Missense_Mutation_p.R1255C|MLLT4_uc003qwc.1_Missense_Mutation_p.R1271C|MLLT4_uc003qwg.1_Missense_Mutation_p.R580C	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1271					adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		CTTTTTGCAGCGTGTTACACG	0.353			T	MLL	AL								15	54	---	---	---	---	PASS
SLC29A4	222962	broad.mit.edu	37	7	5331371	5331371	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5331371G>T	uc003sod.2	+	5	624	c.463G>T	c.(463-465)GTG>TTG	p.V155L	SLC29A4_uc011jwg.1_RNA|SLC29A4_uc003soc.2_Missense_Mutation_p.V155L|SLC29A4_uc003soe.2_Silent_p.T142T	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN	solute carrier family 29 (nucleoside	155	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity			liver(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)		CATCTGCGACGTGTGGCTGCA	0.637													12	82	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21654792	21654792	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21654792C>G	uc003svc.2	+	21	3944	c.3913C>G	c.(3913-3915)CTT>GTT	p.L1305V		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1305	Potential.|Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						ATCTACTCGTCTTTTTGAAGT	0.398									Kartagener_syndrome				25	47	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21778398	21778398	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21778398C>A	uc003svc.2	+	48	7777	c.7746C>A	c.(7744-7746)ATC>ATA	p.I2582I		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2582	AAA 3 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TTTATTTTATCGACGACATGA	0.383									Kartagener_syndrome				7	18	---	---	---	---	PASS
TBX20	57057	broad.mit.edu	37	7	35242129	35242129	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35242129C>T	uc011kas.1	-	8	1268	c.1257G>A	c.(1255-1257)CCG>CCA	p.P419P		NM_001077653	NP_001071121	Q9UMR3	TBX20_HUMAN	T-box transcription factor TBX20	419						nucleus	DNA binding			central_nervous_system(1)	1						GATGGTATCGCGGCATGTGGA	0.522													9	28	---	---	---	---	PASS
SEPT14	346288	broad.mit.edu	37	7	55914210	55914210	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55914210C>G	uc003tqz.2	-	3	292	c.175G>C	c.(175-177)GGG>CGG	p.G59R		NM_207366	NP_997249	Q6ZU15	SEP14_HUMAN	septin 14	59	GTP (By similarity).				cell cycle|cell division	septin complex	GTP binding|protein binding				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TGACACTTACCCACACAGAGA	0.333													41	171	---	---	---	---	PASS
ELN	2006	broad.mit.edu	37	7	73462840	73462840	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73462840C>A	uc003tzw.2	+	15	844	c.753C>A	c.(751-753)GGC>GGA	p.G251G	RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_Intron|ELN_uc011kfe.1_Silent_p.G220G|ELN_uc003tzn.2_Silent_p.G251G|ELN_uc003tzz.2_Silent_p.G215G|ELN_uc003tzo.2_Silent_p.G237G|ELN_uc003tzp.2_Silent_p.G207G|ELN_uc003tzq.2_Silent_p.G134G|ELN_uc003tzr.2_RNA|ELN_uc003tzs.2_Silent_p.G251G|ELN_uc003tzt.2_Silent_p.G256G|ELN_uc003tzu.2_Silent_p.G256G|ELN_uc003tzv.2_Silent_p.G241G|ELN_uc003tzx.2_Silent_p.G241G|ELN_uc011kff.1_Silent_p.G251G|ELN_uc003tzy.2_Silent_p.G246G	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor	251	Ala-rich.				blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	CAGGGGTTGGCCCCCAGgcag	0.517			T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						24	157	---	---	---	---	PASS
POR	5447	broad.mit.edu	37	7	75613147	75613147	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75613147G>T	uc003udy.2	+	10	1121	c.1039G>T	c.(1039-1041)GTC>TTC	p.V347F	POR_uc011kgc.1_Missense_Mutation_p.V155F|POR_uc011kgd.1_Missense_Mutation_p.V246F|POR_uc011kge.1_Missense_Mutation_p.V85F|POR_uc003uea.2_5'Flank	NM_000941	NP_000932	P16435	NCPR_HUMAN	cytochrome P450 reductase	344	FAD-binding FR-type.				cellular organofluorine metabolic process|positive regulation of monooxygenase activity	endoplasmic reticulum membrane	iron ion binding|NADPH-hemoprotein reductase activity			central_nervous_system(1)	1					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Lipoic Acid(DB00166)|Menadione(DB00170)|Methoxyflurane(DB01028)|Mitomycin(DB00305)|Nilutamide(DB00665)	CGACCTGGACGTCGTCATGTC	0.632													6	14	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86394673	86394673	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86394673C>T	uc003uid.2	+	2	1311	c.212C>T	c.(211-213)GCC>GTC	p.A71V	GRM3_uc010lef.2_Missense_Mutation_p.A69V|GRM3_uc010leg.2_Intron|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	71	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	CGCCTGGAAGCCATGTTGTTT	0.428													57	147	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86479772	86479772	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86479772C>T	uc003uid.2	+	5	3577	c.2478C>T	c.(2476-2478)ATC>ATT	p.I826I	GRM3_uc010lef.2_Missense_Mutation_p.P469S|GRM3_uc010leg.2_Silent_p.I698I|GRM3_uc010leh.2_Silent_p.I418I	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	826	Helical; Name=7; (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	TTCACATCATCCTGTTTCAAC	0.488													29	82	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86479773	86479773	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86479773C>G	uc003uid.2	+	5	3578	c.2479C>G	c.(2479-2481)CTG>GTG	p.L827V	GRM3_uc010lef.2_Missense_Mutation_p.P469R|GRM3_uc010leg.2_Missense_Mutation_p.L699V|GRM3_uc010leh.2_Missense_Mutation_p.L419V	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	827	Helical; Name=7; (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	TCACATCATCCTGTTTCAACC	0.493													29	81	---	---	---	---	PASS
ANKIB1	54467	broad.mit.edu	37	7	92028042	92028042	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92028042G>C	uc003ulw.2	+	20	3425	c.3049G>C	c.(3049-3051)GTG>CTG	p.V1017L	ANKIB1_uc010lew.1_Missense_Mutation_p.V286L	NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	1017							protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGTGGAACTGGTGCTGCCAGA	0.468													11	50	---	---	---	---	PASS
PEG10	23089	broad.mit.edu	37	7	94293392	94293392	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94293392G>C	uc011kie.1	+	2	969	c.752G>C	c.(751-753)CGC>CCC	p.R251P		NM_001040152	NP_001035242	Q86TG7	PEG10_HUMAN	paternally expressed 10 isoform RF1	175	Necessary for interaction with ALK1.				apoptosis|cell differentiation|negative regulation of transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			AGACGCCTGCGCCAAGGCATG	0.527													32	264	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103293160	103293160	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103293160G>A	uc003vca.2	-	14	1761	c.1601C>T	c.(1600-1602)CCT>CTT	p.P534L	RELN_uc010liz.2_Missense_Mutation_p.P534L	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	534					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TTTGGTAGCAGGAGTCTGAAG	0.428													47	158	---	---	---	---	PASS
RINT1	60561	broad.mit.edu	37	7	105182850	105182850	+	Intron	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105182850G>C	uc003vda.1	+						RINT1_uc010ljj.1_Intron	NM_021930	NP_068749	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1						cell cycle|G2/M transition DNA damage checkpoint|protein transport|vesicle-mediated transport	endoplasmic reticulum membrane	protein binding			ovary(3)|central_nervous_system(1)	4						TAAAATTATGGTCAGGTACTT	0.234													24	75	---	---	---	---	PASS
GPR85	54329	broad.mit.edu	37	7	112724772	112724772	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112724772G>C	uc010ljv.2	-	2	522	c.5C>G	c.(4-6)GCG>GGG	p.A2G	GPR85_uc003vgp.1_Missense_Mutation_p.A2G|GPR85_uc003vgq.2_Missense_Mutation_p.A2G|GPR85_uc010ljw.1_Missense_Mutation_p.A2G	NM_001146266	NP_001139738	P60893	GPR85_HUMAN	G protein-coupled receptor 85	2	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|central_nervous_system(1)	2						GCTATAGTTCGCCATAGATGG	0.398													15	31	---	---	---	---	PASS
PPP1R3A	5506	broad.mit.edu	37	7	113517799	113517799	+	Silent	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113517799T>C	uc010ljy.1	-	4	3379	c.3348A>G	c.(3346-3348)AAA>AAG	p.K1116K		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	1116					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						TGACAGACTCTTTTTGTCTAC	0.363													56	134	---	---	---	---	PASS
SPAM1	6677	broad.mit.edu	37	7	123593754	123593754	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123593754A>T	uc003vld.2	+	4	532	c.130A>T	c.(130-132)ATT>TTT	p.I44F	SPAM1_uc003vle.2_Missense_Mutation_p.I44F|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Missense_Mutation_p.I44F|SPAM1_uc010lku.2_Missense_Mutation_p.I44F	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	44					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	ACCTCCTGTTATTCCAAATGT	0.418													21	91	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131887566	131887566	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131887566C>A	uc003vra.3	-	12	2654	c.2425G>T	c.(2425-2427)GAG>TAG	p.E809*		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	809	PSI 3.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						CCGCAGCTCTCACGCATGGCT	0.647													8	27	---	---	---	---	PASS
KEL	3792	broad.mit.edu	37	7	142641733	142641733	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142641733G>T	uc003wcb.2	-	12	1620	c.1410C>A	c.(1408-1410)GAC>GAA	p.D470E		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	470	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	p.D470N(1)		ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					GCCTGACCTTGTCCTGGGCCA	0.567													7	38	---	---	---	---	PASS
CTAGE6	340307	broad.mit.edu	37	7	143453479	143453479	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143453479G>C	uc003wdk.3	-	1	1365	c.1273C>G	c.(1273-1275)CGT>GGT	p.R425G	uc011ktn.1_Intron|uc011kto.1_Intron|uc011ktp.1_Intron|LOC154761_uc011ktq.1_Intron|LOC154761_uc011ktr.1_Intron|LOC154761_uc011kts.1_Intron|LOC154761_uc003wdj.1_Intron	NM_178561	NP_848656	Q86UF2	CTGE6_HUMAN	CTAGE family, member 6	425	Potential.					integral to membrane					0	Melanoma(164;0.0903)					TCAGTGGCACGGCTGAGCTTT	0.378													17	276	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147092850	147092850	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147092850G>A	uc003weu.1	+	10	2164	c.1648G>A	c.(1648-1650)GAC>AAC	p.D550N		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	550	Extracellular (Potential).|Laminin G-like 2.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TGTCAGCATTGACATGTGTGC	0.428										HNSCC(39;0.1)			58	143	---	---	---	---	PASS
HTR5A	3361	broad.mit.edu	37	7	154863283	154863283	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154863283A>G	uc003wlu.1	+	1	738	c.674A>G	c.(673-675)AAG>AGG	p.K225R	uc011kvt.1_5'Flank|uc003wlt.2_5'Flank	NM_024012	NP_076917	P47898	5HT5A_HUMAN	5-hydroxytryptamine receptor 5A	225	Cytoplasmic (By similarity).					integral to plasma membrane	serotonin receptor activity			ovary(2)|large_intestine(1)	3	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		AAGATCTACAAGGCTGCCAAG	0.557													9	73	---	---	---	---	PASS
WDR60	55112	broad.mit.edu	37	7	158663842	158663842	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158663842T>C	uc003woe.3	+	3	237	c.79T>C	c.(79-81)TCA>CCA	p.S27P		NM_018051	NP_060521	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	27										ovary(2)|breast(1)|central_nervous_system(1)	4	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		GGCCATACAGTCAGGTGGTTC	0.488													3	46	---	---	---	---	PASS
BLK	640	broad.mit.edu	37	8	11400774	11400774	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11400774C>T	uc003wty.2	+	2	622	c.41C>T	c.(40-42)CCG>CTG	p.P14L	BLK_uc003wtz.2_Intron	NM_001715	NP_001706	P51451	BLK_HUMAN	B lymphoid tyrosine kinase	14					intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		AAGGAAAAGCCGATCAAAGAG	0.602													17	45	---	---	---	---	PASS
MCM4	4173	broad.mit.edu	37	8	48878887	48878887	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48878887C>G	uc003xqk.1	+	9	1068	c.973C>G	c.(973-975)CCC>GCC	p.P325A	MCM4_uc003xql.1_Missense_Mutation_p.P325A|MCM4_uc011ldi.1_Missense_Mutation_p.P312A	NM_182746	NP_877423	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	325					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(2)|skin(2)	4		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				CATTGCAGAGCCCAGTGTGTG	0.642													18	56	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53071463	53071463	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53071463C>T	uc003xqz.2	-	10	1957	c.1801G>A	c.(1801-1803)GCC>ACC	p.A601T	ST18_uc011ldq.1_Missense_Mutation_p.A248T|ST18_uc011ldr.1_Missense_Mutation_p.A566T|ST18_uc011lds.1_Missense_Mutation_p.A506T|ST18_uc003xra.2_Missense_Mutation_p.A601T|ST18_uc003xrb.2_Missense_Mutation_p.A601T	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	601						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CCTACCTTGGCATGCAGACTC	0.547													56	171	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53074140	53074140	+	Intron	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53074140G>C	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron|ST18_uc003xrb.2_Intron	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGGAGAGGGGGGTGAAGCAGT	0.433													30	114	---	---	---	---	PASS
ATP6V1H	51606	broad.mit.edu	37	8	54684613	54684613	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54684613C>A	uc003xrl.2	-	10	1137	c.985G>T	c.(985-987)GAA>TAA	p.E329*	ATP6V1H_uc003xrk.2_Nonsense_Mutation_p.E289*|ATP6V1H_uc003xrm.2_Nonsense_Mutation_p.E329*|ATP6V1H_uc003xrn.2_Nonsense_Mutation_p.E311*|ATP6V1H_uc011ldv.1_Nonsense_Mutation_p.E249*|ATP6V1H_uc010lyd.2_Nonsense_Mutation_p.E265*	NM_213620	NP_998785	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1	329					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|endocytosis|insulin receptor signaling pathway|interspecies interaction between organisms|regulation of defense response to virus by virus|transferrin transport|vacuolar acidification|viral reproduction	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase, V1 domain	enzyme regulator activity|protein binding|proton-transporting ATPase activity, rotational mechanism				0		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)			CTGATATCTTCATCATCGTAC	0.393													71	141	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61750802	61750802	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61750802C>T	uc003xue.2	+	19	4998	c.4521C>T	c.(4519-4521)TCC>TCT	p.S1507S		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1507					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GGAAAGGTTCCACATTTGCTA	0.418													7	23	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72967808	72967808	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72967808C>A	uc003xza.2	-	12	1567	c.1392G>T	c.(1390-1392)AGG>AGT	p.R464S		NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	464	ANK 11.|Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	CTTGTAGGAGCCTCTGACAGG	0.388													36	167	---	---	---	---	PASS
KCNB2	9312	broad.mit.edu	37	8	73480336	73480336	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73480336C>A	uc003xzb.2	+	2	955	c.367C>A	c.(367-369)CTT>ATT	p.L123I		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	123	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			TGGCCAAGAACTTGATTACTG	0.453													75	162	---	---	---	---	PASS
TERF1	7013	broad.mit.edu	37	8	73958325	73958325	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73958325A>G	uc003xzd.2	+	10	1298	c.1273A>G	c.(1273-1275)AGG>GGG	p.R425G	TERF1_uc003xze.2_Missense_Mutation_p.R405G	NM_017489	NP_059523	P54274	TERF1_HUMAN	telomeric repeat binding factor 1 isoform 1	425	H-T-H motif.|HTH myb-type.				age-dependent telomere shortening|cell division|G2/M transition of mitotic cell cycle|induction of apoptosis|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of telomere maintenance via semi-conservative replication|negative regulation of telomere maintenance via telomerase|positive regulation of microtubule polymerization|positive regulation of mitosis|positive regulation of mitotic cell cycle|protein homooligomerization|regulation of transcription, DNA-dependent|telomere maintenance via telomerase|telomere maintenance via telomerase|telomere maintenance via telomere shortening	chromosome, telomeric region|cytoplasm|nuclear telomere cap complex|nucleoplasm|nucleus|spindle	caspase activator activity|DNA bending activity|double-stranded telomeric DNA binding|identical protein binding|microtubule binding|protein heterodimerization activity|protein homodimerization activity|telomerase inhibitor activity|telomeric DNA binding			ovary(1)|lung(1)|skin(1)	3	Breast(64;0.218)		Epithelial(68;0.0984)			AGACAGATGGAGGACCATGAA	0.383													25	129	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77767923	77767923	+	Silent	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77767923A>G	uc003yav.2	+	10	9018	c.8631A>G	c.(8629-8631)AAA>AAG	p.K2877K	ZFHX4_uc003yau.1_Silent_p.K2922K|ZFHX4_uc003yaw.1_Silent_p.K2877K	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2877						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTAAATCCAAAAGTAATGATC	0.512										HNSCC(33;0.089)			21	87	---	---	---	---	PASS
PMP2	5375	broad.mit.edu	37	8	82359589	82359589	+	Silent	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82359589A>T	uc003ycb.1	-	1	131	c.33T>A	c.(31-33)CTT>CTA	p.L11L	PMP2_uc010lzv.1_RNA	NM_002677	NP_002668	P02689	MYP2_HUMAN	peripheral myelin protein 2	11						cytoplasm	cholesterol binding|fatty acid binding|transporter activity				0			Epithelial(68;0.186)			CACTAGAGACAAGTTTCCAGG	0.418													31	188	---	---	---	---	PASS
RALYL	138046	broad.mit.edu	37	8	85441619	85441619	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85441619C>A	uc003ycq.3	+	3	479	c.63C>A	c.(61-63)TCC>TCA	p.S21S	RALYL_uc003ycr.3_Silent_p.S21S|RALYL_uc003ycs.3_Silent_p.S21S|RALYL_uc010lzy.2_Silent_p.S21S|RALYL_uc003yct.3_Silent_p.S34S	NM_001100392	NP_001093862	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like isoform 2	21	RRM.						identical protein binding|nucleotide binding|RNA binding			ovary(1)	1						CCATCAACTCCCGTGTTTTCA	0.383													10	47	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87738864	87738864	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87738864G>A	uc003ydx.2	-	3	279	c.233C>T	c.(232-234)TCC>TTC	p.S78F		NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	78	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						ATCTCCAGAGGAATTTTTCTT	0.428													193	458	---	---	---	---	PASS
SLC26A7	115111	broad.mit.edu	37	8	92352656	92352656	+	Silent	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92352656G>C	uc003yex.2	+	9	1181	c.903G>C	c.(901-903)CCG>CCC	p.P301P	SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Silent_p.P301P|SLC26A7_uc003yfa.2_Silent_p.P301P	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a	301	Cytoplasmic (Potential).					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			GAGCTCCCCCGATGAACATCC	0.443													26	190	---	---	---	---	PASS
RRM2B	50484	broad.mit.edu	37	8	103231116	103231116	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103231116C>A	uc003ykn.2	-	6	854	c.610G>T	c.(610-612)GCT>TCT	p.A204S	RRM2B_uc003yko.2_RNA|RRM2B_uc010mbv.1_Missense_Mutation_p.A152S|RRM2B_uc010mbw.1_Intron|RRM2B_uc010mbx.1_Intron|RRM2B_uc010mby.1_Intron	NM_015713	NP_056528	Q7LG56	RIR2B_HUMAN	ribonucleotide reductase M2 B (TP53 inducible)	204					deoxyribonucleoside diphosphate metabolic process|DNA repair|nucleobase, nucleoside and nucleotide interconversion	nucleoplasm	ribonucleoside-diphosphate reductase activity|transition metal ion binding			ovary(2)	2	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000728)			CAGAATATAGCAGCAAAAGAT	0.398								Direct_reversal_of_damage|Modulation_of_nucleotide_pools					41	268	---	---	---	---	PASS
ENPP2	5168	broad.mit.edu	37	8	120569785	120569785	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120569785C>T	uc003yot.1	-	25	2654	c.2568G>A	c.(2566-2568)CTG>CTA	p.L856L	ENPP2_uc011lic.1_Silent_p.L394L|ENPP2_uc003yor.1_Silent_p.L491L|ENPP2_uc003yos.1_Silent_p.L908L|ENPP2_uc010mdd.1_Silent_p.L881L	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	856					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CATATGTATGCAGGTATGTCT	0.403													39	201	---	---	---	---	PASS
FER1L6	654463	broad.mit.edu	37	8	125035683	125035683	+	Splice_Site	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125035683G>C	uc003yqw.2	+	18	2340	c.2134_splice	c.e18-1	p.P712_splice	uc003yqx.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6							integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TATTCCCACAGCCCCAGCACA	0.498													59	272	---	---	---	---	PASS
ZNF572	137209	broad.mit.edu	37	8	125989627	125989627	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125989627G>T	uc003yrr.2	+	3	1272	c.1117G>T	c.(1117-1119)GAA>TAA	p.E373*		NM_152412	NP_689625	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	373					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			CAATGTGATAGAAGAATGCAG	0.393										HNSCC(60;0.17)			12	167	---	---	---	---	PASS
OC90	729330	broad.mit.edu	37	8	133051285	133051285	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133051285G>T	uc003ytg.2	-	5	495	c.495C>A	c.(493-495)TCC>TCA	p.S165S	OC90_uc011lix.1_Silent_p.S181S	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90	181	Phospholipase A2-like 1.				lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			GAAGGTTCAGGGAAGAGTTGA	0.562													17	70	---	---	---	---	PASS
SCRIB	23513	broad.mit.edu	37	8	144877216	144877216	+	Missense_Mutation	SNP	C	T	T	rs144293240		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144877216C>T	uc003yzp.1	-	27	3845	c.3838G>A	c.(3838-3840)GTG>ATG	p.V1280M	SCRIB_uc003yzn.1_Translation_Start_Site|SCRIB_uc003yzo.1_Missense_Mutation_p.V1280M	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b	1280					activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			ACCCTCTGCACGCTGCCAGCG	0.687													11	35	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144993255	144993255	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144993255G>T	uc003zaf.1	-	32	11315	c.11145C>A	c.(11143-11145)GGC>GGA	p.G3715G	PLEC_uc003zab.1_Silent_p.G3578G|PLEC_uc003zac.1_Silent_p.G3582G|PLEC_uc003zad.2_Silent_p.G3578G|PLEC_uc003zae.1_Silent_p.G3546G|PLEC_uc003zag.1_Silent_p.G3556G|PLEC_uc003zah.2_Silent_p.G3564G|PLEC_uc003zaj.2_Silent_p.G3605G	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3715	Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CGCCGTGGCTGCCGCCGCCGG	0.647													58	81	---	---	---	---	PASS
RPL8	6132	broad.mit.edu	37	8	146015194	146015194	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146015194T>C	uc003zeb.2	-	6	880	c.769A>G	c.(769-771)AAC>GAC	p.N257D	RPL8_uc003zdz.2_RNA|RPL8_uc003zea.2_Missense_Mutation_p.N221D|RPL8_uc003zec.2_Missense_Mutation_p.N257D	NM_033301	NP_150644	P62917	RL8_HUMAN	ribosomal protein L8	257					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	rRNA binding|structural constituent of ribosome				0	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.191)		CAGCACTAGTTCTCTTTCTCC	0.582													69	431	---	---	---	---	PASS
SYK	6850	broad.mit.edu	37	9	93650155	93650155	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93650155G>T	uc004aqz.2	+	12	1911	c.1706G>T	c.(1705-1707)GGG>GTG	p.G569V	SYK_uc004ara.2_Missense_Mutation_p.G546V|SYK_uc004arb.2_Missense_Mutation_p.G546V|SYK_uc004arc.2_Missense_Mutation_p.G569V|SYK_uc011ltr.1_RNA|SYK_uc011lts.1_RNA|SYK_uc011ltt.1_RNA	NM_003177	NP_003168	P43405	KSYK_HUMAN	spleen tyrosine kinase isoform 1	569	Protein kinase.				cell proliferation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|neutrophil chemotaxis|organ morphogenesis|platelet activation|protein complex assembly	cytosol|T cell receptor complex	ATP binding|integrin binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						TTCTCCTATGGGCAGAAGCCA	0.468			T	ETV6|ITK	MDS|peripheral T-cell lymphoma								22	53	---	---	---	---	PASS
CRB2	286204	broad.mit.edu	37	9	126128327	126128327	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126128327G>T	uc004bnx.1	+	3	642	c.550G>T	c.(550-552)GAC>TAC	p.D184Y	CRB2_uc004bnw.1_Missense_Mutation_p.D184Y	NM_173689	NP_775960	Q5IJ48	CRUM2_HUMAN	crumbs homolog 2 precursor	184	Extracellular (Potential).|EGF-like 4; calcium-binding (Potential).					extracellular region|integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						TTGCCAGCTGGACCTCGACGA	0.751													5	9	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7262362	7262362	+	Intron	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7262362C>A	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						CTACCCCCAGCGAGTACGTAC	0.542													61	288	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15655666	15655666	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15655666C>A	uc001ioc.1	-	15	1546	c.1546G>T	c.(1546-1548)GCT>TCT	p.A516S	ITGA8_uc010qcb.1_Missense_Mutation_p.A501S	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	516	Extracellular (Potential).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						CACCAGGCAGCAGATGTCATA	0.274													49	223	---	---	---	---	PASS
ZNF32	7580	broad.mit.edu	37	10	44139991	44139991	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44139991C>A	uc001jbb.2	-	3	518	c.329G>T	c.(328-330)TGT>TTT	p.C110F	uc001jba.2_Intron|ZNF32_uc001jbc.2_Missense_Mutation_p.C110F	NM_001005368	NP_001005368	P17041	ZNF32_HUMAN	zinc finger protein 32	110	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)		GCTTTTTCCACAGTGGGTGCA	0.468													30	112	---	---	---	---	PASS
KCNMA1	3778	broad.mit.edu	37	10	78674815	78674815	+	Intron	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78674815G>A	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxl.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	ACCCTAGTGGGAAGGAAACAG	0.423													57	175	---	---	---	---	PASS
LIPK	643414	broad.mit.edu	37	10	90486621	90486621	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90486621C>A	uc010qmv.1	+	2	175	c.175C>A	c.(175-177)CTT>ATT	p.L59I		NM_001080518	NP_001073987	Q5VXJ0	LIPK_HUMAN	lipase, family member K precursor	59					lipid catabolic process	extracellular region	hydrolase activity			ovary(2)	2		Colorectal(252;0.0381)		Colorectal(12;7.03e-05)|COAD - Colon adenocarcinoma(12;8.33e-05)		TGGTTATATCCTTGGAATTTA	0.343													10	19	---	---	---	---	PASS
HTR7	3363	broad.mit.edu	37	10	92509212	92509212	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92509212C>T	uc001kha.2	-	2	922	c.679G>A	c.(679-681)GAT>AAT	p.D227N	HTR7_uc001kgz.2_Missense_Mutation_p.D227N|HTR7_uc001khb.2_Missense_Mutation_p.D227N	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d	227	Extracellular (By similarity).				blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)	ACCTTATCATCATTTACATTC	0.468													27	98	---	---	---	---	PASS
CYP2C19	1557	broad.mit.edu	37	10	96522558	96522558	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96522558C>A	uc010qnz.1	+	1	96	c.96C>A	c.(94-96)GGC>GGA	p.G32G	CYP2C19_uc009xus.1_Intron|CYP2C19_uc010qny.1_Intron	NM_000769	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C,	32					exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	(S)-limonene 6-monooxygenase activity|(S)-limonene 7-monooxygenase activity|4-hydroxyacetophenone monooxygenase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding|steroid hydroxylase activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Adinazolam(DB00546)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Arformoterol(DB01274)|Bortezomib(DB00188)|Carisoprodol(DB00395)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Desipramine(DB01151)|Desloratadine(DB00967)|Diclofenac(DB00586)|Diltiazem(DB00343)|Efavirenz(DB00625)|Esomeprazole(DB00736)|Famotidine(DB00927)|Felbamate(DB00949)|Finasteride(DB01216)|Flunitrazepam(DB01544)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Guanfacine(DB01018)|Imipramine(DB00458)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Loratadine(DB00455)|Melatonin(DB01065)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nilutamide(DB00665)|Norgestrel(DB00506)|Omeprazole(DB00338)|Oxcarbazepine(DB00776)|Pantoprazole(DB00213)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Quinidine(DB00908)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Temazepam(DB00231)|Teniposide(DB00444)|Terfenadine(DB00342)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tolbutamide(DB01124)|Topiramate(DB00273)|Tranylcypromine(DB00752)|Troglitazone(DB00197)|Troleandomycin(DB01361)|Voriconazole(DB00582)	TCCCTCCTGGCCCTACTCCTC	0.453													64	178	---	---	---	---	PASS
DNTT	1791	broad.mit.edu	37	10	98092315	98092315	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98092315C>A	uc001kmf.2	+	9	1491	c.1321C>A	c.(1321-1323)CGT>AGT	p.R441S	DNTT_uc001kmg.2_Missense_Mutation_p.R441S	NM_004088	NP_004079	P04053	TDT_HUMAN	terminal deoxynucleotidyltransferase isoform 1	441	Mediates interaction with DNTTIP2.				DNA modification	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding			ovary(1)	1		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		CCCCTACGAGCGTCGTGCCTT	0.547													86	303	---	---	---	---	PASS
LBX1	10660	broad.mit.edu	37	10	102987419	102987419	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102987419G>A	uc001ksx.2	-	2	599	c.454C>T	c.(454-456)CCC>TCC	p.P152S	uc010qpy.1_5'Flank	NM_006562	NP_006553	P52954	LBX1_HUMAN	ladybird homeobox 1	152	Homeobox.				muscle organ development		sequence-specific DNA binding				0		Colorectal(252;0.234)		Epithelial(162;3.22e-09)|all cancers(201;1.79e-07)		CGATCGGCGGGGGACAGGTAC	0.592													31	176	---	---	---	---	PASS
C10orf90	118611	broad.mit.edu	37	10	128147646	128147646	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128147646G>T	uc001ljq.2	-	6	1981	c.1860C>A	c.(1858-1860)ACC>ACA	p.T620T	C10orf90_uc001ljp.2_Silent_p.T476T|C10orf90_uc010qum.1_Silent_p.T717T|C10orf90_uc001ljo.2_RNA	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611	620										ovary(1)|skin(1)	2		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		GCTTCTTGCTGGTGCGGATGG	0.572													33	52	---	---	---	---	PASS
VENTX	27287	broad.mit.edu	37	10	135053756	135053756	+	Silent	SNP	G	T	T	rs56130458		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135053756G>T	uc010quy.1	+	3	734	c.723G>T	c.(721-723)CTG>CTT	p.L241L		NM_014468	NP_055283	O95231	VENTX_HUMAN	VENT homeobox	241					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		GACCAGCCCTGTCCACGGGGC	0.682													13	33	---	---	---	---	PASS
PDDC1	347862	broad.mit.edu	37	11	771358	771358	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:771358C>T	uc001lrc.2	-	6	544	c.519G>A	c.(517-519)GTG>GTA	p.V173V	PDDC1_uc010qwm.1_Silent_p.V123V|PDDC1_uc001lrd.2_Silent_p.V173V|PDDC1_uc001lrf.1_Silent_p.*151*|PDDC1_uc001lrg.1_RNA|PDDC1_uc009ycg.2_Silent_p.V123V|PDDC1_uc010qwn.1_RNA|PDDC1_uc010qwo.1_RNA|PDDC1_uc010qwp.1_Silent_p.V137V|PDDC1_uc010qwq.1_Silent_p.V87V|PDDC1_uc010qwr.1_Silent_p.V173V|PDDC1_uc010qws.1_Silent_p.V123V	NM_182612	NP_872418	Q8NB37	PDDC1_HUMAN	Parkinson disease 7 domain containing 1	173						extracellular region					0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;3.66e-26)|Epithelial(43;2.43e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-19)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCGAATCCTTCACGAAGTCCT	0.687													5	13	---	---	---	---	PASS
OR4P4	81300	broad.mit.edu	37	11	55406221	55406221	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55406221T>C	uc010rij.1	+	1	388	c.388T>C	c.(388-390)TAC>CAC	p.Y130H		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	130	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						GCCCCTGCACTACACCATTAT	0.428													53	164	---	---	---	---	PASS
OR4P4	81300	broad.mit.edu	37	11	55406499	55406499	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55406499C>A	uc010rij.1	+	1	666	c.666C>A	c.(664-666)ACC>ACA	p.T222T		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	222	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						TATTGTATACCATCAGAGCAT	0.373													69	142	---	---	---	---	PASS
OR5D14	219436	broad.mit.edu	37	11	55563225	55563225	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55563225T>A	uc010rim.1	+	1	194	c.194T>A	c.(193-195)CTT>CAT	p.L65H		NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D,	65	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3		all_epithelial(135;0.196)				TACTTTTTCCTTAGTCACCTC	0.378													67	166	---	---	---	---	PASS
OR5F1	338674	broad.mit.edu	37	11	55761370	55761370	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55761370G>T	uc010riv.1	-	1	732	c.732C>A	c.(730-732)CAC>CAA	p.H244Q		NM_003697	NP_003688	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F,	244	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)					TGGCTGTCAGGTGAGAGGCAC	0.493													17	86	---	---	---	---	PASS
OR5M10	390167	broad.mit.edu	37	11	56345080	56345080	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56345080C>A	uc001niz.1	-	1	118	c.118G>T	c.(118-120)GCA>TCA	p.A40S		NM_001004741	NP_001004741	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M,	40	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGGTTGCCTGCCAGTGTGATT	0.478													45	174	---	---	---	---	PASS
OR9I1	219954	broad.mit.edu	37	11	57886859	57886859	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57886859G>T	uc001nml.1	-	1	58	c.58C>A	c.(58-60)CAC>AAC	p.H20N	OR9Q1_uc001nmj.2_Intron	NM_001005211	NP_001005211	Q8NGQ6	OR9I1_HUMAN	olfactory receptor, family 9, subfamily I,	20	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Breast(21;0.0589)				AATTTGGGGTGGTCCATAAAG	0.423													6	83	---	---	---	---	PASS
OR9Q1	219956	broad.mit.edu	37	11	57947632	57947632	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57947632C>A	uc001nmj.2	+	3	1032	c.716C>A	c.(715-717)ACC>AAC	p.T239N		NM_001005212	NP_001005212	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q,	239	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.222)				ACCTTCTCCACCTGCACCTCC	0.522													36	271	---	---	---	---	PASS
MS4A12	54860	broad.mit.edu	37	11	60268610	60268610	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60268610C>A	uc001npr.2	+	3	426	c.369C>A	c.(367-369)GCC>GCA	p.A123A		NM_017716	NP_060186	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member	123	Helical; (Potential).					integral to membrane	receptor activity				0						TAGGTTTTGCCTCTACTGCTG	0.393													73	233	---	---	---	---	PASS
TMEM216	51259	broad.mit.edu	37	11	61165333	61165333	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61165333A>T	uc010rlj.1	+	4	589	c.296A>T	c.(295-297)TAC>TTC	p.Y99F	TMEM216_uc001nrn.1_Missense_Mutation_p.Y45F	NM_016499	NP_057583	Q9P0N5	TM216_HUMAN	transmembrane protein 216	99	Helical; (Potential).					integral to membrane					0						GCCTCCTATTACCTGCTGCTG	0.527													66	176	---	---	---	---	PASS
SLC3A2	6520	broad.mit.edu	37	11	62655847	62655847	+	Silent	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62655847G>A	uc001nwd.2	+	12	1799	c.1575G>A	c.(1573-1575)CGG>CGA	p.R525R	SLC3A2_uc001nwb.2_Silent_p.R556R|SLC3A2_uc001nwc.2_Silent_p.R526R|SLC3A2_uc001nwe.2_Silent_p.R494R|SLC3A2_uc001nwf.2_Silent_p.R463R|SLC3A2_uc001nwg.2_Silent_p.R424R	NM_002394	NP_002385	P08195	4F2_HUMAN	solute carrier family 3, member 2 isoform c	525	Extracellular (Potential).				blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding				0						TGTTCCGGCGGCTGAGTGACC	0.587													54	83	---	---	---	---	PASS
PLCB3	5331	broad.mit.edu	37	11	64022421	64022421	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64022421G>T	uc001nzb.2	+	4	298	c.298G>T	c.(298-300)GAG>TAG	p.E100*	PLCB3_uc009ypg.1_Nonsense_Mutation_p.E100*|PLCB3_uc009yph.1_Intron|PLCB3_uc009ypi.2_Nonsense_Mutation_p.E100*	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C beta 3	100					intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2						TGCCCGGCTGGAGGAGAAGCT	0.617													9	52	---	---	---	---	PASS
PLCB3	5331	broad.mit.edu	37	11	64028885	64028885	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64028885G>T	uc001nzb.2	+	15	1745	c.1745G>T	c.(1744-1746)AGC>ATC	p.S582I	PLCB3_uc009ypg.1_Missense_Mutation_p.S582I|PLCB3_uc009yph.1_Missense_Mutation_p.S515I|PLCB3_uc009ypi.2_Missense_Mutation_p.S582I	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C beta 3	582					intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2						ACAGCCAGCAGCGAGGTGAAT	0.607													9	71	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64418069	64418069	+	Nonsense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64418069A>T	uc001oar.2	-	16	3399	c.2960T>A	c.(2959-2961)TTG>TAG	p.L987*	NRXN2_uc001oas.2_Nonsense_Mutation_p.L947*|NRXN2_uc001oaq.2_Nonsense_Mutation_p.L654*	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						CCCCTTCATCAAGGACGGGCC	0.587											OREG0021057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	33	149	---	---	---	---	PASS
NADSYN1	55191	broad.mit.edu	37	11	71189499	71189499	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71189499C>A	uc001oqn.2	+	10	983	c.857C>A	c.(856-858)TCA>TAA	p.S286*	NADSYN1_uc001oqo.2_Nonsense_Mutation_p.S26*|NADSYN1_uc001oqp.2_5'Flank	NM_018161	NP_060631	Q6IA69	NADE_HUMAN	NAD synthetase 1	286	CN hydrolase.				NAD biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds|NAD+ synthase (glutamine-hydrolyzing) activity|protein binding			ovary(2)	2					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GCGGAGATTTCATCTCGAAAC	0.572													5	21	---	---	---	---	PASS
MAP6	4135	broad.mit.edu	37	11	75298590	75298590	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75298590G>T	uc001owu.2	-	4	2021	c.1956C>A	c.(1954-1956)GCC>GCA	p.A652A		NM_033063	NP_149052	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6 isoform 1	652	Pro-rich.					Golgi apparatus|microtubule|perinuclear region of cytoplasm	calmodulin binding				0	Ovarian(111;0.11)					CTGTGGCCATGGCACTTTCAT	0.502													22	164	---	---	---	---	PASS
MTNR1B	4544	broad.mit.edu	37	11	92714979	92714979	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92714979G>A	uc001pdk.1	+	2	693	c.590G>A	c.(589-591)AGC>AAC	p.S197N		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	197	Extracellular (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)	CAGACCGCCAGCACCCAGTAC	0.607													15	44	---	---	---	---	PASS
CWC15	51503	broad.mit.edu	37	11	94704172	94704172	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94704172G>A	uc001pfd.3	-	4	425	c.302C>T	c.(301-303)GCC>GTC	p.A101V	CWC15_uc009ywl.1_3'UTR|KDM4D_uc001pfe.2_5'Flank	NM_016403	NP_057487	Q9P013	CWC15_HUMAN	CWC15 homolog	101					nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome	protein binding|RNA binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ATCAAGGTTGGCGGCAGGAAT	0.368													62	129	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105804490	105804490	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105804490C>A	uc001pix.2	+	14	2535	c.2089C>A	c.(2089-2091)CGA>AGA	p.R697R	GRIA4_uc001piw.2_Silent_p.R697R|GRIA4_uc010rvm.1_RNA|GRIA4_uc009yxl.1_RNA	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	697	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	GACCTACATGCGATCAGCAGA	0.403													9	37	---	---	---	---	PASS
TTC12	54970	broad.mit.edu	37	11	113233118	113233118	+	Intron	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113233118C>A	uc001pnu.2	+						TTC12_uc001pnv.2_Intron|TTC12_uc001pnw.2_Intron|TTC12_uc001pnx.2_Intron	NM_017868	NP_060338	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12								binding			pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		TTCTGCTGTACTCAGAGAGCT	0.428													3	92	---	---	---	---	PASS
USP28	57646	broad.mit.edu	37	11	113679924	113679924	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113679924C>A	uc001poh.2	-	17	2058	c.2025G>T	c.(2023-2025)GTG>GTT	p.V675V	USP28_uc001pog.2_Silent_p.V383V|USP28_uc010rwy.1_Silent_p.V550V|USP28_uc001poi.2_Silent_p.V30V	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28	675					cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		GCTTGAGTTCCACAGATAGGG	0.453													80	585	---	---	---	---	PASS
CCDC15	80071	broad.mit.edu	37	11	124875010	124875010	+	Silent	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124875010A>G	uc001qbm.3	+	13	2572	c.2313A>G	c.(2311-2313)CAA>CAG	p.Q771Q		NM_025004	NP_079280	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	771						centrosome				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		tttagcgtcaaaagcagtacc	0.144													4	8	---	---	---	---	PASS
DCPS	28960	broad.mit.edu	37	11	126176543	126176543	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126176543G>T	uc001qdp.2	+	2	609	c.280G>T	c.(280-282)GTG>TTG	p.V94L		NM_014026	NP_054745	Q96C86	DCPS_HUMAN	mRNA decapping enzyme	94					deadenylation-dependent decapping of nuclear-transcribed mRNA|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	exoribonuclease activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		GGTGGAACAGGTGGCTCAGCT	0.547													12	44	---	---	---	---	PASS
ERC1	23085	broad.mit.edu	37	12	1292459	1292459	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1292459G>A	uc001qjb.2	+	11	2270	c.2029G>A	c.(2029-2031)GAT>AAT	p.D677N	ERC1_uc001qiz.2_RNA|ERC1_uc001qjc.2_Missense_Mutation_p.D649N|ERC1_uc001qja.2_RNA|ERC1_uc001qjd.2_RNA|ERC1_uc001qjf.2_Missense_Mutation_p.D677N|ERC1_uc010sdv.1_Missense_Mutation_p.D425N|ERC1_uc009zdp.2_Missense_Mutation_p.D317N	NM_178040	NP_829884	Q8IUD2	RB6I2_HUMAN	RAB6-interacting protein 2 isoform epsilon	677	Potential.				I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			TTCACTTTTGGATCTGAAAGA	0.343													29	74	---	---	---	---	PASS
GALNT8	26290	broad.mit.edu	37	12	4835998	4835998	+	Intron	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4835998G>C	uc001qne.1	+							NM_017417	NP_059113	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(1)|skin(1)	4						GACTACAGGTGGGATGAACCA	0.567													6	84	---	---	---	---	PASS
AICDA	57379	broad.mit.edu	37	12	8757847	8757847	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8757847G>C	uc001qur.2	-	3	470	c.391C>G	c.(391-393)CGC>GGC	p.R131G	AICDA_uc001qup.1_Missense_Mutation_p.R126G|AICDA_uc001quq.1_Missense_Mutation_p.R126G|AICDA_uc009zgd.1_Intron	NM_020661	NP_065712	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	131					B cell differentiation|DNA demethylation|mRNA processing|negative regulation of methylation-dependent chromatin silencing	cytoplasm	cytidine deaminase activity|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung SC(5;0.184)					ACCCCGGCGCGGTGCAGCCGC	0.642									Immune_Deficiency_with_Hyper-IgM				8	39	---	---	---	---	PASS
GUCY2C	2984	broad.mit.edu	37	12	14849359	14849359	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14849359C>T	uc001rcd.2	-	1	161	c.24G>A	c.(22-24)TTG>TTA	p.L8L	GUCY2C_uc009zhz.2_Silent_p.L8L	NM_004963	NP_004954	P25092	GUC2C_HUMAN	guanylate cyclase 2C precursor	8					intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6						ACCACAAAGCCAAGTCCAACA	0.532													16	47	---	---	---	---	PASS
PLCZ1	89869	broad.mit.edu	37	12	18854483	18854483	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18854483T>A	uc010sid.1	-	9	1160	c.969A>T	c.(967-969)GAA>GAT	p.E323D	PLCZ1_uc001rdv.3_Missense_Mutation_p.E219D|PLCZ1_uc001rdw.3_Missense_Mutation_p.E64D|PLCZ1_uc001rdu.1_Missense_Mutation_p.E105D|PLCZ1_uc009zil.1_RNA	NM_033123	NP_149114	Q86YW0	PLCZ1_HUMAN	phospholipase C, zeta 1	323					intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					TTACCCCTGTTTCCTTGTCTT	0.259													27	154	---	---	---	---	PASS
KCNJ8	3764	broad.mit.edu	37	12	21926429	21926429	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21926429C>T	uc001rff.2	-	2	460	c.122G>A	c.(121-123)GGG>GAG	p.G41E		NM_004982	NP_004973	Q15842	IRK8_HUMAN	potassium inwardly-rectifying channel J8	41	Cytoplasmic (By similarity).					voltage-gated potassium channel complex					0					Levosimendan(DB00922)	GTTGCAGGCCCCGCTCTTGGC	0.622											OREG0021704	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	31	105	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26810795	26810795	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26810795C>A	uc001rhg.2	-	18	2454	c.2037G>T	c.(2035-2037)ATG>ATT	p.M679I		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	679	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					TGGAGCTCTCCATGGGGTTGT	0.398													36	120	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43945642	43945642	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43945642G>T	uc010skx.1	-	1	83	c.83C>A	c.(82-84)CCC>CAC	p.P28H		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	28						proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ACCTTGCCTGGGGTGGAAGTC	0.647													17	70	---	---	---	---	PASS
KRT18	3875	broad.mit.edu	37	12	53343127	53343127	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53343127G>A	uc001sbe.2	+	2	239	c.170G>A	c.(169-171)GGC>GAC	p.G57D	KRT18_uc009zmn.1_Missense_Mutation_p.G57D|KRT18_uc001sbf.1_5'UTR|KRT18_uc001sbg.2_Missense_Mutation_p.G57D|KRT18_uc009zmo.2_Missense_Mutation_p.G57D|KRT8_uc009zml.1_Intron|KRT8_uc009zmm.1_Intron	NM_199187	NP_954657	P05783	K1C18_HUMAN	keratin 18	57	Head.				anatomical structure morphogenesis|cell cycle|Golgi to plasma membrane CFTR protein transport|interspecies interaction between organisms|negative regulation of apoptosis	centriolar satellite|keratin filament|perinuclear region of cytoplasm	protein binding|structural molecule activity			skin(1)	1						TTCAGGGGCGGCATGGGGTCC	0.697													3	41	---	---	---	---	PASS
ERBB3	2065	broad.mit.edu	37	12	56495308	56495308	+	Intron	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56495308C>G	uc001sjh.2	+						ERBB3_uc009zoj.2_Intron|ERBB3_uc010sqb.1_Intron|ERBB3_uc010sqc.1_Intron|ERBB3_uc009zok.2_Intron|ERBB3_uc001sjk.2_Intron|ERBB3_uc001sjl.2_Intron|PA2G4_uc001sjm.2_5'Flank|PA2G4_uc009zol.2_5'Flank|PA2G4_uc009zom.2_5'Flank	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor						cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CTTCTCAACCCCCAGGTACTC	0.448													8	221	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57592399	57592399	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57592399G>A	uc001snd.2	+	60	10088	c.9622G>A	c.(9622-9624)GCC>ACC	p.A3208T		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3208	LDL-receptor class B 29.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTGGGCCGACGCCCGCGAGGA	0.602													6	23	---	---	---	---	PASS
DPY19L2	283417	broad.mit.edu	37	12	64057611	64057611	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64057611G>A	uc001srp.1	-	3	558	c.377C>T	c.(376-378)ACA>ATA	p.T126I	DPY19L2_uc009zqk.1_Intron	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2	126	Helical; (Potential).				multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		TTCAAAAAGTGTTACTAAATG	0.303													30	86	---	---	---	---	PASS
KCNMB4	27345	broad.mit.edu	37	12	70760767	70760767	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70760767G>C	uc001svx.2	+	1	706	c.253G>C	c.(253-255)GTC>CTC	p.V85L		NM_014505	NP_055320	Q86W47	KCMB4_HUMAN	calcium-activated potassium channel beta 4	85	Extracellular (Potential).				detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of neurotransmitter secretion|regulation of vasoconstriction|synaptic transmission	voltage-gated potassium channel complex	calcium-activated potassium channel activity|protein binding				0	Renal(347;0.236)		Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			GTACCCCTGCGTCCAGGTCTA	0.637													21	152	---	---	---	---	PASS
SYT1	6857	broad.mit.edu	37	12	79693310	79693310	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79693310G>T	uc001sys.2	+	9	1460	c.789G>T	c.(787-789)CTG>CTT	p.L263L	SYT1_uc001syt.2_Silent_p.L263L|SYT1_uc001syu.2_Silent_p.L260L|SYT1_uc001syv.2_Silent_p.L263L	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I	263	Cytoplasmic (Potential).|Phospholipid binding (Probable).				detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						GGCGTGACCTGCAAAGTGCTG	0.393													40	104	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104089553	104089553	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104089553C>T	uc001tjw.2	+	33	3699	c.3513C>T	c.(3511-3513)GCC>GCT	p.A1171A		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1171	Extracellular (Potential).|FAS1 4.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						CTGCCGATGCCTACACAGTGT	0.448													24	65	---	---	---	---	PASS
MTERFD3	80298	broad.mit.edu	37	12	107372288	107372288	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107372288C>T	uc001tme.1	-	2	2024	c.205G>A	c.(205-207)GTA>ATA	p.V69I	MTERFD3_uc001tmf.1_Missense_Mutation_p.V69I|MTERFD3_uc001tmg.1_Missense_Mutation_p.V69I|MTERFD3_uc001tmh.1_Missense_Mutation_p.V69I	NM_025198	NP_079474	Q49AM1	MTER3_HUMAN	transcription termination factor-like protein	69					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	transcription regulatory region DNA binding				0						TCTAAAAGTACCCATCCTTTT	0.373													67	132	---	---	---	---	PASS
CORO1C	23603	broad.mit.edu	37	12	109095058	109095058	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109095058C>A	uc001tnj.2	-	2	133	c.37G>T	c.(37-39)GTA>TTA	p.V13L	CORO1C_uc009zva.2_Missense_Mutation_p.V66L|CORO1C_uc010sxf.1_Missense_Mutation_p.V13L	NM_014325	NP_055140	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C isoform 1	13					actin cytoskeleton organization|phagocytosis|signal transduction	actin cytoskeleton	actin filament binding			skin(3)	3						TGCCCAAATACATGCCGAAAC	0.443													28	118	---	---	---	---	PASS
HPD	3242	broad.mit.edu	37	12	122277622	122277622	+	3'UTR	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122277622G>T	uc001ubj.2	-	14					HPD_uc001ubk.2_3'UTR	NM_002150	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase						L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	4-hydroxyphenylpyruvate dioxygenase activity|metal ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	GCCTCCGTGGGGTGGGCGGGG	0.642													11	29	---	---	---	---	PASS
KNTC1	9735	broad.mit.edu	37	12	123060176	123060176	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123060176G>T	uc001ucv.2	+	28	2632	c.2469G>T	c.(2467-2469)CTG>CTT	p.L823L	KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	823					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AACAGCACCTGGAAATGGACC	0.428													5	17	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	129566582	129566582	+	Intron	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129566582G>T	uc009zyl.1	-						TMEM132D_uc001uia.2_Intron	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GCAGGCCTGTGAAAGAAGCAG	0.622													22	67	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	130184949	130184949	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130184949A>T	uc009zyl.1	-	2	702	c.374T>A	c.(373-375)CTT>CAT	p.L125H		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	125	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TTTCCAGTTAAGAGAAAATTT	0.512													20	59	---	---	---	---	PASS
XPO4	64328	broad.mit.edu	37	13	21361694	21361694	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21361694G>A	uc001unq.3	-	21	3127	c.3091C>T	c.(3091-3093)CCG>TCG	p.P1031S		NM_022459	NP_071904	Q9C0E2	XPO4_HUMAN	exportin 4	1031					protein transport	cytoplasm|nucleus	protein binding			large_intestine(1)|ovary(1)|kidney(1)	3		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		TCAGCTAACGGTGTCAAGGCC	0.423													36	91	---	---	---	---	PASS
OLFM4	10562	broad.mit.edu	37	13	53603174	53603174	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53603174A>T	uc001vhl.2	+	1	203	c.203A>T	c.(202-204)CAG>CTG	p.Q68L	OLFM4_uc001vhk.1_Missense_Mutation_p.Q68L	NM_006418	NP_006409	Q6UX06	OLFM4_HUMAN	olfactomedin 4 precursor	68	Ser-rich.				cell adhesion	extracellular space				skin(1)	1		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		TCTGTGTCCCAGGTGAGGAGG	0.368													28	66	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70456586	70456586	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70456586G>T	uc001vip.2	-	5	1850	c.1056C>A	c.(1054-1056)CTC>CTA	p.L352L	KLHL1_uc010thm.1_Silent_p.L291L	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	352					actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CAGCTGGAAGGAGTAAAAACT	0.383													32	63	---	---	---	---	PASS
GPR180	160897	broad.mit.edu	37	13	95278296	95278296	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95278296A>T	uc001vly.2	+	8	1241	c.1163A>T	c.(1162-1164)AAG>ATG	p.K388M	GPR180_uc001vlz.2_Missense_Mutation_p.K287M|GPR180_uc010afi.2_Missense_Mutation_p.K149M	NM_180989	NP_851320	Q86V85	GP180_HUMAN	G protein-coupled receptor 180 precursor	388						integral to membrane				breast(1)	1	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					CAAAGAGACAAGGTAAGAAAT	0.313													19	55	---	---	---	---	PASS
OR4M1	441670	broad.mit.edu	37	14	20248545	20248545	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20248545G>A	uc010tku.1	+	1	64	c.64G>A	c.(64-66)GAG>AAG	p.E22K		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCAGACTCGGGAGGTCCAACT	0.373													154	275	---	---	---	---	PASS
OR4L1	122742	broad.mit.edu	37	14	20529020	20529020	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20529020G>A	uc001vwn.1	+	1	817	c.817G>A	c.(817-819)GTA>ATA	p.V273I		NM_001004717	NP_001004717	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L,	273	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		AACTCTTGCCGTATTTTATAC	0.368													114	116	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21869029	21869029	+	Intron	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21869029C>G	uc001was.1	-						CHD8_uc001war.1_Intron|CHD8_uc001wav.1_Intron	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8						ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		AAGTTGGGGTCTTACCCATAT	0.498													90	79	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23855646	23855646	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23855646C>A	uc001wjv.2	-	33	4904	c.4837G>T	c.(4837-4839)GTC>TTC	p.V1613F		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	1613	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		ACCCTCAGGACCTCGTTGCGG	0.597													100	106	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23891537	23891537	+	Intron	SNP	G	A	A	rs111761637		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23891537G>A	uc001wjx.2	-							NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta						adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CCTTCCAGCTGGTAGAGAGAA	0.542													39	39	---	---	---	---	PASS
LRRC16B	90668	broad.mit.edu	37	14	24527278	24527278	+	Intron	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24527278G>T	uc001wlj.2	+							NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B											ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)		CCTCAGGTCGGGTGGGTGCAG	0.662											OREG0022615	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	47	52	---	---	---	---	PASS
NOVA1	4857	broad.mit.edu	37	14	27064669	27064669	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27064669T>A	uc001wpy.2	-	2	545	c.227A>T	c.(226-228)CAA>CTA	p.Q76L	NOVA1_uc001wpz.2_Missense_Mutation_p.Q76L|NOVA1_uc001wqa.2_5'UTR|NOVA1_uc001wqb.2_Missense_Mutation_p.Q76L	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1	76	KH 1.				locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		AGTTTCTTTTTGCAACTGAAC	0.423													82	97	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71568781	71568781	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71568781C>A	uc001xmo.2	+	31	6110	c.5664C>A	c.(5662-5664)AAC>AAA	p.N1888K	PCNX_uc010are.1_Missense_Mutation_p.N1777K|PCNX_uc010arf.1_Missense_Mutation_p.N676K|PCNX_uc001xmp.2_5'UTR	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1888						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		ATGAGAAGAACCTCGTAATAG	0.438													77	119	---	---	---	---	PASS
RGS6	9628	broad.mit.edu	37	14	72431529	72431529	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72431529T>A	uc001xna.3	+	2	544	c.21T>A	c.(19-21)GAT>GAA	p.D7E	RGS6_uc010ttn.1_Missense_Mutation_p.D7E|RGS6_uc001xmx.3_Missense_Mutation_p.D7E|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Missense_Mutation_p.D7E	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6	7					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		GATCCGGGGATCAAAGAGCAG	0.473													53	88	---	---	---	---	PASS
SERPINA11	256394	broad.mit.edu	37	14	94914513	94914513	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94914513C>T	uc001ydd.1	-	2	659	c.599G>A	c.(598-600)AGC>AAC	p.S200N		NM_001080451	NP_001073920	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1	200					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			kidney(1)	1				COAD - Colon adenocarcinoma(157;0.211)		CGTGTCCTGGCTGAACTCCGG	0.468													118	131	---	---	---	---	PASS
EVL	51466	broad.mit.edu	37	14	100603959	100603959	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100603959C>G	uc001ygt.2	+	10	1242	c.1003C>G	c.(1003-1005)CCT>GCT	p.P335A	EVL_uc001ygv.2_Missense_Mutation_p.P341A|EVL_uc001ygu.2_Missense_Mutation_p.P337A|EVL_uc010avu.2_Missense_Mutation_p.P194A	NM_016337	NP_057421	Q9UI08	EVL_HUMAN	Enah/Vasp-like	335	EVH2.				actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)				GGTGGAGAAGCCTGTGTCCTC	0.612													43	44	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106757699	106757699	+	RNA	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106757699A>T	uc010tyt.1	-	472		c.16366T>A								Parts of antibodies, mostly variable regions.												0						CATGTTGGTCATGGTAAGGAC	0.502													126	136	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20657624	20657624	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20657624T>A	uc001ytg.2	-	16	2354	c.1645A>T	c.(1645-1647)ATT>TTT	p.I549F	uc010tyx.1_RNA|uc001yth.3_Missense_Mutation_p.I549F|uc010tyy.1_Missense_Mutation_p.I549F|uc010tyz.1_3'UTR					RecName: Full=Putative HERC2-like protein 3;																		GACCTACCAATCAGGCGCAGT	0.463													5	46	---	---	---	---	PASS
NDN	4692	broad.mit.edu	37	15	23931648	23931648	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23931648G>T	uc001ywk.2	-	1	803	c.717C>A	c.(715-717)TTC>TTA	p.F239L		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	239	MAGE.				negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		TCATTTGGACGAACTCCTCAG	0.607									Prader-Willi_syndrome				3	81	---	---	---	---	PASS
SNRPN	6638	broad.mit.edu	37	15	25223422	25223422	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25223422C>A	uc001ywp.1	+	12	1532	c.642C>A	c.(640-642)GGC>GGA	p.G214G	SNRPN_uc001ywq.1_Silent_p.G214G|SNRPN_uc001ywr.1_Silent_p.G214G|SNRPN_uc001yws.1_Silent_p.G214G|SNRPN_uc001ywt.1_Silent_p.G214G|SNRPN_uc001ywv.1_Silent_p.G217G|SNRPN_uc001yww.1_Silent_p.G214G|SNRPN_uc001ywx.1_Silent_p.G214G|SNRPN_uc001ywz.1_RNA|PAR-SN_uc001yxa.1_Intron|SNRPN_uc001ywy.1_3'UTR	NM_022807	NP_073718	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	214	Repeat-rich region.				RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		CGCCAATAGGCATGCCGCCTC	0.567									Prader-Willi_syndrome				64	218	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25307476	25307476	+	Intron	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25307476G>A	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-5_uc001yxo.2_5'Flank|SNORD116-2_uc001yxp.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						CTTCAAATGTGCTTGGATCGA	0.502													43	143	---	---	---	---	PASS
GABRG3	2567	broad.mit.edu	37	15	27271912	27271912	+	Missense_Mutation	SNP	G	T	T	rs79497756		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27271912G>T	uc001zbg.1	+	3	380	c.214G>T	c.(214-216)GTA>TTA	p.V72L	GABRG3_uc001zbf.2_Missense_Mutation_p.V72L	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma	72	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		AAAACCGACCGTAATTGACGT	0.398													13	47	---	---	---	---	PASS
ARHGAP11A	9824	broad.mit.edu	37	15	32929009	32929009	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32929009A>T	uc001zgy.1	+	12	2757	c.2035A>T	c.(2035-2037)ACT>TCT	p.T679S	ARHGAP11A_uc010ubw.1_Missense_Mutation_p.T490S|ARHGAP11A_uc010ubx.1_Missense_Mutation_p.T490S	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A isoform 1	679					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			skin(3)|breast(2)|urinary_tract(1)	6		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		ACCCCTTCAAACTCAAACATT	0.303													19	71	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33927899	33927899	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33927899G>T	uc001zhi.2	+	26	3330	c.3260G>T	c.(3259-3261)TGG>TTG	p.W1087L	RYR3_uc010bar.2_Missense_Mutation_p.W1087L	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	1087	B30.2/SPRY 2.|Cytoplasmic (By similarity).|4 X approximate repeats.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCTGGAAAGTGGTATTTTGAG	0.532													16	59	---	---	---	---	PASS
ACTC1	70	broad.mit.edu	37	15	35086886	35086886	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35086886G>T	uc001ziu.1	-	2	367	c.124C>A	c.(124-126)CAC>AAC	p.H42N	uc001zit.1_Intron	NM_005159	NP_005150	P68032	ACTC_HUMAN	cardiac muscle alpha actin 1 proprotein	42					apoptosis|cardiac muscle tissue morphogenesis|cardiac myofibril assembly|muscle filament sliding|skeletal muscle thin filament assembly	actomyosin, actin part|cytosol|I band	ATP binding|ATPase activity|myosin binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		TTTACCTGGTGCCGCGGGCGG	0.667													9	24	---	---	---	---	PASS
AQR	9716	broad.mit.edu	37	15	35198840	35198840	+	Silent	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35198840C>A	uc001ziv.2	-	18	1918	c.1737G>T	c.(1735-1737)CGG>CGT	p.R579R		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	579						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		AAGGTCTCCTCCGGTCAAACT	0.418													41	129	---	---	---	---	PASS
TMCO5A	145942	broad.mit.edu	37	15	38243320	38243320	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38243320C>A	uc001zjw.2	+	11	855	c.752C>A	c.(751-753)CCA>CAA	p.P251Q	TMCO5A_uc001zjv.1_Intron	NM_152453	NP_689666	Q8N6Q1	TMC5A_HUMAN	transmembrane and coiled-coil domains 5A	251						integral to membrane				central_nervous_system(1)	1						TTCATAAATCCAGATCTCCTC	0.423													49	164	---	---	---	---	PASS
THBS1	7057	broad.mit.edu	37	15	39881155	39881155	+	Intron	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39881155C>T	uc001zkh.2	+						THBS1_uc010bbi.2_Silent_p.V19V	NM_003246	NP_003237	P07996	TSP1_HUMAN	thrombospondin 1 precursor						activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding			ovary(3)|central_nervous_system(3)	6		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	Becaplermin(DB00102)	CTCTCCTTGTCTCAGATGGAT	0.498													88	343	---	---	---	---	PASS
MGA	23269	broad.mit.edu	37	15	41961148	41961148	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41961148G>C	uc001zog.1	+	2	147	c.56G>C	c.(55-57)GGA>GCA	p.G19A	MGA_uc010ucy.1_Missense_Mutation_p.G19A|MGA_uc010ucz.1_Missense_Mutation_p.G19A	NM_001080541	NP_001074010	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 2	19						MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		ACAGTGGCAGGAGCAGCACCT	0.423													27	132	---	---	---	---	PASS
SLC12A1	6557	broad.mit.edu	37	15	48594977	48594977	+	Silent	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48594977A>T	uc001zwn.3	+	27	3411	c.3195A>T	c.(3193-3195)ATA>ATT	p.I1065I	SLC12A1_uc001zwq.3_Silent_p.I836I|SLC12A1_uc001zwr.3_Silent_p.I792I	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2	1065	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	AGGGATCCATATCGGATTTGT	0.368													32	126	---	---	---	---	PASS
CEP152	22995	broad.mit.edu	37	15	49061206	49061206	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49061206C>A	uc001zwy.2	-	14	1889	c.1855G>T	c.(1855-1857)GAT>TAT	p.D619Y	CEP152_uc001zwz.2_Missense_Mutation_p.D619Y|CEP152_uc001zxa.1_Missense_Mutation_p.D526Y	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa	619	Potential.				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		AGAATATCATCTCTGACAACA	0.274													13	47	---	---	---	---	PASS
HDC	3067	broad.mit.edu	37	15	50555607	50555607	+	Intron	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50555607A>T	uc001zxz.2	-						HDC_uc010uff.1_Intron|HDC_uc010bet.1_Intron|HDC_uc010beu.1_Intron	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase						catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	CTCTCTCCCTAGAAGTGACAT	0.567													17	55	---	---	---	---	PASS
TRPM7	54822	broad.mit.edu	37	15	50866531	50866531	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50866531C>G	uc001zyt.3	-	36	5512	c.5248G>C	c.(5248-5250)GCC>CCC	p.A1750P	TRPM7_uc001zyr.2_Missense_Mutation_p.A187P	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,	1750	Cytoplasmic (Potential).|Alpha-type protein kinase.				cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		TGGCTAAAGGCTAGCATGATC	0.348													28	132	---	---	---	---	PASS
MYO5A	4644	broad.mit.edu	37	15	52667601	52667601	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52667601C>G	uc002aby.2	-	20	2721	c.2477G>C	c.(2476-2478)CGC>CCC	p.R826P	MYO5A_uc002abx.3_Missense_Mutation_p.R826P|MYO5A_uc010uge.1_Missense_Mutation_p.R695P	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1	826	IQ 3.				actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		CACATACATGCGCCAGTACTT	0.443													22	84	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53957876	53957876	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53957876T>A	uc002acj.2	-	14	1897	c.1855A>T	c.(1855-1857)ATT>TTT	p.I619F	WDR72_uc010bfi.1_Missense_Mutation_p.I619F	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	619										lung(1)|skin(1)	2				all cancers(107;0.0511)		TCTGAGGCAATGGGAAGTACA	0.458													42	123	---	---	---	---	PASS
RNF111	54778	broad.mit.edu	37	15	59377922	59377922	+	Silent	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59377922T>C	uc002afv.2	+	10	2767	c.2488T>C	c.(2488-2490)TTG>CTG	p.L830L	RNF111_uc002afs.2_Silent_p.L830L|RNF111_uc002aft.2_Silent_p.L839L|RNF111_uc002afu.2_Silent_p.L829L|RNF111_uc002afw.2_Silent_p.L839L|RNF111_uc002afx.2_Silent_p.L356L|RNF111_uc002afy.2_5'UTR	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111	830					multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		GCATCCTCACTTGGCCCATTA	0.408													39	119	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	63952040	63952040	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63952040G>C	uc002amp.2	-	47	9467	c.9319C>G	c.(9319-9321)CGC>GGC	p.R3107G		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	3107					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						GGTACAATGCGCCGGTCATTT	0.468													17	78	---	---	---	---	PASS
DENND4A	10260	broad.mit.edu	37	15	66030127	66030127	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66030127G>A	uc002aph.2	-	7	1336	c.958C>T	c.(958-960)CCT>TCT	p.P320S	DENND4A_uc002api.2_Missense_Mutation_p.P320S|DENND4A_uc002apj.3_Missense_Mutation_p.P320S|DENND4A_uc010ujj.1_Missense_Mutation_p.P320S	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2	320	DENN.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						TCAAAAAAAGGCCAGTGAGAA	0.383													3	11	---	---	---	---	PASS
LRRC49	54839	broad.mit.edu	37	15	71211536	71211536	+	Intron	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71211536A>T	uc002asw.2	+						LRRC49_uc002asu.2_Intron|LRRC49_uc002asx.2_Intron|LRRC49_uc010ukf.1_Intron|LRRC49_uc002asy.2_Intron|LRRC49_uc002asz.2_Intron	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49							cytoplasm|microtubule				ovary(1)	1						TTTCGTGGTGAGTATTAAAAT	0.338													51	184	---	---	---	---	PASS
ACSBG1	23205	broad.mit.edu	37	15	78471983	78471983	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78471983C>A	uc002bdh.2	-	10	1449	c.1393G>T	c.(1393-1395)GGT>TGT	p.G465C	ACSBG1_uc010umw.1_Missense_Mutation_p.G461C|ACSBG1_uc010umx.1_Missense_Mutation_p.G223C	NM_015162	NP_055977	Q96GR2	ACBG1_HUMAN	lipidosin	465					long-chain fatty acid metabolic process|myelination|very long-chain fatty acid metabolic process	cytoplasmic membrane-bounded vesicle|endoplasmic reticulum|microsome	ATP binding|long-chain fatty acid-CoA ligase activity|very long-chain fatty acid-CoA ligase activity			ovary(1)	1						ATGTTGAGACCCAGGAAGAAG	0.572													25	67	---	---	---	---	PASS
MORF4L1	10933	broad.mit.edu	37	15	79172853	79172853	+	Splice_Site	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79172853G>A	uc002bel.2	+	3	276	c.88_splice	c.e3-1	p.C30_splice	MORF4L1_uc010bli.1_Splice_Site_p.C30_splice|MORF4L1_uc010blj.1_Splice_Site_p.C30_splice|MORF4L1_uc002bem.2_Splice_Site_p.C30_splice|MORF4L1_uc010une.1_Splice_Site	NM_206839	NP_996670	Q9UBU8	MO4L1_HUMAN	MORF-related gene 15 isoform 2						double-strand break repair via homologous recombination|histone deacetylation|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Sin3 complex	protein N-terminus binding				0						TTGAATTTCAGTGTGTAAAGG	0.289													13	45	---	---	---	---	PASS
KLHL25	64410	broad.mit.edu	37	15	86311564	86311564	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86311564T>C	uc002bly.2	-	2	1681	c.1478A>G	c.(1477-1479)CAG>CGG	p.Q493R		NM_022480	NP_071925	Q9H0H3	ENC2_HUMAN	BTB/POZ KELCH domain protein	493						cytoplasm				ovary(2)	2						GATGAAGATCTGGCTGCCCAG	0.617													33	90	---	---	---	---	PASS
MSLNL	401827	broad.mit.edu	37	16	822922	822922	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:822922C>A	uc002cjz.1	-	11	2263	c.2263G>T	c.(2263-2265)GCC>TCC	p.A755S		NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	404	Extracellular (Potential).				cell adhesion	integral to membrane				breast(3)|ovary(1)	4						ACGTCGGAGGCCAGCAGAGCC	0.687													17	34	---	---	---	---	PASS
THUMPD1	55623	broad.mit.edu	37	16	20748507	20748507	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20748507C>T	uc002dho.2	-	4	895	c.757G>A	c.(757-759)GTG>ATG	p.V253M	THUMPD1_uc010vaz.1_Missense_Mutation_p.V106M|THUMPD1_uc002dhp.2_Missense_Mutation_p.V253M	NM_017736	NP_060206	Q9NXG2	THUM1_HUMAN	THUMP domain containing 1	253	THUMP.										0						TAATCTTTCACAACACTCAGG	0.418													64	123	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	20994170	20994170	+	Silent	SNP	G	T	T	rs138051514		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20994170G>T	uc010vbe.1	-	49	7732	c.7732C>A	c.(7732-7734)CGG>AGG	p.R2578R	DNAH3_uc010vbd.1_Silent_p.R13R	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2578	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		GGGAACATCCGCAGGCGGTTC	0.498													40	100	---	---	---	---	PASS
ANKS4B	257629	broad.mit.edu	37	16	21261440	21261440	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21261440C>T	uc010bwp.1	+	2	596	c.553C>T	c.(553-555)CCT>TCT	p.P185S	CRYM_uc010bwq.1_Intron	NM_145865	NP_665872	Q8N8V4	ANS4B_HUMAN	harmonin-interacting ankyrin-repeat containing	185										ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0565)		CAGATCATCCCCTTCAAATGC	0.473													22	72	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	33647237	33647237	+	IGR	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33647237C>T								SLC6A10P (750774 upstream) : MIR1826 (318271 downstream)																							ACTGACTTCCCCTCGCTGTGT	0.577													59	204	---	---	---	---	PASS
N4BP1	9683	broad.mit.edu	37	16	48594820	48594820	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48594820C>G	uc002efp.2	-	2	1971	c.1734G>C	c.(1732-1734)AGG>AGC	p.R578S		NM_153029	NP_694574	O75113	N4BP1_HUMAN	Nedd4 binding protein 1	578					negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)				GTCCTGCCGACCTTGCATCAG	0.433													51	179	---	---	---	---	PASS
RSPRY1	89970	broad.mit.edu	37	16	57261270	57261270	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57261270G>A	uc002elb.2	+	11	1456	c.1178G>A	c.(1177-1179)GGG>GAG	p.G393E	RSPRY1_uc002elc.2_Missense_Mutation_p.G393E|RSPRY1_uc002eld.2_Missense_Mutation_p.G393E	NM_133368	NP_588609	Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	393	B30.2/SPRY.					extracellular region	zinc ion binding			ovary(1)	1						TACGGCATTGGGGATGATGAA	0.507													8	48	---	---	---	---	PASS
CCDC135	84229	broad.mit.edu	37	16	57734153	57734153	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57734153A>G	uc002emi.2	+	4	564	c.475A>G	c.(475-477)ATG>GTG	p.M159V	CCDC135_uc002emj.2_Missense_Mutation_p.M159V|CCDC135_uc002emk.2_Missense_Mutation_p.M159V	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135	159						cytoplasm				central_nervous_system(1)	1						CTTCCTCACCATGGTGCCCCT	0.542													26	88	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61689508	61689508	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61689508G>T	uc002eog.1	-	11	2024	c.1772C>A	c.(1771-1773)ACC>AAC	p.T591N		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	591	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	p.T591T(1)		ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GATTGTCAAGGTGCTAGTGCT	0.468													34	139	---	---	---	---	PASS
PRMT7	54496	broad.mit.edu	37	16	68390608	68390608	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68390608G>C	uc002evy.1	+	18	2092	c.1816G>C	c.(1816-1818)GGG>CGG	p.G606R	PRMT7_uc010vlg.1_Missense_Mutation_p.G556R|PRMT7_uc002evz.1_Missense_Mutation_p.G378R|PRMT7_uc010cfd.1_Missense_Mutation_p.G98R	NM_019023	NP_061896	Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	606					cell differentiation|DNA methylation involved in gamete generation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	[myelin basic protein]-arginine N-methyltransferase activity|histone methyltransferase activity (H4-R3 specific)|protein-arginine omega-N monomethyltransferase activity|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		TGACAGGCCCGGGCAGAGCCA	0.647													8	21	---	---	---	---	PASS
TAT	6898	broad.mit.edu	37	16	71609830	71609830	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71609830G>T	uc002fap.2	-	3	434	c.335C>A	c.(334-336)TCC>TAC	p.S112Y	TAT_uc002faq.2_Missense_Mutation_p.S112Y|TAT_uc002far.2_3'UTR	NM_000353	NP_000344	P17735	ATTY_HUMAN	tyrosine aminotransferase	112					2-oxoglutarate metabolic process|glutamate metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-tyrosine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(2)	2		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Glutamic Acid(DB00142)|L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Pyridoxal Phosphate(DB00114)	CTTACCGATGGATGGGGCATA	0.488													34	133	---	---	---	---	PASS
FBXO31	79791	broad.mit.edu	37	16	87393974	87393974	+	Splice_Site	SNP	T	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87393974T>G	uc002fjw.2	-	2	385	c.341_splice	c.e2-1	p.E114_splice	FBXO31_uc010vot.1_Splice_Site|FBXO31_uc002fjv.2_Silent_p.T5T	NM_024735	NP_079011	Q5XUX0	FBX31_HUMAN	F-box protein 31						cell cycle|cyclin catabolic process|mitotic cell cycle G1/S transition DNA damage checkpoint|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	SCF ubiquitin ligase complex	cyclin binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0272)		CACCATACTCTGTAACAAGAA	0.493													16	61	---	---	---	---	PASS
OR1A2	26189	broad.mit.edu	37	17	3101541	3101541	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3101541C>G	uc002fvd.1	+	1	729	c.729C>G	c.(727-729)CAC>CAG	p.H243Q		NM_012352	NP_036484	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A,	243	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						GTGGCTCCCACCTCACAGTTG	0.438													88	252	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577551	7577551	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577551C>A	uc002gim.2	-	7	924	c.730G>T	c.(730-732)GGC>TGC	p.G244C	TP53_uc002gig.1_Missense_Mutation_p.G244C|TP53_uc002gih.2_Missense_Mutation_p.G244C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G112C|TP53_uc010cng.1_Missense_Mutation_p.G112C|TP53_uc002gii.1_Missense_Mutation_p.G112C|TP53_uc010cnh.1_Missense_Mutation_p.G244C|TP53_uc010cni.1_Missense_Mutation_p.G244C|TP53_uc002gij.2_Missense_Mutation_p.G244C|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.G151C|TP53_uc002gio.2_Missense_Mutation_p.G112C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	244	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		G -> A (in sporadic cancers; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|MG -> IC (in a sporadic cancer; somatic mutation).|G -> E (in a sporadic cancer; somatic mutation).|G -> C (in sporadic cancers; somatic mutation).|MG -> IS (in a sporadic cancer; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G244C(36)|p.G244S(35)|p.G244D(32)|p.G244V(14)|p.G244G(13)|p.G244A(9)|p.0?(7)|p.G244fs*3(5)|p.G244R(3)|p.M243_G244>IC(1)|p.G244E(1)|p.G244fs*19(1)|p.G151C(1)|p.G244fs*17(1)|p.M243fs*18(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.G244del(1)|p.C238_M246delCNSSCMGGM(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCATGCCGCCCATGCAGGAA	0.582		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			16	74	---	---	---	---	PASS
NTN1	9423	broad.mit.edu	37	17	8926186	8926186	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8926186G>T	uc002glw.3	+	2	603	c.496G>T	c.(496-498)GAC>TAC	p.D166Y		NM_004822	NP_004813	O95631	NET1_HUMAN	netrin 1 precursor	166	Laminin N-terminal.				apoptosis|axon guidance		protein binding				0						CAAGTCCATGGACTACGGGCG	0.622													3	26	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10446460	10446460	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10446460G>T	uc010coi.2	-	9	888	c.760C>A	c.(760-762)CAC>AAC	p.H254N	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.H254N|MYH2_uc010coj.2_Missense_Mutation_p.H254N	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	254	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						GTGCCAAAGTGGATTCTGATG	0.294													42	154	---	---	---	---	PASS
TEKT3	64518	broad.mit.edu	37	17	15234560	15234560	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15234560G>T	uc002gon.2	-	3	530	c.343C>A	c.(343-345)CAT>AAT	p.H115N		NM_031898	NP_114104	Q9BXF9	TEKT3_HUMAN	tektin 3	115					microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		TCCGAATTATGTCGGGAAGTG	0.418													69	283	---	---	---	---	PASS
MPP2	4355	broad.mit.edu	37	17	41955348	41955348	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41955348C>T	uc010wip.1	-	13	1678	c.1621G>A	c.(1621-1623)GCG>ACG	p.A541T	MPP2_uc002ien.1_Missense_Mutation_p.A513T|MPP2_uc010wim.1_Missense_Mutation_p.A485T|MPP2_uc002ieo.1_Missense_Mutation_p.A496T|MPP2_uc010win.1_Missense_Mutation_p.A357T|MPP2_uc010wio.1_Missense_Mutation_p.A485T	NM_005374	NP_005365	Q14168	MPP2_HUMAN	palmitoylated membrane protein 2	520	Guanylate kinase-like.				signal transduction	cell surface|integral to plasma membrane|membrane fraction	guanylate kinase activity				0		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		CTCAGGTCCGCCTCCTGCCCA	0.627													19	43	---	---	---	---	PASS
CALCOCO2	10241	broad.mit.edu	37	17	46925692	46925692	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46925692C>T	uc002iof.2	+	4	371	c.292C>T	c.(292-294)CTG>TTG	p.L98L	CALCOCO2_uc010wlp.1_Silent_p.L119L|CALCOCO2_uc010wlq.1_Silent_p.L26L|CALCOCO2_uc010wlr.1_Silent_p.L122L|CALCOCO2_uc010wls.1_Silent_p.L98L	NM_005831	NP_005822	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2	98					response to interferon-gamma|viral reproduction	cytoskeleton|Golgi apparatus|nucleus|perinuclear region of cytoplasm|soluble fraction	protein homodimerization activity			ovary(1)	1						AGCTTACTACCTGCCCAAGGA	0.398													32	78	---	---	---	---	PASS
COL1A1	1277	broad.mit.edu	37	17	48262882	48262882	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48262882C>A	uc002iqm.2	-	51	4502	c.4376G>T	c.(4375-4377)GGC>GTC	p.G1459V		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	1459	Fibrillar collagen NC1.				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	GCAGACAGGGCCAACGTCGAA	0.572			T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						31	122	---	---	---	---	PASS
PSMC5	5705	broad.mit.edu	37	17	61908449	61908449	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61908449A>G	uc002jcb.2	+	8	774	c.733A>G	c.(733-735)ATC>GTC	p.I245V	PSMC5_uc010ddy.2_Missense_Mutation_p.I222V|PSMC5_uc010ddz.2_Missense_Mutation_p.I166V|PSMC5_uc002jcc.2_Missense_Mutation_p.I237V|PSMC5_uc002jcd.2_Missense_Mutation_p.I237V	NM_002805	NP_002796	P62195	PRS8_HUMAN	proteasome 26S ATPase subunit 5	245					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of programmed cell death|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|ATPase activity|thyrotropin-releasing hormone receptor binding|transcription cofactor activity|transcription factor binding			large_intestine(1)	1						TGCTCCATCTATCATCTTCAT	0.557													45	123	---	---	---	---	PASS
GPRC5C	55890	broad.mit.edu	37	17	72443133	72443133	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72443133C>G	uc002jks.2	+	3	1331	c.1292C>G	c.(1291-1293)TCT>TGT	p.S431C	GPRC5C_uc002jkp.2_Missense_Mutation_p.S476C|GPRC5C_uc002jkq.2_3'UTR|GPRC5C_uc002jkr.2_Missense_Mutation_p.S443C|GPRC5C_uc002jkt.2_Missense_Mutation_p.S431C|GPRC5C_uc002jku.2_Missense_Mutation_p.S186C	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,	431	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						GGCAAGAACTCTCAGGTCTTT	0.652													41	108	---	---	---	---	PASS
CD300LF	146722	broad.mit.edu	37	17	72700780	72700780	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72700780C>T	uc002jlg.2	-	2	322	c.219G>A	c.(217-219)CAG>CAA	p.Q73Q	RAB37_uc002jlc.2_Intron|RAB37_uc010dfu.2_Intron|RAB37_uc002jld.2_Intron|CD300LF_uc002jlf.2_Silent_p.Q76Q|CD300LF_uc010dfw.2_RNA|CD300LF_uc002jlh.2_Silent_p.Q73Q|CD300LF_uc002jli.2_Silent_p.Q76Q|CD300LF_uc010wra.1_Silent_p.Q73Q|CD300LF_uc002jlj.1_Silent_p.Q76Q	NM_139018	NP_620587	Q8TDQ1	CLM1_HUMAN	NK inhibitory receptor precursor	73	Ig-like V-type.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			upper_aerodigestive_tract(1)	1						TCTTCACCTCCTGCTCTGACC	0.498													86	290	---	---	---	---	PASS
TMEM200C	645369	broad.mit.edu	37	18	5891956	5891956	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5891956T>C	uc002kmx.1	-	1	148	c.107A>G	c.(106-108)AAG>AGG	p.K36R		NM_001080209	NP_001073678	A6NKL6	T200C_HUMAN	transmembrane protein 200C	36						integral to membrane					0						CACGTCGTTCTTGCGCCTCTT	0.612													16	42	---	---	---	---	PASS
L3MBTL4	91133	broad.mit.edu	37	18	5956349	5956349	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5956349G>C	uc002kmz.3	-	20	1902	c.1742C>G	c.(1741-1743)ACG>AGG	p.T581R	L3MBTL4_uc010dkt.2_Missense_Mutation_p.T581R|L3MBTL4_uc002kmy.3_Missense_Mutation_p.T410R	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4	581	SAM.				chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				GACAATGTCCGTCTGTGTCAG	0.438													66	310	---	---	---	---	PASS
L3MBTL4	91133	broad.mit.edu	37	18	6243368	6243368	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6243368T>A	uc002kmz.3	-	7	545	c.385A>T	c.(385-387)ACC>TCC	p.T129S	L3MBTL4_uc010dkt.2_Missense_Mutation_p.T129S|L3MBTL4_uc002kmy.3_5'Flank	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4	129	MBT 1.				chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				CCAGCATTGGTCCAAAAATCA	0.393													30	142	---	---	---	---	PASS
L3MBTL4	91133	broad.mit.edu	37	18	6243369	6243369	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6243369C>T	uc002kmz.3	-	7	544	c.384G>A	c.(382-384)TGG>TGA	p.W128*	L3MBTL4_uc010dkt.2_Nonsense_Mutation_p.W128*|L3MBTL4_uc002kmy.3_5'Flank	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4	128	MBT 1.				chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				CAGCATTGGTCCAAAAATCAT	0.393													30	142	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6986250	6986250	+	Silent	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6986250T>A	uc002knm.2	-	37	5359	c.5265A>T	c.(5263-5265)TCA>TCT	p.S1755S	LAMA1_uc010wzj.1_Silent_p.S1231S	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1755	Domain II and I.|Potential.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGTTGTGCTTTGAAAGGACGT	0.478													56	221	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7049067	7049067	+	Intron	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7049067C>A	uc002knm.2	-						LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GACTGCCGTCCCATACTCACG	0.413													19	68	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8069965	8069965	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8069965G>T	uc002knn.3	+	8	1917	c.1414G>T	c.(1414-1416)GAA>TAA	p.E472*	PTPRM_uc010dkv.2_Nonsense_Mutation_p.E472*|PTPRM_uc010wzl.1_Nonsense_Mutation_p.E259*	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	472	Fibronectin type-III 2.|Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				GGAAAGCCAAGAACTCATAGT	0.418													9	40	---	---	---	---	PASS
AFG3L2	10939	broad.mit.edu	37	18	12344181	12344181	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12344181C>A	uc002kqz.1	-	14	1842	c.1729G>T	c.(1729-1731)GGC>TGC	p.G577C		NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2	577					cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	ACCGCATGGCCTGCTTCGTGG	0.522													36	119	---	---	---	---	PASS
CEP192	55125	broad.mit.edu	37	18	13104996	13104996	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13104996G>C	uc010xac.1	+	40	7045	c.6965G>C	c.(6964-6966)AGT>ACT	p.S2322T	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.S1847T|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_Missense_Mutation_p.S744T|CEP192_uc002krw.2_Missense_Mutation_p.S471T|CEP192_uc002krx.2_Missense_Mutation_p.S326T|CEP192_uc002kry.2_RNA	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	2322										ovary(4)|pancreas(1)	5						GTTGATGAAAGTGGAGATGTT	0.388													36	175	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22804449	22804449	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22804449C>A	uc002kvk.2	-	4	3680	c.3433G>T	c.(3433-3435)GTT>TTT	p.V1145F	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.V1145F|ZNF521_uc002kvl.2_Missense_Mutation_p.V925F	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	1145	C2H2-type 26.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TCAAACTTAACGTTGCAGCTA	0.532			T	PAX5	ALL								29	92	---	---	---	---	PASS
KLHL14	57565	broad.mit.edu	37	18	30350379	30350379	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30350379C>G	uc002kxm.1	-	2	564	c.176G>C	c.(175-177)CGA>CCA	p.R59P		NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14	59	BTB.					cytosol|endoplasmic reticulum membrane				ovary(1)	1						GAAGAGCGATCGGAAGTACTG	0.592													11	33	---	---	---	---	PASS
KIAA0427	9811	broad.mit.edu	37	18	46287933	46287933	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46287933G>C	uc002ldc.2	+	9	1529	c.1244G>C	c.(1243-1245)CGC>CCC	p.R415P	KIAA0427_uc002ldd.2_Missense_Mutation_p.R417P|KIAA0427_uc002lde.3_Missense_Mutation_p.R44P	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1	415	MIF4G.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						GAGATCGTGCGCACAATCTAC	0.592													25	78	---	---	---	---	PASS
LIPG	9388	broad.mit.edu	37	18	47088747	47088747	+	Silent	SNP	A	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47088747A>C	uc002ldv.2	+	1	321	c.69A>C	c.(67-69)GTA>GTC	p.V23V	LIPG_uc002ldu.1_Silent_p.V23V|LIPG_uc010xdh.1_Silent_p.V23V	NM_006033	NP_006024	Q9Y5X9	LIPE_HUMAN	endothelial lipase precursor	23					cholesterol homeostasis|high-density lipoprotein particle remodeling|phospholipid catabolic process|phospholipid homeostasis|positive regulation of cholesterol transport|positive regulation of high-density lipoprotein particle clearance|reverse cholesterol transport	extracellular space	heparin binding|lipoprotein lipase activity|phospholipase A1 activity|protein binding|triglyceride lipase activity			ovary(1)|skin(1)	2						GGAGCCCCGTACCTTTTGGTC	0.562													18	66	---	---	---	---	PASS
GALR1	2587	broad.mit.edu	37	18	74980855	74980855	+	Silent	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74980855G>A	uc002lms.3	+	3	1544	c.1047G>A	c.(1045-1047)GTG>GTA	p.V349V		NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1	349	Cytoplasmic (Potential).				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		GTACTCATGTGTGATAAAAGA	0.383													26	125	---	---	---	---	PASS
MEX3D	399664	broad.mit.edu	37	19	1556842	1556842	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1556842C>A	uc010dsn.2	-	2	676	c.676G>T	c.(676-678)GTG>TTG	p.V226L		NM_203304	NP_976049	Q86XN8	MEX3D_HUMAN	ring finger and KH domain containing 1	226	KH 1.				mRNA destabilization|posttranscriptional regulation of gene expression by mRNA localization|regulation of anti-apoptosis	nucleus|perinuclear region of cytoplasm	AU-rich element binding|zinc ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCCGGTCACGATGAAGACC	0.657													10	36	---	---	---	---	PASS
SHD	56961	broad.mit.edu	37	19	4282913	4282913	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4282913A>T	uc002lzw.2	+	2	1807	c.344A>T	c.(343-345)CAT>CTT	p.H115L	SHD_uc010dtu.2_Missense_Mutation_p.H115L	NM_020209	NP_064594	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming	115											0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCAGCCTCATCCTGCACCC	0.577													36	146	---	---	---	---	PASS
KDM4B	23030	broad.mit.edu	37	19	5133937	5133937	+	Silent	SNP	C	T	T	rs146435915		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5133937C>T	uc002mbq.3	+	14	2176	c.1950C>T	c.(1948-1950)GAC>GAT	p.D650D	KDM4B_uc010xim.1_Silent_p.D684D|KDM4B_uc002mbr.3_Silent_p.D408D	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B	650					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1						GTGACCCGGACGCCTTGAGGC	0.612													23	87	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8966671	8966671	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8966671T>C	uc002mkp.2	-	81	43486	c.43282A>G	c.(43282-43284)AGG>GGG	p.R14428G	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.R1228G|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	14526	SEA 16.|Extracellular (Potential).			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ACACTGCTCCTGTCCAGGGTG	0.562													6	13	---	---	---	---	PASS
ZNF426	79088	broad.mit.edu	37	19	9639140	9639140	+	Silent	SNP	T	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9639140T>C	uc002mlq.2	-	8	1845	c.1581A>G	c.(1579-1581)ACA>ACG	p.T527T	ZNF426_uc010dws.2_Silent_p.T489T	NM_024106	NP_077011	Q9BUY5	ZN426_HUMAN	zinc finger protein 426	527					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GTTTCTCTTCTGTGTGAGTTT	0.428													60	158	---	---	---	---	PASS
ANGPTL6	83854	broad.mit.edu	37	19	10204093	10204093	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10204093C>G	uc002mmx.1	-	5	1272	c.1154G>C	c.(1153-1155)GGA>GCA	p.G385A	ANGPTL6_uc002mmy.1_Missense_Mutation_p.G385A	NM_031917	NP_114123	Q8NI99	ANGL6_HUMAN	angiopoietin-like 6 precursor	385	Fibrinogen C-terminal.				angiogenesis|cell differentiation|signal transduction	extracellular space	receptor binding				0			OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)			AAGAGAGTCTCCAGCATCACC	0.577													34	103	---	---	---	---	PASS
ILF3	3609	broad.mit.edu	37	19	10798245	10798245	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10798245G>C	uc002mpn.2	+	18	2600	c.2283G>C	c.(2281-2283)CAG>CAC	p.Q761H	ILF3_uc002mpo.2_Missense_Mutation_p.Q765H|ILF3_uc002mpq.2_Missense_Mutation_p.R64T	NM_012218	NP_036350	Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3 isoform a	761	Interaction with PRMT1.				M phase|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleolus|ribonucleoprotein complex	DNA binding|double-stranded RNA binding|protein binding|protein binding			ovary(3)	3			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			CCTACAACCAGAGCCCCTACA	0.607													6	54	---	---	---	---	PASS
LDLR	3949	broad.mit.edu	37	19	11215997	11215997	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11215997G>C	uc002mqk.3	+	4	583	c.415G>C	c.(415-417)GAC>CAC	p.D139H	LDLR_uc010xlk.1_Missense_Mutation_p.D139H|LDLR_uc010xll.1_Missense_Mutation_p.D98H|LDLR_uc010xlm.1_Intron|LDLR_uc010xln.1_Intron|LDLR_uc010xlo.1_Intron	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	139	Extracellular (Potential).|LDL-receptor class A 3.				cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)	GGACGGCTCAGACGAGGCCTC	0.647													65	239	---	---	---	---	PASS
CYP4F3	4051	broad.mit.edu	37	19	15770052	15770052	+	Missense_Mutation	SNP	G	C	C	rs118159249	by1000genomes	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15770052G>C	uc002nbj.2	+	13	1470	c.1420G>C	c.(1420-1422)GCG>CCG	p.A474P	CYP4F3_uc010xok.1_Missense_Mutation_p.A474P|CYP4F3_uc010xol.1_Missense_Mutation_p.A474P|CYP4F3_uc010xom.1_Missense_Mutation_p.A325P|CYP4F3_uc002nbk.2_Missense_Mutation_p.A474P|CYP4F3_uc010xon.1_Missense_Mutation_p.A184P	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,	474					leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						GCAGGCGTTCGCGATGGCGGA	0.677													5	40	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	15989724	15989724	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15989724C>G	uc002nbs.1	-	13	1470	c.1420G>C	c.(1420-1422)GCG>CCG	p.A474P	CYP4F2_uc010xot.1_Missense_Mutation_p.A325P	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	474					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						TCCGCCATCGCGAACGTCTGC	0.677													6	80	---	---	---	---	PASS
FAM125A	93343	broad.mit.edu	37	19	17534842	17534842	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17534842A>C	uc002ngo.1	+	7	701	c.668A>C	c.(667-669)CAC>CCC	p.H223P	FAM125A_uc002ngp.1_Missense_Mutation_p.H131P|FAM125A_uc002ngq.1_Missense_Mutation_p.H119P	NM_138401	NP_612410	Q96EY5	F125A_HUMAN	family with sequence similarity 125, member A	223	UMA.|Interaction with TSG101, VPS37B and VPS28.				protein transport	late endosome membrane|microtubule organizing center|nucleus	SH3 domain binding				0						TTCACACTCCACCCACGATTT	0.637													18	88	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22941177	22941177	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22941177C>G	uc010xrh.1	-	5	1261	c.1261G>C	c.(1261-1263)GAA>CAA	p.E421Q		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CCACATTCTTCACATTTGCAA	0.358													20	74	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23543371	23543371	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23543371C>A	uc002nre.2	-	4	2523	c.2410G>T	c.(2410-2412)GGC>TGC	p.G804C	ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Missense_Mutation_p.G772C	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	804	C2H2-type 24.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AAAGCTTTGCCACATTCTTCA	0.388													37	146	---	---	---	---	PASS
C19orf2	8725	broad.mit.edu	37	19	30500243	30500243	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30500243A>G	uc002nsr.2	+	8	1048	c.1018A>G	c.(1018-1020)ACT>GCT	p.T340A	C19orf2_uc002nsq.2_Missense_Mutation_p.T322A|C19orf2_uc002nss.2_Missense_Mutation_p.T300A|C19orf2_uc002nst.2_Missense_Mutation_p.T264A	NM_003796	NP_003787	O94763	RMP_HUMAN	RPB5-mediating protein isoform a	340					protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)|kidney(1)	2	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)		TTTTTCACATACTGTTGAGCC	0.224													14	83	---	---	---	---	PASS
UBA2	10054	broad.mit.edu	37	19	34945244	34945244	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34945244G>C	uc002nvk.2	+	11	1188	c.1118G>C	c.(1117-1119)AGA>ACA	p.R373T	UBA2_uc010xrx.1_Missense_Mutation_p.R246T|UBA2_uc002nvl.2_Missense_Mutation_p.R277T	NM_005499	NP_005490	Q9UBT2	SAE2_HUMAN	SUMO-1 activating enzyme subunit 2	373					protein sumoylation	nucleus	ATP binding|enzyme activator activity|ligase activity|metal ion binding|protein heterodimerization activity|SUMO activating enzyme activity			ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			ATGAAGAGTAGATTTGATATC	0.308													36	132	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38948829	38948829	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38948829C>T	uc002oit.2	+	18	2194	c.2064C>T	c.(2062-2064)ACC>ACT	p.T688T	RYR1_uc002oiu.2_Silent_p.T688T	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	688	Cytoplasmic.|B30.2/SPRY 1.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GGGCCCTCACCGAGGGCTACA	0.627													34	101	---	---	---	---	PASS
HIF3A	64344	broad.mit.edu	37	19	46815636	46815636	+	Intron	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46815636C>T	uc002peh.2	+						HIF3A_uc002pef.1_Missense_Mutation_p.T330I|HIF3A_uc002peg.3_Intron|HIF3A_uc010xxx.1_Intron|HIF3A_uc002pei.3_Intron|HIF3A_uc002pej.1_Intron|HIF3A_uc002pek.2_Intron|HIF3A_uc010xxy.1_Intron|HIF3A_uc002pel.2_Intron|HIF3A_uc010xxz.1_Intron	NM_152795	NP_690008	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		CACCTCAACACCAGCTCCCTG	0.632													5	20	---	---	---	---	PASS
PNMAL2	57469	broad.mit.edu	37	19	46997151	46997151	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46997151C>A	uc002pes.2	-	1	2019	c.1572G>T	c.(1570-1572)GAG>GAT	p.E524D	uc002peu.1_5'Flank	NM_020709	NP_065760	Q9ULN7	PNML2_HUMAN	PNMA-like 2	524										central_nervous_system(1)	1		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		TGTCCTCCGGCTCCGACGCCT	0.741													5	42	---	---	---	---	PASS
CYTH2	9266	broad.mit.edu	37	19	48976622	48976622	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48976622G>T	uc002pjj.3	+	5	721	c.421G>T	c.(421-423)GTG>TTG	p.V141L	CYTH2_uc002pji.2_RNA	NM_017457	NP_059431	Q99418	CYH2_HUMAN	cytohesin 2 isoform 1	141	SEC7.				actin cytoskeleton organization|endocytosis|regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|membrane fraction|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						CCTCAATCTGGTGCAGGCCCT	0.398													17	87	---	---	---	---	PASS
SLC17A7	57030	broad.mit.edu	37	19	49937935	49937935	+	Nonsense_Mutation	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49937935G>C	uc002pnp.2	-	5	733	c.561C>G	c.(559-561)TAC>TAG	p.Y187*	SLC17A7_uc002pnq.1_Nonsense_Mutation_p.Y120*|SLC17A7_uc002pno.2_5'UTR	NM_020309	NP_064705	Q9P2U7	VGLU1_HUMAN	solute carrier family 17, member 7	187	Helical; (Potential).				glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity			ovary(1)|pancreas(1)|skin(1)	3		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		GGCAGGCGGGGTATGTGACCC	0.522													13	62	---	---	---	---	PASS
FAM71E1	112703	broad.mit.edu	37	19	50978640	50978640	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50978640G>A	uc002psh.2	-	3	839	c.481C>T	c.(481-483)CCG>TCG	p.P161S	FAM71E1_uc002psg.2_Missense_Mutation_p.P145S|FAM71E1_uc002psi.2_RNA|C19orf63_uc002psj.2_5'Flank|C19orf63_uc002psk.2_5'Flank|C19orf63_uc002psl.2_5'Flank	NM_138411	NP_612420	Q6IPT2	F71E1_HUMAN	hypothetical protein LOC112703	161										breast(1)	1		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)		AATAGGTCCGGGAGCTCCAGG	0.652													8	16	---	---	---	---	PASS
LRRC4B	94030	broad.mit.edu	37	19	51021789	51021789	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51021789A>C	uc002pss.2	-	3	1318	c.1181T>G	c.(1180-1182)GTC>GGC	p.V394G		NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor	394	Extracellular (Potential).|Ig-like C2-type.					cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CAGCCAGTTGACGGAGGTCAT	0.647													6	30	---	---	---	---	PASS
KLK15	55554	broad.mit.edu	37	19	51330015	51330015	+	Splice_Site	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51330015T>A	uc002ptl.2	-	4	513	c.482_splice	c.e4-1	p.V161_splice	KLK1_uc002ptk.1_5'Flank|KLK1_uc010ycg.1_5'Flank|KLK15_uc002ptm.2_Intron|KLK15_uc002ptn.2_Intron|KLK15_uc002pto.2_Splice_Site_p.V160_splice|KLK15_uc010ych.1_Splice_Site|KLK15_uc010yci.1_Intron|KLK15_uc010eod.2_RNA	NM_017509	NP_059979	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15 isoform 4						proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)|breast(1)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		GGAGACTCACTGGGGAAGACA	0.547													43	99	---	---	---	---	PASS
ZNF665	79788	broad.mit.edu	37	19	53669097	53669097	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53669097T>A	uc010eqm.1	-	4	746	c.646A>T	c.(646-648)ACT>TCT	p.T216S		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	151	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)		GAACGAACAGTAAAGGCTTTG	0.403													64	173	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54410101	54410101	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54410101C>T	uc002qcq.1	+	18	2328	c.2046C>T	c.(2044-2046)CAC>CAT	p.H682H	PRKCG_uc010yeg.1_Silent_p.H682H|PRKCG_uc010yeh.1_Silent_p.H533H	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	682	AGC-kinase C-terminal.				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		ACTTCGTGCACCCGGATGCCC	0.697											OREG0025667	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	83	---	---	---	---	PASS
CACNG8	59283	broad.mit.edu	37	19	54466449	54466449	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54466449G>A	uc002qcs.1	+	1	156	c.50G>A	c.(49-51)GGG>GAG	p.G17E		NM_031895	NP_114101	Q8WXS5	CCG8_HUMAN	voltage-dependent calcium channel gamma-8	18					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic density|postsynaptic membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		TGCGAGAAGGGGGTGCAGGTG	0.672													3	10	---	---	---	---	PASS
LILRA6	79168	broad.mit.edu	37	19	54745734	54745734	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54745734G>A	uc002qeu.1	-	4	500	c.376C>T	c.(376-378)CTC>TTC	p.L126F	LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Missense_Mutation_p.L126F|LILRA6_uc002qek.1_Missense_Mutation_p.L126F|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Missense_Mutation_p.L126F|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.L126F|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Missense_Mutation_p.L126F|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Missense_Mutation_p.L126F|LILRA6_uc010yep.1_Missense_Mutation_p.L126F|LILRA6_uc010yeq.1_Missense_Mutation_p.L126F|LILRA6_uc002qet.3_RNA|LILRA6_uc002qev.1_5'UTR	NM_024318	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor,	126	Extracellular (Potential).					integral to membrane	receptor activity			skin(2)	2	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGGGCTGAGAGGGTGGGTTTG	0.567													17	82	---	---	---	---	PASS
LILRA1	11024	broad.mit.edu	37	19	55106425	55106425	+	Intron	SNP	G	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55106425G>C	uc002qgh.1	+						LILRA2_uc010yfg.1_Intron|LILRA1_uc010yfh.1_Intron	NM_006863	NP_006854	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity			skin(2)|ovary(1)	3				GBM - Glioblastoma multiforme(193;0.0348)		CAGGTGAGCTGACACTGAGGG	0.637													18	72	---	---	---	---	PASS
ZIM2	23619	broad.mit.edu	37	19	57286498	57286498	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57286498C>A	uc002qnr.2	-	11	1524	c.1142G>T	c.(1141-1143)AGG>ATG	p.R381M	uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_Missense_Mutation_p.R177M|ZIM2_uc010ygr.1_Missense_Mutation_p.R177M|ZIM2_uc002qnq.2_Missense_Mutation_p.R381M|ZIM2_uc010etp.2_Missense_Mutation_p.R381M|ZIM2_uc010ygs.1_Missense_Mutation_p.R381M	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	381					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		AGAAGTCTTCCTACCAGAATG	0.463													41	113	---	---	---	---	PASS
ZNF417	147687	broad.mit.edu	37	19	58420710	58420710	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58420710A>C	uc002qqq.2	-	3	1135	c.936T>G	c.(934-936)ATT>ATG	p.I312M	ZNF417_uc010yhm.1_Missense_Mutation_p.I269M|ZNF417_uc002qqr.2_Missense_Mutation_p.I311M	NM_152475	NP_689688	Q8TAU3	ZN417_HUMAN	zinc finger protein 417	312	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0151)		GCTGATGGCTAATAAGGCTGC	0.458													71	297	---	---	---	---	PASS
ZNF544	27300	broad.mit.edu	37	19	58762739	58762739	+	Intron	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58762739G>T	uc010euo.2	+						ZNF544_uc010eun.1_Intron|ZNF544_uc010yhw.1_Intron|ZNF544_uc010yhx.1_Intron|ZNF544_uc010yhy.1_Intron|ZNF544_uc002qrt.3_Intron|ZNF544_uc002qru.3_Intron|ZNF544_uc002qrv.2_RNA	NM_014480	NP_055295	Q6NX49	ZN544_HUMAN	zinc finger protein 544						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		cccggtctgggacttcacata	0.000													16	56	---	---	---	---	PASS
PDYN	5173	broad.mit.edu	37	20	1961207	1961207	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1961207C>T	uc010gaj.2	-	3	769	c.527G>A	c.(526-528)GGG>GAG	p.G176E	uc002wfu.1_Intron|PDYN_uc002wfv.2_Missense_Mutation_p.G176E|PDYN_uc010zpt.1_Missense_Mutation_p.G21E	NM_024411	NP_077722	P01213	PDYN_HUMAN	beta-neoendorphin-dynorphin preproprotein	176					cell death|neuropeptide signaling pathway|synaptic transmission	extracellular region|plasma membrane	opioid peptide activity			upper_aerodigestive_tract(1)|ovary(1)	2						CAAAAAGCCCCCATAGCGTTT	0.592													56	160	---	---	---	---	PASS
SMOX	54498	broad.mit.edu	37	20	4162950	4162950	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4162950G>T	uc002wkm.1	+	5	1025	c.824G>T	c.(823-825)GGC>GTC	p.G275V	SMOX_uc002wkk.1_Missense_Mutation_p.G275V|SMOX_uc002wkl.1_Missense_Mutation_p.G275V|SMOX_uc002wkn.1_Intron|SMOX_uc002wkp.2_Missense_Mutation_p.G275V|SMOX_uc010zqo.1_Missense_Mutation_p.G252V|SMOX_uc002wko.1_Missense_Mutation_p.G275V	NM_175839	NP_787033	Q9NWM0	SMOX_HUMAN	spermine oxidase isoform 1	275					polyamine biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	polyamine oxidase activity			breast(1)	1					Spermine(DB00127)	CGCCCCAGAGGCCCTGAGATT	0.677													12	36	---	---	---	---	PASS
TTLL9	164395	broad.mit.edu	37	20	30527060	30527060	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30527060A>G	uc010gdx.1	+	14	1487	c.1234A>G	c.(1234-1236)ACA>GCA	p.T412A	TTLL9_uc002wwy.1_RNA|TTLL9_uc002wwz.1_Intron|TTLL9_uc002wxa.1_RNA|TTLL9_uc002wxb.1_RNA|TTLL9_uc010zto.1_RNA|TTLL9_uc002wxc.2_Missense_Mutation_p.T314A|TTLL9_uc010ztp.1_Intron|TTLL9_uc010ztq.1_RNA	NM_001008409	NP_001008409	Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	412					protein modification process	cilium|microtubule|microtubule basal body	ATP binding|tubulin-tyrosine ligase activity			ovary(2)	2			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TGTGACCAACACACATCTCGG	0.557													21	61	---	---	---	---	PASS
BPIL1	80341	broad.mit.edu	37	20	31600616	31600616	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31600616A>T	uc002wyj.2	+	4	405	c.211A>T	c.(211-213)ATT>TTT	p.I71F		NM_025227	NP_079503	Q8N4F0	BPIL1_HUMAN	bactericidal/permeability-increasing	71						extracellular region	lipid binding			skin(2)|large_intestine(1)|ovary(1)	4						CAGGATCCGGATTCTGAATGT	0.527													102	318	---	---	---	---	PASS
LBP	3929	broad.mit.edu	37	20	36997634	36997634	+	Intron	SNP	C	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36997634C>G	uc002xic.1	+							NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor						acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				TAATTCTGTTCCCAGTTAGCC	0.493													29	131	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60926760	60926760	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60926760C>A	uc002ycq.2	-	6	1023	c.956G>T	c.(955-957)AGG>ATG	p.R319M		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	319	Laminin EGF-like 1.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGGGCCTCACCTGAACGGGTC	0.562													7	15	---	---	---	---	PASS
KCNQ2	3785	broad.mit.edu	37	20	62076723	62076723	+	Intron	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62076723G>T	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ATTTCCTGCAGGGGAGGAAAG	0.672													13	52	---	---	---	---	PASS
USP16	10600	broad.mit.edu	37	21	30419000	30419000	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30419000C>T	uc002ymy.2	+	14	1571	c.1369C>T	c.(1369-1371)CAA>TAA	p.Q457*	USP16_uc002ymx.2_Nonsense_Mutation_p.Q456*|USP16_uc002ymw.2_Nonsense_Mutation_p.Q457*|USP16_uc011acm.1_Nonsense_Mutation_p.Q442*|USP16_uc011acn.1_Nonsense_Mutation_p.Q123*|USP16_uc011aco.1_Nonsense_Mutation_p.Q147*	NM_006447	NP_006438	Q9Y5T5	UBP16_HUMAN	ubiquitin specific protease 16 isoform a	457					cell division|histone deubiquitination|mitosis|positive regulation of transcription, DNA-dependent|protein homotetramerization|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|histone binding|transcription coactivator activity|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(2)|breast(1)|pancreas(1)	4						CCAACGAAGACAACAAAAAAT	0.239													15	58	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41447126	41447126	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41447126G>T	uc002yyq.1	-	27	5178	c.4726C>A	c.(4726-4728)CTC>ATC	p.L1576I	DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1576	Extracellular (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GACTTAATGAGTGGAGGAATT	0.507													28	84	---	---	---	---	PASS
MX2	4600	broad.mit.edu	37	21	42749718	42749718	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42749718G>T	uc002yzf.1	+	3	356	c.252G>T	c.(250-252)GGG>GGT	p.G84G	MX2_uc011aer.1_RNA	NM_002463	NP_002454	P20592	MX2_HUMAN	myxovirus resistance protein 2	84					response to virus|type I interferon-mediated signaling pathway	cytoplasm|nucleus	GTP binding|GTPase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				TTCTCCAGGGGCCCGAGAACA	0.597													15	71	---	---	---	---	PASS
UMODL1	89766	broad.mit.edu	37	21	43531420	43531420	+	Intron	SNP	G	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43531420G>A	uc002zaf.1	+						UMODL1_uc002zad.1_Intron|UMODL1_uc002zae.1_Silent_p.A624A|UMODL1_uc002zag.1_Silent_p.A696A|C21orf128_uc002zak.2_5'Flank	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor							cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						CCAGCCACGCGAACTCCAGCC	0.701													5	12	---	---	---	---	PASS
ARVCF	421	broad.mit.edu	37	22	19968948	19968948	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19968948T>G	uc002zqz.2	-	5	953	c.682A>C	c.(682-684)ACA>CCA	p.T228P	ARVCF_uc002zqy.2_5'Flank|ARVCF_uc002zra.2_Missense_Mutation_p.T228P	NM_001670	NP_001661	O00192	ARVC_HUMAN	armadillo repeat protein	228					cell adhesion|multicellular organismal development		protein binding			liver(1)	1	Colorectal(54;0.0993)					CCAGGCAGTGTGAAGCAGCCA	0.721													5	6	---	---	---	---	PASS
CSF2RB	1439	broad.mit.edu	37	22	37333595	37333595	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37333595A>T	uc003aqa.3	+	14	1962	c.1745A>T	c.(1744-1746)AAA>ATA	p.K582I	CSF2RB_uc003aqc.3_Missense_Mutation_p.K588I	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta	582	Cytoplasmic (Potential).				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)	ACACCTGAGAAACAGGCTTCC	0.677													6	18	---	---	---	---	PASS
CD99	4267	broad.mit.edu	37	X	2609967	2609967	+	Intron	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2609967A>G	uc004cqm.2	+						CD99_uc010nda.2_Intron|CD99_uc004cqn.2_Intron|CD99_uc004cqo.2_Intron	NM_002414	NP_002405	P14209	CD99_HUMAN	CD99 antigen isoform a precursor						cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1						GGGAAGGAAAAGTTAGAAAAA	0.572													15	23	---	---	---	---	PASS
MAGEB6	158809	broad.mit.edu	37	X	26212770	26212770	+	Silent	SNP	C	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26212770C>T	uc004dbr.2	+	2	956	c.807C>T	c.(805-807)GGC>GGT	p.G269G	MAGEB6_uc010ngc.1_Silent_p.G49G	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	269	MAGE.									ovary(3)	3						GCAAGCTAGGCCTCCCCAGTG	0.527													52	61	---	---	---	---	PASS
KDM6A	7403	broad.mit.edu	37	X	44937643	44937643	+	Splice_Site	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44937643A>G	uc004dge.3	+	19	3208	c.2833_splice	c.e19-2	p.L945_splice	KDM6A_uc010nhk.2_Splice_Site_p.L911_splice|KDM6A_uc011mkz.1_Splice_Site_p.L997_splice|KDM6A_uc011mla.1_Splice_Site_p.L900_splice|KDM6A_uc011mlb.1_Splice_Site_p.L952_splice|KDM6A_uc011mlc.1_Splice_Site_p.L649_splice|KDM6A_uc011mld.1_Splice_Site_p.L584_splice	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide						histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						TTAATTTTACAGTTGGAAAAT	0.308			D|N|F|S		renal|oesophageal SCC|MM								33	29	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53230856	53230856	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53230856T>A	uc004drz.2	-	14	2470	c.1937A>T	c.(1936-1938)GAG>GTG	p.E646V	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Missense_Mutation_p.E579V|KDM5C_uc004dsa.2_Missense_Mutation_p.E645V	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	646					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding	p.E645_E646>D*(1)		kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						GCAGATAAGCTCCTCATGGGA	0.582			N|F|S		clear cell renal carcinoma								16	20	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73063516	73063516	+	RNA	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73063516G>T	uc004ebm.1	-	1		c.9073C>A				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						ACAGGAACATGCTTAGAGAAT	0.413													23	28	---	---	---	---	PASS
TBX22	50945	broad.mit.edu	37	X	79286183	79286183	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79286183A>G	uc010nmg.1	+	9	1270	c.1136A>G	c.(1135-1137)AAT>AGT	p.N379S	TBX22_uc004edi.1_Missense_Mutation_p.N259S|TBX22_uc004edj.1_Missense_Mutation_p.N379S	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN	T-box 22 isoform 1	379					multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						TGTCCAACTAATTTTTGGCAA	0.468													57	90	---	---	---	---	PASS
MAGEA6	4105	broad.mit.edu	37	X	151869721	151869721	+	Silent	SNP	G	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151869721G>T	uc004ffq.1	+	3	605	c.411G>T	c.(409-411)GGG>GGT	p.G137G	MAGEA6_uc004ffr.1_Silent_p.G137G|MAGEA2_uc010nto.2_Intron	NM_005363	NP_005354	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	137	MAGE.						protein binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					AAATGCTGGGGAGTGTCGTCG	0.517													22	116	---	---	---	---	PASS
TSPY1	7258	broad.mit.edu	37	Y	9305917	9305917	+	Silent	SNP	A	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9305917A>G	uc004frw.3	+	3	619	c.573A>G	c.(571-573)GAA>GAG	p.E191E	TSPY1_uc004frx.3_Silent_p.E191E|TSPY1_uc010nwp.1_Intron	NM_003308	NP_003299	Q01534	TSPY1_HUMAN	testis specific protein, Y-linked 1	191					cell differentiation|cell proliferation|gonadal mesoderm development|nucleosome assembly|spermatogenesis	cytoplasm|nucleus	identical protein binding				0						AGGTGGGAGAAGAGAAGCATC	0.448													62	531	---	---	---	---	PASS
SLC44A5	204962	broad.mit.edu	37	1	75804992	75804993	+	Intron	INS	-	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75804992_75804993insT	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						CTCATAAAGCATTTTTTTTCAC	0.337													4	2	---	---	---	---	
F5	2153	broad.mit.edu	37	1	169515419	169515420	+	Intron	DEL	AC	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169515419_169515420delAC	uc001ggg.1	-							NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	ATGTCTGTGTacacacacacac	0.361													4	2	---	---	---	---	
DARS2	55157	broad.mit.edu	37	1	173819744	173819744	+	Intron	DEL	T	-	-	rs66665709		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173819744delT	uc001gjh.1	+							NM_018122	NP_060592	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial						tRNA aminoacylation for protein translation	mitochondrial matrix|nucleus	aspartate-tRNA ligase activity|ATP binding|nucleic acid binding			central_nervous_system(2)	2					L-Aspartic Acid(DB00128)	TGCATAAATCttttttttttt	0.184													6	3	---	---	---	---	
COG2	22796	broad.mit.edu	37	1	230778244	230778244	+	5'UTR	DEL	C	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230778244delC	uc001htw.2	+	1					COG2_uc001htx.2_5'UTR|COG2_uc010pwc.1_5'UTR	NM_007357	NP_031383	Q14746	COG2_HUMAN	component of oligomeric golgi complex 2 isoform						Golgi organization|intra-Golgi vesicle-mediated transport|intracellular protein transport|oligosaccharide biosynthetic process|protein glycosylation	Golgi membrane|Golgi stack|Golgi transport complex	protein binding|protein transporter activity				0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				CGGAAGCGGACCCCCCTGTGC	0.726													1	6	---	---	---	---	
PLGLB2	5342	broad.mit.edu	37	2	87238032	87238032	+	3'UTR	DEL	A	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87238032delA	uc002ssd.2	-	4					RMND5A_uc002srs.3_Intron|RGPD1_uc010fgv.2_Intron|RGPD1_uc002ssb.2_Intron|RGPD1_uc002ssc.2_Intron	NM_002665	NP_002656	Q02325	PLGB_HUMAN	plasminogen-like B2 precursor							extracellular region					0						tctgtctcagaaaaaaaaaaa	0.179													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89472135	89472142	+	Intron	DEL	GTGTGTGT	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89472135_89472142delGTGTGTGT	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		ATTGCGGCGCgtgtgtgtgtgtgtgtgt	0.216													6	5	---	---	---	---	
VWA3B	200403	broad.mit.edu	37	2	98779625	98779626	+	Intron	DEL	TG	-	-	rs112049891		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98779625_98779626delTG	uc002syo.2	+						VWA3B_uc010yvh.1_Intron|VWA3B_uc002syj.2_Intron|VWA3B_uc002syk.1_Intron|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Intron|VWA3B_uc002syn.1_Intron|VWA3B_uc010yvi.1_Intron	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6						TGCATGGACATGTGTGTGTGTG	0.550													5	3	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179529144	179529144	+	Intron	DEL	C	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179529144delC	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron|TTN_uc010zfk.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTCTATCGCCCCACCCACT	0.403													95	44	---	---	---	---	
FN1	2335	broad.mit.edu	37	2	216262125	216262126	+	Intron	DEL	TC	-	-	rs148941206		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216262125_216262126delTC	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GACAAAGACTTCTTTATGATTA	0.213													4	3	---	---	---	---	
VENTXP7	391518	broad.mit.edu	37	3	21447901	21447902	+	RNA	INS	-	CC	CC	rs143568999	by1000genomes	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21447901_21447902insCC	uc003ccd.2	+	1		c.684_685insCC				NR_002311				Homo sapiens VENT homeobox (Xenopus laevis) pseudogene 7 (VENTXP7), non-coding RNA.												0						CTGGCATACCACCCCCCACGCC	0.663													5	5	---	---	---	---	
CDC25A	993	broad.mit.edu	37	3	48209534	48209534	+	Intron	DEL	C	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48209534delC	uc003csh.1	-						CDC25A_uc003csi.1_Intron	NM_001789	NP_001780	P30304	MPIP1_HUMAN	cell division cycle 25A isoform a						cell cycle checkpoint|cell division|cell proliferation|cellular response to UV|DNA replication|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitosis|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle	cytosol|nucleoplasm	protein binding|protein tyrosine phosphatase activity			lung(3)|kidney(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000685)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		AATGTTAATGCCTACATTTAG	0.348													11	9	---	---	---	---	
CCDC52	152185	broad.mit.edu	37	3	113167135	113167135	+	Intron	DEL	T	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113167135delT	uc003eag.3	-						CCDC52_uc003eaf.3_Intron	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52						cell division|mitosis	centriole|spindle	protein binding				0						CTTGAAAGACTTTTTTTTTTT	0.323													11	5	---	---	---	---	
GOLIM4	27333	broad.mit.edu	37	3	167745288	167745288	+	Intron	DEL	T	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167745288delT	uc003ffe.2	-						GOLIM4_uc011bpe.1_Intron|GOLIM4_uc011bpf.1_Intron|GOLIM4_uc011bpg.1_Intron	NM_014498	NP_055313	O00461	GOLI4_HUMAN	golgi integral membrane protein 4						transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus				breast(4)|skin(1)	5						CCTGGTTTTGTTTTTTTTTTT	0.323													4	2	---	---	---	---	
CHIC2	26511	broad.mit.edu	37	4	54876121	54876122	+	3'UTR	INS	-	A	A	rs145864126	by1000genomes	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54876121_54876122insA	uc003haj.1	-	6					PDGFRA_uc003haa.2_Intron	NM_012110	NP_036242	Q9UKJ5	CHIC2_HUMAN	cysteine-rich hydrophobic domain 2							plasma membrane	protein binding			central_nervous_system(1)	1	all_cancers(7;0.0193)|all_neural(26;0.0209)|Lung NSC(11;0.0281)|Glioma(25;0.08)		LUSC - Lung squamous cell carcinoma(32;0.00216)			TGCGGTTATTTaaaaaaaaaac	0.317			T	ETV6	AML								5	3	---	---	---	---	
SCOC	60592	broad.mit.edu	37	4	141287338	141287338	+	Intron	DEL	T	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141287338delT	uc003iib.2	+						SCOC_uc011che.1_Intron|SCOC_uc003iid.2_Intron|SCOC_uc011chf.1_Intron|SCOC_uc011chg.1_Intron|uc003iic.1_Intron|uc003iie.2_Intron	NM_032547	NP_115936	Q9UIL1	SCOC_HUMAN	short coiled-coil protein isoform 4							Golgi apparatus|nucleus	protein binding				0	all_hematologic(180;0.162)					tctttctttcttttttttttt	0.343													3	3	---	---	---	---	
HMGCS1	3157	broad.mit.edu	37	5	43298405	43298415	+	Intron	DEL	TCTGACTAAAT	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43298405_43298415delTCTGACTAAAT	uc003jnr.3	-						HMGCS1_uc003jnq.3_Intron	NM_001098272	NP_001091742	Q01581	HMCS1_HUMAN	hydroxymethylglutaryl-CoA synthase 1						cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	hydroxymethylglutaryl-CoA synthase activity				0						CTGTCATCCATCTGACTAAATTTTGAATAGA	0.313													4	2	---	---	---	---	
REEP5	7905	broad.mit.edu	37	5	112237915	112237915	+	Intron	DEL	G	-	-	rs141436136		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112237915delG	uc003kqe.1	-						REEP5_uc011cvw.1_Intron|REEP5_uc011cvx.1_Intron|REEP5_uc011cvy.1_Intron|REEP5_uc011cvz.1_Intron	NM_005669	NP_005660	Q00765	REEP5_HUMAN	receptor accessory protein 5							integral to membrane	protein binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		gcATTtttttgtttttgtttt	0.104													7	4	---	---	---	---	
IK	3550	broad.mit.edu	37	5	140028326	140028327	+	Intron	INS	-	T	T	rs113938710		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140028326_140028327insT	uc003lgq.2	+						NDUFA2_uc003lgp.2_5'Flank|IK_uc011czk.1_Intron	NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein						cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGGTGTTAAGTTTTTTTTTTT	0.337													4	2	---	---	---	---	
CDC40	51362	broad.mit.edu	37	6	110536283	110536284	+	Intron	DEL	TG	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110536283_110536284delTG	uc003pua.2	+							NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		TGTGTGACTCTGTGTGTGTGTG	0.307													4	2	---	---	---	---	
RADIL	55698	broad.mit.edu	37	7	4845039	4845040	+	Intron	DEL	GC	-	-	rs148730991	by1000genomes	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4845039_4845040delGC	uc003snj.1	-						RADIL_uc003sng.1_Intron|RADIL_uc003sni.1_Intron|RADIL_uc011jwc.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snh.1_5'Flank	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor						cell adhesion|multicellular organismal development|signal transduction		protein binding			lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		ATGGGGCGGGGCGGGGGGGTCC	0.673													14	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62574337	62574337	+	IGR	DEL	C	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62574337delC								None (None upstream) : LOC643955 (177335 downstream)																							GGCGGGGGCTCCCGCAGCCCC	0.692													4	2	---	---	---	---	
PON1	5444	broad.mit.edu	37	7	94937696	94937697	+	Intron	INS	-	AA	AA	rs139246338	by1000genomes	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94937696_94937697insAA	uc003uns.2	-						PON1_uc011kih.1_Intron	NM_000446	NP_000437	P27169	PON1_HUMAN	paraoxonase 1 precursor						aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)	ATACAATCCTTAGACAATCATT	0.337													3	7	---	---	---	---	
CNGB3	54714	broad.mit.edu	37	8	87656306	87656307	+	Intron	INS	-	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87656306_87656307insA	uc003ydx.2	-						CNGB3_uc010maj.2_Intron	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3						signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						AGAGTGTAAAGAAAAAAAAAAG	0.381													4	2	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6602378	6602378	+	Intron	DEL	T	-	-	rs10975676		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6602378delT	uc003zkc.2	-							NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	TGATTACTGAttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69876385	69876386	+	IGR	INS	-	TCT	TCT			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69876385_69876386insTCT								LOC100133920 (211436 upstream) : FOXD4L5 (299323 downstream)																							TTCTTCTCTTCTCTTCTTGTTT	0.277													4	2	---	---	---	---	
CENPP	401541	broad.mit.edu	37	9	95099601	95099602	+	Intron	INS	-	A	A	rs78317101		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95099601_95099602insA	uc004arz.2	+						CENPP_uc010mqx.2_Intron|CENPP_uc004ary.1_Intron	NM_001012267	NP_001012267	Q6IPU0	CENPP_HUMAN	centromere protein P						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	chromosome, centromeric region|cytosol|nucleoplasm				ovary(2)	2						actccttctggaaaaaaaaaaa	0.109													4	2	---	---	---	---	
TXN	7295	broad.mit.edu	37	9	113007320	113007322	+	Intron	DEL	GAA	-	-	rs144802558		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113007320_113007322delGAA	uc004bep.1	-						TXN_uc004beq.1_Intron	NM_003329	NP_003320	P10599	THIO_HUMAN	thioredoxin						cell proliferation|cell-cell signaling|cellular component movement|electron transport chain|glycerol ether metabolic process|nucleobase, nucleoside and nucleotide interconversion|positive regulation of DNA binding|regulation of protein import into nucleus, translocation|response to radiation|signal transduction|transcription, DNA-dependent|transport	cytosol|extracellular region|nucleoplasm	electron carrier activity|protein binding|protein disulfide oxidoreductase activity				0				OV - Ovarian serous cystadenocarcinoma(323;7.36e-07)		TATTCTCAATGAAGAAGTTTTAT	0.345													2	5	---	---	---	---	
MRC1	4360	broad.mit.edu	37	10	18122472	18122473	+	Intron	INS	-	AA	AA			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18122472_18122473insAA	uc001ipm.2	+							NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						gactctgtctcaaaaaaaaaaa	0.079													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	21741095	21741095	+	IGR	DEL	A	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21741095delA								NEBL (277979 upstream) : C10orf114 (42327 downstream)																							actccgtctcaaaaaaaaaaa	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42392302	42392302	+	IGR	DEL	G	-	-	rs72505279		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42392302delG								None (None upstream) : LOC441666 (435013 downstream)																							aacatcgaatggaatcgaatg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	30925316	30925317	+	Intron	INS	-	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30925316_30925317insA	uc001mss.1	-						uc009yjk.1_Intron|uc009yjj.1_Intron					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		CTAAAAATCTGAAAAAAAAAAT	0.322													4	2	---	---	---	---	
SYT12	91683	broad.mit.edu	37	11	66802474	66802474	+	Intron	DEL	T	-	-	rs11316433		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66802474delT	uc009yrl.2	+						SYT12_uc001oju.2_Intron	NM_177963	NP_808878	Q8IV01	SYT12_HUMAN	synaptotagmin XII							cell junction|integral to membrane|synaptic vesicle membrane				ovary(1)	1						CATCTTCAACttttttttttt	0.269													6	3	---	---	---	---	
ESYT1	23344	broad.mit.edu	37	12	56528385	56528386	+	Intron	INS	-	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56528385_56528386insT	uc001sjq.2	+						ESYT1_uc001sjr.2_Intron	NM_015292	NP_056107	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1							integral to membrane				ovary(4)|skin(1)	5						CCAGAATAATAttttttttttt	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	48337842	48337847	+	IGR	DEL	TGTAAG	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48337842_48337847delTGTAAG								HTR2A (866792 upstream) : SUCLA2 (178945 downstream)																							CTCAAACACCTGTAAGTTAAATGTGC	0.379													41	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20501984	20501984	+	IGR	DEL	T	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20501984delT								OR4K14 (18632 upstream) : OR4K13 (21 downstream)																							AAGTCTCATCTAAAAAGTATG	0.239													25	11	---	---	---	---	
KIAA0391	9692	broad.mit.edu	37	14	35649732	35649733	+	Intron	INS	-	TG	TG	rs140304917	by1000genomes	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35649732_35649733insTG	uc001wsy.1	+						KIAA0391_uc010tps.1_Intron|KIAA0391_uc001wsz.1_Intron|KIAA0391_uc001wta.2_Intron|KIAA0391_uc001wtb.1_Intron|KIAA0391_uc001wtc.1_Intron	NM_014672	NP_055487	O15091	MRRP3_HUMAN	mitochondrial RNase P protein 3 precursor						tRNA processing	mitochondrion					0	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		TGTAGAGTATCtgtgtgtgtgt	0.228													5	6	---	---	---	---	
ITPK1	3705	broad.mit.edu	37	14	93482996	93482997	+	Intron	INS	-	CT	CT			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93482996_93482997insCT	uc001ybg.2	-						ITPK1_uc001ybe.2_Intron|ITPK1_uc001ybf.2_Intron|ITPK1_uc001ybh.2_Intron	NM_014216	NP_055031	Q13572	ITPK1_HUMAN	inositol 1,3,4-triphosphate 5/6 kinase isoform						blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		ATGCCACAGCCAAGGGCTGCAT	0.495													83	49	---	---	---	---	
PPP1R13B	23368	broad.mit.edu	37	14	104219676	104219683	+	Intron	DEL	CAAAAAGC	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104219676_104219683delCAAAAAGC	uc001yof.1	-						PPP1R13B_uc001yog.1_Intron	NM_015316	NP_056131	Q96KQ4	ASPP1_HUMAN	apoptosis-stimulating protein of p53, 1						apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				CAACACATTTCAAAAAGCCTTTGGGACA	0.337													11	12	---	---	---	---	
TJP1	7082	broad.mit.edu	37	15	30020389	30020390	+	Intron	INS	-	T	T			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30020389_30020390insT	uc001zcr.2	-						TJP1_uc010azl.2_Intron|TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GCATACTTCCCTTTTTTTTTTT	0.163													7	4	---	---	---	---	
ZC3H18	124245	broad.mit.edu	37	16	88694954	88694954	+	Intron	DEL	C	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88694954delC	uc002fky.2	+						ZC3H18_uc010voz.1_Intron|ZC3H18_uc010chw.2_Intron|ZC3H18_uc002fkz.2_Intron	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18							nucleus	nucleic acid binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0542)		CAGGGTGCTTCCCCTGGAACG	0.662													4	6	---	---	---	---	
GLOD4	51031	broad.mit.edu	37	17	673935	673936	+	Intron	INS	-	T	T	rs79441857		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:673935_673936insT	uc002frv.2	-						GLOD4_uc002frt.2_Intron|GLOD4_uc002fru.2_Intron|GLOD4_uc010vqc.1_Intron	NM_016080	NP_057164	Q9HC38	GLOD4_HUMAN	glyoxalase domain containing 4							mitochondrion					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		acgcatctatgttttttttttt	0.000													5	3	---	---	---	---	
ZZEF1	23140	broad.mit.edu	37	17	3962780	3962781	+	Intron	DEL	AG	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3962780_3962781delAG	uc002fxe.2	-						ZZEF1_uc002fxh.2_Intron|ZZEF1_uc002fxi.2_Intron|ZZEF1_uc002fxj.1_Intron	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1								calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GACGGGCTCAAGAGAGTTACCC	0.366													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	18304008	18304008	+	5'Flank	DEL	G	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18304008delG	uc010vxw.1	-						uc002gto.2_5'Flank					DQ589132																		CTGGACGCCTGGGGTGGCCAC	0.592													6	3	---	---	---	---	
MYO19	80179	broad.mit.edu	37	17	34855111	34855111	+	Intron	DEL	T	-	-	rs111268012		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34855111delT	uc010wcy.1	-						MYO19_uc002hmw.2_Intron|MYO19_uc010cuu.2_Intron|ZNHIT3_uc010cut.1_RNA	NM_001163735	NP_001157207	Q96H55	MYO19_HUMAN	myosin XIX isoform 2							mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)	1		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TTCAAATACGTTTTTTTTTTT	0.378													4	2	---	---	---	---	
SPAG9	9043	broad.mit.edu	37	17	49076857	49076858	+	Intron	INS	-	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49076857_49076858insA	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron|SPAG9_uc002ita.2_Intron|SPAG9_uc002ite.2_Intron	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CACtatatattaaaaaaaaaaa	0.322													4	3	---	---	---	---	
TBC1D16	125058	broad.mit.edu	37	17	77958419	77958420	+	Intron	INS	-	GAAG	GAAG	rs9900976	by1000genomes	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77958419_77958420insGAAG	uc002jxj.2	-							NM_019020	NP_061893	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16							intracellular	Rab GTPase activator activity				0	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			agggagggagtgaaggaaggaa	0.089													5	3	---	---	---	---	
CCDC57	284001	broad.mit.edu	37	17	80141907	80141908	+	Intron	INS	-	CA	CA	rs12953056	by1000genomes	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80141907_80141908insCA	uc002kdz.1	-						CCDC57_uc002kdx.1_Intron|CCDC57_uc010dik.1_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GCGCGCGCGCGcacacacacac	0.381													8	4	---	---	---	---	
ANKRD30B	374860	broad.mit.edu	37	18	14779833	14779834	+	Intron	INS	-	CCA	CCA			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14779833_14779834insCCA	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											ovary(1)|skin(1)	2						GTGGTTGTTATTCAATAGAATA	0.257													4	2	---	---	---	---	
ANKRD30B	374860	broad.mit.edu	37	18	14814680	14814680	+	Intron	DEL	G	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14814680delG	uc010dlo.2	+						ANKRD30B_uc010xak.1_RNA	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											ovary(1)|skin(1)	2						ACATCAAAAAGAATTCGATAC	0.328													4	2	---	---	---	---	
FBN3	84467	broad.mit.edu	37	19	8150965	8150966	+	Intron	INS	-	G	G			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8150965_8150966insG	uc002mjf.2	-						FBN3_uc002mje.2_Intron	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						gaacaggcagtgggagggacag	0.139													3	3	---	---	---	---	
ADAMTS10	81794	broad.mit.edu	37	19	8657127	8657128	+	Intron	DEL	AG	-	-	rs35800262		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8657127_8657128delAG	uc002mkj.1	-						ADAMTS10_uc002mki.1_5'Flank|ADAMTS10_uc002mkk.1_Intron	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						ACATGCGAACAGAGTCAGGTTA	0.619													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13709273	13709274	+	IGR	INS	-	AAAG	AAAG	rs148148215	by1000genomes	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13709273_13709274insAAAG								CACNA1A (91999 upstream) : CCDC130 (133300 downstream)																							gaccctgtcaaaaaggaaggaa	0.000											OREG0025297	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	4	---	---	---	---	
ZNF492	57615	broad.mit.edu	37	19	22838450	22838453	+	Intron	DEL	TTAT	-	-	rs35989436		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22838450_22838453delTTAT	uc002nqw.3	+							NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				aactttttacttatttgtcttcaa	0.000													4	2	---	---	---	---	
ZNF813	126017	broad.mit.edu	37	19	53983619	53983620	+	Intron	DEL	AA	-	-	rs35502614		TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53983619_53983620delAA	uc002qbu.2	+							NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		GTTGTGATGTAAAAAAAAAAAA	0.361													7	4	---	---	---	---	
CBFA2T2	9139	broad.mit.edu	37	20	32161763	32161763	+	Intron	DEL	T	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32161763delT	uc002wzg.1	+						CBFA2T2_uc010zug.1_Intron|CBFA2T2_uc002wze.1_Intron|CBFA2T2_uc002wzf.1_Intron|CBFA2T2_uc002wzh.1_Intron|CBFA2T2_uc002wzi.1_5'Flank	NM_005093	NP_005084	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit							nucleus	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)|skin(1)	2						atttttcttattttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	34341658	34341658	+	IGR	DEL	A	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34341658delA								RBM39 (11465 upstream) : PHF20 (18265 downstream)																							GAAATTAtggaaaaaaaaaaa	0.169													9	4	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074183	62074184	+	Intron	INS	-	CAC	CAC			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074183_62074184insCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	accatcaccatcaccaccacca	0.000													8	4	---	---	---	---	
TCN2	6948	broad.mit.edu	37	22	31019234	31019235	+	Intron	INS	-	C	C	rs141234711	by1000genomes	TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31019234_31019235insC	uc003aip.1	+						TCN2_uc003aiq.1_Intron|TCN2_uc003air.1_Intron	NM_000355	NP_000346	P20062	TCO2_HUMAN	transcobalamin II precursor						cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGAAGCCTTAGAATTTTTATGC	0.366													5	3	---	---	---	---	
EFCAB6	64800	broad.mit.edu	37	22	44127853	44127853	+	Intron	DEL	T	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44127853delT	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc010gzk.1_5'Flank|EFCAB6_uc011aqa.1_Intron|EFCAB6_uc003bea.1_Intron|EFCAB6_uc003beb.3_Intron	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				TACTGTCAGATTTTTTTTTTA	0.373													4	2	---	---	---	---	
ALG13	79868	broad.mit.edu	37	X	110967050	110967052	+	In_Frame_Del	DEL	TAT	-	-			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110967050_110967052delTAT	uc011msy.1	+	14	1559_1561	c.1525_1527delTAT	c.(1525-1527)TATdel	p.Y510del	ALG13_uc011msx.1_In_Frame_Del_p.Y406del|ALG13_uc011msz.1_In_Frame_Del_p.Y432del|ALG13_uc011mta.1_In_Frame_Del_p.Y406del|ALG13_uc011mtb.1_In_Frame_Del_p.Y406del			Q9NP73	ALG13_HUMAN	SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);	510	Tudor.				dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity			lung(1)	1						AGAAGGAAGATATTATAATGCTC	0.350													6	4	---	---	---	---	
FLNA	2316	broad.mit.edu	37	X	153592424	153592425	+	Frame_Shift_Ins	INS	-	A	A			TCGA-60-2724-01	TCGA-60-2724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153592424_153592425insA	uc004fkk.2	-	15	2494_2495	c.2245_2246insT	c.(2245-2247)TGGfs	p.W749fs	FLNA_uc010nuu.1_Frame_Shift_Ins_p.W749fs	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	749	Filamin 5.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GACGCCTCCCCAGGACACCATG	0.594													88	60	---	---	---	---	
