Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRKCZ	5590	broad.mit.edu	37	1	2116079	2116079	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2116079C>A	uc001aiq.2	+	17	1794	c.1633C>A	c.(1633-1635)CTG>ATG	p.L545M	PRKCZ_uc001air.2_Missense_Mutation_p.L362M|PRKCZ_uc010nyw.1_Missense_Mutation_p.L441M|PRKCZ_uc001ais.2_Missense_Mutation_p.L362M|PRKCZ_uc009vla.2_Missense_Mutation_p.L369M|PRKCZ_uc010nyx.1_RNA|PRKCZ_uc001ait.2_Missense_Mutation_p.L393M|uc009vlc.1_5'Flank|C1orf86_uc001aiv.1_RNA|C1orf86_uc001aiw.1_RNA|C1orf86_uc001aix.1_3'UTR	NM_002744	NP_002735	Q05513	KPCZ_HUMAN	protein kinase C, zeta isoform 1	545	AGC-kinase C-terminal.				anti-apoptosis|intracellular signal transduction|negative regulation of insulin receptor signaling pathway|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein complex assembly|peptidyl-serine phosphorylation|platelet activation	endosome	ATP binding|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(2)	6	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)		CGACTACGGTCTGGACAACTT	0.607													16	14	---	---	---	---	PASS
ACTRT2	140625	broad.mit.edu	37	1	2939247	2939247	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2939247G>C	uc001ajz.2	+	1	1202	c.997G>C	c.(997-999)GCT>CCT	p.A333P		NM_080431	NP_536356	Q8TDY3	ACTT2_HUMAN	actin-related protein M2	333						cytoplasm|cytoskeleton					0	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		CAAGATCACGGCTCCCCCCGA	0.617													23	48	---	---	---	---	PASS
CCDC27	148870	broad.mit.edu	37	1	3679954	3679954	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3679954G>A	uc001akv.2	+	7	1318	c.1237G>A	c.(1237-1239)GCC>ACC	p.A413T		NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	413	Glu-rich.									skin(1)	1	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		GGAGCTGCTGGCCCAGCTGGA	0.488													15	43	---	---	---	---	PASS
GPR153	387509	broad.mit.edu	37	1	6314950	6314950	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6314950G>A	uc001amp.1	-	2	276	c.16C>T	c.(16-18)CGG>TGG	p.R6W		NM_207370	NP_997253	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153	6	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		CCAGGCAGCCGCCGCTCATCA	0.662													10	8	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7725091	7725091	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7725091G>C	uc001aoi.2	+	9	2691	c.2484G>C	c.(2482-2484)CAG>CAC	p.Q828H		NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	828					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GCCCCCAGCAGGGTAGCCTGC	0.711													8	96	---	---	---	---	PASS
H6PD	9563	broad.mit.edu	37	1	9305264	9305264	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9305264G>T	uc001apt.2	+	2	544	c.271G>T	c.(271-273)GCA>TCA	p.A91S		NM_004285	NP_004276	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase precursor	91	Glucose 1-dehydrogenase.					endoplasmic reticulum lumen	6-phosphogluconolactonase activity|glucose 1-dehydrogenase|glucose-6-phosphate dehydrogenase activity|NADP binding				0	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)	NADH(DB00157)	CAAGGACATGGCACCCAGTCA	0.577													13	49	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16892899	16892899	+	Intron	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16892899T>A	uc009vos.1	-						uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TTGCTCAAAGTTACCTGGGGC	0.413													13	502	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17264204	17264204	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17264204A>C	uc001azt.2	+	10	1331	c.1262A>C	c.(1261-1263)AAG>ACG	p.K421T	CROCC_uc009voy.1_Missense_Mutation_p.K124T|CROCC_uc009voz.1_Missense_Mutation_p.K184T|CROCC_uc001azu.2_5'Flank	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	421	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CAGGTCAACAAGGACCTCACT	0.582													7	57	---	---	---	---	PASS
PADI1	29943	broad.mit.edu	37	1	17531716	17531716	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17531716G>T	uc001bah.1	+	1	96	c.4G>T	c.(4-6)GCC>TCC	p.A2S		NM_013358	NP_037490	Q9ULC6	PADI1_HUMAN	peptidylarginine deiminase type I	2					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity				0		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	TGACAGGATGGCCCCAAAGAG	0.587													6	25	---	---	---	---	PASS
C1QB	713	broad.mit.edu	37	1	22987627	22987627	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22987627C>T	uc001bgd.2	+	3	642	c.510C>T	c.(508-510)TTC>TTT	p.F170F		NM_000491	NP_000482	P02746	C1QB_HUMAN	complement component 1, q subcomponent, B chain	170	C1q.				complement activation, classical pathway|innate immune response	collagen|complement component C1 complex				breast(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.06e-27)|Colorectal(126;1.58e-07)|GBM - Glioblastoma multiforme(114;6.72e-06)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000551)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TCTACTACTTCACCTACCACG	0.562													11	39	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27106961	27106961	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27106961G>T	uc001bmv.1	+	20	6945	c.6572G>T	c.(6571-6573)AGT>ATT	p.S2191I	ARID1A_uc001bmu.1_Missense_Mutation_p.S1974I|ARID1A_uc001bmx.1_Missense_Mutation_p.S1037I|ARID1A_uc009vsm.1_Missense_Mutation_p.S519I|ARID1A_uc009vsn.1_Missense_Mutation_p.S433I	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	2191					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CAGAAGGGCAGTATCGGCAAC	0.627			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								48	38	---	---	---	---	PASS
PTPRU	10076	broad.mit.edu	37	1	29587223	29587223	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29587223G>T	uc001bru.2	+	7	1062	c.952G>T	c.(952-954)GTG>TTG	p.V318L	PTPRU_uc001brv.2_Missense_Mutation_p.V318L|PTPRU_uc001brw.2_Missense_Mutation_p.V318L|PTPRU_uc009vtq.2_Missense_Mutation_p.V318L|PTPRU_uc009vtr.2_Missense_Mutation_p.V318L	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	318	Fibronectin type-III 1.|Extracellular (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CGGGCCGATCGTGCGCAAGGA	0.662													15	53	---	---	---	---	PASS
DCDC2B	149069	broad.mit.edu	37	1	32674705	32674705	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32674705G>A	uc001bun.2	+	1	11	c.11G>A	c.(10-12)GGC>GAC	p.G4D		NM_001099434	NP_001092904	A2VCK2	DCD2B_HUMAN	doublecortin domain containing 2B	4					intracellular signal transduction						0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				ATGGCAGGTGGCAGTCCAGCA	0.587													13	42	---	---	---	---	PASS
FAM167B	84734	broad.mit.edu	37	1	32713219	32713219	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32713219G>T	uc001buw.2	+	1	402	c.197G>T	c.(196-198)GGA>GTA	p.G66V		NM_032648	NP_116037	Q9BTA0	F167B_HUMAN	hypothetical protein LOC84734	66										ovary(1)	1						GGACCAGGGGGACCTGGGGAC	0.657													33	65	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39924766	39924766	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39924766C>G	uc010oiu.1	+	56	16665	c.16534C>G	c.(16534-16536)CTA>GTA	p.L5512V	MACF1_uc010ois.1_Missense_Mutation_p.L5010V|MACF1_uc001cde.1_5'Flank|MACF1_uc001cdf.1_5'Flank	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	6968					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGGGAAATCCCTAAGTCAGCC	0.423													23	131	---	---	---	---	PASS
C1orf175	374977	broad.mit.edu	37	1	55139836	55139836	+	Intron	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55139836C>A	uc010ooe.1	+						C1orf175_uc001cxq.2_Intron|C1orf175_uc010ooc.1_Intron|C1orf175_uc001cxs.2_Intron|C1orf175_uc010ood.1_Intron|C1orf175_uc010oof.1_Intron|C1orf175_uc001cxr.1_Intron|C1orf175_uc010oog.1_Intron|C1orf175_uc010ooh.1_Intron|C1orf175_uc009vzq.1_Intron|C1orf175_uc001cxt.1_Intron	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN	hypothetical protein LOC374977							integral to membrane	binding				0						TAAGCCCTATCGGAGTACTTC	0.498													24	105	---	---	---	---	PASS
PRKAA2	5563	broad.mit.edu	37	1	57157066	57157066	+	Splice_Site	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57157066G>A	uc001cyk.3	+	3	308	c.237_splice	c.e3-1	p.L79_splice		NM_006252	NP_006243	P54646	AAPK2_HUMAN	AMP-activated protein kinase alpha 2 catalytic						carnitine shuttle|cell cycle arrest|cholesterol biosynthetic process|energy reserve metabolic process|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleoplasm	ATP binding|metal ion binding			breast(4)|ovary(1)|stomach(1)	6						TAACAAAAAAGATACCAGGTG	0.303													19	65	---	---	---	---	PASS
DAB1	1600	broad.mit.edu	37	1	57476449	57476449	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57476449C>T	uc001cys.1	-	16	2261	c.1587G>A	c.(1585-1587)CAG>CAA	p.Q529Q	DAB1_uc001cyt.1_Silent_p.Q527Q|DAB1_uc001cyq.1_Silent_p.Q527Q|DAB1_uc001cyr.1_Silent_p.Q443Q|DAB1_uc009vzw.1_Silent_p.Q511Q|DAB1_uc009vzx.1_Silent_p.Q529Q	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1	562					cell differentiation|nervous system development					skin(2)|ovary(1)	3						TGGATGAGGCCTGTGATCCAT	0.443													33	94	---	---	---	---	PASS
LEPR	3953	broad.mit.edu	37	1	66036187	66036187	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66036187G>T	uc001dci.2	+	4	274	c.72G>T	c.(70-72)TTG>TTT	p.L24F	LEPR_uc001dcg.2_Missense_Mutation_p.L24F|LEPR_uc001dch.2_Missense_Mutation_p.L24F|LEPR_uc009waq.2_Missense_Mutation_p.L24F|LEPR_uc001dcj.2_Missense_Mutation_p.L24F|LEPR_uc001dck.2_Missense_Mutation_p.L24F	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1	24	Extracellular (Potential).				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		CGTTTAACTTGTCATATCCAA	0.323													58	69	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70486774	70486774	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70486774G>C	uc001dep.2	+	14	1423	c.1393G>C	c.(1393-1395)GAC>CAC	p.D465H	LRRC7_uc009wbg.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	465						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						TGAATTTGAAGACAAAAAAGA	0.388													13	57	---	---	---	---	PASS
PTGER3	5733	broad.mit.edu	37	1	71512360	71512360	+	Intron	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71512360C>T	uc001dfg.1	-						PTGER3_uc001dfh.1_Intron|PTGER3_uc001dfi.1_Intron|PTGER3_uc001dfj.1_Intron|PTGER3_uc001dfk.1_Intron|PTGER3_uc001dfl.1_Intron|PTGER3_uc009wbm.1_Intron|PTGER3_uc001dfm.1_Intron|PTGER3_uc001dfn.2_Intron|PTGER3_uc009wbn.1_Intron|PTGER3_uc009wbo.2_Intron|PTGER3_uc001dfo.2_Intron|PTGER3_uc001dfp.1_Intron|PTGER3_uc001dfq.2_Intron|uc001dfr.2_RNA	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform						cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)	CTGGAACTACCTACCAGGAGC	0.602													14	54	---	---	---	---	PASS
IFI44	10561	broad.mit.edu	37	1	79121152	79121152	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79121152G>A	uc001dip.3	+	5	920	c.796G>A	c.(796-798)GAC>AAC	p.D266N	IFI44_uc010orr.1_Missense_Mutation_p.D266N|IFI44_uc010ors.1_5'UTR	NM_006417	NP_006408	Q8TCB0	IFI44_HUMAN	interferon-induced, hepatitis C-associated	266					response to virus	cytoplasm				ovary(1)|central_nervous_system(1)	2						GTGCAGGGATGACATATTCTA	0.383													19	187	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86591544	86591544	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86591544G>A	uc001dlj.2	-	3	517	c.475C>T	c.(475-477)CAT>TAT	p.H159Y	COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Missense_Mutation_p.H159Y	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	159	TSP N-terminal.|Laminin G-like.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		TGCTCATCATGAACACTGTAG	0.343													19	43	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92149357	92149357	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92149357C>T	uc001doh.2	-	17	2961	c.2495G>A	c.(2494-2496)AGT>AAT	p.S832N	TGFBR3_uc009wde.2_Missense_Mutation_p.S527N|TGFBR3_uc010osy.1_Missense_Mutation_p.S790N|TGFBR3_uc001doi.2_Missense_Mutation_p.S831N|TGFBR3_uc001doj.2_Missense_Mutation_p.S831N	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	832	Cytoplasmic (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		GTGGGCAGCACTGCTGTTTTC	0.433													8	8	---	---	---	---	PASS
EVI5	7813	broad.mit.edu	37	1	92979246	92979246	+	Silent	SNP	C	A	A	rs138799860		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92979246C>A	uc001dox.2	-	18	2410	c.2400G>T	c.(2398-2400)CCG>CCT	p.P800P	EVI5_uc010otf.1_Silent_p.P811P	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5	800	Targeting to the centrosomes.|Interaction with AURKB and INCENP.				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		CTCTTCTTCTCGGGGGCCGCT	0.483													60	122	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103388930	103388930	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103388930G>C	uc001dul.2	-	47	3934	c.3616C>G	c.(3616-3618)CCT>GCT	p.P1206A	COL11A1_uc001duk.2_Missense_Mutation_p.P402A|COL11A1_uc001dum.2_Missense_Mutation_p.P1218A|COL11A1_uc001dun.2_Missense_Mutation_p.P1167A|COL11A1_uc009weh.2_Missense_Mutation_p.P1090A	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1206	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTTTCACCAGGTGGGCCTGGC	0.343													8	14	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103444475	103444475	+	Intron	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103444475G>A	uc001dul.2	-						COL11A1_uc001duk.2_Intron|COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GGACCCTGCAGATGAGAACAA	0.378													23	37	---	---	---	---	PASS
SLC25A24	29957	broad.mit.edu	37	1	108703861	108703861	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108703861G>T	uc001dvn.3	-	4	667	c.453C>A	c.(451-453)TTC>TTA	p.F151L	SLC25A24_uc001dvm.2_Missense_Mutation_p.F132L	NM_013386	NP_037518	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 member 24 isoform 1	151	EF-hand 4.|Mitochondrial intermembrane (Potential).				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding			ovary(1)	1		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		GATTAAATAAGAAGTAGTCTC	0.303													35	78	---	---	---	---	PASS
FAM19A3	284467	broad.mit.edu	37	1	113264982	113264982	+	Intron	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113264982G>T	uc001ecv.2	+						FAM19A3_uc001ecu.2_Intron|FAM19A3_uc010owk.1_Intron|FAM19A3_uc010owl.1_Intron	NM_182759	NP_877436	Q7Z5A8	F19A3_HUMAN	family with sequence similarity 19 (chemokine							extracellular region					0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTGGAGGAGGTGGCAGGGCC	0.657													6	22	---	---	---	---	PASS
LOC200030	200030	broad.mit.edu	37	1	148252121	148252121	+	Intron	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148252121G>T	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc009wkf.1_Intron|uc010pah.1_Intron|uc010pai.1_Intron|uc001eqz.2_Intron|uc001erb.2_Intron|uc001erd.3_Intron|uc001erc.3_Intron|uc010paj.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						CGTTGAGCCTGGAAAAGGAGA	0.443													193	191	---	---	---	---	PASS
VPS72	6944	broad.mit.edu	37	1	151156932	151156932	+	Silent	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151156932T>C	uc001exe.1	-	4	466	c.423A>G	c.(421-423)ACA>ACG	p.T141T	VPS72_uc001exf.1_Silent_p.T141T	NM_005997	NP_005988	Q15906	VPS72_HUMAN	transcription factor-like 1	141					chromatin modification|negative regulation of transcription from RNA polymerase II promoter	nucleus|protein complex	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|pancreas(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ACGTTTGTCGTGTATGCTCAG	0.498													23	137	---	---	---	---	PASS
TCHHL1	126637	broad.mit.edu	37	1	152057685	152057685	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152057685G>A	uc001ezo.1	-	3	2538	c.2473C>T	c.(2473-2475)CAG>TAG	p.Q825*		NM_001008536	NP_001008536	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	825							calcium ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TGGGCTATCTGAACTTGCTTT	0.478													196	103	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152276658	152276658	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152276658C>A	uc001ezu.1	-	3	10740	c.10704G>T	c.(10702-10704)CAG>CAT	p.Q3568H		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3568	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGACTGCTCCTGAGCAGATC	0.567									Ichthyosis				259	371	---	---	---	---	PASS
ADAR	103	broad.mit.edu	37	1	154575070	154575070	+	Silent	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154575070T>C	uc001ffh.2	-	2	248	c.48A>G	c.(46-48)CCA>CCG	p.P16P	ADAR_uc001ffj.2_Silent_p.P16P|ADAR_uc001ffi.2_Silent_p.P16P|ADAR_uc001ffk.2_5'UTR|ADAR_uc001ffl.1_5'UTR|ADAR_uc001ffm.1_RNA|ADAR_uc001ffn.1_Silent_p.P16P	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a	16					adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		AGCCTTGAAATGGATGGGTGT	0.507													66	42	---	---	---	---	PASS
ZBTB7B	51043	broad.mit.edu	37	1	154987802	154987802	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154987802G>T	uc001fgk.3	+	3	824	c.666G>T	c.(664-666)GAG>GAT	p.E222D	ZBTB7B_uc009wpa.2_Missense_Mutation_p.E222D|ZBTB7B_uc001fgj.3_Missense_Mutation_p.E256D|ZBTB7B_uc010peq.1_Missense_Mutation_p.E256D|ZBTB7B_uc001fgl.3_Missense_Mutation_p.E222D	NM_015872	NP_056956	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	222					cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TAGTCCCTGAGGTGCCCACAG	0.687													15	75	---	---	---	---	PASS
BCAN	63827	broad.mit.edu	37	1	156617450	156617450	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156617450G>T	uc001fpp.2	+	4	953	c.617G>T	c.(616-618)GGC>GTC	p.G206V	BCAN_uc001fpo.2_Missense_Mutation_p.G206V	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1	206	Link 1.				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGTGATGCTGGCTGGCTGTCG	0.657													28	170	---	---	---	---	PASS
BCAN	63827	broad.mit.edu	37	1	156626883	156626883	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156626883T>G	uc001fpp.2	+	10	2540	c.2204T>G	c.(2203-2205)ATC>AGC	p.I735S		NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1	735	C-type lectin.				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGGACTTCATCAACAGTGGG	0.463													47	19	---	---	---	---	PASS
PEAR1	375033	broad.mit.edu	37	1	156883542	156883542	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156883542C>G	uc001fqj.1	+	21	2819	c.2703C>G	c.(2701-2703)TTC>TTG	p.F901L	PEAR1_uc001fqk.1_Missense_Mutation_p.F526L	NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	901	Pro-rich.					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CAGGCCCATTCTACAATAAAG	0.577													69	46	---	---	---	---	PASS
C1orf92	149499	broad.mit.edu	37	1	156902245	156902245	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156902245G>A	uc001fqm.2	+	14	1643	c.1471G>A	c.(1471-1473)GGC>AGC	p.G491S	C1orf92_uc001fql.2_Missense_Mutation_p.G277S	NM_144702	NP_653303	Q8N4P6	LRC71_HUMAN	hypothetical protein LOC149499	491											0	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGGGCTGGAGGGCTTCCTCGC	0.602													8	56	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157491042	157491042	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157491042C>A	uc001fqu.2	-	11	2438	c.2280G>T	c.(2278-2280)GGG>GGT	p.G760G	FCRL5_uc009wsm.2_Silent_p.G760G	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	760	Extracellular (Potential).|Ig-like C2-type 8.					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CAGCATGGGTCCCGGGAGCCC	0.537													19	82	---	---	---	---	PASS
OR10K1	391109	broad.mit.edu	37	1	158435624	158435624	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158435624C>A	uc010pij.1	+	1	273	c.273C>A	c.(271-273)ACC>ACA	p.T91T		NM_001004473	NP_001004473	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K,	91	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					AGAAGAAGACCATTTCTTTCC	0.483													60	339	---	---	---	---	PASS
OR6N1	128372	broad.mit.edu	37	1	158736095	158736095	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158736095G>A	uc010piq.1	-	1	378	c.378C>T	c.(376-378)ATC>ATT	p.I126I		NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N,	126	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					GGGGCCGGCAGATGGCTAAAT	0.527													12	49	---	---	---	---	PASS
CD84	8832	broad.mit.edu	37	1	160535366	160535366	+	Silent	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160535366G>C	uc001fwh.3	-	2	240	c.216C>G	c.(214-216)CCC>CCG	p.P72P	CD84_uc001fwf.3_Silent_p.P72P|CD84_uc001fwg.3_Silent_p.P72P|CD84_uc009wtn.2_Silent_p.P72P|CD84_uc001fwi.3_Intron|CD84_uc001fwj.2_Silent_p.P72P|CD84_uc001fwk.2_Silent_p.P72P	NM_003874	NP_003865	Q9UIB8	SLAF5_HUMAN	CD84 molecule	72	Extracellular (Potential).				blood coagulation|defense response|homophilic cell adhesion|leukocyte migration	integral to plasma membrane	receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CAGTAACTACGGGTGCTGTTT	0.433													278	176	---	---	---	---	PASS
C1orf192	257177	broad.mit.edu	37	1	161336228	161336228	+	Splice_Site	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161336228C>A	uc001gal.2	-	2	96	c.90_splice	c.e2+1	p.E30_splice		NM_001013625	NP_001013647	Q5VTH2	CA192_HUMAN	hypothetical protein LOC257177												0	all_cancers(52;4.64e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			ACATGGAATACCTCTTTTGTT	0.433													13	422	---	---	---	---	PASS
POU2F1	5451	broad.mit.edu	37	1	167370723	167370723	+	Silent	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167370723A>G	uc001gec.2	+	14	1578	c.1416A>G	c.(1414-1416)GCA>GCG	p.A472A	POU2F1_uc001ged.2_Silent_p.A470A|POU2F1_uc001gee.2_Silent_p.A472A|POU2F1_uc010plh.1_Silent_p.A409A|POU2F1_uc001gef.2_Silent_p.A484A|POU2F1_uc001geg.2_Silent_p.A370A|POU2F1_uc009wvg.1_Intron	NM_002697	NP_002688	P14859	PO2F1_HUMAN	POU class 2 homeobox 1	472					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5						CTAGCAGTGCAGCAACTACCC	0.488											OREG0013970	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	49	---	---	---	---	PASS
XCL1	6375	broad.mit.edu	37	1	168549299	168549299	+	Splice_Site	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168549299A>T	uc001gfo.1	+	2	82	c.62_splice	c.e2-2	p.G21_splice		NM_002995	NP_002986	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1						CD4-positive, alpha-beta T cell proliferation|CD8-positive, alpha-beta T cell proliferation|cell-cell signaling|cellular response to interleukin-4|cellular response to transforming growth factor beta stimulus|immunoglobulin production in mucosal tissue|lymphocyte chemotaxis|negative regulation of interferon-gamma production|negative regulation of interleukin-2 production|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell cytokine production|negative regulation of T-helper 1 cell activation|negative regulation of transcription, DNA-dependent|neutrophil chemotaxis|positive regulation of activated T cell proliferation|positive regulation of B cell chemotaxis|positive regulation of granzyme A production|positive regulation of granzyme B production|positive regulation of interleukin-10 production|positive regulation of natural killer cell chemotaxis|positive regulation of neutrophil chemotaxis|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell chemotaxis|positive regulation of T cell cytokine production|positive regulation of T cell mediated cytotoxicity|positive regulation of thymocyte migration|positive regulation of transforming growth factor-beta production|regulation of inflammatory response|release of sequestered calcium ion into cytosol|response to virus|T-helper 1 cell cytokine production|T-helper 2 cell cytokine production	extracellular space	chemokine activity|protein homodimerization activity				0	all_hematologic(923;0.208)					TTTCCTCACCAGGTGTAGGGA	0.418													99	46	---	---	---	---	PASS
XCL1	6375	broad.mit.edu	37	1	168549300	168549300	+	Splice_Site	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168549300G>T	uc001gfo.1	+	2	82	c.62_splice	c.e2-1	p.G21_splice		NM_002995	NP_002986	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1						CD4-positive, alpha-beta T cell proliferation|CD8-positive, alpha-beta T cell proliferation|cell-cell signaling|cellular response to interleukin-4|cellular response to transforming growth factor beta stimulus|immunoglobulin production in mucosal tissue|lymphocyte chemotaxis|negative regulation of interferon-gamma production|negative regulation of interleukin-2 production|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell cytokine production|negative regulation of T-helper 1 cell activation|negative regulation of transcription, DNA-dependent|neutrophil chemotaxis|positive regulation of activated T cell proliferation|positive regulation of B cell chemotaxis|positive regulation of granzyme A production|positive regulation of granzyme B production|positive regulation of interleukin-10 production|positive regulation of natural killer cell chemotaxis|positive regulation of neutrophil chemotaxis|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell chemotaxis|positive regulation of T cell cytokine production|positive regulation of T cell mediated cytotoxicity|positive regulation of thymocyte migration|positive regulation of transforming growth factor-beta production|regulation of inflammatory response|release of sequestered calcium ion into cytosol|response to virus|T-helper 1 cell cytokine production|T-helper 2 cell cytokine production	extracellular space	chemokine activity|protein homodimerization activity				0	all_hematologic(923;0.208)					TTCCTCACCAGGTGTAGGGAG	0.423													99	46	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175066830	175066830	+	Intron	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175066830A>T	uc001gkl.1	+						TNN_uc010pmx.1_Intron	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GTAACAAAAGAGAGATGGTCA	0.488													65	46	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176525531	176525531	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176525531G>T	uc001gkz.2	+	2	1237	c.73G>T	c.(73-75)GAG>TAG	p.E25*	PAPPA2_uc001gky.1_Nonsense_Mutation_p.E25*|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	25					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TGCCAACTCTGAGCTGGGCTG	0.517													183	90	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176661310	176661310	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176661310A>T	uc001gkz.2	+	6	3644	c.2480A>T	c.(2479-2481)CAT>CTT	p.H827L	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	827					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						GCCCGAATGCATTGCTATTTG	0.483											OREG0014001	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	49	290	---	---	---	---	PASS
KIAA1614	57710	broad.mit.edu	37	1	180904462	180904462	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180904462C>T	uc001gok.2	+	5	1484	c.1417C>T	c.(1417-1419)CGC>TGC	p.R473C	KIAA1614_uc001gol.1_Missense_Mutation_p.R94C|KIAA1614_uc001gom.1_Intron	NM_020950	NP_066001	Q5VZ46	K1614_HUMAN	hypothetical protein LOC57710	473										ovary(3)|skin(1)	4						GCAGCGCCAGCGCCAGGTGCT	0.731													5	5	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181701923	181701923	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181701923G>A	uc001gow.2	+	20	2866	c.2701G>A	c.(2701-2703)GGA>AGA	p.G901R	CACNA1E_uc009wxs.2_Missense_Mutation_p.G789R|CACNA1E_uc001gox.1_Missense_Mutation_p.G127R|CACNA1E_uc009wxt.2_Missense_Mutation_p.G127R	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	901	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						GGAGGCAGGGGGAGGAGAGGC	0.667													24	52	---	---	---	---	PASS
LAMC1	3915	broad.mit.edu	37	1	183106930	183106930	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183106930G>T	uc001gpy.3	+	26	4698	c.4441G>T	c.(4441-4443)GAC>TAC	p.D1481Y		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	1481	Potential.|Domain II and I.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AAAACAAGATGACGCTGACCA	0.398													75	38	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197390270	197390270	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197390270T>A	uc001gtz.2	+	6	1447	c.1312T>A	c.(1312-1314)TGT>AGT	p.C438S	CRB1_uc010poz.1_Missense_Mutation_p.C369S|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.C326S|CRB1_uc010ppb.1_Missense_Mutation_p.C438S|CRB1_uc010ppc.1_RNA|CRB1_uc010ppd.1_5'UTR|CRB1_uc001gub.1_Missense_Mutation_p.C87S	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	438	Extracellular (Potential).|EGF-like 10; calcium-binding (Potential).				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						AGGAAGGGACTGTTCTGATAT	0.448													136	90	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201044687	201044687	+	Silent	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201044687G>T	uc001gvv.2	-	13	2111	c.1884C>A	c.(1882-1884)GGC>GGA	p.G628G		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	628	II.|Extracellular (Potential).			YG -> SS (in Ref. 1; AAA51902).|G -> R (in Ref. 2; AAB37235).	axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	AGGACGGCCCGCCGTAGGCCA	0.542													82	218	---	---	---	---	PASS
IPO9	55705	broad.mit.edu	37	1	201837922	201837922	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201837922G>A	uc001gwz.2	+	16	2052	c.2002G>A	c.(2002-2004)GCG>ACG	p.A668T		NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9	668					protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						AGGGCTTTGTGCGGTAAGTGG	0.458													22	17	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207737203	207737203	+	Intron	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207737203C>T	uc001hfy.2	+						CR1_uc009xcl.1_Intron|CR1_uc001hfx.2_Intron|CR1_uc009xck.1_Intron	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor						complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						GTTTCTCTCTCCCCAGTATGT	0.418													62	81	---	---	---	---	PASS
TMEM206	55248	broad.mit.edu	37	1	212583782	212583782	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212583782G>A	uc001hjc.3	-	2	286	c.118C>T	c.(118-120)CCG>TCG	p.P40S	TMEM206_uc010pte.1_Missense_Mutation_p.P101S	NM_018252	NP_060722	Q9H813	TM206_HUMAN	transmembrane protein 206	40	Cytoplasmic (Potential).					integral to membrane				breast(1)	1				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		AAGATACCCGGACCTTGGACT	0.567													407	305	---	---	---	---	PASS
VASH2	79805	broad.mit.edu	37	1	213146147	213146147	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213146147C>A	uc001hjy.2	+	5	927	c.723C>A	c.(721-723)CAC>CAA	p.H241Q	VASH2_uc001hjv.2_RNA|VASH2_uc001hjx.2_Missense_Mutation_p.H176Q|VASH2_uc010ptn.1_Missense_Mutation_p.H137Q|VASH2_uc001hjw.2_Missense_Mutation_p.H197Q	NM_001136475	NP_001129947	Q86V25	VASH2_HUMAN	vasohibin 2 isoform 3	241					positive regulation of angiogenesis|positive regulation of endothelial cell proliferation	cytoplasm					0				OV - Ovarian serous cystadenocarcinoma(81;0.00479)|all cancers(67;0.00844)|GBM - Glioblastoma multiforme(131;0.0496)|Epithelial(68;0.0986)		AATACCTGCACACAGTCAAGA	0.512													66	59	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216373149	216373149	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216373149C>A	uc001hku.1	-	17	4018	c.3631G>T	c.(3631-3633)GTT>TTT	p.V1211F	USH2A_uc001hkv.2_Missense_Mutation_p.V1211F	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1211	Extracellular (Potential).|Fibronectin type-III 2.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCAAATGGAACCAGATTCCAG	0.507										HNSCC(13;0.011)			76	175	---	---	---	---	PASS
SPATA17	128153	broad.mit.edu	37	1	217915365	217915365	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217915365G>T	uc001hlh.1	+	6	470	c.444G>T	c.(442-444)AAG>AAT	p.K148N	SPATA17_uc009xdr.1_RNA|SPATA17_uc001hli.2_Missense_Mutation_p.K148N	NM_138796	NP_620151	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	148						cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		AAGAGAAGAAGGCTAACCTCG	0.418													109	52	---	---	---	---	PASS
RAB3GAP2	25782	broad.mit.edu	37	1	220325052	220325052	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220325052T>G	uc010puk.1	-	34	4086	c.3922A>C	c.(3922-3924)ACG>CCG	p.T1308P	RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_Missense_Mutation_p.T888P|RAB3GAP2_uc001hmh.2_Missense_Mutation_p.T252P	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic	1308					intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		CTTTGCCCCGTGAGCACCAGC	0.512													42	175	---	---	---	---	PASS
DISP1	84976	broad.mit.edu	37	1	223176741	223176741	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223176741A>T	uc001hnu.1	+	8	2149	c.2002A>T	c.(2002-2004)ACT>TCT	p.T668S		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	668					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)		TAATATATTCACTTGCTTCAA	0.438													14	212	---	---	---	---	PASS
PARP1	142	broad.mit.edu	37	1	226567665	226567665	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226567665C>T	uc001hqd.3	-	10	1672	c.1501G>A	c.(1501-1503)GCT>ACT	p.A501T		NM_001618	NP_001609	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase family, member 1	501	Automodification domain.				cellular response to insulin stimulus|protein ADP-ribosylation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nuclear envelope|nucleolus|transcription factor complex	DNA binding|identical protein binding|NAD+ ADP-ribosyltransferase activity|protein N-terminus binding|transcription factor binding|zinc ion binding			lung(3)|ovary(2)|breast(2)|skin(2)|upper_aerodigestive_tract(1)	10	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		GAGAGCGCAGCCCCTGACTTC	0.602								Direct_reversal_of_damage|PARP_enzymes_that_bind_to_DNA					10	244	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227333183	227333183	+	Intron	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227333183T>A	uc001hqr.2	-						CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				CACAGTGTCATACTTACAGAA	0.313													32	162	---	---	---	---	PASS
ACTA1	58	broad.mit.edu	37	1	229568451	229568451	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229568451C>A	uc001htm.2	-	3	411	c.306G>T	c.(304-306)GAG>GAT	p.E102D		NM_001100	NP_001091	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	102					muscle filament sliding|skeletal muscle fiber development|skeletal muscle thin filament assembly	actin filament|cytosol|stress fiber|striated muscle thin filament	ADP binding|ATP binding|myosin binding|structural constituent of cytoskeleton				0	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)			Dornase Alfa(DB00003)	GGGTGGGGTGCTCCTCGGGAG	0.582													156	61	---	---	---	---	PASS
DISC1	27185	broad.mit.edu	37	1	232144658	232144658	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232144658G>T	uc001huz.2	+	11	2223	c.2170G>T	c.(2170-2172)GAC>TAC	p.D724Y	TSNAX-DISC1_uc010pwl.1_RNA|DISC1_uc010pxd.1_Missense_Mutation_p.D369Y|DISC1_uc010pxe.1_Missense_Mutation_p.D724Y|DISC1_uc009xfr.2_Missense_Mutation_p.D679Y|DISC1_uc010pxf.1_3'UTR|DISC1_uc010pxg.1_3'UTR|DISC1_uc010pxh.1_Missense_Mutation_p.D756Y|DISC1_uc010pxi.1_RNA|DISC1_uc010pxj.1_Missense_Mutation_p.D369Y|DISC1_uc010pxk.1_RNA|DISC1_uc010pxl.1_RNA|DISC1_uc010pxm.1_Missense_Mutation_p.D602Y|DISC1_uc010pxn.1_Missense_Mutation_p.D369Y|DISC1_uc001hva.2_Missense_Mutation_p.D724Y	NM_018662	NP_061132	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1 isoform L	724	Necessary and sufficient for interaction with PCNT and localization at the centrosome.|Interaction with ATF4 and ATF5.				microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)				GCAGATGGATGACTTAGAGGG	0.522													49	14	---	---	---	---	PASS
PCNXL2	80003	broad.mit.edu	37	1	233270786	233270786	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233270786G>A	uc001hvl.2	-	21	4045	c.3810C>T	c.(3808-3810)TTC>TTT	p.F1270F	PCNXL2_uc001hvm.1_RNA|PCNXL2_uc009xfu.2_RNA|PCNXL2_uc001hvp.1_RNA|PCNXL2_uc009xfv.1_RNA	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	1270	Helical; (Potential).					integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				ACACCATGAAGAAATCCAGTA	0.338													23	149	---	---	---	---	PASS
GNG4	2786	broad.mit.edu	37	1	235747064	235747064	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235747064C>A	uc001hxe.3	-	3	529	c.75G>T	c.(73-75)ATG>ATT	p.M25I	GNG4_uc009xfz.2_Missense_Mutation_p.M25I|GNG4_uc001hxh.3_Missense_Mutation_p.M25I	NM_001098722	NP_001092192	P50150	GBG4_HUMAN	guanine nucleotide binding protein (G protein),	25					cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|negative regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00168)|Prostate(94;0.0776)|Acute lymphoblastic leukemia(190;0.23)	OV - Ovarian serous cystadenocarcinoma(106;0.000882)			TACAGGCTTCCATCTTTAGCT	0.517													192	103	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237955441	237955441	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237955441C>A	uc001hyl.1	+	94	13720	c.13600C>A	c.(13600-13602)CCC>ACC	p.P4534T	RYR2_uc010pyb.1_5'UTR	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4534					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAAGGAGCTCCCCACGAGAAG	0.453													6	32	---	---	---	---	PASS
RNF144A	9781	broad.mit.edu	37	2	7154903	7154903	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7154903G>C	uc002qys.2	+	5	743	c.301G>C	c.(301-303)GAG>CAG	p.E101Q	RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144	101	IBR-type.					Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		ATTTGAAAGAGGTAGGTGCCT	0.363													16	130	---	---	---	---	PASS
GEN1	348654	broad.mit.edu	37	2	17941244	17941244	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17941244C>A	uc002rct.2	+	2	107	c.34C>A	c.(34-36)CCT>ACT	p.P12T	SMC6_uc010exo.2_Intron|GEN1_uc010yjs.1_Missense_Mutation_p.P12T|GEN1_uc002rcu.2_Missense_Mutation_p.P12T	NM_182625	NP_872431	Q17RS7	GEN_HUMAN	Gen homolog 1, endonuclease	12	N-domain.				DNA repair	nucleus	DNA binding|endonuclease activity|metal ion binding			breast(5)|kidney(1)|central_nervous_system(1)|skin(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AATTTTGGAGCCTGTTAAGCA	0.403								Homologous_recombination					215	164	---	---	---	---	PASS
TMEM214	54867	broad.mit.edu	37	2	27259938	27259938	+	Intron	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27259938C>T	uc002ria.3	+						TMEM214_uc010yle.1_Intron|TMEM214_uc002rib.3_Intron	NM_017727	NP_060197	Q6NUQ4	TM214_HUMAN	transmembrane protein 214 isoform 1							integral to membrane	protein binding				0						TTTCTTCATCCCCACAGGATG	0.527													76	99	---	---	---	---	PASS
GCKR	2646	broad.mit.edu	37	2	27728609	27728609	+	Missense_Mutation	SNP	C	T	T	rs138410297	byFrequency	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27728609C>T	uc002rky.2	+	10	841	c.775C>T	c.(775-777)CGG>TGG	p.R259W	GCKR_uc010ezd.2_Missense_Mutation_p.R259W|GCKR_uc010ylu.1_Missense_Mutation_p.R69W	NM_001486	NP_001477	Q14397	GCKR_HUMAN	glucokinase regulatory protein	259	SIS 1.				carbohydrate metabolic process|glucose transport|negative regulation of glucokinase activity|positive regulation of gene expression|protein import into nucleus, translocation|regulation of glucose transport|response to fructose stimulus|transmembrane transport|triglyceride homeostasis|urate metabolic process	cytosol|nucleoplasm	fructose-6-phosphate binding|protein binding			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)					CGGCTCCTCCCGGATGAAAGG	0.552													21	46	---	---	---	---	PASS
SLC4A1AP	22950	broad.mit.edu	37	2	27890251	27890251	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27890251C>T	uc002rlk.3	+	3	1420	c.1138C>T	c.(1138-1140)CGA>TGA	p.R380*		NM_018158	NP_060628	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger),	380						cytoplasm|nucleus	double-stranded RNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)					CTTTTTTGACCGAGAAGGTAT	0.408													37	73	---	---	---	---	PASS
WDR43	23160	broad.mit.edu	37	2	29152529	29152529	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29152529G>T	uc002rmo.2	+	11	1422	c.1390G>T	c.(1390-1392)GTT>TTT	p.V464F		NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43	464						nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					TAGCTTTCCAGTTCTTCTTAC	0.348													12	114	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32750665	32750665	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32750665G>T	uc010ezu.2	+	59	12024	c.11890G>T	c.(11890-11892)GTG>TTG	p.V3964L		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	3964					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TACTGTCCCAGTGTTTCACCT	0.418													86	31	---	---	---	---	PASS
STRN	6801	broad.mit.edu	37	2	37143248	37143248	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37143248C>A	uc002rpn.2	-	3	394	c.385G>T	c.(385-387)GAT>TAT	p.D129Y	STRN_uc010ezx.2_Missense_Mutation_p.D129Y	NM_003162	NP_003153	O43815	STRN_HUMAN	striatin, calmodulin binding protein	129					dendrite development|locomotory behavior|negative regulation of cell proliferation|tight junction assembly|Wnt receptor signaling pathway	cytoplasm|dendritic spine|neuronal cell body|postsynaptic density|postsynaptic membrane|tight junction	armadillo repeat domain binding|calmodulin binding|estrogen receptor binding|protein complex binding|protein phosphatase 2A binding			skin(1)	1		Ovarian(717;0.0129)|all_hematologic(82;0.21)				GGCTTCATATCTCCCTGATTC	0.308													25	33	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40657159	40657159	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40657159T>G	uc002rrx.2	-	1	286	c.262A>C	c.(262-264)ATG>CTG	p.M88L	SLC8A1_uc002rry.2_Missense_Mutation_p.M88L|SLC8A1_uc002rrz.2_Missense_Mutation_p.M88L|SLC8A1_uc002rsa.2_Missense_Mutation_p.M88L|SLC8A1_uc002rsd.3_Missense_Mutation_p.M88L|SLC8A1_uc002rsb.1_Missense_Mutation_p.M88L|SLC8A1_uc010fan.1_Missense_Mutation_p.M88L|SLC8A1_uc002rsc.1_Missense_Mutation_p.M88L	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	88	Helical; (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CCAAGAAACATGTAGACCATG	0.413													60	92	---	---	---	---	PASS
THADA	63892	broad.mit.edu	37	2	43804383	43804383	+	Splice_Site	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43804383T>C	uc002rsw.3	-	10	1169	c.817_splice	c.e10-1	p.I273_splice	THADA_uc002rsx.3_Splice_Site_p.I273_splice|THADA_uc002rsy.3_Intron|THADA_uc010fas.1_5'Flank|THADA_uc002rsz.2_Intron|THADA_uc002rta.2_Intron|THADA_uc002rtb.1_Splice_Site_p.I273_splice|THADA_uc002rtc.3_Splice_Site_p.I273_splice|THADA_uc002rtd.2_Splice_Site_p.I273_splice	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				ACTGCTAATCTGGAAAAATAT	0.428											OREG0014580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	13	---	---	---	---	PASS
FSHR	2492	broad.mit.edu	37	2	49189894	49189894	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49189894A>G	uc002rww.2	-	10	2140	c.2066T>C	c.(2065-2067)CTA>CCA	p.L689P	FSHR_uc002rwx.2_Missense_Mutation_p.L627P|FSHR_uc010fbn.2_Missense_Mutation_p.L663P	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	689	Cytoplasmic (Potential).				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	TAAATGACTTAGAGGGACAAG	0.333									Gonadal_Dysgenesis_46_XX				43	178	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55522967	55522967	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55522967G>T	uc002ryv.2	-	31	6156	c.5314C>A	c.(5314-5316)CCT>ACT	p.P1772T	CCDC88A_uc010yoz.1_Missense_Mutation_p.P1745T|CCDC88A_uc010ypa.1_Intron|CCDC88A_uc002ryt.2_Missense_Mutation_p.P63T|CCDC88A_uc010fbw.2_Missense_Mutation_p.P274T|CCDC88A_uc002ryu.2_Missense_Mutation_p.P1027T|CCDC88A_uc002rys.2_Missense_Mutation_p.P730T|CCDC88A_uc002ryw.2_Missense_Mutation_p.P1056T|CCDC88A_uc010fby.1_Missense_Mutation_p.P624T	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	1773					activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						CCTGGTGTAGGTTTTCCCGCA	0.413													27	143	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55544718	55544718	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55544718T>C	uc002ryv.2	-	20	4423	c.3581A>G	c.(3580-3582)CAT>CGT	p.H1194R	CCDC88A_uc010yoz.1_Missense_Mutation_p.H1195R|CCDC88A_uc010ypa.1_Missense_Mutation_p.H1194R|CCDC88A_uc002ryu.2_Missense_Mutation_p.H477R|CCDC88A_uc002rys.2_Missense_Mutation_p.H180R|CCDC88A_uc002ryw.2_Missense_Mutation_p.H478R|CCDC88A_uc010fby.1_Missense_Mutation_p.H74R	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	1195	Potential.				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						AAGGTCTCTATGTTCCACCTC	0.318													80	74	---	---	---	---	PASS
BCL11A	53335	broad.mit.edu	37	2	60688134	60688134	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60688134A>T	uc002sae.1	-	4	2141	c.1913T>A	c.(1912-1914)CTC>CAC	p.L638H	BCL11A_uc002sab.2_Missense_Mutation_p.L638H|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Missense_Mutation_p.L307H|BCL11A_uc010ypj.1_Missense_Mutation_p.L604H|BCL11A_uc002sad.1_Missense_Mutation_p.L486H|BCL11A_uc002saf.1_Missense_Mutation_p.L604H	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	638					negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			CTCCTTCTCGAGCTTGATGCG	0.677			T	IGH@	B-CLL								30	18	---	---	---	---	PASS
VPS54	51542	broad.mit.edu	37	2	64160937	64160937	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64160937G>A	uc002scq.2	-	12	1772	c.1609C>T	c.(1609-1611)CAA>TAA	p.Q537*	VPS54_uc002scp.2_Nonsense_Mutation_p.Q525*|VPS54_uc002sco.2_Nonsense_Mutation_p.Q22*|VPS54_uc010fct.2_Nonsense_Mutation_p.Q384*	NM_016516	NP_057600	Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 isoform 1	537					protein transport|retrograde transport, endosome to Golgi						0						GCATTTCTTTGAGAGGTAGTG	0.443													38	83	---	---	---	---	PASS
ARHGAP25	9938	broad.mit.edu	37	2	69002433	69002433	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69002433A>G	uc002seu.2	+	2	506	c.142A>G	c.(142-144)ATC>GTC	p.I48V	ARHGAP25_uc010yqk.1_Missense_Mutation_p.I22V|ARHGAP25_uc010fdg.2_Missense_Mutation_p.I48V|ARHGAP25_uc010yql.1_Missense_Mutation_p.I48V|ARHGAP25_uc002sev.2_Missense_Mutation_p.I41V|ARHGAP25_uc002sew.2_Missense_Mutation_p.I41V|ARHGAP25_uc002sex.2_Missense_Mutation_p.I41V|ARHGAP25_uc010fdh.1_RNA	NM_001007231	NP_001007232	P42331	RHG25_HUMAN	Rho GTPase activating protein 25 isoform a	48	PH.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|breast(2)	4						GGAGAGGCCCATCAAGATGGG	0.562													60	168	---	---	---	---	PASS
ZNF638	27332	broad.mit.edu	37	2	71607696	71607696	+	Splice_Site	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71607696G>T	uc002shx.2	+	10	2696	c.2377_splice	c.e10+1	p.A793_splice	ZNF638_uc010fec.2_Splice_Site_p.E899_splice|ZNF638_uc010yqw.1_Splice_Site_p.A372_splice|ZNF638_uc002shw.2_Splice_Site_p.G793_splice|ZNF638_uc002shy.2_Splice_Site_p.A793_splice|ZNF638_uc002shz.2_Splice_Site_p.A793_splice|ZNF638_uc002sia.2_Splice_Site_p.A793_splice|ZNF638_uc002sib.1_Splice_Site_p.A793_splice|ZNF638_uc010fed.2_Splice_Site	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638						RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						ACTTCTGCTGGTAAGTTGTTA	0.308													14	45	---	---	---	---	PASS
C2orf65	130951	broad.mit.edu	37	2	74802644	74802644	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74802644G>A	uc002smy.2	-	7	1112	c.995C>T	c.(994-996)CCT>CTT	p.P332L	C2orf65_uc010ysa.1_Missense_Mutation_p.P332L|C2orf65_uc002smz.2_Missense_Mutation_p.P332L|C2orf65_uc010ffp.2_Missense_Mutation_p.P50L|C2orf65_uc002smx.2_Missense_Mutation_p.P88L	NM_138804	NP_620159	Q8TC57	CB065_HUMAN	hypothetical protein LOC130951	332					chromatin assembly|female gamete generation|RNA processing|spermatogenesis	integral to membrane				ovary(1)|pancreas(1)	2						ACAGCTTGTAGGTCTGAGGAT	0.493													64	129	---	---	---	---	PASS
REG3A	5068	broad.mit.edu	37	2	79385853	79385853	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79385853C>A	uc002sod.1	-	2	374	c.119G>T	c.(118-120)TGT>TTT	p.C40F	REG3A_uc002soe.1_Missense_Mutation_p.C40F|REG3A_uc002sof.1_Missense_Mutation_p.C40F	NM_138938	NP_620355	Q06141	REG3A_HUMAN	pancreatitis-associated protein precursor	40	C-type lectin.				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding			skin(1)	1						GCCTTTGGGACAGCGGATCCG	0.547													48	27	---	---	---	---	PASS
POLR1A	25885	broad.mit.edu	37	2	86258514	86258514	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86258514C>A	uc002sqs.2	-	30	4896	c.4517G>T	c.(4516-4518)CGT>CTT	p.R1506L	POLR1A_uc010ytb.1_Missense_Mutation_p.R872L	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A	1506					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						GTGGATCTCACGCACAGCCTG	0.677													82	160	---	---	---	---	PASS
ACTR1B	10120	broad.mit.edu	37	2	98274445	98274445	+	Missense_Mutation	SNP	C	T	T	rs138142670	byFrequency	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98274445C>T	uc002syb.2	-	8	1094	c.886G>A	c.(886-888)GCC>ACC	p.A296T		NM_005735	NP_005726	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B,	296						centrosome|dynactin complex	ATP binding|protein binding			skin(1)	1						ACGATGTTGGCGAACAGCGTC	0.607													39	200	---	---	---	---	PASS
CNGA3	1261	broad.mit.edu	37	2	99013001	99013001	+	Silent	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99013001G>C	uc002syt.2	+	8	1785	c.1368G>C	c.(1366-1368)GTG>GTC	p.V456V	CNGA3_uc002syu.2_Silent_p.V438V|CNGA3_uc010fij.2_Silent_p.V460V	NM_001298	NP_001289	Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3 isoform	456					signal transduction|visual perception	integral to membrane	cGMP binding			ovary(5)|upper_aerodigestive_tract(1)	6						AGAAGGAGGTGCTCAAGAGCC	0.567													58	27	---	---	---	---	PASS
MFSD9	84804	broad.mit.edu	37	2	103335075	103335075	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103335075G>T	uc002tcb.2	-	6	1297	c.1229C>A	c.(1228-1230)ACC>AAC	p.T410N	MFSD9_uc010fja.2_RNA	NM_032718	NP_116107	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing	410					transmembrane transport	integral to membrane|plasma membrane	transporter activity			ovary(2)|breast(2)	4						GCCAATAAGGGTGCCGCTGGC	0.672													11	21	---	---	---	---	PASS
C2orf40	84417	broad.mit.edu	37	2	106690371	106690371	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106690371G>A	uc010fjf.2	+	3	265	c.157G>A	c.(157-159)GTT>ATT	p.V53I		NM_032411	NP_115787	Q9H1Z8	AUGN_HUMAN	esophageal cancer related gene 4 protein	53						extracellular region|transport vesicle					0						TAAAGTGGCCGTTGATGAGAA	0.527													76	103	---	---	---	---	PASS
PAX8	7849	broad.mit.edu	37	2	114002208	114002208	+	Intron	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114002208C>A	uc010yxt.1	-						PAX8_uc010yxu.1_Intron|PAX8_uc010yxv.1_Intron|PAX8_uc002tjm.2_Intron|PAX8_uc002tjn.2_Intron|PAX8_uc010fku.1_Intron|LOC654433_uc002tjq.3_Intron|LOC654433_uc010fks.2_Intron|LOC654433_uc010fkt.2_Intron|LOC654433_uc002tjr.3_Intron	NM_003466	NP_003457	Q06710	PAX8_HUMAN	paired box 8 isoform PAX8A						branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2						GTACCTACTCCAATAGAGAAT	0.552			T	PPARG	follicular thyroid		Thyroid dysgenesis 						52	321	---	---	---	---	PASS
STEAP3	55240	broad.mit.edu	37	2	120005289	120005289	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120005289G>T	uc002tlp.2	+	4	684	c.527G>T	c.(526-528)CGT>CTT	p.R176L	STEAP3_uc002tlq.2_Missense_Mutation_p.R186L|STEAP3_uc002tlr.2_Missense_Mutation_p.R176L|STEAP3_uc010fle.2_Missense_Mutation_p.R176L	NM_018234	NP_060704	Q658P3	STEA3_HUMAN	dudulin 2 isoform b	176	Cytoplasmic (Potential).				apoptosis|cell cycle|cellular iron ion homeostasis|protein secretion|transferrin transport|transmembrane transport	endosome membrane|integral to membrane|multivesicular body	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			central_nervous_system(2)|skin(1)	3						GAAGCCAAGCGTGCTGTCTCG	0.642													5	36	---	---	---	---	PASS
HS6ST1	9394	broad.mit.edu	37	2	129026314	129026314	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129026314C>A	uc002tpt.3	-	2	692	c.658G>T	c.(658-660)GAG>TAG	p.E220*		NM_004807	NP_004798	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	220	Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process, enzymatic modification	integral to plasma membrane	sulfotransferase activity			pancreas(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		GGCGGCAGCTCCTCAGGCGTG	0.657													4	73	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131520279	131520279	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131520279G>A	uc002trw.2	+	2	824	c.634G>A	c.(634-636)GGC>AGC	p.G212S	FAM123C_uc010fmv.2_Missense_Mutation_p.G212S|FAM123C_uc010fms.1_Missense_Mutation_p.G212S|FAM123C_uc010fmt.1_Missense_Mutation_p.G212S|FAM123C_uc010fmu.1_Missense_Mutation_p.G212S	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	212										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		GGGGCTGGACGGCCTGTGCCA	0.692													20	45	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	132021849	132021849	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132021849G>C	uc002tsn.2	+	15	2873	c.2821G>C	c.(2821-2823)GAG>CAG	p.E941Q	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Missense_Mutation_p.E541Q|POTEE_uc002tsl.2_Missense_Mutation_p.E523Q|POTEE_uc010fmy.1_Missense_Mutation_p.E405Q	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	941	Actin-like.						ATP binding				0						GAAGAGCTACGAGCTGCCCGA	0.607													7	156	---	---	---	---	PASS
CCDC74A	90557	broad.mit.edu	37	2	132289288	132289288	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132289288A>T	uc002tta.2	+	4	648	c.596A>T	c.(595-597)GAC>GTC	p.D199V	CCDC74A_uc002ttb.2_Missense_Mutation_p.D133V	NM_138770	NP_620125	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	199										skin(1)	1						TCAAAAGCTGACGTCTCCCAG	0.587													44	77	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141128330	141128330	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141128330C>T	uc002tvj.1	-	71	11929	c.10957G>A	c.(10957-10959)GAT>AAT	p.D3653N		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3653	Extracellular (Potential).|LDL-receptor class A 29.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGAATTCCATCACACAGCCAT	0.393										TSP Lung(27;0.18)			405	171	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141214043	141214043	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141214043G>C	uc002tvj.1	-	62	10916	c.9944C>G	c.(9943-9945)TCC>TGC	p.S3315C		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3315	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGTGCAGTTGGATAAGCAAGT	0.443										TSP Lung(27;0.18)			219	66	---	---	---	---	PASS
KIF5C	3800	broad.mit.edu	37	2	149840148	149840148	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149840148C>A	uc010zbu.1	+	15	1952	c.1584C>A	c.(1582-1584)ACC>ACA	p.T528T	KIF5C_uc002tws.1_RNA|KIF5C_uc002twt.2_Silent_p.T80T	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C	528					microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		CATTGACAACCACACAGAGAG	0.408													10	55	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160242947	160242947	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160242947C>A	uc002uao.2	-	22	3740	c.3388G>T	c.(3388-3390)GAC>TAC	p.D1130Y	BAZ2B_uc002uap.2_Missense_Mutation_p.D1094Y	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1130	DDT.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						CCCATGCTGTCCCCTATATTT	0.403													40	275	---	---	---	---	PASS
RBMS1	5937	broad.mit.edu	37	2	161133862	161133862	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161133862G>A	uc002ubo.2	-	12	1539	c.1095C>T	c.(1093-1095)GCC>GCT	p.A365A	RBMS1_uc002ubj.2_Silent_p.A345A|RBMS1_uc002ubk.2_Silent_p.A329A|RBMS1_uc002ubl.2_Silent_p.A360A|RBMS1_uc002ubn.2_Silent_p.A362A|RBMS1_uc002ubi.3_Silent_p.A378A|RBMS1_uc002ubm.2_Silent_p.A348A|RBMS1_uc002ubp.2_Silent_p.A381A	NM_016836	NP_058520	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting	365					DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding				0						GTGGCAAGTAGGCTCCTTGCA	0.468													163	120	---	---	---	---	PASS
TBR1	10716	broad.mit.edu	37	2	162274732	162274732	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162274732C>T	uc002ubw.1	+	3	1170	c.868C>T	c.(868-870)CCG>TCG	p.P290S	TBR1_uc010foy.2_Missense_Mutation_p.P3S	NM_006593	NP_006584	Q16650	TBR1_HUMAN	T-box, brain, 1	290	T-box.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						CTATATGCATCCGGATTCCCC	0.438													26	134	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162804144	162804144	+	Silent	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162804144T>C	uc002ubx.3	+	17	2356	c.2172T>C	c.(2170-2172)GAT>GAC	p.D724D	SLC4A10_uc002uby.3_Silent_p.D694D|SLC4A10_uc010zcs.1_Silent_p.D705D	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	724	Helical; (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						ATGTTCCAGATGTTCTATTTT	0.443													12	331	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163291984	163291984	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163291984C>A	uc002uch.1	-	8	1890	c.1678G>T	c.(1678-1680)GCC>TCC	p.A560S	KCNH7_uc002uci.2_Missense_Mutation_p.A553S	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	560	Helical; Name=Segment S5; (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	GCAATCAGGGCAAAGATGCAC	0.493													104	46	---	---	---	---	PASS
FASTKD1	79675	broad.mit.edu	37	2	170417051	170417051	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170417051T>A	uc002uev.3	-	5	1205	c.817A>T	c.(817-819)AGT>TGT	p.S273C	FASTKD1_uc002uew.3_RNA|FASTKD1_uc002uex.3_Missense_Mutation_p.S259C|FASTKD1_uc002uey.2_Missense_Mutation_p.S236C	NM_024622	NP_078898	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	273					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(4)	4						TTGTATACACTAAGTATTTTA	0.284													49	57	---	---	---	---	PASS
MYO3B	140469	broad.mit.edu	37	2	171225765	171225765	+	Silent	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171225765C>G	uc002ufy.2	+	9	992	c.849C>G	c.(847-849)TCC>TCG	p.S283S	MYO3B_uc002ufv.2_Silent_p.S270S|MYO3B_uc010fqb.1_Silent_p.S270S|MYO3B_uc002ufz.2_Silent_p.S283S|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002uga.2_Silent_p.S270S|MYO3B_uc002ugb.2_RNA	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2	283	Protein kinase.				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						GGCGACCTTCCGTCACACATC	0.418													53	82	---	---	---	---	PASS
GAD1	2571	broad.mit.edu	37	2	171686061	171686061	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171686061G>C	uc002ugi.2	+	4	644	c.222G>C	c.(220-222)AAG>AAC	p.K74N	GAD1_uc002ugh.2_Missense_Mutation_p.K74N	NM_000817	NP_000808	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 isoform GAD67	74					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion|protein-pyridoxal-5-phosphate linkage	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|plasma membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	AATCCTCCAAGAACCTGCTTT	0.547													54	100	---	---	---	---	PASS
PDE11A	50940	broad.mit.edu	37	2	178592440	178592440	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178592440G>T	uc002ulq.2	-	12	2307	c.1989C>A	c.(1987-1989)TAC>TAA	p.Y663*	PDE11A_uc002ulp.2_Nonsense_Mutation_p.Y219*|PDE11A_uc002ulr.2_Nonsense_Mutation_p.Y413*|PDE11A_uc002uls.1_Nonsense_Mutation_p.Y305*|PDE11A_uc002ult.1_Nonsense_Mutation_p.Y413*|PDE11A_uc002ulu.1_Nonsense_Mutation_p.Y305*	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4	663	Catalytic (By similarity).				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			TCCAGTTGTGGTATAGAACCA	0.463									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				25	67	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179447926	179447926	+	Silent	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179447926A>G	uc010zfg.1	-	262	58124	c.57900T>C	c.(57898-57900)GCT>GCC	p.A19300A	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.A12995A|TTN_uc010zfi.1_Silent_p.A12928A|TTN_uc010zfj.1_Silent_p.A12803A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20227							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAGATTTCATAGCCACACTCA	0.378													18	27	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189936828	189936828	+	Intron	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189936828A>G	uc002uqk.2	-						COL5A2_uc010frx.2_Intron	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein						axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCCTATTAAAAGAAACCAGAA	0.338													5	16	---	---	---	---	PASS
CDK15	65061	broad.mit.edu	37	2	202700416	202700416	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202700416G>T	uc002uyt.2	+	8	830	c.781G>T	c.(781-783)GTG>TTG	p.V261L	CDK15_uc010ftm.2_Missense_Mutation_p.V126L|CDK15_uc002uys.2_Missense_Mutation_p.V210L|CDK15_uc010ftn.1_Missense_Mutation_p.V210L|CDK15_uc010fto.1_Missense_Mutation_p.V240L	NM_139158	NP_631897	Q96Q40	CDK15_HUMAN	PFTAIRE protein kinase 2	261	Protein kinase.						ATP binding|cyclin-dependent protein kinase activity|metal ion binding|protein binding	p.V210M(1)		breast(2)|ovary(1)|lung(1)|kidney(1)	5					Adenosine triphosphate(DB00171)	TTCAGAAGTCGTGACCCTCTG	0.527													29	35	---	---	---	---	PASS
ICOS	29851	broad.mit.edu	37	2	204822597	204822597	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204822597A>G	uc002vam.2	+	4	644	c.577A>G	c.(577-579)AGA>GGA	p.R193G	ICOS_uc010zip.1_Missense_Mutation_p.R193G|ICOS_uc010fua.2_Intron	NM_012092	NP_036224	Q9Y6W8	ICOS_HUMAN	inducible T-cell co-stimulator precursor	193	Cytoplasmic (Potential).				immune response|T cell costimulation	extracellular region					0						CAAAAAATCTAGACTCACAGG	0.388													31	59	---	---	---	---	PASS
TNS1	7145	broad.mit.edu	37	2	218669327	218669327	+	Intron	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218669327C>A	uc002vgt.2	-						TNS1_uc002vgr.2_Intron|TNS1_uc002vgs.2_Intron|TNS1_uc002vgq.2_Intron	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GCCGAAGAGCCTGCAGGCGGG	0.657													29	26	---	---	---	---	PASS
PAX3	5077	broad.mit.edu	37	2	223066851	223066851	+	Missense_Mutation	SNP	G	T	T	rs1042051		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223066851G>T	uc010fwo.2	-	8	1598	c.1232C>A	c.(1231-1233)GCG>GAG	p.A411E	PAX3_uc002vmt.1_Missense_Mutation_p.A411E|PAX3_uc002vmy.1_Missense_Mutation_p.A410E|PAX3_uc002vmv.1_Missense_Mutation_p.A411E|PAX3_uc002vmw.1_Intron|PAX3_uc002vmx.1_Intron	NM_181457	NP_852122	P23760	PAX3_HUMAN	paired box 3 isoform PAX3	411					apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGGGAGAGCGCGTAATCAGT	0.542			T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						15	24	---	---	---	---	PASS
SCG2	7857	broad.mit.edu	37	2	224462367	224462367	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224462367T>A	uc002vnm.2	-	2	1767	c.1634A>T	c.(1633-1635)CAG>CTG	p.Q545L		NM_003469	NP_003460	P13521	SCG2_HUMAN	secretogranin II precursor	545					angiogenesis|endothelial cell migration|eosinophil chemotaxis|induction of positive chemotaxis|inflammatory response|MAPKKK cascade|negative regulation of apoptosis|negative regulation of endothelial cell proliferation|positive regulation of endothelial cell proliferation|protein secretion	extracellular space|stored secretory granule	chemoattractant activity|cytokine activity			ovary(1)	1		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TTTGATGGCCTGCTCAATTTG	0.488													42	75	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225657779	225657779	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225657779T>G	uc010fwz.1	-	47	5462	c.5223A>C	c.(5221-5223)AAA>AAC	p.K1741N	DOCK10_uc002vob.2_Missense_Mutation_p.K1735N|DOCK10_uc002voa.2_Missense_Mutation_p.K397N|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1741	DHR-2.						GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TCTTTTCCACTTTCCAGTAAC	0.433													82	192	---	---	---	---	PASS
ECEL1	9427	broad.mit.edu	37	2	233348877	233348877	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233348877G>T	uc002vsv.2	-	7	1446	c.1241C>A	c.(1240-1242)TCC>TAC	p.S414Y	ECEL1_uc010fya.1_Missense_Mutation_p.S414Y|ECEL1_uc010fyb.1_Missense_Mutation_p.S121Y	NM_004826	NP_004817	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	414	Lumenal (Potential).				neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity			central_nervous_system(2)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		GAATGGCGGGGACAGGTGTTC	0.647													10	36	---	---	---	---	PASS
OXTR	5021	broad.mit.edu	37	3	8809113	8809113	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8809113C>A	uc003brc.2	-	3	1383	c.761G>T	c.(760-762)CGC>CTC	p.R254L		NM_000916	NP_000907	P30559	OXYR_HUMAN	oxytocin receptor	254	Cytoplasmic (Potential).				female pregnancy|lactation|muscle contraction	integral to plasma membrane	oxytocin receptor activity|vasopressin receptor activity				0				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)	CAGGGCCACGCGCCCCCCATC	0.652													5	5	---	---	---	---	PASS
C3orf20	84077	broad.mit.edu	37	3	14801436	14801436	+	Silent	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14801436G>C	uc003byy.2	+	14	2687	c.2283G>C	c.(2281-2283)CTG>CTC	p.L761L	C3orf20_uc003byz.2_Silent_p.L639L|C3orf20_uc003bza.2_Silent_p.L639L|C3orf20_uc003bzb.1_Silent_p.L262L|C3orf20_uc011avj.1_Silent_p.L88L	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	761						cytoplasm|integral to membrane				ovary(3)|skin(1)	4						AGTATGACCTGGACAGCCCCC	0.562													5	35	---	---	---	---	PASS
C3orf20	84077	broad.mit.edu	37	3	14801437	14801437	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14801437G>T	uc003byy.2	+	14	2688	c.2284G>T	c.(2284-2286)GAC>TAC	p.D762Y	C3orf20_uc003byz.2_Missense_Mutation_p.D640Y|C3orf20_uc003bza.2_Missense_Mutation_p.D640Y|C3orf20_uc003bzb.1_Missense_Mutation_p.D263Y|C3orf20_uc011avj.1_Missense_Mutation_p.D89Y	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	762						cytoplasm|integral to membrane				ovary(3)|skin(1)	4						GTATGACCTGGACAGCCCCCT	0.557													5	35	---	---	---	---	PASS
KCNH8	131096	broad.mit.edu	37	3	19389265	19389265	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19389265G>T	uc003cbk.1	+	5	814	c.619G>T	c.(619-621)GCA>TCA	p.A207S	KCNH8_uc011awe.1_Missense_Mutation_p.A207S|KCNH8_uc010hex.1_5'UTR	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	207	Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						AGTTTCTGATGCAAAAAAGTC	0.368													60	94	---	---	---	---	PASS
TOP2B	7155	broad.mit.edu	37	3	25686809	25686809	+	Silent	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25686809T>C	uc011awn.1	-	2	265	c.222A>G	c.(220-222)TCA>TCG	p.S74S	TOP2B_uc003cdj.2_Silent_p.S69S	NM_001068	NP_001059	Q02880	TOP2B_HUMAN	DNA topoisomerase II, beta isozyme	74					DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						ATGGCTCCACTGACCCAATAT	0.313													33	115	---	---	---	---	PASS
UBP1	7342	broad.mit.edu	37	3	33481291	33481291	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33481291T>A	uc003cfq.3	-	1	580	c.50A>T	c.(49-51)CAC>CTC	p.H17L	UBP1_uc003cfr.3_Missense_Mutation_p.H17L|UBP1_uc010hga.2_Missense_Mutation_p.H17L	NM_014517	NP_055332	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a) isoform a	17					negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			kidney(2)	2						GTCGAAGTCGTGCACCAGCCC	0.697													13	36	---	---	---	---	PASS
SLC22A13	9390	broad.mit.edu	37	3	38318955	38318955	+	Nonstop_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38318955G>C	uc003chz.3	+	10	1709	c.1655G>C	c.(1654-1656)TGA>TCA	p.*552S		NM_004256	NP_004247	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion	552						integral to plasma membrane	organic cation transmembrane transporter activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		ACATACTTCTGATTGAGGTCT	0.567													26	45	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38830446	38830446	+	Splice_Site	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38830446C>T	uc003ciq.2	-	3	470	c.470_splice	c.e3+1	p.E157_splice		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha						sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	AATCTACTCACTCAATTTTCT	0.383													22	42	---	---	---	---	PASS
KBTBD5	131377	broad.mit.edu	37	3	42728173	42728173	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42728173G>T	uc003clv.1	+	1	1163	c.1063G>T	c.(1063-1065)GTT>TTT	p.V355F		NM_152393	NP_689606	Q2TBA0	KBTB5_HUMAN	kelch repeat and BTB (POZ) domain containing 5	355										ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.214)		CGTCAGCCTGGTTACCAAGGA	0.572													14	46	---	---	---	---	PASS
SEMA3F	6405	broad.mit.edu	37	3	50224169	50224169	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50224169G>A	uc003cyj.2	+	18	2135	c.1937G>A	c.(1936-1938)CGG>CAG	p.R646Q	SEMA3F_uc003cyk.2_Missense_Mutation_p.R615Q	NM_004186	NP_004177	Q13275	SEM3F_HUMAN	semaphorin 3F precursor	646	Ig-like C2-type.				axon guidance	extracellular space|membrane	chemorepellent activity|receptor activity			lung(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		CCTGGTGACCGGCGCCGAGAG	0.612													5	15	---	---	---	---	PASS
CACNA1D	776	broad.mit.edu	37	3	53815622	53815622	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53815622C>T	uc003dgv.3	+	39	4883	c.4720C>T	c.(4720-4722)CGG>TGG	p.R1574W	CACNA1D_uc003dgu.3_Missense_Mutation_p.R1594W|CACNA1D_uc003dgy.3_Missense_Mutation_p.R1559W|CACNA1D_uc003dgw.3_Missense_Mutation_p.R1241W|CACNA1D_uc003dgx.1_Missense_Mutation_p.R750W	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	1574	Cytoplasmic (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	TGAAGAACTTCGGGCTGTGAT	0.453													16	39	---	---	---	---	PASS
PTPRG	5793	broad.mit.edu	37	3	62187209	62187209	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62187209G>T	uc003dlb.2	+	11	2077	c.1358G>T	c.(1357-1359)AGA>ATA	p.R453I	PTPRG_uc003dlc.2_Missense_Mutation_p.R453I	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	453	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CAAGGGACCAGAATAGTGAAA	0.333													15	29	---	---	---	---	PASS
C3orf64	285203	broad.mit.edu	37	3	69028822	69028822	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69028822T>A	uc003dnl.2	-	16	1736	c.1331A>T	c.(1330-1332)GAA>GTA	p.E444V	C3orf64_uc003dnj.2_Missense_Mutation_p.E123V|C3orf64_uc003dnk.2_Missense_Mutation_p.E360V|C3orf64_uc011bfw.1_RNA	NM_173654	NP_775925	Q5NDL2	AER61_HUMAN	AER61 glycosyltransferase	444						extracellular region	transferase activity, transferring glycosyl groups			ovary(1)	1		Lung NSC(201;0.126)		BRCA - Breast invasive adenocarcinoma(55;4.61e-05)|Epithelial(33;0.000291)|LUSC - Lung squamous cell carcinoma(21;0.0127)|KIRC - Kidney renal clear cell carcinoma(39;0.216)		CACTTACAGTTCAAATACAGC	0.393													16	51	---	---	---	---	PASS
LMOD3	56203	broad.mit.edu	37	3	69168128	69168128	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69168128C>T	uc003dns.2	-	2	1587	c.1378G>A	c.(1378-1380)GTC>ATC	p.V460I	LMOD3_uc003dnt.2_Missense_Mutation_p.V460I	NM_198271	NP_938012	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	460						cytoplasm|cytoskeleton	tropomyosin binding			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		CTAAAGGGGACATTTTGGGGG	0.567													14	38	---	---	---	---	PASS
MITF	4286	broad.mit.edu	37	3	70008496	70008496	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70008496G>A	uc003dnz.2	+	9	1202	c.1086G>A	c.(1084-1086)CAG>CAA	p.Q362Q	MITF_uc011bgb.1_Silent_p.Q310Q|MITF_uc003doa.2_Silent_p.Q361Q|MITF_uc003dob.2_Silent_p.Q346Q|MITF_uc003dod.2_Silent_p.Q337Q|MITF_uc003doe.2_Silent_p.Q255Q|MITF_uc003dof.2_Silent_p.Q261Q	NM_198159	NP_937802	O75030	MITF_HUMAN	microphthalmia-associated transcription factor	368					melanocyte differentiation|multicellular organismal development|protein complex assembly	nucleus|protein complex	DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			ovary(2)	2		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		AACGAGAACAGCAACGCGCAA	0.463			A		melanoma 		Waardenburg syndrome type 2|Tietz syndrome						16	21	---	---	---	---	PASS
ROBO1	6091	broad.mit.edu	37	3	79174626	79174626	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:79174626T>A	uc003dqe.2	-	3	360	c.152A>T	c.(151-153)GAC>GTC	p.D51V		NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	51	Extracellular (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CAGCGAATTGTCATCGTTATC	0.502													9	23	---	---	---	---	PASS
ARL13B	200894	broad.mit.edu	37	3	93722670	93722670	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93722670G>T	uc003drc.2	+	3	584	c.298G>T	c.(298-300)GAT>TAT	p.D100Y	ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Missense_Mutation_p.D85Y|ARL13B_uc003drf.2_Missense_Mutation_p.D100Y|ARL13B_uc003drg.2_5'UTR	NM_182896	NP_878899	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 2-like 1 isoform 1	100							GTP binding				0						GGATTCCAGTGATGAAGAGAG	0.403													6	162	---	---	---	---	PASS
SENP7	57337	broad.mit.edu	37	3	101062529	101062529	+	Splice_Site	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101062529C>A	uc003dut.2	-	14	2217	c.2106_splice	c.e14+1	p.Q702_splice	SENP7_uc003duu.2_Splice_Site_p.Q637_splice|SENP7_uc003duv.2_Splice_Site_p.Q669_splice|SENP7_uc003duw.2_Splice_Site_p.Q636_splice|SENP7_uc003dux.2_Splice_Site_p.Q538_splice	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1						proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5						GATATGCTAACCTGAGATACT	0.323													27	145	---	---	---	---	PASS
DIRC2	84925	broad.mit.edu	37	3	122591354	122591354	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122591354G>T	uc003efw.3	+	8	1370	c.1231G>T	c.(1231-1233)GTT>TTT	p.V411F	DIRC2_uc010hrl.2_RNA|DIRC2_uc010hrm.2_Missense_Mutation_p.V249F	NM_032839	NP_116228	Q96SL1	DIRC2_HUMAN	disrupted in renal carcinoma 2	411					transport	integral to membrane					0				GBM - Glioblastoma multiforme(114;0.0614)		TGTCTACCCAGTTCCAGAAGG	0.343													58	355	---	---	---	---	PASS
SEMA5B	54437	broad.mit.edu	37	3	122632822	122632822	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122632822G>T	uc003efz.1	-	15	2319	c.2015C>A	c.(2014-2016)TCG>TAG	p.S672*	SEMA5B_uc011bju.1_Nonsense_Mutation_p.S614*|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003egb.1_Nonsense_Mutation_p.S672*|SEMA5B_uc010hro.1_Nonsense_Mutation_p.S614*|SEMA5B_uc003efy.1_5'Flank	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1	672	Extracellular (Potential).|TSP type-1 1.				cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		CAGCGCCCACGATGACCACGG	0.667													13	82	---	---	---	---	PASS
ZBTB38	253461	broad.mit.edu	37	3	141161800	141161800	+	Silent	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141161800A>G	uc003etw.2	+	8	1552	c.570A>G	c.(568-570)AAA>AAG	p.K190K	ZBTB38_uc010hun.2_Silent_p.K187K|ZBTB38_uc010huo.2_Silent_p.K190K|ZBTB38_uc003ety.2_Silent_p.K190K|ZBTB38_uc010hup.2_Silent_p.K191K	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	190					positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						CAAGTTTCAAAAAGGTCTCCG	0.502													192	67	---	---	---	---	PASS
ATP1B3	483	broad.mit.edu	37	3	141626098	141626098	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141626098C>A	uc003eug.1	+	3	502	c.328C>A	c.(328-330)CTT>ATT	p.L110I	ATP1B3_uc011bne.1_RNA|ATP1B3_uc003euh.1_Missense_Mutation_p.L96I	NM_001679	NP_001670	P54709	AT1B3_HUMAN	Na+/K+ -ATPase beta 3 subunit	110	Extracellular (Potential).				ATP biosynthetic process|blood coagulation|leukocyte migration	melanosome|sodium:potassium-exchanging ATPase complex	protein binding|sodium:potassium-exchanging ATPase activity				0						CATTGAAGACCTTAAGAAGTT	0.323													43	166	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164781244	164781244	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164781244T>C	uc003fei.2	-	8	955	c.893A>G	c.(892-894)AAT>AGT	p.N298S		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	298	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TGCATTGCTATTCATTAAAAA	0.259										HNSCC(35;0.089)			6	151	---	---	---	---	PASS
TACC3	10460	broad.mit.edu	37	4	1737455	1737455	+	Intron	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1737455C>T	uc003gdo.2	+						TACC3_uc010ibz.2_Intron|TACC3_uc003gdp.2_Intron|TACC3_uc010ica.2_Intron	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing							centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			CTCTTGTCCCCAGTTTAAGGA	0.612													55	62	---	---	---	---	PASS
ZFYVE28	57732	broad.mit.edu	37	4	2343282	2343282	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2343282G>A	uc003gex.1	-	3	560	c.241C>T	c.(241-243)CCC>TCC	p.P81S	ZFYVE28_uc011bvk.1_Missense_Mutation_p.P11S|ZFYVE28_uc011bvl.1_Missense_Mutation_p.P81S|ZFYVE28_uc003gey.3_Missense_Mutation_p.P11S|ZFYVE28_uc003gez.2_Missense_Mutation_p.P34S|ZFYVE28_uc003gew.1_5'Flank	NM_020972	NP_066023	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	81					negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			skin(2)|ovary(1)	3						AAATCTCTGGGGGCGCGGTCC	0.582													29	42	---	---	---	---	PASS
WDR1	9948	broad.mit.edu	37	4	10078919	10078919	+	Intron	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10078919G>A	uc003gmf.2	-						WDR1_uc003gmg.2_Intron|WDR1_uc010idm.2_Intron	NM_017491	NP_059830	O75083	WDR1_HUMAN	WD repeat-containing protein 1 isoform 1						platelet activation|platelet degranulation|sensory perception of sound	cytoskeleton|cytosol|extracellular region	actin binding			ovary(2)|pancreas(1)	3				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		GCCTGGGGGCGGAAGTCACCT	0.597													22	18	---	---	---	---	PASS
LDB2	9079	broad.mit.edu	37	4	16510279	16510279	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16510279C>T	uc003goz.2	-	7	1086	c.770G>A	c.(769-771)CGG>CAG	p.R257Q	LDB2_uc003gpa.2_Missense_Mutation_p.R257Q|LDB2_uc003gpb.2_Missense_Mutation_p.R257Q|LDB2_uc011bxh.1_Missense_Mutation_p.R229Q|LDB2_uc010iee.2_Missense_Mutation_p.R257Q|LDB2_uc003goy.2_Missense_Mutation_p.R132Q|LDB2_uc011bxi.1_Missense_Mutation_p.R133Q	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a	257							LIM domain binding|transcription cofactor activity				0						CCTTTTTCTCCGTTTGGTTGT	0.478													45	54	---	---	---	---	PASS
LGI2	55203	broad.mit.edu	37	4	25014047	25014047	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25014047C>A	uc003grf.2	-	7	829	c.730G>T	c.(730-732)GTG>TTG	p.V244L		NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	244	EAR 1.					extracellular region					0		Breast(46;0.173)				GCGATGGCCACGTACACATCG	0.468													81	76	---	---	---	---	PASS
PCDH7	5099	broad.mit.edu	37	4	30724143	30724143	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30724143C>A	uc003gsk.1	+	1	2107	c.1099C>A	c.(1099-1101)CTC>ATC	p.L367I	PCDH7_uc011bxw.1_Missense_Mutation_p.L320I|PCDH7_uc011bxx.1_Missense_Mutation_p.L367I	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	367	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						GTCCGGCTGGCTCAGCGTCCT	0.692													21	15	---	---	---	---	PASS
PCDH7	5099	broad.mit.edu	37	4	30725461	30725461	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30725461A>C	uc003gsk.1	+	1	3425	c.2417A>C	c.(2416-2418)AAA>ACA	p.K806T	PCDH7_uc011bxw.1_Missense_Mutation_p.K759T|PCDH7_uc011bxx.1_Missense_Mutation_p.K806T	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	806	Extracellular (Potential).|Cadherin 7.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						TTAGTGGGAAAACTCACCCAA	0.498													11	26	---	---	---	---	PASS
ARAP2	116984	broad.mit.edu	37	4	36160997	36160997	+	Missense_Mutation	SNP	C	A	A	rs112661490		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36160997C>A	uc003gsq.1	-	14	2911	c.2573G>T	c.(2572-2574)GGG>GTG	p.G858V		NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	858					regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						CAGACTTTGCCCAGCTTTCTT	0.468													32	114	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48584729	48584729	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48584729C>A	uc003gyh.1	-	20	2376	c.1771G>T	c.(1771-1773)GAA>TAA	p.E591*	FRYL_uc003gyk.2_Nonsense_Mutation_p.E591*	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	591					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						GCACGCAGTTCTTCATCCATA	0.368													30	118	---	---	---	---	PASS
NMU	10874	broad.mit.edu	37	4	56465343	56465343	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56465343C>T	uc003hbc.2	-	9	601	c.495G>A	c.(493-495)CGG>CGA	p.R165R	NMU_uc003hbd.1_RNA|NMU_uc010igv.1_RNA|NMU_uc010igw.1_Silent_p.R80R|NMU_uc010igx.1_RNA	NM_006681	NP_006672	P48645	NMU_HUMAN	neuromedin U precursor	165					neuropeptide signaling pathway	extracellular region					0	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		TTCTTCCATTCCGTGGCTGAA	0.289													4	33	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57181602	57181602	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57181602C>T	uc003hbk.2	+	8	2325	c.1934C>T	c.(1933-1935)GCG>GTG	p.A645V	KIAA1211_uc010iha.2_Missense_Mutation_p.A638V|KIAA1211_uc011bzz.1_Missense_Mutation_p.A555V|KIAA1211_uc003hbm.1_Missense_Mutation_p.A531V	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	645										ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					CCCGGCGACGCGAGGGCGGGC	0.667													6	11	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62812663	62812663	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62812663C>A	uc010ihh.2	+	13	2420	c.2247C>A	c.(2245-2247)AAC>AAA	p.N749K	LPHN3_uc003hcq.3_Missense_Mutation_p.N749K|LPHN3_uc003hct.2_Missense_Mutation_p.N142K	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	736	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						TCCTGTATAACAACTTGGGTC	0.373													59	202	---	---	---	---	PASS
TECRL	253017	broad.mit.edu	37	4	65175635	65175635	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65175635C>A	uc003hcv.2	-	6	675	c.566G>T	c.(565-567)TGT>TTT	p.C189F	TECRL_uc003hcw.2_Missense_Mutation_p.C189F	NM_001010874	NP_001010874	Q5HYJ1	TECRL_HUMAN	steroid 5 alpha-reductase 2-like 2	189					lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors				0						TATACAATGACAGAAGCAAGC	0.333													39	55	---	---	---	---	PASS
UGT2B4	7363	broad.mit.edu	37	4	70351093	70351093	+	Silent	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70351093A>G	uc003hek.3	-	5	1190	c.1143T>C	c.(1141-1143)TAT>TAC	p.Y381Y	UGT2B4_uc011cap.1_Silent_p.Y245Y|UGT2B4_uc003hel.3_Intron	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	381					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						AGATTGCCTCATAGATGCCAT	0.418													74	208	---	---	---	---	PASS
UGT2B4	7363	broad.mit.edu	37	4	70361501	70361501	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70361501G>T	uc003hek.3	-	1	126	c.79C>A	c.(79-81)CTG>ATG	p.L27M	UGT2B4_uc011cap.1_Intron|UGT2B4_uc003hel.3_Missense_Mutation_p.L27M	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	27					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						GGCCACACCAGCACCTTTCCA	0.463													47	184	---	---	---	---	PASS
CDKL2	8999	broad.mit.edu	37	4	76522207	76522207	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76522207T>C	uc003hiq.2	-	9	1759	c.1234A>G	c.(1234-1236)ATT>GTT	p.I412V	CDKL2_uc011cbp.1_Missense_Mutation_p.I412V	NM_003948	NP_003939	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2	412					sex differentiation|signal transduction	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(2)|stomach(2)|breast(2)|skin(1)	7			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AGTGGGGGAATTGCCACGCTT	0.463													108	133	---	---	---	---	PASS
RASGEF1B	153020	broad.mit.edu	37	4	82369222	82369222	+	Splice_Site	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82369222C>A	uc003hmi.1	-	5	798	c.654_splice	c.e5+1	p.L218_splice	RASGEF1B_uc003hmj.1_Splice_Site_p.L217_splice|RASGEF1B_uc010ijq.1_Splice_Site_p.L176_splice	NM_152545	NP_689758	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						AACGGCCTTACCAGCTCTATA	0.463													59	56	---	---	---	---	PASS
RASGEF1B	153020	broad.mit.edu	37	4	82369223	82369223	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82369223C>A	uc003hmi.1	-	5	798	c.654G>T	c.(652-654)CTG>CTT	p.L218L	RASGEF1B_uc003hmj.1_Silent_p.L217L|RASGEF1B_uc010ijq.1_Silent_p.L176L	NM_152545	NP_689758	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B	218	Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						ACGGCCTTACCAGCTCTATAT	0.463													59	56	---	---	---	---	PASS
ENOPH1	58478	broad.mit.edu	37	4	83369094	83369094	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83369094G>C	uc003hmv.2	+	2	363	c.106G>C	c.(106-108)GAA>CAA	p.E36Q	ENOPH1_uc003hmw.2_5'UTR|ENOPH1_uc003hmx.2_5'UTR	NM_021204	NP_067027	Q9UHY7	ENOPH_HUMAN	enolase-phosphatase 1	36					L-methionine salvage from methylthioadenosine	cytoplasm|nucleus	2,3-diketo-5-methylthiopentyl-1-phosphate enolase activity|2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase activity|acireductone synthase activity|magnesium ion binding|phosphoglycolate phosphatase activity				0						TCCTTACATCGAAGAAAATGT	0.368													20	22	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87671973	87671973	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87671973G>T	uc003hpz.2	+	18	3481	c.3001G>T	c.(3001-3003)GGA>TGA	p.G1001*	PTPN13_uc003hpy.2_Nonsense_Mutation_p.G1001*|PTPN13_uc003hqa.2_Nonsense_Mutation_p.G1001*|PTPN13_uc003hqb.2_Intron	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	1001						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		AGAGTTGGTGGGAAAACCTTC	0.398													13	29	---	---	---	---	PASS
PPM1K	152926	broad.mit.edu	37	4	89199742	89199742	+	5'UTR	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89199742G>A	uc003hrm.3	-	2					PPM1K_uc010ikp.1_5'UTR|PPM1K_uc003hrn.2_5'UTR	NM_152542	NP_689755	Q8N3J5	PPM1K_HUMAN	protein phosphatase 1K (PP2C domain containing)						protein dephosphorylation	mitochondrial matrix|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000192)		ACATAACTCAGCTCCAAAGGA	0.443													24	23	---	---	---	---	PASS
PDLIM5	10611	broad.mit.edu	37	4	95583637	95583637	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95583637G>T	uc003hti.2	+	12	1801	c.1650G>T	c.(1648-1650)ATG>ATT	p.M550I	PDLIM5_uc011cdx.1_Missense_Mutation_p.M447I|PDLIM5_uc003hth.2_Missense_Mutation_p.M441I|PDLIM5_uc003htj.2_Missense_Mutation_p.M225I|PDLIM5_uc003htk.2_Missense_Mutation_p.M579I|PDLIM5_uc011cdy.1_Missense_Mutation_p.M428I|PDLIM5_uc003htl.2_Missense_Mutation_p.M225I	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a	550	LIM zinc-binding 3.				regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		CTGGTGACATGTTCCTGGAAG	0.413													72	89	---	---	---	---	PASS
MTTP	4547	broad.mit.edu	37	4	100542253	100542253	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100542253A>T	uc003hvc.3	+	18	2634	c.2378A>T	c.(2377-2379)GAC>GTC	p.D793V	MTTP_uc011cej.1_Missense_Mutation_p.D820V	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large	793					lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	ATCACAGTGGACTCCTCTTTT	0.388													62	70	---	---	---	---	PASS
CFI	3426	broad.mit.edu	37	4	110663664	110663664	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110663664T>G	uc003hzr.3	-	12	1725	c.1517A>C	c.(1516-1518)AAA>ACA	p.K506T	CFI_uc003hzq.2_Missense_Mutation_p.K303T|CFI_uc011cft.1_Missense_Mutation_p.K514T|CFI_uc003hzs.3_Missense_Mutation_p.K499T	NM_000204	NP_000195	P05156	CFAI_HUMAN	complement factor I preproprotein	506	Peptidase S1.				complement activation, classical pathway|innate immune response|proteolysis	extracellular space|membrane	scavenger receptor activity|serine-type endopeptidase activity				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		TTCCATTTCTTTTTCATAGAA	0.393													56	40	---	---	---	---	PASS
ENPEP	2028	broad.mit.edu	37	4	111482577	111482577	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111482577G>T	uc003iab.3	+	20	3079	c.2737G>T	c.(2737-2739)GCA>TCA	p.A913S		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	913	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	GAGCTTTTTTGCAAAATATCC	0.363													15	34	---	---	---	---	PASS
PRSS12	8492	broad.mit.edu	37	4	119219991	119219991	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119219991G>T	uc003ica.1	-	9	1781	c.1734C>A	c.(1732-1734)GAC>GAA	p.D578E		NM_003619	NP_003610	P56730	NETR_HUMAN	neurotrypsin precursor	578	SRCR 4.					membrane	scavenger receptor activity			skin(1)	1						GCTTGATACAGTCAGCCAAGG	0.453													58	67	---	---	---	---	PASS
PRDM5	11107	broad.mit.edu	37	4	121774680	121774680	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121774680C>A	uc003idn.2	-	3	443	c.193G>T	c.(193-195)GGA>TGA	p.G65*	PRDM5_uc003ido.2_Nonsense_Mutation_p.G65*|PRDM5_uc010ine.2_Nonsense_Mutation_p.G65*|PRDM5_uc010inf.2_Nonsense_Mutation_p.G65*|PRDM5_uc003idp.1_Nonsense_Mutation_p.G65*	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	65	SET.				histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						AAAACTTCTCCCTTACTCCCA	0.448													97	238	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126242174	126242174	+	Silent	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126242174T>A	uc003ifj.3	+	1	4608	c.4608T>A	c.(4606-4608)GCT>GCA	p.A1536A		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1536	Cadherin 15.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						ACGCCCTTGCTGCAGACCCAT	0.428													56	205	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126369706	126369706	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126369706A>T	uc003ifj.3	+	9	7535	c.7535A>T	c.(7534-7536)AAA>ATA	p.K2512I	FAT4_uc011cgp.1_Missense_Mutation_p.K810I|FAT4_uc003ifi.1_5'UTR	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	2512	Extracellular (Potential).|Cadherin 24.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						AATTCTGAAAAATTTCACATT	0.428													25	83	---	---	---	---	PASS
TRIM2	23321	broad.mit.edu	37	4	154197105	154197105	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154197105G>T	uc003ing.2	+	3	396	c.195G>T	c.(193-195)CAG>CAT	p.Q65H	TRIM2_uc003inh.2_Missense_Mutation_p.Q92H|TRIM2_uc003ini.1_Missense_Mutation_p.Q83H	NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2	65						cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		TGTGCCGCCAGACCTCCATCC	0.577													15	87	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155156620	155156620	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155156620C>T	uc003inw.2	-	25	7819	c.7819G>A	c.(7819-7821)GTG>ATG	p.V2607M		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	2607					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ACAGGGACCACCTCGTTACTG	0.483													39	123	---	---	---	---	PASS
NPY2R	4887	broad.mit.edu	37	4	156135540	156135540	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156135540G>T	uc003ioq.2	+	2	944	c.449G>T	c.(448-450)AGG>ATG	p.R150M	NPY2R_uc003ior.2_Missense_Mutation_p.R150M	NM_000910	NP_000901	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	150	Cytoplasmic (Potential).				cardiac left ventricle morphogenesis|inhibition of adenylate cyclase activity by G-protein signaling pathway|locomotory behavior|outflow tract morphogenesis	integral to plasma membrane	calcium channel regulator activity			lung(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0854)				GACCGGCACAGGTGCATCGTC	0.562													34	26	---	---	---	---	PASS
FSTL5	56884	broad.mit.edu	37	4	162402218	162402218	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162402218A>T	uc003iqh.2	-	13	1998	c.1562T>A	c.(1561-1563)TTG>TAG	p.L521*	FSTL5_uc003iqi.2_Nonsense_Mutation_p.L520*|FSTL5_uc010iqv.2_Nonsense_Mutation_p.L511*	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	521						extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		GACTCTGTCCAAAGTTGGCTG	0.348													53	206	---	---	---	---	PASS
ZDHHC11	79844	broad.mit.edu	37	5	801262	801262	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:801262G>T	uc011cma.1	-	12	1583	c.1199C>A	c.(1198-1200)ACA>AAA	p.T400K	ZDHHC11_uc010itc.2_RNA|ZDHHC11_uc003jbj.2_RNA	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	400						integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			CATGGGCTCTGTTGTTTCTTG	0.403													31	358	---	---	---	---	PASS
TAS2R1	50834	broad.mit.edu	37	5	9629530	9629530	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9629530G>A	uc003jem.1	-	1	934	c.615C>T	c.(613-615)ACC>ACT	p.T205T		NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN	taste receptor T2R1	205	Cytoplasmic (Potential).				chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity			ovary(3)	3						TCATTTGCCGGGTGTGCCTCC	0.502													5	171	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10414598	10414598	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10414598C>T	uc003jet.1	+	20	2133	c.1950C>T	c.(1948-1950)ATC>ATT	p.I650I	MARCH6_uc011cmu.1_Silent_p.I602I|MARCH6_uc003jeu.1_Silent_p.I348I|MARCH6_uc011cmv.1_Silent_p.I545I	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	650	Helical; (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						CCAGCCTCATCTGCCTTACTT	0.318													288	121	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11384928	11384928	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11384928G>A	uc003jfa.1	-	7	1171	c.1026C>T	c.(1024-1026)TCC>TCT	p.S342S	CTNND2_uc010itt.2_Silent_p.S251S|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_5'UTR	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	342					multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						TGGGCGAGGAGGAGATGGTGG	0.667													74	24	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13811766	13811766	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13811766A>C	uc003jfd.2	-	44	7439	c.7397T>G	c.(7396-7398)ATT>AGT	p.I2466S		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2466					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CTTCAGAGGAATCAGGCCTTG	0.403									Kartagener_syndrome				7	468	---	---	---	---	PASS
TRIO	7204	broad.mit.edu	37	5	14465677	14465677	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14465677C>T	uc003jff.2	+	37	5697	c.5691C>T	c.(5689-5691)CGC>CGT	p.R1897R	TRIO_uc003jfg.2_RNA|TRIO_uc003jfh.1_Silent_p.R1546R|TRIO_uc003jfi.1_Silent_p.R200R	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	1897					apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					TATTAGTCCGCCCCACCAGCT	0.517													14	223	---	---	---	---	PASS
ZNF622	90441	broad.mit.edu	37	5	16465700	16465700	+	Silent	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16465700C>G	uc003jfq.2	-	1	195	c.75G>C	c.(73-75)ACG>ACC	p.T25T		NM_033414	NP_219482	Q969S3	ZN622_HUMAN	zinc finger protein 622	25	U1-type 1.					cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1						GGTGCCAGTCCGTCTTATAGT	0.672													18	147	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19543973	19543973	+	Intron	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19543973T>C	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CATAAAGTAGTTTACCAATTT	0.373													18	303	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21975465	21975465	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21975465G>A	uc010iuc.2	-	3	719	c.261C>T	c.(259-261)GGC>GGT	p.G87G	CDH12_uc011cno.1_Silent_p.G87G|CDH12_uc003jgk.2_Silent_p.G87G	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	87	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						ATTTCACAGTGCCCTCTCCCT	0.368										HNSCC(59;0.17)			318	142	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32087950	32087950	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32087950G>C	uc003jhl.2	+	20	4784	c.4396G>C	c.(4396-4398)GGT>CGT	p.G1466R	PDZD2_uc003jhm.2_Missense_Mutation_p.G1466R	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	1466					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CGGGGCTGGAGGTGGGAGCTC	0.706													31	14	---	---	---	---	PASS
NPR3	4883	broad.mit.edu	37	5	32774933	32774933	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32774933G>T	uc003jhv.2	+	4	1397	c.1179G>T	c.(1177-1179)TGG>TGT	p.W393C	NPR3_uc010iuo.2_Missense_Mutation_p.W177C|NPR3_uc011cnz.1_Missense_Mutation_p.W177C|NPR3_uc003jhu.2_Missense_Mutation_p.W393C	NM_000908	NP_000899	P17342	ANPRC_HUMAN	natriuretic peptide receptor C/guanylate cyclase	393	Extracellular (Potential).				osteoclast proliferation|positive regulation of urine volume|regulation of blood pressure|regulation of osteoblast proliferation|skeletal system development	integral to membrane	hormone binding|natriuretic peptide receptor activity			ovary(1)|central_nervous_system(1)	2					Nesiritide(DB04899)	AGCAGACTTGGAACAGAACAT	0.453													58	350	---	---	---	---	PASS
TARS	6897	broad.mit.edu	37	5	33461108	33461108	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33461108G>C	uc003jhy.2	+	12	1647	c.1352G>C	c.(1351-1353)GGA>GCA	p.G451A	TARS_uc011cob.1_Missense_Mutation_p.G439A|TARS_uc010iup.1_Missense_Mutation_p.G392A|TARS_uc011coc.1_Missense_Mutation_p.G472A|TARS_uc003jhz.2_Missense_Mutation_p.G347A|TARS_uc011cod.1_Missense_Mutation_p.G330A	NM_152295	NP_689508	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	451					threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity			ovary(2)	2					L-Threonine(DB00156)	GCACTCACAGGACTCACCCGG	0.493													46	286	---	---	---	---	PASS
IL7R	3575	broad.mit.edu	37	5	35873682	35873682	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35873682T>G	uc003jjs.2	+	5	727	c.638T>G	c.(637-639)TTT>TGT	p.F213C	IL7R_uc011coo.1_Missense_Mutation_p.F213C|IL7R_uc011cop.1_Intron	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor	213	Extracellular (Potential).|Fibronectin type-III.				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			GATCACTATTTTAAAGGCTTC	0.423													9	310	---	---	---	---	PASS
C5orf51	285636	broad.mit.edu	37	5	41909865	41909865	+	Silent	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41909865A>T	uc003jmo.2	+	3	225	c.225A>T	c.(223-225)ACA>ACT	p.T75T		NM_175921	NP_787117	A6NDU8	CE051_HUMAN	hypothetical protein LOC285636	75											0						TGGACATGACATATTTTGAGG	0.294													25	129	---	---	---	---	PASS
HTR1A	3350	broad.mit.edu	37	5	63257019	63257019	+	Silent	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63257019G>T	uc011cqt.1	-	1	528	c.528C>A	c.(526-528)CGC>CGA	p.R176R		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	176	Helical; Name=4; (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	CTTCCGGGGTGCGCCAGCCCA	0.597													59	58	---	---	---	---	PASS
IQGAP2	10788	broad.mit.edu	37	5	75954376	75954376	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75954376G>T	uc003kek.2	+	21	2635	c.2413G>T	c.(2413-2415)GCA>TCA	p.A805S	IQGAP2_uc010izv.2_Missense_Mutation_p.A358S|IQGAP2_uc011csv.1_Missense_Mutation_p.A301S|IQGAP2_uc003kel.2_Missense_Mutation_p.A301S	NM_006633	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	805					small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		ACTAGAGGTTGCACGATTAAG	0.448													78	28	---	---	---	---	PASS
YTHDC2	64848	broad.mit.edu	37	5	112915353	112915353	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112915353G>T	uc003kqn.2	+	24	3498	c.3315G>T	c.(3313-3315)TTG>TTT	p.L1105F		NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	1105							ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		TGGCAGCCTTGAAACTTGATG	0.368													90	45	---	---	---	---	PASS
PCDHA1	56147	broad.mit.edu	37	5	140166631	140166631	+	Silent	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140166631A>G	uc003lhb.2	+	1	756	c.756A>G	c.(754-756)TTA>TTG	p.L252L	PCDHA1_uc003lha.2_Silent_p.L252L|PCDHA1_uc003lgz.2_Silent_p.L252L	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	252	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCACTTGTTAGAGACTACAG	0.463													49	64	---	---	---	---	PASS
PCDHA1	56147	broad.mit.edu	37	5	140167155	140167155	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140167155C>A	uc003lhb.2	+	1	1280	c.1280C>A	c.(1279-1281)GCG>GAG	p.A427E	PCDHA1_uc003lha.2_Missense_Mutation_p.A427E|PCDHA1_uc003lgz.2_Missense_Mutation_p.A427E	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	427	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGTGACCGCGCGGGACGGG	0.647													50	30	---	---	---	---	PASS
PCDHA8	56140	broad.mit.edu	37	5	140223247	140223247	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140223247G>A	uc003lhs.2	+	1	2341	c.2341G>A	c.(2341-2343)GGA>AGA	p.G781R	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.G781R	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	781	Cytoplasmic (Potential).|5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTGATCTGGGATCAGTTGA	0.473													39	26	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140515490	140515490	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140515490G>T	uc003liq.2	+	1	691	c.474G>T	c.(472-474)CAG>CAT	p.Q158H		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	158	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAATAGCCCAGGACTTTGACA	0.453													77	36	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140553340	140553340	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140553340C>A	uc003lit.2	+	1	1098	c.924C>A	c.(922-924)GAC>GAA	p.D308E		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	308	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCAATTGGACTATGAGGCAA	0.408													63	24	---	---	---	---	PASS
PCDHB11	56125	broad.mit.edu	37	5	140580788	140580788	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140580788G>T	uc003liy.2	+	1	1441	c.1441G>T	c.(1441-1443)GGC>TGC	p.G481C	PCDHB11_uc011daj.1_Missense_Mutation_p.G116C	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11 precursor	481	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGAGACTCAGGCACCAACGC	0.632													83	37	---	---	---	---	PASS
PCDHGA2	56113	broad.mit.edu	37	5	140720359	140720359	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140720359C>T	uc003ljk.1	+	1	2006	c.1821C>T	c.(1819-1821)CAC>CAT	p.H607H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Silent_p.H607H	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	607	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCTTACCACCTGCTCAAGG	0.692													19	55	---	---	---	---	PASS
PDGFRB	5159	broad.mit.edu	37	5	149503824	149503824	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149503824C>T	uc003lro.2	-	14	2481	c.2012G>A	c.(2011-2013)TGC>TAC	p.C671Y	PDGFRB_uc010jhd.2_Missense_Mutation_p.C510Y	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	671	Cytoplasmic (Potential).|Protein kinase.				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCCTTTGGTGCAGGCCCCCAA	0.642			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								20	12	---	---	---	---	PASS
ZNF300	91975	broad.mit.edu	37	5	150277688	150277688	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150277688C>A	uc003lsy.1	-	5	468	c.201G>T	c.(199-201)TGG>TGT	p.W67C	IRGM_uc011dcl.1_Intron	NM_052860	NP_443092	Q96RE9	ZN300_HUMAN	zinc finger protein 300	67	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTTTATGATCCATGGCTCTT	0.373													77	42	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	5	177483185	177483185	+	IGR	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177483185C>A								FAM153C (7097 upstream) : N4BP3 (57371 downstream)																							GAGGAAGAGACCAAGAAATAA	0.438													8	8	---	---	---	---	PASS
TRIM7	81786	broad.mit.edu	37	5	180625213	180625213	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180625213G>T	uc003mmz.1	-	6	1061	c.994C>A	c.(994-996)CTT>ATT	p.L332I	TRIM7_uc003mmv.1_Missense_Mutation_p.L150I|TRIM7_uc003mmw.1_Missense_Mutation_p.L124I|TRIM7_uc003mmx.1_Missense_Mutation_p.L124I|TRIM7_uc003mmy.1_Missense_Mutation_p.L124I	NM_203293	NP_976038	Q9C029	TRIM7_HUMAN	tripartite motif-containing 7 isoform 1	332	B30.2/SPRY.					cytoplasm|nucleus	zinc ion binding			ovary(2)|skin(1)	3	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		TCTCCCCGAAGGTCCTCTGAG	0.522													23	7	---	---	---	---	PASS
SLC17A1	6568	broad.mit.edu	37	6	25820133	25820133	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25820133T>C	uc003nfh.3	-	4	334	c.218A>G	c.(217-219)TAT>TGT	p.Y73C	SLC17A1_uc011djy.1_RNA|SLC17A1_uc010jqb.1_Missense_Mutation_p.Y71C|SLC17A1_uc010jqc.1_Missense_Mutation_p.Y71C	NM_005074	NP_005065	Q14916	NPT1_HUMAN	solute carrier family 17 (sodium phosphate),	73					sodium ion transport|urate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(3)|pancreas(1)	4						GCTCCAATTATACATAGGGTT	0.423													68	25	---	---	---	---	PASS
SCAND3	114821	broad.mit.edu	37	6	28543354	28543354	+	Silent	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28543354T>C	uc003nlo.2	-	3	1746	c.1128A>G	c.(1126-1128)CAA>CAG	p.Q376Q		NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN	SCAN domain containing 3	376	Integrase catalytic.				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TAAGATCTACTTGGCATCTTG	0.348													166	48	---	---	---	---	PASS
ZNF311	282890	broad.mit.edu	37	6	28962925	28962925	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28962925T>A	uc003nlu.2	-	7	2367	c.1854A>T	c.(1852-1854)AAA>AAT	p.K618N	ZNF311_uc011dlk.1_Missense_Mutation_p.K526N|ZNF311_uc003nlv.2_Missense_Mutation_p.K526N	NM_001010877	NP_001010877	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	618	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding				0						CTCTAAAAGCTTTTCCACATT	0.453													94	29	---	---	---	---	PASS
ZNF311	282890	broad.mit.edu	37	6	28962926	28962926	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28962926T>G	uc003nlu.2	-	7	2366	c.1853A>C	c.(1852-1854)AAA>ACA	p.K618T	ZNF311_uc011dlk.1_Missense_Mutation_p.K526T|ZNF311_uc003nlv.2_Missense_Mutation_p.K526T	NM_001010877	NP_001010877	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	618	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding				0						TCTAAAAGCTTTTCCACATTC	0.448													94	30	---	---	---	---	PASS
MDC1	9656	broad.mit.edu	37	6	30672713	30672713	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30672713G>A	uc003nrg.3	-	10	4687	c.4247C>T	c.(4246-4248)CCT>CTT	p.P1416L	MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Missense_Mutation_p.P1023L	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1416	Pro-rich.|Interaction with the PRKDC complex.				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						GGAAGTGGAAGGCTCGAGCTT	0.557								Other_conserved_DNA_damage_response_genes					153	28	---	---	---	---	PASS
ZNF318	24149	broad.mit.edu	37	6	43322911	43322911	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43322911G>A	uc003oux.2	-	4	2239	c.2161C>T	c.(2161-2163)CAT>TAT	p.H721Y	ZNF318_uc003ouw.2_RNA	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	721					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CCTGAAATATGACCCACTGGA	0.517													57	16	---	---	---	---	PASS
BMP5	653	broad.mit.edu	37	6	55638864	55638864	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55638864C>G	uc003pcq.2	-	4	1722	c.1010G>C	c.(1009-1011)AGA>ACA	p.R337T	BMP5_uc011dxf.1_Missense_Mutation_p.R337T	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein	337					cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			ACTGGACATTCTGGAGGAGTC	0.448													18	161	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	71004007	71004007	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71004007C>A	uc003pfg.3	-	5	718	c.559G>T	c.(559-561)GTG>TTG	p.V187L		NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor	187	Nonhelical region (NC4).|TSP N-terminal.				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						CTCCTCTCCACGCCAATCATG	0.433													90	112	---	---	---	---	PASS
TTK	7272	broad.mit.edu	37	6	80737728	80737728	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80737728G>T	uc003pjc.2	+	13	1595	c.1521G>T	c.(1519-1521)CAG>CAT	p.Q507H	TTK_uc003pjb.3_Missense_Mutation_p.Q506H	NM_003318	NP_003309	P33981	TTK_HUMAN	TTK protein kinase	507					mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		AAAATTTACAGGTTCGATAAG	0.373													34	33	---	---	---	---	PASS
FAM46A	55603	broad.mit.edu	37	6	82461468	82461468	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82461468G>A	uc003pjg.2	-	2	709	c.391C>T	c.(391-393)CAG>TAG	p.Q131*	FAM46A_uc003pjf.2_Nonsense_Mutation_p.Q150*|FAM46A_uc003pjh.1_Nonsense_Mutation_p.Q131*	NM_017633	NP_060103	Q96IP4	FA46A_HUMAN	hypothetical protein LOC55603	131											0		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		CCGCTGTCCTGGTGCAGGACA	0.667													26	25	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90415838	90415838	+	Silent	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90415838T>A	uc003pnn.1	-	53	8204	c.8088A>T	c.(8086-8088)GCA>GCT	p.A2696A		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	2696					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GCAGGACTAGTGCATCACAAA	0.408													39	39	---	---	---	---	PASS
FUT9	10690	broad.mit.edu	37	6	96652006	96652006	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96652006T>A	uc003pop.3	+	3	1316	c.975T>A	c.(973-975)AAT>AAA	p.N325K		NM_006581	NP_006572	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3)	325	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			skin(4)|ovary(1)	5		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		TCACTGTAAATCTTCCACGAT	0.368													30	102	---	---	---	---	PASS
BEND3	57673	broad.mit.edu	37	6	107391664	107391664	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107391664G>A	uc003prs.2	-	5	1381	c.731C>T	c.(730-732)CCT>CTT	p.P244L		NM_001080450	NP_001073919	Q5T5X7	BEND3_HUMAN	BEN domain containing 3	244	BEN 1.									ovary(3)	3						CTGGTACTCAGGGGGCGGCTG	0.637													9	33	---	---	---	---	PASS
GPRC6A	222545	broad.mit.edu	37	6	117130548	117130548	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117130548C>A	uc003pxj.1	-	2	449	c.427G>T	c.(427-429)GTC>TTC	p.V143F	GPRC6A_uc003pxk.1_Missense_Mutation_p.V143F|GPRC6A_uc003pxl.1_Missense_Mutation_p.V143F	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, family C, group 6,	143	Extracellular (Potential).				response to amino acid stimulus		G-protein coupled receptor activity			ovary(4)|skin(2)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		GAACCTATGACAGCCTTAACT	0.438													43	59	---	---	---	---	PASS
RFX6	222546	broad.mit.edu	37	6	117240430	117240430	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117240430C>T	uc003pxm.2	+	11	1216	c.1153C>T	c.(1153-1155)CGA>TGA	p.R385*		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	385					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						TTCTCTGAAACGACAAACATC	0.363													14	88	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117681563	117681563	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117681563C>A	uc003pxp.1	-	22	3586	c.3387G>T	c.(3385-3387)AGG>AGT	p.R1129S	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1129	Fibronectin type-III 5.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ATGTAAAGGCCCTAACCTAAA	0.358			T	GOPC|ROS1	glioblastoma|NSCLC								37	34	---	---	---	---	PASS
MCM9	254394	broad.mit.edu	37	6	119252620	119252620	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119252620A>C	uc003pyh.2	-	2	532	c.269T>G	c.(268-270)GTT>GGT	p.V90G		NM_153255	NP_694987	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	90					DNA replication		ATP binding|DNA binding|nucleoside-triphosphatase activity			ovary(1)	1		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		TTTCATGGAAACAGCCTCAGG	0.393													40	32	---	---	---	---	PASS
TRDN	10345	broad.mit.edu	37	6	123892145	123892145	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123892145A>T	uc003pzj.1	-	2	177	c.155T>A	c.(154-156)CTG>CAG	p.L52Q	TRDN_uc003pzk.1_Missense_Mutation_p.L52Q|TRDN_uc003pzl.1_Missense_Mutation_p.L52Q|TRDN_uc010ken.2_Missense_Mutation_p.L52Q|TRDN_uc010keo.1_Missense_Mutation_p.L52Q	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin	52	Helical; (Potential).				muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		GGCAATGACCAGAAGCCAGGC	0.453													14	84	---	---	---	---	PASS
TAAR5	9038	broad.mit.edu	37	6	132910476	132910476	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132910476A>T	uc003qdk.2	-	1	402	c.350T>A	c.(349-351)TTC>TAC	p.F117Y		NM_003967	NP_003958	O14804	TAAR5_HUMAN	trace amine associated receptor 5	117	Helical; Name=3; (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			skin(1)	1	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		GGTGAGGCAGAAGAGGGTGTC	0.582													21	80	---	---	---	---	PASS
VNN2	8875	broad.mit.edu	37	6	133077158	133077158	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133077158C>A	uc003qdt.2	-	3	372	c.361G>T	c.(361-363)GTA>TTA	p.V121L	VNN2_uc003qds.2_5'UTR|VNN2_uc010kgb.2_Missense_Mutation_p.V121L|VNN2_uc003qdv.2_Missense_Mutation_p.V68L	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor	121	CN hydrolase.				cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		CTTGCTTGTACTGGTGTGTGA	0.363													7	32	---	---	---	---	PASS
PHACTR2	9749	broad.mit.edu	37	6	144098473	144098473	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144098473G>T	uc003qjq.3	+	9	1695	c.1565G>T	c.(1564-1566)AGC>ATC	p.S522I	PHACTR2_uc010khh.2_Missense_Mutation_p.S442I|PHACTR2_uc010khi.2_Missense_Mutation_p.S533I|PHACTR2_uc003qjr.3_Missense_Mutation_p.S453I	NM_014721	NP_055536	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2 isoform 3	522	RPEL 3.						actin binding|protein phosphatase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		AGGAGGCTGAGCCAGAGGCCC	0.373													11	33	---	---	---	---	PASS
SASH1	23328	broad.mit.edu	37	6	148864899	148864899	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148864899A>G	uc003qme.1	+	18	2768	c.2293A>G	c.(2293-2295)AAT>GAT	p.N765D	SASH1_uc011eeb.1_Missense_Mutation_p.N526D|SASH1_uc003qmf.1_Missense_Mutation_p.N175D	NM_015278	NP_056093	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	765							protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		CCAGTTGGGCAATTACCCAAC	0.537													85	74	---	---	---	---	PASS
PDE10A	10846	broad.mit.edu	37	6	165792838	165792838	+	Silent	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165792838G>T	uc003qun.2	-	19	2041	c.1800C>A	c.(1798-1800)ATC>ATA	p.I600I	PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Silent_p.I530I|PDE10A_uc003quo.2_Silent_p.I610I	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2	600					platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	GAGTGGAGAAGATATTGTGCC	0.383													14	64	---	---	---	---	PASS
TCP10	6953	broad.mit.edu	37	6	167796370	167796370	+	5'UTR	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167796370C>T	uc003qvv.1	-	2					TCP10_uc003qvu.2_5'UTR|TCP10_uc003qvw.2_Intron	NM_004610	NP_004601	Q12799	TCP10_HUMAN	t-complex 10							cytosol				breast(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		ATGGCAGCCCCAGCTCCCGGG	0.652													9	12	---	---	---	---	PASS
SNX8	29886	broad.mit.edu	37	7	2302977	2302977	+	Missense_Mutation	SNP	G	T	T	rs10229132	byFrequency	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2302977G>T	uc003slw.2	-	7	846	c.803C>A	c.(802-804)ACC>AAC	p.T268N		NM_013321	NP_037453	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	268					cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		GGGCAGCGGGGTCGTGTCAGA	0.632													7	14	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	4249700	4249700	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4249700C>T	uc003smx.2	+	38	5584	c.5445C>T	c.(5443-5445)TCC>TCT	p.S1815S	SDK1_uc010kso.2_Silent_p.S1071S|SDK1_uc003smy.2_Silent_p.S302S	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1815	Fibronectin type-III 12.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AAATAACCTCCACCACGCTCA	0.572													58	64	---	---	---	---	PASS
FBXL18	80028	broad.mit.edu	37	7	5540380	5540380	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5540380C>A	uc003soo.2	-	3	1614	c.1520G>T	c.(1519-1521)CGC>CTC	p.R507L	FBXL18_uc003son.3_Missense_Mutation_p.R507L	NM_024963	NP_079239	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	507										central_nervous_system(2)|ovary(1)	3		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		GAGCGAGTTGCGGATGGCGGG	0.662													20	8	---	---	---	---	PASS
ZNF12	7559	broad.mit.edu	37	7	6730591	6730591	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6730591T>C	uc003sqt.1	-	5	2536	c.1982A>G	c.(1981-1983)TAT>TGT	p.Y661C	ZNF12_uc011jxa.1_Missense_Mutation_p.Y499C|ZNF12_uc003sqs.1_Missense_Mutation_p.Y623C	NM_016265	NP_057349	P17014	ZNF12_HUMAN	zinc finger protein 12 isoform a	661	C2H2-type 15.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		AGTACACTCATAGGGTTTCTC	0.393													18	91	---	---	---	---	PASS
ICA1	3382	broad.mit.edu	37	7	8167591	8167591	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8167591C>A	uc003srm.2	-	13	1309	c.1242G>T	c.(1240-1242)GAG>GAT	p.E414D	ICA1_uc010ktr.2_Missense_Mutation_p.E443D|ICA1_uc003srl.2_Missense_Mutation_p.E402D|ICA1_uc003srn.3_Missense_Mutation_p.E340D|ICA1_uc003srp.3_Missense_Mutation_p.E413D|ICA1_uc010kts.2_RNA|ICA1_uc003srq.2_Missense_Mutation_p.E414D|ICA1_uc003srr.2_Missense_Mutation_p.E413D|ICA1_uc003sro.3_Missense_Mutation_p.E414D	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1	414					neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		TGGGGTCTGGCTCTCCCAGGG	0.552													157	153	---	---	---	---	PASS
NDUFA4	4697	broad.mit.edu	37	7	10979689	10979689	+	5'UTR	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10979689G>A	uc003srx.1	-	1						NM_002489	NP_002480	O00483	NDUA4_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)	NADH(DB00157)	GAGCATGTTTGCGGCAGAGGT	0.532													109	80	---	---	---	---	PASS
OSBPL3	26031	broad.mit.edu	37	7	24874224	24874224	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24874224C>A	uc003sxf.2	-	15	2032	c.1627G>T	c.(1627-1629)GTG>TTG	p.V543L	OSBPL3_uc003sxd.2_RNA|OSBPL3_uc003sxe.2_RNA|OSBPL3_uc003sxg.2_Missense_Mutation_p.V507L|OSBPL3_uc003sxh.2_Missense_Mutation_p.V512L|OSBPL3_uc003sxi.2_Missense_Mutation_p.V476L|OSBPL3_uc003sxj.1_Missense_Mutation_p.V272L|OSBPL3_uc003sxk.1_Missense_Mutation_p.V241L	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform	543					lipid transport		lipid binding|protein binding			skin(1)	1						GGCATGGCCACCTTGGACAGG	0.632													51	50	---	---	---	---	PASS
NOD1	10392	broad.mit.edu	37	7	30475671	30475671	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30475671T>C	uc003tav.2	-	11	3087	c.2564A>G	c.(2563-2565)GAA>GGA	p.E855G		NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain	855	LRR 6.				activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						CTTTCCTCCTTCTGTGGAGAT	0.408													14	50	---	---	---	---	PASS
SFRP4	6424	broad.mit.edu	37	7	37955994	37955994	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37955994C>T	uc003tfo.3	-	1	532	c.146G>A	c.(145-147)AGC>AAC	p.S49N		NM_003014	NP_003005	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related  protein 4 precursor	49	FZ.				brain development|cell differentiation|decidualization|embryo development|epithelium development|gonad development|mammary gland involution|menstrual cycle phase|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell proliferation|negative regulation of JNK cascade|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of sodium-dependent phosphate transport|phosphate ion homeostasis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epidermal cell differentiation|positive regulation of gene expression|positive regulation of receptor internalization|vasculature development|Wnt receptor signaling pathway	cell surface|cytoplasm|extracellular space|nucleus	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1						CTCCTGCGTGCTGTGGTGCAG	0.672													55	49	---	---	---	---	PASS
SFRP4	6424	broad.mit.edu	37	7	37956126	37956126	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37956126A>T	uc003tfo.3	-	1	400	c.14T>A	c.(13-15)ATC>AAC	p.I5N		NM_003014	NP_003005	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related  protein 4 precursor	5					brain development|cell differentiation|decidualization|embryo development|epithelium development|gonad development|mammary gland involution|menstrual cycle phase|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell proliferation|negative regulation of JNK cascade|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of sodium-dependent phosphate transport|phosphate ion homeostasis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epidermal cell differentiation|positive regulation of gene expression|positive regulation of receptor internalization|vasculature development|Wnt receptor signaling pathway	cell surface|cytoplasm|extracellular space|nucleus	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1						CGCCACTAGGATGGAGAGGAA	0.677													14	13	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38289044	38289044	+	5'UTR	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38289044A>T	uc003tfu.3	-	2					uc003tfv.2_5'UTR|uc003tfw.2_RNA|uc003tfx.1_RNA|uc003tfz.1_RNA					SubName: Full=TARP protein;																		TTGCCAATGTATCTTAATAAT	0.403													152	161	---	---	---	---	PASS
C7orf57	136288	broad.mit.edu	37	7	48086126	48086126	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48086126C>T	uc003toh.3	+	5	632	c.420C>T	c.(418-420)AGC>AGT	p.S140S	C7orf57_uc003toi.3_Silent_p.S14S	NM_001100159	NP_001093629	Q8NEG2	CG057_HUMAN	hypothetical protein LOC136288	140										ovary(1)	1						CCAATGGTAGCTATGCATCCA	0.498													6	16	---	---	---	---	PASS
DDC	1644	broad.mit.edu	37	7	50531071	50531071	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50531071T>A	uc003tpf.3	-	14	1387	c.1301A>T	c.(1300-1302)CAC>CTC	p.H434L	DDC_uc010kza.2_Missense_Mutation_p.H349L|DDC_uc003tpg.3_Missense_Mutation_p.H434L	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid	434					cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	TGGAACCAAGTGGATTTTTTT	0.502													18	55	---	---	---	---	PASS
VSTM2A	222008	broad.mit.edu	37	7	54636708	54636708	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54636708G>T	uc010kzf.2	+	5	1046	c.641G>T	c.(640-642)AGG>ATG	p.R214M	VSTM2A_uc003tqc.3_Intron|uc003tqd.2_5'Flank	NM_182546	NP_872352	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2	214						extracellular region					0			STAD - Stomach adenocarcinoma(5;0.0525)			GCAGGTGCGAGGATAGCTACA	0.368													3	8	---	---	---	---	PASS
SEPT14	346288	broad.mit.edu	37	7	55910723	55910723	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55910723C>A	uc003tqz.2	-	5	587	c.470G>T	c.(469-471)CGC>CTC	p.R157L		NM_207366	NP_997249	Q6ZU15	SEP14_HUMAN	septin 14	157					cell cycle|cell division	septin complex	GTP binding|protein binding				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CACGTGGACGCGAGAATCATG	0.398													11	12	---	---	---	---	PASS
HGF	3082	broad.mit.edu	37	7	81331912	81331912	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81331912C>A	uc003uhl.2	-	18	2337	c.2172G>T	c.(2170-2172)AAG>AAT	p.K724N	HGF_uc003uhm.2_Missense_Mutation_p.K719N	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	724					epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						ACTGTGGTACCTTATATGTTA	0.368													39	55	---	---	---	---	PASS
C7orf43	55262	broad.mit.edu	37	7	99754531	99754531	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99754531C>T	uc003utr.2	-	6	1110	c.930G>A	c.(928-930)CTG>CTA	p.L310L	C7orf43_uc010lgo.2_5'Flank|C7orf43_uc010lgp.2_5'UTR|C7orf43_uc011kjj.1_Silent_p.L78L|C7orf43_uc003uts.2_Silent_p.L41L	NM_018275	NP_060745	Q8WVR3	CG043_HUMAN	hypothetical protein LOC55262	310											0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGTGTTCCTCCAGGGCATTCA	0.592													29	159	---	---	---	---	PASS
ARMC10	83787	broad.mit.edu	37	7	102738950	102738950	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102738950C>A	uc003vaw.1	+	7	1374	c.982C>A	c.(982-984)CAT>AAT	p.H328N	ARMC10_uc003vay.1_Missense_Mutation_p.H269N|ARMC10_uc003vax.1_Missense_Mutation_p.H293N|ARMC10_uc003vbb.1_Missense_Mutation_p.H234N|ARMC10_uc011kli.1_Missense_Mutation_p.H269N|ARMC10_uc010lis.1_Missense_Mutation_p.H210N|ARMC10_uc003vba.1_RNA|ARMC10_uc003vaz.1_Missense_Mutation_p.H206N	NM_031905	NP_114111	Q8N2F6	ARM10_HUMAN	SVH protein isoform a	328					regulation of growth	endoplasmic reticulum membrane|integral to membrane	binding			ovary(1)	1						AGTTGATCACCATGATGCAGA	0.373													59	145	---	---	---	---	PASS
ARMC10	83787	broad.mit.edu	37	7	102738951	102738951	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102738951A>T	uc003vaw.1	+	7	1375	c.983A>T	c.(982-984)CAT>CTT	p.H328L	ARMC10_uc003vay.1_Missense_Mutation_p.H269L|ARMC10_uc003vax.1_Missense_Mutation_p.H293L|ARMC10_uc003vbb.1_Missense_Mutation_p.H234L|ARMC10_uc011kli.1_Missense_Mutation_p.H269L|ARMC10_uc010lis.1_Missense_Mutation_p.H210L|ARMC10_uc003vba.1_RNA|ARMC10_uc003vaz.1_Missense_Mutation_p.H206L	NM_031905	NP_114111	Q8N2F6	ARM10_HUMAN	SVH protein isoform a	328					regulation of growth	endoplasmic reticulum membrane|integral to membrane	binding			ovary(1)	1						GTTGATCACCATGATGCAGAG	0.378													59	150	---	---	---	---	PASS
LAMB1	3912	broad.mit.edu	37	7	107603475	107603475	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107603475C>A	uc003vew.2	-	15	2067	c.1732G>T	c.(1732-1734)GAC>TAC	p.D578Y	LAMB1_uc003vev.2_Missense_Mutation_p.D602Y|LAMB1_uc003vex.2_Missense_Mutation_p.D578Y|LAMB1_uc010ljn.1_Missense_Mutation_p.D664Y	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	578	Laminin IV type B.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGAATCCGGTCCTGGATATAT	0.448													66	116	---	---	---	---	PASS
PAX4	5078	broad.mit.edu	37	7	127254600	127254600	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127254600G>A	uc010lld.1	-	3	554	c.348C>T	c.(346-348)ATC>ATT	p.I116I	PAX4_uc003vmf.2_Silent_p.I114I|PAX4_uc003vmg.1_Silent_p.I116I|PAX4_uc003vmh.2_Silent_p.I114I	NM_006193	NP_006184	O43316	PAX4_HUMAN	paired box 4	124	Paired.				cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GGACTCGGTTGATGGAGGAGA	0.562													11	4	---	---	---	---	PASS
FAM40B	57464	broad.mit.edu	37	7	129094344	129094344	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129094344C>T	uc011koy.1	+	7	722	c.682C>T	c.(682-684)CGG>TGG	p.R228W	FAM40B_uc003vow.2_Missense_Mutation_p.R228W	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN	hypothetical protein LOC57464 isoform a	228											0						GAGAACAGCCCGGGAGACCTT	0.532													26	128	---	---	---	---	PASS
PODXL	5420	broad.mit.edu	37	7	131195746	131195746	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131195746G>A	uc003vqw.3	-	2	805	c.547C>T	c.(547-549)CCT>TCT	p.P183S	PODXL_uc003vqx.3_Missense_Mutation_p.P183S	NM_001018111	NP_001018121	O00592	PODXL_HUMAN	podocalyxin-like isoform 1 precursor	183	Thr-rich.|Extracellular (Potential).				cell adhesion|epithelial tube formation|negative regulation of cell-cell adhesion|positive regulation of cell migration|positive regulation of cell-cell adhesion mediated by integrin|regulation of microvillus assembly	actin cytoskeleton|apical plasma membrane|centrosome|filopodium|integral to plasma membrane|lamellipodium|membrane raft|microvillus membrane|nucleolus|ruffle				breast(2)|pancreas(1)	3	Melanoma(18;0.162)					GGACTTGTAGGGTGAGGGGTC	0.522													65	294	---	---	---	---	PASS
JHDM1D	80853	broad.mit.edu	37	7	139826529	139826529	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139826529C>T	uc003vvm.2	-	6	800	c.796G>A	c.(796-798)GTT>ATT	p.V266I		NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase	266	JmjC.				midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					TATTTCTGAACAAATGGCTTG	0.418													106	213	---	---	---	---	PASS
AGK	55750	broad.mit.edu	37	7	141341201	141341201	+	Intron	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141341201G>T	uc003vwi.2	+						AGK_uc011krg.1_Intron	NM_018238	NP_060708	Q53H12	AGK_HUMAN	acylglycerol kinase precursor						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway	mitochondrial membrane	acylglycerol kinase activity|ATP binding|diacylglycerol kinase activity|NAD+ kinase activity			ovary(1)|breast(1)	2	Melanoma(164;0.0171)					ACAGGATGGTGAGCAATGTGG	0.483													95	95	---	---	---	---	PASS
TRPV5	56302	broad.mit.edu	37	7	142605694	142605694	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142605694C>T	uc003wby.1	-	15	2440	c.2176G>A	c.(2176-2178)GTC>ATC	p.V726I		NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	726	Cytoplasmic (Potential).|Involved in Ca(2+)-dependent inactivation (By similarity).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					AAATGGTAGACCTCCTCTCCA	0.547													79	138	---	---	---	---	PASS
KEL	3792	broad.mit.edu	37	7	142654955	142654955	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142654955G>T	uc003wcb.2	-	6	841	c.631C>A	c.(631-633)CTA>ATA	p.L211I		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	211	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					TGAGGTCCTAGGTAGGCTCTG	0.522													83	77	---	---	---	---	PASS
ERICH1	157697	broad.mit.edu	37	8	623391	623391	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:623391C>A	uc003wph.2	-	4	1026	c.961G>T	c.(961-963)GAC>TAC	p.D321Y	ERICH1_uc011kwh.1_Missense_Mutation_p.D321Y|ERICH1_uc003wpe.1_Missense_Mutation_p.D227Y|ERICH1_uc003wpi.2_Missense_Mutation_p.D133Y	NM_207332	NP_997215	Q86X53	ERIC1_HUMAN	glutamate-rich 1	321	Glu-rich.									large_intestine(2)	2		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)		TCTGCACCGTCCTCCTCCCCG	0.517													96	52	---	---	---	---	PASS
MSR1	4481	broad.mit.edu	37	8	15998506	15998506	+	Intron	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15998506T>C	uc003wwz.2	-						MSR1_uc010lsu.2_Intron|MSR1_uc003wxa.2_Intron|MSR1_uc003wxb.2_3'UTR|MSR1_uc011kxz.1_3'UTR	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1						cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		CCAACCCACCTGATCTTAAGA	0.423													34	52	---	---	---	---	PASS
MSR1	4481	broad.mit.edu	37	8	15998507	15998507	+	Intron	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15998507G>T	uc003wwz.2	-						MSR1_uc010lsu.2_Intron|MSR1_uc003wxa.2_Intron|MSR1_uc003wxb.2_3'UTR|MSR1_uc011kxz.1_3'UTR	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1						cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		CAACCCACCTGATCTTAAGAG	0.423													34	51	---	---	---	---	PASS
C8orf80	389643	broad.mit.edu	37	8	27918117	27918117	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27918117G>C	uc003xgm.3	-	8	1066	c.923C>G	c.(922-924)ACC>AGC	p.T308S		NM_001010906	NP_001010906	Q68CJ6	SLIP_HUMAN	speckled-like pattern in the germinal center	308						nucleus	GTP binding|GTPase activity			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)		CTTGTCAATGGTCTGCAAAAC	0.532											OREG0018675	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	10	---	---	---	---	PASS
NRG1	3084	broad.mit.edu	37	8	32505746	32505746	+	Intron	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32505746G>A	uc003xiv.2	+						NRG1_uc003xip.2_Intron|NRG1_uc003xir.2_Intron|NRG1_uc010lvl.2_Intron|NRG1_uc010lvm.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc003xix.2_Intron|NRG1_uc003xiy.2_Silent_p.A170A|NRG1_uc010lvt.2_Silent_p.A170A	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		AACCATCAGCGGCACCGACAC	0.522													24	187	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52321974	52321974	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52321974A>T	uc003xqu.3	-	17	2311	c.2210T>A	c.(2209-2211)CTG>CAG	p.L737Q	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	737					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GGGCTGCTGCAGGTTGTTGCA	0.687													6	57	---	---	---	---	PASS
RGS20	8601	broad.mit.edu	37	8	54852126	54852126	+	Intron	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54852126C>A	uc003xrp.2	+						RGS20_uc003xrq.2_Intron|RGS20_uc010lye.2_Intron|RGS20_uc010lyf.2_Intron|RGS20_uc003xrs.2_Intron|RGS20_uc003xrt.2_Intron	NM_170587	NP_733466	O76081	RGS20_HUMAN	regulator of G-protein signaling 20 isoform a						negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|nucleus|plasma membrane	GTPase activator activity|protein binding|signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			TGTTCCTCTCCCTCTTGCAGC	0.622													5	18	---	---	---	---	PASS
TRIM55	84675	broad.mit.edu	37	8	67040550	67040550	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67040550G>A	uc003xvv.2	+	2	406	c.180G>A	c.(178-180)CCG>CCA	p.P60P	TRIM55_uc003xvu.2_Silent_p.P60P|TRIM55_uc003xvw.2_Silent_p.P60P|TRIM55_uc003xvx.2_Silent_p.P60P	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1	60	RING-type.					cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			CCTCTAACCCGTATTTGCCCA	0.473													79	367	---	---	---	---	PASS
C8orf45	157777	broad.mit.edu	37	8	67791064	67791064	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67791064G>C	uc003xwz.3	+	7	790	c.619G>C	c.(619-621)GAA>CAA	p.E207Q	C8orf45_uc003xwv.2_Missense_Mutation_p.E207Q|C8orf45_uc011lev.1_Missense_Mutation_p.E207Q|C8orf45_uc011lew.1_Missense_Mutation_p.E138Q|C8orf45_uc011lex.1_5'UTR|C8orf45_uc003xwy.3_Missense_Mutation_p.E207Q	NM_173518	NP_775789	Q4G0Z9	CH045_HUMAN	minichromosome maintenance complex	207					DNA replication		ATP binding|DNA binding			ovary(1)	1	Breast(64;0.186)		Epithelial(68;0.00384)|OV - Ovarian serous cystadenocarcinoma(28;0.00913)|all cancers(69;0.0175)|BRCA - Breast invasive adenocarcinoma(89;0.206)			ACAAATAGTTGAAATAATTGC	0.269													10	186	---	---	---	---	PASS
XKR9	389668	broad.mit.edu	37	8	71646107	71646107	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71646107G>C	uc003xyq.2	+	5	1104	c.570G>C	c.(568-570)TTG>TTC	p.L190F	XKR9_uc010lze.2_Missense_Mutation_p.L190F|XKR9_uc010lzd.2_Missense_Mutation_p.L58F	NM_001011720	NP_001011720	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related	190						integral to membrane				ovary(1)|skin(1)	2	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)			GAAAATCCTTGCCTGACAAAA	0.338													30	177	---	---	---	---	PASS
EYA1	2138	broad.mit.edu	37	8	72128977	72128977	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72128977C>G	uc003xys.3	-	13	1597	c.1310G>C	c.(1309-1311)CGC>CCC	p.R437P	EYA1_uc003xyr.3_Missense_Mutation_p.R402P|EYA1_uc003xyt.3_Missense_Mutation_p.R404P|EYA1_uc010lzf.2_Missense_Mutation_p.R364P|EYA1_uc003xyu.2_Missense_Mutation_p.R437P|EYA1_uc011lfe.1_Missense_Mutation_p.R431P|EYA1_uc003xyv.2_Missense_Mutation_p.R315P	NM_172058	NP_742055	Q99502	EYA1_HUMAN	eyes absent 1 isoform b	437					double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			CCGTCTGTAGCGGAAGGCCAA	0.468													85	371	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77617652	77617652	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77617652C>T	uc003yav.2	+	2	1716	c.1329C>T	c.(1327-1329)AAC>AAT	p.N443N	ZFHX4_uc003yat.1_Silent_p.N443N|ZFHX4_uc003yau.1_Silent_p.N443N|ZFHX4_uc003yaw.1_Silent_p.N443N	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	443						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ACCAAGAGAACAACTGTGAAA	0.483										HNSCC(33;0.089)			10	65	---	---	---	---	PASS
CDH17	1015	broad.mit.edu	37	8	95178149	95178149	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95178149G>T	uc003ygh.2	-	10	1247	c.1122C>A	c.(1120-1122)AAC>AAA	p.N374K	CDH17_uc011lgo.1_Missense_Mutation_p.N160K|CDH17_uc011lgp.1_Missense_Mutation_p.N374K	NM_004063	NP_004054	Q12864	CAD17_HUMAN	cadherin 17 precursor	374	Extracellular (Potential).|Cadherin 4.					integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TTAGAAAACTGTTGGCAGTAT	0.438													21	169	---	---	---	---	PASS
KCNS2	3788	broad.mit.edu	37	8	99440455	99440455	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99440455A>G	uc003yin.2	+	2	598	c.248A>G	c.(247-249)CAT>CGT	p.H83R		NM_020697	NP_065748	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel,	83	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			TACGTGCTGCATTTCTATCAC	0.557													37	331	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	101092427	101092427	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101092427C>A	uc003yjb.1	-	4	469	c.274G>T	c.(274-276)GTT>TTT	p.V92F	RGS22_uc003yja.1_5'UTR|RGS22_uc003yjc.1_Missense_Mutation_p.V92F|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	92					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			ACAGGTTTAACCTCATTCTTT	0.338													44	415	---	---	---	---	PASS
ANKRD46	157567	broad.mit.edu	37	8	101541821	101541821	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101541821C>T	uc003yjm.2	-	3	445	c.241G>A	c.(241-243)GCT>ACT	p.A81T	ANKRD46_uc003yjn.1_Missense_Mutation_p.A81T|ANKRD46_uc003yjo.1_Missense_Mutation_p.A81T|ANKRD46_uc003yjp.1_Missense_Mutation_p.A81T	NM_198401	NP_940683	Q86W74	ANR46_HUMAN	ankyrin repeat domain 46	81	ANK 3.					integral to membrane					0	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)			AGGTGAAGAGCTGTGTTTCCT	0.433													22	240	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103291045	103291045	+	Intron	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103291045C>G	uc003ykr.1	-						UBR5_uc003yks.1_Intron	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin						cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			AAAACTTTTACTGTCTTACCT	0.338													53	579	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104898440	104898440	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104898440T>C	uc003yls.2	+	2	1188	c.947T>C	c.(946-948)GTA>GCA	p.V316A	RIMS2_uc003ylp.2_Missense_Mutation_p.V538A|RIMS2_uc003ylw.2_Missense_Mutation_p.V346A|RIMS2_uc003ylq.2_Missense_Mutation_p.V346A|RIMS2_uc003ylr.2_Missense_Mutation_p.V346A	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	569					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGTGAGAGTGTAAGTGAAAAA	0.348										HNSCC(12;0.0054)			14	158	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106815488	106815488	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106815488C>A	uc003ymd.2	+	8	3201	c.3178C>A	c.(3178-3180)CAA>AAA	p.Q1060K	ZFPM2_uc011lhs.1_Missense_Mutation_p.Q791K	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	1060					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CAACCCACAGCAAGAGAACAT	0.478													39	72	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110451189	110451189	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110451189T>C	uc003yne.2	+	32	3928	c.3824T>C	c.(3823-3825)GTG>GCG	p.V1275A		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1275	Extracellular (Potential).|IPT/TIG 6.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AACATGGCGGTGTATGTTGGA	0.333										HNSCC(38;0.096)			18	186	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110539082	110539082	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110539082T>C	uc003yne.2	+	77	12658	c.12554T>C	c.(12553-12555)CTG>CCG	p.L4185P		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	4185	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTCAGCCTGCTGGCAGAGTCT	0.308										HNSCC(38;0.096)			4	20	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113299427	113299427	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113299427G>T	uc003ynu.2	-	58	9356	c.9197C>A	c.(9196-9198)TCT>TAT	p.S3066Y	CSMD3_uc003yns.2_Missense_Mutation_p.S2268Y|CSMD3_uc003ynt.2_Missense_Mutation_p.S3026Y|CSMD3_uc011lhx.1_Missense_Mutation_p.S2897Y	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3066	Extracellular (Potential).|Sushi 22.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TTCCTGTCTAGAGCCATGGCC	0.413										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			30	273	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113314025	113314025	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113314025G>T	uc003ynu.2	-	53	8596	c.8437C>A	c.(8437-8439)CTA>ATA	p.L2813I	CSMD3_uc003yns.2_Missense_Mutation_p.L2015I|CSMD3_uc003ynt.2_Missense_Mutation_p.L2773I|CSMD3_uc011lhx.1_Missense_Mutation_p.L2644I	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2813	Extracellular (Potential).|Sushi 17.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TCTGTACCTAGGCATCTGGTT	0.418										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			12	176	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113347715	113347715	+	Intron	SNP	G	T	T	rs149924431	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113347715G>T	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron|CSMD3_uc003ynw.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TATGAGACAAGGATTGGGAAA	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			20	128	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113697630	113697630	+	Intron	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113697630C>G	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GAAACAGAAACTTACTGTTGT	0.338										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			17	189	---	---	---	---	PASS
SLC30A8	169026	broad.mit.edu	37	8	118165221	118165221	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118165221G>A	uc003yoh.2	+	3	540	c.310G>A	c.(310-312)GCT>ACT	p.A104T	SLC30A8_uc010mcz.2_Missense_Mutation_p.A55T|SLC30A8_uc011lia.1_Missense_Mutation_p.A55T|SLC30A8_uc003yog.2_Missense_Mutation_p.A55T	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8	104	Helical; (Potential).				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TGTCACAGATGCTGCCCACCT	0.493													22	291	---	---	---	---	PASS
MAL2	114569	broad.mit.edu	37	8	120233905	120233905	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120233905G>T	uc003yop.2	+	3	313	c.211G>T	c.(211-213)GTG>TTG	p.V71L		NM_052886	NP_443118	Q969L2	MAL2_HUMAN	MAL2 proteolipid protein	71	MARVEL.|Helical; (Potential).					apical plasma membrane|endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding				0	all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			GGTCATGTTTGTGTCCGTGAC	0.478													98	719	---	---	---	---	PASS
ANXA13	312	broad.mit.edu	37	8	124714890	124714890	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124714890A>G	uc003yqu.2	-	3	251	c.178T>C	c.(178-180)TAC>CAC	p.Y60H	ANXA13_uc003yqt.2_Missense_Mutation_p.Y101H	NM_004306	NP_004297	P27216	ANX13_HUMAN	annexin A13 isoform a	60	Annexin 1.				cell differentiation	plasma membrane	calcium ion binding|calcium-dependent phospholipid binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			ACCTTGCCGTACGTTGCCTTG	0.512													20	321	---	---	---	---	PASS
ST3GAL1	6482	broad.mit.edu	37	8	134488264	134488264	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134488264C>T	uc003yuk.2	-	5	833	c.4G>A	c.(4-6)GTG>ATG	p.V2M	ST3GAL1_uc003yum.2_Missense_Mutation_p.V2M	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	2	Cytoplasmic (Potential).				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			CGCAGGGTCACCATCTTCGCA	0.547													19	154	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143545865	143545865	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143545865C>A	uc003ywm.2	+	1	489	c.306C>A	c.(304-306)TAC>TAA	p.Y102*		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	102	Extracellular (Potential).				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TGCGCACCTACCAGTTCGACT	0.701													12	4	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144991188	144991188	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144991188C>A	uc003zaf.1	-	32	13382	c.13212G>T	c.(13210-13212)CTG>CTT	p.L4404L	PLEC_uc003zab.1_Silent_p.L4267L|PLEC_uc003zac.1_Silent_p.L4271L|PLEC_uc003zad.2_Silent_p.L4267L|PLEC_uc003zae.1_Silent_p.L4235L|PLEC_uc003zag.1_Silent_p.L4245L|PLEC_uc003zah.2_Silent_p.L4253L|PLEC_uc003zaj.2_Silent_p.L4294L	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	4404	Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						ACCAGGAGGCCAGCTGGGTCC	0.672													23	84	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144995483	144995483	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144995483C>T	uc003zaf.1	-	32	9087	c.8917G>A	c.(8917-8919)GAC>AAC	p.D2973N	PLEC_uc003zab.1_Missense_Mutation_p.D2836N|PLEC_uc003zac.1_Missense_Mutation_p.D2840N|PLEC_uc003zad.2_Missense_Mutation_p.D2836N|PLEC_uc003zae.1_Missense_Mutation_p.D2804N|PLEC_uc003zag.1_Missense_Mutation_p.D2814N|PLEC_uc003zah.2_Missense_Mutation_p.D2822N|PLEC_uc003zaj.2_Missense_Mutation_p.D2863N	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2973	Plectin 4.|Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						ATCTCCTCGTCGAAGTAGCCG	0.667													15	134	---	---	---	---	PASS
SPATC1	375686	broad.mit.edu	37	8	145101592	145101592	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145101592A>G	uc011lkw.1	+	5	1613	c.1511A>G	c.(1510-1512)TAT>TGT	p.Y504C	SPATC1_uc011lkx.1_3'UTR	NM_198572	NP_940974	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	504										ovary(1)|central_nervous_system(1)	2	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ACACAGCGCTATGTGAGCGTC	0.622													24	96	---	---	---	---	PASS
KCNV2	169522	broad.mit.edu	37	9	2718879	2718879	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2718879C>A	uc003zho.1	+	1	1354	c.1140C>A	c.(1138-1140)CGC>CGA	p.R380R		NM_133497	NP_598004	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	380	Helical; Voltage-sensor; Name=Segment S4; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(50;0.0257)		GCGTCATGCGCCTCATGCGCA	0.672													28	41	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14746970	14746970	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14746970A>G	uc003zlm.2	-	34	6679	c.6089T>C	c.(6088-6090)CTG>CCG	p.L2030P	FREM1_uc010mic.2_RNA|FREM1_uc003zlk.2_RNA|FREM1_uc003zll.2_Missense_Mutation_p.L566P	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	2030					cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		GCACTGATACAGCTTCTGGAT	0.493													6	34	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14846058	14846058	+	Silent	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14846058G>T	uc003zlm.2	-	8	1883	c.1293C>A	c.(1291-1293)GCC>GCA	p.A431A	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	431	CSPG 2.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		CCCAAGTGATGGCTCGAGACT	0.418													5	14	---	---	---	---	PASS
TEK	7010	broad.mit.edu	37	9	27213551	27213551	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27213551T>A	uc003zqi.3	+	18	3389	c.2947T>A	c.(2947-2949)TTT>ATT	p.F983I	TEK_uc011lno.1_Missense_Mutation_p.F940I|TEK_uc011lnp.1_Missense_Mutation_p.F835I	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor	983	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		AATAGCAGATTTTGGATTGTC	0.413													20	881	---	---	---	---	PASS
C9orf131	138724	broad.mit.edu	37	9	35043619	35043619	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35043619G>C	uc003zvw.2	+	2	1022	c.993G>C	c.(991-993)AAG>AAC	p.K331N	C9orf131_uc003zvu.2_Missense_Mutation_p.K283N|C9orf131_uc003zvv.2_Missense_Mutation_p.K258N|C9orf131_uc003zvx.2_Missense_Mutation_p.K296N	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	331											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			GACACAAAAAGATGCCCCAAG	0.527													91	730	---	---	---	---	PASS
OR13J1	392309	broad.mit.edu	37	9	35870133	35870133	+	Missense_Mutation	SNP	C	T	T	rs140653664	byFrequency	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35870133C>T	uc011lph.1	-	1	266	c.266G>A	c.(265-267)CGG>CAG	p.R89Q		NM_001004487	NP_001004487	Q8NGT2	O13J1_HUMAN	olfactory receptor, family 13, subfamily J,	89	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_epithelial(49;0.169)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)			GATGGTCTTCCGGGATGACAG	0.597													25	51	---	---	---	---	PASS
GRHPR	9380	broad.mit.edu	37	9	37436733	37436733	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37436733T>A	uc003zzu.1	+	9	982	c.941T>A	c.(940-942)CTG>CAG	p.L314Q	GRHPR_uc003zzt.1_Missense_Mutation_p.L234Q|GRHPR_uc003zzw.1_Missense_Mutation_p.L171Q	NM_012203	NP_036335	Q9UBQ7	GRHPR_HUMAN	glyoxylate reductase/hydroxypyruvate reductase	314					cellular nitrogen compound metabolic process|excretion|glyoxylate metabolic process	peroxisomal matrix	glycerate dehydrogenase activity|glyoxylate reductase (NADP) activity|hydroxypyruvate reductase activity|NAD binding|protein binding				0				GBM - Glioblastoma multiforme(29;0.00687)		AACAACTTGCTGGCTGGCCTG	0.557													64	134	---	---	---	---	PASS
TMC1	117531	broad.mit.edu	37	9	75407227	75407227	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75407227G>A	uc004aiz.1	+	17	2065	c.1525G>A	c.(1525-1527)GAT>AAT	p.D509N	TMC1_uc010moz.1_Missense_Mutation_p.D467N|TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_Missense_Mutation_p.D363N|TMC1_uc010mpa.1_Missense_Mutation_p.D363N	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	509	Cytoplasmic (Potential).				sensory perception of sound	integral to membrane				ovary(1)	1						TCACCCTGCAGATGTACCTCG	0.428													95	198	---	---	---	---	PASS
HEMGN	55363	broad.mit.edu	37	9	100693291	100693291	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100693291G>C	uc004axy.2	-	3	494	c.386C>G	c.(385-387)CCT>CGT	p.P129R	HEMGN_uc004axz.2_Missense_Mutation_p.P129R	NM_197978	NP_932095	Q9BXL5	HEMGN_HUMAN	hemogen	129					cell differentiation|multicellular organismal development					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				GTGTTCCTCAGGCACAACTTT	0.393													59	165	---	---	---	---	PASS
SMC2	10592	broad.mit.edu	37	9	106889588	106889588	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106889588G>A	uc004bbv.2	+	20	2905	c.2617G>A	c.(2617-2619)GAA>AAA	p.E873K	SMC2_uc004bbw.2_Missense_Mutation_p.E873K|SMC2_uc011lvl.1_Missense_Mutation_p.E873K|SMC2_uc004bbx.2_Missense_Mutation_p.E873K|SMC2_uc004bby.2_RNA	NM_001042551	NP_001036016	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	873	Potential.				cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity			ovary(4)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|breast(1)	9						TAAAGCTCAAGAAGAGGTGAC	0.318													24	78	---	---	---	---	PASS
OR13F1	138805	broad.mit.edu	37	9	107267220	107267220	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107267220T>A	uc011lvm.1	+	1	677	c.677T>A	c.(676-678)CTG>CAG	p.L226Q		NM_001004485	NP_001004485	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F,	226	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)|skin(1)	3						GCCAGTATCCTGAGAATCAGC	0.478													71	220	---	---	---	---	PASS
CTNNAL1	8727	broad.mit.edu	37	9	111732694	111732694	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111732694C>A	uc004bdo.1	-	10	1470	c.1428G>T	c.(1426-1428)GTG>GTT	p.V476V	CTNNAL1_uc010mts.1_Intron|CTNNAL1_uc010mtt.1_Silent_p.V476V|CTNNAL1_uc004bdp.1_Silent_p.V476V|CTNNAL1_uc004bdq.1_5'UTR	NM_003798	NP_003789	Q9UBT7	CTNL1_HUMAN	catenin, alpha-like 1	476					cell adhesion|Rho protein signal transduction	actin cytoskeleton|cytosol|plasma membrane	cadherin binding|structural molecule activity			ovary(1)	1				STAD - Stomach adenocarcinoma(157;0.0768)		GTTGGCCAGTCACCTGAAATG	0.403													16	35	---	---	---	---	PASS
AKNA	80709	broad.mit.edu	37	9	117120444	117120444	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117120444C>A	uc004biq.3	-	11	2631	c.2496G>T	c.(2494-2496)GAG>GAT	p.E832D	AKNA_uc004bin.3_Missense_Mutation_p.E79D|AKNA_uc004bio.3_Missense_Mutation_p.E292D|AKNA_uc004bip.3_Missense_Mutation_p.E751D|AKNA_uc004bir.3_Missense_Mutation_p.E832D|AKNA_uc004bis.3_Missense_Mutation_p.E832D|AKNA_uc010mve.2_Missense_Mutation_p.E713D	NM_030767	NP_110394	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	832					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(2)	6						TCTCCGTGGCCTCCCTGGCAT	0.587													18	41	---	---	---	---	PASS
OR1L8	138881	broad.mit.edu	37	9	125330162	125330162	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125330162C>A	uc004bmp.1	-	1	595	c.595G>T	c.(595-597)GTG>TTG	p.V199L		NM_001004454	NP_001004454	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L,	199	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3						GTCATCTGCACAATTTCATTG	0.428													18	22	---	---	---	---	PASS
DENND1A	57706	broad.mit.edu	37	9	126392755	126392755	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126392755G>A	uc004bnz.1	-	10	852	c.619C>T	c.(619-621)CTG>TTG	p.L207L	DENND1A_uc011lzl.1_Silent_p.L24L|DENND1A_uc004bny.1_Silent_p.L24L|DENND1A_uc011lzm.1_Silent_p.L175L|DENND1A_uc004boa.1_Silent_p.L207L|DENND1A_uc004bob.1_Silent_p.L177L|DENND1A_uc004boc.2_Silent_p.L175L	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1	207	DENN.					cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						CAGGCAGTCAGCTGGAACAGA	0.507													4	1	---	---	---	---	PASS
DENND1A	57706	broad.mit.edu	37	9	126520021	126520021	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126520021C>T	uc004bnz.1	-	5	496	c.263G>A	c.(262-264)CGC>CAC	p.R88H	DENND1A_uc004bny.1_5'UTR|DENND1A_uc011lzm.1_Missense_Mutation_p.R56H|DENND1A_uc004boa.1_Missense_Mutation_p.R88H|DENND1A_uc004bob.1_Missense_Mutation_p.R58H|DENND1A_uc004boc.2_Missense_Mutation_p.R56H	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1	88	UDENN.					cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						TGAAGATAAGCGGCAGAACCC	0.493													24	60	---	---	---	---	PASS
LHX2	9355	broad.mit.edu	37	9	126794783	126794783	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126794783G>A	uc004boe.1	+	5	1757	c.1018G>A	c.(1018-1020)GCG>ACG	p.A340T	LHX2_uc010mwi.1_Missense_Mutation_p.A348T	NM_004789	NP_004780	P50458	LHX2_HUMAN	LIM homeobox protein 2	340						nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GACAGACGCGGCGCTGCAGAC	0.667													25	32	---	---	---	---	PASS
ST6GALNAC4	27090	broad.mit.edu	37	9	130672250	130672250	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130672250C>A	uc004bss.2	-	5	975	c.699G>T	c.(697-699)ATG>ATT	p.M233I	ST6GALNAC4_uc004bst.2_Missense_Mutation_p.M149I	NM_175039	NP_778204	Q9H4F1	SIA7D_HUMAN	sialyltransferase 7D isoform a	233	Lumenal (Potential).				glycolipid metabolic process|protein glycosylation	integral to Golgi membrane|nucleus|soluble fraction	(alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl-galactosaminide 6-alpha-sialyltransferase activity				0						TGTCGCTGACCATCCCATAGA	0.652													22	13	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135204637	135204637	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135204637T>A	uc004cbk.2	-	10	2531	c.2348A>T	c.(2347-2349)CAG>CTG	p.Q783L	SETX_uc004cbj.2_Missense_Mutation_p.Q402L|SETX_uc010mzt.2_Missense_Mutation_p.Q402L	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	783					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TTCATCTTTCTGTACCTTAGT	0.338													37	67	---	---	---	---	PASS
C9orf98	158067	broad.mit.edu	37	9	135739175	135739175	+	Intron	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135739175G>A	uc004cbu.1	-						C9orf98_uc010mzx.1_Intron|C9orf98_uc004cbv.1_Intron	NM_152572	NP_689785	Q96MA6	KAD8_HUMAN	putative adenylate kinase-like protein C9orf98							cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)		CCTGAAGAAAGGAAAGAAGAA	0.433													7	20	---	---	---	---	PASS
KCNT1	57582	broad.mit.edu	37	9	138645808	138645808	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138645808T>C	uc011mdq.1	+	5	534	c.460T>C	c.(460-462)TCC>CCC	p.S154P	KCNT1_uc011mdr.1_5'UTR|KCNT1_uc010nbf.2_Missense_Mutation_p.S106P|KCNT1_uc004cgo.1_5'UTR	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	154						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GCAGAACTACTCCTTCAATGA	0.632													20	36	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16916418	16916418	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16916418C>T	uc001ioo.2	-	58	9243	c.9191G>A	c.(9190-9192)TGT>TAT	p.C3064Y	CUBN_uc009xjq.1_RNA|CUBN_uc009xjr.1_Missense_Mutation_p.C420Y	NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3064	CUB 23.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGTATACAGACAGTGCATATC	0.408													92	94	---	---	---	---	PASS
SLC39A12	221074	broad.mit.edu	37	10	18289742	18289742	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18289742C>A	uc001ipo.2	+	11	2020	c.1747C>A	c.(1747-1749)CCA>ACA	p.P583T	SLC39A12_uc001ipn.2_Missense_Mutation_p.P546T|SLC39A12_uc001ipp.2_Missense_Mutation_p.P582T|SLC39A12_uc010qck.1_Missense_Mutation_p.P449T	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	583	XEXPHE-motif.|Cytoplasmic (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						TCATGAAATCCCACATGAAAT	0.413													20	54	---	---	---	---	PASS
SPAG6	9576	broad.mit.edu	37	10	22634681	22634681	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22634681C>G	uc001iri.2	+	2	197	c.55C>G	c.(55-57)CAG>GAG	p.Q19E	SPAG6_uc001irj.2_Missense_Mutation_p.Q19E|SPAG6_uc010qct.1_5'UTR|SPAG6_uc009xkh.2_5'UTR	NM_012443	NP_036575	O75602	SPAG6_HUMAN	sperm associated antigen 6 isoform 1	19					cell projection organization|spermatid development	axoneme|cilium|cytoplasm|flagellum|microtubule	binding			breast(1)	1						GGCCAGGACCCAGTTCGTGCA	0.672													6	10	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26359100	26359100	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26359100G>C	uc001isn.2	+	13	1591	c.1231G>C	c.(1231-1233)GCT>CCT	p.A411P	MYO3A_uc009xko.1_Missense_Mutation_p.A411P|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Missense_Mutation_p.A411P	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	411	Myosin head-like.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						TTTTGCAATGGCTGACTTAGG	0.328													47	46	---	---	---	---	PASS
PTCHD3	374308	broad.mit.edu	37	10	27702174	27702174	+	Missense_Mutation	SNP	C	A	A	rs143991061	byFrequency	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27702174C>A	uc001itu.2	-	1	1124	c.1006G>T	c.(1006-1008)GAC>TAC	p.D336Y		NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	336					spermatid development	integral to membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|skin(1)	4						CTCTGCACGTCGTACTCAGGG	0.527													71	216	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28233220	28233220	+	Silent	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28233220A>G	uc009xky.2	-	12	1772	c.1674T>C	c.(1672-1674)ACT>ACC	p.T558T	ARMC4_uc010qds.1_Silent_p.T83T|ARMC4_uc010qdt.1_Silent_p.T250T|ARMC4_uc001itz.2_Silent_p.T558T|ARMC4_uc010qdu.1_Silent_p.T250T	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	558	ARM 2.						binding			ovary(4)|skin(2)	6						CATTCGCGATAGTCTCGGCTG	0.468													13	34	---	---	---	---	PASS
ARHGAP22	58504	broad.mit.edu	37	10	49791061	49791061	+	Silent	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49791061G>C	uc001jgt.2	-	2	468	c.171C>G	c.(169-171)CGC>CGG	p.R57R	ARHGAP22_uc001jgu.2_Silent_p.R57R|ARHGAP22_uc010qgl.1_Silent_p.R57R|ARHGAP22_uc010qgm.1_Silent_p.R63R|ARHGAP22_uc001jgv.2_5'UTR	NM_021226	NP_067049	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 2	57	PH.				angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity			ovary(1)	1						GCACAAACCAGCGCTGCTGCC	0.607													48	151	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50835662	50835662	+	Silent	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50835662C>G	uc001jhz.2	+	7	1095	c.942C>G	c.(940-942)GTC>GTG	p.V314V	CHAT_uc001jhv.1_Silent_p.V196V|CHAT_uc001jhx.1_Silent_p.V196V|CHAT_uc001jhy.1_Silent_p.V196V|CHAT_uc001jia.2_Silent_p.V196V|CHAT_uc010qgs.1_Silent_p.V196V	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	314					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	AGTTCTTTGTCTTGGATGTTG	0.512													56	147	---	---	---	---	PASS
RHOBTB1	9886	broad.mit.edu	37	10	62648482	62648482	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62648482T>A	uc001jli.2	-	7	1382	c.944A>T	c.(943-945)AAG>ATG	p.K315M	RHOBTB1_uc001jlh.2_Missense_Mutation_p.K315M|RHOBTB1_uc001jlj.2_Missense_Mutation_p.K315M|RHOBTB1_uc001jlk.2_Missense_Mutation_p.K315M|RHOBTB1_uc009xpe.1_Missense_Mutation_p.K253M|RHOBTB1_uc001jll.2_Missense_Mutation_p.K65M	NM_014836	NP_055651	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	315	BTB 1.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding			upper_aerodigestive_tract(1)	1	Prostate(12;0.0112)					TCTGCTCTGCTTCTCTTTCTC	0.493													35	143	---	---	---	---	PASS
POLR3A	11128	broad.mit.edu	37	10	79769439	79769439	+	Intron	SNP	G	A	A	rs115020338	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79769439G>A	uc001jzn.2	-							NM_007055	NP_008986	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide						innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			ACAGGCTGAGGGGGGGAGGAA	0.597													24	209	---	---	---	---	PASS
ZCCHC24	219654	broad.mit.edu	37	10	81154191	81154191	+	Silent	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81154191G>C	uc001kak.2	-	3	640	c.453C>G	c.(451-453)CGC>CGG	p.R151R	ZCCHC24_uc010qlr.1_Missense_Mutation_p.P92A|ZCCHC24_uc009xrw.2_RNA	NM_153367	NP_699198	Q8N2G6	ZCH24_HUMAN	zinc finger, CCHC domain containing 24	151							nucleic acid binding|zinc ion binding			breast(1)	1						CGCCTTTGGGGCGTGCCTACA	0.582													15	100	---	---	---	---	PASS
WAPAL	23063	broad.mit.edu	37	10	88227065	88227065	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88227065T>C	uc001kdo.2	-	9	2783	c.2341A>G	c.(2341-2343)AAC>GAC	p.N781D	WAPAL_uc009xsv.2_Missense_Mutation_p.N95D|WAPAL_uc001kdn.2_Missense_Mutation_p.N818D|WAPAL_uc009xsw.2_Missense_Mutation_p.N775D	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	781	Potential.|WAPL.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1						AGATGCTTGTTGTGTACAGTT	0.358													32	70	---	---	---	---	PASS
PI4K2A	55361	broad.mit.edu	37	10	99361612	99361612	+	Splice_Site	SNP	A	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99361612A>C	uc010qoy.1	+	2	571	c.212_splice	c.e2-2	p.G71_splice	DHDPSL_uc001kny.2_Splice_Site_p.G234_splice|DHDPSL_uc001knz.2_Splice_Site_p.G71_splice	NM_018425	NP_060895	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		TACTTCGTGCAGGAGCTGTGG	0.627													5	23	---	---	---	---	PASS
HPS1	3257	broad.mit.edu	37	10	100195396	100195396	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100195396T>A	uc010qpf.1	-	4	497	c.251A>T	c.(250-252)CAC>CTC	p.H84L	HPS1_uc001kpi.1_Missense_Mutation_p.H84L|HPS1_uc001kpj.1_Missense_Mutation_p.H24L|HPS1_uc001kpk.1_Missense_Mutation_p.H84L|HPS1_uc009xwb.2_RNA|HPS1_uc010qph.1_Missense_Mutation_p.H84L|HPS1_uc001kpl.2_Missense_Mutation_p.H84L	NM_000195	NP_000186	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1 protein isoform a	84					lysosome organization|response to stimulus|visual perception	cytoplasmic membrane-bounded vesicle|integral to plasma membrane|lysosome|membrane fraction|soluble fraction	protein dimerization activity			skin(1)	1		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		ACTCACCAGGTGAAGGACATA	0.522									Hermansky-Pudlak_syndrome				39	95	---	---	---	---	PASS
DNMBP	23268	broad.mit.edu	37	10	101715737	101715737	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101715737C>A	uc001kqj.2	-	4	1586	c.1494G>T	c.(1492-1494)CAG>CAT	p.Q498H	NCRNA00093_uc001kqk.1_Intron	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	498					intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		GGTTGTGGAGCTGAGGACTTG	0.488													61	116	---	---	---	---	PASS
MGEA5	10724	broad.mit.edu	37	10	103559213	103559213	+	Splice_Site	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103559213C>T	uc001ktv.2	-	9	1639	c.1196_splice	c.e9-1	p.S399_splice	MGEA5_uc001ktu.2_Splice_Site|MGEA5_uc010qqe.1_Splice_Site_p.S346_splice|MGEA5_uc009xws.2_Splice_Site_p.S346_splice|MGEA5_uc001ktw.2_Splice_Site_p.S399_splice|MGEA5_uc009xwt.2_Intron	NM_012215	NP_036347	O60502	NCOAT_HUMAN	meningioma expressed antigen 5 (hyaluronidase)						glycoprotein catabolic process	cytoplasm|nucleus	histone acetyltransferase activity|hyalurononglucosaminidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		ACTTGCCTACCTACAAAAATA	0.348													39	69	---	---	---	---	PASS
PPRC1	23082	broad.mit.edu	37	10	103909051	103909051	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103909051G>T	uc001kum.2	+	13	4895	c.4856G>T	c.(4855-4857)CGA>CTA	p.R1619L	PPRC1_uc001kun.2_Missense_Mutation_p.R1497L|PPRC1_uc010qqj.1_Missense_Mutation_p.R1355L|PPRC1_uc009xxa.2_RNA|NOLC1_uc001kuo.2_5'Flank|NOLC1_uc001kup.2_5'Flank|NOLC1_uc001kuq.2_5'Flank|NOLC1_uc009xxb.1_5'Flank|NOLC1_uc001kur.2_5'Flank	NM_015062	NP_055877	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor	1619	RRM.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		TTTGGGGGCCGAAGGCAGTTC	0.552													17	43	---	---	---	---	PASS
ABLIM1	3983	broad.mit.edu	37	10	116331078	116331078	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116331078C>A	uc010qsg.1	-	4	750	c.651G>T	c.(649-651)CCG>CCT	p.P217P	ABLIM1_uc010qsh.1_Silent_p.P157P|ABLIM1_uc010qsi.1_Silent_p.P157P|ABLIM1_uc010qsk.1_Silent_p.P141P|ABLIM1_uc009xyp.2_Silent_p.P151P|ABLIM1_uc009xyo.2_Silent_p.P65P	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a	217					axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		TGGTTTCTTTCGGACTGGACG	0.552													3	43	---	---	---	---	PASS
C10orf46	143384	broad.mit.edu	37	10	120460919	120460919	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120460919T>C	uc001lds.1	-	5	1179	c.695A>G	c.(694-696)AAT>AGT	p.N232S	C10orf46_uc010qst.1_RNA	NM_153810	NP_722517	Q86Y37	CJ046_HUMAN	chromosome 10 open reading frame 46	232					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding				0		Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0131)		GTAAAACTTATTCTGAAAAAT	0.299													19	46	---	---	---	---	PASS
HTRA1	5654	broad.mit.edu	37	10	124271486	124271486	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124271486C>A	uc001lgj.2	+	8	1307	c.1179C>A	c.(1177-1179)AGC>AGA	p.S393R		NM_002775	NP_002766	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1 precursor	393	PDZ.				proteolysis|regulation of cell growth	extracellular space	insulin-like growth factor binding|serine-type endopeptidase activity				0		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				TCTGGAGCAGCAAAGCCAAAG	0.512													23	53	---	---	---	---	PASS
C10orf90	118611	broad.mit.edu	37	10	128153489	128153489	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128153489G>T	uc001ljq.2	-	4	1431	c.1310C>A	c.(1309-1311)GCT>GAT	p.A437D	C10orf90_uc001ljp.2_Intron|C10orf90_uc010qum.1_Missense_Mutation_p.A534D|C10orf90_uc009yao.2_3'UTR|C10orf90_uc001ljo.2_5'Flank	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611	437										ovary(1)|skin(1)	2		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		CACTGGAGGAGCAGACACAGT	0.453													34	61	---	---	---	---	PASS
TUBGCP2	10844	broad.mit.edu	37	10	135112994	135112994	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135112994C>A	uc001lmg.1	-	4	750	c.393G>T	c.(391-393)ATG>ATT	p.M131I	TUBGCP2_uc010qvc.1_Missense_Mutation_p.M131I|TUBGCP2_uc009ybk.1_Missense_Mutation_p.M131I|TUBGCP2_uc010qvd.1_Missense_Mutation_p.M1I|TUBGCP2_uc001lmh.1_RNA	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	131					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		CAAGCTCCTGCATGGAGATCT	0.597													29	28	---	---	---	---	PASS
FRG2B	441581	broad.mit.edu	37	10	135440163	135440163	+	Silent	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135440163G>T	uc010qvg.1	-	1	137	c.84C>A	c.(82-84)TCC>TCA	p.S28S		NM_001080998	NP_001074467	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	28						nucleus					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TTTCTGTAAAGGAGATCTGTT	0.488													9	241	---	---	---	---	PASS
RASSF7	8045	broad.mit.edu	37	11	562207	562207	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:562207A>G	uc001lqc.2	+	3	288	c.253A>G	c.(253-255)AGG>GGG	p.R85G	C11orf35_uc001lpx.2_5'Flank|RASSF7_uc001lqa.2_Missense_Mutation_p.R85G|RASSF7_uc001lqb.2_Missense_Mutation_p.R85G|RASSF7_uc001lqd.2_Missense_Mutation_p.R85G	NM_003475	NP_003466	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family	85	Ras-associating.				regulation of transcription, DNA-dependent|signal transduction	nucleus	DNA binding|protein binding			skin(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTTTGTCCTGAGGCGCACAGG	0.657													21	38	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1016849	1016849	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1016849C>A	uc001lsw.2	-	31	6003	c.5952G>T	c.(5950-5952)ATG>ATT	p.M1984I		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1984	Thr-rich.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ATGTTGCAGTCATAGGACCTG	0.582													17	670	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1268797	1268797	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1268797A>G	uc009ycr.1	+	50	12397	c.12271A>G	c.(12271-12273)ATA>GTA	p.I4091V	MUC5B_uc001ltb.2_Missense_Mutation_p.I3566V	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3563	7 X Cys-rich subdomain repeats.|Thr-rich.|HAT 2.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ATCGGCCCCCATAACCACGGT	0.687													3	48	---	---	---	---	PASS
TH	7054	broad.mit.edu	37	11	2189848	2189848	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2189848C>T	uc001lvq.2	-	4	472	c.453G>A	c.(451-453)AGG>AGA	p.R151R	TH_uc001lvp.2_Silent_p.R147R|TH_uc001lvr.2_Silent_p.R120R|TH_uc010qxj.1_Silent_p.R124R|TH_uc001lvs.2_Silent_p.R120R|TH_uc001lvt.2_Silent_p.R124R|TH_uc009ydh.1_5'Flank	NM_199292	NP_954986	P07101	TY3H_HUMAN	tyrosine hydroxylase isoform a	151					dopamine biosynthetic process from tyrosine|embryonic camera-type eye morphogenesis|epinephrine biosynthetic process|eye photoreceptor cell development|heart morphogenesis|hormone biosynthetic process|learning|locomotory behavior|memory|neurotransmitter biosynthetic process|neurotransmitter secretion|norepinephrine biosynthetic process|pigmentation|regulation of heart contraction|response to ethanol|response to hypoxia|synaptic transmission, dopaminergic|visual perception	cytosol|internal side of plasma membrane|melanosome membrane|nucleus|perikaryon|smooth endoplasmic reticulum	protein binding|tyrosine 3-monooxygenase activity				0		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	CAGCTCGCGGCCTCTGGGCGG	0.552													14	20	---	---	---	---	PASS
OR52K1	390036	broad.mit.edu	37	11	4510178	4510178	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4510178G>T	uc001lza.1	+	1	48	c.48G>T	c.(46-48)TTG>TTT	p.L16F		NM_001005171	NP_001005171	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K,	16	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		TCTTTTTGTTGGTAGGAATTC	0.463													96	147	---	---	---	---	PASS
OR56A1	120796	broad.mit.edu	37	11	6048656	6048656	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6048656C>G	uc010qzw.1	-	1	279	c.279G>C	c.(277-279)TGG>TGC	p.W93C		NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A,	93	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)	3		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TAAGATCATACCAGAAGATGG	0.562													41	90	---	---	---	---	PASS
WEE1	7465	broad.mit.edu	37	11	9608047	9608047	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9608047G>T	uc001mhs.2	+	9	1775	c.1522G>T	c.(1522-1524)GTA>TTA	p.V508L	WEE1_uc001mht.2_Missense_Mutation_p.V294L	NM_003390	NP_003381	P30291	WEE1_HUMAN	WEE1 tyrosine kinase isoform 1	508	Protein kinase.				blood coagulation|cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitosis|S phase of mitotic cell cycle	nucleoplasm	ATP binding|magnesium ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	5				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		CCTCACAGTGGTATGTGCTGC	0.393													81	101	---	---	---	---	PASS
SPON1	10418	broad.mit.edu	37	11	14157086	14157086	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14157086T>A	uc001mle.2	+	7	1335	c.797T>A	c.(796-798)GTG>GAG	p.V266E		NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein	266	Spondin.				cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		GGCTCACCCGTGAAAATGGAG	0.433													48	58	---	---	---	---	PASS
INSC	387755	broad.mit.edu	37	11	15199998	15199998	+	Intron	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15199998G>A	uc001mly.2	+						INSC_uc001mlz.2_Intron|INSC_uc001mma.2_Intron|INSC_uc010rcs.1_Intron|INSC_uc001mmb.2_Intron|INSC_uc001mmc.2_Intron	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a						cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						GTTCAGGTCAGTGCAGGCTGG	0.602													23	41	---	---	---	---	PASS
MRGPRX4	117196	broad.mit.edu	37	11	18194982	18194982	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18194982C>A	uc001mnv.1	+	1	599	c.179C>A	c.(178-180)GCT>GAT	p.A60D		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	60	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						CGCAGGAACGCTGTCTCCATC	0.547													70	73	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26463486	26463486	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26463486A>C	uc001mqt.3	+	2	213	c.68A>C	c.(67-69)GAG>GCG	p.E23A	ANO3_uc010rdr.1_Missense_Mutation_p.E7A	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	23	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						AGCAAGAGTGAGATAACAAAA	0.388													45	153	---	---	---	---	PASS
LMO2	4005	broad.mit.edu	37	11	33886140	33886140	+	Intron	SNP	G	A	A	rs34368207		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33886140G>A	uc001mve.2	-						LMO2_uc001mvc.2_Intron|LMO2_uc001mvd.2_Intron|LMO2_uc010rel.1_Intron|LMO2_uc010rem.1_Intron	NM_001142316	NP_001135788	P25791	RBTN2_HUMAN	LIM domain only 2 isoform 2						multicellular organismal development	nucleus	protein binding|zinc ion binding			lung(1)	1						GAGTGCCGGGGAGGGTACCTG	0.657			T	TRD@	T-ALL								12	16	---	---	---	---	PASS
EHF	26298	broad.mit.edu	37	11	34668094	34668094	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34668094A>T	uc001mvr.1	+	3	317	c.206A>T	c.(205-207)GAT>GTT	p.D69V	EHF_uc009yke.1_Missense_Mutation_p.D69V|EHF_uc009ykf.1_Missense_Mutation_p.D72V	NM_012153	NP_036285	Q9NZC4	EHF_HUMAN	ets homologous factor	69	PNT.				cell proliferation|epithelial cell differentiation|multicellular organismal development|positive regulation of transcription, DNA-dependent		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(20;0.117)	Epithelial(1;0.055)|all cancers(1;0.137)|STAD - Stomach adenocarcinoma(6;0.235)			AACCAGCTGGATGCCAATTGT	0.577													99	171	---	---	---	---	PASS
SYT13	57586	broad.mit.edu	37	11	45277321	45277321	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45277321A>C	uc001myq.2	-	2	431	c.305T>G	c.(304-306)CTG>CGG	p.L102R	SYT13_uc009yku.1_5'UTR	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	102	Cytoplasmic (Potential).					transport vesicle				ovary(1)	1						CGTAGACCTCAGTGAATAGTC	0.592													21	71	---	---	---	---	PASS
CRY2	1408	broad.mit.edu	37	11	45893667	45893667	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45893667C>G	uc010rgn.1	+	11	1752	c.1730C>G	c.(1729-1731)CCA>CGA	p.P577R	CRY2_uc009ykw.2_Missense_Mutation_p.P495R|CRY2_uc010rgo.1_Missense_Mutation_p.P299R	NM_021117	NP_066940	Q49AN0	CRY2_HUMAN	cryptochrome 2 (photolyase-like) isoform 1	556					DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	blue light photoreceptor activity|damaged DNA binding|DNA photolyase activity|nucleotide binding|protein binding|single-stranded DNA binding			central_nervous_system(1)	1						CCCAGTGGCCCAGCATCCCCC	0.597													21	65	---	---	---	---	PASS
LRP4	4038	broad.mit.edu	37	11	46897450	46897450	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46897450G>A	uc001ndn.3	-	26	3750	c.3604C>T	c.(3604-3606)CGC>TGC	p.R1202C		NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	1202	Extracellular (Potential).|LDL-receptor class B 13.				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		AGCACCGCGCGGTCTGAGCCA	0.537													32	39	---	---	---	---	PASS
AGBL2	79841	broad.mit.edu	37	11	47703571	47703571	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47703571C>A	uc001ngg.2	-	11	1965	c.1865G>T	c.(1864-1866)GGA>GTA	p.G622V	AGBL2_uc001ngf.2_RNA|AGBL2_uc010rhq.1_Missense_Mutation_p.G584V|AGBL2_uc001ngh.1_Missense_Mutation_p.G566V	NM_024783	NP_079059	Q5U5Z8	CBPC2_HUMAN	carboxypeptidase 2, cytosolic	622					proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2						GTTTAGGATTCCCATCCGCCA	0.418													14	71	---	---	---	---	PASS
NUP160	23279	broad.mit.edu	37	11	47825022	47825022	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47825022T>A	uc001ngm.2	-	22	2828	c.2743A>T	c.(2743-2745)AGG>TGG	p.R915W	NUP160_uc009ylw.2_RNA	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa	915					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						AGGTAACACCTTCCCAGCATA	0.373													76	119	---	---	---	---	PASS
OR4A15	81328	broad.mit.edu	37	11	55135929	55135929	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55135929T>G	uc010rif.1	+	1	570	c.570T>G	c.(568-570)TTT>TTG	p.F190L		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	190	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						AATTTCTCTTTATTTATCAGC	0.423													87	304	---	---	---	---	PASS
OR6Q1	219952	broad.mit.edu	37	11	57799186	57799186	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57799186C>A	uc010rjz.1	+	1	762	c.762C>A	c.(760-762)CTC>CTA	p.L254L	OR9Q1_uc001nmj.2_Intron	NM_001005186	NP_001005186	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q,	254	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(1)	1		Breast(21;0.0707)|all_epithelial(135;0.142)				TGGTGAGCCTCTTCTATGGCA	0.522													95	153	---	---	---	---	PASS
ZFP91	80829	broad.mit.edu	37	11	58377407	58377407	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58377407G>T	uc001nmx.3	+	3	643	c.475G>T	c.(475-477)GTT>TTT	p.V159F	ZFP91_uc001nmy.3_Missense_Mutation_p.V159F|ZFP91-CNTF_uc010rkm.1_RNA	NM_053023	NP_444251	Q96JP5	ZFP91_HUMAN	zinc finger protein 91	159					activation of NF-kappaB-inducing kinase activity|protein K63-linked ubiquitination	nucleus	nucleic acid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				TAGGACATCTGTTTCTCGCCA	0.498													68	86	---	---	---	---	PASS
MPEG1	219972	broad.mit.edu	37	11	58979095	58979095	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58979095C>G	uc001nnu.3	-	1	1400	c.1244G>C	c.(1243-1245)GGC>GCC	p.G415A		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	415	Extracellular (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				CGGGGAGTAGCCAGAGGGGCA	0.537													34	54	---	---	---	---	PASS
OSBP	5007	broad.mit.edu	37	11	59361714	59361714	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59361714C>A	uc001noc.1	-	8	1806	c.1326G>T	c.(1324-1326)GAG>GAT	p.E442D	OSBP_uc009ymr.1_RNA	NM_002556	NP_002547	P22059	OSBP1_HUMAN	oxysterol binding protein	442	Sterol binding (By similarity).				lipid transport	Golgi membrane	oxysterol binding			large_intestine(1)	1		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TGGACAAGGGCTCATTAAAGT	0.373													31	63	---	---	---	---	PASS
VWCE	220001	broad.mit.edu	37	11	61049333	61049333	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61049333G>A	uc001nra.2	-	7	991	c.712C>T	c.(712-714)CAC>TAC	p.H238Y	VWCE_uc001nrb.2_RNA	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	238	EGF-like 4; calcium-binding (Potential).					extracellular region	calcium ion binding			ovary(1)	1						ACGGTGTTGTGGCAGGAATGG	0.622													5	38	---	---	---	---	PASS
TUT1	64852	broad.mit.edu	37	11	62344195	62344195	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62344195C>A	uc001nto.2	-	8	1560	c.1522G>T	c.(1522-1524)GGC>TGC	p.G508C	EEF1G_uc001ntm.1_5'Flank|EEF1G_uc010rlw.1_5'Flank|TUT1_uc001ntp.1_5'UTR	NM_022830	NP_073741	Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6	470					mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2						CAGTCCCAGCCATCGACTTCC	0.527													37	72	---	---	---	---	PASS
EML3	256364	broad.mit.edu	37	11	62373335	62373335	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62373335C>T	uc001ntu.1	-	14	2082	c.1774G>A	c.(1774-1776)GTA>ATA	p.V592I	EML3_uc001ntr.1_Missense_Mutation_p.V564I|EML3_uc001nts.1_Missense_Mutation_p.V564I|EML3_uc001ntt.1_Missense_Mutation_p.V476I|EML3_uc010rly.1_Missense_Mutation_p.V592I	NM_153265	NP_694997	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like	592						cytoplasm|microtubule	protein binding			ovary(1)	1						ACCTGGATTACAGGGGAGAAG	0.612													26	82	---	---	---	---	PASS
INTS5	80789	broad.mit.edu	37	11	62415076	62415076	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62415076C>T	uc001nud.2	-	2	2529	c.2476G>A	c.(2476-2478)GGT>AGT	p.G826S	GANAB_uc001nua.2_5'Flank|GANAB_uc001nub.2_5'Flank|GANAB_uc001nuc.2_5'Flank|GANAB_uc010rma.1_5'Flank|GANAB_uc010rmb.1_5'Flank	NM_030628	NP_085131	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	826					snRNA processing	integral to membrane|integrator complex	protein binding			ovary(2)	2						AGCTCTGCACCAGCTGCATCG	0.652													49	102	---	---	---	---	PASS
SLC22A8	9376	broad.mit.edu	37	11	62760744	62760744	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62760744G>T	uc001nwo.2	-	11	1730	c.1594C>A	c.(1594-1596)CTA>ATA	p.L532I	SLC22A8_uc001nwn.1_3'UTR|SLC22A8_uc001nwp.2_3'UTR|SLC22A8_uc009yom.2_Missense_Mutation_p.L409I|SLC22A8_uc010rmm.1_Missense_Mutation_p.L441I|SLC22A8_uc009yon.2_Missense_Mutation_p.L532I	NM_004254	NP_004245	Q8TCC7	S22A8_HUMAN	solute carrier family 22 member 8	532	Extracellular (Potential).				response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3						TGAGGCTGTAGAGGGATCCTC	0.602													7	35	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64419624	64419624	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64419624T>C	uc001oar.2	-	14	2858	c.2419A>G	c.(2419-2421)AAA>GAA	p.K807E	NRXN2_uc001oas.2_Missense_Mutation_p.K767E|NRXN2_uc001oaq.2_Missense_Mutation_p.K474E	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						TCGGGGCCTTTACCTGCGGCA	0.582													9	31	---	---	---	---	PASS
NPAS4	266743	broad.mit.edu	37	11	66191304	66191304	+	Splice_Site	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66191304A>T	uc001ohx.1	+	7	1121	c.945_splice	c.e7-2	p.S315_splice	NPAS4_uc010rpc.1_Splice_Site_p.S105_splice	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4						transcription, DNA-dependent		DNA binding|signal transducer activity				0						TCTCCTCTCCAGTGACATGGA	0.577													71	62	---	---	---	---	PASS
NPAS4	266743	broad.mit.edu	37	11	66192136	66192136	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66192136C>G	uc001ohx.1	+	7	1951	c.1775C>G	c.(1774-1776)GCC>GGC	p.A592G	NPAS4_uc010rpc.1_Missense_Mutation_p.A382G	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	592					transcription, DNA-dependent		DNA binding|signal transducer activity				0						TTGGCCCTAGCCCAGCTCCGG	0.587													73	103	---	---	---	---	PASS
MRPL11	65003	broad.mit.edu	37	11	66206131	66206131	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66206131C>A	uc001ohz.3	-	1	180	c.95G>T	c.(94-96)GGG>GTG	p.G32V	MRPL11_uc001ohy.3_Missense_Mutation_p.G32V|MRPL11_uc001oia.3_Intron	NM_016050	NP_057134	Q9Y3B7	RM11_HUMAN	mitochondrial ribosomal protein L11 isoform a	32					translation		structural constituent of ribosome				0						TAGTGGGGGCCCGGGCATGGC	0.692													14	18	---	---	---	---	PASS
CARNS1	57571	broad.mit.edu	37	11	67191123	67191123	+	Nonsense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67191123T>A	uc009yrp.2	+	9	1987	c.1535T>A	c.(1534-1536)TTG>TAG	p.L512*	PPP1CA_uc001okx.1_5'Flank|CARNS1_uc001olc.3_Nonsense_Mutation_p.L651*	NM_020811	NP_065862	A5YM72	CRNS1_HUMAN	ATP-grasp domain containing 1	512					carnosine biosynthetic process		ATP binding|carnosine synthase activity|metal ion binding				0						CTGCACCTGTTGCACCACCAT	0.662													5	7	---	---	---	---	PASS
PRCP	5547	broad.mit.edu	37	11	82536067	82536067	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82536067C>G	uc001ozs.2	-	9	1485	c.1372G>C	c.(1372-1374)GAT>CAT	p.D458H	PRCP_uc001ozr.2_Missense_Mutation_p.D479H	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein	458					blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1						GTGCGGAGATCTAAGTGGTGG	0.493													7	45	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92543101	92543101	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92543101C>A	uc001pdj.3	+	12	9357	c.9340C>A	c.(9340-9342)CAG>AAG	p.Q3114K		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3114	Cadherin 28.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAGGTTCTGCCAGTCCAACAT	0.532										TCGA Ovarian(4;0.039)			58	59	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92616285	92616285	+	Silent	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92616285C>G	uc001pdj.3	+	23	12680	c.12663C>G	c.(12661-12663)GTC>GTG	p.V4221V	FAT3_uc001pdi.3_Silent_p.V661V	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	4221	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GCCGCAACGTCTACCAGGAGG	0.657										TCGA Ovarian(4;0.039)			47	76	---	---	---	---	PASS
MTNR1B	4544	broad.mit.edu	37	11	92715461	92715461	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92715461C>G	uc001pdk.1	+	2	1175	c.1072C>G	c.(1072-1074)CAG>GAG	p.Q358E		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	358	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)	TGTGCAGCACCAGGCAGATGC	0.597													39	68	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	99786867	99786867	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99786867C>A	uc001pga.2	+	7	998	c.659C>A	c.(658-660)CCG>CAG	p.P220Q	CNTN5_uc009ywv.1_Missense_Mutation_p.P220Q|CNTN5_uc001pfz.2_Missense_Mutation_p.P220Q|CNTN5_uc001pgb.2_Missense_Mutation_p.P146Q	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	220	Ig-like C2-type 2.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TGCTCTCCTCCGCCACATTCA	0.458													5	21	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	121060483	121060483	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121060483G>C	uc010rzo.1	+	22	6261	c.6261G>C	c.(6259-6261)TGG>TGC	p.W2087C		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	2087					cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GGCTGGACTGGTGTGAGGACA	0.522													45	34	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6076771	6076771	+	Intron	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6076771G>T	uc001qnn.1	-						VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	TTCCCGGGCTGGAAGCAGAGG	0.622													35	154	---	---	---	---	PASS
GNB3	2784	broad.mit.edu	37	12	6952794	6952794	+	Splice_Site	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6952794A>T	uc001qrd.2	+	8	836	c.431_splice	c.e8-2	p.G144_splice	GNB3_uc001qrc.2_Splice_Site_p.G100_splice|GNB3_uc009zfe.2_Splice_Site_p.G144_splice	NM_002075	NP_002066	P16520	GBB3_HUMAN	guanine nucleotide-binding protein, beta-3						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of blood pressure|synaptic transmission	plasma membrane	GTPase activity|GTPase binding|signal transducer activity				0						AACCGCCTCCAGGTTATCTCT	0.612													56	21	---	---	---	---	PASS
NANOG	79923	broad.mit.edu	37	12	7942241	7942241	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7942241T>A	uc009zfy.1	+	1	247	c.31T>A	c.(31-33)TTG>ATG	p.L11M		NM_024865	NP_079141	Q9H9S0	NANOG_HUMAN	Nanog homeobox	11					cell proliferation|embryo development|somatic stem cell maintenance	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				Kidney(36;0.0872)		TCCCCAAAGCTTGCCTTGCTT	0.428													97	103	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	9001331	9001331	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9001331C>A	uc001quz.3	+	16	1947	c.1849C>A	c.(1849-1851)CCA>ACA	p.P617T	A2ML1_uc001qva.1_Missense_Mutation_p.P197T|A2ML1_uc010sgm.1_Missense_Mutation_p.P117T	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor	461						extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						TGGGATGTTTCCATTCTGGTA	0.478													55	221	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9227156	9227156	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9227156C>A	uc001qvk.1	-	29	3869	c.3756G>T	c.(3754-3756)CAG>CAT	p.Q1252H	A2M_uc001qvj.1_Missense_Mutation_p.Q294H|A2M_uc009zgk.1_Missense_Mutation_p.Q1102H	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	1252					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	AATCACCAACCTGGGTGGAGG	0.468													12	11	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13716971	13716971	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13716971G>A	uc001rbt.2	-	13	3380	c.3201C>T	c.(3199-3201)ACC>ACT	p.T1067T		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	1067	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	CATAGGTGACGGTGTGGGTTG	0.577													41	24	---	---	---	---	PASS
PTPRO	5800	broad.mit.edu	37	12	15722408	15722408	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15722408C>A	uc001rcv.1	+	19	2979	c.2805C>A	c.(2803-2805)GAC>GAA	p.D935E	PTPRO_uc001rcw.1_Missense_Mutation_p.D907E|PTPRO_uc001rcx.1_Missense_Mutation_p.D124E|PTPRO_uc001rcy.1_Missense_Mutation_p.D124E|PTPRO_uc001rcz.1_Missense_Mutation_p.D96E|PTPRO_uc001rda.1_Missense_Mutation_p.D96E	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	935	Cytoplasmic (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				AAGACTCTGACTATAAATTTT	0.393													31	144	---	---	---	---	PASS
SLCO1B3	28234	broad.mit.edu	37	12	21069122	21069122	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21069122G>A	uc001rek.2	+	15	2176	c.2050G>A	c.(2050-2052)GCT>ACT	p.A684T	SLCO1B3_uc001rel.2_Missense_Mutation_p.A684T|SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Intron	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	684	Cytoplasmic (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					TGTACCTTCTGCTGGAACAGA	0.343													17	79	---	---	---	---	PASS
ARNTL2	56938	broad.mit.edu	37	12	27521353	27521353	+	Intron	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27521353A>T	uc001rht.1	+						ARNTL2_uc001rhw.2_Intron|ARNTL2_uc010sjp.1_Intron|ARNTL2_uc001rhu.1_Intron|ARNTL2_uc009zji.1_Intron|ARNTL2_uc001rhv.1_Intron	NM_020183	NP_064568	Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear						circadian rhythm|entrainment of circadian clock|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|skin(1)	2	Colorectal(261;0.0847)|Lung SC(9;0.184)					CCAGTAAGTGAATTTGGTCCT	0.408													20	78	---	---	---	---	PASS
ARID2	196528	broad.mit.edu	37	12	46245498	46245498	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46245498C>G	uc001ros.1	+	15	3592	c.3592C>G	c.(3592-3594)CCA>GCA	p.P1198A	ARID2_uc001ror.2_Missense_Mutation_p.P1198A|ARID2_uc009zkg.1_Missense_Mutation_p.P654A|ARID2_uc009zkh.1_Missense_Mutation_p.P825A|ARID2_uc001rou.1_Missense_Mutation_p.P532A	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1198					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GCTCATTGCTCCAGCAGGAAT	0.498													55	45	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48387259	48387259	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48387259G>A	uc001rqu.2	-	15	1132	c.951C>T	c.(949-951)AAC>AAT	p.N317N	COL2A1_uc001rqv.2_Silent_p.N248N	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	317	Triple-helical region.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CCGGAGATCCGTTCTCACCCG	0.532													16	74	---	---	---	---	PASS
FMNL3	91010	broad.mit.edu	37	12	50050949	50050949	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50050949C>A	uc001ruv.1	-	7	864	c.630G>T	c.(628-630)AGG>AGT	p.R210S	FMNL3_uc001ruw.1_Missense_Mutation_p.R159S|FMNL3_uc001ruu.1_Missense_Mutation_p.R60S	NM_175736	NP_783863	Q8IVF7	FMNL3_HUMAN	formin-like 3 isoform 1	210	GBD/FH3.				actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4						TCTTCAGGGCCCTGCGCCCAG	0.582													9	154	---	---	---	---	PASS
AQP5	362	broad.mit.edu	37	12	50357895	50357895	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50357895C>A	uc001rvo.2	+	3	1071	c.549C>A	c.(547-549)TCC>TCA	p.S183S		NM_001651	NP_001642	P55064	AQP5_HUMAN	aquaporin 5	183	Extracellular (Potential).				carbon dioxide transport|excretion|odontogenesis|pancreatic juice secretion	apical plasma membrane|integral to plasma membrane	protein binding|water channel activity				0						CTGGCTGCTCCATGAACCCAG	0.532													41	27	---	---	---	---	PASS
OR6C74	254783	broad.mit.edu	37	12	55641480	55641480	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55641480A>T	uc010spg.1	+	1	409	c.409A>T	c.(409-411)AGA>TGA	p.R137*		NM_001005490	NP_001005490	A6NCV1	O6C74_HUMAN	olfactory receptor, family 6, subfamily C,	137	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						CATGAGCAGCAGAGTTTGCAG	0.498													49	167	---	---	---	---	PASS
MMP19	4327	broad.mit.edu	37	12	56231417	56231417	+	Silent	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56231417G>C	uc001sib.2	-	8	1231	c.1110C>G	c.(1108-1110)CCC>CCG	p.P370P	MMP19_uc001sia.2_Silent_p.P84P|MMP19_uc001sid.2_RNA|MMP19_uc010spw.1_Intron	NM_002429	NP_002420	Q99542	MMP19_HUMAN	matrix metalloproteinase 19 isoform rasi-1	370	Hemopexin-like 2.				angiogenesis|cell differentiation|collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)	1						TCAGCTTCTTGGGGAAGCCAG	0.468													24	143	---	---	---	---	PASS
IL23A	51561	broad.mit.edu	37	12	56733876	56733876	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56733876C>T	uc001sla.2	+	4	724	c.558C>T	c.(556-558)ACC>ACT	p.T186T		NM_016584	NP_057668	Q9NPF7	IL23A_HUMAN	interleukin 23, alpha subunit p19 precursor	186					defense response to Gram-negative bacterium|inflammatory response|innate immune response|negative regulation of interleukin-10 production|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to virus|tissue remodeling	interleukin-23 complex	cytokine activity				0						GAGCAGCAACCCTGAGTCCCT	0.592													20	115	---	---	---	---	PASS
USP15	9958	broad.mit.edu	37	12	62749201	62749201	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62749201G>T	uc001src.1	+	8	869	c.860G>T	c.(859-861)GGC>GTC	p.G287V	USP15_uc001srb.1_Missense_Mutation_p.G258V	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	287					protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		GAACAGCCAGGCCTCTGTGGC	0.373													26	34	---	---	---	---	PASS
IRAK3	11213	broad.mit.edu	37	12	66620625	66620625	+	Intron	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66620625C>A	uc001sth.2	+						IRAK3_uc010ssy.1_Intron	NM_007199	NP_009130	Q9Y616	IRAK3_HUMAN	interleukin-1 receptor-associated kinase 3						interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8				GBM - Glioblastoma multiforme(28;0.0203)		GTAGTAAGTTCTATCTATTAT	0.443													4	99	---	---	---	---	PASS
CLLU1OS	574016	broad.mit.edu	37	12	92821879	92821879	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92821879G>T	uc001tcb.1	-	1	46	c.44C>A	c.(43-45)ACT>AAT	p.T15N	CLLU1_uc001tcc.2_Intron|CLLU1_uc001tcd.2_Intron|CLLU1_uc001tce.1_Intron|CLLU1_uc001tcf.2_Intron	NM_001025232	NP_001020403	Q5K130	CLU1O_HUMAN	chronic lymphocytic leukemia up-regulated 1	15											0						accagtggcagtcttaaggca	0.065													114	61	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	99793515	99793515	+	Silent	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99793515G>T	uc001tge.1	-	12	2067	c.1650C>A	c.(1648-1650)ATC>ATA	p.I550I	ANKS1B_uc001tgf.1_Silent_p.I130I|ANKS1B_uc009ztt.1_Silent_p.I516I	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	550						Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TAGATGTGTTGATTTCAAAAT	0.438													44	176	---	---	---	---	PASS
TCTN1	79600	broad.mit.edu	37	12	111057646	111057646	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111057646G>C	uc009zvs.2	+	2	334	c.226G>C	c.(226-228)GTT>CTT	p.V76L	TCTN1_uc010syb.1_Missense_Mutation_p.V76L|TCTN1_uc009zvr.1_RNA|TCTN1_uc001trl.2_RNA|TCTN1_uc001trm.2_Missense_Mutation_p.V16L|TCTN1_uc010syc.1_RNA|TCTN1_uc001tro.2_RNA|TCTN1_uc001trp.3_Missense_Mutation_p.V76L|TCTN1_uc001trn.3_Missense_Mutation_p.V76L|TCTN1_uc001tri.2_Missense_Mutation_p.V20L|TCTN1_uc001trj.1_Missense_Mutation_p.V20L|TCTN1_uc001trk.3_RNA	NM_001082537	NP_001076006	Q2MV58	TECT1_HUMAN	tectonic family member 1 isoform 2	76					multicellular organismal development	extracellular region					0						TGCAGTTGCTGTTCTCTGTGT	0.502													139	57	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133398574	133398574	+	Intron	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133398574C>A	uc001ukz.1	-						GOLGA3_uc001ula.1_Intron|GOLGA3_uc001ulb.2_Intron	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3						intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		AGGAACCTCACGACTTACACT	0.607													25	174	---	---	---	---	PASS
EDNRB	1910	broad.mit.edu	37	13	78474025	78474025	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78474025A>T	uc001vko.2	-	6	1421	c.1163T>A	c.(1162-1164)TTG>TAG	p.L388*	EDNRB_uc001vkq.1_Nonsense_Mutation_p.L388*|uc001vkn.1_Intron|EDNRB_uc010aez.1_Nonsense_Mutation_p.L388*|EDNRB_uc001vkp.1_Nonsense_Mutation_p.L471*	NM_001122659	NP_001116131	P24530	EDNRB_HUMAN	endothelin receptor type B isoform 1 precursor	388	Helical; Name=7; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|enteric nervous system development|enteric smooth muscle cell differentiation|macrophage chemotaxis|negative regulation of adenylate cyclase activity|negative regulation of cellular protein metabolic process|negative regulation of neuron maturation|negative regulation of transcription from RNA polymerase II promoter|vein smooth muscle contraction	integral to plasma membrane	endothelin-B receptor activity|peptide hormone binding				0		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)	TTTGCTCACCAAATACAGAGC	0.343													41	22	---	---	---	---	PASS
UBAC2	337867	broad.mit.edu	37	13	100020152	100020152	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100020152G>A	uc001voa.3	+	8	1403	c.919G>A	c.(919-921)GAG>AAG	p.E307K	UBAC2_uc010tiu.1_Missense_Mutation_p.E329K|UBAC2_uc001vob.3_Missense_Mutation_p.E280K|UBAC2_uc010tiv.1_RNA|UBAC2_uc001vod.2_Missense_Mutation_p.E194K|UBAC2_uc001voc.2_Missense_Mutation_p.E272K|UBAC2_uc010tiw.1_RNA|UBAC2_uc001voh.2_Missense_Mutation_p.E111K	NM_001144072	NP_001137544	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2 isoform 1	307	UBA.|Cytoplasmic (Potential).					integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AGAAGTTTCTGAGGAACAGGT	0.443													37	16	---	---	---	---	PASS
POTEG	404785	broad.mit.edu	37	14	19563501	19563501	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19563501C>A	uc001vuz.1	+	5	1067	c.1015C>A	c.(1015-1017)CAG>AAG	p.Q339K	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA|uc001vvb.2_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	339										ovary(1)	1						TCTATCTGGACAGACGGCCAG	0.358													156	511	---	---	---	---	PASS
TEP1	7011	broad.mit.edu	37	14	20846399	20846399	+	Intron	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20846399C>T	uc001vxe.2	-						TEP1_uc010ahk.2_Intron|TEP1_uc010tlf.1_Intron|TEP1_uc010tlg.1_Intron|TEP1_uc010tlh.1_Intron	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1						telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CCAGGTCCTACACAGGGAGGT	0.582													12	52	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22314989	22314989	+	Intron	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22314989G>T	uc010tmf.1	+						uc001wbw.2_Intron|uc010tmg.1_Intron|uc001wby.2_Intron|uc010ait.1_Nonsense_Mutation_p.G16*|uc001wbz.1_Nonsense_Mutation_p.G16*					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		TTTTACTCTGGGTGAGTAACA	0.502											OREG0022570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	75	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22573998	22573998	+	Intron	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22573998C>A	uc001wbw.2	+						uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdb.2_Missense_Mutation_p.T73N					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TTTGTAATGACTTTAAATGGG	0.438													4	29	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23886518	23886518	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23886518C>A	uc001wjx.2	-	32	4469	c.4363G>T	c.(4363-4365)GAG>TAG	p.E1455*		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1455	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TGCTTCCACTCGGCCAGGATC	0.622													47	33	---	---	---	---	PASS
ADCY4	196883	broad.mit.edu	37	14	24787706	24787706	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24787706C>A	uc001wov.2	-	25	3156	c.3150G>T	c.(3148-3150)AAG>AAT	p.K1050N	ADCY4_uc001wow.2_Missense_Mutation_p.K1050N|ADCY4_uc010toh.1_Missense_Mutation_p.K736N|ADCY4_uc001wox.2_Missense_Mutation_p.K1050N|ADCY4_uc001woy.2_Missense_Mutation_p.K1050N	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	1050	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)		TGCCTTTCACCTTGATGACAC	0.567													63	49	---	---	---	---	PASS
NFATC4	4776	broad.mit.edu	37	14	24842951	24842951	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24842951G>A	uc001wpc.2	+	5	1931	c.1610G>A	c.(1609-1611)CGG>CAG	p.R537Q	NFATC4_uc010tok.1_Missense_Mutation_p.R600Q|NFATC4_uc010tol.1_Missense_Mutation_p.R600Q|NFATC4_uc010alr.2_Missense_Mutation_p.R600Q|NFATC4_uc010als.2_Missense_Mutation_p.R550Q|NFATC4_uc010tom.1_Missense_Mutation_p.R550Q|NFATC4_uc010ton.1_Missense_Mutation_p.R550Q|NFATC4_uc010too.1_Missense_Mutation_p.R550Q|NFATC4_uc010alt.2_Missense_Mutation_p.R569Q|NFATC4_uc010top.1_Missense_Mutation_p.R569Q|NFATC4_uc010toq.1_Missense_Mutation_p.R569Q|NFATC4_uc010alu.2_Missense_Mutation_p.R229Q|NFATC4_uc010tor.1_Missense_Mutation_p.R537Q|NFATC4_uc010tos.1_Missense_Mutation_p.R467Q|NFATC4_uc010tot.1_Missense_Mutation_p.R525Q|NFATC4_uc010tou.1_Missense_Mutation_p.R467Q|NFATC4_uc010tov.1_Missense_Mutation_p.R525Q|NFATC4_uc010tow.1_Missense_Mutation_p.R467Q|NFATC4_uc010alv.2_Missense_Mutation_p.R525Q|NFATC4_uc010tox.1_Missense_Mutation_p.R467Q|NFATC4_uc001wpd.2_Missense_Mutation_p.R72Q|NFATC4_uc010toy.1_Missense_Mutation_p.R72Q|NFATC4_uc010toz.1_Missense_Mutation_p.R72Q|NFATC4_uc010tpa.1_5'UTR|NFATC4_uc010tpb.1_5'UTR	NM_004554	NP_004545	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells,	537	RHD.				cell differentiation|inflammatory response|transcription from RNA polymerase II promoter	cytoplasm|intermediate filament cytoskeleton|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(265;0.018)		ATTGAGCTTCGGAAGGGTGAG	0.577													26	190	---	---	---	---	PASS
MBIP	51562	broad.mit.edu	37	14	36786011	36786011	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36786011A>C	uc001wtm.2	-	2	225	c.137T>G	c.(136-138)CTC>CGC	p.L46R	MBIP_uc001wto.2_Missense_Mutation_p.L46R|MBIP_uc010tpy.1_5'UTR|MBIP_uc001wtn.2_Missense_Mutation_p.L46R	NM_016586	NP_057670	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1 isoform 1	46					histone H3 acetylation|inactivation of MAPK activity involved in osmosensory signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm|nucleolus	identical protein binding|protein kinase inhibitor activity				0	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		ATCATCTCTGAGGTCAAGCTT	0.413													18	91	---	---	---	---	PASS
NKX2-1	7080	broad.mit.edu	37	14	36989335	36989335	+	5'Flank	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36989335C>A	uc001wtt.2	-						SFTA3_uc001wts.2_5'Flank|NKX2-1_uc001wtu.2_5'UTR|NKX2-1_uc001wtv.2_5'UTR|uc001wtw.1_Intron	NM_003317	NP_003308	P43699	NKX21_HUMAN	thyroid transcription factor 1 isoform 2						epithelial tube branching involved in lung morphogenesis|globus pallidus development|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|thyroid gland development		protein binding|transcription regulatory region DNA binding			skin(1)	1	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)		CGGACCACATCGGGCTTCGCT	0.687			A		NSCLC								6	36	---	---	---	---	PASS
C14orf39	317761	broad.mit.edu	37	14	60928127	60928127	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60928127C>A	uc001xez.3	-	13	1172	c.1062G>T	c.(1060-1062)TTG>TTT	p.L354F	C14orf39_uc010apo.2_Missense_Mutation_p.L65F	NM_174978	NP_777638	Q08AQ4	Q08AQ4_HUMAN	hypothetical protein LOC317761	354										ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		GTGGGGTTAACAATCTAAAAT	0.279													12	47	---	---	---	---	PASS
RHOJ	57381	broad.mit.edu	37	14	63671679	63671679	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63671679C>A	uc001xgb.1	+	1	535	c.92C>A	c.(91-93)GCC>GAC	p.A31D		NM_020663	NP_065714	Q9H4E5	RHOJ_HUMAN	ras homolog gene family, member J precursor	31	GTP (By similarity).				actin cytoskeleton organization|regulation of cell shape|regulation of small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		GGGGACGGTGCCGTGGGGAAA	0.562													8	39	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64610582	64610582	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64610582G>A	uc001xgm.2	+	83	15629	c.15399G>A	c.(15397-15399)AAG>AAA	p.K5133K	SYNE2_uc001xgl.2_Silent_p.K5133K|SYNE2_uc010apy.2_Silent_p.K1518K|SYNE2_uc001xgn.2_Silent_p.K95K|SYNE2_uc001xgo.2_RNA	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5133	Spectrin 2.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TAGAAAGCAAGCGCTATGAAA	0.448													206	164	---	---	---	---	PASS
DCAF5	8816	broad.mit.edu	37	14	69584943	69584943	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69584943C>A	uc001xkp.2	-	4	667	c.448G>T	c.(448-450)GTG>TTG	p.V150L	DCAF5_uc001xkq.2_Missense_Mutation_p.V149L|DCAF5_uc001xkr.3_Missense_Mutation_p.V150L|DCAF5_uc001xks.2_3'UTR	NM_003861	NP_003852	Q96JK2	DCAF5_HUMAN	WD repeat domain 22	150	WD 3.					CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)	2						ACTGGGCTCACAGACAAGCCA	0.493													31	36	---	---	---	---	PASS
SLC8A3	6547	broad.mit.edu	37	14	70634927	70634927	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70634927C>A	uc001xly.2	-	2	967	c.213G>T	c.(211-213)GGG>GGT	p.G71G	SLC8A3_uc001xlw.2_Silent_p.G71G|SLC8A3_uc001xlx.2_Silent_p.G71G|SLC8A3_uc001xlz.2_Silent_p.G71G|SLC8A3_uc010ara.2_RNA	NM_183002	NP_892114	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium	71	Extracellular (Potential).				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(2)|breast(2)	7				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		CAATCTTGTCCCCAAGGGAAG	0.517													12	54	---	---	---	---	PASS
RBM25	58517	broad.mit.edu	37	14	73550247	73550247	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73550247G>T	uc001xno.2	+	5	578	c.370G>T	c.(370-372)GGA>TGA	p.G124*	RBM25_uc001xnn.3_Nonsense_Mutation_p.G124*|RBM25_uc010ttu.1_Nonsense_Mutation_p.G124*|RBM25_uc001xnp.2_Intron	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25	124	RRM.				apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		AGGTGCTTCCGGAAAGCTTCA	0.323													13	53	---	---	---	---	PASS
RBM25	58517	broad.mit.edu	37	14	73550249	73550249	+	Silent	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73550249A>T	uc001xno.2	+	5	580	c.372A>T	c.(370-372)GGA>GGT	p.G124G	RBM25_uc001xnn.3_Silent_p.G124G|RBM25_uc010ttu.1_Silent_p.G124G|RBM25_uc001xnp.2_Intron	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25	124	RRM.				apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		GTGCTTCCGGAAAGCTTCAAG	0.323													13	54	---	---	---	---	PASS
LTBP2	4053	broad.mit.edu	37	14	74969447	74969447	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74969447G>T	uc001xqa.2	-	34	5466	c.5079C>A	c.(5077-5079)AAC>AAA	p.N1693K		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	1693					protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GACCGGCTGTGTTGGGGAAGG	0.627													102	53	---	---	---	---	PASS
SPTLC2	9517	broad.mit.edu	37	14	78063612	78063612	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78063612T>C	uc001xub.2	-	2	432	c.244A>G	c.(244-246)ACC>GCC	p.T82A		NM_004863	NP_004854	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base	82	Helical; (Potential).					integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups			upper_aerodigestive_tract(1)|ovary(1)	2			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	CCAAAGAGGGTGAGTACGCCA	0.398													67	56	---	---	---	---	PASS
GALC	2581	broad.mit.edu	37	14	88454509	88454509	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88454509C>A	uc001xvt.2	-	3	706	c.307G>T	c.(307-309)GGT>TGT	p.G103C	GALC_uc010tvx.1_Missense_Mutation_p.G77C|GALC_uc010tvy.1_Missense_Mutation_p.G80C|GALC_uc010tvz.1_Missense_Mutation_p.G47C|GALC_uc001xvu.1_Missense_Mutation_p.G103C	NM_000153	NP_000144	P54803	GALC_HUMAN	galactosylceramidase isoform a precursor	103					carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0						CCATCACCACCTATTTCCACT	0.368													15	90	---	---	---	---	PASS
RIN3	79890	broad.mit.edu	37	14	93043795	93043795	+	Nonsense_Mutation	SNP	G	T	T	rs139542247		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93043795G>T	uc001yap.2	+	3	492	c.340G>T	c.(340-342)GAA>TAA	p.E114*	RIN3_uc010auk.2_5'UTR|RIN3_uc001yaq.2_Nonsense_Mutation_p.E39*	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	114	SH2.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				CGAGGTGCTCGAATACACCAT	0.522													39	151	---	---	---	---	PASS
MOAP1	64112	broad.mit.edu	37	14	93650150	93650150	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93650150C>T	uc001ybj.2	-	3	808	c.438G>A	c.(436-438)TTG>TTA	p.L146L	C14orf109_uc001ybk.3_5'Flank|C14orf109_uc010auo.2_5'Flank	NM_022151	NP_071434	Q96BY2	MOAP1_HUMAN	modulator of apoptosis 1	146					activation of caspase activity|apoptotic nuclear change	cytoplasm	protein homodimerization activity			skin(2)|ovary(1)	3		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.178)|all cancers(159;0.2)|COAD - Colon adenocarcinoma(157;0.204)		atgcctgtgccaacatagggg	0.000													16	229	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94129013	94129013	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94129013G>A	uc001ybv.1	+	39	6324	c.6241G>A	c.(6241-6243)GCC>ACC	p.A2081T	KIAA1409_uc001ybs.1_Missense_Mutation_p.A2059T	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	2236	Helical; (Potential).					integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		CTTCACTCTGGCCTACCTGGT	0.433													12	54	---	---	---	---	PASS
SNORD114-31	767612	broad.mit.edu	37	14	101458324	101458324	+	5'Flank	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101458324C>G	uc001yjv.2	+						SNORD114-30_uc001yju.2_RNA	NR_003224				Homo sapiens small nucleolar RNA, C/D box 114-31 (SNORD114-31), non-coding RNA.												0						ACTCTGAGGTCCATCAGAAAA	0.423													20	105	---	---	---	---	PASS
MIR496	574454	broad.mit.edu	37	14	101526921	101526921	+	RNA	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101526921T>C	hsa-mir-496|MI0003136	+			c.12T>C			uc010awh.1_5'Flank|MIR377_hsa-mir-377|MI0000785_5'Flank																	0						CCAAGTCAGGTACTCGAATGG	0.507													9	13	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106311806	106311806	+	RNA	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106311806T>C	uc010tyt.1	-	3608		c.57117A>G			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysj.2_Missense_Mutation_p.Q83R|uc001ysk.1_Missense_Mutation_p.Q83R|uc001ysl.1_Missense_Mutation_p.Q83R|uc001ysm.1_Missense_Mutation_p.Q26R|uc001ysn.1_Missense_Mutation_p.Q26R|uc001yso.1_Missense_Mutation_p.Q26R					Parts of antibodies, mostly variable regions.												0						GGTGGAGAGCTGGCTGCTTGT	0.587													42	36	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106780656	106780656	+	RNA	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106780656A>T	uc010tyt.1	-	413		c.15206T>A								Parts of antibodies, mostly variable regions.												0						TAATAGATGTACCCAATCCAC	0.557													29	122	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107078494	107078494	+	RNA	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107078494G>A	uc010tyt.1	-	117		c.5796C>T								Parts of antibodies, mostly variable regions.												0						TGCGTAGTTTGTGTTACCACT	0.532													69	100	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	26792999	26792999	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26792999C>G	uc001zaz.2	-	9	1505	c.1363G>C	c.(1363-1365)GTG>CTG	p.V455L	GABRB3_uc010uae.1_Missense_Mutation_p.V370L|GABRB3_uc001zba.2_Missense_Mutation_p.V455L|GABRB3_uc001zbb.2_Missense_Mutation_p.V511L	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	455	Helical; (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	AATGGAAACACGATCCTGGAC	0.398													44	79	---	---	---	---	PASS
CHRM5	1133	broad.mit.edu	37	15	34355547	34355547	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34355547C>T	uc001zhk.1	+	3	1299	c.629C>T	c.(628-630)ACC>ATC	p.T210I	CHRM5_uc001zhl.1_Missense_Mutation_p.T210I	NM_012125	NP_036257	P08912	ACM5_HUMAN	cholinergic receptor, muscarinic 5	210	Helical; Name=5; (By similarity).				cell proliferation|inhibition of adenylate cyclase activity by muscarinic acetylcholine receptor signaling pathway	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Atropine(DB00572)|Benzquinamide(DB00767)|Cryptenamine(DB00785)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Thiethylperazine(DB00372)	TCTGTCATGACCATCCTCTAC	0.512													178	100	---	---	---	---	PASS
SLC12A1	6557	broad.mit.edu	37	15	48548064	48548064	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48548064G>A	uc001zwn.3	+	16	2215	c.1999G>A	c.(1999-2001)GCT>ACT	p.A667T	SLC12A1_uc010uew.1_Missense_Mutation_p.A473T|SLC12A1_uc010bem.2_Missense_Mutation_p.A667T|SLC12A1_uc001zwq.3_Missense_Mutation_p.A438T|SLC12A1_uc001zwr.3_Missense_Mutation_p.A394T	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2	667					potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TTTAGACAATGCTCTGGAATT	0.463													7	6	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48826374	48826374	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48826374C>A	uc001zwx.1	-	8	1093	c.765G>T	c.(763-765)GGG>GGT	p.G255G		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	255	EGF-like 4; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CCTGACAGAGCCCGGGGATGG	0.393													162	104	---	---	---	---	PASS
CILP	8483	broad.mit.edu	37	15	65491427	65491427	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65491427C>A	uc002aon.2	-	9	1378	c.1197G>T	c.(1195-1197)GAG>GAT	p.E399D		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	399					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						TGCAAGGAGTCTCATCAGATG	0.408													35	21	---	---	---	---	PASS
UACA	55075	broad.mit.edu	37	15	70959875	70959875	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70959875G>C	uc002asr.2	-	16	3252	c.3148C>G	c.(3148-3150)CTC>GTC	p.L1050V	UACA_uc010uke.1_Missense_Mutation_p.L941V|UACA_uc002asq.2_Missense_Mutation_p.L1037V|UACA_uc010bin.1_Missense_Mutation_p.L1025V	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	1050	Potential.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						TTCTCAATGAGAACTGTCTTA	0.348													68	32	---	---	---	---	PASS
TMEM202	338949	broad.mit.edu	37	15	72690670	72690670	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72690670G>A	uc002auq.2	+	1	3	c.3G>A	c.(1-3)ATG>ATA	p.M1I	TMEM202_uc002aur.2_RNA	NM_001080462	NP_001073931	A6NGA9	TM202_HUMAN	transmembrane protein 202	1						integral to membrane				central_nervous_system(1)|skin(1)	2						CTGCCAAGATGGAGCGAAGGG	0.473													6	8	---	---	---	---	PASS
ISLR2	57611	broad.mit.edu	37	15	74426101	74426101	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74426101G>C	uc002axd.2	+	4	1775	c.1006G>C	c.(1006-1008)GCA>CCA	p.A336P	ISLR2_uc002axe.2_Missense_Mutation_p.A336P|ISLR2_uc010bjg.2_Missense_Mutation_p.A336P|ISLR2_uc010bjf.2_Missense_Mutation_p.A336P	NM_001130136	NP_001123608	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing	336	Ig-like.|Extracellular (Potential).				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane					0						CCTGGCCCTCGCAAATGGCTC	0.602													6	4	---	---	---	---	PASS
BCL2A1	597	broad.mit.edu	37	15	80263171	80263171	+	Silent	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80263171A>G	uc002bfc.3	-	1	473	c.291T>C	c.(289-291)GGT>GGC	p.G97G	BCL2A1_uc002bfd.3_Silent_p.G97G	NM_004049	NP_004040	Q16548	B2LA1_HUMAN	BCL2-related protein A1 isoform 1	97	BH1.				anti-apoptosis|apoptosis	cytoplasm	protein binding			pancreas(1)	1						TGATGAGAATACCTTCAAATG	0.388													130	87	---	---	---	---	PASS
KCTD5	54442	broad.mit.edu	37	16	2749842	2749842	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2749842C>T	uc002crd.2	+	4	529	c.474C>T	c.(472-474)TAC>TAT	p.Y158Y		NM_018992	NP_061865	Q9NXV2	KCTD5_HUMAN	potassium channel tetramerisation domain	158					interspecies interaction between organisms	cytosol|nucleus|voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity				0						AGCATGTGTACCGTGTGCTGC	0.652													42	61	---	---	---	---	PASS
C16orf68	79091	broad.mit.edu	37	16	8722823	8722823	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8722823G>T	uc002cyz.2	+	3	646	c.370G>T	c.(370-372)GTG>TTG	p.V124L	C16orf68_uc002cza.2_Intron	NM_024109	NP_077014	Q9BUU2	MET22_HUMAN	hypothetical protein LOC79091	124							methyltransferase activity				0						GGATTTGGACGTGGTGAGAAG	0.567													75	67	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9857766	9857766	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9857766G>T	uc002czo.3	-	13	4183	c.3635C>A	c.(3634-3636)ACG>AAG	p.T1212K	GRIN2A_uc010uym.1_Missense_Mutation_p.T1212K|GRIN2A_uc010uyn.1_Missense_Mutation_p.T1055K|GRIN2A_uc002czr.3_Missense_Mutation_p.T1212K	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1212	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TCTGCAGTGCGTGGAGTTCTG	0.557													184	206	---	---	---	---	PASS
ACSM3	6296	broad.mit.edu	37	16	20802007	20802007	+	Nonsense_Mutation	SNP	C	G	G	rs34381224	byFrequency	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20802007C>G	uc002dhr.2	+	10	1510	c.1323C>G	c.(1321-1323)TAC>TAG	p.Y441*	ACSM3_uc010vba.1_Nonsense_Mutation_p.Y470*|ERI2_uc002dhs.2_Intron	NM_005622	NP_005613	Q53FZ2	ACSM3_HUMAN	SA hypertension-associated homolog isoform 1	441					regulation of blood pressure	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			ovary(1)	1						TTACTCATTACGTAGTAAGTG	0.373													55	125	---	---	---	---	PASS
GTF3C1	2975	broad.mit.edu	37	16	27509984	27509984	+	Missense_Mutation	SNP	C	A	A	rs143838885	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27509984C>A	uc002dov.1	-	13	2172	c.2132G>T	c.(2131-2133)CGC>CTC	p.R711L	GTF3C1_uc002dou.2_Missense_Mutation_p.R711L	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide	711						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						GATCCGGAAGCGGACCTGCTC	0.582													118	137	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27752197	27752197	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27752197A>C	uc002dow.2	+	15	2603	c.2579A>C	c.(2578-2580)GAT>GCT	p.D860A		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	860										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						TCAAGGAAGGATGCTGGCAGC	0.582													3	11	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30719027	30719027	+	Silent	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30719027G>T	uc002dze.1	+	6	1012	c.627G>T	c.(625-627)GTG>GTT	p.V209V	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Silent_p.V66V|SRCAP_uc010bzz.1_5'Flank|SNORA30_uc002dzh.1_5'Flank	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	209					interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			GGAGCAATGTGGAGAAGGTAG	0.522													26	35	---	---	---	---	PASS
ITGAM	3684	broad.mit.edu	37	16	31309148	31309148	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31309148T>A	uc002ebq.2	+	14	1678	c.1580T>A	c.(1579-1581)CTG>CAG	p.L527Q	ITGAM_uc002ebr.2_Missense_Mutation_p.L528Q|ITGAM_uc010cam.1_Intron|ITGAM_uc010can.2_Intron	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	527	FG-GAP 6.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						CTAACAGTGCTGGGGGACGTA	0.607													18	55	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	33965597	33965597	+	IGR	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33965597C>G								MIR1826 (5 upstream) : UBE2MP1 (438205 downstream)																							CAGTAGTCCCCGGGGGTGCCT	0.672													7	37	---	---	---	---	PASS
VPS35	55737	broad.mit.edu	37	16	46714640	46714640	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46714640C>T	uc002eef.3	-	5	548	c.449G>A	c.(448-450)CGA>CAA	p.R150Q	VPS35_uc002eed.2_5'Flank|VPS35_uc002eee.2_Missense_Mutation_p.R111Q	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35	150					protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AAGGTAATTTCGAAGAAACAG	0.378													25	85	---	---	---	---	PASS
ABCC12	94160	broad.mit.edu	37	16	48138185	48138185	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48138185A>T	uc002efc.1	-	20	3114	c.2768T>A	c.(2767-2769)CTG>CAG	p.L923Q	ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_Intron|ABCC12_uc002efd.1_RNA	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	923	ABC transmembrane type-1 2.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				GTGAAACGGCAGCCTCACATC	0.483													82	77	---	---	---	---	PASS
N4BP1	9683	broad.mit.edu	37	16	48594716	48594716	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48594716C>T	uc002efp.2	-	2	2075	c.1838G>A	c.(1837-1839)GGG>GAG	p.G613E		NM_153029	NP_694574	O75113	N4BP1_HUMAN	Nedd4 binding protein 1	613					negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)				ATCCGTTCTCCCTGGTTCATT	0.368													58	256	---	---	---	---	PASS
C16orf78	123970	broad.mit.edu	37	16	49433126	49433126	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49433126C>T	uc002efr.2	+	5	778	c.735C>T	c.(733-735)CAC>CAT	p.H245H		NM_144602	NP_653203	Q8WTQ4	CP078_HUMAN	hypothetical protein LOC123970	245										central_nervous_system(1)	1						TCCACCCCCACATGGTCGAAG	0.498													32	112	---	---	---	---	PASS
FTO	79068	broad.mit.edu	37	16	53913764	53913764	+	Silent	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53913764A>G	uc002ehr.2	+	6	1206	c.984A>G	c.(982-984)ACA>ACG	p.T328T	FTO_uc010vha.1_Silent_p.T32T	NM_001080432	NP_001073901	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	328					DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						AGTGCTCAACAGGAACCTTGG	0.423													142	100	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	65038625	65038625	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65038625G>A	uc002eoi.2	-	3	582	c.148C>T	c.(148-150)CGC>TGC	p.R50C	CDH11_uc010cdn.2_RNA|CDH11_uc002eoj.2_Missense_Mutation_p.R50C|CDH11_uc010vin.1_Intron|CDH11_uc010vio.1_Missense_Mutation_p.R50C	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	50					adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CGCTTGGAGCGCTGTAGCACC	0.647			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			3	26	---	---	---	---	PASS
LCAT	3931	broad.mit.edu	37	16	67976608	67976608	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67976608C>T	uc002euy.1	-	4	500	c.489G>A	c.(487-489)GTG>GTA	p.V163V		NM_000229	NP_000220	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase precursor	163					cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|high-density lipoprotein particle remodeling|phosphatidylcholine biosynthetic process|reverse cholesterol transport|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle	apolipoprotein A-I binding|phosphatidylcholine-sterol O-acyltransferase activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		GGGCGGCGCGCACAGTCTCGT	0.687													13	145	---	---	---	---	PASS
DHX38	9785	broad.mit.edu	37	16	72142741	72142741	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72142741C>T	uc002fcb.2	+	24	3653	c.3298C>T	c.(3298-3300)CAC>TAC	p.H1100Y	DHX38_uc010vmp.1_Missense_Mutation_p.H412Y	NM_014003	NP_054722	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	1100					mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1		Ovarian(137;0.125)				GATGCCCTGCCACTTGCACCC	0.542													87	10	---	---	---	---	PASS
RFWD3	55159	broad.mit.edu	37	16	74678506	74678506	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74678506C>A	uc002fda.2	-	5	1018	c.920G>T	c.(919-921)TGT>TTT	p.C307F	RFWD3_uc010cgq.2_Missense_Mutation_p.C307F	NM_018124	NP_060594	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3	307	RING-type; degenerate.				DNA repair|mitotic cell cycle G1/S transition DNA damage checkpoint|response to ionizing radiation	nucleus	MDM2 binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(1)	3						GAGATGCCCACAGCGTAATGC	0.483													20	185	---	---	---	---	PASS
FAM92B	339145	broad.mit.edu	37	16	85132794	85132794	+	Silent	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85132794G>C	uc010vok.1	-	8	1068	c.912C>G	c.(910-912)CTC>CTG	p.L304L		NM_198491	NP_940893	Q6ZTR7	FA92B_HUMAN	hypothetical protein LOC339145	304										central_nervous_system(1)	1						TACGTCGTTAGAGAGAATGTC	0.318													5	142	---	---	---	---	PASS
SLC7A5	8140	broad.mit.edu	37	16	87874694	87874694	+	Silent	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87874694C>G	uc002fkm.2	-	3	804	c.732G>C	c.(730-732)GTG>GTC	p.V244V		NM_003486	NP_003477	Q01650	LAT1_HUMAN	solute carrier family 7 (cationic amino acid	244	Helical; (Potential).				blood coagulation|cell differentiation|cellular amino acid metabolic process|ion transport|leukocyte migration|nervous system development	apical plasma membrane|cytosol|integral to membrane	neutral amino acid transmembrane transporter activity|peptide antigen binding				0				BRCA - Breast invasive adenocarcinoma(80;0.049)		ATAATGCCAGCACAATGTTCC	0.517													41	77	---	---	---	---	PASS
CA5A	763	broad.mit.edu	37	16	87960508	87960508	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87960508G>A	uc002fkn.1	-	2	242	c.186C>T	c.(184-186)ACC>ACT	p.T62T		NM_001739	NP_001730	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial precursor	62					one-carbon metabolic process	mitochondrial matrix	carbonate dehydratase activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0513)		GAGACTGCCGGGTGCCCCCTG	0.602													6	9	---	---	---	---	PASS
ACSF3	197322	broad.mit.edu	37	16	89169102	89169102	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89169102G>T	uc002fmp.2	+	4	1097	c.757G>T	c.(757-759)GCG>TCG	p.A253S	ACSF3_uc010cig.1_Missense_Mutation_p.A253S|ACSF3_uc010cih.1_5'UTR|ACSF3_uc002fmq.1_RNA|ACSF3_uc010cii.1_RNA|ACSF3_uc002fmr.1_5'UTR	NM_174917	NP_777577	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3 precursor	253					fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)		TGTGGTCAACGCGCTGCTCTG	0.627													10	67	---	---	---	---	PASS
OR1D2	4991	broad.mit.edu	37	17	2996172	2996172	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2996172A>T	uc010vrb.1	-	1	119	c.119T>A	c.(118-120)GTG>GAG	p.V40E		NM_002548	NP_002539	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D,	40	Helical; Name=1; (Potential).				cellular component movement|chemotaxis|protein import into nucleus, translocation|sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity			ovary(1)	1						CACATTTCCCACCACCGTGAC	0.542													58	189	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	3967877	3967877	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3967877G>A	uc002fxe.2	-	29	4560	c.4496C>T	c.(4495-4497)TCC>TTC	p.S1499F	ZZEF1_uc002fxh.2_5'Flank|ZZEF1_uc002fxi.2_5'UTR|ZZEF1_uc002fxj.1_Missense_Mutation_p.S112F	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	1499							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GCCACTGCTGGATGGCAGCTT	0.642													6	60	---	---	---	---	PASS
GP1BA	2811	broad.mit.edu	37	17	4837541	4837541	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4837541C>T	uc010vsq.1	+	3	1678	c.1603C>T	c.(1603-1605)CTC>TTC	p.L535F	uc002fzn.1_RNA	NM_000173	NP_000164	P07359	GP1BA_HUMAN	platelet glycoprotein Ib alpha polypeptide	548											0						CTCTGTGGTCCTCATCCTGCT	0.577													66	30	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578407	7578407	+	Missense_Mutation	SNP	G	C	C	rs138729528		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578407G>C	uc002gim.2	-	5	717	c.523C>G	c.(523-525)CGC>GGC	p.R175G	TP53_uc002gig.1_Missense_Mutation_p.R175G|TP53_uc002gih.2_Missense_Mutation_p.R175G|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R43G|TP53_uc010cng.1_Missense_Mutation_p.R43G|TP53_uc002gii.1_Missense_Mutation_p.R43G|TP53_uc010cnh.1_Missense_Mutation_p.R175G|TP53_uc010cni.1_Missense_Mutation_p.R175G|TP53_uc002gij.2_Missense_Mutation_p.R175G|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R82G|TP53_uc002gio.2_Missense_Mutation_p.R43G|TP53_uc010vug.1_Missense_Mutation_p.R136G	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	175	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R175H(721)|p.R175L(19)|p.R175C(12)|p.R175G(11)|p.0?(7)|p.R175P(5)|p.R175S(5)|p.R175R(4)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.R175fs*5(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R175fs*72(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.S149fs*72(1)|p.R174_E180>K(1)|p.R174fs*3(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGGGGGCAGCGCCTCACAACC	0.657		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			42	12	---	---	---	---	PASS
KDM6B	23135	broad.mit.edu	37	17	7750033	7750033	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7750033G>A	uc002giw.1	+	8	1062	c.686G>A	c.(685-687)CGA>CAA	p.R229Q	KDM6B_uc002gix.2_5'Flank	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	229	Pro-rich.				inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2						GGAGGCAAGCGAAGGAGAGGC	0.622													81	18	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11837289	11837289	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11837289C>A	uc002gne.2	+	65	12458	c.12390C>A	c.(12388-12390)TAC>TAA	p.Y4130*	DNAH9_uc010coo.2_Nonsense_Mutation_p.Y3348*|DNAH9_uc002gnf.2_Nonsense_Mutation_p.Y442*	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	4130					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GCAGAACCTACCTGGGGGAAT	0.493													83	33	---	---	---	---	PASS
SEBOX	645832	broad.mit.edu	37	17	26691546	26691546	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26691546G>A	uc010wai.1	-	3	409	c.395C>T	c.(394-396)CCC>CTC	p.P132L	SARM1_uc010wah.1_Intron|SEBOX_uc010crk.1_Missense_Mutation_p.P131L|SARM1_uc010waj.1_Intron	NM_001080837	NP_001074306	Q9HB31	SEBOX_HUMAN	SEBOX homeobox isoform 1	132					cell differentiation|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		TGGCATTTGGGGATCCCAGGG	0.582													31	25	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26970223	26970223	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26970223C>A	uc002hbu.2	-	4	454	c.355G>T	c.(355-357)GAA>TAA	p.E119*	KIAA0100_uc002hbv.2_Nonsense_Mutation_p.E119*|KIAA0100_uc010crr.1_5'UTR	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor	119						extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					AAGGACAGTTCCTTTTGATCC	0.493													96	134	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26970224	26970224	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26970224C>A	uc002hbu.2	-	4	453	c.354G>T	c.(352-354)AAG>AAT	p.K118N	KIAA0100_uc002hbv.2_Missense_Mutation_p.K118N|KIAA0100_uc010crr.1_Translation_Start_Site	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor	118						extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					AGGACAGTTCCTTTTGATCCA	0.493													96	137	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29541520	29541520	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29541520A>G	uc002hgg.2	+	13	1777	c.1444A>G	c.(1444-1446)ACA>GCA	p.T482A	NF1_uc002hge.1_Missense_Mutation_p.T482A|NF1_uc002hgf.1_Missense_Mutation_p.T482A|NF1_uc002hgh.2_Missense_Mutation_p.T482A|NF1_uc010csn.1_Missense_Mutation_p.T342A	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	482					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AGAAAAACCTACAGACCTGGA	0.313			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			28	56	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29676265	29676265	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29676265A>T	uc002hgg.2	+	49	7650	c.7317A>T	c.(7315-7317)TTA>TTT	p.L2439F	NF1_uc002hgh.2_Missense_Mutation_p.L2418F|NF1_uc010cso.2_Missense_Mutation_p.L627F|NF1_uc010wbt.1_5'UTR|NF1_uc010wbu.1_RNA	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2439					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGGCCTACTTAGCAGGTAAAA	0.338			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			19	28	---	---	---	---	PASS
RHOT1	55288	broad.mit.edu	37	17	30526045	30526045	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30526045G>T	uc002hgz.2	+	12	1188	c.949G>T	c.(949-951)GAT>TAT	p.D317Y	RHOT1_uc002hgw.2_Missense_Mutation_p.D317Y|RHOT1_uc002hgy.2_Missense_Mutation_p.D317Y|RHOT1_uc002hha.2_Missense_Mutation_p.D190Y|RHOT1_uc010csv.2_RNA|RHOT1_uc002hgx.2_Missense_Mutation_p.D190Y|RHOT1_uc010wby.1_Missense_Mutation_p.D317Y|RHOT1_uc002hhb.2_Missense_Mutation_p.D296Y|RHOT1_uc002hgv.2_Missense_Mutation_p.D317Y	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN	ras homolog gene family, member T1 isoform 3	317	EF-hand 2.|2 (Probable).|Mitochondrial intermembrane (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				TGACAAGCATGATTTGGTAAG	0.328													117	92	---	---	---	---	PASS
AMAC1	146861	broad.mit.edu	37	17	33520727	33520727	+	Silent	SNP	G	T	T	rs147862619		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33520727G>T	uc002hjd.2	-	1	686	c.600C>A	c.(598-600)GGC>GGA	p.G200G		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	200	Helical; (Potential).					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)		ACAGCGCCAGGCCTCCCAGGA	0.602													65	119	---	---	---	---	PASS
KRTAP3-3	85293	broad.mit.edu	37	17	39150267	39150267	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39150267C>A	uc002hvr.1	-	1	119	c.83G>T	c.(82-84)TGT>TTT	p.C28F		NM_033185	NP_149441	Q9BYR6	KRA33_HUMAN	keratin associated protein 3-3	28	3 X 5 AA repeats of C-C-X(3).					keratin filament	structural molecule activity				0		Breast(137;0.00043)				GCAGACTCCACAGCGGCAGGA	0.612													79	77	---	---	---	---	PASS
SC65	10609	broad.mit.edu	37	17	39959557	39959557	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39959557C>G	uc002hxt.2	-	7	1557	c.1273G>C	c.(1273-1275)GGT>CGT	p.G425R	SC65_uc002hxu.2_Missense_Mutation_p.G516R	NM_006455	NP_006446	Q92791	SC65_HUMAN	synaptonemal complex protein SC65	425	Asp/Glu-rich (acidic).				synaptonemal complex assembly	nucleolus|synaptonemal complex	binding				0		Breast(137;0.000162)		BRCA - Breast invasive adenocarcinoma(366;0.149)		GCCTCGTCACCCTTGGCATCC	0.642													18	85	---	---	---	---	PASS
KCNH4	23415	broad.mit.edu	37	17	40330849	40330849	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40330849T>C	uc002hzb.2	-	2	605	c.272A>G	c.(271-273)CAG>CGG	p.Q91R		NM_012285	NP_036417	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H,	91	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	two-component sensor activity|voltage-gated potassium channel activity			large_intestine(1)	1		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CCGGTGCTCCTGGTGGCCCTC	0.597													29	82	---	---	---	---	PASS
RAMP2	10266	broad.mit.edu	37	17	40913878	40913878	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40913878G>T	uc002ibg.2	+	2	192	c.124G>T	c.(124-126)GCT>TCT	p.A42S	LOC100190938_uc002ibd.1_5'Flank|LOC100190938_uc002ibe.3_5'Flank|LOC100190938_uc002ibf.3_5'Flank|RAMP2_uc010cyt.2_Missense_Mutation_p.A42S|RAMP2_uc002ibh.2_Missense_Mutation_p.A42S	NM_005854	NP_005845	O60895	RAMP2_HUMAN	receptor activity modifying protein 2 precursor	42					intracellular protein transport|receptor-mediated endocytosis|regulation of G-protein coupled receptor protein signaling pathway	coated pit|integral to plasma membrane|lysosome	protein transporter activity				0		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0741)	Pramlintide(DB01278)	CGAGGCCCTGGCTCAGCCTCT	0.647													12	27	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41246004	41246004	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41246004T>A	uc002icq.2	-	10	1776	c.1544A>T	c.(1543-1545)GAG>GTG	p.E515V	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.E444V|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.E468V|BRCA1_uc002ict.2_Missense_Mutation_p.E515V|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.E515V|BRCA1_uc002ide.1_Missense_Mutation_p.E346V|BRCA1_uc010cyy.1_Missense_Mutation_p.E515V|BRCA1_uc010whs.1_Missense_Mutation_p.E515V|BRCA1_uc010cyz.2_Missense_Mutation_p.E468V|BRCA1_uc010cza.2_Missense_Mutation_p.E489V|BRCA1_uc010wht.1_Missense_Mutation_p.E219V	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	515					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GATAAAATCCTCAGGATGAAG	0.388			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			60	135	---	---	---	---	PASS
CRHR1	1394	broad.mit.edu	37	17	43893944	43893944	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43893944C>T	uc010dap.2	+	3	502	c.237C>T	c.(235-237)ACC>ACT	p.T79T	CRHR1_uc010wjx.1_5'UTR|CRHR1_uc002ijp.2_Missense_Mutation_p.P7L|CRHR1_uc002ijm.2_Silent_p.T79T|CRHR1_uc002ijn.2_Intron|CRHR1_uc010dar.2_Silent_p.T79T|CRHR1_uc010dao.2_Missense_Mutation_p.P7L|CRHR1_uc010daq.2_5'UTR|CRHR1_uc010das.1_RNA|CRHR1_uc002ijo.1_Intron	NM_001145146	NP_001138618	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	79	Extracellular (Potential).				female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		GCTACAATACCACAAGTAAGG	0.582													20	42	---	---	---	---	PASS
HOXB1	3211	broad.mit.edu	37	17	46608014	46608014	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46608014C>T	uc002ink.1	-	1	259	c.253G>A	c.(253-255)GCT>ACT	p.A85T		NM_002144	NP_002135	P14653	HXB1_HUMAN	homeobox B1	85						nucleus	protein domain specific binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GCGGCAGGAGCATACCCCGAG	0.657													40	78	---	---	---	---	PASS
MED13	9969	broad.mit.edu	37	17	60033202	60033202	+	Intron	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60033202G>A	uc002izo.2	-							NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						GCTCCAATCTGTGGGTATCAA	0.323													28	55	---	---	---	---	PASS
MED13	9969	broad.mit.edu	37	17	60033203	60033203	+	Intron	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60033203T>A	uc002izo.2	-							NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						CTCCAATCTGTGGGTATCAAC	0.328													28	55	---	---	---	---	PASS
TSEN54	283989	broad.mit.edu	37	17	73517538	73517538	+	Silent	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73517538G>T	uc002jof.1	+	7	603	c.570G>T	c.(568-570)GTG>GTT	p.V190V	TSEN54_uc002joe.1_3'UTR	NM_207346	NP_997229	Q7Z6J9	SEN54_HUMAN	tRNA splicing endonuclease 54 homolog	190					mRNA processing|tRNA splicing, via endonucleolytic cleavage and ligation	nucleolus				ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			ATGCCAGCGTGCAGCACTTGG	0.632													20	57	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76558032	76558032	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76558032G>C	uc002jvv.1	-	8	812	c.706C>G	c.(706-708)CGG>GGG	p.R236G						RecName: Full=Dynein heavy chain 17, axonemal; AltName: Full=Axonemal beta dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain-like protein 1; AltName: Full=Axonemal dynein heavy chain-like protein 1; AltName: Full=Dynein light chain 2, axonemal;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			ATCAGGGGCCGCTCCATGAGG	0.577													35	26	---	---	---	---	PASS
BAHCC1	57597	broad.mit.edu	37	17	79409552	79409552	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79409552A>G	uc002kaf.2	+	3	1177	c.1177A>G	c.(1177-1179)ACC>GCC	p.T393A	BAHCC1_uc002kae.2_5'Flank	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	393							DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			CAGCGGGCCCACCTTCGTGCC	0.731													9	10	---	---	---	---	PASS
WDR45L	56270	broad.mit.edu	37	17	80575231	80575231	+	Silent	SNP	G	A	A	rs145253791	byFrequency	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80575231G>A	uc002kfq.2	-	8	942	c.747C>T	c.(745-747)AGC>AGT	p.S249S	WDR45L_uc002kfr.2_RNA	NM_019613	NP_062559	Q5MNZ6	WIPI3_HUMAN	WDR45-like	249	WD 2.				autophagy|response to starvation	organelle membrane	phosphatidylinositol-3,5-bisphosphate binding			ovary(1)	1	Breast(20;0.00106)|all_neural(118;0.0952)	all_cancers(8;0.101)|all_epithelial(8;0.198)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.0835)			TGCCGTGGTCGCTGGATACGC	0.517													14	50	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6943296	6943296	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6943296T>C	uc002knm.2	-	62	9044	c.8950A>G	c.(8950-8952)AAA>GAA	p.K2984E	LAMA1_uc002knk.2_Missense_Mutation_p.K314E|LAMA1_uc002knl.2_Missense_Mutation_p.K437E|LAMA1_uc010wzj.1_Missense_Mutation_p.K2460E	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2984	Laminin G-like 5.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGTTTGCTTTTGTTAGCTTGA	0.488													46	154	---	---	---	---	PASS
PPP4R1	9989	broad.mit.edu	37	18	9557338	9557338	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9557338C>A	uc002koe.1	-	15	2189	c.2071G>T	c.(2071-2073)GCA>TCA	p.A691S	PPP4R1_uc002kof.2_Missense_Mutation_p.A108S|PPP4R1_uc010wzo.1_Missense_Mutation_p.A537S|PPP4R1_uc002kod.1_Missense_Mutation_p.A674S	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	691					protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1						AGAATAACTGCAAGCTCGTGG	0.388													208	55	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	14183733	14183733	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14183733T>C	uc010xag.1	+	2	584	c.286T>C	c.(286-288)TAT>CAT	p.Y96H	uc002ksv.1_5'Flank					RecName: Full=Putative ankyrin repeat domain-containing protein 20A5;																		GATTGATATCTATGACAAAGA	0.378													33	157	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31323871	31323871	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31323871C>T	uc010dmg.1	+	12	4114	c.4059C>T	c.(4057-4059)CTC>CTT	p.L1353L	ASXL3_uc002kxq.2_Silent_p.L1060L	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1353	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						TGCCAAACCTCTCCACTAGCT	0.453											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	218	78	---	---	---	---	PASS
CDH20	28316	broad.mit.edu	37	18	59206307	59206307	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59206307G>T	uc010dps.1	+	8	1471	c.1459G>T	c.(1459-1461)GTG>TTG	p.V487L	CDH20_uc002lif.2_Missense_Mutation_p.V481L	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	487	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)				AGTCTTAGATGTGAATGACAA	0.463													154	48	---	---	---	---	PASS
SERPINB13	5275	broad.mit.edu	37	18	61256064	61256064	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61256064G>T	uc002ljc.2	+	2	331	c.163G>T	c.(163-165)GAG>TAG	p.E55*	SERPINB13_uc002ljd.2_5'UTR|SERPINB13_uc010xep.1_Nonsense_Mutation_p.E55*|SERPINB13_uc010xeq.1_5'UTR|SERPINB13_uc010xer.1_5'UTR	NM_012397	NP_036529	Q9UIV8	SPB13_HUMAN	serine (or cysteine) proteinase inhibitor, clade	55					regulation of proteolysis|response to UV	cytoplasm|extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1						CCAGTTGGAGGAGGTTGGGCG	0.527													4	78	---	---	---	---	PASS
HMHA1	23526	broad.mit.edu	37	19	1073665	1073665	+	Intron	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1073665C>A	uc002lqz.1	+						HMHA1_uc010xgd.1_Intron|HMHA1_uc010xge.1_Intron|HMHA1_uc002lra.1_Intron|HMHA1_uc002lrb.1_Intron	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCTCGCTGGCCCTGCAGAGT	0.667													3	12	---	---	---	---	PASS
ZNF560	147741	broad.mit.edu	37	19	9578078	9578078	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9578078G>A	uc002mlp.1	-	10	1755	c.1545C>T	c.(1543-1545)CCC>CCT	p.P515P	ZNF560_uc010dwr.1_Silent_p.P409P	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560	515					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						AACACTTAAAGGGCTTCTCAC	0.408													128	41	---	---	---	---	PASS
ZNF121	7675	broad.mit.edu	37	19	9677376	9677376	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9677376T>G	uc010xkp.1	-	4	645	c.413A>C	c.(412-414)CAT>CCT	p.H138P	ZNF121_uc010dwt.2_Missense_Mutation_p.H138P|ZNF121_uc010xkq.1_Missense_Mutation_p.H138P	NM_001008727	NP_001008727	P58317	ZN121_HUMAN	zinc finger protein 121	138	C2H2-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTCTACAGTATGCATTTTAAC	0.388													31	17	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10602473	10602473	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10602473C>G	uc002moq.1	-	3	1261	c.1105G>C	c.(1105-1107)GTG>CTG	p.V369L	KEAP1_uc002mop.1_Missense_Mutation_p.V87L|KEAP1_uc002mor.1_Missense_Mutation_p.V369L	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	369	Kelch 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			CCGCCCACCACGCAGCCGGCC	0.677													6	2	---	---	---	---	PASS
KANK2	25959	broad.mit.edu	37	19	11280921	11280921	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11280921C>G	uc010dxv.2	-	13	2773	c.2215G>C	c.(2215-2217)GGA>CGA	p.G739R	KANK2_uc002mqm.2_Missense_Mutation_p.G747R|KANK2_uc002mqo.3_Missense_Mutation_p.G739R|KANK2_uc002mqp.1_Missense_Mutation_p.G548R	NM_015493	NP_056308	Q63ZY3	KANK2_HUMAN	ankyrin repeat domain 25 isoform 1	739	ANK 3.										0						GCCGTCTGTCCTGCCTGGGGA	0.612													22	10	---	---	---	---	PASS
PRKCSH	5589	broad.mit.edu	37	19	11547248	11547248	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11547248C>G	uc002mrt.2	+	3	454	c.118C>G	c.(118-120)CTG>GTG	p.L40V	CCDC151_uc002mrs.2_5'Flank|CCDC151_uc010dxz.2_5'Flank|PRKCSH_uc002mru.2_Missense_Mutation_p.L40V|PRKCSH_uc010xlz.1_Missense_Mutation_p.L40V|PRKCSH_uc010dya.2_Silent_p.A8A|PRKCSH_uc002mrv.1_Missense_Mutation_p.L40V|PRKCSH_uc010dyb.2_Missense_Mutation_p.L40V	NM_002743	NP_002734	P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H isoform 1	40					innate immune response|intracellular protein kinase cascade|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen	calcium ion binding|protein kinase C binding				0						TTTCACCTGCCTGGACGGTTC	0.532													43	14	---	---	---	---	PASS
ZNF443	10224	broad.mit.edu	37	19	12542492	12542492	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12542492C>A	uc002mtu.2	-	4	692	c.494G>T	c.(493-495)GGA>GTA	p.G165V		NM_005815	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	165					induction of apoptosis|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						TGGTTTCTTTCCAGTGTGAAG	0.428													100	46	---	---	---	---	PASS
MAST1	22983	broad.mit.edu	37	19	12963060	12963060	+	Silent	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12963060A>T	uc002mvm.2	+	9	1136	c.1008A>T	c.(1006-1008)CCA>CCT	p.P336P	MAST1_uc002mvk.2_Silent_p.P332P	NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase	336					cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						ACCCCTTTCCAGGTGCCGGCT	0.662													26	13	---	---	---	---	PASS
KLHL26	55295	broad.mit.edu	37	19	18778777	18778777	+	Silent	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18778777G>C	uc002njz.1	+	3	597	c.570G>C	c.(568-570)CGG>CGC	p.R190R		NM_018316	NP_060786	Q53HC5	KLH26_HUMAN	kelch-like 26	190	BACK.									ovary(1)	1						TCACCTTCCGGCACTTCCTGC	0.642													24	14	---	---	---	---	PASS
ZNF100	163227	broad.mit.edu	37	19	21910245	21910245	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21910245C>G	uc002nqi.2	-	5	1068	c.869G>C	c.(868-870)AGA>ACA	p.R290T	ZNF100_uc002nqh.2_Missense_Mutation_p.R226T	NM_173531	NP_775802	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	290	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTCTTCACATCTGTATGGTTT	0.398													42	20	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30935660	30935660	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30935660C>A	uc002nsu.1	+	2	1329	c.1191C>A	c.(1189-1191)AAC>AAA	p.N397K	ZNF536_uc010edd.1_Missense_Mutation_p.N397K	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	397					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					TCCACCTCAACAAGCTGTCGG	0.612													47	70	---	---	---	---	PASS
ZNF461	92283	broad.mit.edu	37	19	37130209	37130209	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37130209T>G	uc002oem.2	-	6	1266	c.1038A>C	c.(1036-1038)GAA>GAC	p.E346D	ZNF461_uc002oen.2_Missense_Mutation_p.E315D|ZNF461_uc010xtj.1_Missense_Mutation_p.E323D	NM_153257	NP_694989	Q8TAF7	ZN461_HUMAN	gonadotropin inducible transcription repressor	346	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GTCGCAGGTGTTCAGTAAGTT	0.393													8	78	---	---	---	---	PASS
CATSPERG	57828	broad.mit.edu	37	19	38860826	38860826	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38860826C>G	uc002oih.3	+	28	3228	c.3141C>G	c.(3139-3141)AAC>AAG	p.N1047K	CATSPERG_uc002oig.3_Missense_Mutation_p.N1007K|CATSPERG_uc002oif.3_Missense_Mutation_p.N687K|CATSPERG_uc010efw.2_RNA	NM_021185	NP_067008	Q6ZRH7	CTSRG_HUMAN	cation channel, sperm-associated, gamma	1047	Extracellular (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)|skin(1)	2						CCTACTGCAACTACCAGCTCA	0.617													5	59	---	---	---	---	PASS
PAPL	390928	broad.mit.edu	37	19	39589135	39589135	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39589135G>A	uc002oki.2	+	3	433	c.159G>A	c.(157-159)TGG>TGA	p.W53*	PAPL_uc010egl.2_Nonsense_Mutation_p.W53*	NM_001004318	NP_001004318	Q6ZNF0	PAPL_HUMAN	iron/zinc purple acid phosphatase-like protein	53						extracellular region	acid phosphatase activity|metal ion binding				0						GGACCACATGGGTCCCAACCC	0.647													17	64	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40357380	40357380	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40357380C>A	uc002omp.3	-	34	15941	c.15933G>T	c.(15931-15933)GTG>GTT	p.V5311V		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	5311	VWFD 13.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AACTTACCCACACACCCTTGT	0.527													30	52	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40368654	40368654	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40368654T>C	uc002omp.3	-	28	12702	c.12694A>G	c.(12694-12696)AAT>GAT	p.N4232D		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	4232	VWFD 10.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGTGTGCCATTAGGGAAGACC	0.642													28	245	---	---	---	---	PASS
CYP2F1	1572	broad.mit.edu	37	19	41630695	41630695	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41630695A>T	uc002opu.1	+	8	1092	c.1036A>T	c.(1036-1038)ATG>TTG	p.M346L	CYP2F1_uc010xvw.1_Intron|CYP2F1_uc010xvv.1_3'UTR|CYP2F1_uc002opv.1_RNA	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,	346					naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						CCGCGCGGCCATGCCTTACAC	0.677													7	17	---	---	---	---	PASS
PSG7	5676	broad.mit.edu	37	19	43439811	43439811	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43439811G>C	uc002ovl.3	-	2	277	c.175C>G	c.(175-177)CCC>GCC	p.P59A	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_Intron	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7	59	Ig-like V-type.				female pregnancy	extracellular region					0		Prostate(69;0.00682)				AGATTCTGGGGCAAATTGTGG	0.448													109	204	---	---	---	---	PASS
PSG6	5675	broad.mit.edu	37	19	43585288	43585288	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43585288G>C	uc002ovi.2	-	2	268	c.175C>G	c.(175-177)CCC>GCC	p.P59A	PSG6_uc010xwk.1_Intron|PSG2_uc002ovr.2_Missense_Mutation_p.P59A|PSG2_uc002ovq.3_Missense_Mutation_p.P59A|PSG2_uc010eiq.1_Missense_Mutation_p.P59A|PSG2_uc002ovs.3_Missense_Mutation_p.P59A|PSG2_uc002ovt.3_Missense_Mutation_p.P59A			Q00889	PSG6_HUMAN	SubName: Full=Putative uncharacterized protein PSG6;	59	Ig-like V-type.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				AGATTCTGGGGCAAATTGTGG	0.448													7	308	---	---	---	---	PASS
PSG5	5673	broad.mit.edu	37	19	43690491	43690491	+	Intron	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43690491C>A	uc002ovu.2	-						PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_5'Flank|PSG5_uc002ovx.2_Intron|PSG5_uc002ovv.2_Intron|PSG5_uc002ovw.2_Intron	NM_002781	NP_002772	Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5						female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)				GTTCTCTCCTCACCTGTGAGC	0.552													71	126	---	---	---	---	PASS
ZNF230	7773	broad.mit.edu	37	19	44514667	44514667	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44514667A>T	uc002oyb.1	+	5	727	c.476A>T	c.(475-477)CAG>CTG	p.Q159L		NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	159	KRNB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				GATCCTCCTCAGCAGTTCCAC	0.433													95	154	---	---	---	---	PASS
PRKD2	25865	broad.mit.edu	37	19	47207526	47207526	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47207526C>A	uc002pfh.2	-	6	1131	c.789G>T	c.(787-789)GTG>GTT	p.V263V	PRKD2_uc002pfg.2_Silent_p.V106V|PRKD2_uc002pfi.2_Silent_p.V263V|PRKD2_uc002pfj.2_Silent_p.V263V|PRKD2_uc010xye.1_Silent_p.V263V|PRKD2_uc002pfk.2_Silent_p.V106V	NM_001079881	NP_001073350	Q9BZL6	KPCD2_HUMAN	protein kinase D2 isoform A	263					cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		AGGTGTGCGGCACCTTGACCT	0.597											OREG0025578	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	38	48	---	---	---	---	PASS
LIG1	3978	broad.mit.edu	37	19	48619233	48619233	+	Intron	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48619233G>A	uc002pia.1	-						LIG1_uc010xze.1_Intron|LIG1_uc002phz.1_Intron|LIG1_uc002pib.1_Intron|LIG1_uc010xzf.1_Intron|LIG1_uc010xzg.1_Intron	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I						anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	CTGCGGAAGCGGGATGGAGAC	0.617								NER					10	14	---	---	---	---	PASS
GRIN2D	2906	broad.mit.edu	37	19	48922880	48922880	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48922880T>C	uc002pjc.3	+	9	1988	c.1900T>C	c.(1900-1902)TGG>CGG	p.W634R	GRIN2D_uc010elx.2_5'UTR	NM_000836	NP_000827	O15399	NMDE4_HUMAN	N-methyl-D-aspartate receptor subunit 2D	634	Cytoplasmic (Potential).					cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|protein binding			ovary(3)|breast(3)	6		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Orphenadrine(DB01173)	GAAATCCATCTGGCTGCTCTG	0.572													39	64	---	---	---	---	PASS
DBP	1628	broad.mit.edu	37	19	49136751	49136751	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49136751G>C	uc002pjx.3	-	3	1100	c.712C>G	c.(712-714)CAG>GAG	p.Q238E	DBP_uc002pjy.2_3'UTR|DBP_uc010elz.1_Missense_Mutation_p.Q238E	NM_001352	NP_001343	Q10586	DBP_HUMAN	D site of albumin promoter (albumin D-box)	238	Pro-rich (proline/acidic region (PAR)).				regulation of transcription from RNA polymerase II promoter|rhythmic process	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		ATGATTGGCTGGGGCTTAAGT	0.537													100	494	---	---	---	---	PASS
TEAD2	8463	broad.mit.edu	37	19	49863137	49863137	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49863137G>A	uc002pnj.2	-	2	287	c.196C>T	c.(196-198)CGG>TGG	p.R66W	TEAD2_uc002png.2_Missense_Mutation_p.R66W|TEAD2_uc002pnh.2_Missense_Mutation_p.R66W|TEAD2_uc002pni.2_Missense_Mutation_p.R66W|TEAD2_uc010yao.1_Intron|TEAD2_uc010emw.2_Missense_Mutation_p.R66W	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2	66	TEA.				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		ATTATTTTCCGGCGGCCGCAG	0.557													38	119	---	---	---	---	PASS
LRRC4B	94030	broad.mit.edu	37	19	51021381	51021381	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51021381G>A	uc002pss.2	-	3	1726	c.1589C>T	c.(1588-1590)GCG>GTG	p.A530V		NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor	530	Gly-rich.|Extracellular (Potential).					cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		AGGGCCGGCCGCGTCCCCAGG	0.736													5	5	---	---	---	---	PASS
CLEC11A	6320	broad.mit.edu	37	19	51226814	51226814	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51226814T>A	uc002psy.2	+	1	210	c.32T>A	c.(31-33)GTG>GAG	p.V11E		NM_002975	NP_002966	Q9Y240	CLC11_HUMAN	stem cell growth factor precursor	11					positive regulation of cell proliferation	cytoplasm|extracellular region	growth factor activity|sugar binding			ovary(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		GGGGCTTTGGTGGTCCCCCAG	0.418													51	60	---	---	---	---	PASS
KLK8	11202	broad.mit.edu	37	19	51503952	51503952	+	Intron	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51503952G>T	uc002pur.1	-						KLK9_uc002puw.1_Intron|KLK8_uc002puq.1_Silent_p.L31L|KLK8_uc002pus.1_Intron|KLK8_uc002put.1_Intron|KLK8_uc002puu.1_Intron|KLK9_uc002puv.1_Intron	NM_007196	NP_009127	O60259	KLK8_HUMAN	kallikrein 8 isoform 1 preproprotein						cell death|keratinocyte proliferation|memory|negative regulation of axon regeneration|negative regulation of myelination|neuron projection morphogenesis|proteolysis|regulation of synapse organization|response to wounding	cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			central_nervous_system(1)	1		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		ACAACTTAGTGAGGAGGTCCA	0.567													32	45	---	---	---	---	PASS
KLK13	26085	broad.mit.edu	37	19	51559890	51559890	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51559890C>A	uc002pvn.2	-	5	831	c.788G>T	c.(787-789)CGA>CTA	p.R263L	KLK13_uc002pvl.2_RNA|KLK13_uc002pvm.2_RNA|KLK13_uc002pvo.2_RNA|KLK13_uc002pvp.2_RNA|KLK13_uc010eon.2_Missense_Mutation_p.R190L|KLK13_uc002pvq.2_RNA|KLK13_uc010eoo.2_Missense_Mutation_p.R111L	NM_015596	NP_056411	Q9UKR3	KLK13_HUMAN	kallikrein 13 precursor	263	Peptidase S1.				proteolysis		protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00432)		TTCATATTTTCGGATTGTTTC	0.512													148	228	---	---	---	---	PASS
SIGLEC9	27180	broad.mit.edu	37	19	51628465	51628465	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51628465C>G	uc002pvu.2	+	1	301	c.234C>G	c.(232-234)AAC>AAG	p.N78K	SIGLEC9_uc010yct.1_Missense_Mutation_p.N78K	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9 precursor	78	Extracellular (Potential).|Ig-like V-type.				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CCACAAACAACCCAGCTCGGG	0.577													28	68	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51918132	51918132	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51918132A>T	uc002pwo.2	-	8	2177	c.1561T>A	c.(1561-1563)TGT>AGT	p.C521S	SIGLEC10_uc002pwp.2_Missense_Mutation_p.C463S|SIGLEC10_uc002pwq.2_Intron|SIGLEC10_uc002pwr.2_Intron|SIGLEC10_uc010ycy.1_Intron|SIGLEC10_uc010ycz.1_Intron|SIGLEC10_uc010eow.2_Intron|SIGLEC10_uc002pws.1_Intron	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	521	Extracellular (Potential).				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		CAGGCCTCACAGCGGAGCCTG	0.667													36	119	---	---	---	---	PASS
ZNF320	162967	broad.mit.edu	37	19	53385123	53385123	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53385123A>T	uc002qag.2	-	4	447	c.256T>A	c.(256-258)TGC>AGC	p.C86S	ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Missense_Mutation_p.C32S|ZNF320_uc002qai.2_Missense_Mutation_p.C86S	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320	86					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		TCCTGGGAGCAAAATGCTCCA	0.398													128	200	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	53418495	53418495	+	IGR	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53418495T>A								ZNF320 (17549 upstream) : ZNF321 (11893 downstream)																							CGTCTCTGTATAGAGTCCTCT	0.468													94	131	---	---	---	---	PASS
ZNF331	55422	broad.mit.edu	37	19	54080616	54080616	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54080616G>T	uc002qbx.1	+	7	2236	c.802G>T	c.(802-804)GAG>TAG	p.E268*	ZNF331_uc002qby.1_Nonsense_Mutation_p.E268*|ZNF331_uc002qbz.1_Nonsense_Mutation_p.E268*|ZNF331_uc002qca.1_Nonsense_Mutation_p.E268*|ZNF331_uc010eqr.1_Nonsense_Mutation_p.E268*|ZNF331_uc002qcb.1_Nonsense_Mutation_p.E268*|ZNF331_uc002qcc.1_Nonsense_Mutation_p.E268*|ZNF331_uc002qcd.1_Nonsense_Mutation_p.E268*	NM_018555	NP_061025	Q9NQX6	ZN331_HUMAN	zinc finger protein 331	268					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)	6				GBM - Glioblastoma multiforme(134;0.00555)		TCATAGTGGGGAGAAGCCTTA	0.428			T	?	follicular thyroid adenoma								50	93	---	---	---	---	PASS
LILRB2	10288	broad.mit.edu	37	19	54780770	54780770	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54780770G>A	uc002qfb.2	-	10	1640	c.1374C>T	c.(1372-1374)CAC>CAT	p.H458H	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Silent_p.H458H|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Silent_p.H457H|LILRB2_uc010yet.1_Silent_p.H342H	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	458	Extracellular (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CAACCCCCAGGTGCCTTCCCA	0.323													23	34	---	---	---	---	PASS
LILRA5	353514	broad.mit.edu	37	19	54823222	54823222	+	Silent	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54823222T>C	uc002qfe.2	-	4	441	c.321A>G	c.(319-321)ACA>ACG	p.T107T	LILRA5_uc002qff.2_Silent_p.T95T|LILRA5_uc010yev.1_Silent_p.T107T|LILRA5_uc010yew.1_Silent_p.T95T|LILRA5_uc002qfh.1_Silent_p.T95T|LILRA5_uc002qfg.1_Silent_p.T107T	NM_021250	NP_067073	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor subfamily	107	Extracellular (Potential).|Ig-like C2-type 1.				innate immune response	extracellular region|integral to membrane	receptor activity			upper_aerodigestive_tract(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CATGGTGCTCTGTCATGGATG	0.577													134	220	---	---	---	---	PASS
LILRB4	11006	broad.mit.edu	37	19	55178211	55178211	+	Intron	SNP	G	T	T	rs141237818	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55178211G>T	uc002qgp.2	+						LILRB4_uc002qgq.2_Intron|LILRB4_uc002qgr.2_Intron|LILRB4_uc010ert.2_Intron|LILRB4_uc010eru.2_Intron	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,							integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)		GTGAgaacccgcccctgtccc	0.279													46	80	---	---	---	---	PASS
KIR3DL1	3811	broad.mit.edu	37	19	55341617	55341617	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55341617C>A	uc002qhk.3	+	9	1285	c.1222C>A	c.(1222-1224)CAG>AAG	p.Q408K	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Missense_Mutation_p.Q333K|KIR3DL1_uc010esf.2_Missense_Mutation_p.Q313K|KIR3DL1_uc010yfo.1_Missense_Mutation_p.Q350K|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_5'Flank|KIR2DS4_uc002qhm.1_5'Flank	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	408	Cytoplasmic (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		CGTTTTCACACAGAGAAAAAT	0.498													193	327	---	---	---	---	PASS
NCR1	9437	broad.mit.edu	37	19	55418142	55418142	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55418142A>G	uc002qib.2	+	3	370	c.332A>G	c.(331-333)AAC>AGC	p.N111S	NCR1_uc002qic.2_Missense_Mutation_p.N111S|NCR1_uc002qie.2_Missense_Mutation_p.N111S|NCR1_uc002qid.2_Intron|NCR1_uc002qif.2_Intron|NCR1_uc010esj.2_Intron	NM_004829	NP_004820	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	111	Ig-like 1.|Extracellular (Potential).				cellular defense response|natural killer cell activation|regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane|SWI/SNF complex	receptor activity|receptor signaling protein activity			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(193;0.0449)		GAGCCCAGCAACTTGCTGGAT	0.502													50	79	---	---	---	---	PASS
PTPRH	5794	broad.mit.edu	37	19	55715298	55715298	+	Silent	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55715298A>T	uc002qjq.2	-	5	811	c.738T>A	c.(736-738)ACT>ACA	p.T246T	PTPRH_uc010esv.2_Intron|PTPRH_uc002qjs.2_Silent_p.T253T	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	246	Extracellular (Potential).|Fibronectin type-III 3.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CACCATCTCCAGTGCACTGAA	0.577													65	92	---	---	---	---	PASS
BRSK1	84446	broad.mit.edu	37	19	55815127	55815127	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55815127G>A	uc002qkg.2	+	12	1496	c.1219G>A	c.(1219-1221)GAT>AAT	p.D407N	BRSK1_uc002qkf.2_Missense_Mutation_p.D423N|BRSK1_uc002qkh.2_Missense_Mutation_p.D102N	NM_032430	NP_115806	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	407					establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		GAGCATCACCGATGCCGGGGG	0.667													29	116	---	---	---	---	PASS
ZNF579	163033	broad.mit.edu	37	19	56089943	56089943	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56089943C>A	uc002qlh.2	-	2	1116	c.1063G>T	c.(1063-1065)GCG>TCG	p.A355S		NM_152600	NP_689813	Q8NAF0	ZN579_HUMAN	zinc finger protein 579	355	Gly-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.106)		CCGCACTCCGCCCCCTCGCCC	0.597													2	1	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57325172	57325172	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57325172G>C	uc002qnu.2	-	7	4989	c.4638C>G	c.(4636-4638)ATC>ATG	p.I1546M	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.I1517M|PEG3_uc002qnv.2_Missense_Mutation_p.I1546M|PEG3_uc002qnw.2_Missense_Mutation_p.I1422M|PEG3_uc002qnx.2_Missense_Mutation_p.I1420M|PEG3_uc010etr.2_Missense_Mutation_p.I1546M	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	1546					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TGGCACGTTCGATGTAGCCTG	0.517													70	104	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57641313	57641313	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57641313G>T	uc002qny.2	+	4	1626	c.1270G>T	c.(1270-1272)GTT>TTT	p.V424F		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	424					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGTTTGCCCTGTTGTTGCTAA	0.388													92	154	---	---	---	---	PASS
ZIK1	284307	broad.mit.edu	37	19	58101882	58101882	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58101882G>T	uc002qpg.2	+	4	800	c.703G>T	c.(703-705)GGA>TGA	p.G235*	ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Nonsense_Mutation_p.G180*|ZIK1_uc002qpi.2_Nonsense_Mutation_p.G222*|ZIK1_uc002qpj.2_Nonsense_Mutation_p.G132*	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein	235					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AGTCTACACTGGAAAAAAGCT	0.468													35	70	---	---	---	---	PASS
ZSCAN4	201516	broad.mit.edu	37	19	58189414	58189414	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58189414A>G	uc002qpu.2	+	4	1226	c.529A>G	c.(529-531)ACT>GCT	p.T177A		NM_152677	NP_689890	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	177					telomere maintenance via telomere lengthening|viral reproduction	nuclear chromosome, telomeric region	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ACCCTCCCAGACTTCCCAAGA	0.438													51	70	---	---	---	---	PASS
C20orf141	128653	broad.mit.edu	37	20	2796245	2796245	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2796245G>C	uc010gat.2	+	3	405	c.322G>C	c.(322-324)GGT>CGT	p.G108R	C20orf141_uc002wgv.1_Intron|C20orf141_uc002wgw.2_Missense_Mutation_p.G108R|uc002wgx.1_5'Flank|uc002wgy.1_5'Flank	NM_080739	NP_542777	Q9NUB4	CT141_HUMAN	hypothetical protein LOC128653	108	Leu-rich.					integral to membrane					0						TCAGGGGGCCGGTGAAGGTCC	0.607													29	18	---	---	---	---	PASS
CST8	10047	broad.mit.edu	37	20	23473592	23473592	+	Intron	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23473592C>A	uc002wth.1	+							NM_005492	NP_005483	O60676	CST8_HUMAN	cystatin 8 precursor							extracellular region	cysteine-type endopeptidase inhibitor activity				0	Colorectal(13;0.0431)|Lung NSC(19;0.235)					TGCTAACCAACAGGTCACAAA	0.338													162	141	---	---	---	---	PASS
ASXL1	171023	broad.mit.edu	37	20	31024449	31024449	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31024449G>T	uc002wxs.2	+	12	4360	c.3934G>T	c.(3934-3936)GCA>TCA	p.A1312S	ASXL1_uc010geb.2_Missense_Mutation_p.A1203S	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	1312					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding	p.A1312V(1)		haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						GAATGTGGCTGCAACCCTTCA	0.567			F|N|Mis		MDS|CMML								30	81	---	---	---	---	PASS
GDF5	8200	broad.mit.edu	37	20	34021838	34021838	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34021838C>A	uc002xck.1	-	2	1694	c.1375G>T	c.(1375-1377)GAG>TAG	p.E459*	GDF5_uc010gfc.1_Nonsense_Mutation_p.E459*|uc002xcj.2_Silent_p.L83L|GDF5_uc010zvc.1_Nonsense_Mutation_p.E459*	NM_000557	NP_000548	P43026	GDF5_HUMAN	growth differentiation factor 5 preproprotein	459					cartilage development|cell-cell signaling|growth|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			GGTGTGGACTCGGGGTCCATG	0.582													42	35	---	---	---	---	PASS
ZNF335	63925	broad.mit.edu	37	20	44592562	44592562	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44592562C>A	uc002xqw.2	-	8	1293	c.1170G>T	c.(1168-1170)GAG>GAT	p.E390D	ZNF335_uc010zxk.1_Missense_Mutation_p.E235D	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	390					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				AGCTGGGAGCCTCGGGATCCT	0.627													52	30	---	---	---	---	PASS
RBM38	55544	broad.mit.edu	37	20	55966871	55966871	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55966871C>T	uc010zzj.1	+	1	409	c.234C>T	c.(232-234)GGC>GGT	p.G78G	RBM38_uc010zzk.1_Silent_p.G78G	NM_017495	NP_059965	Q9H0Z9	RBM38_HUMAN	RNA-binding region containing protein 1 isoform	78	RRM.				3'-UTR-mediated mRNA stabilization|cell cycle|cell cycle arrest|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mRNA processing|negative regulation of cell proliferation|regulation of RNA splicing|RNA splicing	cytosol|cytosol|nucleus|nucleus	mRNA 3'-UTR binding|mRNA binding|nucleotide binding|RNA binding				0	Lung NSC(12;0.00242)|all_lung(29;0.00767)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.55e-12)|Epithelial(14;9.49e-09)|all cancers(14;5.01e-08)			GCGGCTACGGCTTCGTAAGTg	0.552													5	3	---	---	---	---	PASS
KCNQ2	3785	broad.mit.edu	37	20	62065179	62065179	+	Silent	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62065179G>T	uc002yey.1	-	8	1278	c.1101C>A	c.(1099-1101)GTC>GTA	p.V367V	KCNQ2_uc002yez.1_Silent_p.V367V|KCNQ2_uc002yfa.1_Silent_p.V367V|KCNQ2_uc002yfb.1_Silent_p.V367V|KCNQ2_uc011aax.1_Silent_p.V367V|KCNQ2_uc002yfc.1_Silent_p.V367V	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein	367	Cytoplasmic (Potential).				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	TGGGCACGGTGACCGTTCGCT	0.542													113	61	---	---	---	---	PASS
PCMTD2	55251	broad.mit.edu	37	20	62896781	62896781	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62896781A>T	uc002yil.3	+	4	781	c.581A>T	c.(580-582)AAG>ATG	p.K194M	PCMTD2_uc002yim.3_Missense_Mutation_p.K194M	NM_018257	NP_060727	Q9NV79	PCMD2_HUMAN	protein-L-isoaspartate (D-aspartate)	194						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					CTGGAAGAGAAGGTCAGATTC	0.284													54	38	---	---	---	---	PASS
LIPI	149998	broad.mit.edu	37	21	15554143	15554143	+	Silent	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15554143T>A	uc002yjm.2	-	4	652	c.642A>T	c.(640-642)CCA>CCT	p.P214P	LIPI_uc010gkw.1_Silent_p.P147P	NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN	lipase, member I	193					lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		TGCTATATGGTGGTTTTCTGG	0.398													41	29	---	---	---	---	PASS
CLDN17	26285	broad.mit.edu	37	21	31538288	31538288	+	Silent	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31538288A>T	uc011acv.1	-	1	648	c.648T>A	c.(646-648)CTT>CTA	p.L216L		NM_012131	NP_036263	P56750	CLD17_HUMAN	claudin 17	216	Cytoplasmic (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	Golgi apparatus|integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(2)	2						AGGTCTTACTAAGCATTGTCG	0.433													50	130	---	---	---	---	PASS
KRTAP13-1	140258	broad.mit.edu	37	21	31768854	31768854	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31768854C>T	uc002yoa.2	+	1	463	c.450C>T	c.(448-450)ACC>ACT	p.T150T		NM_181599	NP_853630	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	150						intermediate filament				ovary(1)	1						GCCGCCCAACCTACTTGGCTT	0.517													15	34	---	---	---	---	PASS
KRTAP19-5	337972	broad.mit.edu	37	21	31874249	31874249	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31874249C>A	uc011ada.1	-	1	160	c.160G>T	c.(160-162)GGA>TGA	p.G54*		NM_181611	NP_853642	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	54						intermediate filament	protein binding				0						CTGCGGTATCCATAGCCTCCG	0.537													64	78	---	---	---	---	PASS
KRTAP19-5	337972	broad.mit.edu	37	21	31874250	31874250	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31874250A>T	uc011ada.1	-	1	159	c.159T>A	c.(157-159)TAT>TAA	p.Y53*		NM_181611	NP_853642	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	53						intermediate filament	protein binding				0						TGCGGTATCCATAGCCTCCGA	0.537													64	80	---	---	---	---	PASS
RIPK4	54101	broad.mit.edu	37	21	43161307	43161307	+	Silent	SNP	G	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43161307G>A	uc002yzn.1	-	8	2094	c.2046C>T	c.(2044-2046)CAC>CAT	p.H682H		NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3	682						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						CAGTGGCCAGGTGTCCGTTGC	0.682													40	118	---	---	---	---	PASS
MCM3AP	8888	broad.mit.edu	37	21	47676828	47676828	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47676828G>T	uc002zir.1	-	17	3843	c.3807C>A	c.(3805-3807)TGC>TGA	p.C1269*	MCM3AP_uc002zip.1_Nonsense_Mutation_p.C10*|MCM3AP_uc002ziq.1_Nonsense_Mutation_p.C196*	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	1269					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					TCACGTCCACGCAGCAGGGCG	0.642													11	15	---	---	---	---	PASS
CDC45	8318	broad.mit.edu	37	22	19483537	19483537	+	Silent	SNP	A	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19483537A>G	uc002zpr.2	+	7	652	c.576A>G	c.(574-576)GAA>GAG	p.E192E	CDC45_uc011agz.1_Silent_p.E187E|CDC45_uc011aha.1_Silent_p.E224E|CDC45_uc002zps.2_Silent_p.E192E|CDC45_uc002zpt.2_Silent_p.E146E	NM_003504	NP_003495	O75419	CDC45_HUMAN	CDC45-like	192					DNA replication checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	centrosome|nucleoplasm	protein binding			lung(1)	1						AGCAGTATGAATATCATGGGA	0.368													450	126	---	---	---	---	PASS
GGT1	2678	broad.mit.edu	37	22	25010801	25010801	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25010801G>T	uc003aan.1	+	6	710	c.223G>T	c.(223-225)GTG>TTG	p.V75L	GGT1_uc003aas.1_Missense_Mutation_p.V75L|GGT1_uc003aat.1_Missense_Mutation_p.V75L|GGT1_uc003aau.1_Missense_Mutation_p.V75L|GGT1_uc003aav.1_Missense_Mutation_p.V75L|GGT1_uc003aaw.1_Missense_Mutation_p.V75L|GGT1_uc003aax.1_Missense_Mutation_p.V75L	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	75	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	CCTGTTGTGTGTGGGGCTCAT	0.607													44	25	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26342180	26342180	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26342180C>G	uc003abz.1	+	35	5845	c.5595C>G	c.(5593-5595)CAC>CAG	p.H1865Q	MYO18B_uc003aca.1_Missense_Mutation_p.H1746Q|MYO18B_uc010guy.1_Missense_Mutation_p.H1747Q|MYO18B_uc010guz.1_Missense_Mutation_p.H1745Q|MYO18B_uc011aka.1_Missense_Mutation_p.H1019Q|MYO18B_uc011akb.1_Missense_Mutation_p.H1378Q	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1865	Tail.|Potential.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						AGAGCATGCACAGCGAGCTGG	0.597													2	4	---	---	---	---	PASS
EMID1	129080	broad.mit.edu	37	22	29628307	29628307	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29628307G>T	uc003aen.2	+	8	808	c.733G>T	c.(733-735)GGA>TGA	p.G245*	EMID1_uc003aem.2_Nonsense_Mutation_p.G247*|EMID1_uc003aeo.2_Nonsense_Mutation_p.G247*|EMID1_uc003aep.2_Nonsense_Mutation_p.G247*	NM_133455	NP_597712	Q96A84	EMID1_HUMAN	EMI domain containing 1	245	Collagen-like.					collagen					0						TGGAGAGAGGGGACCTCCTGG	0.697													24	18	---	---	---	---	PASS
THOC5	8563	broad.mit.edu	37	22	29917005	29917005	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29917005T>G	uc003afr.2	-	14	1594	c.1259A>C	c.(1258-1260)TAT>TCT	p.Y420S	THOC5_uc003afq.2_Missense_Mutation_p.Y81S|THOC5_uc003afs.2_Missense_Mutation_p.Y420S|THOC5_uc003aft.2_Missense_Mutation_p.Y420S|THOC5_uc003afu.2_Missense_Mutation_p.Y420S|THOC5_uc010gvo.2_Missense_Mutation_p.Y164S	NM_001002878	NP_001002878	Q13769	THOC5_HUMAN	THO complex 5	420					intronless viral mRNA export from host nucleus|monocyte differentiation|mRNA processing|primitive hemopoiesis|RNA splicing	cytoplasm|intermediate filament cytoskeleton|THO complex part of transcription export complex	protein binding|RNA binding			breast(3)	3						ATCAAACTGATACTGATTGGC	0.458													52	178	---	---	---	---	PASS
ISX	91464	broad.mit.edu	37	22	35478551	35478551	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35478551C>A	uc003anj.2	+	2	1221	c.270C>A	c.(268-270)ACC>ACA	p.T90T	ISX_uc011amg.1_Silent_p.T78T	NM_001008494	NP_001008494	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	90	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)	5						CCACCTTCACCACTGAGCAGC	0.567													18	98	---	---	---	---	PASS
ENTHD1	150350	broad.mit.edu	37	22	40139939	40139939	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40139939C>G	uc003ayg.2	-	7	1820	c.1569G>C	c.(1567-1569)CAG>CAC	p.Q523H		NM_152512	NP_689725	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	523										ovary(2)|skin(1)	3	Melanoma(58;0.0749)					GAGGGATGAACTGGTCTACAT	0.408													19	50	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3235239	3235239	+	Silent	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3235239T>C	uc004crg.3	-	6	6640	c.6483A>G	c.(6481-6483)GGA>GGG	p.G2161G		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2161	Ig-like C2-type 6.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGAGGGTTCCTCCGTACCTGA	0.687													5	2	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3238595	3238595	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3238595T>C	uc004crg.3	-	5	5288	c.5131A>G	c.(5131-5133)AGA>GGA	p.R1711G		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	1711						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				ACTGGGTTTCTTGCCTCAGGG	0.433													18	106	---	---	---	---	PASS
PHEX	5251	broad.mit.edu	37	X	22095826	22095826	+	Intron	SNP	A	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22095826A>C	uc004dah.2	+						PHEX_uc011mjr.1_Intron|PHEX_uc011mjs.1_Intron	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase						biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						TGAAGGTATAATGAGGACCCA	0.423													105	23	---	---	---	---	PASS
MAGEB6	158809	broad.mit.edu	37	X	26212413	26212413	+	Silent	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26212413A>T	uc004dbr.2	+	2	599	c.450A>T	c.(448-450)GGA>GGT	p.G150G	MAGEB6_uc010ngc.1_5'UTR	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	150	Ser-rich.									ovary(3)	3						AGTCTCAGGGAGCTTCACCCA	0.517													18	9	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	29972727	29972727	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29972727C>A	uc004dby.2	+	10	1798	c.1290C>A	c.(1288-1290)GCC>GCA	p.A430A		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	430	Cytoplasmic (Potential).|TIR.				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						AACGTTTTGCCCTTGAAATCC	0.348													28	16	---	---	---	---	PASS
MAGEB1	4112	broad.mit.edu	37	X	30269642	30269642	+	Silent	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30269642C>A	uc004dcc.2	+	4	1352	c.1032C>A	c.(1030-1032)TCC>TCA	p.S344S	MAGEB1_uc004dcd.2_Silent_p.S344S|MAGEB1_uc004dce.2_Silent_p.S344S	NM_002363	NP_002354	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	344											0						GCAGGTCCTCCCACCCCATGT	0.512													12	8	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37026573	37026573	+	Silent	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37026573C>T	uc004ddl.1	+	1	104	c.90C>T	c.(88-90)TTC>TTT	p.F30F		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	30										ovary(3)	3						CCAAGTACTTCGCGAAGCGCA	0.642													11	19	---	---	---	---	PASS
WDR13	64743	broad.mit.edu	37	X	48463413	48463413	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48463413A>T	uc004dkh.1	+	10	1598	c.1451A>T	c.(1450-1452)CAG>CTG	p.Q484L	WDR13_uc004dki.1_Missense_Mutation_p.Q392L|WDR13_uc004dkj.1_Missense_Mutation_p.Q484L|WDR13_uc004dkk.1_Missense_Mutation_p.Q392L|WDR13_uc004dkl.3_Missense_Mutation_p.Q392L	NM_017883	NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13 protein	484	WD 5.					cytoplasm|nucleus				ovary(2)	2						AGGCGGGAGCAGAAGTAGGGT	0.602													15	7	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73062809	73062809	+	RNA	SNP	T	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73062809T>A	uc004ebm.1	-	1		c.9780A>T				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						TACCTGTGATTTTACACACTG	0.453													58	9	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73963708	73963708	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73963708C>A	uc004eby.2	-	3	1301	c.684G>T	c.(682-684)GAG>GAT	p.E228D		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	228					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						GAGCCGGATCCTCCAAGTCAA	0.478													116	45	---	---	---	---	PASS
P2RY10	27334	broad.mit.edu	37	X	78216657	78216657	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78216657A>T	uc004ede.2	+	4	1009	c.640A>T	c.(640-642)ATC>TTC	p.I214F	P2RY10_uc004edf.2_Missense_Mutation_p.I214F	NM_014499	NP_055314	O00398	P2Y10_HUMAN	G-protein coupled purinergic receptor P2Y10	214	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(2)|breast(1)	5						AGTGATCATCATCGCATGGTG	0.473													40	24	---	---	---	---	PASS
TBX22	50945	broad.mit.edu	37	X	79286062	79286062	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79286062C>A	uc010nmg.1	+	9	1149	c.1015C>A	c.(1015-1017)CTT>ATT	p.L339I	TBX22_uc004edi.1_Missense_Mutation_p.L219I|TBX22_uc004edj.1_Missense_Mutation_p.L339I	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN	T-box 22 isoform 1	339					multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						GAACTCCTTACTTTCTCCACT	0.483													106	27	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91066259	91066259	+	Translation_Start_Site	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91066259C>A	uc004efh.1	+	3	510	c.-79C>A	c.(-81--77)GACTG>GAATG			NM_032967	NP_116749	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform b precursor						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						ACTATGAGGACTGAACGACAG	0.388													43	15	---	---	---	---	PASS
TNMD	64102	broad.mit.edu	37	X	99854605	99854605	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99854605C>A	uc004efy.3	+	7	1071	c.845C>A	c.(844-846)CCT>CAT	p.P282H	TNMD_uc004efz.2_3'UTR	NM_022144	NP_071427	Q9H2S6	TNMD_HUMAN	tenomodulin	282	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1						GTCTGTGAACCTTTACTAGGC	0.502													23	9	---	---	---	---	PASS
SRPX2	27286	broad.mit.edu	37	X	99917334	99917334	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99917334C>T	uc004egb.2	+	4	805	c.325C>T	c.(325-327)CGT>TGT	p.R109C		NM_014467	NP_055282	O60687	SRPX2_HUMAN	sushi-repeat-containing protein, X-linked 2	109	Sushi 1.				angiogenesis|cell motility|cell-cell adhesion|positive regulation of cell migration involved in sprouting angiogenesis|regulation of phosphorylation	cytoplasm|extracellular region	receptor binding			ovary(2)	2						CCTGCCAAGCCGTCGTTGGTC	0.557													35	42	---	---	---	---	PASS
GLA	2717	broad.mit.edu	37	X	100656649	100656649	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100656649T>C	uc004ehl.1	-	3	628	c.518A>G	c.(517-519)TAC>TGC	p.Y173C	GLA_uc011mrj.1_Missense_Mutation_p.Y173C	NM_000169	NP_000160	P06280	AGAL_HUMAN	alpha-galactosidase A precursor	173					glycoside catabolic process|glycosphingolipid catabolic process|glycosylceramide catabolic process|negative regulation of nitric oxide biosynthetic process|negative regulation of nitric-oxide synthase activity|oligosaccharide metabolic process	extracellular region|Golgi apparatus|lysosome	cation binding|protein homodimerization activity|raffinose alpha-galactosidase activity|receptor binding				0					Agalsidase beta(DB00103)	ACTGTCACAGTAACAACCATC	0.443													55	94	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123654451	123654451	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123654451C>A	uc004euj.2	-	18	3281	c.3217G>T	c.(3217-3219)GCC>TCC	p.A1073S	ODZ1_uc011muj.1_Missense_Mutation_p.A1072S|ODZ1_uc010nqy.2_Missense_Mutation_p.A1073S	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1073	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TTAATTGCGGCGGGAAACCAC	0.473													119	14	---	---	---	---	PASS
MAGEA11	4110	broad.mit.edu	37	X	148797279	148797279	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148797279G>T	uc004fdq.2	+	4	310	c.208G>T	c.(208-210)GCC>TCC	p.A70S	HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|MAGEA11_uc004fdr.2_Missense_Mutation_p.A41S	NM_005366	NP_005357	P43364	MAGAB_HUMAN	melanoma antigen family A, 11 isoform a	70						cytoplasm|nucleus	protein binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					TAGAGAACAGGCCAACCTGGA	0.507													82	23	---	---	---	---	PASS
RPS4Y2	140032	broad.mit.edu	37	Y	22918696	22918696	+	Silent	SNP	T	G	G			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:22918696T>G	uc011nbb.1	+	2	132	c.36T>G	c.(34-36)GTT>GTG	p.V12V		NM_001039567	NP_001034656	Q8TD47	RS4Y2_HUMAN	ribosomal protein S4, Y-linked 2	12					translation	ribosome	rRNA binding|structural constituent of ribosome				0						TGAAGCGTGTTGCAGCGCCGA	0.433													45	6	---	---	---	---	PASS
CHD5	26038	broad.mit.edu	37	1	6206386	6206386	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6206386delC	uc001amb.1	-	11	1788	c.1688delG	c.(1687-1689)GGCfs	p.G563fs	CHD5_uc001ama.1_5'Flank|CHD5_uc001amc.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	563					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CTCGCTCTTGCCGTCTTCATC	0.542													71	76	---	---	---	---	
FAAH	2166	broad.mit.edu	37	1	46872228	46872228	+	Intron	DEL	T	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46872228delT	uc001cpu.2	+						FAAH_uc001cpv.2_Intron	NM_001441	NP_001432	O00519	FAAH1_HUMAN	fatty acid amide hydrolase						fatty acid catabolic process	cytoplasm|cytoskeleton|endomembrane system|integral to membrane|organelle membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|fatty acid amide hydrolase activity			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	ATCCTCAGGCTTTTTTTTTTT	0.328													4	2	---	---	---	---	
PPAP2B	8613	broad.mit.edu	37	1	56962018	56962018	+	3'UTR	DEL	C	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56962018delC	uc001cyj.1	-	7						NM_177414	NP_803133	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B						canonical Wnt receptor signaling pathway involved in positive regulation of cell-cell adhesion|canonical Wnt receptor signaling pathway involved in positive regulation of endothelial cell migration|canonical Wnt receptor signaling pathway involved in positive regulation of wound healing|germ cell migration|homotypic cell-cell adhesion|negative regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|sphingolipid metabolic process	adherens junction|Golgi apparatus|integral to membrane	phosphatidate phosphatase activity|phosphoprotein phosphatase activity|protein binding|sphingosine-1-phosphate phosphatase activity				0						GACTCTGGCACTTGGTGTTAG	0.388													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121137816	121137816	+	IGR	DEL	C	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121137816delC								FCGR1B (201872 upstream) : LOC647121 (123094 downstream)																							CGGCTTTTTGCCCCCCCGCCG	0.667													9	5	---	---	---	---	
TBX19	9095	broad.mit.edu	37	1	168262598	168262598	+	Intron	DEL	G	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168262598delG	uc001gfl.2	+						TBX19_uc001gfj.3_Intron	NM_005149	NP_005140	O60806	TBX19_HUMAN	T-box 19						anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)					CAGGATGGGCGGGGGGGGTCC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	199130171	199130172	+	IGR	INS	-	G	G	rs145131094	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199130171_199130172insG								MIR181A1 (301889 upstream) : NR5A2 (866598 downstream)																							gaaggaaggaagaaggaaggaa	0.084													4	3	---	---	---	---	
C2orf48	348738	broad.mit.edu	37	2	10295168	10295168	+	Intron	DEL	A	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10295168delA	uc002rai.1	+							NM_182626	NP_872432	Q96LS8	CB048_HUMAN	hypothetical protein LOC348738												0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)		ATTGCTCTGTAAAAAAAAAAA	0.294													4	2	---	---	---	---	
SMC6	79677	broad.mit.edu	37	2	17959524	17959525	+	Intron	INS	-	ACAT	ACAT	rs10626431	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17959524_17959525insACAT	uc010exo.2	-						GEN1_uc002rct.2_Intron|GEN1_uc010yjs.1_Intron|GEN1_uc002rcu.2_Intron	NM_024624	NP_078900	Q96SB8	SMC6_HUMAN	SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					tgtatacacacatatgtgtgta	0.000													4	2	---	---	---	---	
APOB	338	broad.mit.edu	37	2	21239159	21239159	+	Intron	DEL	A	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21239159delA	uc002red.2	-							NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor						cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	actccatctcaaaaaaaaaaa	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89472135	89472142	+	Intron	DEL	GTGTGTGT	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89472135_89472142delGTGTGTGT	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		ATTGCGGCGCgtgtgtgtgtgtgtgtgt	0.216													6	3	---	---	---	---	
RBMS1	5937	broad.mit.edu	37	2	161133998	161133998	+	Intron	DEL	G	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161133998delG	uc002ubo.2	-						RBMS1_uc002ubj.2_Intron|RBMS1_uc002ubk.2_Intron|RBMS1_uc002ubl.2_Intron|RBMS1_uc002ubn.2_Intron|RBMS1_uc002ubi.3_Intron|RBMS1_uc002ubm.2_Intron|RBMS1_uc002ubp.2_Intron	NM_016836	NP_058520	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting						DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding				0						AAATCTCAAAGAAGAAATTTA	0.343													25	21	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179446298	179446299	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179446298_179446299delAC	uc010zfg.1	-	265	59216_59217	c.58992_58993delGT	c.(58990-58995)GTGTATfs	p.V19664fs	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Frame_Shift_Del_p.V13359fs|TTN_uc010zfi.1_Frame_Shift_Del_p.V13292fs|TTN_uc010zfj.1_Frame_Shift_Del_p.V13167fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20591_20592							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAACGGCATACACACGGAATT	0.441													71	33	---	---	---	---	
COQ10B	80219	broad.mit.edu	37	2	198324935	198324935	+	Intron	DEL	T	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198324935delT	uc002uuh.1	+						COQ10B_uc010fsl.1_Intron	NM_025147	NP_079423	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B precursor							mitochondrial inner membrane					0			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			GGCCtttttcttttttttttt	0.209													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	229605255	229605258	+	IGR	DEL	CTTC	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229605255_229605258delCTTC								SPHKAP (558894 upstream) : PID1 (283432 downstream)																							cttcttctttcttccttccttcct	0.005													4	2	---	---	---	---	
POLN	353497	broad.mit.edu	37	4	2130804	2130804	+	Intron	DEL	G	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2130804delG	uc003ger.2	-						POLN_uc010icg.1_Intron|POLN_uc010ich.1_Intron	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			aaaaaaaaaagaaTTTATTTG	0.149								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	95332244	95332245	+	IGR	INS	-	AAGG	AAGG	rs141921585	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95332244_95332245insAAGG								HPGDS (68217 upstream) : PDLIM5 (40793 downstream)																							aaagaaagaaaaaggaaggaag	0.074													3	3	---	---	---	---	
SLC6A18	348932	broad.mit.edu	37	5	1245073	1245074	+	Intron	INS	-	CT	CT	rs145699992	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1245073_1245074insCT	uc003jby.1	+							NM_182632	NP_872438	Q96N87	S6A18_HUMAN	solute carrier family 6, member 18						cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GTGCAGCGCCCGAGTGCCCGCT	0.624													2	9	---	---	---	---	
MCCC2	64087	broad.mit.edu	37	5	70939896	70939899	+	Intron	DEL	GTGC	-	-	rs71859051		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70939896_70939899delGTGC	uc003kbs.3	+						MCCC2_uc003kbt.3_Intron	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)						leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	gtgtgtgtgtgtgcgcgcgtgtgt	0.201													4	2	---	---	---	---	
FAM13B	51306	broad.mit.edu	37	5	137290194	137290195	+	Intron	INS	-	AC	AC	rs151026681	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137290194_137290195insAC	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						catacacacatacacacacaca	0.228													4	3	---	---	---	---	
FLT4	2324	broad.mit.edu	37	5	180049871	180049872	+	Intron	INS	-	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180049871_180049872insT	uc003mma.3	-						FLT4_uc003mlz.3_Intron|FLT4_uc003mmb.1_Intron|FLT4_uc011dgy.1_Intron	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	GATCCATTTCCTGCCCAAGTTC	0.564									Congenital_Hereditary_Lymphedema				2	15	---	---	---	---	
KLHL31	401265	broad.mit.edu	37	6	53516197	53516198	+	3'UTR	INS	-	AAAAAAA	AAAAAAA	rs67397082		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53516197_53516198insAAAAAAA	uc003pcb.3	-	3					uc003pcc.1_5'Flank	NM_001003760	NP_001003760	Q9H511	KLH31_HUMAN	kelch repeat and BTB (POZ) domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent					ovary(1)	1	Lung NSC(77;0.0158)					TGTATTTTGCTaaaaaaaaaaa	0.396											OREG0017507	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PRSS37	136242	broad.mit.edu	37	7	141539002	141539002	+	Intron	DEL	C	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141539002delC	uc003vws.1	-						PRSS37_uc011krk.1_Intron|PRSS37_uc011krl.1_Intron|PRSS37_uc003vwt.1_Intron	NM_001008270	NP_001008271	A4D1T9	PRS37_HUMAN	protease, serine, 37 precursor						proteolysis	extracellular region	serine-type endopeptidase activity			skin(1)	1						aatagcactgccccctggttg	0.025													6	8	---	---	---	---	
TRPV5	56302	broad.mit.edu	37	7	142630780	142630781	+	5'UTR	DEL	TG	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142630780_142630781delTG	uc003wby.1	-	1					TRPV5_uc003wbz.2_5'UTR	NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,						protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					ctgtggtgtatgtgtgtgcatg	0.218													3	4	---	---	---	---	
ASB10	136371	broad.mit.edu	37	7	150878702	150878702	+	Intron	DEL	T	-	-	rs112543142		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150878702delT	uc003wjm.1	-						ASB10_uc003wjl.1_Intron|ASB10_uc003wjn.1_Intron	NM_001142459	NP_001135931	Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box-containing 10						intracellular signal transduction						0			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGTGCCCttcttttttttttt	0.284													6	6	---	---	---	---	
UBE3C	9690	broad.mit.edu	37	7	156971613	156971614	+	Intron	DEL	TG	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156971613_156971614delTG	uc010lqs.2	+						UBE3C_uc003wnf.2_Intron|UBE3C_uc003wng.2_Intron	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C						protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		AGCCTGCTGCTGTGAGCCTGTG	0.535													24	31	---	---	---	---	
DLC1	10395	broad.mit.edu	37	8	12960257	12960257	+	Intron	DEL	C	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12960257delC	uc003wwm.2	-						DLC1_uc003wwk.1_Intron|DLC1_uc003wwl.1_Intron|DLC1_uc011kxx.1_Intron	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						TTTTTGTTTGCCCCTTTTCCC	0.358													81	49	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	64445822	64445823	+	IGR	INS	-	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64445822_64445823insT								YTHDF3 (320477 upstream) : MIR124-2 (845883 downstream)																							tccttccttccttccttccttc	0.015													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96977957	96977964	+	IGR	DEL	AGGGAAGG	-	-	rs67336860		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96977957_96977964delAGGGAAGG								C8orf37 (696520 upstream) : GDF6 (176596 downstream)																							gaaggaaggaagggaaggaaggaaggaa	0.125													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	104130484	104130485	+	5'Flank	INS	-	AAAA	AAAA	rs140200328	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104130484_104130485insAAAA	uc003ylb.1	+											Homo sapiens cDNA FLJ10489 fis, clone NT2RP2000232.																		aaggaaggaaggaaggaaggaa	0.233													4	3	---	---	---	---	
EBAG9	9166	broad.mit.edu	37	8	110576655	110576656	+	Intron	DEL	TG	-	-	rs73700655	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110576655_110576656delTG	uc003ynf.2	+						EBAG9_uc003yng.2_Intron	NM_198120	NP_936056	O00559	RCAS1_HUMAN	estrogen receptor binding site associated						apoptosis|regulation of cell growth	focal adhesion|Golgi membrane|integral to membrane|soluble fraction	apoptotic protease activator activity				0			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)			AGTAAAAGTATGTTTCTTTTCA	0.342													32	84	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113353775	113353775	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113353775delG	uc003ynu.2	-	42	6742	c.6583delC	c.(6583-6585)CATfs	p.H2195fs	CSMD3_uc003yns.2_Frame_Shift_Del_p.H1397fs|CSMD3_uc003ynt.2_Frame_Shift_Del_p.H2155fs|CSMD3_uc011lhx.1_Frame_Shift_Del_p.H2091fs	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2195	Extracellular (Potential).|CUB 12.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CTGGTTTCATGGGTGGTGCTG	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			73	137	---	---	---	---	
ZHX2	22882	broad.mit.edu	37	8	123799327	123799328	+	Intron	INS	-	GT	GT	rs142849253	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123799327_123799328insGT	uc003ypk.1	+							NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2							cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GATTGGCAGTGgtgtgtgtgtg	0.356													4	2	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139648723	139648724	+	Intron	INS	-	AG	AG	rs72095793		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139648723_139648724insAG	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			aagagaaggaagaaaggaaagg	0.248										HNSCC(7;0.00092)			6	5	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139774831	139774832	+	Intron	INS	-	CA	CA	rs5895560		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139774831_139774832insCA	uc003yvd.2	-						COL22A1_uc011ljo.1_5'Flank	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AAACGCACGTGcacacacacac	0.302										HNSCC(7;0.00092)			10	8	---	---	---	---	
SLC28A3	64078	broad.mit.edu	37	9	86895090	86895090	+	Intron	DEL	T	-	-	rs35540005		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86895090delT	uc010mpz.2	-						SLC28A3_uc011lsy.1_Intron|SLC28A3_uc004anu.1_Intron	NM_022127	NP_071410	Q9HAS3	S28A3_HUMAN	concentrative Na+-nucleoside cotransporter						nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						GTCAGCTGACTTTTTTTTTTT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	27620447	27620448	+	IGR	INS	-	TT	TT	rs142562667	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27620447_27620448insTT								LOC387646 (79212 upstream) : PTCHD3 (66669 downstream)																							ACTCAGGCTTCTTTCCGCCAAG	0.465													3	3	---	---	---	---	
PPRC1	23082	broad.mit.edu	37	10	103909505	103909505	+	Intron	DEL	G	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103909505delG	uc001kum.2	+						PPRC1_uc001kun.2_Intron|PPRC1_uc010qqj.1_Intron|PPRC1_uc009xxa.2_Intron|NOLC1_uc001kuo.2_5'Flank|NOLC1_uc001kup.2_5'Flank|NOLC1_uc001kuq.2_5'Flank|NOLC1_uc009xxb.1_5'Flank|NOLC1_uc001kur.2_5'Flank	NM_015062	NP_055877	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		aaaaaaaaaaGACCCAAGGGG	0.249													3	3	---	---	---	---	
WNK1	65125	broad.mit.edu	37	12	968798	968799	+	Intron	INS	-	GT	GT	rs112501353	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:968798_968799insGT	uc001qio.3	+						WNK1_uc001qip.3_Intron|WNK1_uc001qir.3_5'Flank	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GTGTGTGTGTGTTTTTTTTTTT	0.272													6	4	---	---	---	---	
RBMS2	5939	broad.mit.edu	37	12	56930346	56930346	+	Intron	DEL	T	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56930346delT	uc001sln.2	+						RBMS2_uc010sqp.1_Intron|RBMS2_uc010sqq.1_Intron|RBMS2_uc009zou.2_Intron	NM_002898	NP_002889	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting						RNA processing	nucleus	nucleotide binding|RNA binding				0						tccttctttcttttttttttt	0.060													4	2	---	---	---	---	
GALNT4	8693	broad.mit.edu	37	12	89919630	89919631	+	5'Flank	DEL	AC	-	-	rs145526963	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89919630_89919631delAC	uc001tbd.2	-						POC1B_uc001tba.2_5'Flank|POC1B_uc001tbb.2_5'Flank|POC1B_uc001tbc.2_Intron|POC1B_uc010sun.1_Intron|GALNT4_uc001tbe.2_Intron|GALNT4_uc010suo.1_Intron	NM_003774	NP_003765	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4						carbohydrate metabolic process	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0						CCAGGGAGGGACCCCCCCCACC	0.673													4	2	---	---	---	---	
SRRM4	84530	broad.mit.edu	37	12	119560098	119560105	+	Intron	DEL	AGGAAGGA	-	-	rs146974381	by1000genomes	TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119560098_119560105delAGGAAGGA	uc001txa.1	+							NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						gcaggaaggcaggaaggaaggaaggaag	0.197													5	3	---	---	---	---	
N6AMT2	221143	broad.mit.edu	37	13	21321602	21321602	+	Intron	DEL	T	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21321602delT	uc001uno.1	-						N6AMT2_uc009zzr.1_Intron|N6AMT2_uc001unp.2_Intron	NM_174928	NP_777588	Q8WVE0	N6MT2_HUMAN	N-6 adenine-specific DNA methyltransferase 2								methyltransferase activity|nucleic acid binding				0		all_cancers(29;5.91e-19)|all_epithelial(30;1.42e-15)|all_lung(29;5.9e-14)|Lung SC(185;0.0367)		all cancers(112;0.000234)|Epithelial(112;0.000471)|OV - Ovarian serous cystadenocarcinoma(117;0.0111)|Lung(94;0.0161)|LUSC - Lung squamous cell carcinoma(192;0.0431)		AGGCACAttcttttttttttt	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22918912	22918913	+	Intron	INS	-	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22918912_22918913insA	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wdw.2_Intron|uc001wdx.3_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CTTCCGAAAGCAAACCTGTCCC	0.490													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	52754387	52754387	+	IGR	DEL	A	-	-	rs72414119		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52754387delA								PTGDR (10946 upstream) : PTGER2 (26629 downstream)																							aaagtataataaaaaaaaaaa	0.095													4	2	---	---	---	---	
C14orf37	145407	broad.mit.edu	37	14	58727897	58727898	+	Intron	INS	-	T	T	rs11402145		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58727897_58727898insT	uc010tro.1	-						PSMA3_uc001xdj.1_Intron|PSMA3_uc001xdk.1_Intron	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor							integral to membrane	binding				0						GTCCAACAGAAttttttttttt	0.109													4	3	---	---	---	---	
KIAA0586	9786	broad.mit.edu	37	14	58937239	58937240	+	Intron	DEL	AC	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58937239_58937240delAC	uc001xdv.3	+						KIAA0586_uc010trr.1_Intron|KIAA0586_uc001xdt.3_Intron|KIAA0586_uc001xdu.3_Intron|KIAA0586_uc010trs.1_Intron|KIAA0586_uc010trt.1_Intron|KIAA0586_uc010tru.1_Intron	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein											ovary(1)	1						atatgtgtatacacacacacat	0.178													7	10	---	---	---	---	
RGS6	9628	broad.mit.edu	37	14	72961683	72961685	+	Intron	DEL	ATA	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72961683_72961685delATA	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron|RGS6_uc010ttp.1_Intron|RGS6_uc001xmz.1_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		TATGTTCGTTATAAGAAGGAAAT	0.330													3	6	---	---	---	---	
CPSF2	53981	broad.mit.edu	37	14	92627275	92627276	+	Intron	INS	-	GG	GG			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92627275_92627276insGG	uc001yah.1	+							NM_017437	NP_059133	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2						histone mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	hydrolase activity|protein binding|RNA binding			ovary(2)	2		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		TGTTAAATAATGGGGTAAAATT	0.322													6	3	---	---	---	---	
MARK3	4140	broad.mit.edu	37	14	103925146	103925147	+	Intron	INS	-	TTA	TTA			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103925146_103925147insTTA	uc001ymz.3	+						MARK3_uc001ymx.3_Intron|MARK3_uc001ymw.3_Intron|MARK3_uc001yna.3_Intron|MARK3_uc001ymy.3_Intron|MARK3_uc010awp.2_Intron	NM_001128918	NP_001122390	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3								ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|stomach(1)	4		Melanoma(154;0.155)	Epithelial(46;0.241)			AGTGATAGGACTTATTAAGTTT	0.297													3	4	---	---	---	---	
MEFV	4210	broad.mit.edu	37	16	3296554	3296555	+	Intron	INS	-	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3296554_3296555insA	uc002cun.1	-							NM_000243	NP_000234	O15553	MEFV_HUMAN	Mediterranean fever protein						inflammatory response	cytoplasm|microtubule|microtubule associated complex|nucleus	actin binding|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|lung(1)	6					Colchicine(DB01394)	TGTCCTAGGAGAAAAAAGAAGG	0.550													39	26	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	20981350	20981350	+	Intron	DEL	G	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20981350delG	uc010vbe.1	-						DNAH3_uc010vbd.1_Intron	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TGAGTGCCCAGGGCCTGGCAC	0.582													30	23	---	---	---	---	
ABCC12	94160	broad.mit.edu	37	16	48167439	48167439	+	Intron	DEL	A	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48167439delA	uc002efc.1	-						ABCC12_uc002eey.1_Intron|ABCC12_uc002eez.1_Intron|ABCC12_uc002efa.1_Intron|ABCC12_uc002efb.1_Intron|ABCC12_uc002efd.1_Intron|ABCC12_uc002efe.1_Intron	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				cctgtctcagaaaaaaaaaaa	0.219													6	3	---	---	---	---	
CNOT1	23019	broad.mit.edu	37	16	58622794	58622794	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58622794delC	uc002env.2	-	3	412	c.119delG	c.(118-120)GGTfs	p.G40fs	CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Frame_Shift_Del_p.G40fs|CNOT1_uc002enx.2_Frame_Shift_Del_p.G40fs|CNOT1_uc002enz.1_5'UTR	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	40					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TGCCTCAGGACCGTGCCGATT	0.373													18	32	---	---	---	---	
HYDIN	54768	broad.mit.edu	37	16	70902623	70902624	+	Frame_Shift_Ins	INS	-	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70902623_70902624insT	uc002ezr.2	-	66	11284_11285	c.11156_11157insA	c.(11155-11157)AACfs	p.N3719fs	HYDIN_uc010cfy.2_5'Flank	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3720										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				TATTCTTTAGGTTGATGGGTAC	0.510													29	74	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25289230	25289233	+	IGR	DEL	TCTA	-	-	rs138697975		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25289230_25289233delTCTA								None (None upstream) : WSB1 (331873 downstream)																							GTTTGTTACCTCTATCTATTGACT	0.343													4	8	---	---	---	---	
MAPT	4137	broad.mit.edu	37	17	44039763	44039763	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44039763delG	uc002ijr.3	+	2	380	c.60delG	c.(58-60)TTGfs	p.L20fs	MAPT_uc010dau.2_Frame_Shift_Del_p.L20fs|MAPT_uc002ijs.3_Frame_Shift_Del_p.L20fs|MAPT_uc002ijx.3_Frame_Shift_Del_p.L20fs|MAPT_uc002ijt.3_Frame_Shift_Del_p.L20fs|MAPT_uc002iju.3_Frame_Shift_Del_p.L20fs|MAPT_uc002ijv.3_Frame_Shift_Del_p.L20fs	NM_016835	NP_058519	P10636	TAU_HUMAN	microtubule-associated protein tau isoform 1	20					cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)				CGTACGGGTTGGGGGACAGGA	0.577													37	27	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62070286	62070289	+	IGR	DEL	AGGA	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62070286_62070289delAGGA								SCN4A (20008 upstream) : C17orf72 (5422 downstream)																							ggaaggaaggaggaaggaaggaag	0.132													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	52646248	52646248	+	IGR	DEL	G	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52646248delG								ZNF616 (3057 upstream) : ZNF836 (11879 downstream)																							GTGATATAGCGGAAGTGCCTT	0.368													7	9	---	---	---	---	
ZNFX1	57169	broad.mit.edu	37	20	47870567	47870567	+	Intron	DEL	T	-	-	rs11353174		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47870567delT	uc002xui.2	-							NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1								metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ttcttttttcttttttttttt	0.194													5	4	---	---	---	---	
SIK1	150094	broad.mit.edu	37	21	44841253	44841254	+	Intron	INS	-	A	A			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44841253_44841254insA	uc002zdf.2	-							NM_173354	NP_775490	P57059	SIK1_HUMAN	salt-inducible kinase 1						anoikis|cell cycle|cell differentiation|intracellular protein kinase cascade|multicellular organismal development|regulation of cell differentiation|regulation of mitotic cell cycle	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(2)|testis(2)|ovary(1)|central_nervous_system(1)|skin(1)	7						AAAATCTGAGCGGCAAAGAAAC	0.579													106	47	---	---	---	---	
COL6A1	1291	broad.mit.edu	37	21	47410424	47410424	+	Intron	DEL	C	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47410424delC	uc002zhu.1	+							NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	gtgaaggtgacccggggaggg	0.104													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	19649028	19649031	+	IGR	DEL	CCTC	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19649028_19649031delCCTC								LOC150185 (94666 upstream) : SEPT5 (52956 downstream)																							CCATtttcttcctccctcccttcc	0.265													1	5	---	---	---	---	
EGFL6	25975	broad.mit.edu	37	X	13637475	13637475	+	Intron	DEL	A	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13637475delA	uc004cvi.2	+						EGFL6_uc004cvj.2_Intron	NM_015507	NP_056322	Q8IUX8	EGFL6_HUMAN	epidermal growth factor-like protein 6						cell adhesion|cell cycle|cell differentiation|multicellular organismal development	basement membrane|extracellular space|membrane	calcium ion binding|integrin binding			breast(2)	2						GTAAACCCCCAAGGGAAAAAT	0.373													2	4	---	---	---	---	
POLA1	5422	broad.mit.edu	37	X	24735993	24735994	+	Intron	INS	-	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24735993_24735994insT	uc004dbl.2	+						POLA1_uc004dbm.2_Intron|POLA1_uc004dbn.2_Intron	NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	gtttatttctgttttttttttc	0.252													4	2	---	---	---	---	
POLA1	5422	broad.mit.edu	37	X	24753779	24753780	+	Intron	INS	-	T	T			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24753779_24753780insT	uc004dbl.2	+							NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	CTGCAAGATAGTTTTTTTTTTT	0.351													3	3	---	---	---	---	
WAS	7454	broad.mit.edu	37	X	48547644	48547644	+	Intron	DEL	G	-	-			TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48547644delG	uc004dkm.3	+							NM_000377	NP_000368	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome protein						blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity			ovary(1)	1		all_lung(315;1.27e-10)				TATTGATGGAGGGGCGGGGAG	0.592			Mis|N|F|S			lymphoma			Wiskott-Aldrich_syndrome				3	3	---	---	---	---	
SRPK3	26576	broad.mit.edu	37	X	153048657	153048657	+	Intron	DEL	A	-	-	rs112360480		TCGA-66-2756-01	TCGA-66-2756-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153048657delA	uc004fil.2	+						SRPK3_uc004fik.2_Intron|SRPK3_uc010nul.2_Intron|SRPK3_uc004fin.2_Intron|SRPK3_uc004fim.2_Intron	NM_014370	NP_055185	Q9UPE1	SRPK3_HUMAN	serine arginine rich protein-specific kinase 3						cell differentiation|muscle organ development|muscle tissue development		ATP binding|protein serine/threonine kinase activity			pancreas(2)|lung(1)	3	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GTCCCCCCCCACCGCTCCCCA	0.677													9	4	---	---	---	---	
