Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIF1B	23095	broad.mit.edu	37	1	10364623	10364623	+	Intron	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10364623G>A	uc001aqx.3	+						KIF1B_uc001aqv.3_Missense_Mutation_p.C1127Y|KIF1B_uc001aqw.3_Intron|KIF1B_uc001aqy.2_Intron|KIF1B_uc001aqz.2_Intron|KIF1B_uc001ara.2_Intron|KIF1B_uc001arb.2_Intron	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CCCAGCCACTGTAGCCAGTTT	0.478													27	28	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10425162	10425162	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10425162G>A	uc001aqx.3	+	42	4573	c.4371G>A	c.(4369-4371)ATG>ATA	p.M1457I	KIF1B_uc001aqw.3_Missense_Mutation_p.M1411I|KIF1B_uc001aqy.2_Missense_Mutation_p.M1431I|KIF1B_uc001aqz.2_Missense_Mutation_p.M1457I|KIF1B_uc001ara.2_Missense_Mutation_p.M1417I|KIF1B_uc001arb.2_Missense_Mutation_p.M1443I	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	1457					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TCTTAGGTATGCAGAGAAGGA	0.373													26	39	---	---	---	---	PASS
CASZ1	54897	broad.mit.edu	37	1	10716794	10716794	+	Splice_Site	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10716794C>G	uc001aro.2	-	8	1730	c.1410_splice	c.e8-1	p.R470_splice	CASZ1_uc001arp.1_Splice_Site_p.R470_splice|CASZ1_uc009vmx.2_Splice_Site_p.R494_splice	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GCCCGAGAACCTGGAGGGAGG	0.532													3	4	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11297936	11297936	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11297936G>A	uc001asd.2	-	13	2293	c.2172C>T	c.(2170-2172)GCC>GCT	p.A724A		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	724					cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						GCATGACAAAGGCAGGGTTCA	0.557													27	44	---	---	---	---	PASS
CLCN6	1185	broad.mit.edu	37	1	11898493	11898493	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11898493G>A	uc001ate.3	+	21	2510	c.2397G>A	c.(2395-2397)ATG>ATA	p.M799I	CLCN6_uc010oat.1_Missense_Mutation_p.M515I|CLCN6_uc010oau.1_Missense_Mutation_p.M777I|CLCN6_uc010oav.1_5'Flank|CLCN6_uc010oaw.1_5'Flank|CLCN6_uc010oax.1_5'Flank|CLCN6_uc010oay.1_5'Flank|CLCN6_uc010oaz.1_5'Flank|CLCN6_uc010oba.1_5'Flank	NM_001286	NP_001277	P51797	CLCN6_HUMAN	chloride channel 6 isoform ClC-6a	799	Cytoplasmic (By similarity).				cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		ACCCGCGCATGATCGTGGTGA	0.657											OREG0013104	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	25	---	---	---	---	PASS
PRAMEF10	343071	broad.mit.edu	37	1	12955401	12955401	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12955401A>G	uc001auo.2	-	2	351	c.278T>C	c.(277-279)GTT>GCT	p.V93A		NM_001039361	NP_001034450	O60809	PRA10_HUMAN	PRAME family member 10	93											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGGGGCGAACCTTCTGGGC	0.607													12	6	---	---	---	---	PASS
SLC25A34	284723	broad.mit.edu	37	1	16065173	16065173	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16065173G>T	uc001axb.1	+	4	854	c.682G>T	c.(682-684)GAT>TAT	p.D228Y	SLC25A34_uc009vok.1_5'Flank	NM_207348	NP_997231	Q6PIV7	S2534_HUMAN	solute carrier family 25, member 34	228	Solcar 3.				transport	integral to membrane|mitochondrial inner membrane					0		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GACTCCCTTCGATGTGGTCAG	0.652													16	39	---	---	---	---	PASS
RUNX3	864	broad.mit.edu	37	1	25229099	25229099	+	Silent	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25229099C>A	uc001bjq.2	-	5	1173	c.762G>T	c.(760-762)ACG>ACT	p.T254T	RUNX3_uc010oen.1_Silent_p.T201T|RUNX3_uc009vrj.2_Silent_p.T268T|RUNX3_uc001bjr.2_Silent_p.T268T|RUNX3_uc001bjs.2_RNA	NM_004350	NP_004341	Q13761	RUNX3_HUMAN	runt-related transcription factor 3 isoform 2	254	Pro/Ser/Thr-rich.				cell proliferation|induction of apoptosis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|protein phosphorylation|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		GGGTTGGCAGCGTGGGGAAGG	0.642													3	125	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34076683	34076683	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34076683C>T	uc001bxn.1	-	41	6210	c.6181G>A	c.(6181-6183)GAC>AAC	p.D2061N	CSMD2_uc001bxm.1_Missense_Mutation_p.D2101N|CSMD2_uc001bxo.1_Missense_Mutation_p.D974N	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2061	CUB 12.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGGGAGTGGTCGCTGTGGAAA	0.567													16	14	---	---	---	---	PASS
SLC1A7	6512	broad.mit.edu	37	1	53555558	53555558	+	Silent	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53555558G>C	uc001cuy.2	-	9	1443	c.1275C>G	c.(1273-1275)GCC>GCG	p.A425A	SLC1A7_uc001cux.2_Silent_p.A78A	NM_006671	NP_006662	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter),	425	Helical; (Potential).					integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)	TGACGAGGCCGGCCTGGGGGA	0.627													28	49	---	---	---	---	PASS
FAM73A	374986	broad.mit.edu	37	1	78268972	78268972	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78268972A>G	uc001dhx.2	+	4	423	c.391A>G	c.(391-393)AGC>GGC	p.S131G	FAM73A_uc010ork.1_Missense_Mutation_p.S131G|FAM73A_uc010orl.1_Missense_Mutation_p.S93G|FAM73A_uc001dhy.1_5'UTR	NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN	hypothetical protein LOC374986	131						integral to membrane				ovary(1)	1				Colorectal(170;0.226)		TTGTTCCAGTAGCAGACAGAA	0.284													6	101	---	---	---	---	PASS
GSTM2	2946	broad.mit.edu	37	1	110210760	110210760	+	Intron	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110210760G>A	uc001dyi.2	+						GSTM2_uc001dyj.2_Nonsense_Mutation_p.W8*|GSTM2_uc010ovt.1_Nonsense_Mutation_p.W8*|GSTM2_uc009wfk.2_RNA	NM_000848	NP_000839	P28161	GSTM2_HUMAN	glutathione S-transferase mu 2 isoform 1						glutathione metabolic process|xenobiotic catabolic process	cytoplasm	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	CTGGGGTACTGGAACATCCGC	0.677													15	28	---	---	---	---	PASS
CD53	963	broad.mit.edu	37	1	111435128	111435128	+	Silent	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111435128C>A	uc001dzw.2	+	4	396	c.225C>A	c.(223-225)ATC>ATA	p.I75I	CD53_uc001dzx.2_Silent_p.I75I|CD53_uc010owa.1_Silent_p.I75I|CD53_uc001dzy.2_Silent_p.I75I	NM_001040033	NP_001035122	P19397	CD53_HUMAN	CD53 antigen	75	Cytoplasmic (Potential).				signal transduction	integral to membrane|plasma membrane					0		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		TGGGCTCTATCAAGGAAAACA	0.517													5	243	---	---	---	---	PASS
GJA8	2703	broad.mit.edu	37	1	147380119	147380119	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147380119G>T	uc001epu.1	+	2	100	c.37G>T	c.(37-39)GAG>TAG	p.E13*		NM_005267	NP_005258	P48165	CXA8_HUMAN	connexin 50	13	Cytoplasmic (Potential).				cell communication|visual perception	connexon complex|integral to plasma membrane	channel activity			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.0276)					CATCTTGGAGGAGGTGAATGA	0.577													34	111	---	---	---	---	PASS
NES	10763	broad.mit.edu	37	1	156639573	156639573	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156639573C>G	uc001fpq.2	-	4	4540	c.4407G>C	c.(4405-4407)TGG>TGC	p.W1469C		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	1469	Tail.				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGCTGTCATCCCAGGGGACAC	0.612													30	35	---	---	---	---	PASS
OR6K3	391114	broad.mit.edu	37	1	158687756	158687756	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158687756C>G	uc010pip.1	-	1	198	c.198G>C	c.(196-198)AGG>AGC	p.R66S		NM_001005327	NP_001005327	Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K,	66	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					GGGTGTCCAGCCTTACAGCAG	0.398													114	200	---	---	---	---	PASS
SLAMF6	114836	broad.mit.edu	37	1	160466051	160466051	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160466051G>T	uc001fwe.1	-	2	242	c.182C>A	c.(181-183)TCT>TAT	p.S61Y	SLAMF6_uc001fwd.1_Missense_Mutation_p.S61Y|SLAMF6_uc010pjh.1_Intron|SLAMF6_uc010pji.1_Intron|SLAMF6_uc010pjj.1_Intron|SLAMF6_uc009wtm.1_Intron	NM_052931	NP_443163	Q96DU3	SLAF6_HUMAN	activating NK receptor precursor	61	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			GAAGGCAAGAGATGTTTCATT	0.478													145	220	---	---	---	---	PASS
NOS1AP	9722	broad.mit.edu	37	1	162302887	162302887	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162302887G>C	uc001gbv.2	+	5	812	c.425G>C	c.(424-426)AGG>ACG	p.R142T	NOS1AP_uc010pkr.1_Missense_Mutation_p.R137T|NOS1AP_uc010pks.1_RNA|NOS1AP_uc001gbw.2_Missense_Mutation_p.R137T	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor	142	PID.				regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			AATATCTTCAGGTGTAACGTC	0.448													49	74	---	---	---	---	PASS
SELP	6403	broad.mit.edu	37	1	169586442	169586442	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169586442G>A	uc001ggi.3	-	3	370	c.305C>T	c.(304-306)ACA>ATA	p.T102I	SELP_uc001ggh.2_5'UTR|SELP_uc009wvr.2_Missense_Mutation_p.T102I	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	102	Extracellular (Potential).|C-type lectin.				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	TCCCACCCATGTCCATGTCTT	0.443													172	228	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175375773	175375773	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175375773G>C	uc001gkp.1	-	1	159	c.78C>G	c.(76-78)ATC>ATG	p.I26M	TNR_uc009wwu.1_Missense_Mutation_p.I26M|TNR_uc010pmz.1_Missense_Mutation_p.I26M	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	26					axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					CTGAAGGCTTGATCATGGAGC	0.532													116	166	---	---	---	---	PASS
SMG7	9887	broad.mit.edu	37	1	183498558	183498558	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183498558G>C	uc001gqg.2	+	8	855	c.733G>C	c.(733-735)GGT>CGT	p.G245R	SMG7_uc010pob.1_Missense_Mutation_p.G274R|SMG7_uc001gqf.2_Missense_Mutation_p.G245R|SMG7_uc001gqh.2_Missense_Mutation_p.G245R|SMG7_uc001gqi.2_Missense_Mutation_p.G203R|SMG7_uc010poc.1_Missense_Mutation_p.G203R	NM_173156	NP_775179	Q92540	SMG7_HUMAN	SMG-7 homolog isoform 1	245					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						AACCAAGTGGGGTGTTTCTGA	0.418													9	201	---	---	---	---	PASS
UCHL5	51377	broad.mit.edu	37	1	193018982	193018982	+	Splice_Site	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193018982C>A	uc001gsm.2	-	3	272	c.141_splice	c.e3-1	p.K47_splice	UCHL5_uc001gsn.2_Splice_Site|UCHL5_uc001gso.2_Splice_Site_p.K47_splice|UCHL5_uc010pov.1_Splice_Site|UCHL5_uc001gsp.2_Splice_Site_p.K47_splice|UCHL5_uc001gsq.2_Splice_Site_p.K47_splice|UCHL5_uc010pow.1_Splice_Site|UCHL5_uc010pox.1_Intron	NM_015984	NP_057068	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5						DNA recombination|DNA repair|protein deubiquitination|regulation of proteasomal protein catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytosol|Ino80 complex|proteasome complex	endopeptidase inhibitor activity|omega peptidase activity|proteasome binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|ovary(1)	3						ATGAACTGGCCTACAAAATAA	0.343													23	49	---	---	---	---	PASS
CAMK1G	57172	broad.mit.edu	37	1	209786165	209786165	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209786165C>G	uc001hhd.2	+	12	1478	c.1376C>G	c.(1375-1377)GCC>GGC	p.A459G	CAMK1G_uc001hhe.2_Missense_Mutation_p.A459G	NM_020439	NP_065172	Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	459						Golgi membrane|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			breast(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		CCAGTTAAAGCCAGTGGCAGC	0.507													23	64	---	---	---	---	PASS
SYT14	255928	broad.mit.edu	37	1	210126103	210126103	+	Splice_Site	SNP	T	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210126103T>A	uc009xcv.2	+	2	133	c.61_splice	c.e2+2	p.V21_splice	SYT14_uc001hhs.3_Splice_Site_p.K25_splice|SYT14_uc001hht.3_Splice_Site_p.V21_splice|SYT14_uc001hhu.3_Splice_Site|SYT14_uc010psn.1_Splice_Site_p.K25_splice|SYT14_uc010pso.1_Splice_Site	NM_153262	NP_694994	Q8NB59	SYT14_HUMAN	synaptotagmin XIV isoform 4							integral to membrane				ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.085)		TTAGAAAAGGTAAGTCATTGC	0.318													9	108	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220153444	220153444	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220153444T>G	uc001hly.1	-	26	3964	c.3694A>C	c.(3694-3696)AGT>CGT	p.S1232R		NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	1232	Prolyl-tRNA synthetase.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	GCTCTTCCACTAGCAGATATA	0.408													22	357	---	---	---	---	PASS
C1orf65	164127	broad.mit.edu	37	1	223568525	223568525	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223568525C>A	uc001hoa.2	+	1	1811	c.1708C>A	c.(1708-1710)CAG>AAG	p.Q570K		NM_152610	NP_689823	Q8N715	CA065_HUMAN	hypothetical protein LOC164127	570	Potential.									central_nervous_system(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0704)		GAAAAAGGAGCAGAGGGTGCA	0.532													19	51	---	---	---	---	PASS
SDCCAG8	10806	broad.mit.edu	37	1	243504391	243504391	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243504391G>A	uc001hzw.2	+	11	1428	c.1272G>A	c.(1270-1272)AAG>AAA	p.K424K	SDCCAG8_uc010pyk.1_Silent_p.K279K|SDCCAG8_uc010pyl.1_Silent_p.K236K|SDCCAG8_uc001hzx.2_Silent_p.K236K	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	424	Potential.|Sufficient for homodimerization (By similarity).				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		AGGTGGAAAAGGTTACAAAGG	0.383													65	101	---	---	---	---	PASS
ALLC	55821	broad.mit.edu	37	2	3743381	3743381	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3743381G>T	uc010ewt.2	+	8	747	c.586G>T	c.(586-588)GCA>TCA	p.A196S	ALLC_uc002qyf.2_5'UTR	NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a	215							allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		CAAAGAACCTGCAGACCTAGT	0.433										HNSCC(21;0.051)			25	36	---	---	---	---	PASS
C2orf71	388939	broad.mit.edu	37	2	29296801	29296801	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29296801G>T	uc002rmt.1	-	1	327	c.327C>A	c.(325-327)CAC>CAA	p.H109Q		NM_001029883	NP_001025054	A6NGG8	CB071_HUMAN	hypothetical protein LOC388939	109					response to stimulus|visual perception	photoreceptor outer segment				skin(1)	1						CCTTAGCCATGTGGCTTTGTG	0.468													117	163	---	---	---	---	PASS
MSH6	2956	broad.mit.edu	37	2	48026011	48026011	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48026011G>A	uc002rwd.3	+	4	1041	c.889G>A	c.(889-891)GCT>ACT	p.A297T	MSH6_uc002rwc.2_Missense_Mutation_p.A297T|MSH6_uc010fbj.2_5'UTR|MSH6_uc010yoi.1_Missense_Mutation_p.A167T|MSH6_uc010yoj.1_5'UTR	NM_000179	NP_000170	P52701	MSH6_HUMAN	mutS homolog 6	297					determination of adult lifespan|DNA damage response, signal transduction resulting in induction of apoptosis|isotype switching|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|response to UV|somatic hypermutation of immunoglobulin genes	MutSalpha complex	ATP binding|DNA-dependent ATPase activity|protein binding			large_intestine(53)|central_nervous_system(28)|endometrium(28)|stomach(22)|haematopoietic_and_lymphoid_tissue(9)|lung(7)|skin(6)|urinary_tract(5)|breast(5)|ovary(3)|thyroid(1)|upper_aerodigestive_tract(1)	168		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TGTCAAAGTTGCTCGAAAGCG	0.478			Mis|N|F|S		colorectal	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				105	160	---	---	---	---	PASS
LHCGR	3973	broad.mit.edu	37	2	48915454	48915454	+	Silent	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48915454A>G	uc002rwu.3	-	11	1552	c.1482T>C	c.(1480-1482)TCT>TCC	p.S494S	GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	494	Helical; Name=4; (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	CAATTAGAGAAGAAAAGAGCC	0.443									Familial_Male-Limited_Precocious_Puberty				53	79	---	---	---	---	PASS
RTN4	57142	broad.mit.edu	37	2	55253585	55253585	+	Silent	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55253585C>G	uc002rye.2	-	3	1948	c.1650G>C	c.(1648-1650)CTG>CTC	p.L550L	RTN4_uc002ryd.2_Silent_p.L344L|RTN4_uc002ryf.2_Intron|RTN4_uc002ryg.2_Intron	NM_020532	NP_065393	Q9NQC3	RTN4_HUMAN	reticulon 4 isoform A	550	Cytoplasmic (Potential).				apoptosis|axonal fasciculation|cerebral cortex radial glia guided migration|endoplasmic reticulum tubular network organization|negative regulation of anti-apoptosis|negative regulation of axon extension|nerve growth factor receptor signaling pathway|regulation of apoptosis|regulation of branching morphogenesis of a nerve|regulation of cell migration	integral to endoplasmic reticulum membrane|nuclear envelope|plasma membrane	protein binding			ovary(2)|large_intestine(1)	3						AATCTGGAGTCAGGCCTTCAG	0.393													80	124	---	---	---	---	PASS
ST3GAL5	8869	broad.mit.edu	37	2	86074975	86074975	+	Intron	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86074975C>A	uc002sqq.1	-						ST3GAL5_uc010fgq.1_Intron|ST3GAL5_uc002sqp.1_Intron	NM_003896	NP_003887	Q9UNP4	SIAT9_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase						ganglioside biosynthetic process|protein glycosylation	integral to Golgi membrane|integral to plasma membrane	lactosylceramide alpha-2,3-sialyltransferase activity|neolactotetraosylceramide alpha-2,3-sialyltransferase activity				0						ACAAAAAAAACCAATGTACCT	0.279													5	184	---	---	---	---	PASS
IMMT	10989	broad.mit.edu	37	2	86378604	86378604	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86378604G>C	uc002sqz.3	-	12	1605	c.1217C>G	c.(1216-1218)GCT>GGT	p.A406G	IMMT_uc002sqy.3_Missense_Mutation_p.A147G|IMMT_uc002srb.3_Missense_Mutation_p.A395G|IMMT_uc002sra.3_Missense_Mutation_p.A405G|IMMT_uc010ytd.1_Missense_Mutation_p.A394G|IMMT_uc010yte.1_Missense_Mutation_p.A359G|IMMT_uc002src.1_Missense_Mutation_p.A142G	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1	406	Mitochondrial intermembrane (Potential).					integral to mitochondrial inner membrane	protein binding			skin(1)	1						ATGTGCATGAGCAATGAGGGA	0.428													6	105	---	---	---	---	PASS
RGPD1	400966	broad.mit.edu	37	2	87140967	87140967	+	5'UTR	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87140967G>C	uc010fgv.2	+	1					RMND5A_uc002srs.3_Intron	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						CCAGGTTGGCGGTGCGATGAG	0.667													4	4	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89278203	89278203	+	Intron	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89278203C>A	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TCTGACTGGCCCTGCAGGAGA	0.522													51	90	---	---	---	---	PASS
GPR17	2840	broad.mit.edu	37	2	128408686	128408686	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128408686G>A	uc010yzn.1	+	4	1072	c.461G>A	c.(460-462)AGC>AAC	p.S154N	LIMS2_uc002tow.2_5'Flank|LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Missense_Mutation_p.S154N|GPR17_uc010yzo.1_Missense_Mutation_p.S126N|GPR17_uc002tpd.2_Missense_Mutation_p.S126N	NM_001161415	NP_001154887	Q13304	GPR17_HUMAN	G protein-coupled receptor 17 isoform a	154	Helical; Name=3; (Potential).					integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		ACCTGCATCAGCGCCGACCGT	0.602													50	81	---	---	---	---	PASS
ARHGEF4	50649	broad.mit.edu	37	2	131688620	131688620	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131688620C>A	uc002tsa.1	+	3	610	c.90C>A	c.(88-90)TTC>TTA	p.F30L	ARHGEF4_uc010fmw.1_Missense_Mutation_p.F676L|ARHGEF4_uc002tsb.1_Missense_Mutation_p.F30L|ARHGEF4_uc010fmx.1_Missense_Mutation_p.F30L|ARHGEF4_uc002trz.1_Missense_Mutation_p.F676L	NM_015320	NP_056135	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor 4 isoform	30					apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|lamellipodium assembly|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|ruffle membrane	protein domain specific binding|Rac guanyl-nucleotide exchange factor activity			breast(3)|ovary(2)|skin(1)	6		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		AGCCCTGCTTCACCACTGACA	0.612													35	54	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138163301	138163301	+	Silent	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138163301C>G	uc002tva.1	+	12	2526	c.2526C>G	c.(2524-2526)ACC>ACG	p.T842T	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Silent_p.T732T	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		AAGACTGCACCTTCACTGCTT	0.498													10	31	---	---	---	---	PASS
SCN3A	6328	broad.mit.edu	37	2	165994574	165994574	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165994574C>T	uc002ucx.2	-	15	2698	c.2206G>A	c.(2206-2208)GTG>ATG	p.V736M	SCN3A_uc002ucy.2_Missense_Mutation_p.V687M|SCN3A_uc002ucz.2_Missense_Mutation_p.V687M|SCN3A_uc002uda.1_Missense_Mutation_p.V556M|SCN3A_uc002udb.1_Missense_Mutation_p.V556M	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	736						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	ATCAAGAACACATTGGCAAAT	0.363													37	72	---	---	---	---	PASS
CHRNA1	1134	broad.mit.edu	37	2	175624353	175624353	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175624353C>A	uc002ujd.2	-	2	130	c.52G>T	c.(52-54)GTC>TTC	p.V18F	uc002uiw.2_Intron|CHRNA1_uc002uje.2_Missense_Mutation_p.V18F|CHRNA1_uc002ujf.3_Missense_Mutation_p.V18F	NM_001039523	NP_001034612	P02708	ACHA_HUMAN	nicotinic cholinergic receptor alpha 1 isoform a	18					muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GAGCCCAGGACGAGGCCAGCT	0.557													68	75	---	---	---	---	PASS
HOXD3	3232	broad.mit.edu	37	2	177036984	177036984	+	Silent	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177036984C>G	uc002ukt.1	+	3	1457	c.1281C>G	c.(1279-1281)CCC>CCG	p.P427P		NM_006898	NP_008829	P31249	HXD3_HUMAN	homeobox D3	427					anterior/posterior pattern formation|cartilage development|cell-matrix adhesion|embryonic skeletal system morphogenesis|Notch signaling pathway|positive regulation of gene expression|positive regulation of neuron differentiation|thyroid gland development		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)		CGGAGGCTCCCAAACTGACGC	0.632													9	20	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179604027	179604027	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179604027G>T	uc010zfh.1	-	46	13644	c.13420C>A	c.(13420-13422)CCT>ACT	p.P4474T	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.P4407T|TTN_uc010zfj.1_Missense_Mutation_p.P4282T|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATCTGAAGGCACCAGTTTA	0.368													38	55	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179621084	179621084	+	Nonsense_Mutation	SNP	T	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179621084T>A	uc010zfh.1	-	44	10830	c.10606A>T	c.(10606-10608)AAA>TAA	p.K3536*	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc002unb.2_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	3550							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTGATTGTTTCAGTCTCTCG	0.403													56	105	---	---	---	---	PASS
MYL1	4632	broad.mit.edu	37	2	211159113	211159113	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211159113G>T	uc002vec.2	-	4	463	c.334C>A	c.(334-336)CAA>AAA	p.Q112K	MYL1_uc002veb.2_Missense_Mutation_p.Q68K	NM_079420	NP_524144	P05976	MYL1_HUMAN	fast skeletal myosin alkali light chain 1	112					muscle filament sliding|muscle organ development	cytosol|muscle myosin complex|sarcomere	calcium ion binding|structural constituent of muscle			ovary(1)	1				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		GGCAGAAATTGTTCAAACTCA	0.398													48	65	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211447371	211447371	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211447371G>T	uc002vee.3	+	6	691	c.559G>T	c.(559-561)GGT>TGT	p.G187C	CPS1_uc010fur.2_Missense_Mutation_p.G193C	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	187	Anthranilate phosphoribosyltransferase homolog.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		TGAATTTGAAGGTCAGCCTGT	0.348													56	142	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216257885	216257885	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216257885C>T	uc002vfa.2	-	25	4104	c.3838G>A	c.(3838-3840)GAT>AAT	p.D1280N	FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Missense_Mutation_p.D1280N|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Missense_Mutation_p.D1280N|FN1_uc002vfj.2_Missense_Mutation_p.D1280N|FN1_uc002vez.2_5'Flank|FN1_uc010zjp.1_5'UTR	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	1280	Fibronectin type-III 8.|Cell-attachment.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ATGCTTGAATCGGTTATATCA	0.468													30	79	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228881925	228881925	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228881925G>C	uc002vpq.2	-	7	3692	c.3645C>G	c.(3643-3645)AGC>AGG	p.S1215R	SPHKAP_uc002vpp.2_Missense_Mutation_p.S1215R|SPHKAP_uc010zlx.1_Missense_Mutation_p.S1215R	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1215						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		AATCCTGGCTGCTCCGTCTGG	0.577													61	74	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230643658	230643658	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230643658G>C	uc002vpw.1	-	34	5027	c.4918C>G	c.(4918-4920)CAG>GAG	p.Q1640E	TRIP12_uc002vpx.1_Missense_Mutation_p.Q1688E|TRIP12_uc002vpy.1_Missense_Mutation_p.Q1370E	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1640					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TGTAGTTCCTGAGATACAAGC	0.393													17	313	---	---	---	---	PASS
AQP12A	375318	broad.mit.edu	37	2	241631534	241631534	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241631534G>T	uc002vzu.2	+	2	236	c.167G>T	c.(166-168)GGG>GTG	p.G56V	AQP12A_uc002vzv.2_Intron	NM_198998	NP_945349	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	56	Helical; Name=2; (Potential).					integral to membrane	transporter activity				0		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GGGGACTTTGGGCCTGACCTG	0.692													22	9	---	---	---	---	PASS
ATG7	10533	broad.mit.edu	37	3	11468349	11468349	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11468349A>T	uc003bwc.2	+	18	2145	c.2028A>T	c.(2026-2028)TTA>TTT	p.L676F	ATG7_uc003bwd.2_Missense_Mutation_p.L649F|ATG7_uc011aum.1_Intron	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a	676					autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						ATTCCTTCTTAGAAGACTTGA	0.358													35	30	---	---	---	---	PASS
SLC22A14	9389	broad.mit.edu	37	3	38357879	38357879	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38357879A>G	uc010hhc.1	+	10	1639	c.1597A>G	c.(1597-1599)ATC>GTC	p.I533V	SLC22A14_uc003cib.2_Missense_Mutation_p.I533V|SLC22A14_uc011ayo.1_RNA	NM_004803	NP_004794	Q9Y267	S22AE_HUMAN	organic cation transporter like 4	533	Helical; (Potential).					integral to plasma membrane	organic cation transmembrane transporter activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		CCTGACAATCATCAGCCAGAC	0.617													27	11	---	---	---	---	PASS
PLXNB1	5364	broad.mit.edu	37	3	48450817	48450817	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48450817C>G	uc003csw.2	-	34	6277	c.6007G>C	c.(6007-6009)GAT>CAT	p.D2003H	PLXNB1_uc003cst.2_Missense_Mutation_p.D453H|PLXNB1_uc003csu.2_Missense_Mutation_p.D1820H|PLXNB1_uc003csx.2_Missense_Mutation_p.D2003H	NM_002673	NP_002664	O43157	PLXB1_HUMAN	plexin B1 precursor	2003	Cytoplasmic (Potential).				axon guidance|cell migration|intracellular signal transduction|regulation of cell shape|regulation of cytoskeleton organization|regulation of small GTPase mediated signal transduction|semaphorin-plexin signaling pathway	extracellular region|integral to plasma membrane|intracellular|semaphorin receptor complex	GTPase activator activity|semaphorin receptor activity|semaphorin receptor binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TCCATGTTATCAGATGTTTGC	0.552													79	33	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77572060	77572060	+	Intron	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77572060G>T	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CGAGGTAAGAGATTTAAGATG	0.368													13	71	---	---	---	---	PASS
EPHA6	285220	broad.mit.edu	37	3	97467485	97467485	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97467485C>G	uc010how.1	+	18	3376	c.3333C>G	c.(3331-3333)AGC>AGG	p.S1111R		NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	1016	SAM.|Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						GAATAGTCAGCAGCATACAGA	0.333													14	47	---	---	---	---	PASS
ABI3BP	25890	broad.mit.edu	37	3	100472662	100472662	+	Splice_Site	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100472662C>A	uc003dun.2	-	32	2912	c.2827_splice	c.e32+1	p.A943_splice	ABI3BP_uc003duj.2_Splice_Site_p.A523_splice|ABI3BP_uc003duk.2_Splice_Site_p.A652_splice|ABI3BP_uc003dul.2_Splice_Site_p.A773_splice|ABI3BP_uc011bhd.1_Splice_Site_p.A897_splice|ABI3BP_uc003dum.2_Splice_Site_p.A354_splice	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						CAGGTACTTACCAGAAACTGG	0.423													14	32	---	---	---	---	PASS
IMPG2	50939	broad.mit.edu	37	3	100962934	100962934	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100962934C>A	uc003duq.1	-	13	2444	c.2241G>T	c.(2239-2241)ATG>ATT	p.M747I	IMPG2_uc011bhe.1_Missense_Mutation_p.M610I	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	747	Extracellular (Potential).				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						TAATTTGTTCCATATCCTCCC	0.403													14	295	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108224623	108224623	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108224623C>A	uc003dxa.1	-	3	259	c.202G>T	c.(202-204)GTA>TTA	p.V68L		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	68	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						CTCCCTTTTACCTCAGCCTCG	0.358													87	287	---	---	---	---	PASS
HSPBAP1	79663	broad.mit.edu	37	3	122487665	122487665	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122487665G>A	uc003efu.1	-	3	438	c.315C>T	c.(313-315)AAC>AAT	p.N105N	HSPBAP1_uc003efv.1_Silent_p.N105N	NM_024610	NP_078886	Q96EW2	HBAP1_HUMAN	Hspb associated protein 1	105	Interaction with HSPB1 (By similarity).					cytoplasm				ovary(1)|lung(1)	2				GBM - Glioblastoma multiforme(114;0.0531)		ACTGGTCACAGTTCCAGGTCA	0.363													3	115	---	---	---	---	PASS
OSBPL11	114885	broad.mit.edu	37	3	125313525	125313525	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125313525G>T	uc003eic.2	-	1	857	c.120C>A	c.(118-120)AGC>AGA	p.S40R		NM_022776	NP_073613	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	40					lipid transport		lipid binding			ovary(3)|breast(1)|kidney(1)	5						tgctgctgctgctactgattc	0.388													63	32	---	---	---	---	PASS
GATA2	2624	broad.mit.edu	37	3	128205181	128205181	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128205181G>C	uc003ekm.3	-	4	695	c.260C>G	c.(259-261)CCA>CGA	p.P87R	GATA2_uc003ekn.3_Missense_Mutation_p.P87R|GATA2_uc003eko.2_Missense_Mutation_p.P87R|uc003ekp.2_5'Flank	NM_001145661	NP_001139133	P23769	GATA2_HUMAN	GATA binding protein 2 isoform 1	87					blood coagulation|negative regulation of fat cell differentiation|negative regulation of fat cell proliferation|negative regulation of neural precursor cell proliferation|negative regulation of Notch signaling pathway|phagocytosis|positive regulation of angiogenesis|positive regulation of phagocytosis|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	C2H2 zinc finger domain binding|chromatin binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15				GBM - Glioblastoma multiforme(114;0.173)		CAACAAGTGTGGGCGGCACAT	0.677			Mis		AML(CML blast transformation)								2	6	---	---	---	---	PASS
IFT122	55764	broad.mit.edu	37	3	129238477	129238477	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129238477G>C	uc003emm.2	+	29	3744	c.3538G>C	c.(3538-3540)GAT>CAT	p.D1180H	IFT122_uc003eml.2_Missense_Mutation_p.D1231H|IFT122_uc003emn.2_Missense_Mutation_p.D1121H|IFT122_uc003emo.2_Missense_Mutation_p.D1070H|IFT122_uc003emp.2_Missense_Mutation_p.D1030H|IFT122_uc010htc.2_Missense_Mutation_p.D1173H|IFT122_uc011bky.1_Missense_Mutation_p.D971H|IFT122_uc003emq.2_Missense_Mutation_p.D1020H|IFT122_uc003emr.2_Missense_Mutation_p.D933H|IFT122_uc011bla.1_Missense_Mutation_p.D954H|IFT122_uc010hte.2_Missense_Mutation_p.D506H|IFT122_uc003ems.2_Missense_Mutation_p.D562H	NM_052989	NP_443715	Q9HBG6	IF122_HUMAN	WD repeat domain 10 isoform 2	1180					camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2						GAGCCGCCGGGATGTCCTCAT	0.642													17	91	---	---	---	---	PASS
PIK3CB	5291	broad.mit.edu	37	3	138382872	138382872	+	Splice_Site	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138382872C>T	uc011bmq.1	-	19	2673	c.2673_splice	c.e19-1	p.G891_splice	PIK3CB_uc011bmn.1_Splice_Site_p.G403_splice|PIK3CB_uc011bmo.1_Splice_Site_p.G342_splice|PIK3CB_uc011bmp.1_Splice_Site_p.G478_splice	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta						activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						CAGGTCATCCCTGAACAAGAG	0.453													4	101	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	139894792	139894792	+	Splice_Site	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139894792G>T	uc003etn.2	+	2	300	c.110_splice	c.e2-1	p.V37_splice	CLSTN2_uc003etm.2_Splice_Site_p.V37_splice	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						TTATTTTCTAGTCAATAAGCA	0.333										HNSCC(16;0.037)			44	121	---	---	---	---	PASS
C3orf58	205428	broad.mit.edu	37	3	143691762	143691762	+	Silent	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143691762C>T	uc003evo.2	+	1	1123	c.588C>T	c.(586-588)AAC>AAT	p.N196N	C3orf58_uc011bnl.1_5'Flank	NM_173552	NP_775823	Q8NDZ4	CC058_HUMAN	hypothetical protein LOC205428 isoform a	196						COPI vesicle coat|extracellular region				ovary(1)	1						TGCTTCGCAACCTCAAGGACT	0.692													6	3	---	---	---	---	PASS
DHX36	170506	broad.mit.edu	37	3	154024045	154024045	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154024045C>A	uc003ezy.3	-	6	934	c.853G>T	c.(853-855)GGC>TGC	p.G285C	DHX36_uc010hvq.2_Missense_Mutation_p.G285C|DHX36_uc003ezz.3_Missense_Mutation_p.G285C	NM_020865	NP_065916	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	285	Helicase ATP-binding.					cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTACCACTGCCACAAGATTCT	0.348													49	162	---	---	---	---	PASS
ZBBX	79740	broad.mit.edu	37	3	167045879	167045879	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167045879G>T	uc003fep.2	-	11	1036	c.713C>A	c.(712-714)GCA>GAA	p.A238E	ZBBX_uc011bpc.1_Missense_Mutation_p.A238E|ZBBX_uc003feq.2_Missense_Mutation_p.A209E	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	238						intracellular	zinc ion binding			ovary(2)	2						TGTACGTTGTGCTCTTTTCAT	0.338													7	306	---	---	---	---	PASS
ATP13A5	344905	broad.mit.edu	37	3	193039528	193039528	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193039528G>C	uc011bsq.1	-	16	1857	c.1857C>G	c.(1855-1857)TTC>TTG	p.F619L		NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5	619					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TGTAGACATGGAAATGATTCT	0.458													4	186	---	---	---	---	PASS
GBA3	57733	broad.mit.edu	37	4	22749311	22749311	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22749311G>C	uc003gqp.3	+	3	770	c.679G>C	c.(679-681)GTC>CTC	p.V227L	GBA3_uc010iep.2_Intron|GBA3_uc011bxo.1_Missense_Mutation_p.V228L	NM_020973	NP_066024	Q9H227	GBA3_HUMAN	cytosolic beta-glucosidase isoform a	227					glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity				0						ACTTTTTGCGGTCTGGTTGGA	0.423													9	285	---	---	---	---	PASS
PI4K2B	55300	broad.mit.edu	37	4	25256684	25256684	+	Intron	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25256684T>C	uc003grk.2	+						PI4K2B_uc011bxs.1_Intron	NM_018323	NP_060793	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta							cytoplasm|membrane	1-phosphatidylinositol 4-kinase activity|ATP binding			ovary(2)|skin(2)	4		Breast(46;0.173)				TTTTTTGCTCTAGAAAATTAT	0.333													26	48	---	---	---	---	PASS
TMEM156	80008	broad.mit.edu	37	4	38972693	38972693	+	Silent	SNP	T	C	C	rs148909241	byFrequency	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38972693T>C	uc003gto.2	-	6	996	c.888A>G	c.(886-888)CTA>CTG	p.L296L	TMEM156_uc010ifj.2_Silent_p.L295L	NM_024943	NP_079219	Q8N614	TM156_HUMAN	transmembrane protein 156	296	Cytoplasmic (Potential).					integral to membrane				skin(1)	1						AAGTAACTTATAGTTCTGGAA	0.403													6	105	---	---	---	---	PASS
RBM47	54502	broad.mit.edu	37	4	40440165	40440165	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40440165T>C	uc003gvc.2	-	4	1456	c.746A>G	c.(745-747)TAC>TGC	p.Y249C	RBM47_uc003gvd.2_Missense_Mutation_p.Y249C|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Missense_Mutation_p.Y211C|RBM47_uc003gvg.1_Missense_Mutation_p.Y249C	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	249	RRM 3.					nucleus	nucleotide binding|RNA binding			breast(3)	3						GTTGCGCACGTAGAGGATCTT	0.622													59	110	---	---	---	---	PASS
KCTD8	386617	broad.mit.edu	37	4	44177019	44177019	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44177019G>T	uc003gwu.2	-	2	1494	c.1210C>A	c.(1210-1212)CCA>ACA	p.P404T		NM_198353	NP_938167	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerisation domain	404						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(2)|ovary(1)	3						CGTTTGTCTGGTGGGGGTATC	0.483										HNSCC(17;0.042)			159	259	---	---	---	---	PASS
GABRA2	2555	broad.mit.edu	37	4	46388199	46388199	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46388199G>T	uc003gxc.3	-	2	752	c.79C>A	c.(79-81)CTG>ATG	p.L27M	GABRA2_uc010igc.2_Missense_Mutation_p.L27M|GABRA2_uc011bzc.1_Translation_Start_Site|GABRA2_uc003gxe.2_Missense_Mutation_p.L27M|GABRA2_uc010igd.1_Missense_Mutation_p.L27M	NM_001114175	NP_001107647	P47869	GBRA2_HUMAN	gamma-aminobutyric acid A receptor, alpha 2	27					gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|skin(2)	4					Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ATGTTAGCCAGCACCAACCTA	0.343													20	39	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55962494	55962494	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55962494C>A	uc003has.2	-	19	2932	c.2630G>T	c.(2629-2631)AGT>ATT	p.S877I	KDR_uc003hat.1_Missense_Mutation_p.S877I	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	877	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	TCGATGCTCACTGTGTGTTGC	0.463			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			58	103	---	---	---	---	PASS
FAM190A	401145	broad.mit.edu	37	4	91229477	91229477	+	Silent	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91229477G>T	uc003hsv.3	+	2	382	c.42G>T	c.(40-42)CGG>CGT	p.R14R	FAM190A_uc003hsu.3_Silent_p.R14R|FAM190A_uc010ikv.2_RNA|FAM190A_uc003hsw.2_Silent_p.R14R	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1	14	Ser-rich.									large_intestine(1)|ovary(1)	2						TGGTCTCCCGGTTGCCAATAT	0.453													18	6	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94690580	94690580	+	Silent	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94690580C>A	uc011cdt.1	+	15	2838	c.2580C>A	c.(2578-2580)GGC>GGA	p.G860G	GRID2_uc011cdu.1_Silent_p.G765G	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	860	Cytoplasmic (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	AGAGGAAAGGCTCCCGGGTTC	0.488													38	22	---	---	---	---	PASS
ANXA5	308	broad.mit.edu	37	4	122599657	122599657	+	Intron	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122599657A>G	uc003idu.3	-						ANXA5_uc003idv.3_Intron|ANXA5_uc003idw.3_Intron|ANXA5_uc010inm.2_Intron|ANXA5_uc010inn.2_Intron|ANXA5_uc010ino.2_Intron	NM_001154	NP_001145	P08758	ANXA5_HUMAN	annexin 5						anti-apoptosis|blood coagulation|negative regulation of coagulation|signal transduction	cytoplasm	calcium ion binding|calcium-dependent phospholipid binding|phospholipase inhibitor activity			ovary(1)	1						ATTCTGCAACAAAATAATTTC	0.388													15	5	---	---	---	---	PASS
LPCAT1	79888	broad.mit.edu	37	5	1463865	1463865	+	Silent	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1463865T>C	uc003jcm.2	-	14	1623	c.1506A>G	c.(1504-1506)GCA>GCG	p.A502A	LPCAT1_uc003jcl.2_Silent_p.A76A	NM_024830	NP_079106	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	502	Lumenal (Potential).				phospholipid biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		GTGAGGTCTCTGCACAGCTTT	0.537													45	198	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19747261	19747261	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19747261C>A	uc003jgc.2	-	3	690	c.313G>T	c.(313-315)GAT>TAT	p.D105Y	CDH18_uc003jgd.2_Missense_Mutation_p.D105Y|CDH18_uc011cnm.1_Missense_Mutation_p.D105Y	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	105	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CCCGTGGTATCGTCAATGATA	0.438													66	140	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19747262	19747262	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19747262G>C	uc003jgc.2	-	3	689	c.312C>G	c.(310-312)GAC>GAG	p.D104E	CDH18_uc003jgd.2_Missense_Mutation_p.D104E|CDH18_uc011cnm.1_Missense_Mutation_p.D104E	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	104	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CCGTGGTATCGTCAATGATAA	0.438													68	141	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24593426	24593426	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24593426C>A	uc003jgr.1	-	2	506	c.174G>T	c.(172-174)TGG>TGT	p.W58C	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	58	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		AAAATTGATTCCACATCCAAC	0.388										HNSCC(23;0.051)			69	240	---	---	---	---	PASS
FGF10	2255	broad.mit.edu	37	5	44305296	44305296	+	Intron	SNP	T	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44305296T>A	uc003jog.1	-							NM_004465	NP_004456	O15520	FGF10_HUMAN	fibroblast growth factor 10 precursor						actin cytoskeleton reorganization|activation of MAPK activity|bud outgrowth involved in lung branching|ERK1 and ERK2 cascade|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|insulin receptor signaling pathway|lacrimal gland development|lung saccule development|mesonephros development|negative regulation of cell cycle arrest|positive regulation of ATPase activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of DNA repair|positive regulation of DNA replication|positive regulation of epithelial cell migration|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of ERK1 and ERK2 cascade|positive regulation of hair follicle cell proliferation|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of lymphocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of Ras protein signal transduction|positive regulation of transcription, DNA-dependent|positive regulation of urothelial cell proliferation|protein localization at cell surface|radial glial cell differentiation|regulation of saliva secretion|response to protein stimulus|secretion by lung epithelial cell involved in lung growth|tear secretion|thymus development|urothelial cell proliferation	cell surface|extracellular space|nucleus|plasma membrane	chemoattractant activity|growth factor activity|heparin binding|type 2 fibroblast growth factor receptor binding			lung(3)	3	Lung NSC(6;1.12e-06)					AAATTCTTTCTGCAAAGGAAA	0.373													60	144	---	---	---	---	PASS
PDE4D	5144	broad.mit.edu	37	5	58297870	58297870	+	Intron	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58297870T>C	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jrt.2_Intron|PDE4D_uc003jru.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc010iwi.1_Intron|PDE4D_uc003jrs.2_5'Flank	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	CAGAGCTGTTTCTTTCAGTTT	0.264													18	10	---	---	---	---	PASS
CENPK	64105	broad.mit.edu	37	5	64850615	64850615	+	Intron	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64850615G>C	uc003jts.2	-						CENPK_uc003jtt.2_Intron|CENPK_uc003jtu.2_Intron	NM_022145	NP_071428	Q9BS16	CENPK_HUMAN	SoxLZ/Sox6 leucine zipper binding protein						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm					0		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00466)		TCTATCTTTTGAAACTTACTT	0.303													87	36	---	---	---	---	PASS
PCSK1	5122	broad.mit.edu	37	5	95751805	95751805	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95751805C>G	uc003kls.1	-	6	847	c.641G>C	c.(640-642)GGA>GCA	p.G214A		NM_000439	NP_000430	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	214	Catalytic.				cell-cell signaling|cellular nitrogen compound metabolic process|energy reserve metabolic process|hormone biosynthetic process|peptide biosynthetic process|peptide hormone processing|regulation of insulin secretion	extracellular space|stored secretory granule|transport vesicle	serine-type endopeptidase activity			ovary(2)	2		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GGCAATTTCTCCTGCACATCT	0.383													7	87	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127680126	127680126	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127680126G>C	uc003kuu.2	-	25	3733	c.3294C>G	c.(3292-3294)TGC>TGG	p.C1098W	FBN2_uc003kuv.2_Missense_Mutation_p.C1065W	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1098	EGF-like 15; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TATTGCAACGGCATTTGAAGC	0.413													81	37	---	---	---	---	PASS
PCDHA1	56147	broad.mit.edu	37	5	140167445	140167445	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140167445G>T	uc003lhb.2	+	1	1570	c.1570G>T	c.(1570-1572)GAC>TAC	p.D524Y	PCDHA1_uc003lha.2_Missense_Mutation_p.D524Y|PCDHA1_uc003lgz.2_Missense_Mutation_p.D524Y	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	524	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGCCCCTGGACCACGAGGA	0.677													39	8	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140558611	140558611	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140558611C>A	uc011dai.1	+	1	1182	c.996C>A	c.(994-996)TGC>TGA	p.C332*	PCDHB16_uc003liv.2_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	332	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGGAAAATGCACCGTTCTGA	0.438													8	161	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140725487	140725487	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140725487G>A	uc003ljm.1	+	1	1887	c.1887G>A	c.(1885-1887)GCG>GCA	p.A629A	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Silent_p.A389A|PCDHGA3_uc011dap.1_Silent_p.A629A	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	629	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCGCACGGCGCGAGCCCTGC	0.701													21	14	---	---	---	---	PASS
PCDHGB2	56103	broad.mit.edu	37	5	140741626	140741626	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140741626C>A	uc003ljs.1	+	1	1924	c.1924C>A	c.(1924-1926)CTG>ATG	p.L642M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Missense_Mutation_p.L642M|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	642	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCCAGCGCCTGCTGGTCGC	0.687													11	1	---	---	---	---	PASS
PCDHGB5	56101	broad.mit.edu	37	5	140779598	140779598	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140779598G>C	uc003lkf.1	+	1	1904	c.1904G>C	c.(1903-1905)CGC>CCC	p.R635P	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Missense_Mutation_p.R635P|PCDHGA9_uc011dax.1_5'Flank|PCDHGA9_uc003lkh.1_5'Flank	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	protocadherin gamma subfamily B, 5 isoform 1	635	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGCGGCCCGCCAGCGCCTG	0.687													26	8	---	---	---	---	PASS
FBXO38	81545	broad.mit.edu	37	5	147821650	147821650	+	Silent	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147821650G>T	uc003lpf.1	+	22	3627	c.3507G>T	c.(3505-3507)GTG>GTT	p.V1169V	FBXO38_uc003lpg.1_Silent_p.V1094V|FBXO38_uc003lph.2_Silent_p.V924V	NM_205836	NP_995308	Q6PIJ6	FBX38_HUMAN	F-box protein 38 isoform b	1169						cytoplasm|nucleus				ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCGAGTAGTGGCAATTTTTA	0.418													13	132	---	---	---	---	PASS
ADRB2	154	broad.mit.edu	37	5	148207106	148207106	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148207106G>A	uc003lpr.1	+	1	951	c.712G>A	c.(712-714)GGC>AGC	p.G238S	SH3TC2_uc003lpp.1_Intron	NM_000024	NP_000015	P07550	ADRB2_HUMAN	adrenergic, beta-2-, receptor, surface	238	Cytoplasmic.				activation of transmembrane receptor protein tyrosine kinase activity|desensitization of G-protein coupled receptor protein signaling pathway by arrestin|endosome to lysosome transport|positive regulation of MAPKKK cascade|receptor-mediated endocytosis	endosome|integral to plasma membrane|lysosome|receptor complex	beta2-adrenergic receptor activity|norepinephrine binding|potassium channel regulator activity|protein homodimerization activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Alprenolol(DB00866)|Arformoterol(DB01274)|Bambuterol(DB01408)|Bisoprolol(DB00612)|Bitolterol(DB00901)|Bretylium(DB01158)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Isoproterenol(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Metipranolol(DB01214)|Nadolol(DB01203)|Norepinephrine(DB00368)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Terbutaline(DB00871)|Timolol(DB00373)	CAAATCTGAGGGCCGCTTCCA	0.552													35	21	---	---	---	---	PASS
CSF1R	1436	broad.mit.edu	37	5	149465950	149465950	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149465950G>T	uc003lrl.2	-	1	236	c.41C>A	c.(40-42)GCT>GAT	p.A14D	CSF1R_uc010jhc.2_RNA|CSF1R_uc003lrm.2_Missense_Mutation_p.A14D|CSF1R_uc011dce.1_Missense_Mutation_p.A14D|CSF1R_uc011dcf.1_Missense_Mutation_p.A14D	NM_005211	NP_005202	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor precursor	14					cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity			haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	ACCATGCCAAGCTGTGGCCAC	0.627													6	2	---	---	---	---	PASS
ADAM19	8728	broad.mit.edu	37	5	156947033	156947033	+	Silent	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156947033C>T	uc003lwz.2	-	6	478	c.414G>A	c.(412-414)CTG>CTA	p.L138L	ADAM19_uc003lww.1_5'UTR|ADAM19_uc011ddr.1_Silent_p.L69L	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 preproprotein	138					proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCACCGTAATCAGTCCTCTGT	0.473													7	78	---	---	---	---	PASS
FGF18	8817	broad.mit.edu	37	5	170883546	170883546	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170883546G>T	uc003mbk.2	+	5	898	c.361G>T	c.(361-363)GAT>TAT	p.D121Y		NM_003862	NP_003853	O76093	FGF18_HUMAN	fibroblast growth factor 18 precursor	121					cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell proliferation	extracellular space|nucleolus	growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCTGCAGCCCGATGGCACCAG	0.368													53	20	---	---	---	---	PASS
HRH2	3274	broad.mit.edu	37	5	175110623	175110623	+	Silent	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175110623G>T	uc003mdd.2	+	1	2160	c.387G>T	c.(385-387)CTG>CTT	p.L129L	HRH2_uc003mdc.3_Silent_p.L129L	NM_022304	NP_071640	P25021	HRH2_HUMAN	histamine receptor H2 isoform 2	129	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|immune response	integral to plasma membrane	histamine receptor activity			ovary(1)	1	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Nizatidine(DB00585)|Ranitidine(DB00863)	ACCCTGTGCTGGTCACCCCAG	0.557													31	15	---	---	---	---	PASS
ZNF454	285676	broad.mit.edu	37	5	178392042	178392042	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178392042G>T	uc003mjo.1	+	5	908	c.637G>T	c.(637-639)GAG>TAG	p.E213*	ZNF454_uc010jkz.1_Nonsense_Mutation_p.E213*	NM_182594	NP_872400	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	213					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		TCATATTAAGGAGAAAAGATA	0.353													50	30	---	---	---	---	PASS
BTNL9	153579	broad.mit.edu	37	5	180477308	180477308	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180477308G>A	uc003mmt.2	+	4	906	c.675G>A	c.(673-675)GTG>GTA	p.V225V	BTNL9_uc011dhi.1_Silent_p.V156V	NM_152547	NP_689760	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9 precursor	225	Extracellular (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCAGCAATGTGTCCGTCTCCA	0.547													52	25	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	6	9933028	9933028	+	RNA	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9933028C>A	uc003myg.1	-	2		c.219G>T			uc010jog.1_Missense_Mutation_p.R52S|uc003myh.1_Missense_Mutation_p.R77S|uc003myj.1_Missense_Mutation_p.R77S|uc003myk.1_RNA|uc003myn.2_Missense_Mutation_p.R77S|uc010joi.1_Missense_Mutation_p.R145S|uc010joh.1_RNA|uc011dif.1_Missense_Mutation_p.R77S|uc011dig.1_Missense_Mutation_p.R77S					Homo sapiens clone 958LR MRDS1 protein (MRDS1) mRNA, complete cds.																		AGGCTGGCAGCCTGAATTTTT	0.488													82	191	---	---	---	---	PASS
HIST1H4K	8362	broad.mit.edu	37	6	27799308	27799308	+	5'Flank	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27799308C>A	uc003njr.2	-							NM_003541	NP_003532	P62805	H4_HUMAN	histone cluster 1, H4k						CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding				0						CCAGACATGACGAGCAAGAGG	0.582													20	53	---	---	---	---	PASS
PSMB8	5696	broad.mit.edu	37	6	32810867	32810867	+	Splice_Site	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32810867C>A	uc003oce.2	-	2	191	c.148_splice	c.e2-1	p.P50_splice	PSMB8_uc003ocf.2_Splice_Site_p.P46_splice|PSMB8_uc011dqh.1_Intron	NM_148919	NP_683720	P28062	PSB8_HUMAN	proteasome beta 8 subunit isoform E2 proprotein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|type I interferon-mediated signaling pathway|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity			skin(1)	1						ATTCTGTGGGCTGATAAGAGA	0.488													25	60	---	---	---	---	PASS
MDGA1	266727	broad.mit.edu	37	6	37614074	37614074	+	Silent	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37614074C>T	uc003onu.1	-	11	3303	c.2124G>A	c.(2122-2124)CTG>CTA	p.L708L	MDGA1_uc003onv.1_5'UTR	NM_153487	NP_705691	Q8NFP4	MDGA1_HUMAN	MAM domain containing	708	Fibronectin type-III.				brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane				central_nervous_system(2)	2						GGAGATCGGTCAGGATGTACT	0.592													6	12	---	---	---	---	PASS
LRFN2	57497	broad.mit.edu	37	6	40400339	40400339	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40400339T>G	uc003oph.1	-	2	979	c.514A>C	c.(514-516)ATG>CTG	p.M172L		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	172	Extracellular (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGGTTGACCATGCGTCGCACG	0.592													5	114	---	---	---	---	PASS
LRFN2	57497	broad.mit.edu	37	6	40400484	40400484	+	Silent	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40400484C>A	uc003oph.1	-	2	834	c.369G>T	c.(367-369)CTG>CTT	p.L123L		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	123	Extracellular (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCAGGTTGACCAGGCCCCGGA	0.582													21	45	---	---	---	---	PASS
CUL7	9820	broad.mit.edu	37	6	43020080	43020080	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43020080G>T	uc003otq.2	-	2	750	c.447C>A	c.(445-447)AGC>AGA	p.S149R	CUL7_uc011dvb.1_Missense_Mutation_p.S201R|CUL7_uc010jyh.2_Intron|KLC4_uc003otr.1_Intron	NM_014780	NP_055595	Q14999	CUL7_HUMAN	cullin 7	149					interspecies interaction between organisms|ubiquitin-dependent protein catabolic process|vasculogenesis	anaphase-promoting complex|mitochondrion	ubiquitin protein ligase binding			ovary(3)|kidney(1)	4			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GGGGCTCAATGCTGGCATAGG	0.562													5	98	---	---	---	---	PASS
MEP1A	4224	broad.mit.edu	37	6	46803046	46803046	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46803046G>T	uc010jzh.1	+	13	1886	c.1844G>T	c.(1843-1845)GGC>GTC	p.G615V	MEP1A_uc011dwg.1_Missense_Mutation_p.G337V|MEP1A_uc011dwh.1_Missense_Mutation_p.G643V|MEP1A_uc011dwi.1_Missense_Mutation_p.G515V	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	meprin A alpha precursor	615	Extracellular (Potential).				digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding			pancreas(2)|ovary(1)	3			Lung(136;0.192)			AGCCCCCAAGGCCTCATTCTC	0.547													19	8	---	---	---	---	PASS
GSTA1	2938	broad.mit.edu	37	6	52658956	52658956	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52658956T>G	uc003paz.2	-	5	493	c.381A>C	c.(379-381)AAA>AAC	p.K127N		NM_145740	NP_665683	P08263	GSTA1_HUMAN	glutathione S-transferase alpha 1	127	GST C-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.118)				Amsacrine(DB00276)|Busulfan(DB01008)|Glutathione(DB00143)	GATTTTTTATTTTCTCTTTGA	0.418													15	648	---	---	---	---	PASS
TPBG	7162	broad.mit.edu	37	6	83075380	83075380	+	Silent	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83075380C>T	uc003pjn.3	+	3	1638	c.702C>T	c.(700-702)CCC>CCT	p.P234P	TPBG_uc010kbj.2_Silent_p.P234P|TPBG_uc003pjo.2_Silent_p.P234P	NM_006670	NP_006661	Q13641	TPBG_HUMAN	trophoblast glycoprotein precursor	234	Extracellular (Potential).				cell adhesion	integral to plasma membrane				central_nervous_system(1)	1		all_cancers(76;0.000805)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0897)		BRCA - Breast invasive adenocarcinoma(397;0.107)		CCCAACTGCCCAGCCTCAGGC	0.622													38	107	---	---	---	---	PASS
KIAA1009	22832	broad.mit.edu	37	6	84895046	84895046	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84895046C>T	uc010kbp.2	-	13	1619	c.1522G>A	c.(1522-1524)GCG>ACG	p.A508T	KIAA1009_uc003pkj.3_Missense_Mutation_p.A432T|KIAA1009_uc003pkk.2_Missense_Mutation_p.A508T|KIAA1009_uc003pki.3_5'UTR	NM_014895	NP_055710	Q5TB80	QN1_HUMAN	KIAA1009 protein	508					cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding			ovary(1)	1		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		CTAACTGACGCATATAATCCA	0.413													82	228	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102124587	102124587	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102124587G>A	uc003pqp.3	+	4	880	c.631G>A	c.(631-633)GCA>ACA	p.A211T	GRIK2_uc003pqn.2_Missense_Mutation_p.A211T|GRIK2_uc003pqo.3_Missense_Mutation_p.A211T|GRIK2_uc010kcw.2_Missense_Mutation_p.A211T	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	211	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	TACAAAGGATGCAAAACCCTT	0.368													36	66	---	---	---	---	PASS
C6orf174	387104	broad.mit.edu	37	6	127765251	127765251	+	3'UTR	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127765251G>T	uc003qbd.2	-	12					C6orf174_uc003qbc.2_3'UTR|C6orf174_uc003qba.2_3'UTR|C6orf174_uc003qbb.2_3'UTR|KIAA0408_uc011ebs.1_3'UTR	NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor							integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		CCAGGCCAAAGACTTAAACCA	0.478													19	54	---	---	---	---	PASS
C6orf174	387104	broad.mit.edu	37	6	127775124	127775124	+	3'UTR	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127775124C>T	uc003qbd.2	-	8					C6orf174_uc003qbc.2_Missense_Mutation_p.M1I|C6orf174_uc003qbb.2_5'Flank|KIAA0408_uc011ebs.1_Missense_Mutation_p.M1I	NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor							integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		TATGTAGGTCCATGGCAACAG	0.418													113	118	---	---	---	---	PASS
HBS1L	10767	broad.mit.edu	37	6	135303709	135303709	+	Intron	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135303709C>A	uc003qez.2	-						HBS1L_uc003qey.2_Intron|HBS1L_uc011ecy.1_Intron|HBS1L_uc011ecz.1_Intron|HBS1L_uc011eda.1_Intron	NM_006620	NP_006611	Q9Y450	HBS1L_HUMAN	Hsp70 subfamily B suppressor 1-like protein						signal transduction		GTP binding|GTPase activity|translation elongation factor activity			skin(2)	2	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		ATCTGCAAAACATACCAAAAT	0.348													3	109	---	---	---	---	PASS
LATS1	9113	broad.mit.edu	37	6	150004707	150004707	+	Silent	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150004707T>C	uc003qmu.1	-	4	2066	c.1518A>G	c.(1516-1518)CCA>CCG	p.P506P	LATS1_uc010kif.1_Silent_p.P401P|LATS1_uc003qmv.1_Silent_p.P506P|LATS1_uc003qmw.2_Silent_p.P506P|LATS1_uc010kig.1_Silent_p.P401P	NM_004690	NP_004681	O95835	LATS1_HUMAN	LATS homolog 1	506					cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		TCTGTAGCTCTGGTTTTAATA	0.453													81	197	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152451874	152451874	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152451874C>T	uc010kiw.2	-	145	26736	c.26134G>A	c.(26134-26136)GTC>ATC	p.V8712I	SYNE1_uc010kiv.2_Missense_Mutation_p.V3236I|SYNE1_uc003qos.3_Missense_Mutation_p.V3236I|SYNE1_uc003qot.3_Missense_Mutation_p.V8664I|SYNE1_uc003qou.3_Missense_Mutation_p.V8712I|SYNE1_uc003qop.3_Missense_Mutation_p.V897I|SYNE1_uc011eez.1_Intron|SYNE1_uc003qoq.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8712	Ser-rich.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGACTGCTGACAGAGGGTCCA	0.468										HNSCC(10;0.0054)			7	40	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152737884	152737884	+	Silent	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152737884A>G	uc010kiw.2	-	41	6290	c.5688T>C	c.(5686-5688)AGT>AGC	p.S1896S	SYNE1_uc003qot.3_Silent_p.S1903S|SYNE1_uc003qou.3_Silent_p.S1896S|SYNE1_uc010kjb.1_Silent_p.S1879S	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1896	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTATTCATACTGTTGGTTG	0.488										HNSCC(10;0.0054)			67	66	---	---	---	---	PASS
PARK2	5071	broad.mit.edu	37	6	161969928	161969928	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161969928C>A	uc003qtx.3	-	9	1175	c.1041G>T	c.(1039-1041)CAG>CAT	p.Q347H	PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Missense_Mutation_p.Q156H|PARK2_uc003qtw.3_Missense_Mutation_p.Q156H|PARK2_uc003qty.3_Missense_Mutation_p.Q319H|PARK2_uc003qtz.3_Missense_Mutation_p.Q198H|PARK2_uc010kke.1_Missense_Mutation_p.Q366H|PARK2_uc011egf.1_Missense_Mutation_p.Q21H	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1	347	IBR-type.				aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		TGACTTTCCTCTGGTCAGGCT	0.632													103	94	---	---	---	---	PASS
GPNMB	10457	broad.mit.edu	37	7	23296615	23296615	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23296615G>C	uc003swc.2	+	4	633	c.472G>C	c.(472-474)GAT>CAT	p.D158H	GPNMB_uc003swa.2_Missense_Mutation_p.D158H|GPNMB_uc003swb.2_Missense_Mutation_p.D158H|GPNMB_uc011jyy.1_Intron|GPNMB_uc011jyz.1_Missense_Mutation_p.D59H	NM_001005340	NP_001005340	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb isoform a	158	Extracellular (Potential).				negative regulation of cell proliferation	melanosome				ovary(3)|breast(2)	5			GBM - Glioblastoma multiforme(13;0.154)			CGTCTTCCCTGATGGGAAACC	0.483													64	43	---	---	---	---	PASS
HOXA3	3200	broad.mit.edu	37	7	27147774	27147774	+	Silent	SNP	G	A	A	rs140908739		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27147774G>A	uc011jzl.1	-	3	1292	c.1092C>T	c.(1090-1092)CCC>CCT	p.P364P	HOXA3_uc011jzk.1_Silent_p.P206P|HOXA3_uc003syk.2_Silent_p.P364P	NM_030661	NP_109377	O43365	HXA3_HUMAN	homeobox A3 isoform a	364					angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(2)	2						CCACGAAGACGGGGCTTCCCT	0.682													9	4	---	---	---	---	PASS
C7orf10	79783	broad.mit.edu	37	7	40220565	40220565	+	Silent	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40220565A>G	uc003thn.1	+	2	165	c.120A>G	c.(118-120)CCA>CCG	p.P40P	C7orf10_uc003thm.1_Silent_p.P47P|C7orf10_uc003tho.1_Silent_p.P40P	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13	47							transferase activity			ovary(2)	2						ATATAAAGCCATTGGAAGGGG	0.294													14	188	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43484986	43484986	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43484986G>T	uc003tid.1	+	11	2820	c.2215G>T	c.(2215-2217)GAG>TAG	p.E739*	HECW1_uc011kbi.1_Nonsense_Mutation_p.E739*	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	739					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						GCAAGACGACGAGGAGGAGGA	0.642													6	66	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48684351	48684351	+	Splice_Site	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48684351G>A	uc003toq.2	+	61	15106	c.15081_splice	c.e61+1	p.Q5027_splice	ABCA13_uc010kys.1_Splice_Site_p.Q2102_splice|ABCA13_uc010kyu.1_Splice_Site_p.Q757_splice	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TTTGGAGCAGGTATAGTATCT	0.343													9	143	---	---	---	---	PASS
ZNF479	90827	broad.mit.edu	37	7	57187718	57187718	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57187718T>A	uc010kzo.2	-	5	1675	c.1404A>T	c.(1402-1404)GAA>GAT	p.E468D		NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479	468	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			TGCCACATTCTTCACATGTGT	0.423													7	97	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98506430	98506430	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98506430G>A	uc003upp.2	+	14	1404	c.1195G>A	c.(1195-1197)GTC>ATC	p.V399I	TRRAP_uc011kis.1_Missense_Mutation_p.V399I|TRRAP_uc003upr.2_Missense_Mutation_p.V91I	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	399					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTCCCTCGCCGTCCAGCTCTT	0.647													7	11	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100676069	100676069	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100676069C>A	uc003uxp.1	+	3	1425	c.1372C>A	c.(1372-1374)CCT>ACT	p.P458T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	458	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|5.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AACAAGTATGCCTGTCAGCAC	0.498													169	213	---	---	---	---	PASS
MOGAT3	346606	broad.mit.edu	37	7	100839548	100839548	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100839548G>T	uc003uyc.2	-	6	958	c.791C>A	c.(790-792)CCT>CAT	p.P264H	MOGAT3_uc010lhr.2_Intron	NM_178176	NP_835470	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	264					glycerol metabolic process|lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity|diacylglycerol O-acyltransferase activity			ovary(2)	2	Lung NSC(181;0.168)|all_lung(186;0.215)					GAAGATGCAAGGAGAGAAGCC	0.582													11	16	---	---	---	---	PASS
NAMPT	10135	broad.mit.edu	37	7	105893560	105893560	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105893560T>C	uc003vdq.2	-	10	1576	c.1268A>G	c.(1267-1269)AAA>AGA	p.K423R		NM_005746	NP_005737	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	423					cell-cell signaling|NAD biosynthetic process|nicotinamide metabolic process|positive regulation of cell proliferation|positive regulation of nitric-oxide synthase biosynthetic process|signal transduction|water-soluble vitamin metabolic process	cytosol	cytokine activity|nicotinamide phosphoribosyltransferase activity|nicotinate phosphoribosyltransferase activity|nicotinate-nucleotide diphosphorylase (carboxylating) activity			large_intestine(1)	1						TTTGGACCTTTTGTTGGGATC	0.403													37	72	---	---	---	---	PASS
MET	4233	broad.mit.edu	37	7	116411551	116411551	+	Splice_Site	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116411551G>C	uc003vij.2	+	13	2918	c.2731_splice	c.e13-1	p.W911_splice	MET_uc010lkh.2_Splice_Site_p.W929_splice|MET_uc011knj.1_Splice_Site_p.W481_splice	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor						axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			GTCATTTTTAGTGGAAGCAAG	0.368			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				84	159	---	---	---	---	PASS
LMOD2	442721	broad.mit.edu	37	7	123296224	123296224	+	Silent	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123296224G>T	uc003vky.2	+	1	364	c.207G>T	c.(205-207)CTG>CTT	p.L69L		NM_207163	NP_997046	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	69	Glu-rich.					cytoskeleton	actin binding|tropomyosin binding				0						GAGAGGCACTGATGGCCTATT	0.532													12	12	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141765143	141765143	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141765143A>T	uc003vwy.2	+	38	4547	c.4493A>T	c.(4492-4494)CAG>CTG	p.Q1498L		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	1498	Glucoamylase.|Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGAGCCGTGCAGGAGGTGACG	0.607													5	9	---	---	---	---	PASS
OR2A5	393046	broad.mit.edu	37	7	143747699	143747699	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143747699G>C	uc011ktw.1	+	1	205	c.205G>C	c.(205-207)GAT>CAT	p.D69H		NM_012365	NP_036497	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Melanoma(164;0.0783)					GGCCATCATTGATATTTCGTA	0.498													84	120	---	---	---	---	PASS
KRBA1	84626	broad.mit.edu	37	7	149418508	149418508	+	Silent	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149418508G>T	uc003wfz.2	+	5	747	c.348G>T	c.(346-348)CTG>CTT	p.L116L	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_5'Flank	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	116										ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TCCGAGGCCTGCTCAGCTGCC	0.627													4	15	---	---	---	---	PASS
GALNTL5	168391	broad.mit.edu	37	7	151711789	151711789	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151711789A>G	uc003wkp.2	+	8	1310	c.1087A>G	c.(1087-1089)AAG>GAG	p.K363E	GALNTL5_uc003wkq.2_Missense_Mutation_p.K114E|GALNTL5_uc003wkr.2_RNA|GALNTL5_uc003wks.2_RNA|GALNTL5_uc010lqf.2_Missense_Mutation_p.K252E	NM_145292	NP_660335	Q7Z4T8	GLTL5_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	363	Catalytic subdomain B.|Lumenal (Potential).					Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		ACATATCAGTAAGAAACAAAC	0.408													66	115	---	---	---	---	PASS
INSIG1	3638	broad.mit.edu	37	7	155095617	155095617	+	Intron	SNP	A	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155095617A>C	uc003wly.2	+						INSIG1_uc011kvu.1_Intron|INSIG1_uc003wlz.2_Intron	NM_005542	NP_005533	O15503	INSI1_HUMAN	insulin induced gene 1 isoform 1						cell proliferation|ER-nuclear sterol response pathway	endoplasmic reticulum membrane|integral to membrane	protein binding				0	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TAGAATTTGCAGTCTTCCACT	0.348													21	47	---	---	---	---	PASS
DLC1	10395	broad.mit.edu	37	8	12947973	12947973	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12947973C>T	uc003wwm.2	-	15	4306	c.3862G>A	c.(3862-3864)GAG>AAG	p.E1288K	DLC1_uc003wwk.1_Missense_Mutation_p.E851K|DLC1_uc003wwl.1_Missense_Mutation_p.E885K|DLC1_uc011kxx.1_Missense_Mutation_p.E777K	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	1288					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						CTCATTTCCTCGGGAACCTGT	0.512													42	8	---	---	---	---	PASS
XPO7	23039	broad.mit.edu	37	8	21856802	21856802	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21856802C>T	uc003xaa.3	+	23	2731	c.2629C>T	c.(2629-2631)CAC>TAC	p.H877Y	XPO7_uc010lti.2_Missense_Mutation_p.H886Y|XPO7_uc010ltk.2_Missense_Mutation_p.H878Y	NM_015024	NP_055839	Q9UIA9	XPO7_HUMAN	exportin 7 isoform b	877					mRNA transport|protein export from nucleus|transmembrane transport	cytoplasm|nuclear pore	nuclear export signal receptor activity|protein transporter activity			ovary(1)|kidney(1)|breast(1)|central_nervous_system(1)|pancreas(1)	5				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		CTCTATTCCTCACAGTGATCT	0.478													166	70	---	---	---	---	PASS
PHYHIP	9796	broad.mit.edu	37	8	22084393	22084393	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22084393C>A	uc003xbk.3	-	4	1005	c.311G>T	c.(310-312)TGG>TTG	p.W104L	PHYHIP_uc003xbj.3_Missense_Mutation_p.W104L	NM_001099335	NP_001092805	Q92561	PHYIP_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein	104	Fibronectin type-III.										0				Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0629)		CGTCTCGCTCCAGCCGGACAC	0.647													28	5	---	---	---	---	PASS
FZD3	7976	broad.mit.edu	37	8	28420380	28420380	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28420380C>A	uc003xgx.2	+	8	2331	c.1853C>A	c.(1852-1854)ACA>AAA	p.T618K	FZD3_uc010lvb.2_Missense_Mutation_p.T618K	NM_017412	NP_059108	Q9NPG1	FZD3_HUMAN	frizzled 3 precursor	618	Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell proliferation in midbrain|commissural neuron axon guidance|establishment of planar polarity|facial nucleus development|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|inner ear morphogenesis|neural tube closure|vasculature development	apical part of cell|axon|cytoplasm|dendrite|integral to membrane|neuron projection membrane|neuronal cell body|presynaptic active zone	G-protein coupled receptor activity|PDZ domain binding|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		TCACGACTAACAGATCACTCC	0.453													31	8	---	---	---	---	PASS
TMEM66	51669	broad.mit.edu	37	8	29927553	29927553	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29927553T>C	uc003xhs.2	-	3	489	c.305A>G	c.(304-306)GAT>GGT	p.D102G	TMEM66_uc003xht.2_Missense_Mutation_p.D102G|TMEM66_uc003xhu.2_Missense_Mutation_p.D66G|TMEM66_uc003xhv.2_5'UTR	NM_016127	NP_057211	Q96BY9	TMM66_HUMAN	transmembrane protein 66 precursor	102						integral to membrane					0				KIRC - Kidney renal clear cell carcinoma(542;0.0993)|Kidney(114;0.119)		GTATGCAATATCTAAGTCCGT	0.333													4	227	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35606132	35606132	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35606132G>T	uc003xjr.1	+	12	2182	c.1854G>T	c.(1852-1854)TTG>TTT	p.L618F	UNC5D_uc003xjs.1_Missense_Mutation_p.L613F|UNC5D_uc003xju.1_Missense_Mutation_p.L194F	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	618	ZU5.|Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CCTTTGCATTGACCATCCCGC	0.507													133	135	---	---	---	---	PASS
SGK3	23678	broad.mit.edu	37	8	67755686	67755686	+	Splice_Site	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67755686G>C	uc003xwr.2	+	14	1278	c.979_splice	c.e14-1	p.Y327_splice	SGK3_uc003xwp.2_Splice_Site_p.Y321_splice|SGK3_uc003xwt.2_Splice_Site_p.Y327_splice|SGK3_uc003xwu.2_Intron	NM_001033578	NP_001028750	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase 3 isoform						cell communication|response to stress	cytoplasmic membrane-bounded vesicle|early endosome	ATP binding|phosphatidylinositol binding|protein serine/threonine kinase activity			ovary(1)|large_intestine(1)|lung(1)|breast(1)	4	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GTTTTCTATAGTATCTTGCAC	0.308													4	152	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113649187	113649187	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113649187T>A	uc003ynu.2	-	22	3733	c.3574A>T	c.(3574-3576)AGT>TGT	p.S1192C	CSMD3_uc003yns.2_Missense_Mutation_p.S464C|CSMD3_uc003ynt.2_Missense_Mutation_p.S1152C|CSMD3_uc011lhx.1_Missense_Mutation_p.S1088C	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1192	Sushi 6.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CCGATTCGACTACCATATTGA	0.443										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			5	179	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139838952	139838952	+	Silent	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139838952C>T	uc003yvd.2	-	6	1365	c.918G>A	c.(916-918)CGG>CGA	p.R306R		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	306	TSP N-terminal.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AGTCTTCCTTCCGAGAGGTTT	0.507										HNSCC(7;0.00092)			95	22	---	---	---	---	PASS
PTK2	5747	broad.mit.edu	37	8	141810641	141810641	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141810641G>A	uc003yvu.2	-	12	1240	c.1010C>T	c.(1009-1011)GCG>GTG	p.A337V	PTK2_uc011ljq.1_5'UTR|PTK2_uc003yvp.2_5'UTR|PTK2_uc003yvq.2_5'UTR|PTK2_uc003yvr.2_Missense_Mutation_p.A236V|PTK2_uc003yvs.2_Missense_Mutation_p.A337V|PTK2_uc003yvt.2_Missense_Mutation_p.A359V|PTK2_uc003yvv.2_Missense_Mutation_p.A224V|PTK2_uc011ljr.1_Missense_Mutation_p.A337V	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a	337	FERM.				axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CATATTCTCCGCAATGGTTAG	0.483													4	134	---	---	---	---	PASS
C9orf150	286343	broad.mit.edu	37	9	12775704	12775704	+	5'UTR	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12775704C>A	uc003zkw.2	+	1						NM_203403	NP_981948	Q8IV03	CI150_HUMAN	hypothetical protein LOC286343												0				GBM - Glioblastoma multiforme(1;1.64e-13)		TATCGCCGTTCCGGAAAAGTC	0.572													10	21	---	---	---	---	PASS
BNC2	54796	broad.mit.edu	37	9	16582977	16582977	+	Intron	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16582977T>C	uc003zml.2	-						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc003zmq.1_Intron|BNC2_uc003zmr.1_Intron|BNC2_uc003zmp.1_Intron|BNC2_uc010mij.1_Intron|BNC2_uc003zmo.1_Intron	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		CAGATTTTCCTCACCATGTGC	0.343													100	128	---	---	---	---	PASS
FRMPD1	22844	broad.mit.edu	37	9	37740726	37740726	+	Missense_Mutation	SNP	C	T	T	rs147406379	byFrequency	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37740726C>T	uc004aag.1	+	15	2245	c.2201C>T	c.(2200-2202)CCG>CTG	p.P734L	FRMPD1_uc004aah.1_Missense_Mutation_p.P734L|FRMPD1_uc011lqm.1_Missense_Mutation_p.P556L|FRMPD1_uc011lqn.1_Missense_Mutation_p.P603L	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	734						cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		GGGGGAGCCCCGCCAGCCTGG	0.652													24	16	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79318347	79318347	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79318347G>T	uc010mpk.2	-	9	8306	c.8182C>A	c.(8182-8184)CCA>ACA	p.P2728T	PRUNE2_uc004akj.3_Missense_Mutation_p.P181T|PRUNE2_uc010mpl.1_Missense_Mutation_p.P181T	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	2728					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						ACAGGCTGTGGTGAAAGCATT	0.512													75	60	---	---	---	---	PASS
BAAT	570	broad.mit.edu	37	9	104125029	104125029	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104125029A>G	uc010mtd.2	-	4	1047	c.938T>C	c.(937-939)ATT>ACT	p.I313T	BAAT_uc004bbd.3_Missense_Mutation_p.I313T	NM_001127610	NP_001121082	Q14032	BAAT_HUMAN	bile acid Coenzyme A: amino acid	313					acyl-CoA metabolic process|bile acid and bile salt transport|bile acid biosynthetic process|digestion|fatty acid metabolic process|glycine metabolic process	cytosol|peroxisomal matrix	carboxylesterase activity|glycine N-choloyltransferase activity|N-acyltransferase activity|palmitoyl-CoA hydrolase activity			ovary(1)|lung(1)|skin(1)	3		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	GGCCTCTTCAATAGGAAACAA	0.448													91	101	---	---	---	---	PASS
ZFP37	7539	broad.mit.edu	37	9	115818962	115818962	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115818962C>G	uc004bgm.1	-	1	35	c.7G>C	c.(7-9)GTC>CTC	p.V3L	ZFP37_uc011lwz.1_Missense_Mutation_p.V3L|ZFP37_uc011lxa.1_Missense_Mutation_p.V3L	NM_003408	NP_003399	Q9Y6Q3	ZFP37_HUMAN	zinc finger protein 37 homolog	3						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						CCGCTGGAGACCGACATGGCG	0.662													27	37	---	---	---	---	PASS
OLFML2A	169611	broad.mit.edu	37	9	127572392	127572392	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127572392G>A	uc004bov.2	+	8	1773	c.1660G>A	c.(1660-1662)GAC>AAC	p.D554N	OLFML2A_uc004bow.2_Missense_Mutation_p.D340N	NM_182487	NP_872293	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A precursor	554	Olfactomedin-like.										0						GAGTCGCTTGGACCCCGGCGA	0.652													31	46	---	---	---	---	PASS
NCS1	23413	broad.mit.edu	37	9	132984952	132984952	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132984952G>A	uc004bzi.2	+	5	417	c.331G>A	c.(331-333)GAC>AAC	p.D111N	NCS1_uc010myz.1_Missense_Mutation_p.D93N	NM_014286	NP_055101	P62166	NCS1_HUMAN	frequenin homolog isoform 1	111	EF-hand 3.|2.				negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding				0						CTACGACTTGGACAATGATGG	0.567													28	40	---	---	---	---	PASS
KCNT1	57582	broad.mit.edu	37	9	138669314	138669314	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138669314C>G	uc011mdq.1	+	21	2554	c.2480C>G	c.(2479-2481)TCC>TGC	p.S827C	KCNT1_uc011mdr.1_Missense_Mutation_p.S654C|KCNT1_uc010nbf.2_Missense_Mutation_p.S782C|KCNT1_uc004cgo.1_Missense_Mutation_p.S576C	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	827						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		TACTACAGATCCCGCAAGGAG	0.627													28	41	---	---	---	---	PASS
UBAC1	10422	broad.mit.edu	37	9	138838190	138838190	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138838190C>T	uc004cgt.2	-	5	687	c.469G>A	c.(469-471)GTG>ATG	p.V157M	UBAC1_uc004cgs.1_Missense_Mutation_p.V157M|UBAC1_uc004cgu.2_RNA	NM_016172	NP_057256	Q9BSL1	UBAC1_HUMAN	ubiquitin associated domain containing 1	157						Golgi apparatus|plasma membrane	protein binding			skin(2)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		ATGAGAGACACCAGTATCTTC	0.473													49	54	---	---	---	---	PASS
INPP5E	56623	broad.mit.edu	37	9	139327487	139327487	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139327487C>G	uc004cho.2	-	5	1585	c.1200G>C	c.(1198-1200)CAG>CAC	p.Q400H	INPP5E_uc010nbm.2_Missense_Mutation_p.Q400H	NM_019892	NP_063945	Q9NRR6	INP5E_HUMAN	inositol polyphosphate-5-phosphatase E	400						cilium axoneme|cytoskeleton|Golgi cisterna membrane	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity			skin(1)	1		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		TGGTCTTGATCTGAGACACGA	0.602													21	30	---	---	---	---	PASS
SEC16A	9919	broad.mit.edu	37	9	139366443	139366443	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139366443C>T	uc004chx.2	-	4	3997	c.3688G>A	c.(3688-3690)GAA>AAA	p.E1230K	SEC16A_uc004chv.3_Missense_Mutation_p.E620K|SEC16A_uc004chw.2_Missense_Mutation_p.E1230K|SEC16A_uc010nbn.2_Missense_Mutation_p.E1230K	NM_014866	NP_055681	O15027	SC16A_HUMAN	SEC16 homolog A	1052	Required for endoplasmic reticulum localization.				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane					0		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GGTGGCCGTTCCGAGGAGTGG	0.632													24	18	---	---	---	---	PASS
FAM21A	387680	broad.mit.edu	37	10	51892656	51892656	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51892656A>T	uc001jjb.2	+	31	4059	c.3977A>T	c.(3976-3978)AAG>ATG	p.K1326M	FAM21A_uc001jja.1_Intron|FAM21A_uc010qhi.1_Missense_Mutation_p.K1305M|FAM21A_uc010qhj.1_Missense_Mutation_p.K1264M|FAM21B_uc009xoq.2_Missense_Mutation_p.K1238M	NM_001005751	NP_001005751	Q641Q2	FA21A_HUMAN	hypothetical protein LOC387680	1326					retrograde transport, endosome to Golgi	early endosome membrane|WASH complex				ovary(1)	1						TTTGAACACAAGGTGTCCAAC	0.473													32	15	---	---	---	---	PASS
ZMIZ1	57178	broad.mit.edu	37	10	81061960	81061960	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81061960A>G	uc001kaf.2	+	18	2688	c.2116A>G	c.(2116-2118)ATC>GTC	p.I706V	ZMIZ1_uc001kag.2_Missense_Mutation_p.I582V	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17	706					transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			AGAGCACTGTATCACGAAAAG	0.617													9	68	---	---	---	---	PASS
DNTT	1791	broad.mit.edu	37	10	98078223	98078223	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98078223G>A	uc001kmf.2	+	2	488	c.318G>A	c.(316-318)TGG>TGA	p.W106*	DNTT_uc001kmg.2_Nonsense_Mutation_p.W106*	NM_004088	NP_004079	P04053	TDT_HUMAN	terminal deoxynucleotidyltransferase isoform 1	106	BRCT.				DNA modification	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding			ovary(1)	1		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		ATGTCTCCTGGCTGATCGAAT	0.478													70	30	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115423110	115423110	+	Splice_Site	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115423110C>A	uc001laj.2	-	2	331	c.167_splice	c.e2+1	p.A56_splice	NRAP_uc001lak.2_Splice_Site_p.A56_splice|NRAP_uc001lal.3_Splice_Site_p.A56_splice	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S							fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CAAACACTTACGCGTGACAGT	0.398													26	12	---	---	---	---	PASS
OR51B2	79345	broad.mit.edu	37	11	5345298	5345298	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5345298G>C	uc001mao.1	-	1	285	c.230C>G	c.(229-231)CCT>CGT	p.P77R	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033180	NP_149420	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B,	77	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CATTACAGTAGGCATCGTGGT	0.493													43	58	---	---	---	---	PASS
OR52B2	255725	broad.mit.edu	37	11	6191107	6191107	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6191107G>A	uc010qzy.1	-	1	450	c.450C>T	c.(448-450)GTC>GTT	p.V150V		NM_001004052	NP_001004052	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B,	150	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCGGGTGATGACGGCCAGAG	0.507													17	35	---	---	---	---	PASS
HPS5	11234	broad.mit.edu	37	11	18320386	18320386	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18320386C>A	uc001mod.1	-	10	1395	c.1117G>T	c.(1117-1119)GCT>TCT	p.A373S	HPS5_uc001moe.1_Missense_Mutation_p.A259S|HPS5_uc001mof.1_Missense_Mutation_p.A259S	NM_181507	NP_852608	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5 isoform a	373						cytosol				ovary(1)|pancreas(1)|skin(1)	3						GTACGAGCAGCCAAGTTCCAT	0.463									Hermansky-Pudlak_syndrome				81	137	---	---	---	---	PASS
NELL1	4745	broad.mit.edu	37	11	20805279	20805279	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20805279C>G	uc001mqe.2	+	3	391	c.238C>G	c.(238-240)CTG>GTG	p.L80V	NELL1_uc001mqf.2_Missense_Mutation_p.L80V|NELL1_uc009yid.2_Missense_Mutation_p.L108V|NELL1_uc010rdo.1_Missense_Mutation_p.L80V|NELL1_uc010rdp.1_5'UTR	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	80					cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						ATTAATTCAGCTGTTCCGGAA	0.368													39	63	---	---	---	---	PASS
OR4X2	119764	broad.mit.edu	37	11	48266819	48266819	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48266819T>C	uc001ngs.1	+	1	164	c.164T>C	c.(163-165)CTC>CCC	p.L55P		NM_001004727	NP_001004727	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X,	55	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TACTTCTTCCTCAGCTACCTC	0.493													13	195	---	---	---	---	PASS
OR8H3	390152	broad.mit.edu	37	11	55890765	55890765	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55890765A>T	uc001nii.1	+	1	917	c.917A>T	c.(916-918)CAG>CTG	p.Q306L		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	306	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)					AGAGTCATGCAGAGAAGACAG	0.353													29	134	---	---	---	---	PASS
OR4D6	219983	broad.mit.edu	37	11	59224643	59224643	+	Silent	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59224643C>T	uc010rku.1	+	1	210	c.210C>T	c.(208-210)GAC>GAT	p.D70D		NM_001004708	NP_001004708	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CAGTCCTGGACATCGTTTTTT	0.458													58	101	---	---	---	---	PASS
HNRNPUL2	221092	broad.mit.edu	37	11	62490111	62490111	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62490111G>A	uc001nuw.2	-	6	1250	c.1057C>T	c.(1057-1059)CAG>TAG	p.Q353*	HNRNPUL2_uc001nuu.1_RNA	NM_001079559	NP_001073027	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like	353	B30.2/SPRY.				cell killing	nucleus	ATP binding|nucleic acid binding				0						CCAAAAGTCTGGCCAAATTCC	0.438													80	96	---	---	---	---	PASS
MACROD1	28992	broad.mit.edu	37	11	63767113	63767113	+	Splice_Site	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63767113C>A	uc001nyh.2	-	6	905	c.786_splice	c.e6+1	p.V262_splice		NM_014067	NP_054786	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1												0						CCGTCCCTCACCACCGAGCGG	0.716													4	6	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71725724	71725724	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71725724G>A	uc001orl.1	-	15	2997	c.2825C>T	c.(2824-2826)GCG>GTG	p.A942V	NUMA1_uc009ysw.1_Missense_Mutation_p.A505V|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Missense_Mutation_p.A942V|NUMA1_uc001orn.2_Missense_Mutation_p.A505V|NUMA1_uc009ysx.1_Missense_Mutation_p.A942V|NUMA1_uc001oro.1_Missense_Mutation_p.A942V	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	942	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						TCCTGCCCTCGCAGGCTCCTT	0.637			T	RARA	APL								4	105	---	---	---	---	PASS
PICALM	8301	broad.mit.edu	37	11	85707960	85707960	+	Silent	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85707960C>T	uc001pbm.2	-	12	1453	c.1167G>A	c.(1165-1167)CTG>CTA	p.L389L	PICALM_uc001pbl.2_Silent_p.L389L|PICALM_uc001pbn.2_Silent_p.L389L|PICALM_uc010rtl.1_Silent_p.L338L|PICALM_uc010rtk.1_Silent_p.L21L|PICALM_uc001pbo.1_Silent_p.L21L	NM_007166	NP_009097	Q13492	PICAL_HUMAN	phosphatidylinositol-binding clathrin assembly	389					clathrin coat assembly|endosome transport|negative regulation of receptor-mediated endocytosis|positive regulation of transcription, DNA-dependent|receptor internalization|regulation of protein localization	clathrin coat|clathrin-coated vesicle|coated pit|Golgi apparatus|nucleus|postsynaptic membrane|presynaptic membrane	1-phosphatidylinositol binding|clathrin heavy chain binding			urinary_tract(1)|ovary(1)	2		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				GATCATTGGGCAGCTTTGATG	0.413			T	MLLT10|MLL	TALL|AML|								54	49	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92523317	92523317	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92523317C>T	uc001pdj.3	+	7	4561	c.4544C>T	c.(4543-4545)ACT>ATT	p.T1515I		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1515	Cadherin 14.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GACCCTAGCACTGGCGTGCTC	0.483										TCGA Ovarian(4;0.039)			80	227	---	---	---	---	PASS
GPR83	10888	broad.mit.edu	37	11	94113620	94113620	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94113620T>C	uc001pet.2	-	4	1139	c.967A>G	c.(967-969)AAC>GAC	p.N323D		NM_016540	NP_057624	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83 precursor	323	Extracellular (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			central_nervous_system(2)|ovary(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				AGGGCATTGTTGGTGCGGATG	0.527													160	86	---	---	---	---	PASS
ANGPTL5	253935	broad.mit.edu	37	11	101765763	101765763	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101765763A>G	uc001pgl.2	-	8	1290	c.694T>C	c.(694-696)TAT>CAT	p.Y232H		NM_178127	NP_835228	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5 precursor	232	Fibrinogen C-terminal.				signal transduction	extracellular space	receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)		TTTACTATATAAAAAATCTTT	0.264													61	51	---	---	---	---	PASS
C11orf63	79864	broad.mit.edu	37	11	122795604	122795604	+	Splice_Site	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122795604G>T	uc001pym.2	+	4	1162	c.865_splice	c.e4-1	p.I289_splice		NM_024806	NP_079082	Q6NUN7	CK063_HUMAN	hypothetical protein LOC79864 isoform 1											ovary(3)	3		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		tACCTACCTAGATCTCCTACC	0.333													7	83	---	---	---	---	PASS
KDM5A	5927	broad.mit.edu	37	12	406233	406233	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:406233G>A	uc001qif.1	-	25	4571	c.4208C>T	c.(4207-4209)TCT>TTT	p.S1403F	KDM5A_uc001qie.1_Missense_Mutation_p.S1403F	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	1403					chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						AGAAGCAGAAGAATAAGCATG	0.398			T 	NUP98	AML								17	40	---	---	---	---	PASS
FOXJ2	55810	broad.mit.edu	37	12	8197386	8197386	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8197386G>A	uc001qtu.2	+	6	1734	c.649G>A	c.(649-651)GCA>ACA	p.A217T	FOXJ2_uc001qtt.1_Missense_Mutation_p.A217T	NM_018416	NP_060886	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	217					embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	nucleolus|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding			upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				Kidney(36;0.0944)		TGGAGCAGTGGCAGCAGGGGC	0.502													66	60	---	---	---	---	PASS
SLCO1B3	28234	broad.mit.edu	37	12	21015494	21015494	+	Splice_Site	SNP	T	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21015494T>A	uc001rek.2	+	6	754	c.628_splice	c.e6+2	p.G210_splice	SLCO1B3_uc001rel.2_Splice_Site_p.G210_splice|SLCO1B3_uc010sil.1_Splice_Site_p.G210_splice|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Splice_Site_p.G35_splice	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					TGTATTTAGGTAACGTACAGA	0.318													40	95	---	---	---	---	PASS
FAR2	55711	broad.mit.edu	37	12	29423457	29423457	+	Silent	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29423457G>T	uc001ris.3	+	2	222	c.75G>T	c.(73-75)GTG>GTT	p.V25V	FAR2_uc001rit.2_Silent_p.V25V|FAR2_uc009zjm.2_Intron	NM_018099	NP_060569	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	25					ether lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor				0						TGGGCAAAGTGCTGATGGAGA	0.522													34	47	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31237560	31237560	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31237560A>G	uc001rjt.1	+	4	688	c.437A>G	c.(436-438)CAG>CGG	p.Q146R	DDX11_uc010sjw.1_Missense_Mutation_p.Q146R|DDX11_uc010sjx.1_RNA|DDX11_uc001rjr.1_Missense_Mutation_p.Q146R|DDX11_uc001rjs.1_Missense_Mutation_p.Q146R|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_Missense_Mutation_p.Q146R|DDX11_uc001rjw.1_Missense_Mutation_p.Q120R	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11	146	Helicase ATP-binding.				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CGCCTGCAGCAGCTGCAGCAC	0.587										Multiple Myeloma(12;0.14)			8	9	---	---	---	---	PASS
SYT10	341359	broad.mit.edu	37	12	33579334	33579334	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33579334C>A	uc001rll.1	-	2	545	c.248G>T	c.(247-249)TGC>TTC	p.C83F	SYT10_uc009zju.1_5'UTR	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	83	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					GCTTTTCCAGCATGGCCAACA	0.438													43	57	---	---	---	---	PASS
PDZRN4	29951	broad.mit.edu	37	12	41966881	41966881	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41966881C>A	uc010skn.1	+	10	1771	c.1703C>A	c.(1702-1704)ACC>AAC	p.T568N	PDZRN4_uc001rmq.3_Missense_Mutation_p.T509N|PDZRN4_uc009zjz.2_Missense_Mutation_p.T507N|PDZRN4_uc001rmr.2_Missense_Mutation_p.T394N	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	767							ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				ATCAACCTCACCAATAAGAAA	0.512													70	111	---	---	---	---	PASS
NR4A1	3164	broad.mit.edu	37	12	52449850	52449850	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52449850G>T	uc001rzs.2	+	4	1227	c.913G>T	c.(913-915)GCT>TCT	p.A305S	NR4A1_uc010sno.1_Missense_Mutation_p.A318S|NR4A1_uc001rzt.2_Missense_Mutation_p.A305S|NR4A1_uc009zmc.2_5'Flank	NM_002135	NP_002126	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	305	NR C4-type.|Nuclear receptor.				nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0967)		CATCTGCCTGGCTAACAAGGA	0.612													38	54	---	---	---	---	PASS
KRT6A	3853	broad.mit.edu	37	12	52882246	52882246	+	Silent	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52882246C>A	uc001sam.2	-	7	1499	c.1290G>T	c.(1288-1290)CTG>CTT	p.L430L		NM_005554	NP_005545	P02538	K2C6A_HUMAN	keratin 6A	430	Rod.|Coil 2.				cell differentiation|ectoderm development|positive regulation of cell proliferation	keratin filament	protein binding|structural constituent of cytoskeleton			ovary(4)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.189)		GGGCATCCTCCAGCCCTTCCA	0.612													55	69	---	---	---	---	PASS
SMARCC2	6601	broad.mit.edu	37	12	56565666	56565666	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56565666C>T	uc001skb.2	-	20	1995	c.1889G>A	c.(1888-1890)CGC>CAC	p.R630H	SMARCC2_uc001skd.2_Missense_Mutation_p.R661H|SMARCC2_uc001ska.2_Missense_Mutation_p.R661H|SMARCC2_uc001skc.2_Missense_Mutation_p.R660H|SMARCC2_uc010sqf.1_Missense_Mutation_p.R550H	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated	630	SANT.				chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			GTCCTGTGTGCGGCTTCCCAC	0.532													3	75	---	---	---	---	PASS
SLC5A8	160728	broad.mit.edu	37	12	101584285	101584285	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101584285T>C	uc001thz.3	-	6	1184	c.794A>G	c.(793-795)CAG>CGG	p.Q265R		NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),	265	Cytoplasmic (Potential).				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						AATATATCTCTGCACCTGGGA	0.398													84	119	---	---	---	---	PASS
ASCL1	429	broad.mit.edu	37	12	103352352	103352352	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103352352C>A	uc001tjr.3	+	1	901	c.330C>A	c.(328-330)TAC>TAA	p.Y110*		NM_004316	NP_004307	P50553	ASCL1_HUMAN	achaete-scute complex homolog 1	110					cerebral cortex GABAergic interneuron differentiation|negative regulation of apoptosis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|noradrenergic neuron fate commitment|Notch signaling pathway|positive regulation of neuron differentiation|positive regulation of transcription from RNA polymerase II promoter|response to retinoic acid|sympathetic nervous system development	nucleus	bHLH transcription factor binding|E-box binding|sequence-specific DNA binding transcription factor activity|transcription factor binding transcription factor activity				0						GCTTTGGCTACAGCCTGCCGC	0.667													3	3	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104107464	104107464	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104107464G>T	uc001tjw.2	+	42	4641	c.4455G>T	c.(4453-4455)AAG>AAT	p.K1485N	STAB2_uc009zug.2_RNA	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1485	Extracellular (Potential).|EGF-like 12.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GCTCTGCCAAGGCTGACTGTA	0.532													140	194	---	---	---	---	PASS
RNF34	80196	broad.mit.edu	37	12	121855404	121855404	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121855404C>T	uc001ual.1	+	3	437	c.323C>T	c.(322-324)ACA>ATA	p.T108I	RNF34_uc010szw.1_Missense_Mutation_p.T109I|RNF34_uc001uak.1_Missense_Mutation_p.T109I|RNF34_uc001uam.1_Missense_Mutation_p.T108I	NM_025126	NP_079402	Q969K3	RNF34_HUMAN	ring finger protein 34 isoform 2	108					apoptosis	endomembrane system|membrane|nuclear speck	ligase activity|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)		TTACAAGAGACAGCATTTCAG	0.423													55	83	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132561094	132561094	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132561094A>T	uc001ujn.2	+	51	9090	c.9055A>T	c.(9055-9057)ACA>TCA	p.T3019S	EP400_uc001ujl.2_Missense_Mutation_p.T3018S|EP400_uc001ujm.2_Missense_Mutation_p.T2938S|EP400_uc001ujp.2_Missense_Mutation_p.T229S|EP400_uc010tbo.1_Missense_Mutation_p.N85I	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	3055					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		TCAACAGCAAACACCCGTGGC	0.443													12	39	---	---	---	---	PASS
SPG20	23111	broad.mit.edu	37	13	36878767	36878767	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36878767T>G	uc001uvn.2	-	10	2006	c.1736A>C	c.(1735-1737)TAC>TCC	p.Y579S	SPG20_uc010ten.1_Missense_Mutation_p.Y569S|SPG20_uc001uvm.2_Missense_Mutation_p.Y579S|SPG20_uc001uvo.2_Missense_Mutation_p.Y579S|SPG20_uc001uvq.2_Missense_Mutation_p.Y579S	NM_001142296	NP_001135768	Q8N0X7	SPG20_HUMAN	spartin	579					cell death	cytoplasm	ubiquitin protein ligase binding				0		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		ATTATATCCGTATCTTTAAAA	0.343													66	12	---	---	---	---	PASS
LRCH1	23143	broad.mit.edu	37	13	47263261	47263261	+	Intron	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47263261A>G	uc001vbj.2	+						LRCH1_uc010acp.2_Intron|LRCH1_uc001vbk.2_Intron|LRCH1_uc001vbl.3_Intron	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)											ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GATGGCATCTATCTCAGCAAG	0.328													10	193	---	---	---	---	PASS
TMTC4	84899	broad.mit.edu	37	13	101287433	101287433	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101287433G>T	uc001vou.2	-	10	1322	c.1162C>A	c.(1162-1164)CTG>ATG	p.L388M	TMTC4_uc001vot.2_Missense_Mutation_p.L407M|TMTC4_uc010tja.1_Missense_Mutation_p.L277M|TMTC4_uc001vov.1_Missense_Mutation_p.L133M|TMTC4_uc001vow.1_Missense_Mutation_p.L171M	NM_001079669	NP_001073137	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat	388	Helical; (Potential).					integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AGAAATCCCAGGCCCAGAGTA	0.458													22	4	---	---	---	---	PASS
OR4K5	79317	broad.mit.edu	37	14	20389649	20389649	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20389649A>T	uc010tkw.1	+	1	884	c.884A>T	c.(883-885)AAG>ATG	p.K295M		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	295	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AGGGATATGAAGGCTGCCGTA	0.383													65	183	---	---	---	---	PASS
OR4K1	79544	broad.mit.edu	37	14	20404281	20404281	+	Silent	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20404281C>T	uc001vwj.1	+	1	456	c.456C>T	c.(454-456)GGC>GGT	p.G152G		NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K,	152	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GGGCGGTGGGCGTTCTTCATT	0.458													40	163	---	---	---	---	PASS
IPO4	79711	broad.mit.edu	37	14	24655080	24655080	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24655080G>C	uc001wmv.1	-	12	1287	c.1156C>G	c.(1156-1158)CAC>GAC	p.H386D	IPO4_uc001wmt.1_5'Flank|IPO4_uc001wmu.2_Missense_Mutation_p.H48D|IPO4_uc001wmx.1_Missense_Mutation_p.H250D|IPO4_uc001wmy.1_Missense_Mutation_p.H250D|IPO4_uc010tnz.1_RNA|IPO4_uc001wmw.1_RNA|IPO4_uc001wmz.1_Missense_Mutation_p.H386D	NM_024658	NP_078934	Q8TEX9	IPO4_HUMAN	importin 4	386					intracellular protein transport	cytoplasm|nucleus	protein binding|protein transporter activity			kidney(1)	1				GBM - Glioblastoma multiforme(265;0.0087)		TGCCTGATGTGGTCGCCAGCT	0.507													29	52	---	---	---	---	PASS
KHNYN	23351	broad.mit.edu	37	14	24900891	24900891	+	Silent	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24900891C>T	uc001wph.3	+	3	626	c.424C>T	c.(424-426)CTG>TTG	p.L142L	KHNYN_uc010tpc.1_Silent_p.L183L|KHNYN_uc010alw.2_Silent_p.L142L|CBLN3_uc001wpg.3_5'Flank	NM_015299	NP_056114	O15037	KHNYN_HUMAN	hypothetical protein LOC23351	142										ovary(2)|liver(1)	3						GGCAGAGCGGCTGAGCTGGGA	0.622											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	51	53	---	---	---	---	PASS
NPAS3	64067	broad.mit.edu	37	14	33684419	33684419	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33684419G>A	uc001wru.2	+	3	236	c.172G>A	c.(172-174)GAT>AAT	p.D58N	NPAS3_uc001wrs.2_Missense_Mutation_p.D28N|NPAS3_uc001wrt.2_Missense_Mutation_p.D28N|NPAS3_uc001wrv.2_Missense_Mutation_p.D28N|NPAS3_uc001wrw.2_5'UTR	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3	58	Basic motif.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity	p.L58L(1)		ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		GAAATCCCGAGATGCTGCTCG	0.453													47	35	---	---	---	---	PASS
PAPLN	89932	broad.mit.edu	37	14	73717712	73717712	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73717712C>T	uc010ttx.1	+	6	726	c.563C>T	c.(562-564)ACC>ATC	p.T188I	PAPLN_uc001xnw.3_Missense_Mutation_p.T188I|PAPLN_uc010arl.2_RNA|PAPLN_uc010ttw.1_RNA|PAPLN_uc010tty.1_Missense_Mutation_p.T188I	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	188						proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		GTCGCAGGCACCTTTGACGCT	0.632													4	83	---	---	---	---	PASS
TSHR	7253	broad.mit.edu	37	14	81609743	81609743	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81609743C>A	uc001xvd.1	+	10	1497	c.1341C>A	c.(1339-1341)AAC>AAA	p.N447K		NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1	447	Cytoplasmic (Potential).				cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	ACAAACTGAACGTCCCCCGCT	0.517			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						81	39	---	---	---	---	PASS
PTPN21	11099	broad.mit.edu	37	14	88940130	88940130	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88940130C>A	uc001xwv.3	-	14	2859	c.2528G>T	c.(2527-2529)CGA>CTA	p.R843L	PTPN21_uc010twc.1_Missense_Mutation_p.R639L	NM_007039	NP_008970	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type	843						cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4						TGCATCTACTCGAGTCTTTTT	0.403													8	90	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106926397	106926397	+	RNA	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106926397C>A	uc010tyt.1	-	235		c.10158G>T			uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						GTATAATCATCAAAGGTGAAT	0.557													74	127	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107211191	107211191	+	RNA	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107211191G>A	uc010tyt.1	-	18		c.1150C>T								Parts of antibodies, mostly variable regions.												0						GGACCCCCCAGGCTGGACCAA	0.622													4	62	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22369104	22369104	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369104T>C	uc010tzu.1	+	1	529	c.529T>C	c.(529-531)TAC>CAC	p.Y177H	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	177	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		GTTAGACAGTTACTTCTGTGA	0.507													121	356	---	---	---	---	PASS
UBE3A	7337	broad.mit.edu	37	15	25585248	25585248	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25585248C>A	uc001zaq.2	-	10	2491	c.2491G>T	c.(2491-2493)GGC>TGC	p.G831C	uc001zae.2_Intron|UBE3A_uc001zar.2_Missense_Mutation_p.G808C|UBE3A_uc001zas.2_Missense_Mutation_p.G828C|UBE3A_uc001zat.2_Missense_Mutation_p.G808C	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2	831	HECT.				brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		GTGTCTGGGCCATTTTTGGCT	0.393													59	97	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34048497	34048497	+	Intron	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34048497G>T	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGTTACCTGTGTCTTCGTAGA	0.413													6	10	---	---	---	---	PASS
SEMA6D	80031	broad.mit.edu	37	15	48063935	48063935	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48063935G>C	uc010bek.2	+	19	3535	c.3175G>C	c.(3175-3177)GTT>CTT	p.V1059L	SEMA6D_uc001zvw.2_Missense_Mutation_p.V997L|SEMA6D_uc001zvy.2_Missense_Mutation_p.V1059L|SEMA6D_uc001zvz.2_Missense_Mutation_p.V1003L|SEMA6D_uc001zwa.2_3'UTR|SEMA6D_uc001zwb.2_Missense_Mutation_p.V997L|SEMA6D_uc001zwc.2_Missense_Mutation_p.V984L	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	1059	Cytoplasmic (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GCCTTCCTTTGTTCCTCAAAC	0.502													143	214	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50158605	50158605	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50158605A>G	uc001zxu.2	-	26	3246	c.3104T>C	c.(3103-3105)ATT>ACT	p.I1035T	ATP8B4_uc010ber.2_Missense_Mutation_p.I908T|ATP8B4_uc010ufd.1_Missense_Mutation_p.I845T|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxt.2_Missense_Mutation_p.I38T	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	1035	Helical; (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TGTAAATAAAATGGAGAAATA	0.388													40	83	---	---	---	---	PASS
RFX7	64864	broad.mit.edu	37	15	56387143	56387143	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56387143T>A	uc010bfn.2	-	9	2783	c.2783A>T	c.(2782-2784)CAC>CTC	p.H928L	RFX7_uc010ugk.1_RNA|RFX7_uc002adn.1_Missense_Mutation_p.H742L	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	831					regulation of transcription, DNA-dependent	nucleus	DNA binding				0						GCTGGAAGTGTGAGATGACAT	0.368													20	19	---	---	---	---	PASS
TMEM202	338949	broad.mit.edu	37	15	72700025	72700025	+	Intron	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72700025C>A	uc002auq.2	+						TMEM202_uc002aur.2_Intron	NM_001080462	NP_001073931	A6NGA9	TM202_HUMAN	transmembrane protein 202							integral to membrane				central_nervous_system(1)|skin(1)	2						TTATTCCCTTCCCGTAGGGAT	0.423													42	81	---	---	---	---	PASS
GOLGA6A	342096	broad.mit.edu	37	15	74365074	74365074	+	Intron	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74365074C>T	uc002axa.1	-							NM_001038640	NP_001033729	Q9NYA3	GOG6A_HUMAN	golgi autoantigen, golgin subfamily a, 6												0						TCTGAGTGGTCTCCTGTACCT	0.552													5	64	---	---	---	---	PASS
C15orf27	123591	broad.mit.edu	37	15	76430135	76430135	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76430135G>A	uc002bbq.2	+	3	281	c.126G>A	c.(124-126)CTG>CTA	p.L42L	C15orf27_uc010bkp.2_5'UTR|C15orf27_uc002bbr.2_5'UTR	NM_152335	NP_689548	Q2M3C6	CO027_HUMAN	hypothetical protein LOC123591	42						integral to membrane					0						CTGTGCAGCTGGTGAACTTTG	0.527													76	104	---	---	---	---	PASS
SGK269	79834	broad.mit.edu	37	15	77425758	77425758	+	Silent	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77425758C>T	uc002bcm.2	-	5	3974	c.3666G>A	c.(3664-3666)TTG>TTA	p.L1222L		NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	1222					cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		TCTCCTTGCGCAAAGGCCTTT	0.483													40	66	---	---	---	---	PASS
DEXI	28955	broad.mit.edu	37	16	11035742	11035742	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11035742G>A	uc002dal.2	-	1	516	c.121C>T	c.(121-123)CTG>TTG	p.L41L	CLEC16A_uc002dan.3_5'Flank|CLEC16A_uc002dao.2_5'Flank	NM_014015	NP_054734	O95424	DEXI_HUMAN	dexamethasone-induced protein	41											0						GCGTAGTACAGGATCAGCACA	0.642													14	4	---	---	---	---	PASS
SEZ6L2	26470	broad.mit.edu	37	16	29884939	29884939	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29884939A>G	uc002duq.3	-	13	2456	c.2216T>C	c.(2215-2217)CTC>CCC	p.L739P	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Missense_Mutation_p.L669P|SEZ6L2_uc002dur.3_Missense_Mutation_p.L669P|SEZ6L2_uc002dus.3_Missense_Mutation_p.L625P|SEZ6L2_uc010vec.1_Missense_Mutation_p.L739P|SEZ6L2_uc010ved.1_Missense_Mutation_p.L695P	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform	739	Sushi 4.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						TGCCCCCTCGAGGCTGTACCC	0.677													14	17	---	---	---	---	PASS
ZNF48	197407	broad.mit.edu	37	16	30409275	30409275	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30409275G>A	uc002dya.1	+	2	763	c.704G>A	c.(703-705)CGC>CAC	p.R235H	ZNF48_uc002dxz.1_Missense_Mutation_p.R112H	NM_152652	NP_689865	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	235	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGTTCCGCCCGCATCAAGCAC	0.657													3	54	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7579355	7579355	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7579355A>C	uc002gim.2	-	4	526	c.332T>G	c.(331-333)CTG>CGG	p.L111R	TP53_uc002gig.1_Missense_Mutation_p.L111R|TP53_uc002gih.2_Missense_Mutation_p.L111R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Missense_Mutation_p.L111R|TP53_uc010cni.1_Missense_Mutation_p.L111R|TP53_uc002gij.2_Missense_Mutation_p.L111R|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Missense_Mutation_p.L72R|TP53_uc010cnk.1_Missense_Mutation_p.L126R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	111	|Interaction with HIPK1 (By similarity).		L -> Q (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> M (in a sporadic cancer; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.L111P(6)|p.L111Q(4)|p.L111R(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.Y107fs*44(1)|p.L111L(1)|p.L111M(1)|p.L111fs*10(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y103_L111>L(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAAGAAGCCCAGACGGAAACC	0.617		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			38	13	---	---	---	---	PASS
HS3ST3A1	9955	broad.mit.edu	37	17	13400066	13400066	+	Silent	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13400066C>A	uc002gob.1	-	2	1467	c.669G>T	c.(667-669)CGG>CGT	p.R223R		NM_006042	NP_006033	Q9Y663	HS3SA_HUMAN	heparan sulfate D-glucosaminyl	223	Lumenal (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity			ovary(1)|central_nervous_system(1)	2		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CGGGGGCCTCCCGCGTGACGA	0.622													28	17	---	---	---	---	PASS
LYZL6	57151	broad.mit.edu	37	17	34266340	34266340	+	Missense_Mutation	SNP	G	C	C	rs141105239		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34266340G>C	uc002hkj.1	-	1	171	c.21C>G	c.(19-21)ATC>ATG	p.I7M	LYZL6_uc002hkk.1_Missense_Mutation_p.I7M	NM_020426	NP_065159	O75951	LYZL6_HUMAN	lysozyme-like 6 precursor	7					cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TGACCAAATAGATGAGTAGCG	0.547													60	136	---	---	---	---	PASS
FBXL20	84961	broad.mit.edu	37	17	37420578	37420578	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37420578G>T	uc010wed.1	-	14	1274	c.1053C>A	c.(1051-1053)TGC>TGA	p.C351*	FBXL20_uc002hrt.2_Nonsense_Mutation_p.C351*|FBXL20_uc010cvu.2_Nonsense_Mutation_p.C319*	NM_032875	NP_116264	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	351	LRR 11.					cytoplasm				ovary(1)	1			LUAD - Lung adenocarcinoma(14;0.146)			GGTCATGGGCGCAGGCCCCAT	0.517													59	79	---	---	---	---	PASS
KRT17	3872	broad.mit.edu	37	17	39778625	39778625	+	Silent	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39778625C>A	uc002hxh.2	-	3	775	c.654G>T	c.(652-654)CTG>CTT	p.L218L	JUP_uc010wfs.1_Intron	NM_000422	NP_000413	Q04695	K1C17_HUMAN	keratin 17	218	Coil 1B.|Rod.				epidermis development	cytoplasm|intermediate filament	protein binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2		Breast(137;0.000307)				GGTTCTTCTTCAGGTAGGCCA	0.622									Steatocystoma_Multiplex				8	114	---	---	---	---	PASS
AOC3	8639	broad.mit.edu	37	17	41007479	41007479	+	Silent	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41007479C>A	uc002ibv.2	+	3	2065	c.1905C>A	c.(1903-1905)ACC>ACA	p.T635T		NM_003734	NP_003725	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3 precursor	635	Extracellular (Potential).				amine metabolic process|cell adhesion|inflammatory response	cell surface|integral to membrane|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|protein homodimerization activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	TGGCTGTGACCCAGCGGAAGG	0.552													7	16	---	---	---	---	PASS
MPP3	4356	broad.mit.edu	37	17	41891393	41891393	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41891393C>A	uc002iei.3	-	16	1407	c.1241G>T	c.(1240-1242)GGC>GTC	p.G414V	MPP3_uc002ieh.2_Missense_Mutation_p.G439V|MPP3_uc002iej.2_RNA	NM_001932	NP_001923	Q13368	MPP3_HUMAN	palmitoylated membrane protein 3	414	Guanylate kinase-like.				signal transduction	cell surface|integral to plasma membrane	guanylate kinase activity			large_intestine(1)|skin(1)	2		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		AACAGCGACGCCAAAGTGCTG	0.542													62	117	---	---	---	---	PASS
DCAKD	79877	broad.mit.edu	37	17	43107538	43107538	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43107538T>C	uc002ihx.2	-	3	582	c.326A>G	c.(325-327)TAC>TGC	p.Y109C	DCAKD_uc010daa.1_Missense_Mutation_p.Y109C|DCAKD_uc010dab.1_Missense_Mutation_p.Y109C	NM_024819	NP_079095	Q8WVC6	DCAKD_HUMAN	dephospho-CoA kinase domain containing	109	DPCK.				coenzyme A biosynthetic process		ATP binding|dephospho-CoA kinase activity				0		Prostate(33;0.155)				CAGAATCACGTAGCGGTATCC	0.537													86	135	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62018584	62018584	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62018584C>A	uc002jds.1	-	24	5135	c.5058G>T	c.(5056-5058)GAG>GAT	p.E1686D		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	1686					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	CACCCAGGACCTCTTTGGTCA	0.567													56	177	---	---	---	---	PASS
BAHCC1	57597	broad.mit.edu	37	17	79414562	79414562	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79414562C>T	uc002kaf.2	+	9	3664	c.3664C>T	c.(3664-3666)CCT>TCT	p.P1222S	BAHCC1_uc002kae.2_Missense_Mutation_p.P452S	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	1222							DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			GCAGCCGGCCCCTGAGGAGGA	0.697													3	7	---	---	---	---	PASS
P4HB	5034	broad.mit.edu	37	17	79813047	79813047	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79813047C>G	uc002kbn.1	-	4	792	c.595G>C	c.(595-597)GAC>CAC	p.D199H	P4HB_uc002kbm.1_5'UTR	NM_000918	NP_000909	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta subunit precursor	199					cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			CCATCTTTGTCGAGCTGGTAT	0.542													10	585	---	---	---	---	PASS
HEXDC	284004	broad.mit.edu	37	17	80400154	80400154	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80400154A>C	uc002kew.2	+	12	1406	c.1355A>C	c.(1354-1356)CAC>CCC	p.H452P	HEXDC_uc002kev.3_Missense_Mutation_p.T482P|HEXDC_uc010diq.2_Silent_p.A454A|HEXDC_uc010wvm.1_RNA			Q8WVB3	HEXDC_HUMAN	SubName: Full=Hexosaminidase (Glycosyl hydrolase family 20, catalytic domain) containing, isoform CRA_c; SubName: Full=Hexosaminidase D;	452					carbohydrate metabolic process	cytoplasm|nucleus	beta-N-acetylhexosaminidase activity|cation binding			ovary(1)|skin(1)	2	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GAAAACGTGCACCCCAGCCTG	0.677													5	14	---	---	---	---	PASS
COLEC12	81035	broad.mit.edu	37	18	334876	334876	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:334876G>C	uc002kkm.2	-	6	1897	c.1682C>G	c.(1681-1683)CCT>CGT	p.P561R		NM_130386	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	561	Collagen-like 3.|Extracellular (Potential).				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				CAGTCCCCGAGGTCCAGGCAC	0.741													10	9	---	---	---	---	PASS
MYL12B	103910	broad.mit.edu	37	18	3277383	3277383	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3277383C>T	uc010dkl.2	+	3	476	c.317C>T	c.(316-318)GCC>GTC	p.A106V	MYL12B_uc002klt.3_Missense_Mutation_p.A84V|MYL12B_uc010wyv.1_Missense_Mutation_p.A106V	NM_001144944	NP_001138416	O14950	ML12B_HUMAN	myosin regulatory light chain MRCL2 isoform A	106	EF-hand 2.				axon guidance|muscle contraction	cytosol|myosin complex	calcium ion binding				0						ATCAGAAACGCCTTTGCTTGC	0.433													102	135	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21390438	21390438	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21390438C>T	uc002kuq.2	+	13	1798	c.1712C>T	c.(1711-1713)TCA>TTA	p.S571L	LAMA3_uc002kur.2_Missense_Mutation_p.S571L	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	571	Domain V.|Laminin EGF-like 5.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGGTGTCTCTCAGGAGCTTAT	0.552													41	75	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22806383	22806383	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22806383T>A	uc002kvk.2	-	4	1746	c.1499A>T	c.(1498-1500)CAT>CTT	p.H500L	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.H500L|ZNF521_uc002kvl.2_Missense_Mutation_p.H280L	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	500	C2H2-type 11.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TGCAAATCCATGAGAACATCG	0.443			T	PAX5	ALL								58	113	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28989767	28989767	+	Silent	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28989767C>T	uc002kwq.2	+	14	2268	c.2133C>T	c.(2131-2133)TCC>TCT	p.S711S	DSG4_uc002kwr.2_Intron	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	711	Cytoplasmic (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GGATGGATTCCTCTGGTCAGT	0.343													34	65	---	---	---	---	PASS
DSEL	92126	broad.mit.edu	37	18	65180602	65180602	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65180602C>T	uc002lke.1	-	2	2498	c.1274G>A	c.(1273-1275)TGG>TAG	p.W425*		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	415						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)				AACCACACCCCAGTTAGGGAA	0.478													6	100	---	---	---	---	PASS
TMEM146	257062	broad.mit.edu	37	19	5759085	5759085	+	Intron	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5759085T>C	uc002mda.2	+						TMEM146_uc010duj.1_Intron	NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor							integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						ATTTTCTCTCTTGACCCCACA	0.552													37	84	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9065840	9065840	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9065840G>C	uc002mkp.2	-	3	21810	c.21606C>G	c.(21604-21606)GAC>GAG	p.D7202E		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	7204	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ATGTCTCTGAGTCAGCTAAGG	0.488													110	141	---	---	---	---	PASS
OR7D2	162998	broad.mit.edu	37	19	9297382	9297382	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9297382G>T	uc002mkz.1	+	1	1113	c.925G>T	c.(925-927)GCC>TCC	p.A309S		NM_175883	NP_787079	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D,	309	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|upper_aerodigestive_tract(1)	3						CAGCAGGGCAGCCTCTTGTTT	0.468													32	42	---	---	---	---	PASS
OLFM2	93145	broad.mit.edu	37	19	9968144	9968144	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9968144C>A	uc002mmp.2	-	4	403	c.375G>T	c.(373-375)AGG>AGT	p.R125S	OLFM2_uc002mmo.2_Missense_Mutation_p.R47S	NM_058164	NP_477512	O95897	NOE2_HUMAN	olfactomedin 2 precursor	125						extracellular region				large_intestine(1)|skin(1)	2						GTTCCGTCATCCTGTCCTTCA	0.572													16	34	---	---	---	---	PASS
S1PR2	9294	broad.mit.edu	37	19	10334967	10334967	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10334967G>A	uc002mnl.2	-	2	726	c.615C>T	c.(613-615)ATC>ATT	p.I205I		NM_004230	NP_004221	O95136	S1PR2_HUMAN	endothelial differentiation, sphingolipid	205	Helical; Name=5; (By similarity).				activation of MAPK activity|positive regulation of cell proliferation	integral to membrane|plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity			lung(1)|central_nervous_system(1)	2						ACAGGGCCACGATGGCCAACA	0.627													7	53	---	---	---	---	PASS
ICAM4	3386	broad.mit.edu	37	19	10398376	10398376	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10398376G>T	uc002mns.1	+	2	598	c.559G>T	c.(559-561)GAT>TAT	p.D187Y	ICAM4_uc002mnr.1_Missense_Mutation_p.G161V|ICAM4_uc002mnt.1_Missense_Mutation_p.D187Y|ICAM5_uc002mnu.3_5'Flank	NM_001544	NP_001535	Q14773	ICAM4_HUMAN	intercellular adhesion molecule 4 isoform 1	187	Ig-like C2-type 2.|Extracellular (Potential).				cell-cell adhesion|regulation of immune response	extracellular region|integral to membrane|plasma membrane	integrin binding			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			CACCGGCCTGGATCTGGCCAA	0.632													31	43	---	---	---	---	PASS
SLC44A2	57153	broad.mit.edu	37	19	10741721	10741721	+	Intron	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10741721C>T	uc002mpf.2	+						SLC44A2_uc002mpe.3_Intron	NM_020428	NP_065161	Q8IWA5	CTL2_HUMAN	solute carrier family 44, member 2 isoform 1						positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane|plasma membrane	choline transmembrane transporter activity|signal transducer activity			ovary(1)	1			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	ATTCTCCCTTCTCTAACTCCA	0.279													4	177	---	---	---	---	PASS
ZNF442	79973	broad.mit.edu	37	19	12461833	12461833	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12461833G>A	uc002mtr.1	-	6	1177	c.566C>T	c.(565-567)ACC>ATC	p.T189I	ZNF442_uc010xmk.1_Missense_Mutation_p.T120I	NM_030824	NP_110451	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	189	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(2)|breast(1)|kidney(1)	4						AGAACTGAAGGTTTTCCCACA	0.418													4	234	---	---	---	---	PASS
MAN2B1	4125	broad.mit.edu	37	19	12768935	12768935	+	Silent	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12768935C>A	uc002mub.2	-	10	1327	c.1251G>T	c.(1249-1251)GCG>GCT	p.A417A	MAN2B1_uc010dyv.1_Silent_p.A416A	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	417					protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6						GGCCCACCAGCGCCTCCAGCT	0.682													21	18	---	---	---	---	PASS
C19orf44	84167	broad.mit.edu	37	19	16614123	16614123	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16614123C>G	uc002neh.1	+	3	1080	c.1007C>G	c.(1006-1008)TCC>TGC	p.S336C	MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Missense_Mutation_p.S336C|C19orf44_uc002neg.2_Missense_Mutation_p.S336C|C19orf44_uc010eai.1_RNA	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167	336											0						CTTGTGTCCTCCCCGGGAAGG	0.562													28	56	---	---	---	---	PASS
MAG	4099	broad.mit.edu	37	19	35804240	35804240	+	Silent	SNP	T	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35804240T>G	uc002nyy.1	+	11	1913	c.1764T>G	c.(1762-1764)GGT>GGG	p.G588G	MAG_uc002nyx.1_3'UTR|MAG_uc010eds.1_Silent_p.G563G|MAG_uc002nyz.1_Silent_p.G588G	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a	588	Cytoplasmic (Potential).				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GCCTTCGGGGTGAGCCCCCAG	0.617													41	63	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38937345	38937345	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38937345A>G	uc002oit.2	+	9	867	c.737A>G	c.(736-738)TAT>TGT	p.Y246C	RYR1_uc002oiu.2_Missense_Mutation_p.Y246C	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	246	MIR 3.|Cytoplasmic.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CTTGTCTACTATGAGGGGGGA	0.597													44	64	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41063166	41063166	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41063166G>T	uc002ony.2	+	26	5613	c.5527G>T	c.(5527-5529)GCC>TCC	p.A1843S	SPTBN4_uc002onx.2_Missense_Mutation_p.A1843S|SPTBN4_uc002onz.2_Missense_Mutation_p.A1843S|SPTBN4_uc010egx.2_Missense_Mutation_p.A586S|SPTBN4_uc002ooa.2_Missense_Mutation_p.A519S	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	1843	Spectrin 16.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTTCAGTGACGCCCGAGAGCT	0.662													15	36	---	---	---	---	PASS
STRN4	29888	broad.mit.edu	37	19	47225334	47225334	+	Intron	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47225334G>A	uc002pfl.2	-						STRN4_uc002pfm.2_Intron|STRN4_uc010xyf.1_Intron	NM_013403	NP_037535	Q9NRL3	STRN4_HUMAN	zinedin isoform 1							cytoplasm|membrane	armadillo repeat domain binding|calmodulin binding|protein complex binding|protein phosphatase 2A binding				0		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)		GCTTACCTGAGGCGAGAAGGG	0.622													34	37	---	---	---	---	PASS
STRN4	29888	broad.mit.edu	37	19	47225336	47225336	+	Intron	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47225336C>G	uc002pfl.2	-						STRN4_uc002pfm.2_Intron|STRN4_uc010xyf.1_Intron	NM_013403	NP_037535	Q9NRL3	STRN4_HUMAN	zinedin isoform 1							cytoplasm|membrane	armadillo repeat domain binding|calmodulin binding|protein complex binding|protein phosphatase 2A binding				0		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)		TTACCTGAGGCGAGAAGGGCG	0.622													34	37	---	---	---	---	PASS
CPT1C	126129	broad.mit.edu	37	19	50195642	50195642	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50195642C>T	uc002ppj.2	+	2	338	c.133C>T	c.(133-135)CGT>TGT	p.R45C	CPT1C_uc002ppl.3_Missense_Mutation_p.R45C|CPT1C_uc002ppi.2_Translation_Start_Site|CPT1C_uc002ppk.2_Missense_Mutation_p.R45C|CPT1C_uc010eng.2_Missense_Mutation_p.R45C|CPT1C_uc010enh.2_Missense_Mutation_p.R45C|CPT1C_uc010ybc.1_Translation_Start_Site	NM_152359	NP_689572	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C isoform 2	45	Cytoplasmic (Potential).				fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		GCATCTCTCACGTTTCTGGGT	0.597													12	29	---	---	---	---	PASS
SIGLEC7	27036	broad.mit.edu	37	19	51647859	51647859	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51647859C>A	uc002pvv.1	+	2	699	c.630C>A	c.(628-630)CAC>CAA	p.H210Q	SIGLEC7_uc002pvw.1_Intron|SIGLEC7_uc010eoq.1_Intron|SIGLEC7_uc010eor.1_Intron	NM_014385	NP_055200	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7 isoform 1	210	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion	integral to plasma membrane	receptor activity|sugar binding			large_intestine(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		AGCCCCAGCACCACGGCACCA	0.647													27	35	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56423270	56423270	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56423270A>G	uc010ygg.1	-	5	1938	c.1913T>C	c.(1912-1914)CTT>CCT	p.L638P		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	638							ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		GCAGTGAAAAAGTCGTAGAAT	0.418													62	118	---	---	---	---	PASS
ZNF667	63934	broad.mit.edu	37	19	56973702	56973702	+	Intron	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56973702C>A	uc002qnd.2	-						ZNF667_uc010etl.2_Intron|ZNF667_uc002qne.2_Intron|ZNF667_uc010etm.2_Intron	NM_022103	NP_071386	Q5HYK9	ZN667_HUMAN	zinc finger protein 667						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		GGAATTGCCACTTACCTTGGA	0.527													77	114	---	---	---	---	PASS
ZNF135	7694	broad.mit.edu	37	19	58573067	58573067	+	Silent	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58573067C>A	uc010yhq.1	+	3	249	c.153C>A	c.(151-153)GTC>GTA	p.V51V	ZNF135_uc002qre.2_Silent_p.V51V|ZNF135_uc002qrd.1_Silent_p.V9V|ZNF135_uc002qrf.2_Silent_p.V9V|ZNF135_uc002qrg.2_Silent_p.V9V|ZNF135_uc010yhr.1_Intron	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN	zinc finger protein 135 isoform 2	51					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		GGCTTCTGGTCTCTGTGGGTA	0.517													89	119	---	---	---	---	PASS
PLCB1	23236	broad.mit.edu	37	20	8709735	8709735	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8709735G>T	uc002wnb.2	+	18	1805	c.1802G>T	c.(1801-1803)GGA>GTA	p.G601V	PLCB1_uc010zrb.1_Missense_Mutation_p.G500V|PLCB1_uc002wna.2_Missense_Mutation_p.G601V|PLCB1_uc002wnc.1_Missense_Mutation_p.G500V|PLCB1_uc002wnd.1_Missense_Mutation_p.G178V	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1	601	PI-PLC Y-box.				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						TATCCAAAAGGAACACGTGTG	0.358													40	75	---	---	---	---	PASS
BTBD3	22903	broad.mit.edu	37	20	11903423	11903423	+	Silent	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11903423T>C	uc002wnz.2	+	4	1037	c.678T>C	c.(676-678)TGT>TGC	p.C226C	BTBD3_uc002wny.2_Silent_p.C165C|BTBD3_uc002woa.2_Silent_p.C165C|BTBD3_uc010zrf.1_Silent_p.C75C|BTBD3_uc010zrg.1_Silent_p.C75C|BTBD3_uc010zrh.1_Silent_p.C75C	NM_014962	NP_055777	Q9Y2F9	BTBD3_HUMAN	BTB/POZ domain containing protein 3 isoform a	226										ovary(2)|central_nervous_system(1)	3						AGAATGCCTGTGTGCTCCTCT	0.552													42	76	---	---	---	---	PASS
BTBD3	22903	broad.mit.edu	37	20	11903424	11903424	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11903424G>T	uc002wnz.2	+	4	1038	c.679G>T	c.(679-681)GTG>TTG	p.V227L	BTBD3_uc002wny.2_Missense_Mutation_p.V166L|BTBD3_uc002woa.2_Missense_Mutation_p.V166L|BTBD3_uc010zrf.1_Missense_Mutation_p.V76L|BTBD3_uc010zrg.1_Missense_Mutation_p.V76L|BTBD3_uc010zrh.1_Missense_Mutation_p.V76L	NM_014962	NP_055777	Q9Y2F9	BTBD3_HUMAN	BTB/POZ domain containing protein 3 isoform a	227										ovary(2)|central_nervous_system(1)	3						GAATGCCTGTGTGCTCCTCTC	0.557													42	74	---	---	---	---	PASS
TRPC4AP	26133	broad.mit.edu	37	20	33637788	33637788	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33637788C>A	uc002xbk.2	-	6	572	c.538G>T	c.(538-540)GTT>TTT	p.V180F	TRPC4AP_uc002xbl.2_Missense_Mutation_p.V180F|TRPC4AP_uc010zur.1_Missense_Mutation_p.V141F|TRPC4AP_uc002xbm.1_Missense_Mutation_p.V180F	NM_015638	NP_056453	Q8TEL6	TP4AP_HUMAN	TRPC4-associated protein isoform a	180	Interaction with TNFRSF1A (By similarity).				protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)			CGCTTTGTAACTCCCTCTGTC	0.363													53	142	---	---	---	---	PASS
JPH2	57158	broad.mit.edu	37	20	42788246	42788246	+	Intron	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42788246C>A	uc002xli.1	-							NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1						calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CCCACCCCCACCGCTGTCCTA	0.662													5	17	---	---	---	---	PASS
RIMS4	140730	broad.mit.edu	37	20	43438895	43438895	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43438895G>T	uc002xms.2	-	1	18	c.18C>A	c.(16-18)AGC>AGA	p.S6R	RIMS4_uc010ggu.2_Missense_Mutation_p.S6R	NM_182970	NP_892015	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	6					exocytosis|neurotransmitter transport	cell junction|synapse				ovary(4)|central_nervous_system(1)	5		Myeloproliferative disorder(115;0.0122)				GACTGAGGCGGCTCTGCGAGC	0.507													6	4	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60892706	60892706	+	Intron	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60892706G>A	uc002ycq.2	-							NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor						angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGGGGCCAGGGGCTGCACTCA	0.667													5	9	---	---	---	---	PASS
SLC17A9	63910	broad.mit.edu	37	20	61597089	61597089	+	Intron	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61597089C>A	uc002yea.3	+						SLC17A9_uc002ydz.3_Intron|SLC17A9_uc011aap.1_Intron	NM_022082	NP_071365	Q9BYT1	S17A9_HUMAN	vesicular nucleotide transporter SLC17A9						exocytosis|transmembrane transport	integral to membrane	transporter activity			ovary(1)|skin(1)	2						TGAGGGCCGACTGCTCCATCC	0.617													60	110	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10914395	10914395	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10914395C>A	uc002yip.1	-	21	1692	c.1324G>T	c.(1324-1326)GTC>TTC	p.V442F	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.V424F|TPTE_uc002yir.1_Missense_Mutation_p.V404F|TPTE_uc010gkv.1_Missense_Mutation_p.V304F	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	442	C2 tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GTGGAAAAGACAACCTTTTTC	0.323													6	51	---	---	---	---	PASS
USP25	29761	broad.mit.edu	37	21	17197357	17197357	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17197357G>A	uc002yjy.1	+	12	1498	c.1281G>A	c.(1279-1281)ACG>ACA	p.T427T	USP25_uc011aby.1_Silent_p.T427T|USP25_uc002yjz.1_Silent_p.T427T|USP25_uc010gla.1_Intron	NM_013396	NP_037528	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	427					protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity	p.T427M(1)		ovary(3)|liver(2)	5				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		ATTACCTCACGGTATTACAAC	0.299													29	39	---	---	---	---	PASS
ABCG1	9619	broad.mit.edu	37	21	43645932	43645932	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43645932G>T	uc002zaq.2	+	2	300	c.194G>T	c.(193-195)CGC>CTC	p.R65L	ABCG1_uc002zan.2_Missense_Mutation_p.R67L|ABCG1_uc002zam.2_Missense_Mutation_p.R43L|ABCG1_uc002zao.2_Missense_Mutation_p.R62L|ABCG1_uc002zap.2_Missense_Mutation_p.R65L|ABCG1_uc002zar.2_Missense_Mutation_p.R76L|ABCG1_uc011aev.1_Missense_Mutation_p.R76L	NM_004915	NP_004906	P45844	ABCG1_HUMAN	ATP-binding cassette sub-family G member 1	65	Cytoplasmic (Potential).				amyloid precursor protein catabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|detection of hormone stimulus|high-density lipoprotein particle remodeling|intracellular cholesterol transport|lipoprotein metabolic process|low-density lipoprotein particle remodeling|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|positive regulation of cholesterol biosynthetic process|regulation of cholesterol esterification|regulation of transcription, DNA-dependent|response to lipid|reverse cholesterol transport	endoplasmic reticulum membrane|external side of plasma membrane|Golgi membrane|recycling endosome	ADP binding|ATP binding|cholesterol transporter activity|glycoprotein transporter activity|phospholipid transporter activity|protein heterodimerization activity|protein homodimerization activity|sterol-transporting ATPase activity|toxin transporter activity			ovary(2)|central_nervous_system(1)	3					Adenosine triphosphate(DB00171)	GAAGCCCAGCGCTTCTCCTCC	0.532													137	14	---	---	---	---	PASS
IL17RA	23765	broad.mit.edu	37	22	17589252	17589252	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17589252G>C	uc002zly.2	+	13	1276	c.1143G>C	c.(1141-1143)TGG>TGC	p.W381C	IL17RA_uc010gqt.2_Missense_Mutation_p.W329C	NM_014339	NP_055154	Q96F46	I17RA_HUMAN	interleukin 17A receptor precursor	381	Cytoplasmic (Potential).|SEFIR.				fibroblast activation|positive regulation of interleukin-23 production	integral to plasma membrane	interleukin-17 receptor activity			skin(2)	2		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		GGAAGGTCTGGATCATCTACT	0.632													7	26	---	---	---	---	PASS
AIFM3	150209	broad.mit.edu	37	22	21329007	21329007	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21329007G>C	uc002ztj.2	+	8	840	c.622G>C	c.(622-624)GTG>CTG	p.V208L	AIFM3_uc002ztk.2_Missense_Mutation_p.V208L|AIFM3_uc002ztl.2_Missense_Mutation_p.V214L|AIFM3_uc011ahx.1_Missense_Mutation_p.V196L|AIFM3_uc002ztm.1_Intron	NM_144704	NP_653305	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor,	208					activation of caspase activity by cytochrome c|cell redox homeostasis|electron transport chain|induction of apoptosis|mitochondrial depolarization|transport	endoplasmic reticulum|mitochondrial inner membrane	2 iron, 2 sulfur cluster binding|caspase activator activity|flavin adenine dinucleotide binding|metal ion binding|oxidoreductase activity|protein binding			ovary(2)|lung(2)	4	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			AGCTGGCCTGGTGTGTGCAGA	0.647													4	5	---	---	---	---	PASS
LZTR1	8216	broad.mit.edu	37	22	21345987	21345987	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21345987A>G	uc002zto.2	+	9	965	c.862A>G	c.(862-864)ACC>GCC	p.T288A	LZTR1_uc002ztn.2_Missense_Mutation_p.T247A|LZTR1_uc011ahy.1_Missense_Mutation_p.T269A|LZTR1_uc010gsr.1_Missense_Mutation_p.T159A	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	288					anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CTACGGGCATACCATGGTGGC	0.622													5	3	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22453531	22453531	+	RNA	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22453531C>A	uc011aim.1	+	7		c.664C>A								Parts of antibodies, mostly variable regions.												0						TGGCTCCATCCTTGGGAACAA	0.552													4	82	---	---	---	---	PASS
RFPL2	10739	broad.mit.edu	37	22	32586756	32586756	+	3'UTR	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32586756G>T	uc003amg.3	-	5					RFPL2_uc003ame.3_3'UTR|RFPL2_uc003amf.3_3'UTR|RFPL2_uc003amh.3_3'UTR	NM_001098527	NP_001091997	O75678	RFPL2_HUMAN	ret finger protein-like 2 isoform 2								zinc ion binding			skin(1)	1						TTGGAGTGAGGGCTTATTTGG	0.453													11	147	---	---	---	---	PASS
SCML2	10389	broad.mit.edu	37	X	18259411	18259411	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18259411C>A	uc004cyl.2	-	15	2220	c.2063G>T	c.(2062-2064)TGT>TTT	p.C688F	SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_3'UTR|SCML2_uc011miz.1_3'UTR|SCML2_uc010nfc.2_3'UTR	NM_006089	NP_006080	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2	688	SAM.				anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(33;0.183)					AATGTAGTAACACAGCTTTAA	0.358													106	135	---	---	---	---	PASS
POLA1	5422	broad.mit.edu	37	X	24741271	24741271	+	Splice_Site	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24741271G>T	uc004dbl.2	+	11	1093	c.1070_splice	c.e11-1	p.G357_splice	POLA1_uc004dbm.2_Splice_Site_p.G363_splice|POLA1_uc004dbn.2_Splice_Site_p.G221_splice	NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	TATTCTTTCAGGTGTGGTATT	0.383													82	120	---	---	---	---	PASS
MAGEB6	158809	broad.mit.edu	37	X	26212431	26212431	+	Silent	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26212431G>T	uc004dbr.2	+	2	617	c.468G>T	c.(466-468)TCG>TCT	p.S156S	MAGEB6_uc010ngc.1_5'UTR	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	156	Ser-rich.									ovary(3)	3						CCACTGGCTCGCCTGATGCAG	0.507													3	69	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	29973704	29973704	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29973704C>A	uc004dby.2	+	11	2366	c.1858C>A	c.(1858-1860)CGT>AGT	p.R620S		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	620	Cytoplasmic (Potential).|Interaction with NCS1.				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						TTCACAAATGCGTCAGAAACA	0.532													13	19	---	---	---	---	PASS
MAGEB2	4113	broad.mit.edu	37	X	30236736	30236736	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30236736G>C	uc004dbz.2	+	2	142	c.39G>C	c.(37-39)GAG>GAC	p.E13D		NM_002364	NP_002355	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	13							protein binding			ovary(1)	1						GTGCCCGTGAGAAACGCCGCA	0.537													16	33	---	---	---	---	PASS
MAGEB3	4114	broad.mit.edu	37	X	30254995	30254995	+	Silent	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30254995C>A	uc004dca.1	+	5	1691	c.954C>A	c.(952-954)GTC>GTA	p.V318V		NM_002365	NP_002356	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	318											0						AAGAAAGAGTCCAAGCTGCAG	0.502													19	36	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34148685	34148685	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148685C>A	uc004ddg.2	-	1	1744	c.1711G>T	c.(1711-1713)GAG>TAG	p.E571*		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	571										ovary(4)|central_nervous_system(1)	5						TTGGGAGGCTCCGAGAATTGA	0.522													42	46	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	47657983	47657983	+	IGR	SNP	T	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47657983T>G								LOC100133957 (138207 upstream) : ZNF81 (38318 downstream)																							CTGCCTCCCTTCTCCTCTAGG	0.517													18	30	---	---	---	---	PASS
CCDC22	28952	broad.mit.edu	37	X	49104772	49104772	+	Splice_Site	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49104772G>T	uc004dnd.1	+	10	1368	c.1212_splice	c.e10+1	p.Q404_splice	CCDC22_uc004dnc.1_Splice_Site	NM_014008	NP_054727	O60826	CCD22_HUMAN	coiled-coil domain containing 22											central_nervous_system(1)	1						CAAGCTGCAGGTGGGGTTGGG	0.537													7	12	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54265524	54265524	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54265524G>A	uc004dtd.1	-	18	4099	c.3660C>T	c.(3658-3660)TCC>TCT	p.S1220S	WNK3_uc004dtc.1_Silent_p.S1220S	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	1220					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						AAGCATCTGAGGACATCTCCT	0.363													22	49	---	---	---	---	PASS
GNL3L	54552	broad.mit.edu	37	X	54581038	54581038	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54581038G>A	uc004dth.1	+	14	1498	c.1359G>A	c.(1357-1359)ACG>ACA	p.T453T	GNL3L_uc004dti.2_RNA	NM_019067	NP_061940	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3	453					ribosome biogenesis	nucleolus	GTP binding			ovary(1)	1						TGGGTGACACGGACCCACTTG	0.512													36	55	---	---	---	---	PASS
USP51	158880	broad.mit.edu	37	X	55514393	55514393	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55514393G>A	uc004dun.1	-	2	1059	c.980C>T	c.(979-981)TCA>TTA	p.S327L	USP51_uc011moo.1_Missense_Mutation_p.S31L	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN	ubiquitin specific protease 51	327					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3						TTCAAACCCTGATGTCATAAA	0.353													11	287	---	---	---	---	PASS
ITGB1BP2	26548	broad.mit.edu	37	X	70524083	70524083	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70524083T>C	uc004dzr.1	+	9	715	c.686T>C	c.(685-687)GTA>GCA	p.V229A	BCYRN1_uc011mpt.1_Intron|ITGB1BP2_uc004dzs.1_Missense_Mutation_p.V211A	NM_012278	NP_036410	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein 2	229	CS.				muscle organ development|signal transduction		SH3 domain binding			ovary(1)	1	Renal(35;0.156)					GATTCCTTAGTAGTGGTGACT	0.463													27	77	---	---	---	---	PASS
RLIM	51132	broad.mit.edu	37	X	73812559	73812559	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73812559T>A	uc004ebu.2	-	5	881	c.591A>T	c.(589-591)GAA>GAT	p.E197D	RLIM_uc004ebw.2_Missense_Mutation_p.E197D	NM_183353	NP_899196	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	197					random inactivation of X chromosome|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|transcriptional repressor complex	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						CTGTTAACGCTTCAGTTGAAT	0.493													125	202	---	---	---	---	PASS
DIAPH2	1730	broad.mit.edu	37	X	96171548	96171548	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96171548A>G	uc004efu.3	+	8	1240	c.844A>G	c.(844-846)ATT>GTT	p.I282V	DIAPH2_uc004eft.3_Missense_Mutation_p.I282V|DIAPH2_uc004efs.2_Missense_Mutation_p.I289V	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156	282	GBD/FH3.				cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						ACTTTCTGCTATTTGCATTGT	0.323													3	75	---	---	---	---	PASS
BTK	695	broad.mit.edu	37	X	100612489	100612489	+	Intron	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100612489G>T	uc004ehg.2	-						BTK_uc004ehf.2_Intron|BTK_uc010nnh.2_Intron|BTK_uc010nni.2_Intron|BTK_uc004ehe.2_Intron|BTK_uc010nnj.2_Intron|BTK_uc010nnk.2_Intron|BTK_uc010nnl.2_Intron|BTK_uc010nnm.2_Intron|BTK_uc010nnn.2_Intron|BTK_uc010nno.2_Intron|BTK_uc004ehh.1_Intron|BTK_uc004ehi.2_Intron	NM_000061	NP_000052	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase						calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding			lung(3)|central_nervous_system(2)|ovary(1)	6						AGAGAAATAAGGAGTTACCGT	0.502									Agammaglobulinemia_X-linked				46	73	---	---	---	---	PASS
NXF3	56000	broad.mit.edu	37	X	102338438	102338438	+	Intron	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102338438G>A	uc004eju.2	-						NXF3_uc010noi.1_Intron|NXF3_uc011mrw.1_Intron|NXF3_uc011mrx.1_Intron	NM_022052	NP_071335	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3							cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3						AAACTATAGGGAGAGTTGCAA	0.478													61	131	---	---	---	---	PASS
RAB40A	142684	broad.mit.edu	37	X	102755198	102755198	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102755198T>C	uc004ekk.2	-	3	829	c.487A>G	c.(487-489)ATC>GTC	p.I163V		NM_080879	NP_543155	Q8WXH6	RB40A_HUMAN	RAB40A, member RAS oncogene family	163					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding				0						GACTCTATGATGTTGAAATTG	0.587													6	72	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107464417	107464417	+	Intron	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107464417C>A	uc004enw.3	-						COL4A6_uc004env.3_Intron|COL4A6_uc011msn.1_Intron|COL4A6_uc010npk.2_Intron	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						AACTTCTGATCTTTACATTTG	0.408									Alport_syndrome_with_Diffuse_Leiomyomatosis				16	272	---	---	---	---	PASS
HTR2C	3358	broad.mit.edu	37	X	114082670	114082670	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114082670C>T	uc004epu.1	+	5	1182	c.454C>T	c.(454-456)CGG>TGG	p.R152W	HTR2C_uc010nqc.1_Missense_Mutation_p.R152W|HTR2C_uc004epv.1_Missense_Mutation_p.R152W	NM_000868	NP_000859	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C	152	Cytoplasmic (By similarity).				cGMP biosynthetic process|ERK1 and ERK2 cascade|feeding behavior|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	cytoplasm|integral to membrane|nucleus|plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|protein binding|serotonin binding|serotonin receptor activity			ovary(3)	3					Chlorprothixene(DB01239)|Clozapine(DB00363)|Dexfenfluramine(DB01191)|Fenfluramine(DB00574)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Tramadol(DB00193)|Ziprasidone(DB00246)	ATCGCTGGATCGGTATGTAGC	0.428													100	198	---	---	---	---	PASS
CXorf56	63932	broad.mit.edu	37	X	118699258	118699258	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118699258C>A	uc004erk.1	-	1	107	c.61G>T	c.(61-63)GAC>TAC	p.D21Y	CXorf56_uc004erj.1_5'UTR|CXorf56_uc011mtu.1_Missense_Mutation_p.D21Y	NM_022101	NP_071384	Q9H5V9	CX056_HUMAN	hypothetical protein LOC63932	21							protein binding				0						TCGCCGTCGTCATATTCCTCC	0.557													42	94	---	---	---	---	PASS
UPF3B	65109	broad.mit.edu	37	X	118979157	118979157	+	Intron	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118979157G>C	uc004erz.1	-						UPF3B_uc004esa.1_Intron	NM_080632	NP_542199	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding	p.?(1)		ovary(2)|kidney(1)	3						GAGCTATACTGTACCATCATC	0.318													68	143	---	---	---	---	PASS
NKAP	79576	broad.mit.edu	37	X	119070583	119070583	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119070583G>C	uc004esh.2	-	3	697	c.530C>G	c.(529-531)ACT>AGT	p.T177S	NKAP_uc004esg.2_Missense_Mutation_p.T64S	NM_024528	NP_078804	Q8N5F7	NKAP_HUMAN	NFKB activating protein	177					negative regulation of transcription, DNA-dependent|Notch signaling pathway|positive regulation of alpha-beta T cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|protein binding			ovary(2)	2						ACCTTCTGAAGTAGAAGCTGA	0.279													76	110	---	---	---	---	PASS
THOC2	57187	broad.mit.edu	37	X	122754763	122754763	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122754763C>A	uc004etu.2	-	32	4302	c.4270G>T	c.(4270-4272)GTA>TTA	p.V1424L	THOC2_uc010nqt.1_RNA|THOC2_uc004etw.1_Missense_Mutation_p.V245L	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	1424	Lys-rich.				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						CTAACCTTTACTGTGGAGGAA	0.413													159	250	---	---	---	---	PASS
THOC2	57187	broad.mit.edu	37	X	122757771	122757771	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122757771A>T	uc004etu.2	-	28	3402	c.3370T>A	c.(3370-3372)TTG>ATG	p.L1124M	THOC2_uc010nqt.1_5'Flank|THOC2_uc004etw.1_5'Flank	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	1124					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						AGCACAATCAAGATATTCCTG	0.358													94	133	---	---	---	---	PASS
SASH3	54440	broad.mit.edu	37	X	128927642	128927642	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128927642G>A	uc011mun.1	+	8	1159	c.977G>A	c.(976-978)GGC>GAC	p.G326D	SASH3_uc004euu.2_Missense_Mutation_p.G326D|SASH3_uc011muo.1_Missense_Mutation_p.G293D	NM_018990	NP_061863	O75995	SASH3_HUMAN	SAM and SH3 domain containing 3	326										ovary(2)|pancreas(1)	3						GCTGAAGAGGGCGCCGAGAGC	0.632													15	27	---	---	---	---	PASS
ZNF449	203523	broad.mit.edu	37	X	134481156	134481156	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134481156A>G	uc004eys.2	+	2	278	c.113A>G	c.(112-114)TAC>TGC	p.Y38C	ZNF449_uc004eyq.1_Missense_Mutation_p.Y38C|ZNF449_uc004eyr.3_Missense_Mutation_p.Y38C|ZNF449_uc004eyt.2_5'UTR	NM_152695	NP_689908	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	38	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CAGTTCCAGTACAGAGAAGCA	0.478													55	128	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135429072	135429072	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135429072G>T	uc004ezu.1	+	6	3498	c.3207G>T	c.(3205-3207)CAG>CAT	p.Q1069H	GPR112_uc010nsb.1_Missense_Mutation_p.Q864H|GPR112_uc010nsc.1_Missense_Mutation_p.Q836H	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1069	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					CTTTGGATCAGACTGCTTCCA	0.473													199	319	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138679676	138679676	+	Silent	SNP	C	G	G			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138679676C>G	uc004fau.2	-	18	2292	c.1998G>C	c.(1996-1998)CTG>CTC	p.L666L	MCF2_uc004fav.2_Silent_p.L682L|MCF2_uc011mwl.1_Silent_p.L643L|MCF2_uc010nsh.1_Silent_p.L666L|MCF2_uc011mwm.1_Silent_p.L627L|MCF2_uc011mwn.1_Silent_p.L811L|MCF2_uc004faw.2_Silent_p.L726L|MCF2_uc011mwo.1_Silent_p.L742L	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	666	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					TCAGTAAATCCAGCATTGCAT	0.294													44	123	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138679723	138679723	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138679723C>A	uc004fau.2	-	18	2245	c.1951G>T	c.(1951-1953)GAC>TAC	p.D651Y	MCF2_uc004fav.2_Missense_Mutation_p.D667Y|MCF2_uc011mwl.1_Missense_Mutation_p.D628Y|MCF2_uc010nsh.1_Missense_Mutation_p.D651Y|MCF2_uc011mwm.1_Missense_Mutation_p.D612Y|MCF2_uc011mwn.1_Missense_Mutation_p.D796Y|MCF2_uc004faw.2_Missense_Mutation_p.D711Y|MCF2_uc011mwo.1_Missense_Mutation_p.D727Y	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	651	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					CCTTCACAGTCTTTGCTATAT	0.338													34	83	---	---	---	---	PASS
ATP11C	286410	broad.mit.edu	37	X	138811090	138811090	+	3'UTR	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138811090G>T	uc004faz.2	-	30					ATP11C_uc004fax.2_3'UTR|ATP11C_uc004fay.2_RNA|ATP11C_uc004fba.2_Missense_Mutation_p.S1110Y	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a						ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					ATGCTTGTAGGACAATAACAT	0.313													50	96	---	---	---	---	PASS
MAGEA10	4109	broad.mit.edu	37	X	151303347	151303347	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151303347G>T	uc004ffk.2	-	5	1154	c.746C>A	c.(745-747)GCA>GAA	p.A249E	MAGEA10_uc004ffl.2_Missense_Mutation_p.A249E	NM_001011543	NP_001011543	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	249	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)					CATATTCAGTGCTTCCCAGAT	0.512													67	98	---	---	---	---	PASS
GABRA3	2556	broad.mit.edu	37	X	151424346	151424346	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151424346A>T	uc010ntk.1	-	5	695	c.455T>A	c.(454-456)TTC>TAC	p.F152Y		NM_000808	NP_000799	P34903	GBRA3_HUMAN	gamma-aminobutyric acid A receptor, alpha 3	152	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)				Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ATTGTGGAAGAAGGTGTCCGG	0.488													110	153	---	---	---	---	PASS
MIR105-1	406897	broad.mit.edu	37	X	151560708	151560708	+	RNA	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151560708G>A	hsa-mir-105-1|MI0000111	-			c.64G>A			GABRA3_uc010ntk.1_Intron|uc004ffo.2_RNA																	0						CGTAGCACATGCTCAAACATC	0.463													17	24	---	---	---	---	PASS
GABRQ	55879	broad.mit.edu	37	X	151818344	151818344	+	Splice_Site	SNP	T	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151818344T>A	uc004ffp.1	+	6	768	c.748_splice	c.e6+2	p.G250_splice		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta							cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TCTACACAGGTGGGTCTGACC	0.512													73	130	---	---	---	---	PASS
TREX2	11219	broad.mit.edu	37	X	152710223	152710223	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152710223G>A	uc010nue.1	-	3	908	c.792C>T	c.(790-792)ATC>ATT	p.I264I	TREX2_uc010nud.1_Silent_p.I222I|TREX2_uc011myp.1_Silent_p.I222I|HAUS7_uc004fhl.2_RNA|HAUS7_uc004fhm.2_RNA	NM_080701	NP_542432	Q9BQ50	TREX2_HUMAN	three prime repair exonuclease 2	265					DNA repair	nucleus	3'-5'-exodeoxyribonuclease activity|exodeoxyribonuclease III activity|nucleic acid binding			large_intestine(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACATGGGCTCGATGTGGGCCC	0.687								Editing_and_processing_nucleases					3	3	---	---	---	---	PASS
ABCD1	215	broad.mit.edu	37	X	153001941	153001941	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153001941G>A	uc004fif.2	+	4	1766	c.1367G>A	c.(1366-1368)CGT>CAT	p.R456H	ABCD1_uc004fig.2_5'Flank	NM_000033	NP_000024	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member	456					fatty acid beta-oxidation using acyl-CoA oxidase|peroxisomal membrane transport|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|identical protein binding|peroxisomal fatty-acyl-CoA transporter activity				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCTGGTGTCCGTGTGGAGGGC	0.632													22	34	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153582818	153582818	+	Silent	SNP	G	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153582818G>A	uc004fkk.2	-	33	5596	c.5347C>T	c.(5347-5349)CTG>TTG	p.L1783L	FLNA_uc004fki.2_5'Flank|FLNA_uc011mzn.1_5'UTR|FLNA_uc010nuu.1_Silent_p.L1775L	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1783	Filamin 16.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTCACATCCAGCCCATTGACA	0.622													26	33	---	---	---	---	PASS
PLXNA3	55558	broad.mit.edu	37	X	153697756	153697756	+	Silent	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153697756C>A	uc004flm.2	+	27	4802	c.4629C>A	c.(4627-4629)CTC>CTA	p.L1543L		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	1543	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCATCATCCTCCAGGATGAGG	0.607													58	72	---	---	---	---	PASS
PLXNA3	55558	broad.mit.edu	37	X	153697757	153697757	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153697757C>A	uc004flm.2	+	27	4803	c.4630C>A	c.(4630-4632)CAG>AAG	p.Q1544K		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	1544	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CATCATCCTCCAGGATGAGGA	0.612													55	71	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	700514	700514	+	RNA	DEL	A	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:700514delA	uc001abo.2	-	7		c.1040delT								Homo sapiens cDNA clone IMAGE:4129277, partial cds.																		actccatctcaaaaaaaaaaa	0.179													5	3	---	---	---	---	
ZMYND12	84217	broad.mit.edu	37	1	42905859	42905859	+	Intron	DEL	A	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42905859delA	uc001chj.2	-						ZMYND12_uc010ojt.1_Intron	NM_032257	NP_115633	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12 isoform 1							intracellular	zinc ion binding			ovary(1)	1	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ttggaagagtaaaaaaaaaaa	0.080													8	4	---	---	---	---	
MSH4	4438	broad.mit.edu	37	1	76365140	76365140	+	Intron	DEL	C	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76365140delC	uc001dhd.1	+							NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4						chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						AAGTTGTCATCCAGAATTTTA	0.313								MMR					4	6	---	---	---	---	
TTF2	8458	broad.mit.edu	37	1	117617325	117617328	+	Intron	DEL	CTAT	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117617325_117617328delCTAT	uc001egy.2	+						TTF2_uc001egx.1_Intron	NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase						mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		ggttaagaaactatctattgggca	0.010													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142803275	142803276	+	Intron	INS	-	AAC	AAC	rs145869340		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803275_142803276insAAC	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_5'Flank					Homo sapiens PNAS-130 mRNA, complete cds.																		AACCAAACCAAaacaacaacaa	0.243													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	178587971	178587972	+	IGR	INS	-	GAAGGAAGGAAG	GAAGGAAGGAAG			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178587971_178587972insGAAGGAAGGAAG								C1orf220 (69947 upstream) : RALGPS2 (106328 downstream)																							aaagagagagagaaggaaggaa	0.000													4	2	---	---	---	---	
CACNA1E	777	broad.mit.edu	37	1	181480387	181480387	+	Intron	DEL	C	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181480387delC	uc001gow.2	+						CACNA1E_uc009wxr.2_Intron|CACNA1E_uc009wxs.2_Intron	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,						energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						ACCCTTGCTTCCCACCTACAC	0.567													68	38	---	---	---	---	
TMEM63A	9725	broad.mit.edu	37	1	226065040	226065040	+	Intron	DEL	G	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226065040delG	uc001hpm.1	-						TMEM63A_uc010pvi.1_Intron	NM_014698	NP_055513	O94886	TM63A_HUMAN	transmembrane protein 63A							integral to membrane|lysosomal membrane	nucleotide binding			ovary(1)|breast(1)	2	Breast(184;0.197)					GGCCCTGGGTGGGGCATTTAA	0.348													19	19	---	---	---	---	
MYT1L	23040	broad.mit.edu	37	2	1915896	1915896	+	Intron	DEL	G	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1915896delG	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron|MYT1L_uc010ewl.1_Intron	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GACAGGGAGAGGCAAAGAGAA	0.537													8	5	---	---	---	---	
ITSN2	50618	broad.mit.edu	37	2	24483772	24483773	+	Intron	INS	-	AA	AA	rs34385491		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24483772_24483773insAA	uc002rfe.2	-						ITSN2_uc002rff.2_Intron|ITSN2_uc002rfg.2_Intron|ITSN2_uc002rfh.1_5'Flank	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1						endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ggctccgtctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
LRRTM1	347730	broad.mit.edu	37	2	80530767	80530767	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80530767delC	uc002sok.1	-	2	448	c.178delG	c.(178-180)GCGfs	p.A60fs	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	60	LRRNT.|Lumenal (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						TTGTGGGGCGCCTCGGTGAGG	0.701										HNSCC(69;0.2)			50	26	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92119834	92119836	+	IGR	DEL	ATT	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92119834_92119836delATT								GGT8P (149681 upstream) : FKSG73 (9323 downstream)																							TATGTCTCTCATTATTTTGGTAA	0.187													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	131266624	131266624	+	IGR	DEL	C	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131266624delC								PTPN18 (133643 upstream) : CFC1B (12212 downstream)																							GCACCACTTGCCCATCTTGCT	0.617													71	42	---	---	---	---	
NEB	4703	broad.mit.edu	37	2	152529031	152529031	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152529031delG	uc010fnx.2	-	37	4342	c.4151delC	c.(4150-4152)CCTfs	p.P1384fs		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	1384	Nebulin 35.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CATGTCCCCAGGGGTATGGTA	0.468													128	78	---	---	---	---	
DCAF17	80067	broad.mit.edu	37	2	172337766	172337766	+	3'UTR	DEL	T	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172337766delT	uc002ugx.2	+	14					DCAF17_uc010zdq.1_RNA|DCAF17_uc010zdr.1_RNA|DCAF17_uc010fqg.2_3'UTR	NM_025000	NP_079276	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17 isoform 1							CUL4 RING ubiquitin ligase complex|integral to membrane|nucleolus					0						CTATGACTTCTTTTTTAAACT	0.363													16	12	---	---	---	---	
C2orf60	129450	broad.mit.edu	37	2	200803934	200803935	+	Intron	DEL	TC	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200803934_200803935delTC	uc002uvi.3	-						C2orf60_uc002uvj.3_Intron|C2orf60_uc002uvk.3_Intron|C2orf60_uc010fss.2_Intron	NM_001039693	NP_001034782	A2RUC4	TYW5_HUMAN	hypothetical protein LOC129450						wybutosine biosynthetic process		iron ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein homodimerization activity|tRNA binding				0						tctctatctttctctctctctc	0.153													4	3	---	---	---	---	
ZFAND2B	130617	broad.mit.edu	37	2	220071889	220071889	+	Intron	DEL	T	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220071889delT	uc002vka.2	+						ZFAND2B_uc010zkt.1_Intron|ZFAND2B_uc010fwd.1_Intron|ZFAND2B_uc002vjy.1_Intron|ZFAND2B_uc002vjz.1_Intron|ZFAND2B_uc002vkb.1_5'Flank	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B							endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGGGGGGGTGGTCAGCGGC	0.627													6	4	---	---	---	---	
RAF1	5894	broad.mit.edu	37	3	12633424	12633425	+	Intron	INS	-	T	T	rs150506410		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12633424_12633425insT	uc003bxf.3	-						RAF1_uc011aut.1_Intron|RAF1_uc011auu.1_Intron	NM_002880	NP_002871	P04049	RAF1_HUMAN	v-raf-1 murine leukemia viral oncogene homolog						activation of MAPKK activity|apoptosis|axon guidance|cell proliferation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of peptidyl-serine phosphorylation|Ras protein signal transduction|synaptic transmission	cytosol|mitochondrial outer membrane|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity		ESRP1/RAF1(4)|SRGAP3/RAF1(4)	central_nervous_system(4)|prostate(4)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|liver(1)|ovary(1)	14					Sorafenib(DB00398)	CAAATTTCCAAttttttttttt	0.168			T	SRGAP3	pilocytic astrocytoma				Noonan_syndrome				6	4	---	---	---	---	
TFG	10342	broad.mit.edu	37	3	100439125	100439125	+	Intron	DEL	G	-	-	rs34860451		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100439125delG	uc003due.2	+						TFG_uc003duf.2_Intron|TFG_uc003dug.2_Intron|TFG_uc003duh.2_Intron|TFG_uc003dui.2_Intron	NM_006070	NP_006061	Q92734	TFG_HUMAN	TRK-fused						positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm	signal transducer activity		TFG/ALK(7)	haematopoietic_and_lymphoid_tissue(7)|lung(2)|large_intestine(1)|prostate(1)	11						TGTTAAGTATGTTTTTTTTGA	0.284			T	NTRK1|ALK	papillary thyroid|ALCL|NSCLC								1	5	---	---	---	---	
CD80	941	broad.mit.edu	37	3	119246386	119246386	+	Intron	DEL	G	-	-	rs3830649		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119246386delG	uc003ecq.2	-							NM_005191	NP_005182	P33681	CD80_HUMAN	CD80 antigen precursor						interspecies interaction between organisms|intracellular signal transduction|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of signal transduction|positive regulation of T-helper 1 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation	intracellular	coreceptor activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2					Abatacept(DB01281)	CATGGCAAAAGAAGAGGTTAC	0.368													3	3	---	---	---	---	
ALG1L2	644974	broad.mit.edu	37	3	129814807	129814807	+	Intron	DEL	G	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129814807delG	uc011bld.1	+						ALG1L2_uc010hth.2_Intron	NM_001136152	NP_001129624	C9J202	AG1L2_HUMAN	asparagine-linked glycosylation 1-like 2						biosynthetic process		transferase activity, transferring glycosyl groups				0						CACTCCCCTCGGGGGGTGTTG	0.607													5	3	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	140265581	140265581	+	Intron	DEL	C	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140265581delC	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GCCCAGCCTGCACAGCGCCAG	0.542										HNSCC(16;0.037)			8	18	---	---	---	---	
GYG1	2992	broad.mit.edu	37	3	148741675	148741676	+	Intron	INS	-	A	A	rs139508166	by1000genomes	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148741675_148741676insA	uc003ewn.2	+						GYG1_uc011bnp.1_Intron|GYG1_uc003ewo.2_Intron|GYG1_uc003ewp.2_Intron	NM_004130	NP_004121	P46976	GLYG_HUMAN	glycogenin 1						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	glycogenin glucosyltransferase activity|metal ion binding|protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			ggtgggaagttagaggctgtag	0.045													3	4	---	---	---	---	
NMD3	51068	broad.mit.edu	37	3	160958626	160958628	+	Intron	DEL	TTT	-	-	rs141601797		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160958626_160958628delTTT	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron|NMD3_uc010hwh.2_Intron	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			tcagccAGGATTTTTTTTTTTTT	0.133													9	7	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188295533	188295540	+	Intron	DEL	GTTCCTTC	-	-	rs67188827		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188295533_188295540delGTTCCTTC	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		tccttcctttgttccttcgttccttcgt	0.053			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	4	---	---	---	---	
SLIT2	9353	broad.mit.edu	37	4	20619357	20619358	+	Intron	DEL	AA	-	-	rs71653889		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20619357_20619358delAA	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						agaaaaagtgaaaaaaaaaaaa	0.302													5	3	---	---	---	---	
NFXL1	152518	broad.mit.edu	37	4	47856958	47856958	+	Intron	DEL	A	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47856958delA	uc010igh.2	-						NFXL1_uc003gxo.2_Intron|NFXL1_uc003gxp.2_Intron|NFXL1_uc003gxq.3_Intron|NFXL1_uc010igi.2_Intron	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like							integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						attaaaaggcaaaaaaaaaaa	0.129													7	4	---	---	---	---	
GRID2	2895	broad.mit.edu	37	4	94376782	94376783	+	Intron	INS	-	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94376782_94376783insA	uc011cdt.1	+						GRID2_uc011cdu.1_Intron	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	TTCACACTGTTAATGTATTCCT	0.371													20	30	---	---	---	---	
PDLIM5	10611	broad.mit.edu	37	4	95583389	95583389	+	Intron	DEL	C	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95583389delC	uc003hti.2	+						PDLIM5_uc011cdx.1_Intron|PDLIM5_uc003hth.2_Intron|PDLIM5_uc003htj.2_Intron|PDLIM5_uc003htk.2_Intron|PDLIM5_uc011cdy.1_Intron|PDLIM5_uc003htl.2_Intron	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a						regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		CCAAGGGAATCCTGAAACATG	0.313													3	7	---	---	---	---	
PXT1	222659	broad.mit.edu	37	6	36359505	36359505	+	3'UTR	DEL	A	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36359505delA	uc003omd.1	-	2						NM_152990	NP_694535	Q8NFP0	PXT1_HUMAN	peroxisomal, testis specific 1							peroxisome					0						CTCAGAGGGTAAAAAGAAAAC	0.423													47	57	---	---	---	---	
NOX3	50508	broad.mit.edu	37	6	155749721	155749721	+	Intron	DEL	T	-	-	rs111606766		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155749721delT	uc003qqm.2	-							NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3								electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TCtttttttcttttttttttt	0.363													6	3	---	---	---	---	
SP4	6671	broad.mit.edu	37	7	21468304	21468306	+	In_Frame_Del	DEL	AGG	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21468304_21468306delAGG	uc003sva.2	+	2	198_200	c.17_19delAGG	c.(16-21)AAGGAG>AAG	p.E11del	SP4_uc003svb.2_5'UTR	NM_003112	NP_003103	Q02446	SP4_HUMAN	Sp4 transcription factor	11	Poly-Glu.				regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(3)|skin(2)	5						GATCAGAAGAAGGAGGAGGAGGA	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	26316301	26316302	+	IGR	INS	-	AAAT	AAAT	rs142084046	by1000genomes	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26316301_26316302insAAAT								CBX3 (63327 upstream) : SNX10 (15213 downstream)																							TGCCCCCTCAAaaataaataaa	0.267													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98108146	98108152	+	IGR	DEL	CTGTCAC	-	-	rs112906827		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98108146_98108152delCTGTCAC								BAIAP2L1 (77719 upstream) : NPTX2 (138445 downstream)																							gagtcttgctctgtcacccaggctgga	0.116													2	5	---	---	---	---	
PTCD1	26024	broad.mit.edu	37	7	99046083	99046083	+	Intron	DEL	T	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99046083delT	uc011kiw.1	-						CPSF4_uc003uqi.2_Intron|CPSF4_uc003uqj.2_Intron|CPSF4_uc003uqk.2_Intron|CPSF4_uc011kix.1_Intron	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1											ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TGCTCATCTCTTTTTtttttt	0.249													4	2	---	---	---	---	
ZAN	7455	broad.mit.edu	37	7	100369721	100369721	+	Intron	DEL	T	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100369721delT	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron|ZAN_uc011kkd.1_Intron|ZAN_uc011kke.1_5'Flank	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ctctaaattcttttttttttt	0.254													6	4	---	---	---	---	
CAPZA2	830	broad.mit.edu	37	7	116532874	116532874	+	Intron	DEL	T	-	-	rs139698378		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116532874delT	uc003vil.2	+						CAPZA2_uc003vik.1_Intron|CAPZA2_uc011knk.1_Intron	NM_006136	NP_006127	P47755	CAZA2_HUMAN	capping protein (actin filament) muscle Z-line,						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement|innate immune response|protein complex assembly	cytosol|extracellular region|F-actin capping protein complex	actin binding				0	all_cancers(3;8.53e-08)|all_epithelial(6;7.79e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)		GBM - Glioblastoma multiforme(2;5.01e-06)|STAD - Stomach adenocarcinoma(10;0.000512)|all cancers(2;0.00326)			AACCAAAACCTTTTTTTTTTT	0.308													5	5	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157361870	157361871	+	Intron	DEL	TG	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157361870_157361871delTG	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron|PTPRN2_uc003wnn.2_5'Flank	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CTGAGCAGCTTGTAGCTTGTGG	0.559													4	2	---	---	---	---	
ADAMDEC1	27299	broad.mit.edu	37	8	24249585	24249586	+	Intron	INS	-	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24249585_24249586insA	uc003xdz.2	+						ADAMDEC1_uc010lub.2_Intron|ADAMDEC1_uc011lab.1_Intron	NM_014479	NP_055294	O15204	ADEC1_HUMAN	ADAM-like, decysin 1 isoform 1						integrin-mediated signaling pathway|negative regulation of cell adhesion|proteolysis	extracellular region|integral to membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)	2		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		GGAGGGAGAGCAAAAAAAAAAA	0.366													4	2	---	---	---	---	
KIAA1429	25962	broad.mit.edu	37	8	95523231	95523232	+	Intron	INS	-	T	T	rs143302012	by1000genomes	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95523231_95523232insT	uc003ygo.1	-						KIAA1429_uc003ygp.2_3'UTR|KIAA1429_uc010maz.1_Intron	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1						mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			TTTATTTAAAATGTTACCCCCA	0.337													2	6	---	---	---	---	
EPB41L4B	54566	broad.mit.edu	37	9	111978941	111978943	+	Intron	DEL	AAG	-	-	rs72234623		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111978941_111978943delAAG	uc004bdz.1	-							NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3						aaaaaaaaaaaagaaaagaaaaa	0.167													6	3	---	---	---	---	
ANAPC2	29882	broad.mit.edu	37	9	140070128	140070128	+	Intron	DEL	G	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140070128delG	uc004clr.1	-						ANAPC2_uc004clq.1_Intron	NM_013366	NP_037498	Q9UJX6	ANC2_HUMAN	anaphase-promoting complex subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cyclin catabolic process|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of cyclin-dependent protein kinase activity	anaphase-promoting complex|cytosol|nucleoplasm	ubiquitin protein ligase binding|ubiquitin-protein ligase activity			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		CCGTGTGGCCGGGGCAGGCCA	0.672													25	18	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140267711	140267729	+	Intron	DEL	GAGGGTGAAGCCACGGGCT	-	-	rs59889670		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140267711_140267729delGAGGGTGAAGCCACGGGCT	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncg.1_Intron|EXD3_uc004cmr.2_Intron|EXD3_uc004cms.2_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						TCAGGGGGCAGAGGGTGAAGCCACGGGCTGAGTCTTGGC	0.685													4	5	---	---	---	---	
NOXA1	10811	broad.mit.edu	37	9	140320927	140320928	+	Intron	INS	-	GGGTC	GGGTC	rs145312088	by1000genomes	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140320927_140320928insGGGTC	uc004cmv.2	+						C9orf167_uc011mew.1_Intron|NOXA1_uc004cmu.2_Intron|NOXA1_uc010nch.2_Intron	NM_006647	NP_006638	Q86UR1	NOXA1_HUMAN	NADPH oxidase activator 1						regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|superoxide metabolic process	cytoplasm|NADPH oxidase complex	Rac GTPase binding|superoxide-generating NADPH oxidase activator activity				0	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)		CAGGGAAACCTGAGACTGTGGC	0.426													8	4	---	---	---	---	
YME1L1	10730	broad.mit.edu	37	10	27434231	27434231	+	Intron	DEL	A	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27434231delA	uc001iti.2	-						YME1L1_uc001itj.2_Intron|YME1L1_uc010qdl.1_Intron|YME1L1_uc009xkv.2_Intron	NM_139312	NP_647473	Q96TA2	YMEL1_HUMAN	YME1-like 1 isoform 1						protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity			ovary(1)	1						AAAAAAAAACAAAAAAAAAAC	0.159													8	4	---	---	---	---	
EXOC6	54536	broad.mit.edu	37	10	94733663	94733664	+	Intron	INS	-	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94733663_94733664insA	uc001kig.2	+						EXOC6_uc010qnr.1_Intron|EXOC6_uc001kie.2_Intron|EXOC6_uc009xub.2_Intron|EXOC6_uc009xuc.2_Intron|EXOC6_uc001kih.2_Intron|EXOC6_uc001kii.2_Intron	NM_019053	NP_061926	Q8TAG9	EXOC6_HUMAN	SEC15-like 1 isoform a						protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)				AGTACTGCCAGAAAAAAAAAAC	0.282													4	2	---	---	---	---	
JAKMIP3	282973	broad.mit.edu	37	10	133961636	133961637	+	Intron	INS	-	TGAACA	TGAACA	rs141683861	by1000genomes	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133961636_133961637insTGAACA	uc001lkx.3	+						JAKMIP3_uc009yba.1_Intron	NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		ACACAAAGCCCtgaacatgaac	0.495													4	2	---	---	---	---	
MARK2	2011	broad.mit.edu	37	11	63667298	63667301	+	Intron	DEL	TTAG	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63667298_63667301delTTAG	uc001nxw.2	+						MARK2_uc001nxx.2_Intron|MARK2_uc001nxy.2_Intron|MARK2_uc001nxv.3_Intron|MARK2_uc001nxz.3_Intron|MARK2_uc009yoy.2_Intron	NM_001039469	NP_001034558	Q7KZI7	MARK2_HUMAN	MAP/microtubule affinity-regulating kinase 2						cell differentiation|establishment or maintenance of epithelial cell apical/basal polarity|intracellular protein kinase cascade|multicellular organismal development|response to oxidative stress	plasma membrane	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						GCCCAGGGCCTTAGTCTGGTCCAC	0.490													166	105	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	83585289	83585290	+	Intron	INS	-	GGAAGGAAGGAAGGAGAGAGGGAA	GGAAGGAAGGAAGGAGAGAGGGAA	rs144508115	by1000genomes	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83585289_83585290insGGAAGGAAGGAAGGAGAGAGGGAA	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Intron	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				aaagaaagaagggaaggaagga	0.000													6	7	---	---	---	---	
EED	8726	broad.mit.edu	37	11	85975481	85975482	+	Intron	INS	-	TATT	TATT	rs138959322	by1000genomes	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85975481_85975482insTATT	uc001pbp.2	+						EED_uc010rtm.1_Intron|EED_uc001pbq.2_Intron|EED_uc001pbr.2_Intron|EED_uc001pbs.2_Intron|EED_uc010rtn.1_Intron	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				AGTAAAGACtatatttatttat	0.312													9	6	---	---	---	---	
TTC12	54970	broad.mit.edu	37	11	113194320	113194320	+	Intron	DEL	T	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113194320delT	uc001pnu.2	+						TTC12_uc001pnv.2_Intron|TTC12_uc001pnw.2_Intron|TTC12_uc001pnx.2_Intron	NM_017868	NP_060338	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12								binding			pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		taaaatttgattttttttttC	0.318													5	3	---	---	---	---	
ZW10	9183	broad.mit.edu	37	11	113629092	113629093	+	Intron	INS	-	A	A	rs140550139		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113629092_113629093insA	uc001poe.2	-						ZW10_uc009yyv.2_Intron	NM_004724	NP_004715	O43264	ZW10_HUMAN	centromere/kinetochore protein zw10						cell division|ER to Golgi vesicle-mediated transport|establishment of mitotic spindle orientation|meiosis|mitotic cell cycle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|protein complex assembly|protein localization to kinetochore|protein transport|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|endoplasmic reticulum membrane|kinetochore microtubule|nucleus|spindle pole	centromeric DNA binding|protein binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		AGGAACAGTTGAAAAAAAAAAA	0.322													7	4	---	---	---	---	
ZNF259	8882	broad.mit.edu	37	11	116652729	116652729	+	Intron	DEL	A	-	-	rs76506005		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116652729delA	uc001ppp.2	-						ZNF259_uc009yzd.2_Intron|ZNF259_uc001ppq.2_Intron	NM_003904	NP_003895	O75312	ZPR1_HUMAN	zinc finger protein 259						cell proliferation|signal transduction	cytoplasm|nucleolus					0	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		ctctgtctccaaaaaaaaaaa	0.109													3	4	---	---	---	---	
AQP5	362	broad.mit.edu	37	12	50356237	50356238	+	Intron	INS	-	A	A	rs146758293	by1000genomes	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50356237_50356238insA	uc001rvo.2	+							NM_001651	NP_001642	P55064	AQP5_HUMAN	aquaporin 5						carbon dioxide transport|excretion|odontogenesis|pancreatic juice secretion	apical plasma membrane|integral to plasma membrane	protein binding|water channel activity				0						ACCCCACCTGGAAAAAAGGGGT	0.668													7	4	---	---	---	---	
E2F7	144455	broad.mit.edu	37	12	77428004	77428005	+	Intron	INS	-	T	T	rs144053051	by1000genomes	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77428004_77428005insT	uc001sym.3	-							NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7						cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						TTTCAATGTACTTTTTTTTTTA	0.292													4	6	---	---	---	---	
NR1H4	9971	broad.mit.edu	37	12	100904587	100904587	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100904587delG	uc001tht.1	+	2	169	c.141delG	c.(139-141)CTGfs	p.L47fs	NR1H4_uc001thp.1_Frame_Shift_Del_p.L37fs|NR1H4_uc001thq.1_Frame_Shift_Del_p.L37fs|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_Frame_Shift_Del_p.L37fs|NR1H4_uc010svk.1_Frame_Shift_Del_p.L37fs|NR1H4_uc001ths.1_Frame_Shift_Del_p.L47fs	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	47					bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						CAGGTCCTCTGGGACAGAACC	0.438													53	31	---	---	---	---	
DHRS4	10901	broad.mit.edu	37	14	24473479	24473479	+	Intron	DEL	A	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24473479delA	uc001wlc.3	+						DHRS4L2_uc001wld.3_Intron|DHRS4L2_uc001wle.3_Intron|DHRS4L2_uc001wlg.3_Intron|DHRS4L2_uc001wlh.3_Intron|DHRS4L2_uc010tnt.1_Intron|DHRS4L2_uc001wli.3_Intron|DHRS4L2_uc010alb.2_Intron	NM_021004	NP_066284	Q9BTZ2	DHRS4_HUMAN	peroxisomal short-chain alcohol dehydrogenase							mitochondrion|nuclear membrane|peroxisome	binding|carbonyl reductase (NADPH) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	ctccgtctctaaaaaaaaaaa	0.134													4	2	---	---	---	---	
SLC24A4	123041	broad.mit.edu	37	14	92909835	92909835	+	Intron	DEL	C	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92909835delC	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron|SLC24A4_uc010auj.2_Intron|SLC24A4_uc010twn.1_Intron	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		TGCCCCTCTGCCCCCAAGGTC	0.617													12	11	---	---	---	---	
SPINT1	6692	broad.mit.edu	37	15	41145072	41145073	+	Intron	INS	-	A	A			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41145072_41145073insA	uc001zna.2	+						SPINT1_uc001znb.2_Intron|SPINT1_uc001znc.2_Intron|SPINT1_uc010ucs.1_Intron	NM_181642	NP_857593	O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1							extracellular region|membrane fraction	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		ccatctctaataaaaaaaaaaa	0.139													4	3	---	---	---	---	
POLG	5428	broad.mit.edu	37	15	89868435	89868436	+	Intron	DEL	GA	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89868435_89868436delGA	uc002bns.3	-						POLG_uc002bnr.3_Intron	NM_002693	NP_002684	P54098	DPOG1_HUMAN	DNA-directed DNA polymerase gamma						base-excision repair, gap-filling|cell death|DNA-dependent DNA replication	mitochondrial nucleoid	DNA binding|DNA-directed DNA polymerase activity|protease binding			ovary(1)|lung(1)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			gagagtgagtgagagagtgagt	0.054								DNA_polymerases_(catalytic_subunits)					4	2	---	---	---	---	
MCTP2	55784	broad.mit.edu	37	15	94842066	94842067	+	Intron	INS	-	CT	CT	rs149048088	by1000genomes	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94842066_94842067insCT	uc002btj.2	+						MCTP2_uc010urg.1_Intron|MCTP2_uc002bti.2_Intron|MCTP2_uc010boj.2_Intron|MCTP2_uc010bok.2_Intron|MCTP2_uc002btg.3_Intron|MCTP2_uc002bth.3_Intron	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			cctccccctccctctctcttcc	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	27088694	27088695	+	IGR	INS	-	TCCT	TCCT	rs150155389		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27088694_27088695insTCCT								C16orf82 (8208 upstream) : JMJD5 (126112 downstream)																							cggctcctttctccttccttcc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	90204189	90204190	+	RNA	INS	-	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90204189_90204190insT	uc002fqr.2	+	9		c.1571_1572insT								Homo sapiens cDNA FLJ35239 fis, clone PROST2002212.																		TCCCAAAGGAAttttttttttt	0.213													4	3	---	---	---	---	
SERPINF1	5176	broad.mit.edu	37	17	1673345	1673346	+	Splice_Site	INS	-	TC	TC			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1673345_1673346insTC	uc002ftl.2	+	3	440	c.283_splice	c.e3+1	p.G95_splice	SERPINF1_uc010cjw.2_Intron	NM_002615	NP_002606	P36955	PEDF_HUMAN	serine (or cysteine) proteinase inhibitor, clade						cell proliferation|negative regulation of angiogenesis|positive regulation of neurogenesis|regulation of proteolysis	extracellular space|melanosome	serine-type endopeptidase inhibitor activity			ovary(1)	1						CTCTCGCTGGGTGAGTGCTCAG	0.624													15	14	---	---	---	---	
WRAP53	55135	broad.mit.edu	37	17	7604297	7604297	+	Intron	DEL	T	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7604297delT	uc010vuh.1	+						WRAP53_uc010vui.1_Intron|WRAP53_uc002gip.2_Intron|WRAP53_uc002gir.2_Intron|WRAP53_uc002giq.2_Intron|WRAP53_uc010cnl.2_Intron|WRAP53_uc010vuj.1_Intron	NM_001143990	NP_001137462	Q9BUR4	WAP53_HUMAN	WD repeat domain 79 isoform 2						positive regulation of telomerase activity|telomere formation via telomerase	Cajal body|cytoplasm|telomerase holoenzyme complex	protein binding|RNA binding				0						CTCCCCttccttttttttttt	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	15737072	15737073	+	IGR	INS	-	TTTA	TTTA	rs71838018		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15737072_15737073insTTTA								MEIS3P1 (44055 upstream) : ADORA2B (111158 downstream)																							CTCTATCCTGCTTTATCTTGGA	0.460													4	2	---	---	---	---	
ANKRD29	147463	broad.mit.edu	37	18	21214243	21214255	+	Intron	DEL	TTTTTTTTTTTTT	-	-	rs2914965		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21214243_21214255delTTTTTTTTTTTTT	uc002kun.2	-						ANKRD29_uc002kuo.2_Intron	NM_173505	NP_775776	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29											ovary(3)|breast(1)	4	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ACTTTCCCTGttttttttttttttttttttttt	0.197													6	5	---	---	---	---	
LAMA3	3909	broad.mit.edu	37	18	21447532	21447533	+	Intron	DEL	AG	-	-	rs56266938		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21447532_21447533delAG	uc002kuq.2	+						LAMA3_uc002kur.2_Intron	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	aaaaaaaaaaagaaaaaaaaaa	0.124													4	2	---	---	---	---	
AQP4	361	broad.mit.edu	37	18	24435969	24435970	+	3'UTR	INS	-	T	T			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24435969_24435970insT	uc002kwa.2	-	5					AQP4_uc002kvz.2_3'UTR	NM_001650	NP_001641	P55087	AQP4_HUMAN	aquaporin 4 isoform a						cellular response to interferon-gamma|excretion|nervous system development	cytoplasm|external side of plasma membrane|integral to plasma membrane	water channel activity				0	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)					AAAAATATTTCTTTTTTTAGAT	0.262													8	8	---	---	---	---	
ZNF211	10520	broad.mit.edu	37	19	58153213	58153214	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58153213_58153214delTG	uc002qpq.2	+	3	1539_1540	c.1359_1360delTG	c.(1357-1362)TATGTGfs	p.Y453fs	ZNF211_uc010yhb.1_Frame_Shift_Del_p.Y457fs|ZNF211_uc002qpp.2_Frame_Shift_Del_p.Y466fs|ZNF211_uc002qpr.2_Frame_Shift_Del_p.Y517fs|ZNF211_uc002qps.2_Frame_Shift_Del_p.Y518fs|ZNF211_uc002qpt.2_Frame_Shift_Del_p.Y465fs|ZNF211_uc010yhc.1_Frame_Shift_Del_p.Y465fs|ZNF211_uc010yhd.1_Frame_Shift_Del_p.Y392fs|ZNF211_uc010yhe.1_Frame_Shift_Del_p.Y444fs	NM_198855	NP_942152	Q13398	ZN211_HUMAN	zinc finger protein 211 isoform 2	453_454	C2H2-type 9.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAAGGCCTTATGTGTGTGGGGA	0.470													86	53	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26113543	26113543	+	IGR	DEL	A	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26113543delA								C20orf191 (18866 upstream) : MIR663 (75279 downstream)																							TCTTTGCCTTAACAACATTAT	0.363													6	3	---	---	---	---	
CEP250	11190	broad.mit.edu	37	20	34086362	34086362	+	Intron	DEL	G	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34086362delG	uc002xcm.2	+						CEP250_uc010zve.1_Intron	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2						centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			TGTGTCTGGAGAGGTCTGGCT	0.433													120	120	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	60532402	60532403	+	IGR	DEL	AG	-	-	rs71195424		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60532402_60532403delAG								MIR1257 (3684 upstream) : TAF4 (17452 downstream)																							TCGGACAGACAGATAATGAAAT	0.054													1	5	---	---	---	---	
C20orf11	54994	broad.mit.edu	37	20	61575189	61575189	+	Intron	DEL	T	-	-	rs67614670		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61575189delT	uc002ydy.2	+							NM_017896	NP_060366	Q9NWU2	CT011_HUMAN	chromosome 20 open reading frame 11							nucleus	protein binding				0	Breast(26;5.68e-08)					CCTTCATGGCttttttttttt	0.284													6	5	---	---	---	---	
PRPF6	24148	broad.mit.edu	37	20	62664103	62664104	+	Intron	INS	-	C	C	rs151327097	by1000genomes	TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62664103_62664104insC	uc002yho.2	+						PRPF6_uc002yhp.2_Intron|NCRNA00176_uc002yhq.2_5'Flank|NCRNA00176_uc011abq.1_5'Flank	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog						assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)					TGCTGCCAGGGCCAGGTCTGCA	0.683													5	4	---	---	---	---	
GRIK1	2897	broad.mit.edu	37	21	30963767	30963772	+	Intron	DEL	TCTTTT	-	-	rs72421506		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30963767_30963772delTCTTTT	uc002yno.1	-						GRIK1_uc002ynn.2_Intron|GRIK1_uc011acs.1_Intron|GRIK1_uc011act.1_Intron|GRIK1_uc010glq.1_Intron	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1						central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	TAGGTGGAGGTCTTTTTCTTTTTCAT	0.296													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17071582	17071583	+	IGR	INS	-	A	A	rs78253844		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17071582_17071583insA								OR11H1 (621778 upstream) : CCT8L2 (65 downstream)																							ctccgtctctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
MED15	51586	broad.mit.edu	37	22	20929656	20929656	+	Intron	DEL	T	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20929656delT	uc002zsp.2	+						MED15_uc002zsq.2_Intron|MED15_uc010gso.2_Intron|MED15_uc002zsr.2_Intron|MED15_uc011ahs.1_Intron|MED15_uc002zss.2_Intron|MED15_uc011ahu.1_Intron|MED15_uc002zst.2_Intron	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			CCACAGTCCCTTTTTTTTTTT	0.433													4	2	---	---	---	---	
MEI1	150365	broad.mit.edu	37	22	42128781	42128783	+	Intron	DEL	TTT	-	-	rs34396284		TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42128781_42128783delTTT	uc003baz.1	+						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc003bay.3_Intron|MEI1_uc011apd.1_Intron	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2						gattgaaaaattttttttttttt	0.000													4	2	---	---	---	---	
PGAM4	441531	broad.mit.edu	37	X	77224391	77224391	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77224391delG	uc004ecy.1	-	1	745	c.745delC	c.(745-747)CAGfs	p.Q249fs	ATP7A_uc004ecw.2_Intron|ATP7A_uc004ecx.3_Intron	NM_001029891	NP_001025062	Q8N0Y7	PGAM4_HUMAN	bisphosphoglycerate mutase 4	249					glycolysis		2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity|phosphoglycerate mutase activity				0						GCCTTGCCCTGGGCAGCCACA	0.572													95	46	---	---	---	---	
PNMA5	114824	broad.mit.edu	37	X	152159576	152159576	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2757-01	TCGA-66-2757-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152159576delC	uc010ntw.2	-	3	906	c.567delG	c.(565-567)TGGfs	p.W189fs	PNMA5_uc004fha.3_Frame_Shift_Del_p.W189fs|PNMA5_uc010ntx.2_Frame_Shift_Del_p.W189fs|PNMA5_uc004fgy.3_Frame_Shift_Del_p.W189fs	NM_001103151	NP_001096621	Q96PV4	PNMA5_HUMAN	paraneoplastic antigen like 5	189					apoptosis					ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CAGACACTTGCCATATGGGCA	0.532													101	66	---	---	---	---	
