Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
GPR157	80045	broad.mit.edu	37	1	9188908	9188908	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9188908G>C	uc001apq.1	-	1	322	c.179C>G	c.(178-180)TCG>TGG	p.S60W	GPR157_uc010oad.1_Missense_Mutation_p.S60W|GPR157_uc001apr.2_Missense_Mutation_p.S60W|GPR157_uc001aps.2_Silent_p.L108L	NM_024980	NP_079256	Q5UAW9	GP157_HUMAN	G protein-coupled receptor 157	60	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_lung(157;0.185)	all_epithelial(116;5.02e-20)|all_lung(118;3.6e-06)|Lung NSC(185;7.93e-06)|Renal(390;0.000147)|Breast(348;0.000688)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.16e-07)|COAD - Colon adenocarcinoma(227;7.73e-05)|Kidney(185;0.000252)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.00178)|BRCA - Breast invasive adenocarcinoma(304;0.00186)|READ - Rectum adenocarcinoma(331;0.0642)		GGAGGCGGCCGAGAGCAGGTC	0.716													3	10	---	---	---	---	PASS
EXOSC10	5394	broad.mit.edu	37	1	11158195	11158195	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11158195C>A	uc001asa.2	-	2	180	c.130G>T	c.(130-132)GTG>TTG	p.V44L	EXOSC10_uc001asb.2_Missense_Mutation_p.V44L|EXOSC10_uc009vmy.1_Missense_Mutation_p.V44L	NM_001001998	NP_001001998	Q01780	EXOSX_HUMAN	exosome component 10 isoform 1	44					CUT catabolic process|histone mRNA catabolic process|maturation of 5.8S rRNA|nuclear polyadenylation-dependent rRNA catabolic process|nuclear retention of unspliced pre-mRNA at the site of transcription|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasm|nuclear exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5' exonuclease activity|exoribonuclease activity|identical protein binding|nucleotide binding|protein serine/threonine kinase activity|RNA binding			upper_aerodigestive_tract(1)	1	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		GTGACTGCCACCACGGACCCA	0.448													27	47	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16901155	16901155	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16901155G>A	uc009vos.1	-	21	3113	c.2225C>T	c.(2224-2226)CCT>CTT	p.P742L	NBPF1_uc009vot.1_Missense_Mutation_p.P200L|NBPF1_uc001ayz.1_Missense_Mutation_p.P200L|NBPF1_uc010oce.1_Missense_Mutation_p.P471L	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	742	NBPF 3.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGAGTCCTCAGGGACTTCCTT	0.493													5	366	---	---	---	---	PASS
CNR2	1269	broad.mit.edu	37	1	24201727	24201727	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24201727G>A	uc001bif.2	-	2	508	c.381C>T	c.(379-381)ACC>ACT	p.T127T		NM_001841	NP_001832	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	127	Helical; Name=3; (Potential).				behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity			skin(2)|central_nervous_system(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Nabilone(DB00486)	GGTCAATGGCGGTCAGCAGGA	0.562													4	90	---	---	---	---	PASS
GRHL3	57822	broad.mit.edu	37	1	24663156	24663156	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24663156G>T	uc001biy.2	+	4	512	c.466G>T	c.(466-468)GGC>TGC	p.G156C	GRHL3_uc001bix.2_Missense_Mutation_p.G151C|GRHL3_uc001biz.2_Missense_Mutation_p.G58C	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform	151					regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		CCTCCCTGCAGGCCCCAGCAA	0.562													119	172	---	---	---	---	PASS
AIM1L	55057	broad.mit.edu	37	1	26664162	26664162	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26664162C>A	uc001bmd.3	-	8	806	c.376G>T	c.(376-378)GTG>TTG	p.V126L	AIM1L_uc001bmf.3_Missense_Mutation_p.V17L	NM_001039775	NP_001034864	Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	126	Beta/gamma crystallin 'Greek key' 3.						sugar binding			pancreas(1)	1		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		TCATACACCACAGCCTGGGGG	0.632													20	24	---	---	---	---	PASS
TMEM222	84065	broad.mit.edu	37	1	27648883	27648883	+	Splice_Site	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27648883G>T	uc001bnr.3	+	1	247	c.194_splice	c.e1+1	p.T65_splice	TMEM222_uc001bns.3_Splice_Site|TMEM222_uc001bnt.3_Splice_Site|TMEM222_uc001bnu.3_Splice_Site	NM_032125	NP_115501	Q9H0R3	TM222_HUMAN	transmembrane protein 222							integral to membrane	protein binding				0						CGGTGCTCACGTGAGTCTCTT	0.672													5	5	---	---	---	---	PASS
IQCC	55721	broad.mit.edu	37	1	32673382	32673382	+	Missense_Mutation	SNP	G	T	T	rs149820318	byFrequency	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32673382G>T	uc001bum.2	+	5	1147	c.1100G>T	c.(1099-1101)CGA>CTA	p.R367L	IQCC_uc009vua.2_Missense_Mutation_p.R447L|IQCC_uc010ogz.1_Missense_Mutation_p.R267L|DCDC2B_uc001bun.2_5'Flank	NM_018134	NP_060604	Q4KMZ1	IQCC_HUMAN	IQ motif containing C isoform 2	367										ovary(4)	4		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CCTGACTGCCGAACAGTCAGG	0.527													85	147	---	---	---	---	PASS
DEM1	64789	broad.mit.edu	37	1	40980595	40980595	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40980595G>T	uc001cfp.2	+	3	584	c.379G>T	c.(379-381)GAA>TAA	p.E127*	DEM1_uc001cfq.2_Nonsense_Mutation_p.E127*|DEM1_uc001cfr.2_Nonsense_Mutation_p.E127*|DEM1_uc001cfs.2_Nonsense_Mutation_p.E127*	NM_022774	NP_073611	Q9H790	EXO5_HUMAN	defects in morphology 1 homolog	127							DNA binding|exonuclease activity				0						TAGAGAACTAGAACTTCATGA	0.468													35	147	---	---	---	---	PASS
USP24	23358	broad.mit.edu	37	1	55566598	55566598	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55566598C>T	uc001cyg.3	-	41	4705	c.4705G>A	c.(4705-4707)GAT>AAT	p.D1569N		NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24	1729					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						AACACGCTATCATCTGGATTG	0.378													10	99	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74665364	74665364	+	Silent	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74665364T>C	uc001dge.1	+	2	115	c.99T>C	c.(97-99)CGT>CGC	p.R33R	LRRIQ3_uc001dfy.3_5'Flank|LRRIQ3_uc001dfz.3_5'Flank|TNNI3K_uc001dgc.1_Silent_p.R33R|TNNI3K_uc001dgd.2_Silent_p.R33R|FPGT_uc010oqt.1_5'UTR|FPGT_uc010oqu.1_Silent_p.R33R|FPGT_uc001dgb.1_Silent_p.R33R|FPGT_uc010oqv.1_Silent_p.R33R	NM_001112808	NP_001106279	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform a	Error:Variant_position_missing_in_Q59H18_after_alignment						cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						TTGTAGCACGTGGAGAATTCT	0.378													50	106	---	---	---	---	PASS
MCOLN2	255231	broad.mit.edu	37	1	85422122	85422122	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85422122A>G	uc001dkm.2	-	4	798	c.557T>C	c.(556-558)GTT>GCT	p.V186A	MCOLN2_uc001dkn.2_RNA	NM_153259	NP_694991	Q8IZK6	MCLN2_HUMAN	mucolipin 2	186						integral to membrane	ion channel activity			ovary(3)|upper_aerodigestive_tract(1)	4				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		ACCGAGCTCAACGTCGTTGTC	0.393													100	110	---	---	---	---	PASS
CLCA2	9635	broad.mit.edu	37	1	86889924	86889924	+	5'UTR	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86889924C>T	uc001dlr.3	+	1						NM_006536	NP_006527	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2 precursor						cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity			ovary(1)|breast(1)|skin(1)	3		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		GGAGGCTTCTCTACAACATGA	0.463													37	48	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94496616	94496616	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94496616A>C	uc001dqh.2	-	28	4293	c.4189T>G	c.(4189-4191)TTT>GTT	p.F1397V		NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	1397	Helical; (Potential).				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TATTCGCCAAAAGGAGGGATA	0.517													19	23	---	---	---	---	PASS
S1PR1	1901	broad.mit.edu	37	1	101704932	101704932	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101704932C>A	uc001dud.2	+	2	906	c.392C>A	c.(391-393)TCC>TAC	p.S131Y	S1PR1_uc009weg.2_Missense_Mutation_p.S131Y	NM_001400	NP_001391	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	131	Helical; Name=3; (By similarity).				cell adhesion	integral to membrane	lysosphingolipid and lysophosphatidic acid receptor activity			ovary(2)|lung(1)	3						CTGTCAGCCTCCGTGTTCAGT	0.537											OREG0013620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	41	57	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103405902	103405902	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103405902G>T	uc001dul.2	-	43	3683	c.3365C>A	c.(3364-3366)CCT>CAT	p.P1122H	COL11A1_uc001duk.2_Missense_Mutation_p.P318H|COL11A1_uc001dum.2_Missense_Mutation_p.P1134H|COL11A1_uc001dun.2_Missense_Mutation_p.P1083H|COL11A1_uc009weh.2_Missense_Mutation_p.P1006H	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1122	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GTCTTCCCCAGGGGAGCCGGC	0.463													43	54	---	---	---	---	PASS
HIST2H2AC	8338	broad.mit.edu	37	1	149858886	149858886	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149858886C>A	uc001etd.2	+	1	362	c.362C>A	c.(361-363)ACC>AAC	p.T121N	HIST2H2BE_uc001etc.2_5'Flank	NM_003517	NP_003508	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	121					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)|skin(1)	2	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CCAAAGAAAACCGAAAGCCAC	0.473													47	112	---	---	---	---	PASS
SETDB1	9869	broad.mit.edu	37	1	150900289	150900289	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150900289G>T	uc001evu.2	+	2	289	c.99G>T	c.(97-99)CTG>CTT	p.L33L	SETDB1_uc009wmf.2_Silent_p.L33L|SETDB1_uc001evv.2_Silent_p.L33L|SETDB1_uc001evw.3_Silent_p.L33L|SETDB1_uc009wmg.1_Silent_p.L33L	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1	33	Potential.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			TTGAGGAACTGGGTATCTCTA	0.493													112	202	---	---	---	---	PASS
LYSMD1	388695	broad.mit.edu	37	1	151133379	151133379	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151133379C>A	uc001ewy.2	-	3	1299	c.663G>T	c.(661-663)GAG>GAT	p.E221D	LYSMD1_uc010pcr.1_Missense_Mutation_p.E173D	NM_212551	NP_997716	Q96S90	LYSM1_HUMAN	LysM, putative peptidoglycan-binding, domain	221					cell wall macromolecule catabolic process						0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGATTTCATCCTCCTGGTCCC	0.562													93	180	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152327240	152327240	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152327240G>T	uc001ezw.3	-	3	3095	c.3022C>A	c.(3022-3024)CAG>AAG	p.Q1008K	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1008	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGATGACTGACTTGAGCCA	0.478													248	470	---	---	---	---	PASS
DENND4B	9909	broad.mit.edu	37	1	153915407	153915407	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153915407C>G	uc001fdd.1	-	3	918	c.517G>C	c.(517-519)GAG>CAG	p.E173Q		NM_014856	NP_055671	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	173	MABP.									ovary(1)	1	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGAGTGCCCTCGCCCTTACTG	0.647													14	22	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	153984798	153984798	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153984798T>A	uc001fdw.2	-	34	4774	c.4702A>T	c.(4702-4704)ACT>TCT	p.T1568S	NUP210L_uc009woq.2_Missense_Mutation_p.T477S|NUP210L_uc010peh.1_Missense_Mutation_p.T1568S	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	1568						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GTGAGATAAGTCTTGAGGTCA	0.403													92	215	---	---	---	---	PASS
SYT11	23208	broad.mit.edu	37	1	155838148	155838148	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155838148G>T	uc001fmg.2	+	2	690	c.427G>T	c.(427-429)GAG>TAG	p.E143*	SYT11_uc010pgq.1_Intron	NM_152280	NP_689493	Q9BT88	SYT11_HUMAN	synaptotagmin XI	143	Cytoplasmic (Potential).					cell junction|synaptic vesicle membrane	protein binding|transporter activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			GACCCCTGGGGAGAGCAAAAC	0.507													78	174	---	---	---	---	PASS
INSRR	3645	broad.mit.edu	37	1	156821831	156821831	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156821831G>A	uc010pht.1	-	3	1044	c.790C>T	c.(790-792)CCA>TCA	p.P264S	NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron|INSRR_uc009wsj.1_Missense_Mutation_p.P264S	NM_014215	NP_055030	P14616	INSRR_HUMAN	insulin receptor-related receptor precursor	264					protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity			lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TAGGTGCCTGGCGGGCAGGCC	0.662													17	36	---	---	---	---	PASS
OR10R2	343406	broad.mit.edu	37	1	158450404	158450404	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158450404T>C	uc010pik.1	+	1	737	c.737T>C	c.(736-738)CTG>CCG	p.L246P	uc001fso.1_RNA	NM_001004472	NP_001004472	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R,	246	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)					AGGACTATCCTGAAGATTCCC	0.433													87	172	---	---	---	---	PASS
FCER1A	2205	broad.mit.edu	37	1	159275932	159275932	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159275932C>T	uc001ftq.2	+	5	585	c.486C>T	c.(484-486)TCC>TCT	p.S162S		NM_002001	NP_001992	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor	162	Ig-like 2.|Extracellular (Potential).					integral to plasma membrane				lung(2)|skin(2)|prostate(1)	5	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	ACAACATCTCCATTACAAATG	0.458													48	120	---	---	---	---	PASS
CD84	8832	broad.mit.edu	37	1	160523826	160523826	+	Missense_Mutation	SNP	T	C	C	rs139298884		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160523826T>C	uc001fwh.3	-	3	523	c.499A>G	c.(499-501)AAT>GAT	p.N167D	CD84_uc001fwf.3_Missense_Mutation_p.N167D|CD84_uc001fwg.3_Missense_Mutation_p.N167D|CD84_uc009wtn.2_Missense_Mutation_p.N167D|CD84_uc001fwi.3_Missense_Mutation_p.N53D|CD84_uc001fwj.2_Missense_Mutation_p.N167D|CD84_uc001fwk.2_Missense_Mutation_p.N167D	NM_003874	NP_003865	Q9UIB8	SLAF5_HUMAN	CD84 molecule	167	Extracellular (Potential).|Ig-like C2-type.				blood coagulation|defense response|homophilic cell adhesion|leukocyte migration	integral to plasma membrane	receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			GGACTCCAATTGTATGTCACA	0.448													49	123	---	---	---	---	PASS
PBX1	5087	broad.mit.edu	37	1	164789420	164789420	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164789420A>T	uc001gct.2	+	7	1367	c.1109A>T	c.(1108-1110)CAG>CTG	p.Q370L	PBX1_uc010pku.1_Missense_Mutation_p.Q370L|PBX1_uc010pkv.1_Missense_Mutation_p.Q287L|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Missense_Mutation_p.Q260L	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	370					negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						GTGCAATCACAGGTAGGGACC	0.488			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								26	53	---	---	---	---	PASS
FAM78B	149297	broad.mit.edu	37	1	166039931	166039931	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166039931G>A	uc001gdr.2	-	3	923	c.333C>T	c.(331-333)AGC>AGT	p.S111S	FAM78B_uc010plc.1_RNA|FAM78B_uc001gdq.2_5'Flank	NM_001017961	NP_001017961	Q5VT40	FA78B_HUMAN	hypothetical protein LOC149297	111										central_nervous_system(1)|skin(1)	2	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)					ACCAAGGGTAGCTCACCCCAT	0.522													27	153	---	---	---	---	PASS
ADCY10	55811	broad.mit.edu	37	1	167815444	167815444	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167815444C>T	uc001ger.2	-	20	2793	c.2495G>A	c.(2494-2496)TGT>TAT	p.C832Y	ADCY10_uc009wvk.2_Missense_Mutation_p.C740Y|ADCY10_uc010plj.1_Missense_Mutation_p.C679Y|ADCY10_uc009wvl.2_Missense_Mutation_p.C831Y	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10	832					intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3						GATGGCAGCACATCTCACCAG	0.458													102	213	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175096160	175096160	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175096160C>A	uc001gkl.1	+	13	3097	c.2984C>A	c.(2983-2985)CCC>CAC	p.P995H		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	995	Fibronectin type-III 9.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ACCTGGACGCCCCCCTCTGCT	0.502													73	133	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176564298	176564298	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564298C>G	uc001gkz.2	+	3	2722	c.1558C>G	c.(1558-1560)CGG>GGG	p.R520G	PAPPA2_uc001gky.1_Missense_Mutation_p.R520G|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	520	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CTGGCCCCTTCGGGGAGAGAA	0.537													38	72	---	---	---	---	PASS
RGS8	85397	broad.mit.edu	37	1	182615931	182615931	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182615931C>A	uc010pnw.1	-	7	740	c.482G>T	c.(481-483)AGG>ATG	p.R161M	RGS8_uc001gpn.1_Missense_Mutation_p.R161M|RGS8_uc001gpm.1_Missense_Mutation_p.R179M	NM_001102450	NP_001095920	P57771	RGS8_HUMAN	regulator of G-protein signalling 8 isoform 2	161	RGS.				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)	1						CCTCAGGAACCTGGGGTAAGA	0.527													123	261	---	---	---	---	PASS
CFHR4	10877	broad.mit.edu	37	1	196884211	196884211	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196884211G>T	uc001gto.2	+	5	811	c.742G>T	c.(742-744)GGT>TGT	p.G248C	CFHR4_uc009wyy.2_Missense_Mutation_p.G494C|CFHR4_uc001gtp.2_Missense_Mutation_p.G495C	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	248	Sushi 4.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						TGAACTTCAGGGTTCTAATTA	0.398													112	486	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197325966	197325966	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197325966A>G	uc001gtz.2	+	5	1129	c.994A>G	c.(994-996)ACA>GCA	p.T332A	CRB1_uc010poz.1_Missense_Mutation_p.T263A|CRB1_uc001gty.1_Missense_Mutation_p.T332A|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.T220A|CRB1_uc010ppb.1_Missense_Mutation_p.T332A|CRB1_uc010ppc.1_RNA	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	332	Extracellular (Potential).|EGF-like 8.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						TGCAGGATACACAGGTGCCCA	0.448													33	55	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200539041	200539041	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200539041G>A	uc010ppk.1	-	23	4098	c.3659C>T	c.(3658-3660)TCA>TTA	p.S1220L	KIF14_uc010ppj.1_Missense_Mutation_p.S729L	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	1220	Required for CIT-binding.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						AAAAATACCTGATGAATGTGA	0.244													52	96	---	---	---	---	PASS
CD46	4179	broad.mit.edu	37	1	207930887	207930887	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207930887G>C	uc001hgc.2	+	3	445	c.289G>C	c.(289-291)GAA>CAA	p.E97Q	CD46_uc001hgd.2_Missense_Mutation_p.E97Q|CD46_uc001hge.2_Missense_Mutation_p.E97Q|CD46_uc001hgf.2_Missense_Mutation_p.E97Q|CD46_uc001hgg.2_Missense_Mutation_p.E97Q|CD46_uc001hgh.2_Missense_Mutation_p.E97Q|CD46_uc001hgi.2_Missense_Mutation_p.E97Q|CD46_uc001hgj.2_Missense_Mutation_p.E97Q|CD46_uc001hgk.2_Missense_Mutation_p.E97Q|CD46_uc001hgl.2_Missense_Mutation_p.E97Q|CD46_uc001hgm.2_Missense_Mutation_p.E97Q|CD46_uc001hgn.2_Missense_Mutation_p.E97Q|CD46_uc001hgo.2_Missense_Mutation_p.E97Q|CD46_uc001hgp.2_Missense_Mutation_p.E97Q	NM_002389	NP_002380	P15529	MCP_HUMAN	CD46 antigen, complement regulatory protein	97	Extracellular (Potential).|Sushi 2.				complement activation, classical pathway|innate immune response|interspecies interaction between organisms|single fertilization	inner acrosomal membrane|integral to plasma membrane	protein binding|receptor activity			large_intestine(2)|lung(1)|central_nervous_system(1)	4						TCTTTCAGGAGAAACATGTCC	0.358													17	42	---	---	---	---	PASS
PLXNA2	5362	broad.mit.edu	37	1	208390971	208390971	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208390971G>T	uc001hgz.2	-	2	1055	c.297C>A	c.(295-297)ATC>ATA	p.I99I	PLXNA2_uc001hha.3_Silent_p.I153I	NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor	99	Extracellular (Potential).|Sema.				axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		AGGGCTGCACGATGAGGGGCG	0.557													49	101	---	---	---	---	PASS
TATDN3	128387	broad.mit.edu	37	1	212969882	212969882	+	Silent	SNP	A	C	C	rs141185416	by1000genomes	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212969882A>C	uc001hjo.2	+	3	217	c.123A>C	c.(121-123)GCA>GCC	p.A41A	TATDN3_uc010ptj.1_Silent_p.A41A|TATDN3_uc010ptk.1_Silent_p.A41A|TATDN3_uc001hjp.2_Silent_p.A41A|TATDN3_uc010ptl.1_Silent_p.A41A|TATDN3_uc010ptm.1_5'UTR	NM_001042552	NP_001036017	Q17R31	TATD3_HUMAN	TatD DNase domain containing 3 isoform 1	41						nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)		CCCTTGTGGCAGTTGCCGAAC	0.254													21	44	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215821936	215821936	+	Missense_Mutation	SNP	G	A	A	rs139065588		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215821936G>A	uc001hku.1	-	66	14903	c.14516C>T	c.(14515-14517)ACG>ATG	p.T4839M		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4839	Extracellular (Potential).|Fibronectin type-III 34.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGAGGCCAGCGTCCCGATTTG	0.572										HNSCC(13;0.011)			9	171	---	---	---	---	PASS
WDR26	80232	broad.mit.edu	37	1	224599262	224599262	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224599262T>A	uc001hop.3	-	7	950	c.584A>T	c.(583-585)CAG>CTG	p.Q195L	WDR26_uc001hoq.3_Missense_Mutation_p.Q179L|WDR26_uc010pvh.1_5'UTR	NM_025160	NP_079436	Q9H7D7	WDR26_HUMAN	WD repeat domain 26 isoform a	342						cytoplasm|nucleus					0				GBM - Glioblastoma multiforme(131;0.0104)		ACATGGGAACTGCCTCCTAAA	0.333													27	86	---	---	---	---	PASS
MTR	4548	broad.mit.edu	37	1	237052583	237052583	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237052583G>A	uc001hyi.3	+	28	3377	c.2954G>A	c.(2953-2955)CGG>CAG	p.R985Q	MTR_uc010pxw.1_Missense_Mutation_p.R578Q|MTR_uc010pxx.1_Missense_Mutation_p.R934Q|MTR_uc010pxy.1_Missense_Mutation_p.R839Q	NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine	985	AdoMet activation.				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TGGCAGCTCCGGGGCAAGTAC	0.478													65	118	---	---	---	---	PASS
CEP170	9859	broad.mit.edu	37	1	243328007	243328007	+	Silent	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243328007T>C	uc001hzs.2	-	13	3663	c.3255A>G	c.(3253-3255)TCA>TCG	p.S1085S	CEP170_uc001hzt.2_Silent_p.S987S|CEP170_uc001hzu.2_Silent_p.S987S|CEP170_uc001hzv.1_Silent_p.S463S	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	1085	Targeting to microtubules.					centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			ATTTACTAGATGAACCAGATA	0.483													25	71	---	---	---	---	PASS
KIF26B	55083	broad.mit.edu	37	1	245862230	245862230	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245862230C>A	uc001ibf.1	+	14	6509	c.6069C>A	c.(6067-6069)CAC>CAA	p.H2023Q		NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	2023					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TTCTGGAACACCGCCAGCAGA	0.572													4	52	---	---	---	---	PASS
OR2L3	391192	broad.mit.edu	37	1	248224064	248224064	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248224064C>T	uc001idx.1	+	1	81	c.81C>T	c.(79-81)TTC>TTT	p.F27F	OR2L13_uc001ids.2_Intron	NM_001004687	NP_001004687	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L,	27	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TTTTCCTCTTCATCCTCATTG	0.393													243	574	---	---	---	---	PASS
OR2M4	26245	broad.mit.edu	37	1	248402228	248402228	+	5'Flank	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248402228A>T	uc010pzh.1	+							NM_017504	NP_059974	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(2)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CAAATTATCCAGGATGGTGTG	0.423													50	103	---	---	---	---	PASS
OR2M7	391196	broad.mit.edu	37	1	248487634	248487634	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248487634G>T	uc010pzk.1	-	1	237	c.237C>A	c.(235-237)CCC>CCA	p.P79P		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	79	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGCCATCTTGGGTACAGTGG	0.498													202	408	---	---	---	---	PASS
OR14C36	127066	broad.mit.edu	37	1	248512380	248512380	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248512380G>T	uc010pzl.1	+	1	304	c.304G>T	c.(304-306)GTG>TTG	p.V102L		NM_001001918	NP_001001918	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C,	102	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3						GGTCTTCCTCGTGGTTTTTTT	0.483													46	102	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248524928	248524928	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248524928T>A	uc001ieh.1	+	1	46	c.46T>A	c.(46-48)TTC>ATC	p.F16I		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	16	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATGGTCGGATTTCATCCTGAT	0.493													35	95	---	---	---	---	PASS
OR2T5	401993	broad.mit.edu	37	1	248651977	248651977	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248651977C>A	uc001iem.1	+	1	88	c.88C>A	c.(88-90)CTA>ATA	p.L30I		NM_001004697	NP_001004697	Q6IEZ7	OR2T5_HUMAN	olfactory receptor, family 2, subfamily T,	30	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACATCCAGCTCTACTTAGTGT	0.498													42	282	---	---	---	---	PASS
PGBD2	267002	broad.mit.edu	37	1	249211933	249211933	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249211933C>T	uc001ifh.2	+	3	1297	c.1150C>T	c.(1150-1152)CTA>TTA	p.L384L	PGBD2_uc001ifg.2_Silent_p.L133L|PGBD2_uc009xhd.2_Silent_p.L381L	NM_170725	NP_733843	Q6P3X8	PGBD2_HUMAN	hypothetical protein LOC267002 isoform a	384										ovary(1)	1	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GCGATGTCCCCTAAAAGACCC	0.453													57	123	---	---	---	---	PASS
TPO	7173	broad.mit.edu	37	2	1491690	1491690	+	Silent	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1491690T>C	uc002qww.2	+	10	1786	c.1695T>C	c.(1693-1695)TTT>TTC	p.F565F	TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Intron|TPO_uc002qwr.2_Silent_p.F565F|TPO_uc002qwx.2_Intron|TPO_uc010yio.1_Silent_p.F392F|TPO_uc010yip.1_Silent_p.F565F|TPO_uc002qwy.1_Intron|TPO_uc002qwz.2_Intron	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	565	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	AAAGGCTCTTTGTGCTGTCCA	0.582													55	119	---	---	---	---	PASS
PREB	10113	broad.mit.edu	37	2	27355281	27355281	+	Intron	SNP	G	A	A	rs151121185	by1000genomes	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27355281G>A	uc002rix.1	-						PREB_uc002riy.1_Intron|PREB_uc002riz.1_Intron|PREB_uc002rja.1_Intron	NM_013388	NP_037520	Q9HCU5	PREB_HUMAN	prolactin regulatory element binding protein						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|nucleus	DNA binding|guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGGGGGCCGGATGAGGGGC	0.622													4	108	---	---	---	---	PASS
THADA	63892	broad.mit.edu	37	2	43547590	43547590	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43547590T>A	uc002rsw.3	-	31	4785	c.4433A>T	c.(4432-4434)CAG>CTG	p.Q1478L	THADA_uc010far.2_Missense_Mutation_p.Q673L|THADA_uc002rsx.3_Missense_Mutation_p.Q1478L|THADA_uc002rsy.3_RNA	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1478							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				CATACCTGGCTGGTTGTCCTT	0.418													61	159	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48896930	48896930	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48896930G>C	uc010yol.1	+	6	3066	c.3019G>C	c.(3019-3021)GAT>CAT	p.D1007H	STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.D1054H|GTF2A1L_uc002rws.1_Missense_Mutation_p.D350H|GTF2A1L_uc010yom.1_Missense_Mutation_p.D316H|GTF2A1L_uc002rwt.2_Missense_Mutation_p.D350H	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	1007					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AATTCAAGTAGATGGAAGCGG	0.358													48	280	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50733744	50733744	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50733744C>A	uc010fbq.2	-	13	3983	c.2506G>T	c.(2506-2508)GAG>TAG	p.E836*	NRXN1_uc002rxb.3_Nonsense_Mutation_p.E468*|NRXN1_uc002rxe.3_Nonsense_Mutation_p.E796*|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AAAAGAGTCTCGGGACCTTTG	0.378													15	59	---	---	---	---	PASS
CCDC85A	114800	broad.mit.edu	37	2	56599543	56599543	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56599543C>G	uc002rzn.2	+	4	1884	c.1382C>G	c.(1381-1383)TCC>TGC	p.S461C		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	461										breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GGCTGGGGGTCCAGAGCCCGG	0.517													5	16	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73651667	73651667	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73651667C>G	uc002sje.1	+	6	988	c.877C>G	c.(877-879)CGC>GGC	p.R293G	ALMS1_uc002sjf.1_Missense_Mutation_p.R250G	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	292					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						AGCAAGCAGTCGCTTTAGTGT	0.443													30	26	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73680984	73680984	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73680984C>G	uc002sje.1	+	10	7444	c.7333C>G	c.(7333-7335)CTA>GTA	p.L2445V	ALMS1_uc002sjf.1_Missense_Mutation_p.L2401V|ALMS1_uc002sjg.2_Missense_Mutation_p.L1831V|ALMS1_uc002sjh.1_Missense_Mutation_p.L1831V	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2443					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						TGATGTTCTTCTAAACTTCTT	0.428													60	67	---	---	---	---	PASS
DQX1	165545	broad.mit.edu	37	2	74747070	74747070	+	Silent	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74747070C>G	uc010yrw.1	-	9	1752	c.1587G>C	c.(1585-1587)CTG>CTC	p.L529L	DQX1_uc002smc.2_Silent_p.L90L	NM_133637	NP_598376	Q8TE96	DQX1_HUMAN	DEAQ box polypeptide 1 (RNA-dependent ATPase)	529						nucleus	ATP binding|helicase activity|nucleic acid binding			ovary(2)	2						ACACCTGGATCAGAGAACTGT	0.512													78	237	---	---	---	---	PASS
LRRTM1	347730	broad.mit.edu	37	2	80529775	80529775	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80529775C>A	uc002sok.1	-	2	1440	c.1170G>T	c.(1168-1170)TCG>TCT	p.S390S	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	390	Lumenal (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						GCGTGGTGGCCGAGCTGGCAG	0.721										HNSCC(69;0.2)			11	19	---	---	---	---	PASS
LRRTM1	347730	broad.mit.edu	37	2	80530814	80530814	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80530814C>A	uc002sok.1	-	2	401	c.131G>T	c.(130-132)CGG>CTG	p.R44L	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	44	LRRNT.|Lumenal (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						CCCCTCGCACCGGCACAGCTG	0.701										HNSCC(69;0.2)			16	12	---	---	---	---	PASS
EIF2AK3	9451	broad.mit.edu	37	2	88890573	88890573	+	Intron	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88890573T>C	uc002stc.3	-							NM_004836	NP_004827	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha						activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding			ovary(3)	3						AATTCCACCTTAAATTTACAA	0.333													47	94	---	---	---	---	PASS
ITPRIPL1	150771	broad.mit.edu	37	2	96992837	96992837	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96992837C>A	uc002svx.2	+	3	803	c.468C>A	c.(466-468)TAC>TAA	p.Y156*	ITPRIPL1_uc010yuk.1_Nonsense_Mutation_p.Y148*|ITPRIPL1_uc002svy.2_Nonsense_Mutation_p.Y164*|ITPRIPL1_uc010yul.1_Nonsense_Mutation_p.Y148*	NM_001008949	NP_001008949	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-triphosphate receptor interacting	156	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(2)|ovary(1)	3						TCACCTCTTACAACTGGCTTA	0.537													20	154	---	---	---	---	PASS
WDR33	55339	broad.mit.edu	37	2	128471191	128471191	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128471191C>A	uc002tpg.1	-	18	3457	c.3274G>T	c.(3274-3276)GAG>TAG	p.E1092*		NM_018383	NP_060853	Q9C0J8	WDR33_HUMAN	WD repeat domain 33 isoform 1	1092					postreplication repair|spermatogenesis	collagen|nucleus	protein binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CGTGGGTCCTCGGGATCCCGG	0.612													99	269	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	132021708	132021708	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132021708A>C	uc002tsn.2	+	15	2732	c.2680A>C	c.(2680-2682)ACC>CCC	p.T894P	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Missense_Mutation_p.T494P|POTEE_uc002tsl.2_Missense_Mutation_p.T476P|POTEE_uc010fmy.1_Missense_Mutation_p.T358P	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	894	Actin-like.						ATP binding				0						GAAGATCCTCACCGAGCGTGG	0.587													9	136	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136575532	136575532	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136575532G>T	uc002tuu.1	-	6	1097	c.1086C>A	c.(1084-1086)ATC>ATA	p.I362I		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	362	Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		ATGCTTCCCAGATTCTCTGAT	0.577													66	66	---	---	---	---	PASS
HNMT	3176	broad.mit.edu	37	2	138762736	138762736	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138762736T>A	uc002tvc.2	+	6	612	c.464T>A	c.(463-465)CTG>CAG	p.L155Q	HNMT_uc002tvf.2_Missense_Mutation_p.L155Q	NM_006895	NP_008826	P50135	HNMT_HUMAN	histamine N-methyltransferase isoform 1	155					respiratory gaseous exchange	cytoplasm	histamine N-methyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)	CCAGCTACCCTGAAATTCTTC	0.363													145	162	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141108424	141108424	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141108424C>A	uc002tvj.1	-	77	12806	c.11834G>T	c.(11833-11835)GGA>GTA	p.G3945V		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3945	Extracellular (Potential).|LDL-receptor class B 33.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTAGAAAATTCCGCCTGGATT	0.328										TSP Lung(27;0.18)			55	66	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141359212	141359212	+	Intron	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141359212G>T	uc002tvj.1	-							NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCCACATCTAGTGGGGGAAGA	0.393										TSP Lung(27;0.18)			13	27	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166900510	166900510	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166900510C>A	uc010zcz.1	-	11	1730	c.1712G>T	c.(1711-1713)AGA>ATA	p.R571I	SCN1A_uc002udo.3_Missense_Mutation_p.R440I|SCN1A_uc010fpk.2_Missense_Mutation_p.R440I	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	571						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	AAGGCTTGTTCTGCTATTTCG	0.438													60	57	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167334122	167334122	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167334122G>A	uc002udu.1	-	2	212	c.85C>T	c.(85-87)CAT>TAT	p.H29Y	SCN7A_uc002udv.1_Missense_Mutation_p.H29Y	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	29					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						TCTTCATTATGTGTTTTAGCA	0.368													6	8	---	---	---	---	PASS
MYO3B	140469	broad.mit.edu	37	2	171240299	171240299	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171240299G>T	uc002ufy.2	+	12	1408	c.1265G>T	c.(1264-1266)TGC>TTC	p.C422F	MYO3B_uc002ufv.2_Missense_Mutation_p.C409F|MYO3B_uc010fqb.1_Missense_Mutation_p.C409F|MYO3B_uc002ufz.2_Missense_Mutation_p.C422F|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002ugb.2_RNA	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2	422	Myosin head-like.				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						GCTTACCAGTGCATGGTTACT	0.458													46	64	---	---	---	---	PASS
HOXD9	3235	broad.mit.edu	37	2	176987711	176987711	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176987711C>G	uc010zex.1	+	1	299	c.215C>G	c.(214-216)TCG>TGG	p.S72W		NM_014213	NP_055028	P28356	HXD9_HUMAN	homeobox D9	72						nucleus	sequence-specific DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		GCCCCCAGATCGGCCGTGTTC	0.761													3	4	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179604277	179604277	+	Silent	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179604277G>C	uc010zfh.1	-	46	13394	c.13170C>G	c.(13168-13170)GTC>GTG	p.V4390V	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Silent_p.V4323V|TTN_uc010zfj.1_Silent_p.V4198V|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCGTCAGAGACAACAGCTG	0.423													5	135	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185803755	185803755	+	3'UTR	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185803755C>A	uc002uph.2	+	4						NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A							intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						CTCTTCTAGTCATCACCATAA	0.418													192	209	---	---	---	---	PASS
ITGAV	3685	broad.mit.edu	37	2	187523842	187523842	+	Silent	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187523842T>A	uc002upq.2	+	18	2073	c.1797T>A	c.(1795-1797)GCT>GCA	p.A599A	ITGAV_uc010frs.2_Silent_p.A563A|ITGAV_uc010zfv.1_Silent_p.A553A	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor	599	Extracellular (Potential).				angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		GAACAGCTGCTGATACAACAG	0.363													70	86	---	---	---	---	PASS
AGXT	189	broad.mit.edu	37	2	241813423	241813423	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241813423G>C	uc002waa.3	+	6	745	c.624G>C	c.(622-624)CAG>CAC	p.Q208H	AGXT_uc002wab.3_5'Flank	NM_000030	NP_000021	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	208					glyoxylate metabolic process|protein targeting to peroxisome	mitochondrial matrix|peroxisomal matrix	alanine-glyoxylate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|serine-pyruvate transaminase activity				0		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	CGGGCTCCCAGAAGGCCCTGA	0.637													48	132	---	---	---	---	PASS
ZCWPW2	152098	broad.mit.edu	37	3	28454871	28454871	+	Silent	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28454871A>T	uc003ceh.2	+	3	480	c.312A>T	c.(310-312)GTA>GTT	p.V104V	ZCWPW2_uc003cei.2_Silent_p.V104V	NM_001040432	NP_001035522	Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	104	PWWP.						zinc ion binding			ovary(2)	2						TGGTTTTGGTAAAATTACAGA	0.303													134	141	---	---	---	---	PASS
OXSR1	9943	broad.mit.edu	37	3	38294341	38294341	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38294341G>A	uc003chy.2	+	18	1885	c.1543G>A	c.(1543-1545)GAT>AAT	p.D515N	OXSR1_uc010hhb.2_Missense_Mutation_p.D449N	NM_005109	NP_005100	O95747	OXSR1_HUMAN	oxidative-stress responsive 1	515					intracellular protein kinase cascade|response to oxidative stress		ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TATTCCTGATGATGGTAAACT	0.423													47	41	---	---	---	---	PASS
NKTR	4820	broad.mit.edu	37	3	42679873	42679873	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42679873C>T	uc003clo.2	+	13	2824	c.2677C>T	c.(2677-2679)CGA>TGA	p.R893*	NKTR_uc003clm.1_Nonsense_Mutation_p.R640*|NKTR_uc003clp.2_Nonsense_Mutation_p.R640*|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Nonsense_Mutation_p.R783*|NKTR_uc003clr.1_Nonsense_Mutation_p.R640*|NKTR_uc003cls.2_Nonsense_Mutation_p.R593*	NM_005385	NP_005376	P30414	NKTR_HUMAN	natural killer-tumor recognition sequence	893					protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)		AAATTCAGAACGAGATGTCAC	0.398													11	64	---	---	---	---	PASS
ATXN7	6314	broad.mit.edu	37	3	63981173	63981173	+	Intron	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63981173T>A	uc003dlw.3	+						ATXN7_uc003dlv.2_Intron|ATXN7_uc010hnv.2_Intron|ATXN7_uc011bfn.1_Intron	NM_000333	NP_000324	O15265	ATX7_HUMAN	ataxin 7 isoform a						cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		TCCTCTAATTTTTTTCAGGAA	0.483													6	41	---	---	---	---	PASS
ADAMTS9	56999	broad.mit.edu	37	3	64619205	64619205	+	Silent	SNP	T	A	A	rs143406332		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64619205T>A	uc003dmg.2	-	14	2150	c.2118A>T	c.(2116-2118)ATA>ATT	p.I706I	ADAMTS9_uc011bfo.1_Silent_p.I678I|ADAMTS9_uc003dmh.1_Silent_p.I535I|ADAMTS9_uc003dmk.1_Silent_p.I706I	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1	706	Cys-rich.				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		GAGTTCCATCTATCACTCTGT	0.493													51	70	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74385767	74385767	+	Silent	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74385767C>G	uc003dpm.1	-	11	1487	c.1407G>C	c.(1405-1407)GTG>GTC	p.V469V		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	469	Ig-like C2-type 5.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CAGCTTTAGTCACATTGGCTA	0.353													21	132	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74411092	74411092	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74411092C>A	uc003dpm.1	-	10	1393	c.1313G>T	c.(1312-1314)AGG>ATG	p.R438M		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	438	Ig-like C2-type 5.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AGAGAGTGCCCTTGGGGAGGC	0.488													35	143	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77526583	77526583	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77526583G>T	uc003dpy.3	+	3	1050	c.407G>T	c.(406-408)CGA>CTA	p.R136L	ROBO2_uc003dpz.2_Missense_Mutation_p.R136L|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.R136L	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	136	Ig-like C2-type 2.|Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GATGACTTCCGACAAAACCCC	0.463													80	192	---	---	---	---	PASS
GPR128	84873	broad.mit.edu	37	3	100365481	100365481	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100365481G>A	uc003duc.2	+	10	1447	c.1179G>A	c.(1177-1179)TGG>TGA	p.W393*	GPR128_uc011bhc.1_Nonsense_Mutation_p.W94*	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	393	GPS.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						CGAAGGACTGGGACACATATG	0.388													20	194	---	---	---	---	PASS
CBLB	868	broad.mit.edu	37	3	105495385	105495385	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105495385G>A	uc003dwc.2	-	4	743	c.421C>T	c.(421-423)CGA>TGA	p.R141*	CBLB_uc011bhi.1_Nonsense_Mutation_p.R163*|CBLB_uc003dwd.1_Nonsense_Mutation_p.R141*|CBLB_uc003dwe.1_Nonsense_Mutation_p.R141*|CBLB_uc011bhj.1_Intron	NM_170662	NP_733762	Q13191	CBLB_HUMAN	Cas-Br-M (murine) ecotropic retroviral	141	Cbl-PTB.|4H.				cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding			lung(4)|ovary(3)|breast(1)|skin(1)	9						GTGAGATTTCGTCTGTAGGCA	0.348			Mis S		AML								47	206	---	---	---	---	PASS
TMPRSS7	344805	broad.mit.edu	37	3	111780770	111780770	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111780770C>T	uc010hqb.2	+	9	1239	c.1069C>T	c.(1069-1071)CCC>TCC	p.P357S	TMPRSS7_uc011bhr.1_Missense_Mutation_p.P212S	NM_001042575	NP_001036040	Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	483	LDL-receptor class A 1.|Extracellular (Potential).				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2						CATCAGTCAACGTAAGCCTAG	0.408													30	154	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113098309	113098309	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113098309C>A	uc003eae.1	-	17	2188	c.2142G>T	c.(2140-2142)ATG>ATT	p.M714I		NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2	714	Glu-rich.									central_nervous_system(1)	1						CATCTTCTCCCATCTCTGCTG	0.289													33	352	---	---	---	---	PASS
TMEM39A	55254	broad.mit.edu	37	3	119150879	119150879	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119150879T>A	uc003eck.1	-	9	1779	c.1416A>T	c.(1414-1416)TTA>TTT	p.L472F	TMEM39A_uc003ecl.1_Missense_Mutation_p.L320F	NM_018266	NP_060736	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	472						integral to membrane				ovary(1)|breast(1)	2				GBM - Glioblastoma multiforme(114;0.244)		ATGCCCTGCCTAATACTATTC	0.433													19	91	---	---	---	---	PASS
COX17	10063	broad.mit.edu	37	3	119396168	119396168	+	5'UTR	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119396168A>G	uc003ecz.1	-	1						NM_005694	NP_005685	Q14061	COX17_HUMAN	COX17 homolog, cytochrome c oxidase assembly						copper ion transport|generation of precursor metabolites and energy	mitochondrial intermembrane space	copper chaperone activity				0				GBM - Glioblastoma multiforme(114;0.227)		CTTTCGCGCCAAAAGCAGCTA	0.587													14	9	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124157894	124157894	+	Intron	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124157894C>T	uc003ehg.2	+						KALRN_uc010hrv.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron|KALRN_uc003ehh.1_Intron	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						GGTCAGAGCACATTGTCATGC	0.393													15	69	---	---	---	---	PASS
RAB7A	7879	broad.mit.edu	37	3	128526399	128526399	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128526399G>A	uc003eks.1	+	5	645	c.413G>A	c.(412-414)CGG>CAG	p.R138Q	RAB7A_uc010hsv.1_Missense_Mutation_p.R91Q|RAB7A_uc003ekt.2_Missense_Mutation_p.R114Q	NM_004637	NP_004628	P51149	RAB7A_HUMAN	RAB7, member RAS oncogene family	138					endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)		GCCACAAAGCGGGCACAGGCC	0.567													5	216	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130290127	130290127	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130290127T>C	uc010htl.2	+	6	2898	c.2867T>C	c.(2866-2868)CTG>CCG	p.L956P		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	956	VWFA 5.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						CCCGTGGAGCTGTTAGCCATG	0.507													4	132	---	---	---	---	PASS
CPNE4	131034	broad.mit.edu	37	3	131261561	131261561	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131261561G>T	uc003eok.2	-	15	1814	c.1379C>A	c.(1378-1380)GCC>GAC	p.A460D	CPNE4_uc011blq.1_Missense_Mutation_p.A478D|CPNE4_uc003eol.2_Missense_Mutation_p.A478D|CPNE4_uc003eom.2_Missense_Mutation_p.A460D|CPNE4_uc003eoj.2_Missense_Mutation_p.A11D	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV	460	VWFA.									upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						GAGGTGGGAGGCATGGACAAT	0.547													65	96	---	---	---	---	PASS
PRR23B	389151	broad.mit.edu	37	3	138739142	138739142	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138739142C>A	uc003esy.1	-	1	627	c.362G>T	c.(361-363)GGG>GTG	p.G121V		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	121										breast(1)	1						CACTTCCAGCCCGGCAGACGA	0.637													39	57	---	---	---	---	PASS
TRIM42	287015	broad.mit.edu	37	3	140401761	140401761	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140401761C>A	uc003eto.1	+	2	990	c.799C>A	c.(799-801)CAC>AAC	p.H267N		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	267	B box-type 1.					intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						CAAGGCCTTCCACTCGGATGT	0.607													37	55	---	---	---	---	PASS
TRIM42	287015	broad.mit.edu	37	3	140406742	140406742	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140406742G>A	uc003eto.1	+	3	1409	c.1218G>A	c.(1216-1218)CAG>CAA	p.Q406Q		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	406	Potential.					intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						TGTCCAGGCAGAAGGAAATTG	0.443													4	152	---	---	---	---	PASS
SR140	23350	broad.mit.edu	37	3	142775291	142775291	+	Nonstop_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142775291G>C	uc003evh.1	+	28	3188	c.3089G>C	c.(3088-3090)TGA>TCA	p.*1030S	SR140_uc003evi.1_Nonstop_Mutation_p.*621S|SR140_uc003evj.1_RNA|SR140_uc003evk.1_Nonstop_Mutation_p.*1029S	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein	1030					RNA processing	nucleus	nucleotide binding|RNA binding				0						AACAAACACTGACGTAAATTT	0.358													28	40	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128309	147128309	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128309C>A	uc003ewe.2	+	1	1129	c.410C>A	c.(409-411)GCC>GAC	p.A137D		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	137					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CACACGGACGCCGCGGGCCAC	0.721													12	16	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128310	147128310	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128310C>A	uc003ewe.2	+	1	1130	c.411C>A	c.(409-411)GCC>GCA	p.A137A		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	137					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						ACACGGACGCCGCGGGCCACC	0.721													12	17	---	---	---	---	PASS
TIPARP	25976	broad.mit.edu	37	3	156395782	156395782	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156395782C>G	uc003fav.2	+	2	544	c.296C>G	c.(295-297)TCA>TGA	p.S99*	LOC100287227_uc011boq.1_5'Flank|TIPARP_uc003faw.2_Nonsense_Mutation_p.S99*	NM_015508	NP_056323	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	99							NAD+ ADP-ribosyltransferase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|breast(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			ATCAATTCATCATGCCCACCA	0.438													61	295	---	---	---	---	PASS
MCF2L2	23101	broad.mit.edu	37	3	182948762	182948762	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182948762T>C	uc003fli.1	-	16	1996	c.1906A>G	c.(1906-1908)AAA>GAA	p.K636E	MCF2L2_uc003flj.1_Missense_Mutation_p.K636E|MCF2L2_uc011bqr.1_RNA	NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor	636	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TTAATCTCTTTTATGTAAATC	0.403													41	62	---	---	---	---	PASS
EHHADH	1962	broad.mit.edu	37	3	184953216	184953216	+	Silent	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184953216T>C	uc003fpf.2	-	3	240	c.213A>G	c.(211-213)ACA>ACG	p.T71T	EHHADH_uc011brs.1_5'UTR	NM_001966	NP_001957	Q08426	ECHP_HUMAN	enoyl-Coenzyme A, hydratase/3-hydroxyacyl	71	Enoyl-CoA hydratase / isomerase.					peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity			ovary(3)	3	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		NADH(DB00157)	TAAGGCCAAATGTCCTAGGAG	0.463													67	48	---	---	---	---	PASS
TRA2B	6434	broad.mit.edu	37	3	185638958	185638958	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185638958C>A	uc003fpv.2	-	6	932	c.656G>T	c.(655-657)CGG>CTG	p.R219L	TRA2B_uc003fpt.2_RNA|TRA2B_uc003fpu.2_RNA|TRA2B_uc010hym.2_Missense_Mutation_p.R119L|TRA2B_uc003fpw.2_Missense_Mutation_p.R219L	NM_004593	NP_004584	P62995	TRA2B_HUMAN	splicing factor, arginine/serine-rich 10	219	Linker.				nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|protein binding|RNA binding			ovary(2)	2						ATAGTAATCCCGACGGCGAGA	0.418													42	60	---	---	---	---	PASS
GP5	2814	broad.mit.edu	37	3	194118141	194118141	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194118141C>A	uc003ftv.1	-	2	902	c.871G>T	c.(871-873)GGC>TGC	p.G291C		NM_004488	NP_004479	P40197	GPV_HUMAN	glycoprotein V (platelet) precursor	291	Extracellular (Potential).|LRR 10.				blood coagulation, intrinsic pathway|cell adhesion|platelet activation	integral to plasma membrane				skin(2)|breast(1)	3	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		TCCTGCAGGCCCCCCATCTCC	0.652													7	67	---	---	---	---	PASS
ATP13A3	79572	broad.mit.edu	37	3	194151031	194151031	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194151031T>C	uc003fty.3	-	24	3040	c.2638A>G	c.(2638-2640)ATG>GTG	p.M880V	ATP13A3_uc003ftz.1_Missense_Mutation_p.M586V	NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3	880					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		TCACCACACATCCCAACAAAA	0.264													7	74	---	---	---	---	PASS
PACRGL	133015	broad.mit.edu	37	4	20715094	20715094	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20715094G>T	uc010iek.2	+	7	932	c.541G>T	c.(541-543)GCT>TCT	p.A181S	PACRGL_uc003gpu.2_RNA|PACRGL_uc010iei.1_Missense_Mutation_p.A229S|PACRGL_uc003gpz.2_Missense_Mutation_p.A181S|PACRGL_uc011bxm.1_Missense_Mutation_p.A128S|PACRGL_uc003gqa.2_Missense_Mutation_p.A83S|PACRGL_uc003gpx.3_RNA|PACRGL_uc003gpv.2_Missense_Mutation_p.A181S|PACRGL_uc003gpw.2_RNA|PACRGL_uc010iej.1_RNA|PACRGL_uc011bxn.1_Missense_Mutation_p.A83S|PACRGL_uc003gpy.2_Missense_Mutation_p.A128S	NM_145048	NP_659485	Q8N7B6	PACRL_HUMAN	PARK2 co-regulated-like isoform 1	181							binding				0						AGGATTGAATGCTCTAGTTCA	0.378													53	149	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48533293	48533293	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48533293A>C	uc003gyh.1	-	50	7388	c.6783T>G	c.(6781-6783)GAT>GAG	p.D2261E	FRYL_uc003gyg.1_Missense_Mutation_p.D957E|FRYL_uc003gyi.1_Missense_Mutation_p.D1149E|FRYL_uc003gyj.1_Missense_Mutation_p.D556E	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	2261					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						TCTTGGGGATATCACTGGGTA	0.408													4	204	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48537684	48537684	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48537684T>C	uc003gyh.1	-	48	7159	c.6554A>G	c.(6553-6555)TAT>TGT	p.Y2185C	FRYL_uc003gyg.1_Missense_Mutation_p.Y881C|FRYL_uc003gyi.1_Missense_Mutation_p.Y1073C|FRYL_uc003gyj.1_Missense_Mutation_p.Y480C	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	2185					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						CTCTGCAAGATAAGTCACAAG	0.254													20	52	---	---	---	---	PASS
CLOCK	9575	broad.mit.edu	37	4	56309861	56309861	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56309861G>A	uc003haz.1	-	21	2821	c.1895C>T	c.(1894-1896)TCA>TTA	p.S632L	CLOCK_uc003hba.1_Missense_Mutation_p.S632L|CLOCK_uc010igu.1_RNA	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	632					circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			TACCTGAGTTGATGTACTCTG	0.413													64	605	---	---	---	---	PASS
CLOCK	9575	broad.mit.edu	37	4	56310047	56310047	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56310047G>C	uc003haz.1	-	21	2635	c.1709C>G	c.(1708-1710)TCA>TGA	p.S570*	CLOCK_uc003hba.1_Nonsense_Mutation_p.S570*|CLOCK_uc010igu.1_RNA	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	570					circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			CCCAGGATTTGATTGTTGCAA	0.323													34	449	---	---	---	---	PASS
AASDH	132949	broad.mit.edu	37	4	57221562	57221562	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57221562C>A	uc003hbn.2	-	6	1042	c.889G>T	c.(889-891)GGA>TGA	p.G297*	AASDH_uc010ihb.2_5'UTR|AASDH_uc011caa.1_Nonsense_Mutation_p.G144*|AASDH_uc003hbo.2_Nonsense_Mutation_p.G197*|AASDH_uc011cab.1_5'UTR|AASDH_uc010ihc.2_Nonsense_Mutation_p.G297*|AASDH_uc003hbp.2_Nonsense_Mutation_p.G297*	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	297					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				AGCTGAGATCCAAATCTTCTA	0.353													50	62	---	---	---	---	PASS
UGT2A3	79799	broad.mit.edu	37	4	69811132	69811132	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69811132C>G	uc003hef.2	-	2	787	c.756G>C	c.(754-756)GAG>GAC	p.E252D	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	252	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						TTAGCCATATCTCAGCTTTTC	0.353													38	43	---	---	---	---	PASS
HELQ	113510	broad.mit.edu	37	4	84342850	84342850	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84342850A>C	uc003hom.2	-	15	2994	c.2815T>G	c.(2815-2817)TTT>GTT	p.F939V	HELQ_uc010ikb.2_Missense_Mutation_p.F872V|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308	939							ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						TAAAGAACAAAAGACAGATAT	0.338								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					31	46	---	---	---	---	PASS
FAM13A	10144	broad.mit.edu	37	4	89679910	89679910	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89679910C>G	uc003hse.1	-	14	1929	c.1721G>C	c.(1720-1722)TGG>TCG	p.W574S	FAM13A_uc003hsa.1_Missense_Mutation_p.W45S|FAM13A_uc003hsb.1_Missense_Mutation_p.W248S|FAM13A_uc003hsd.1_Missense_Mutation_p.W248S|FAM13A_uc003hsc.1_Missense_Mutation_p.W234S|FAM13A_uc011cdq.1_Missense_Mutation_p.W220S|FAM13A_uc003hsf.1_Missense_Mutation_p.W160S|FAM13A_uc003hsg.1_Missense_Mutation_p.W45S|FAM13A_uc010ikr.1_Missense_Mutation_p.W70S	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1	574					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						CCTACCTTCCCAGTTCTTTTC	0.448													47	60	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	113970900	113970900	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113970900G>T	uc003ibe.3	+	1	116	c.16G>T	c.(16-18)GCA>TCA	p.A6S	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Missense_Mutation_p.A6S|ANK2_uc003ibc.2_Intron|ANK2_uc011cgb.1_Missense_Mutation_p.A6S	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	6					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GAACGAAGATGCAGCTCAGAA	0.438													15	15	---	---	---	---	PASS
PRSS12	8492	broad.mit.edu	37	4	119220048	119220048	+	Silent	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119220048T>C	uc003ica.1	-	9	1724	c.1677A>G	c.(1675-1677)AAA>AAG	p.K559K		NM_003619	NP_003610	P56730	NETR_HUMAN	neurotrypsin precursor	559	SRCR 4.					membrane	scavenger receptor activity			skin(1)	1						GGATGGGTCCTTTTCCTTCTC	0.448													16	82	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126239263	126239263	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126239263C>T	uc003ifj.3	+	1	1697	c.1697C>T	c.(1696-1698)GCC>GTC	p.A566V		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	566	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GTGTCCTATGCCCAGCTTGTA	0.522											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	31	36	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134073308	134073308	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134073308C>A	uc003iha.2	+	1	2839	c.2013C>A	c.(2011-2013)ACC>ACA	p.T671T	PCDH10_uc003igz.2_Silent_p.T671T	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	671	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		TTTCCTCCACCGCCACCCTGG	0.607													11	13	---	---	---	---	PASS
INPP4B	8821	broad.mit.edu	37	4	143114228	143114228	+	Intron	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143114228G>T	uc003iix.3	-						INPP4B_uc003iiw.3_Intron|INPP4B_uc011chm.1_Intron|INPP4B_uc011chn.1_Intron|INPP4B_uc011cho.1_Intron|INPP4B_uc011chp.1_Intron	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					CTTTCCTCCTGTCTTTACTTA	0.413													50	52	---	---	---	---	PASS
OTUD4	54726	broad.mit.edu	37	4	146073750	146073750	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146073750T>A	uc003ika.3	-	11	854	c.716A>T	c.(715-717)GAT>GTT	p.D239V	OTUD4_uc003ijz.3_Missense_Mutation_p.D238V	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	303							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					TCCTTGAACATCTGCATTCAA	0.363													39	35	---	---	---	---	PASS
KIAA0922	23240	broad.mit.edu	37	4	154502648	154502648	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154502648C>T	uc003inm.3	+	9	880	c.828C>T	c.(826-828)AAC>AAT	p.N276N	KIAA0922_uc010ipp.2_Silent_p.N276N|KIAA0922_uc010ipq.2_Silent_p.N128N	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2	276	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				TTGAAGAAAACACACAACATT	0.323													41	70	---	---	---	---	PASS
GUCY1A3	2982	broad.mit.edu	37	4	156634713	156634713	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156634713G>T	uc003iov.2	+	8	2086	c.1550G>T	c.(1549-1551)TGT>TTT	p.C517F	GUCY1A3_uc010iqc.2_Missense_Mutation_p.C517F|GUCY1A3_uc003iow.2_Missense_Mutation_p.C517F|GUCY1A3_uc010iqd.2_Missense_Mutation_p.C516F|GUCY1A3_uc003iox.2_Missense_Mutation_p.C517F|GUCY1A3_uc003ioz.2_Missense_Mutation_p.C282F|GUCY1A3_uc003ioy.2_Missense_Mutation_p.C517F|GUCY1A3_uc010iqe.2_Missense_Mutation_p.C282F|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Missense_Mutation_p.C517F	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A	517	Guanylate cyclase.				blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GACCAGCAGTGTGGAGAGCTG	0.512													17	22	---	---	---	---	PASS
ACCN5	51802	broad.mit.edu	37	4	156773401	156773401	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156773401G>C	uc003ipe.1	-	4	700	c.653C>G	c.(652-654)GCA>GGA	p.A218G		NM_017419	NP_059115	Q9NY37	ACCN5_HUMAN	amiloride-sensitive cation channel 5,	218	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0464)|Kidney(143;0.058)|COAD - Colon adenocarcinoma(41;0.141)		TTTTCTCTTTGCTTGGAGAGT	0.363													66	99	---	---	---	---	PASS
ACCN5	51802	broad.mit.edu	37	4	156775429	156775429	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156775429A>G	uc003ipe.1	-	3	432	c.385T>C	c.(385-387)TTT>CTT	p.F129L		NM_017419	NP_059115	Q9NY37	ACCN5_HUMAN	amiloride-sensitive cation channel 5,	129	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0464)|Kidney(143;0.058)|COAD - Colon adenocarcinoma(41;0.141)		CATAAGAAAAAAATAACACCA	0.373													3	119	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158257833	158257833	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158257833G>T	uc003ipm.3	+	11	2237	c.1778G>T	c.(1777-1779)GGG>GTG	p.G593V	GRIA2_uc011cit.1_Missense_Mutation_p.G546V|GRIA2_uc003ipl.3_Missense_Mutation_p.G593V|GRIA2_uc003ipk.3_Missense_Mutation_p.G546V|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	593	Cytoplasmic (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	AATGAATTTGGGATTTTTAAT	0.418													70	132	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158257834	158257834	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158257834G>T	uc003ipm.3	+	11	2238	c.1779G>T	c.(1777-1779)GGG>GGT	p.G593G	GRIA2_uc011cit.1_Silent_p.G546G|GRIA2_uc003ipl.3_Silent_p.G593G|GRIA2_uc003ipk.3_Silent_p.G546G|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	593	Cytoplasmic (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	ATGAATTTGGGATTTTTAATA	0.418													70	134	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158281082	158281082	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158281082C>G	uc003ipm.3	+	13	2537	c.2078C>G	c.(2077-2079)ACC>AGC	p.T693S	GRIA2_uc011cit.1_Missense_Mutation_p.T646S|GRIA2_uc003ipl.3_Missense_Mutation_p.T693S|GRIA2_uc003ipk.3_Missense_Mutation_p.T646S|GRIA2_uc010iqh.1_RNA|GRIA2_uc011ciu.1_Missense_Mutation_p.T3S|GRIA2_uc011civ.1_RNA|GRIA2_uc011ciw.1_RNA|GRIA2_uc011cix.1_Missense_Mutation_p.T3S|GRIA2_uc011ciy.1_Missense_Mutation_p.T3S|GRIA2_uc011ciz.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	693	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	AAAATGTGGACCTACATGCGG	0.468													34	30	---	---	---	---	PASS
FAM149A	25854	broad.mit.edu	37	4	187093067	187093067	+	Splice_Site	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187093067G>C	uc003iyt.3	+	14	1955	c.1376_splice	c.e14-1	p.G459_splice	FAM149A_uc003iyu.3_Splice_Site_p.G459_splice|FAM149A_uc010isl.2_Splice_Site_p.G459_splice|FAM149A_uc011clb.1_Splice_Site_p.G458_splice	NM_015398	NP_056213	A5PLN7	F149A_HUMAN	hypothetical protein LOC25854											breast(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		GGTGTTTCCAGGTTCACAATA	0.378													25	50	---	---	---	---	PASS
TUBB4Q	56604	broad.mit.edu	37	4	190904507	190904507	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190904507T>A	uc011clg.1	-	4	476	c.473A>T	c.(472-474)TAC>TTC	p.Y158F		NM_020040	NP_064424	Q99867	TBB4Q_HUMAN	tubulin, beta polypeptide 4, member Q	159					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;4.1e-31)|Epithelial(3;1.44e-30)|OV - Ovarian serous cystadenocarcinoma(60;2.03e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00839)|READ - Rectum adenocarcinoma(43;0.155)		CCTGTCTGGGTACTCCTCCCA	0.572													44	67	---	---	---	---	PASS
AHRR	57491	broad.mit.edu	37	5	428049	428049	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:428049C>T	uc003jav.2	+	9	946	c.902C>T	c.(901-903)GCG>GTG	p.A301V	AHRR_uc003jaw.2_Missense_Mutation_p.A279V|AHRR_uc010isy.2_Missense_Mutation_p.A129V|AHRR_uc010isz.2_Missense_Mutation_p.A279V|AHRR_uc003jax.2_Missense_Mutation_p.A42V|AHRR_uc003jay.2_Missense_Mutation_p.A139V	NM_020731	NP_065782	A9YTQ3	AHRR_HUMAN	arylhydrocarbon receptor repressor	283					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			CCCTCCGCAGCGGAGATGAAA	0.617													20	64	---	---	---	---	PASS
TAS2R1	50834	broad.mit.edu	37	5	9629449	9629449	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9629449G>T	uc003jem.1	-	1	1015	c.696C>A	c.(694-696)TCC>TCA	p.S232S		NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN	taste receptor T2R1	232	Helical; Name=6; (Potential).				chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity			ovary(3)	3						GGATCAGGAAGGACAGGATAG	0.502													35	75	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13830718	13830718	+	Silent	SNP	G	T	T	rs143679999	byFrequency	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13830718G>T	uc003jfd.2	-	36	6091	c.6049C>A	c.(6049-6051)CGG>AGG	p.R2017R		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2017	AAA 1 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TTAAAAATCCGTCCAAGTCCT	0.398									Kartagener_syndrome				22	136	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	31799815	31799815	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31799815G>T	uc003jhl.2	+	2	848	c.460G>T	c.(460-462)GAT>TAT	p.D154Y	PDZD2_uc003jhm.2_Missense_Mutation_p.D154Y	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	154	PDZ 1.				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						GGTTGGAGTTGATGTCAGTGG	0.582													31	90	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33546195	33546195	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33546195C>A	uc003jia.1	-	22	4578	c.4415G>T	c.(4414-4416)TGC>TTC	p.C1472F	ADAMTS12_uc010iuq.1_Missense_Mutation_p.C1387F	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1472	TSP type-1 8.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CCAGTGACAGCACAGGTGCTC	0.413										HNSCC(64;0.19)			36	134	---	---	---	---	PASS
SPEF2	79925	broad.mit.edu	37	5	35740020	35740020	+	Splice_Site	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35740020G>T	uc003jjo.2	+	22	3175	c.3064_splice	c.e22-1	p.E1022_splice	SPEF2_uc003jjp.1_Splice_Site_p.E508_splice	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCATTTAACAGGAAATGCCTT	0.353													20	106	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40959662	40959662	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40959662C>G	uc003jmh.2	+	12	1715	c.1601C>G	c.(1600-1602)TCC>TGC	p.S534C	C7_uc011cpn.1_RNA	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	534	TSP type-1 2.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				GGTGGGAGATCCTGCGTTGGA	0.547													6	35	---	---	---	---	PASS
NNT	23530	broad.mit.edu	37	5	43677883	43677883	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43677883C>T	uc003joe.2	+	19	3106	c.2851C>T	c.(2851-2853)CTC>TTC	p.L951F	NNT_uc003jof.2_Missense_Mutation_p.L951F	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	951	Mitochondrial matrix.				tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	GGTAAAGATGCTCACTGAGCA	0.393													28	255	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45645413	45645413	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45645413T>G	uc003jok.2	-	2	748	c.723A>C	c.(721-723)AAA>AAC	p.K241N		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	241	Extracellular (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						AATCCATTCCTTTTTCTACAA	0.373													7	103	---	---	---	---	PASS
MAP1B	4131	broad.mit.edu	37	5	71493830	71493830	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71493830G>T	uc003kbw.3	+	5	4889	c.4648G>T	c.(4648-4650)GCC>TCC	p.A1550S	MAP1B_uc010iyw.1_Missense_Mutation_p.A1567S|MAP1B_uc010iyx.1_Missense_Mutation_p.A1424S|MAP1B_uc010iyy.1_Missense_Mutation_p.A1424S	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1550						microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GGAGGGTGTGGCCTCAGTGTC	0.512													61	50	---	---	---	---	PASS
POLK	51426	broad.mit.edu	37	5	74893590	74893590	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74893590A>G	uc003kdw.2	+	14	2600	c.2504A>G	c.(2503-2505)CAG>CGG	p.Q835R	POLK_uc003kdx.2_RNA|POLK_uc003kdy.2_RNA|POLK_uc010izq.2_Missense_Mutation_p.Q637R|POLK_uc003kec.2_Missense_Mutation_p.Q745R|POLK_uc010izr.2_RNA|POLK_uc010izs.2_RNA|POLK_uc003ked.2_Missense_Mutation_p.R369G|POLK_uc003kee.2_Missense_Mutation_p.R459G|POLK_uc003kef.2_Missense_Mutation_p.Q745R	NM_016218	NP_057302	Q9UBT6	POLK_HUMAN	DNA-directed DNA polymerase kappa	835					DNA replication|nucleotide-excision repair, DNA gap filling	nucleus	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding			ovary(2)|kidney(2)	4		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		AGTGGAGTACAGAAGGCTGTA	0.244								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					40	39	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79084821	79084821	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79084821G>T	uc003kgc.2	+	10	11655	c.11583G>T	c.(11581-11583)CAG>CAT	p.Q3861H		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3861	Fibronectin type-III 2.					perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AAGGACTCCAGCTGAAAGTTA	0.368													83	96	---	---	---	---	PASS
YTHDC2	64848	broad.mit.edu	37	5	112849645	112849645	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112849645G>A	uc003kqn.2	+	1	236	c.53G>A	c.(52-54)GGA>GAA	p.G18E	YTHDC2_uc010jce.1_Missense_Mutation_p.G18E|YTHDC2_uc010jcf.1_5'UTR	NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	18	Gly-rich.						ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		GGCGGTGGCGGAGGCGGCGGC	0.692													2	1	---	---	---	---	PASS
KCNN2	3781	broad.mit.edu	37	5	113831657	113831657	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113831657G>T	uc003kqo.2	+	8	1975	c.1518G>T	c.(1516-1518)AGG>AGT	p.R506S	KCNN2_uc003kqp.2_Missense_Mutation_p.R158S|KCNN2_uc010jcg.2_RNA|uc003kqr.1_Intron	NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	506						integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		TCGAGAAGAGGATTGTTACCC	0.428													109	121	---	---	---	---	PASS
FTMT	94033	broad.mit.edu	37	5	121187977	121187977	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121187977G>T	uc003kss.2	+	1	328	c.319G>T	c.(319-321)GCC>TCC	p.A107S		NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial precursor	107	Ferritin-like diiron.				cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity			ovary(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GGATGACGTGGCCTTGAACAA	0.587													33	34	---	---	---	---	PASS
SNX24	28966	broad.mit.edu	37	5	122272481	122272481	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122272481G>A	uc011cwo.1	+	2	282	c.113G>A	c.(112-114)AGA>AAA	p.R38K	SNX24_uc003ktf.2_Missense_Mutation_p.R38K|SNX24_uc010jcy.2_Missense_Mutation_p.R38K	NM_014035	NP_054754	Q9Y343	SNX24_HUMAN	SBBI31 protein	38	PX.	Phosphatidylinositol 3-phosphate (By similarity).			cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0		Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000654)|Epithelial(69;0.0016)|all cancers(49;0.0139)		GTTGAAAAGAGATACAGCGAA	0.299													39	48	---	---	---	---	PASS
PCDHGB2	56103	broad.mit.edu	37	5	140741839	140741839	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140741839C>T	uc003ljs.1	+	1	2137	c.2137C>T	c.(2137-2139)CTG>TTG	p.L713L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Silent_p.L713L|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	713	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCAATCTCCCTGCGCCTGCG	0.572													63	103	---	---	---	---	PASS
PCDHGB4	8641	broad.mit.edu	37	5	140769700	140769700	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140769700A>T	uc003lkc.1	+	1	2249	c.2249A>T	c.(2248-2250)TAC>TTC	p.Y750F	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.Y750F	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	750	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTATTCCTACAATCTATGT	0.483													199	242	---	---	---	---	PASS
PCDH1	5097	broad.mit.edu	37	5	141248635	141248635	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141248635C>T	uc003llq.2	-	2	519	c.402G>A	c.(400-402)CTG>CTA	p.L134L	PCDH1_uc003llp.2_Silent_p.L134L|PCDH1_uc011dbf.1_Silent_p.L112L	NM_002587	NP_002578	Q08174	PCDH1_HUMAN	protocadherin 1 isoform 1 precursor	134	Extracellular (Potential).|Cadherin 1.				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding			ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		CCTCAAACTCCAGGATGCAGG	0.547													47	58	---	---	---	---	PASS
LCP2	3937	broad.mit.edu	37	5	169679495	169679495	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169679495C>G	uc003man.1	-	19	1473	c.1266G>C	c.(1264-1266)TGG>TGC	p.W422C	C5orf58_uc003mal.2_RNA|LCP2_uc011des.1_Missense_Mutation_p.W217C|LCP2_uc011det.1_Missense_Mutation_p.W251C	NM_005565	NP_005556	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2	422	SH2.				immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		AAGAAACGTACCACTCTTCAT	0.294													7	12	---	---	---	---	PASS
STK10	6793	broad.mit.edu	37	5	171583797	171583797	+	Intron	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171583797A>G	uc003mbo.1	-							NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10								ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTTGGCCTGCAAAGAGGAGAT	0.537													58	60	---	---	---	---	PASS
CAGE1	285782	broad.mit.edu	37	6	7327090	7327090	+	3'UTR	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7327090T>C	uc003mxi.2	-	11					CAGE1_uc003mxh.2_RNA|CAGE1_uc003mxj.2_3'UTR	NM_205864	NP_995586	Q8TC20	CAGE1_HUMAN	cancer antigen 1												0	Ovarian(93;0.0418)					TTCAGGCTTGTTTAATCTAAA	0.318													27	101	---	---	---	---	PASS
SYCP2L	221711	broad.mit.edu	37	6	10894192	10894192	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10894192A>T	uc003mzo.2	+	3	467	c.171A>T	c.(169-171)AAA>AAT	p.K57N	SYCP2L_uc011dim.1_RNA	NM_001040274	NP_001035364	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	57						nucleus				ovary(1)|skin(1)	2	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			TTCCTCAAAAATATAATCGTC	0.308													25	81	---	---	---	---	PASS
LRRC16A	55604	broad.mit.edu	37	6	25450634	25450634	+	Silent	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25450634A>G	uc011djw.1	+	7	913	c.537A>G	c.(535-537)CAA>CAG	p.Q179Q	LRRC16A_uc010jpx.2_Silent_p.Q179Q|LRRC16A_uc010jpy.2_Silent_p.Q179Q|LRRC16A_uc003nez.1_Silent_p.Q18Q	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	179					actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						AAGAAGTACAATGGGTAAGAA	0.388													20	48	---	---	---	---	PASS
HIST1H4D	8360	broad.mit.edu	37	6	26189072	26189072	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26189072T>A	uc003ngu.2	-	1	233	c.233A>T	c.(232-234)AAA>ATA	p.K78I		NM_003539	NP_003530	P62805	H4_HUMAN	histone cluster 1, H4d	78					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding				0		all_hematologic(11;0.196)				TGTCTTGCGTTTGGCGTGTTC	0.522													46	94	---	---	---	---	PASS
HIST1H4K	8362	broad.mit.edu	37	6	27799020	27799020	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27799020G>A	uc003njr.2	-	1	286	c.286C>T	c.(286-288)CGC>TGC	p.R96C		NM_003541	NP_003532	P62805	H4_HUMAN	histone cluster 1, H4k	96					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding				0						TAGAGGGTGCGGCCCTGGCGC	0.587													3	83	---	---	---	---	PASS
OR2J2	26707	broad.mit.edu	37	6	29141629	29141629	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29141629T>C	uc011dlm.1	+	1	319	c.217T>C	c.(217-219)TGC>CGC	p.C73R		NM_030905	NP_112167	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J,	73	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCTGGATCTCTGCTACACCAC	0.478													78	300	---	---	---	---	PASS
C6orf15	29113	broad.mit.edu	37	6	31079319	31079319	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31079319C>T	uc003nsk.1	-	2	817	c.817G>A	c.(817-819)GGG>AGG	p.G273R		NM_014070	NP_054789	Q6UXA7	CF015_HUMAN	STG protein precursor	273	Gly-rich.										0						TTAATATTCCCCCAGCTGCCT	0.507													34	118	---	---	---	---	PASS
NOTCH4	4855	broad.mit.edu	37	6	32187380	32187380	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32187380A>G	uc003obb.2	-	8	1638	c.1499T>C	c.(1498-1500)CTC>CCC	p.L500P	NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA|NOTCH4_uc003obc.2_Missense_Mutation_p.L500P	NM_004557	NP_004548	Q99466	NOTC4_HUMAN	notch4 preproprotein	500	EGF-like 12; calcium-binding (Potential).|Extracellular (Potential).				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						TGGCGGGCAGAGGCAGTGGAA	0.592													14	25	---	---	---	---	PASS
HLA-DQA1	3117	broad.mit.edu	37	6	32609223	32609223	+	Silent	SNP	G	A	A	rs9272697		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32609223G>A	uc003obr.2	+	2	272	c.219G>A	c.(217-219)GAG>GAA	p.E73E	HLA-DQA1_uc003obs.2_RNA|HLA-DQA1_uc003obt.1_Silent_p.E73E|HLA-DQA1_uc003obu.2_5'Flank	NM_002122	NP_002113	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ	73	Alpha-1.|Extracellular (Potential).		V -> D.|V -> L (in allele DQA1*02:01, allele DQA1*03:01, allele DQA1*03:02 and allele DQA1*03:03).		antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0						GGTGGCCTGAGTTCAGCAAAT	0.502													40	74	---	---	---	---	PASS
TBC1D22B	55633	broad.mit.edu	37	6	37284591	37284591	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37284591G>A	uc003onn.2	+	11	1424	c.1278G>A	c.(1276-1278)CTG>CTA	p.L426L	TBC1D22B_uc010jwt.2_RNA|TBC1D22B_uc003ono.1_Silent_p.L84L|TBC1D22B_uc003onp.2_Silent_p.L84L	NM_017772	NP_060242	Q9NU19	TB22B_HUMAN	TBC1 domain family, member 22B	426	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0			OV - Ovarian serous cystadenocarcinoma(102;0.241)			CCATCCGCCTGTGGGACACAT	0.552													60	152	---	---	---	---	PASS
GLP1R	2740	broad.mit.edu	37	6	39033969	39033969	+	Intron	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39033969A>G	uc003ooj.3	+						GLP1R_uc003ooh.2_Intron|GLP1R_uc003ooi.2_Intron	NM_002062	NP_002053	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor precursor						activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled			lung(3)|breast(1)|pancreas(1)	5					Exenatide(DB01276)|Glucagon recombinant(DB00040)	CCCGTGTGCCACAGAGCTCCC	0.597													10	39	---	---	---	---	PASS
GLP1R	2740	broad.mit.edu	37	6	39047418	39047418	+	Silent	SNP	C	T	T	rs12212036	byFrequency	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39047418C>T	uc003ooj.3	+	11	1182	c.1122C>T	c.(1120-1122)CAC>CAT	p.H374H	GLP1R_uc003ooh.2_RNA|GLP1R_uc003ooi.2_RNA	NM_002062	NP_002053	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor precursor	374	Extracellular (Potential).				activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled			lung(3)|breast(1)|pancreas(1)	5					Exenatide(DB01276)|Glucagon recombinant(DB00040)	TGGACGAGCACGCCCGGGGGA	0.562													21	94	---	---	---	---	PASS
TREML4	285852	broad.mit.edu	37	6	41197820	41197820	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41197820G>A	uc003oqc.2	+	4	570	c.466G>A	c.(466-468)GGG>AGG	p.G156R	TREML4_uc003oqd.2_RNA	NM_198153	NP_937796	Q6UXN2	TRML4_HUMAN	triggering receptor expressed on myeloid	156						extracellular region				breast(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)					TTCTCCAGAGGGGACCTCTGG	0.537													57	144	---	---	---	---	PASS
ZNF318	24149	broad.mit.edu	37	6	43307502	43307502	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43307502C>T	uc003oux.2	-	10	4312	c.4234G>A	c.(4234-4236)GGG>AGG	p.G1412R	ZNF318_uc003ouw.2_Intron	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1412					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			ACCTCTTCCCCTCCAAATGCT	0.413													22	82	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51491894	51491894	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51491894G>T	uc003pah.1	-	66	11962	c.11686C>A	c.(11686-11688)CCT>ACT	p.P3896T		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3896	Cytoplasmic (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TGGGATTCAGGAATCTCTTCA	0.393													57	271	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51892634	51892634	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51892634G>T	uc003pah.1	-	31	3897	c.3621C>A	c.(3619-3621)TCC>TCA	p.S1207S	PKHD1_uc003pai.2_Silent_p.S1207S	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1207	Extracellular (Potential).|IPT/TIG 7.				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CACCCAGCAGGGACCCACAGC	0.428													17	70	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57472440	57472440	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57472440A>T	uc003pdx.2	+	13	1316	c.1229A>T	c.(1228-1230)CAG>CTG	p.Q410L		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	410					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GGGATAAGCCAGGTAGGTCAT	0.438													8	78	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75875302	75875302	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75875302C>G	uc003phs.2	-	14	3070	c.2904G>C	c.(2902-2904)GAG>GAC	p.E968D	COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	968	Fibronectin type-III 6.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TGTATTTGGTCTCTGGCTGCA	0.413													94	200	---	---	---	---	PASS
GABRR1	2569	broad.mit.edu	37	6	89890084	89890084	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89890084G>T	uc003pna.2	-	9	1528	c.1073C>A	c.(1072-1074)TCG>TAG	p.S358*	GABRR1_uc011dzv.1_Nonsense_Mutation_p.S335*	NM_002042	NP_002033	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 1	358	Helical; (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Picrotoxin(DB00466)	CTCCAGCACCGAGAGGAACAC	0.567													26	32	---	---	---	---	PASS
BACH2	60468	broad.mit.edu	37	6	90718357	90718357	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90718357C>G	uc011eab.1	-	6	1016	c.207G>C	c.(205-207)CAG>CAC	p.Q69H	BACH2_uc003pnw.2_Missense_Mutation_p.Q69H|BACH2_uc010kch.2_Missense_Mutation_p.Q69H	NM_021813	NP_068585	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper	69	BTB.					nucleus	protein dimerization activity|sequence-specific DNA binding			ovary(3)|pancreas(1)|lung(1)|skin(1)	6		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CATTTTTTGTCTGTCCAACCA	0.478													4	91	---	---	---	---	PASS
BVES	11149	broad.mit.edu	37	6	105573294	105573294	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105573294C>A	uc003pqw.2	-	4	668	c.511G>T	c.(511-513)GAC>TAC	p.D171Y	BVES_uc003pqx.2_Missense_Mutation_p.D171Y|BVES_uc003pqy.2_Missense_Mutation_p.D171Y	NM_147147	NP_671488	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance isoform 5	171	Cytoplasmic (Potential).				epithelial cell-cell adhesion|muscle organ development|positive regulation of locomotion|positive regulation of receptor recycling|regulation of Cdc42 GTPase activity|regulation of cell shape|regulation of Rac GTPase activity|substrate adhesion-dependent cell spreading|vesicle-mediated transport	integral to membrane|lateral plasma membrane|tight junction	structural molecule activity				0		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				CTCAGACGGTCATCAACTGAG	0.408													132	173	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117641146	117641146	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117641146C>A	uc003pxp.1	-	36	6024	c.5825G>T	c.(5824-5826)CGG>CTG	p.R1942L	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Missense_Mutation_p.R268L	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1942	Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CAGTTTTTCCCGAGGGAAGGC	0.463			T	GOPC|ROS1	glioblastoma|NSCLC								56	66	---	---	---	---	PASS
THEMIS	387357	broad.mit.edu	37	6	128134171	128134171	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128134171G>T	uc003qbi.2	-	5	1934	c.1615C>A	c.(1615-1617)CAA>AAA	p.Q539K	THEMIS_uc010kfa.2_Missense_Mutation_p.Q442K|THEMIS_uc011ebt.1_Missense_Mutation_p.Q539K|THEMIS_uc010kfb.2_Missense_Mutation_p.Q504K	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	539					negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						ATGTAATATTGCTCTTCAGTG	0.463													85	94	---	---	---	---	PASS
TAAR5	9038	broad.mit.edu	37	6	132910096	132910096	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132910096C>A	uc003qdk.2	-	1	782	c.730G>T	c.(730-732)GCC>TCC	p.A244S		NM_003967	NP_003958	O14804	TAAR5_HUMAN	trace amine associated receptor 5	244	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			skin(1)	1	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		TCATGCTTGGCAGCCCCAGCC	0.527													43	42	---	---	---	---	PASS
EYA4	2070	broad.mit.edu	37	6	133789710	133789710	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133789710C>G	uc003qec.3	+	11	1269	c.811C>G	c.(811-813)CCA>GCA	p.P271A	EYA4_uc011ecq.1_Missense_Mutation_p.P217A|EYA4_uc011ecr.1_Missense_Mutation_p.P217A|EYA4_uc003qed.3_Missense_Mutation_p.P271A|EYA4_uc003qee.3_Missense_Mutation_p.P248A|EYA4_uc011ecs.1_Missense_Mutation_p.P271A|uc003qef.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a	271					anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TCAGGATTATCCATCCTATAC	0.383													68	76	---	---	---	---	PASS
EYA4	2070	broad.mit.edu	37	6	133836552	133836552	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133836552C>G	uc003qec.3	+	17	2053	c.1595C>G	c.(1594-1596)TCT>TGT	p.S532C	EYA4_uc011ecq.1_Missense_Mutation_p.S478C|EYA4_uc011ecr.1_Missense_Mutation_p.S484C|EYA4_uc003qed.3_Missense_Mutation_p.S532C|EYA4_uc003qee.3_Missense_Mutation_p.S509C|EYA4_uc011ecs.1_Missense_Mutation_p.S538C|uc003qeg.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a	532					anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		GCACTTAAGTCTTTATCAATT	0.388													86	116	---	---	---	---	PASS
SLC2A12	154091	broad.mit.edu	37	6	134349793	134349793	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134349793C>A	uc003qem.1	-	2	1341	c.1170G>T	c.(1168-1170)GTG>GTT	p.V390V		NM_145176	NP_660159	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose	390	Extracellular (Potential).					endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity			ovary(1)	1	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		GTCCATAAATCACAGACTCAT	0.458													4	201	---	---	---	---	PASS
GPR126	57211	broad.mit.edu	37	6	142726876	142726876	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142726876C>T	uc010khc.2	+	15	2590	c.2179C>T	c.(2179-2181)CCA>TCA	p.P727S	GPR126_uc010khd.2_Missense_Mutation_p.P699S|GPR126_uc010khe.2_Missense_Mutation_p.P727S|GPR126_uc010khf.2_Missense_Mutation_p.P699S	NM_020455	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126 alpha 1	727	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		AATTTTGCCTCCAAACTTACT	0.368													22	21	---	---	---	---	PASS
PARK2	5071	broad.mit.edu	37	6	161781192	161781192	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161781192C>G	uc003qtx.3	-	11	1347	c.1213G>C	c.(1213-1215)GCA>CCA	p.A405P	PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Missense_Mutation_p.A214P|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Missense_Mutation_p.A377P|PARK2_uc003qtz.3_Missense_Mutation_p.A256P|PARK2_uc011egf.1_Missense_Mutation_p.A79P	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1	405					aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		TTGGAGGCTGCTTCCCAACGA	0.512													61	82	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21826351	21826351	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21826351G>A	uc003svc.2	+	60	9759	c.9728G>A	c.(9727-9729)CGA>CAA	p.R3243Q		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3243	Stalk (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CCCAAAGACCGAAGTTGGAAA	0.488									Kartagener_syndrome				10	259	---	---	---	---	PASS
CDCA7L	55536	broad.mit.edu	37	7	21946241	21946241	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21946241G>A	uc010kuk.2	-	5	818	c.698C>T	c.(697-699)GCG>GTG	p.A233V	CDCA7L_uc003sve.3_Missense_Mutation_p.A199V|CDCA7L_uc010kul.2_Missense_Mutation_p.A187V|CDCA7L_uc003svf.3_Missense_Mutation_p.A232V|CDCA7L_uc011jyk.1_Missense_Mutation_p.A233V	NM_018719	NP_061189	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like isoform 1	233	MYC-binding.				positive regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus					0						GTTCAATTCCGCCAATAACTG	0.403													6	151	---	---	---	---	PASS
OSBPL3	26031	broad.mit.edu	37	7	24854819	24854819	+	Silent	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24854819A>G	uc003sxf.2	-	19	2436	c.2031T>C	c.(2029-2031)TTT>TTC	p.F677F	OSBPL3_uc003sxd.2_RNA|OSBPL3_uc003sxe.2_RNA|OSBPL3_uc003sxg.2_Silent_p.F641F|OSBPL3_uc003sxh.2_Silent_p.F646F|OSBPL3_uc003sxi.2_Silent_p.F610F	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform	677					lipid transport		lipid binding|protein binding			skin(1)	1						AATGATCCCCAAAACTAAAAA	0.393													70	144	---	---	---	---	PASS
HOXA1	3198	broad.mit.edu	37	7	27134301	27134301	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27134301G>A	uc003sye.2	-	2	860	c.766C>T	c.(766-768)CGC>TGC	p.R256C	HOXA1_uc003syd.2_3'UTR|uc003syg.2_5'Flank	NM_005522	NP_005513	P49639	HXA1_HUMAN	homeobox A1 isoform a	256	Homeobox.					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3						CTGCGGGCGCGCGTCAGGTAC	0.562													77	140	---	---	---	---	PASS
CRHR2	1395	broad.mit.edu	37	7	30693149	30693149	+	Missense_Mutation	SNP	G	C	C	rs143693159	byFrequency	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30693149G>C	uc003tbn.2	-	12	1407	c.1163C>G	c.(1162-1164)GCC>GGC	p.A388G	CRHR2_uc010kvw.1_3'UTR|CRHR2_uc010kvx.1_Missense_Mutation_p.A387G|CRHR2_uc010kvy.1_Missense_Mutation_p.A224G|CRHR2_uc003tbo.2_Missense_Mutation_p.A374G|CRHR2_uc003tbp.2_Missense_Mutation_p.A415G	NM_001883	NP_001874	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	388	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(2)|ovary(1)|skin(1)	4						CATGGCCCGGGCCATGGGGAC	0.652													61	147	---	---	---	---	PASS
INMT	11185	broad.mit.edu	37	7	30791833	30791833	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30791833A>G	uc003tbs.1	+	1	83	c.67A>G	c.(67-69)ACT>GCT	p.T23A	FAM188B_uc010kwe.2_5'UTR|INMT_uc010kwc.1_Intron|INMT_uc010kwd.1_Missense_Mutation_p.T23A	NM_006774	NP_006765	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	23						cytoplasm	amine N-methyltransferase activity				0						CTACTTGGCTACTTACTACAG	0.557													41	121	---	---	---	---	PASS
GHRHR	2692	broad.mit.edu	37	7	31018795	31018795	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31018795G>C	uc003tbx.2	+	13	1256	c.1208G>C	c.(1207-1209)AGG>ACG	p.R403T	GHRHR_uc003tby.2_Missense_Mutation_p.R339T|GHRHR_uc003tbz.2_3'UTR	NM_000823	NP_000814	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	403	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation|positive regulation of growth hormone secretion|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of multicellular organism growth|response to estrogen stimulus|response to glucocorticoid stimulus	cell surface|integral to membrane|nuclear inner membrane|nuclear matrix|nuclear outer membrane|plasma membrane|stored secretory granule	growth factor binding|growth hormone-releasing hormone receptor activity|peptide hormone binding			ovary(2)|lung(1)|breast(1)|large_intestine(1)	5					Sermorelin(DB00010)	CCAGCCTGGAGGACCCGTGCT	0.592													32	95	---	---	---	---	PASS
CCDC129	223075	broad.mit.edu	37	7	31617870	31617870	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31617870G>T	uc003tcj.1	+	8	1985	c.992G>T	c.(991-993)GGT>GTT	p.G331V	CCDC129_uc011kad.1_Missense_Mutation_p.G341V|CCDC129_uc003tci.1_Intron|CCDC129_uc011kae.1_Missense_Mutation_p.G357V|CCDC129_uc003tck.1_Missense_Mutation_p.G239V	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	331											0						CCTCCTCATGGTCTTCTGAGC	0.507													10	104	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31890253	31890253	+	Splice_Site	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31890253A>T	uc003tcm.1	-	8	1320	c.851_splice	c.e8+1	p.R284_splice	PDE1C_uc003tcn.1_Splice_Site_p.R284_splice|PDE1C_uc003tco.1_Splice_Site_p.R344_splice|PDE1C_uc003tcr.2_Splice_Site_p.R284_splice|PDE1C_uc003tcs.2_Splice_Site_p.R284_splice	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			AAACACCCTCACCGAGTCTGA	0.453													66	147	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43351690	43351690	+	Intron	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43351690A>G	uc003tid.1	+						HECW1_uc011kbi.1_Intron|HECW1_uc003tie.1_Intron	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						CTCATTGGTGAGTAGAATGTG	0.398													26	68	---	---	---	---	PASS
POLD2	5425	broad.mit.edu	37	7	44155788	44155788	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44155788C>A	uc010kxz.2	-	9	1595	c.945G>T	c.(943-945)ATG>ATT	p.M315I	POLD2_uc003tke.3_Missense_Mutation_p.M315I|POLD2_uc010kya.2_Missense_Mutation_p.M315I|POLD2_uc003tkf.3_Missense_Mutation_p.M315I	NM_006230	NP_006221	P49005	DPOD2_HUMAN	DNA-directed DNA polymerase delta 2	315					base-excision repair|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	DNA binding|DNA-directed DNA polymerase activity|protein binding			ovary(2)	2						CCAGCGGGAACATGCAGGGGT	0.627													29	78	---	---	---	---	PASS
FIGNL1	63979	broad.mit.edu	37	7	50514621	50514621	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50514621C>T	uc003tpc.2	-	4	742	c.365G>A	c.(364-366)GGC>GAC	p.G122D	FIGNL1_uc003tpb.2_Missense_Mutation_p.G11D|FIGNL1_uc003tpd.2_Missense_Mutation_p.G122D|FIGNL1_uc003tpe.2_Missense_Mutation_p.G122D|FIGNL1_uc010kyy.2_Missense_Mutation_p.G122D	NM_001042762	NP_001036227	Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	122					ATP metabolic process|negative regulation of apoptosis|osteoblast differentiation|osteoblast proliferation|regulation of cell cycle	cytoplasm|nucleus	ATP binding|magnesium ion binding|nucleoside-triphosphatase activity			ovary(3)	3	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				GAATTTTTTGCCAGCTTGCAT	0.393													5	271	---	---	---	---	PASS
GRB10	2887	broad.mit.edu	37	7	50674067	50674067	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50674067C>T	uc003tpi.2	-	11	1270	c.1239G>A	c.(1237-1239)AGG>AGA	p.R413R	GRB10_uc003tph.3_Silent_p.R355R|GRB10_uc003tpj.2_Silent_p.R367R|GRB10_uc003tpk.2_Silent_p.R413R|GRB10_uc010kzb.2_Silent_p.R355R|GRB10_uc003tpl.2_Silent_p.R407R|GRB10_uc003tpm.2_Silent_p.R355R|GRB10_uc003tpn.2_Silent_p.R355R	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform	413					insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					GCAAGGCCTTCCTCTGCTGAG	0.552									Russell-Silver_syndrome				38	131	---	---	---	---	PASS
EGFR	1956	broad.mit.edu	37	7	55231501	55231501	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55231501C>T	uc003tqk.2	+	14	1953	c.1707C>T	c.(1705-1707)ATC>ATT	p.I569I	EGFR_uc003tqi.2_Silent_p.I569I|EGFR_uc003tqj.2_Silent_p.I569I|EGFR_uc010kzg.1_Silent_p.I524I|EGFR_uc011kco.1_Silent_p.I516I|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_Intron|EGFR_uc003tqn.2_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	569	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CCATGAACATCACCTGCACAG	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			42	111	---	---	---	---	PASS
CALN1	83698	broad.mit.edu	37	7	71571265	71571265	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71571265A>T	uc003twa.3	-	3	660	c.133T>A	c.(133-135)TTT>ATT	p.F45I	CALN1_uc003twb.3_Missense_Mutation_p.F87I|CALN1_uc003twc.3_Missense_Mutation_p.F45I	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	45	EF-hand 1.|Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				AGAACCCGAAAGGCCTCTCGG	0.537													16	45	---	---	---	---	PASS
TRIM50	135892	broad.mit.edu	37	7	72730556	72730556	+	Intron	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72730556G>T	uc010lbd.1	-						FKBP6_uc003twz.2_Intron|TRIM50_uc003txy.1_Intron|TRIM50_uc003txz.1_Intron	NM_178125	NP_835226	Q86XT4	TRI50_HUMAN	tripartite motif protein 50A							cytoplasm|intracellular membrane-bounded organelle	ligase activity|zinc ion binding			skin(1)	1						GACGGGTCAGGGCCTCACCTG	0.562													26	55	---	---	---	---	PASS
TRIM50	135892	broad.mit.edu	37	7	72730557	72730557	+	Intron	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72730557G>T	uc010lbd.1	-						FKBP6_uc003twz.2_Intron|TRIM50_uc003txy.1_Intron|TRIM50_uc003txz.1_Intron	NM_178125	NP_835226	Q86XT4	TRI50_HUMAN	tripartite motif protein 50A							cytoplasm|intracellular membrane-bounded organelle	ligase activity|zinc ion binding			skin(1)	1						ACGGGTCAGGGCCTCACCTGG	0.567													26	54	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87174182	87174182	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87174182C>G	uc003uiz.1	-	17	2439	c.2021G>C	c.(2020-2022)GGA>GCA	p.G674A	ABCB1_uc011khc.1_Missense_Mutation_p.G610A	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	674	Cytoplasmic (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	GGCTTGTGATCCACGGACACT	0.413													88	201	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87196138	87196138	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87196138C>T	uc003uiz.1	-	7	911	c.493G>A	c.(493-495)GTG>ATG	p.V165M	ABCB1_uc011khc.1_Intron	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	165	ABC transmembrane type-1 1.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	ACATCGTGCACATCAAACCAG	0.383													47	80	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88963284	88963284	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88963284C>G	uc011khi.1	+	4	1526	c.988C>G	c.(988-990)CAT>GAT	p.H330D		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	330						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			ATCTAACATTCATCTTTCAGA	0.338										HNSCC(36;0.09)			48	86	---	---	---	---	PASS
C7orf63	79846	broad.mit.edu	37	7	89901183	89901183	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89901183A>T	uc010lep.2	+	8	1022	c.771A>T	c.(769-771)TTA>TTT	p.L257F	C7orf63_uc003ukf.2_Intron|C7orf63_uc003ukg.2_5'UTR|C7orf63_uc011khj.1_Missense_Mutation_p.L239F	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1	257							binding			ovary(1)	1						GACAGCTTTTATTTCGTTCAT	0.368													13	47	---	---	---	---	PASS
CALCR	799	broad.mit.edu	37	7	93090230	93090230	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93090230T>A	uc003umv.1	-	9	914	c.653A>T	c.(652-654)CAC>CTC	p.H218L	CALCR_uc011kia.1_5'UTR|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.H184L|CALCR_uc003umw.2_Missense_Mutation_p.H184L	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	200	Helical; Name=2; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	CATGTTCTTGTGCAGGGTTAC	0.428													57	153	---	---	---	---	PASS
CASD1	64921	broad.mit.edu	37	7	94176441	94176441	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94176441A>T	uc003uni.3	+	13	1894	c.1667A>T	c.(1666-1668)AAA>ATA	p.K556I	CASD1_uc003unj.3_Missense_Mutation_p.K556I	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor	556	Helical; (Potential).					integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TTACTGTTGAAACTAGGCTTT	0.229													56	110	---	---	---	---	PASS
PEG10	23089	broad.mit.edu	37	7	94293676	94293676	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94293676C>A	uc011kie.1	+	2	1253	c.1036C>A	c.(1036-1038)CCA>ACA	p.P346T		NM_001040152	NP_001035242	Q86TG7	PEG10_HUMAN	paternally expressed 10 isoform RF1	270	Necessary for interaction with ALK1.				apoptosis|cell differentiation|negative regulation of transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			CCAGGTAGATCCAACCGAGCC	0.612													4	16	---	---	---	---	PASS
PON1	5444	broad.mit.edu	37	7	94931587	94931587	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94931587A>T	uc003uns.2	-	8	936	c.839T>A	c.(838-840)CTT>CAT	p.L280H	PON1_uc011kih.1_Missense_Mutation_p.L280H	NM_000446	NP_000437	P27169	PON1_HUMAN	paraoxonase 1 precursor	280					aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)	TCCAACCCAAAGGTCTCCTGT	0.378													30	123	---	---	---	---	PASS
PON1	5444	broad.mit.edu	37	7	94931588	94931588	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94931588G>T	uc003uns.2	-	8	935	c.838C>A	c.(838-840)CTT>ATT	p.L280I	PON1_uc011kih.1_Missense_Mutation_p.L280I	NM_000446	NP_000437	P27169	PON1_HUMAN	paraoxonase 1 precursor	280					aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)	CCAACCCAAAGGTCTCCTGTC	0.378													30	122	---	---	---	---	PASS
PTCD1	26024	broad.mit.edu	37	7	99022625	99022625	+	Silent	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99022625G>C	uc003uqh.2	-	6	1661	c.1530C>G	c.(1528-1530)CTC>CTG	p.L510L	PTCD1_uc011kiw.1_Silent_p.L559L	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	510										ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GCTCATCCAGGAGGGCCAGCA	0.617													56	110	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103230067	103230067	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103230067A>T	uc003vca.2	-	28	4281	c.4121T>A	c.(4120-4122)GTT>GAT	p.V1374D	RELN_uc010liz.2_Missense_Mutation_p.V1374D	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	1374					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCTTGGAATAACAATGGTGAT	0.313													100	273	---	---	---	---	PASS
RINT1	60561	broad.mit.edu	37	7	105207724	105207724	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105207724A>T	uc003vda.1	+	15	2576	c.2345A>T	c.(2344-2346)AAT>ATT	p.N782I	RINT1_uc010ljj.1_Missense_Mutation_p.N357I|EFCAB10_uc003vdb.2_Intron|EFCAB10_uc003vdc.3_3'UTR|uc003vdd.1_5'Flank	NM_021930	NP_068749	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	782	RINT1/TIP20.				cell cycle|G2/M transition DNA damage checkpoint|protein transport|vesicle-mediated transport	endoplasmic reticulum membrane	protein binding			ovary(3)|central_nervous_system(1)	4						ATTCTACTTAATTTGAGGACA	0.378													47	90	---	---	---	---	PASS
GPR22	2845	broad.mit.edu	37	7	107115495	107115495	+	Silent	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107115495T>A	uc003vef.2	+	3	2336	c.990T>A	c.(988-990)TCT>TCA	p.S330S	COG5_uc003vec.2_Intron|COG5_uc003ved.2_Intron|COG5_uc003vee.2_Intron	NM_005295	NP_005286	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	330	Helical; Name=6; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(2)	2						CACCAATTTCTGTTTTAAATA	0.353													63	134	---	---	---	---	PASS
SPAM1	6677	broad.mit.edu	37	7	123594310	123594310	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123594310A>G	uc003vld.2	+	4	1088	c.686A>G	c.(685-687)TAT>TGT	p.Y229C	SPAM1_uc003vle.2_Missense_Mutation_p.Y229C|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Missense_Mutation_p.Y229C|SPAM1_uc010lku.2_Missense_Mutation_p.Y229C	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	229					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	AACCATCACTATAAGAAACCC	0.388													103	184	---	---	---	---	PASS
MKLN1	4289	broad.mit.edu	37	7	131122659	131122659	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131122659G>C	uc011kpm.1	+	10	1140	c.1076G>C	c.(1075-1077)AGT>ACT	p.S359T	MKLN1_uc011kpl.1_Missense_Mutation_p.S336T|MKLN1_uc010lmh.2_Missense_Mutation_p.S359T|MKLN1_uc003vqs.2_Missense_Mutation_p.S152T	NM_013255	NP_037387	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing	359	Kelch 2.				signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)					TCTCTGAAAAGTGACTTCTAT	0.413													5	427	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131815234	131815234	+	3'UTR	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131815234G>A	uc003vra.3	-	32					PLXNA4_uc003vqz.3_3'UTR	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1						TGGAAGGACGGTTCTCAGCTG	0.532													11	131	---	---	---	---	PASS
KIAA1549	57670	broad.mit.edu	37	7	138529070	138529070	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138529070C>A	uc011kql.1	-	18	5493	c.5444G>T	c.(5443-5445)GGT>GTT	p.G1815V	KIAA1549_uc011kqi.1_Missense_Mutation_p.G599V|KIAA1549_uc003vuk.3_Missense_Mutation_p.G1765V|KIAA1549_uc011kqj.1_Missense_Mutation_p.G1815V|KIAA1549_uc011kqk.1_Missense_Mutation_p.G599V	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	1815						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						ACCTGTGGTACCCCCGACAGG	0.557			O	BRAF	pilocytic astrocytoma								7	42	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146536991	146536991	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146536991A>G	uc003weu.1	+	3	913	c.397A>G	c.(397-399)ATC>GTC	p.I133V		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	133	F5/8 type C.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			AGATGGGAATATCTGGGTAAG	0.403										HNSCC(39;0.1)			13	41	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147092866	147092866	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147092866T>C	uc003weu.1	+	10	2180	c.1664T>C	c.(1663-1665)ATA>ACA	p.I555T		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	555	EGF-like 1.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TGTGCGATCATAGACAGGTAA	0.413										HNSCC(39;0.1)			65	156	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	148964225	148964225	+	RNA	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148964225A>G	uc003wfr.3	+	4		c.748A>G								Homo sapiens cDNA FLJ36716 fis, clone UTERU2010651.																		TCACCCGGATAGAGAGGGGAG	0.532													22	37	---	---	---	---	PASS
GIMAP1	170575	broad.mit.edu	37	7	150418003	150418003	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150418003G>T	uc003whq.2	+	3	998	c.911G>T	c.(910-912)GGG>GTG	p.G304V	GIMAP1_uc003whp.2_Missense_Mutation_p.G312V	NM_130759	NP_570115	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	304	Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCGGAGGTCGGGCCTGACTGA	0.617													9	24	---	---	---	---	PASS
PIWIL2	55124	broad.mit.edu	37	8	22138668	22138668	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22138668G>A	uc003xbn.2	+	3	382	c.234G>A	c.(232-234)CTG>CTA	p.L78L	PIWIL2_uc011kzf.1_Silent_p.L78L|PIWIL2_uc010ltv.2_Silent_p.L78L	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2	78					DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		TCCGAGGCCTGGGCATTGAAA	0.423													66	72	---	---	---	---	PASS
EBF2	64641	broad.mit.edu	37	8	25897593	25897593	+	Nonsense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25897593T>A	uc003xes.1	-	5	450	c.433A>T	c.(433-435)AAG>TAG	p.K145*	PPP2R2A_uc003xek.2_Intron|EBF2_uc003xet.1_Nonsense_Mutation_p.K145*	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	145					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TCCGGATTCTTATTCTGTCCC	0.557													7	168	---	---	---	---	PASS
ADRA1A	148	broad.mit.edu	37	8	26722124	26722124	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26722124G>T	uc003xfh.1	-	1	799	c.363C>A	c.(361-363)TCC>TCA	p.S121S	ADRA1A_uc003xfc.1_Silent_p.S121S|ADRA1A_uc010lul.1_Silent_p.S121S|ADRA1A_uc003xfd.1_RNA|ADRA1A_uc003xfe.1_Silent_p.S121S|ADRA1A_uc010lum.1_Silent_p.S121S|ADRA1A_uc003xff.1_RNA|ADRA1A_uc003xfg.1_Silent_p.S121S	NM_000680	NP_000671	P35348	ADA1A_HUMAN	alpha-1A-adrenergic receptor isoform 1	121	Helical; Name=3; (By similarity).				activation of phospholipase C activity|aging|apoptosis|calcium ion transport into cytosol|cell-cell signaling|intracellular protein kinase cascade|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of synaptic transmission, GABAergic|positive regulation of action potential|positive regulation of cardiac muscle contraction|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase C signaling cascade|positive regulation of vasoconstriction|response to drug|response to hormone stimulus|response to stress|smooth muscle contraction	integral to plasma membrane	alpha1-adrenergic receptor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amphetamine(DB00182)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Carvedilol(DB01136)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Maprotiline(DB00934)|Mephentermine(DB01365)|Metaraminol(DB00610)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Midodrine(DB00211)|Nefazodone(DB01149)|Nicergoline(DB00699)|Nilutamide(DB00665)|Norepinephrine(DB00368)|Norgestrel(DB00506)|Oxymetazoline(DB00935)|Perphenazine(DB00850)|Phendimetrazine(DB01579)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Prazosin(DB00457)|Promazine(DB00420)|Promethazine(DB01069)|Propericiazine(DB01608)|Propiomazine(DB00777)|Pseudoephedrine(DB00852)|Risperidone(DB00734)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)|Thioridazine(DB00679)|Tolazoline(DB00797)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Ziprasidone(DB00246)	AGCGGTCGATGGAGATGATGC	0.627													24	45	---	---	---	---	PASS
ADRA1A	148	broad.mit.edu	37	8	26722125	26722125	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26722125G>T	uc003xfh.1	-	1	798	c.362C>A	c.(361-363)TCC>TAC	p.S121Y	ADRA1A_uc003xfc.1_Missense_Mutation_p.S121Y|ADRA1A_uc010lul.1_Missense_Mutation_p.S121Y|ADRA1A_uc003xfd.1_RNA|ADRA1A_uc003xfe.1_Missense_Mutation_p.S121Y|ADRA1A_uc010lum.1_Missense_Mutation_p.S121Y|ADRA1A_uc003xff.1_RNA|ADRA1A_uc003xfg.1_Missense_Mutation_p.S121Y	NM_000680	NP_000671	P35348	ADA1A_HUMAN	alpha-1A-adrenergic receptor isoform 1	121	Helical; Name=3; (By similarity).				activation of phospholipase C activity|aging|apoptosis|calcium ion transport into cytosol|cell-cell signaling|intracellular protein kinase cascade|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of synaptic transmission, GABAergic|positive regulation of action potential|positive regulation of cardiac muscle contraction|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase C signaling cascade|positive regulation of vasoconstriction|response to drug|response to hormone stimulus|response to stress|smooth muscle contraction	integral to plasma membrane	alpha1-adrenergic receptor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amphetamine(DB00182)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Carvedilol(DB01136)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Maprotiline(DB00934)|Mephentermine(DB01365)|Metaraminol(DB00610)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Midodrine(DB00211)|Nefazodone(DB01149)|Nicergoline(DB00699)|Nilutamide(DB00665)|Norepinephrine(DB00368)|Norgestrel(DB00506)|Oxymetazoline(DB00935)|Perphenazine(DB00850)|Phendimetrazine(DB01579)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Prazosin(DB00457)|Promazine(DB00420)|Promethazine(DB01069)|Propericiazine(DB01608)|Propiomazine(DB00777)|Pseudoephedrine(DB00852)|Risperidone(DB00734)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)|Thioridazine(DB00679)|Tolazoline(DB00797)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Ziprasidone(DB00246)	GCGGTCGATGGAGATGATGCA	0.627													24	46	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35583824	35583824	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35583824G>T	uc003xjr.1	+	10	1786	c.1458G>T	c.(1456-1458)CAG>CAT	p.Q486H	UNC5D_uc003xjs.1_Missense_Mutation_p.Q481H|UNC5D_uc003xju.1_Missense_Mutation_p.Q62H|UNC5D_uc003xjt.1_Missense_Mutation_p.Q244H	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	486	Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGAAAGTCCAGAGCTCGTTCA	0.502													34	331	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41519056	41519056	+	Intron	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41519056C>A	uc003xok.2	-						NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.Q1011H|ANK1_uc003xoi.2_Missense_Mutation_p.Q1857H|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron|ANK1_uc011lcl.1_Intron|ANK1_uc003xod.2_Missense_Mutation_p.Q132H|ANK1_uc003xoc.2_Intron|ANK1_uc003xof.2_Intron|MIR486_hsa-mir-486|MI0002470_5'Flank	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TCAGGTCCGGCTGTAGGCCAC	0.597													64	230	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52320773	52320773	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52320773C>T	uc003xqu.3	-	17	3512	c.3411G>A	c.(3409-3411)TCG>TCA	p.S1137S	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	1137					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TGGTGGCAGCCGAATCCACGG	0.522													23	169	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52321320	52321320	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52321320A>T	uc003xqu.3	-	17	2965	c.2864T>A	c.(2863-2865)CTG>CAG	p.L955Q	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	955					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GTCCCCGGCCAGGAAACAGGG	0.652													11	22	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52773687	52773687	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52773687C>A	uc003xqx.3	-	2	366	c.25G>T	c.(25-27)GAA>TAA	p.E9*	PCMTD1_uc003xqw.3_Nonsense_Mutation_p.E9*|PCMTD1_uc011ldn.1_Intron|PCMTD1_uc010lya.2_Intron|PCMTD1_uc011ldo.1_Nonsense_Mutation_p.E9*	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)	9						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TCATTATCTTCCCCAGCACTC	0.343													114	93	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55541589	55541589	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55541589G>T	uc003xsd.1	+	4	5295	c.5147G>T	c.(5146-5148)GGT>GTT	p.G1716V	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1716					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TATTGTAGGGGTGACATTGTA	0.403													65	278	---	---	---	---	PASS
TTPA	7274	broad.mit.edu	37	8	63976811	63976811	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63976811A>G	uc003xux.1	-	4	649	c.617T>C	c.(616-618)GTC>GCC	p.V206A		NM_000370	NP_000361	P49638	TTPA_HUMAN	tocopherol (alpha) transfer protein	206	CRAL-TRIO.				lipid metabolic process		transporter activity|vitamin E binding				0	Breast(64;0.0716)	all_cancers(86;0.145)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.123)			Vitamin E(DB00163)	CATGGAAAAGACAGCATGGAA	0.323													32	154	---	---	---	---	PASS
C8orf44	56260	broad.mit.edu	37	8	67590143	67590143	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67590143C>T	uc003xwo.1	+	2	353	c.200C>T	c.(199-201)CCA>CTA	p.P67L	SGK3_uc003xwp.2_Intron|C8orf44_uc003xwq.1_Missense_Mutation_p.P67L	NM_019607	NP_062553	Q96CB5	CH044_HUMAN	hypothetical protein LOC56260	67											0	Breast(64;0.186)		Epithelial(68;0.000959)|OV - Ovarian serous cystadenocarcinoma(28;0.00318)|all cancers(69;0.00363)|BRCA - Breast invasive adenocarcinoma(89;0.149)			ccagcctggccaacatggcga	0.010													6	18	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	68939533	68939533	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68939533T>C	uc003xxv.1	+	5	545	c.518T>C	c.(517-519)ATA>ACA	p.I173T	PREX2_uc003xxu.1_Missense_Mutation_p.I173T|PREX2_uc011lez.1_Missense_Mutation_p.I108T	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	173	DH.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						ATACAAAGAATATGCAAGTAC	0.338													45	141	---	---	---	---	PASS
CRISPLD1	83690	broad.mit.edu	37	8	75898239	75898239	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75898239G>A	uc003yan.2	+	2	392	c.17G>A	c.(16-18)CGG>CAG	p.R6Q		NM_031461	NP_113649	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain	6						extracellular region				ovary(1)|central_nervous_system(1)	2	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			TGTACCGCGCGGGAGTGGCTC	0.463													113	365	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77766792	77766792	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77766792G>A	uc003yav.2	+	10	7887	c.7500G>A	c.(7498-7500)CCG>CCA	p.P2500P	ZFHX4_uc003yau.1_Silent_p.P2545P|ZFHX4_uc003yaw.1_Silent_p.P2500P	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2500						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCAACAATCCGCTGATGACTG	0.537										HNSCC(33;0.089)			12	248	---	---	---	---	PASS
RUNX1T1	862	broad.mit.edu	37	8	92983053	92983053	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92983053G>A	uc003yfd.2	-	10	1456	c.1372C>T	c.(1372-1374)CGC>TGC	p.R458C	RUNX1T1_uc003yfc.1_Missense_Mutation_p.R431C|RUNX1T1_uc003yfe.1_Missense_Mutation_p.R421C|RUNX1T1_uc010mao.2_Missense_Mutation_p.R431C|RUNX1T1_uc011lgi.1_Missense_Mutation_p.R469C|RUNX1T1_uc010man.1_Missense_Mutation_p.R83C|RUNX1T1_uc003yfb.1_Missense_Mutation_p.R421C	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1	458					generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			ATCGCCTGGCGCTTCACCTCA	0.567													28	64	---	---	---	---	PASS
INTS8	55656	broad.mit.edu	37	8	95866063	95866063	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95866063A>G	uc003yhb.2	+	14	1798	c.1672A>G	c.(1672-1674)ATC>GTC	p.I558V	INTS8_uc003yha.1_Missense_Mutation_p.I558V|INTS8_uc011lgq.1_RNA|INTS8_uc011lgr.1_RNA|INTS8_uc010mba.2_Missense_Mutation_p.I385V	NM_017864	NP_060334	Q75QN2	INT8_HUMAN	integrator complex subunit 8	558					snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)					TAGTGGTGTTATCCTGGGAAT	0.333													163	221	---	---	---	---	PASS
POP1	10940	broad.mit.edu	37	8	99149122	99149122	+	Silent	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99149122G>C	uc003yij.3	+	9	1402	c.1302G>C	c.(1300-1302)CTG>CTC	p.L434L	POP1_uc011lgv.1_Silent_p.L434L|POP1_uc003yik.2_Silent_p.L434L	NM_001145860	NP_001139332	Q99575	POP1_HUMAN	processing of precursor 1	434					tRNA 5'-leader removal|tRNA catabolic process	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease MRP activity|ribonuclease P activity			ovary(1)|breast(1)	2	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			GATTCCGGCTGATTGGGCCAC	0.393													106	345	---	---	---	---	PASS
TM7SF4	81501	broad.mit.edu	37	8	105361702	105361702	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105361702G>T	uc003ylx.1	+	2	971	c.922G>T	c.(922-924)GTG>TTG	p.V308L		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	308	Helical; (Potential).				osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTGCATCTGGGTGCTGTTTGC	0.468													139	558	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110451216	110451216	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110451216T>A	uc003yne.2	+	32	3955	c.3851T>A	c.(3850-3852)ATT>AAT	p.I1284N		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1284	Extracellular (Potential).|IPT/TIG 6.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACCTGCCAGATTCTTCACTGG	0.378										HNSCC(38;0.096)			7	253	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113256797	113256797	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113256797T>A	uc003ynu.2	-	65	10387	c.10228A>T	c.(10228-10230)AGC>TGC	p.S3410C	CSMD3_uc003yns.2_Missense_Mutation_p.S2612C|CSMD3_uc003ynt.2_Missense_Mutation_p.S3370C|CSMD3_uc011lhx.1_Missense_Mutation_p.S3241C	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3410	Extracellular (Potential).|Sushi 28.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TGTTTACAGCTGTGGGCTATA	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			74	95	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113304920	113304920	+	Silent	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113304920A>T	uc003ynu.2	-	55	8793	c.8634T>A	c.(8632-8634)CCT>CCA	p.P2878P	CSMD3_uc003yns.2_Silent_p.P2080P|CSMD3_uc003ynt.2_Silent_p.P2838P|CSMD3_uc011lhx.1_Silent_p.P2709P	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2878	Extracellular (Potential).|Sushi 19.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TTGGACTACCAGGGTGACCAC	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			42	145	---	---	---	---	PASS
CPSF1	29894	broad.mit.edu	37	8	145634410	145634410	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145634410G>C	uc003zcj.2	-	2	208	c.133C>G	c.(133-135)CGC>GGC	p.R45G	CPSF1_uc011lle.1_Missense_Mutation_p.R45G|CPSF1_uc011llf.1_Missense_Mutation_p.R45G|CPSF1_uc003zcl.1_RNA	NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	45					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			TCGGCGTCGCGGTTGAGGCGG	0.458													147	90	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14801698	14801698	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14801698G>A	uc003zlm.2	-	20	4236	c.3646C>T	c.(3646-3648)CAG>TAG	p.Q1216*	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1216	CSPG 8.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		GCATGTTTCTGGTGAGGGTTG	0.453													26	70	---	---	---	---	PASS
CNTLN	54875	broad.mit.edu	37	9	17416046	17416046	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17416046G>T	uc003zmz.2	+	18	2996	c.2970G>T	c.(2968-2970)TTG>TTT	p.L990F	CNTLN_uc003zmy.2_Missense_Mutation_p.L991F|CNTLN_uc010mio.2_Missense_Mutation_p.L670F	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1	991	Potential.					centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		TTATATCCTTGCAACAACAAA	0.313													62	121	---	---	---	---	PASS
KLHL9	55958	broad.mit.edu	37	9	21333175	21333175	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21333175C>G	uc003zoy.2	-	1	2255	c.1684G>C	c.(1684-1686)GAA>CAA	p.E562Q	KLHL9_uc003zow.2_Intron|KLHL9_uc003zox.2_RNA	NM_018847	NP_061335	Q9P2J3	KLHL9_HUMAN	kelch-like 9	562	Kelch 6.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex|midbody				ovary(3)|skin(1)	4				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		TGGACAATTTCTACCATACAA	0.398													66	182	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84609748	84609748	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84609748C>G	uc004amn.2	+	4	4410	c.4363C>G	c.(4363-4365)CAG>GAG	p.Q1455E		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	1455						integral to membrane					0						AGAGCCTGTCCAGGGCTGTCC	0.532													28	38	---	---	---	---	PASS
ROR2	4920	broad.mit.edu	37	9	94493272	94493272	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94493272G>T	uc004arj.1	-	7	1302	c.1103C>A	c.(1102-1104)CCC>CAC	p.P368H	ROR2_uc004ari.1_Missense_Mutation_p.P228H|ROR2_uc004ark.2_Missense_Mutation_p.P368H	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	368	Extracellular (Potential).|Kringle.				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						CTGGCCTCCGGGGTTCCGGCA	0.602													34	40	---	---	---	---	PASS
NOL8	55035	broad.mit.edu	37	9	95077001	95077001	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95077001C>A	uc004arv.2	-	7	2243	c.1906G>T	c.(1906-1908)GCG>TCG	p.A636S	NOL8_uc010mqw.2_RNA|NOL8_uc004arw.2_Intron|NOL8_uc011ltw.1_Missense_Mutation_p.A568S	NM_017948	NP_060418	Q76FK4	NOL8_HUMAN	nucleolar protein 8	636					DNA replication|positive regulation of cell growth	nucleolus	nucleotide binding|protein binding|RNA binding			ovary(1)	1						GGGCCATTCGCCTTCTTTGCA	0.448													29	27	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107556765	107556765	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107556765C>A	uc004bcl.2	-	40	5722	c.5409G>T	c.(5407-5409)CTG>CTT	p.L1803L		NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	1803	Helical; (Potential).				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	ACACGGACTTCAGGATATCAT	0.443													43	23	---	---	---	---	PASS
LAMC3	10319	broad.mit.edu	37	9	133901778	133901778	+	Nonsense_Mutation	SNP	C	A	A	rs140728983	byFrequency	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133901778C>A	uc004caa.1	+	2	578	c.480C>A	c.(478-480)TAC>TAA	p.Y160*		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	160	Laminin N-terminal.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GGGAGCCCTACCAGTTCTACA	0.642													30	18	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137642705	137642705	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137642705C>A	uc004cfe.2	+	13	2021	c.1639C>A	c.(1639-1641)CAA>AAA	p.Q547K		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	547	Interrupted collagenous region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GTCCCAGGCGCAAGCCATTCT	0.632													4	17	---	---	---	---	PASS
TRAF2	7186	broad.mit.edu	37	9	139802569	139802569	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139802569G>T	uc010nbu.2	+	6	587	c.414G>T	c.(412-414)GCG>GCT	p.A138A	TRAF2_uc010nbv.1_Silent_p.A190A|TRAF2_uc004cjv.2_Silent_p.A138A|TRAF2_uc011mek.1_Silent_p.A127A|TRAF2_uc010nbw.2_Silent_p.A138A	NM_021138	NP_066961	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	138	TRAF-type 1.				activation of caspase activity|activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cellular protein complex assembly|induction of apoptosis by extracellular signals|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|protein autoubiquitination|protein homotrimerization|protein K63-linked ubiquitination|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane	CD40 receptor binding|enzyme binding|protein binding|signal transducer activity|sphingolipid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)|skin(1)	4	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		AATGTCCCGCGTGCAAAGGCC	0.642													29	45	---	---	---	---	PASS
GDI2	2665	broad.mit.edu	37	10	5836977	5836977	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5836977G>A	uc001iil.3	-	4	550	c.259C>T	c.(259-261)CTG>TTG	p.L87L	GDI2_uc001iim.3_Intron|GDI2_uc009xid.2_Silent_p.L91L	NM_001494	NP_001485	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2 isoform 1	87					protein transport|small GTPase mediated signal transduction	cell surface|cytosol|membrane	protein binding|Rab GDP-dissociation inhibitor activity				0						ATCTTAACCAGCTGACCTAGA	0.323													61	119	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7214075	7214075	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7214075T>C	uc009xio.1	-	19	2288	c.2197A>G	c.(2197-2199)AGT>GGT	p.S733G	SFMBT2_uc001ijn.1_Missense_Mutation_p.S733G|SFMBT2_uc010qay.1_Missense_Mutation_p.S568G	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	733					regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						GTCTCCTCACTGGCGGTGTCA	0.687													7	17	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21097437	21097437	+	Splice_Site	SNP	A	G	G	rs139887121		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21097437A>G	uc001iqi.2	-	26	3158	c.2761_splice	c.e26+1	p.A921_splice	NEBL_uc001iqj.2_Splice_Site|NEBL_uc001iqk.2_Intron	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform						regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						AATGTTTGATACCTCCTTCAT	0.398													42	125	---	---	---	---	PASS
KIAA1217	56243	broad.mit.edu	37	10	24813352	24813352	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24813352G>A	uc001iru.3	+	13	2960	c.2557G>A	c.(2557-2559)GAG>AAG	p.E853K	KIAA1217_uc001irs.2_Missense_Mutation_p.E773K|KIAA1217_uc001irt.3_Missense_Mutation_p.E818K|KIAA1217_uc010qcy.1_Missense_Mutation_p.E818K|KIAA1217_uc010qcz.1_Missense_Mutation_p.E818K|KIAA1217_uc001irv.1_Missense_Mutation_p.E668K|KIAA1217_uc010qda.1_Intron|KIAA1217_uc001irw.2_Missense_Mutation_p.E536K|KIAA1217_uc001irz.2_Missense_Mutation_p.E536K|KIAA1217_uc001irx.2_Missense_Mutation_p.E536K|KIAA1217_uc001iry.2_Missense_Mutation_p.E536K	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	853					embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						GAAGAGTCAGGAGGAGGCAGC	0.612													30	57	---	---	---	---	PASS
APBB1IP	54518	broad.mit.edu	37	10	26790050	26790050	+	Intron	SNP	T	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26790050T>G	uc001iss.2	+						APBB1IP_uc001isr.2_Missense_Mutation_p.W155G|APBB1IP_uc009xks.1_Intron	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,						blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						GGTAAGTATGTGGGACCAGAG	0.488													5	209	---	---	---	---	PASS
MKX	283078	broad.mit.edu	37	10	28032255	28032255	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28032255G>C	uc001ity.3	-	2	315	c.90C>G	c.(88-90)TAC>TAG	p.Y30*	MKX_uc001itx.3_Nonsense_Mutation_p.Y30*	NM_173576	NP_775847	Q8IYA7	MKX_HUMAN	mohawk homeobox	30					muscle organ development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GGACACCGCTGTAGGGCCGGC	0.682													3	12	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37520381	37520381	+	Intron	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37520381C>A	uc001iza.1	+							NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						CTTTTGCAATCTTCACAGAAC	0.328													28	77	---	---	---	---	PASS
RBP3	5949	broad.mit.edu	37	10	48388774	48388774	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48388774A>C	uc001jez.2	-	1	2218	c.2104T>G	c.(2104-2106)TTC>GTC	p.F702V		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	702	4 X approximate tandem repeats.|3.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	GGGCTGTGGAACACTAGCAAG	0.632													60	75	---	---	---	---	PASS
RBP3	5949	broad.mit.edu	37	10	48388777	48388777	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48388777C>T	uc001jez.2	-	1	2215	c.2101G>A	c.(2101-2103)GTG>ATG	p.V701M		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	701	4 X approximate tandem repeats.|3.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	CTGTGGAACACTAGCAAGCGG	0.637													58	81	---	---	---	---	PASS
BICC1	80114	broad.mit.edu	37	10	60549108	60549108	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60549108G>T	uc001jki.1	+	7	687	c.687G>T	c.(685-687)CAG>CAT	p.Q229H		NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1	229					multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						CCTCTATTCAGCATATATCAC	0.408													107	183	---	---	---	---	PASS
EGR2	1959	broad.mit.edu	37	10	64574132	64574132	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64574132G>A	uc010qim.1	-	3	420	c.266C>T	c.(265-267)ACC>ATC	p.T89I	EGR2_uc010qin.1_Missense_Mutation_p.T39I|EGR2_uc001jmi.2_Missense_Mutation_p.T89I|EGR2_uc010qio.1_Missense_Mutation_p.T102I|EGR2_uc009xph.2_Missense_Mutation_p.T89I	NM_001136177	NP_001129649	P11161	EGR2_HUMAN	early growth response 2 protein isoform a	89					fat cell differentiation|protein export from nucleus|transcription from RNA polymerase II promoter	cytoplasm|nucleus	chromatin binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding			ovary(2)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					GTAAGTGAAGGTCTGGTTTCT	0.502													7	113	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64975339	64975339	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64975339C>T	uc001jmn.2	-	6	1096	c.796G>A	c.(796-798)GCC>ACC	p.A266T	JMJD1C_uc001jml.2_Missense_Mutation_p.A47T|JMJD1C_uc001jmm.2_5'UTR|JMJD1C_uc010qiq.1_Missense_Mutation_p.A84T|JMJD1C_uc009xpi.2_Missense_Mutation_p.A84T|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc001jmp.1_5'UTR	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	266					blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					TTTTGATTGGCACGAGACCTG	0.368													81	133	---	---	---	---	PASS
TET1	80312	broad.mit.edu	37	10	70333646	70333646	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70333646A>C	uc001jok.3	+	2	2056	c.1551A>C	c.(1549-1551)TTA>TTC	p.L517F		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	517					DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						GGTTCCCATTAGCCCCTGAGA	0.473													26	86	---	---	---	---	PASS
TET1	80312	broad.mit.edu	37	10	70451518	70451518	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70451518G>T	uc001jok.3	+	12	6863	c.6358G>T	c.(6358-6360)GTG>TTG	p.V2120L		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	2120					DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						TGTTGTCACCGTGTCCCCTTA	0.443													101	210	---	---	---	---	PASS
CCAR1	55749	broad.mit.edu	37	10	70509373	70509373	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70509373G>T	uc001joo.2	+	10	1168	c.1049G>T	c.(1048-1050)CGA>CTA	p.R350L	CCAR1_uc001jol.1_RNA|CCAR1_uc001jom.1_Missense_Mutation_p.R155L|CCAR1_uc009xpx.1_Missense_Mutation_p.R324L|CCAR1_uc001jon.1_Missense_Mutation_p.R296L|CCAR1_uc010qiz.1_Missense_Mutation_p.R335L|CCAR1_uc010qja.1_Missense_Mutation_p.R335L|CCAR1_uc010qjb.1_RNA	NM_018237	NP_060707	Q8IX12	CCAR1_HUMAN	cell-cycle and apoptosis regulatory protein 1	350	Arg-rich.				apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7						GAGCGAGAGCGATCACCTCGG	0.463													64	145	---	---	---	---	PASS
KIAA1274	27143	broad.mit.edu	37	10	72291069	72291069	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72291069G>T	uc001jrd.3	+	5	773	c.492G>T	c.(490-492)CGG>CGT	p.R164R		NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274	164										ovary(2)|central_nervous_system(1)	3						TCTGTGTGCGGGAGGAACCTG	0.542													17	121	---	---	---	---	PASS
KIAA1274	27143	broad.mit.edu	37	10	72291070	72291070	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72291070G>T	uc001jrd.3	+	5	774	c.493G>T	c.(493-495)GAG>TAG	p.E165*		NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274	165										ovary(2)|central_nervous_system(1)	3						CTGTGTGCGGGAGGAACCTGT	0.547													17	122	---	---	---	---	PASS
NDST2	8509	broad.mit.edu	37	10	75562271	75562271	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75562271G>A	uc001jvk.2	-	15	3394	c.2590C>T	c.(2590-2592)CGG>TGG	p.R864W	NDST2_uc010qks.1_Missense_Mutation_p.R490W|NDST2_uc010qkt.1_Missense_Mutation_p.R741W|NDST2_uc001jvl.1_3'UTR	NM_003635	NP_003626	P52849	NDST2_HUMAN	heparan glucosaminyl	864	Lumenal (Potential).|Heparan sulfate N-sulfotransferase 2.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			ovary(1)	1	Prostate(51;0.0112)					TGTCCAAGCCGGCTCAGCAGC	0.522													3	28	---	---	---	---	PASS
MYST4	23522	broad.mit.edu	37	10	76737088	76737088	+	Missense_Mutation	SNP	A	G	G	rs145378526		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76737088A>G	uc001jwn.1	+	9	2501	c.2008A>G	c.(2008-2010)ATA>GTA	p.I670V	MYST4_uc001jwm.1_Missense_Mutation_p.I378V|MYST4_uc001jwo.1_Missense_Mutation_p.I378V|MYST4_uc001jwp.1_Missense_Mutation_p.I487V	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic	670	Negatively regulates HAT activity.				histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)					TGAAATAAAAATAAACATCAA	0.353			T	CREBBP	AML								3	113	---	---	---	---	PASS
LIPF	8513	broad.mit.edu	37	10	90438284	90438284	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90438284C>A	uc001kfg.1	+	10	1209	c.1043C>A	c.(1042-1044)CCC>CAC	p.P348H	LIPF_uc001kfh.1_Missense_Mutation_p.P325H|LIPF_uc010qmt.1_Missense_Mutation_p.P358H|LIPF_uc010qmu.1_Missense_Mutation_p.P315H	NM_004190	NP_004181	P07098	LIPG_HUMAN	lipase, gastric precursor	348					lipid catabolic process|triglyceride metabolic process	extracellular region	lipid binding|triglyceride lipase activity				0		Colorectal(252;0.0161)		Colorectal(12;3.91e-05)|COAD - Colon adenocarcinoma(12;5.43e-05)		TTGGCTGACCCCCAAGATGTT	0.458													97	122	---	---	---	---	PASS
IFIT1B	439996	broad.mit.edu	37	10	91143383	91143383	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91143383T>A	uc001kgh.2	+	2	393	c.313T>A	c.(313-315)TAT>AAT	p.Y105N	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron	NM_001010987	NP_001010987	Q5T764	IFT1B_HUMAN	interferon-induced protein with	105	TPR 2.						binding				0						TGCCTGGGTGTATTACCACAT	0.473													65	65	---	---	---	---	PASS
TLL2	7093	broad.mit.edu	37	10	98146803	98146803	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98146803C>A	uc001kml.1	-	14	1985	c.1759G>T	c.(1759-1761)GGG>TGG	p.G587W		NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor	587	EGF-like 1; calcium-binding (Potential).			EVDECSWPDHGGCEHRCV -> GKKKKKKKKKKKKKKKKK (in Ref. 5; AAH13871).	cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		TGCTCGCACCCGCCGTGATCT	0.592													43	35	---	---	---	---	PASS
EXOSC1	51013	broad.mit.edu	37	10	99202985	99202985	+	Intron	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99202985C>T	uc001kni.2	-						EXOSC1_uc009xvp.1_Intron|ZDHHC16_uc001knp.2_5'Flank|ZDHHC16_uc001knk.2_5'Flank|ZDHHC16_uc001knl.2_5'Flank|ZDHHC16_uc001knm.2_5'Flank|ZDHHC16_uc001knn.2_5'Flank|ZDHHC16_uc010qow.1_5'Flank|ZDHHC16_uc009xvq.2_5'Flank|ZDHHC16_uc001kno.2_5'Flank|ZDHHC16_uc001knj.2_5'Flank	NM_016046	NP_057130	Q9Y3B2	EXOS1_HUMAN	exosomal core protein CSL4						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA processing	cytosol|exosome (RNase complex)|nucleolus	protein binding|RNA binding				0		Renal(717;0.000147)|Colorectal(252;0.00205)|Ovarian(717;0.00965)		all cancers(201;8.29e-42)|Epithelial(162;5.7e-33)|BRCA - Breast invasive adenocarcinoma(275;0.000315)|Kidney(138;0.000832)|KIRC - Kidney renal clear cell carcinoma(50;0.00269)|STAD - Stomach adenocarcinoma(243;0.202)		GAGGTCAGGACCAACTTACCT	0.358													126	210	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	106907423	106907423	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106907423C>A	uc001kyi.1	+	9	1578	c.1351C>A	c.(1351-1353)CAA>AAA	p.Q451K		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	451	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TGCTGCGGTCCAAGAATGGAA	0.488													47	73	---	---	---	---	PASS
GRK5	2869	broad.mit.edu	37	10	121212678	121212678	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121212678A>G	uc001led.2	+	15	1797	c.1564A>G	c.(1564-1566)AAG>GAG	p.K522E	GRK5_uc009xzh.2_Missense_Mutation_p.K387E	NM_005308	NP_005299	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	522					G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		AGAATGCTTTAAGGAGCTGAA	0.552													123	153	---	---	---	---	PASS
C10orf90	118611	broad.mit.edu	37	10	128147613	128147613	+	Silent	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128147613C>G	uc001ljq.2	-	6	2014	c.1893G>C	c.(1891-1893)CTG>CTC	p.L631L	C10orf90_uc001ljp.2_Silent_p.L487L|C10orf90_uc010qum.1_Silent_p.L728L|C10orf90_uc001ljo.2_RNA	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611	631										ovary(1)|skin(1)	2		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		GCTTACCACTCAGAGGATGGG	0.582													29	36	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	134622126	134622126	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134622126C>A	uc010qux.1	-	50	7125	c.7125G>T	c.(7123-7125)AGG>AGT	p.R2375S		NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		ggggagggtccctggctgagg	0.299													13	16	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1265818	1265818	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1265818A>T	uc009ycr.1	+	48	9748	c.9622A>T	c.(9622-9624)ACT>TCT	p.T3208S	MUC5B_uc001ltb.2_Missense_Mutation_p.T2573S	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	2570	7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCCTCCTCCACTCCAGAGAC	0.657													5	45	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1267918	1267918	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1267918A>T	uc009ycr.1	+	49	11683	c.11557A>T	c.(11557-11559)ACT>TCT	p.T3853S	MUC5B_uc001ltb.2_Missense_Mutation_p.T3273S	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3270	7 X Cys-rich subdomain repeats.|Thr-rich.|17 X approximate tandem repeats, Ser/Thr- rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCCTCCTCTACTCCAGAGAC	0.647													5	4	---	---	---	---	PASS
OR52B4	143496	broad.mit.edu	37	11	4389334	4389334	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4389334G>T	uc010qye.1	-	1	192	c.192C>A	c.(190-192)TTC>TTA	p.F64L		NM_001005161	NP_001005161	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B,	64	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCATGCAGAGGAAGAGGTACA	0.532													19	27	---	---	---	---	PASS
OR51S1	119692	broad.mit.edu	37	11	4869506	4869506	+	Silent	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4869506G>C	uc010qyo.1	-	1	933	c.933C>G	c.(931-933)CTC>CTG	p.L311L		NM_001004758	NP_001004758	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S,	311	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCAACCTGTTGAGTATTCTCT	0.448													57	74	---	---	---	---	PASS
OR51L1	119682	broad.mit.edu	37	11	5020320	5020320	+	Silent	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5020320A>G	uc010qyu.1	+	1	108	c.108A>G	c.(106-108)GCA>GCG	p.A36A		NM_001004755	NP_001004755	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L,	36	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTGTCTTGCATATTTGGTAG	0.423													12	248	---	---	---	---	PASS
NLRP14	338323	broad.mit.edu	37	11	7079609	7079609	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7079609T>A	uc001mfb.1	+	8	2884	c.2561T>A	c.(2560-2562)GTC>GAC	p.V854D		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	854	LRR 5.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GCAGACAATGTCTTGGGTGAT	0.433													87	95	---	---	---	---	PASS
CAPRIN1	4076	broad.mit.edu	37	11	34113458	34113458	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34113458C>A	uc001mvh.1	+	15	1749	c.1560C>A	c.(1558-1560)TTC>TTA	p.F520L	CAPRIN1_uc001mvg.2_Missense_Mutation_p.F520L|CAPRIN1_uc001mvi.2_Missense_Mutation_p.F520L|CAPRIN1_uc001mvj.1_Missense_Mutation_p.F439L	NM_005898	NP_005889	Q14444	CAPR1_HUMAN	membrane component chromosome 11 surface marker	520					negative regulation of translation|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis	cytoplasmic mRNA processing body|cytosol|dendrite|integral to plasma membrane|stress granule	protein binding|RNA binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				AACAGGTGTTCAATATGAATG	0.363													21	119	---	---	---	---	PASS
AMBRA1	55626	broad.mit.edu	37	11	46439605	46439605	+	Intron	SNP	A	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46439605A>C	uc010rgu.1	-						AMBRA1_uc010rgt.1_Intron|AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		AAAACTCTCTAGGTAGAGGAA	0.473													33	59	---	---	---	---	PASS
OR4C11	219429	broad.mit.edu	37	11	55371231	55371231	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55371231T>A	uc010rii.1	-	1	619	c.619A>T	c.(619-621)AGT>TGT	p.S207C		NM_001004700	NP_001004700	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C,	207	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						ATGAAACTACTTGAGCAAATT	0.423													72	169	---	---	---	---	PASS
OR4C11	219429	broad.mit.edu	37	11	55371753	55371753	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55371753A>C	uc010rii.1	-	1	97	c.97T>G	c.(97-99)TAT>GAT	p.Y33D		NM_001004700	NP_001004700	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C,	33	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GTTCCCATATAGAAAATTAAG	0.388													78	183	---	---	---	---	PASS
MS4A8B	83661	broad.mit.edu	37	11	60482589	60482589	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60482589C>A	uc001npv.2	+	6	833	c.630C>A	c.(628-630)GTC>GTA	p.V210V		NM_031457	NP_113645	Q9BY19	M4A8B_HUMAN	membrane-spanning 4-domains, subfamily A, member	210	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						GCCAGTTGGTCTGCTGTCAAT	0.547													105	159	---	---	---	---	PASS
SLC22A12	116085	broad.mit.edu	37	11	64360948	64360948	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64360948C>A	uc001oam.1	+	3	1325	c.578C>A	c.(577-579)GCC>GAC	p.A193D	SLC22A12_uc009ypr.1_Missense_Mutation_p.A193D|SLC22A12_uc001oal.1_Intron|SLC22A12_uc009yps.1_Intron|SLC22A12_uc001oan.1_Intron|SLC22A12_uc009ypt.2_Missense_Mutation_p.A11D	NM_144585	NP_653186	Q96S37	S22AC_HUMAN	urate anion exchanger 1 isoform a	193	Helical; (Potential).				cellular homeostasis|response to drug|urate metabolic process	apical plasma membrane|brush border membrane|integral to membrane	PDZ domain binding|urate transmembrane transporter activity			ovary(1)	1						GCTGCCTTCGCCCCTGCCTTC	0.617													73	93	---	---	---	---	PASS
SF1	7536	broad.mit.edu	37	11	64535193	64535193	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64535193G>A	uc001obb.1	-	10	1569	c.1192C>T	c.(1192-1194)CCA>TCA	p.P398S	SF1_uc010rnm.1_Missense_Mutation_p.P90S|SF1_uc010rnn.1_Missense_Mutation_p.P372S|SF1_uc001oaz.1_Missense_Mutation_p.P523S|SF1_uc001oba.1_Missense_Mutation_p.P398S|SF1_uc001obc.1_Missense_Mutation_p.P398S|SF1_uc001obd.1_Missense_Mutation_p.P398S|SF1_uc001obe.1_Missense_Mutation_p.P283S|SF1_uc010rno.1_Missense_Mutation_p.P283S	NM_004630	NP_004621	Q15637	SF01_HUMAN	splicing factor 1 isoform 1	398	Pro-rich.				nuclear mRNA 3'-splice site recognition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ribosome|spliceosomal complex	protein binding|RNA binding|transcription corepressor activity|zinc ion binding			ovary(1)|breast(1)|skin(1)	3						AATGGGTGTGGGAAGCTGTGG	0.652											OREG0004010|OREG0021062	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=REGULATORY REGION|Gene=LOC476031|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	43	72	---	---	---	---	PASS
CDC42BPG	55561	broad.mit.edu	37	11	64597312	64597312	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64597312T>G	uc001obs.3	-	30	3598	c.3598A>C	c.(3598-3600)AAG>CAG	p.K1200Q		NM_017525	NP_059995	Q6DT37	MRCKG_HUMAN	CDC42 binding protein kinase gamma (DMPK-like)	1200	CNH.				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|centrosome	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(3)|central_nervous_system(1)	4						ACCTGGCGCTTGACGGCTACA	0.692													14	26	---	---	---	---	PASS
PPP2R5B	5526	broad.mit.edu	37	11	64695363	64695363	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64695363G>A	uc001oby.2	+	4	1071	c.486G>A	c.(484-486)TGG>TGA	p.W162*	PPP2R5B_uc001obz.2_Nonsense_Mutation_p.W162*	NM_006244	NP_006235	Q15173	2A5B_HUMAN	beta isoform of regulatory subunit B56, protein	162					signal transduction	cytoplasm|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(2)	2						AGCCTTCGTGGCCACACCTGC	0.547													4	128	---	---	---	---	PASS
TSGA10IP	254187	broad.mit.edu	37	11	65715500	65715500	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65715500G>C	uc001ogk.1	+	6	1064	c.1032G>C	c.(1030-1032)TTG>TTC	p.L344F	TSGA10IP_uc009yqw.1_Intron|TSGA10IP_uc009yqx.1_Intron	NM_152762	NP_689975	Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein	344											0						GGAAGACTTTGAGGGCTGCCT	0.617													6	10	---	---	---	---	PASS
SART1	9092	broad.mit.edu	37	11	65743954	65743954	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65743954A>T	uc001ogl.2	+	13	1753	c.1661A>T	c.(1660-1662)AAC>ATC	p.N554I		NM_005146	NP_005137	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T	554					cell cycle arrest|induction of apoptosis by intracellular signals|positive regulation of cytotoxic T cell differentiation|spliceosomal snRNP assembly	Cajal body|catalytic step 2 spliceosome|cytosol				ovary(1)	1						ATCGTGTTCAACGCCACGTCC	0.662													13	43	---	---	---	---	PASS
CCDC87	55231	broad.mit.edu	37	11	66359969	66359969	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66359969C>A	uc001oiq.3	-	1	586	c.518G>T	c.(517-519)CGT>CTT	p.R173L	CCS_uc001oir.2_5'Flank	NM_018219	NP_060689	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	173										ovary(1)|skin(1)	2						AAGCAGGCCACGGTAGACGTT	0.642													40	47	---	---	---	---	PASS
KCTD14	65987	broad.mit.edu	37	11	77728080	77728080	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77728080C>A	uc001oyw.3	-	2	352	c.327G>T	c.(325-327)GAG>GAT	p.E109D		NM_023930	NP_076419	Q9BQ13	KCD14_HUMAN	potassium channel tetramerisation domain	109	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1e-24)			AGAACTGAGCCTCACGGTACA	0.547													53	58	---	---	---	---	PASS
C11orf82	220042	broad.mit.edu	37	11	82643506	82643506	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82643506C>T	uc001ozt.2	+	6	1370	c.1126C>T	c.(1126-1128)CAT>TAT	p.H376Y	C11orf82_uc010rsr.1_Missense_Mutation_p.H75Y|C11orf82_uc010rss.1_Missense_Mutation_p.H75Y|C11orf82_uc009yvd.2_Intron	NM_145018	NP_659455	Q8IXT1	NOXIN_HUMAN	nitric oxide-inducible gene protein	376					apoptosis|cell cycle arrest	cytoplasm|nucleus				ovary(2)	2						TTTTCAGCATCATGGTATAGA	0.458													111	606	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85429842	85429842	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85429842C>A	uc010rth.1	-	9	1882	c.1606G>T	c.(1606-1608)GCT>TCT	p.A536S	SYTL2_uc010rtg.1_Missense_Mutation_p.A537S|SYTL2_uc010rti.1_Missense_Mutation_p.A536S|SYTL2_uc010rtj.1_Missense_Mutation_p.A488S|SYTL2_uc010rte.1_5'UTR|SYTL2_uc001pax.2_5'UTR|SYTL2_uc001paz.2_5'UTR|SYTL2_uc001pba.2_5'UTR|SYTL2_uc001pay.2_5'UTR|SYTL2_uc001paw.2_5'UTR|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Missense_Mutation_p.A858S|SYTL2_uc001pbb.2_Missense_Mutation_p.A858S|SYTL2_uc001pbc.2_Missense_Mutation_p.A858S|SYTL2_uc010rtf.1_Missense_Mutation_p.A394S	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	536					intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CCATCTTCAGCACTACGCACT	0.408													14	49	---	---	---	---	PASS
CTSC	1075	broad.mit.edu	37	11	88029410	88029410	+	Silent	SNP	T	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88029410T>G	uc001pck.3	-	6	881	c.780A>C	c.(778-780)TCA>TCC	p.S260S	CTSC_uc001pcl.3_Silent_p.S112S	NM_001814	NP_001805	P53634	CATC_HUMAN	cathepsin C isoform a preproprotein	260					immune response	lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TAGAAGCAAATGAGTAGCAGC	0.448													23	54	---	---	---	---	PASS
KBTBD3	143879	broad.mit.edu	37	11	105923716	105923716	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105923716T>G	uc001pja.2	-	4	2340	c.1700A>C	c.(1699-1701)GAT>GCT	p.D567A	KBTBD3_uc001pjb.2_Missense_Mutation_p.D567A|KBTBD3_uc009yxm.2_Missense_Mutation_p.D488A	NM_198439	NP_940841	Q8NAB2	KBTB3_HUMAN	BTB and kelch domain containing 3	563	Kelch 5.									ovary(1)|central_nervous_system(1)	2		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		CTGCACTTCATCTGTGATTTC	0.393													70	202	---	---	---	---	PASS
CWF19L2	143884	broad.mit.edu	37	11	107299577	107299577	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107299577C>G	uc010rvp.1	-	8	1411	c.1381G>C	c.(1381-1383)GAT>CAT	p.D461H	CWF19L2_uc001pjh.3_RNA|CWF19L2_uc009yxo.2_RNA	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control	461							catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		GGAGGGTCATCTCTCAAGACT	0.363													135	436	---	---	---	---	PASS
SLC35F2	54733	broad.mit.edu	37	11	107677463	107677463	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107677463G>A	uc001pjq.2	-	4	975	c.554C>T	c.(553-555)GCA>GTA	p.A185V	SLC35F2_uc010rvu.1_Missense_Mutation_p.A37V|SLC35F2_uc001pjs.2_Missense_Mutation_p.A185V	NM_017515	NP_059985	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2	185	Helical; (Potential).				transport	integral to membrane				central_nervous_system(1)	1		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		TTCCCTCCCTGCTAGTATGTC	0.423													55	116	---	---	---	---	PASS
NPAT	4863	broad.mit.edu	37	11	108032210	108032210	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108032210T>C	uc001pjz.3	-	17	3705	c.3603A>G	c.(3601-3603)ATA>ATG	p.I1201M	NPAT_uc010rvv.1_Missense_Mutation_p.I257M	NM_002519	NP_002510	Q14207	NPAT_HUMAN	nuclear protein,  ataxia-telangiectasia locus	1201					positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			ovary(2)	2		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		GCAGTGAAGCTATAGATTTCT	0.353													302	593	---	---	---	---	PASS
HSPA8	3312	broad.mit.edu	37	11	122928975	122928975	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122928975C>A	uc001pyo.2	-	8	1818	c.1740G>T	c.(1738-1740)TGG>TGT	p.W580C	HSPA8_uc009zbc.2_Missense_Mutation_p.W344C|HSPA8_uc001pyp.2_Intron|HSPA8_uc010rzu.1_Missense_Mutation_p.W503C	NM_006597	NP_006588	P11142	HSP7C_HUMAN	heat shock 70kDa protein 8 isoform 1	580					cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding			central_nervous_system(7)|lung(1)	8		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TCTTATCAAGCCAGTTGATAA	0.388													70	177	---	---	---	---	PASS
SPATA19	219938	broad.mit.edu	37	11	133715045	133715045	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133715045T>C	uc001qgv.1	-	2	170	c.119A>G	c.(118-120)CAT>CGT	p.H40R		NM_174927	NP_777587	Q7Z5L4	SPT19_HUMAN	spermatogenesis associated 19 precursor	40					cell differentiation|multicellular organismal development|spermatogenesis	mitochondrial outer membrane					0	all_hematologic(175;0.127)	all_cancers(12;5.59e-17)|all_epithelial(12;2.65e-12)|all_lung(97;0.00045)|Lung NSC(97;0.000861)|Breast(109;0.000873)|Medulloblastoma(222;0.0425)|Esophageal squamous(93;0.0844)|all_neural(223;0.117)		Epithelial(10;4.36e-10)|all cancers(11;7.1e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00286)|Lung(977;0.207)		CAACCAATGATGTAGTACAGA	0.438													29	198	---	---	---	---	PASS
GLB1L3	112937	broad.mit.edu	37	11	134151966	134151966	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134151966G>A	uc009zdf.2	+	5	839	c.479G>A	c.(478-480)CGT>CAT	p.R160H	GLB1L3_uc010scs.1_Missense_Mutation_p.R160H|GLB1L3_uc010sct.1_Missense_Mutation_p.R12H	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3	160					carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		GTGATTCTGCGTCCAGGCCGC	0.617													4	39	---	---	---	---	PASS
B3GAT1	27087	broad.mit.edu	37	11	134253718	134253718	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134253718G>A	uc001qhq.2	-	4	738	c.477C>T	c.(475-477)CGC>CGT	p.R159R	B3GAT1_uc001qhr.2_Silent_p.R159R|B3GAT1_uc010scv.1_Silent_p.R172R	NM_018644	NP_061114	Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	159	Lumenal (Potential).				carbohydrate metabolic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		TGCGTGGGTCGCGGGCGTCTC	0.716													6	14	---	---	---	---	PASS
CLEC12A	160364	broad.mit.edu	37	12	10134718	10134718	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10134718T>A	uc001qwr.3	+	5	819	c.631T>A	c.(631-633)TCC>ACC	p.S211T	CLEC12A_uc001qwq.2_Missense_Mutation_p.S221T|CLEC12A_uc001qws.3_Missense_Mutation_p.S178T|CLEC12A_uc001qwt.2_Missense_Mutation_p.S140T	NM_138337	NP_612210	Q5QGZ9	CL12A_HUMAN	myeloid inhibitory C-type lectin-like receptor	211	Extracellular (Potential).|C-type lectin.					integral to membrane|plasma membrane	receptor activity|sugar binding			skin(1)	1						TATAATCAACTCCTCTGCCTG	0.373													29	69	---	---	---	---	PASS
STYK1	55359	broad.mit.edu	37	12	10786680	10786680	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10786680C>A	uc001qys.2	-	4	617	c.96G>T	c.(94-96)TTG>TTT	p.L32F		NM_018423	NP_060893	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	32	Helical; (Potential).					integral to membrane|plasma membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						TAGTAACCAACAAAGTTGGGA	0.458										HNSCC(73;0.22)			83	261	---	---	---	---	PASS
KIAA1467	57613	broad.mit.edu	37	12	13214673	13214673	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13214673C>T	uc001rbi.2	+	4	720	c.697C>T	c.(697-699)CTC>TTC	p.L233F	KIAA1467_uc009zhx.1_RNA	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613	233						integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		ACACAAGATGCTCAGCGCATT	0.463													22	65	---	---	---	---	PASS
KIF21A	55605	broad.mit.edu	37	12	39726780	39726780	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39726780C>A	uc001rly.2	-	19	2763	c.2617G>T	c.(2617-2619)GCA>TCA	p.A873S	KIF21A_uc001rlv.2_5'Flank|KIF21A_uc001rlw.2_Missense_Mutation_p.A190S|KIF21A_uc001rlx.2_Missense_Mutation_p.A860S|KIF21A_uc001rlz.2_Missense_Mutation_p.A837S|KIF21A_uc010skl.1_Missense_Mutation_p.A860S	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	873					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				GTCCTTGATGCATCTGTTTCG	0.502													66	136	---	---	---	---	PASS
SENP1	29843	broad.mit.edu	37	12	48482584	48482584	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48482584C>T	uc001rqx.2	-	5	826	c.380G>A	c.(379-381)AGT>AAT	p.S127N	SENP1_uc001rqw.2_Missense_Mutation_p.S127N|SENP1_uc001rqy.2_Translation_Start_Site|SENP1_uc001rqz.2_Translation_Start_Site|SENP1_uc009zkx.2_Missense_Mutation_p.S127N	NM_014554	NP_055369	Q9P0U3	SENP1_HUMAN	sentrin/SUMO-specific protease 1	127	Ser-rich.				activation of caspase activity|induction of apoptosis by extracellular signals|protein desumoylation|proteolysis	cytoplasm|nucleus	endopeptidase activity|SUMO-specific protease activity			pancreas(2)|lung(1)	3		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				AAATACGAACCTTGAGGTCTT	0.388													6	18	---	---	---	---	PASS
WNT10B	7480	broad.mit.edu	37	12	49359979	49359979	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49359979G>C	uc001rss.2	-	5	1415	c.1069C>G	c.(1069-1071)CGG>GGG	p.R357G	WNT10B_uc001rst.2_3'UTR	NM_003394	NP_003385	O00744	WN10B_HUMAN	wingless-type MMTV integration site family,	357					axis specification|bone trabecula formation|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|chondrocyte differentiation|female gonad development|hemopoietic stem cell proliferation|midbrain-hindbrain boundary development|myoblast cell differentiation involved in skeletal muscle regeneration|negative regulation of epithelial cell proliferation|negative regulation of fat cell differentiation|neuron differentiation|positive regulation of anagen|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cell proliferation|positive regulation of epithelial cell differentiation|positive regulation of osteoblast differentiation|protein stabilization|regulation of skeletal muscle tissue development|skeletal muscle fiber development|smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			skin(4)|lung(3)	7						CGTGTCTGCCGGAGCACGTTG	0.607													8	20	---	---	---	---	PASS
NR4A1	3164	broad.mit.edu	37	12	52449821	52449821	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52449821T>A	uc001rzs.2	+	4	1198	c.884T>A	c.(883-885)GTG>GAG	p.V295E	NR4A1_uc010sno.1_Missense_Mutation_p.V308E|NR4A1_uc001rzt.2_Missense_Mutation_p.V295E|NR4A1_uc009zmc.2_5'Flank	NM_002135	NP_002126	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	295	Nuclear receptor.				nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0967)		CAGCGCACAGTGCAGAAAAAC	0.612													13	72	---	---	---	---	PASS
ITGA7	3679	broad.mit.edu	37	12	56086982	56086982	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56086982G>A	uc001shh.2	-	20	2887	c.2667C>T	c.(2665-2667)GGC>GGT	p.G889G	ITGA7_uc001shg.2_Silent_p.G885G|ITGA7_uc010sps.1_Silent_p.G792G|ITGA7_uc009znw.2_Silent_p.G132G|ITGA7_uc009znx.2_Silent_p.G766G	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	929	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity	p.G885G(1)		ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						GCCCCTGCCCGCCCTCCAGCT	0.602													18	105	---	---	---	---	PASS
PPM1H	57460	broad.mit.edu	37	12	63087785	63087785	+	Intron	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63087785G>T	uc001srk.3	-							NM_020700	NP_065751	Q9ULR3	PPM1H_HUMAN	protein phosphatase 1H (PP2C domain containing)								phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		ATGCCCTGTAGGGGATAAACA	0.473													7	24	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	72969157	72969157	+	Missense_Mutation	SNP	C	T	T	rs138433001		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72969157C>T	uc001sxa.2	+	11	2149	c.2119C>T	c.(2119-2121)CGG>TGG	p.R707W		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	707	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						TCAATTAATCCGGAATCATGA	0.343													14	161	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78515767	78515767	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78515767C>A	uc001syp.2	+	16	3970	c.3797C>A	c.(3796-3798)ACT>AAT	p.T1266N	NAV3_uc001syo.2_Missense_Mutation_p.T1266N|NAV3_uc010sub.1_Missense_Mutation_p.T766N|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1266	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GCACCTAATACTGAGGGTGTG	0.498										HNSCC(70;0.22)			38	47	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78534061	78534061	+	Splice_Site	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78534061G>T	uc001syp.2	+	20	4804	c.4631_splice	c.e20-1	p.V1544_splice	NAV3_uc001syo.2_Splice_Site_p.V1544_splice|NAV3_uc010sub.1_Splice_Site_p.V1030_splice|NAV3_uc009zsf.2_Splice_Site_p.V375_splice	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GTTTTCTCCAGTTCATGGCTC	0.373										HNSCC(70;0.22)			71	99	---	---	---	---	PASS
ATP2B1	490	broad.mit.edu	37	12	90004201	90004201	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90004201T>C	uc001tbh.2	-	13	2513	c.2332A>G	c.(2332-2334)AAA>GAA	p.K778E	ATP2B1_uc001tbg.2_Missense_Mutation_p.K778E|ATP2B1_uc001tbf.2_Missense_Mutation_p.K448E	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b	778	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						TACTTACCTTTAACCAGTGTA	0.333													115	122	---	---	---	---	PASS
POLR3B	55703	broad.mit.edu	37	12	106772055	106772055	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106772055C>A	uc001tlp.2	+	8	729	c.507C>A	c.(505-507)TTC>TTA	p.F169L	POLR3B_uc001tlq.2_Missense_Mutation_p.F111L	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1	169					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						GTGGCTACTTCATTGTTAAAG	0.398													54	70	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117726032	117726032	+	Intron	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117726032A>G	uc001twm.1	-							NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal						multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	TTCCTGGAAGATCAAGAGATT	0.502													27	53	---	---	---	---	PASS
CCDC64	92558	broad.mit.edu	37	12	120510336	120510336	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120510336G>T	uc001txl.1	+	6	1136	c.1111G>T	c.(1111-1113)GCC>TCC	p.A371S	CCDC64_uc001txk.2_Missense_Mutation_p.A371S|CCDC64_uc009zwv.1_Intron|CCDC64_uc010sze.1_Intron|CCDC64_uc010szf.1_Missense_Mutation_p.A20S	NM_207311	NP_997194	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	371	Potential.				Golgi to secretory granule transport|neuron projection development	centrosome	dynactin binding|Rab GTPase binding			ovary(2)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCTCTGGGAAGCCTACTGCCA	0.512													60	70	---	---	---	---	PASS
FRY	10129	broad.mit.edu	37	13	32810321	32810321	+	Intron	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32810321C>G	uc001utx.2	+						FRY_uc010tdw.1_Intron	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TGAGAATCAGCTTAATGATAC	0.408													3	56	---	---	---	---	PASS
SMAD9	4093	broad.mit.edu	37	13	37447060	37447060	+	Intron	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37447060C>A	uc001uvw.2	-						SMAD9_uc001uvx.2_Intron|SMAD9_uc010tep.1_Intron	NM_001127217	NP_001120689	O15198	SMAD9_HUMAN	SMAD family member 9 isoform a						BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		GTACTAGGATCAGAAAGGAAC	0.473													18	24	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39448660	39448660	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39448660C>T	uc001uwv.2	+	18	8527	c.8218C>T	c.(8218-8220)CGC>TGC	p.R2740C		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	2740	Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGATGAGGGGCGCTTGGCCGT	0.488													6	151	---	---	---	---	PASS
CLN5	1203	broad.mit.edu	37	13	77569277	77569277	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77569277G>T	uc001vkc.2	+	2	428	c.400G>T	c.(400-402)GTT>TTT	p.V134F		NM_006493	NP_006484	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	85					brain development|cell death|lysosomal lumen acidification|neuron maturation|protein catabolic process	endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		ACCTATCCCAGTTATGGAGGG	0.418													117	104	---	---	---	---	PASS
SLITRK1	114798	broad.mit.edu	37	13	84454197	84454197	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84454197C>A	uc001vlk.2	-	1	2332	c.1446G>T	c.(1444-1446)CTG>CTT	p.L482L		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	482	Extracellular (Potential).|LRR 11.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GGGACCTCAGCAGGTTGTTGT	0.547													45	34	---	---	---	---	PASS
CLDN10	9071	broad.mit.edu	37	13	96086249	96086249	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96086249C>G	uc001vmg.2	+	1	397	c.162C>G	c.(160-162)AAC>AAG	p.N54K	CLDN10_uc010tii.1_Intron	NM_182848	NP_878268	P78369	CLD10_HUMAN	claudin 10 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			GCGCAGGTAACGCGTTGGGTT	0.488													69	58	---	---	---	---	PASS
COL4A2	1284	broad.mit.edu	37	13	111155574	111155574	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111155574C>T	uc001vqx.2	+	42	4273	c.3984C>T	c.(3982-3984)GCC>GCT	p.A1328A		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	1328	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			AAGGATGGGCCGGGGACTCCG	0.647													88	43	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22539438	22539438	+	Intron	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22539438A>G	uc001wbw.2	+						uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wcy.2_Missense_Mutation_p.T112A					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TTCCCAGACCACAGACTCAGG	0.527													20	44	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22631532	22631532	+	Intron	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22631532G>T	uc001wbw.2	+						uc010aiv.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Nonsense_Mutation_p.G42*|uc001wdh.2_Nonsense_Mutation_p.G42*					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CGTCCAGGAAGGAAGAATTTC	0.383											OREG0022575	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22631533	22631533	+	Intron	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22631533G>T	uc001wbw.2	+						uc010aiv.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Missense_Mutation_p.G42V|uc001wdh.2_Missense_Mutation_p.G42V					SubName: Full=Alpha-chain C region; Flags: Fragment;																		GTCCAGGAAGGAAGAATTTCT	0.383											OREG0022575	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	28	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22891939	22891939	+	Intron	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22891939A>T	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wdt.1_Intron|uc001wdu.2_Missense_Mutation_p.Q84L					SubName: Full=Alpha-chain C region; Flags: Fragment;																		GACAATTTCCAAGGTGACATT	0.428													91	148	---	---	---	---	PASS
SLC22A17	51310	broad.mit.edu	37	14	23817725	23817725	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23817725G>A	uc001wjl.2	-	4	738	c.682C>T	c.(682-684)CTG>TTG	p.L228L	SLC22A17_uc010akk.2_Silent_p.L10L|SLC22A17_uc001wjn.2_RNA|SLC22A17_uc001wjm.2_Silent_p.L228L	NM_020372	NP_065105	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17 isoform a	228	Helical; (Potential).				siderophore transport	integral to organelle membrane|integral to plasma membrane|vacuolar membrane	transmembrane receptor activity|transmembrane transporter activity				0	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		CCATAAAACAGGAAGAGGATG	0.562													100	124	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23858820	23858820	+	Nonsense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23858820T>A	uc001wjv.2	-	27	3908	c.3841A>T	c.(3841-3843)AAG>TAG	p.K1281*	uc010tnn.1_5'Flank|MIR208A_hsa-mir-208a|MI0000251_5'Flank	NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	1281	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GTCTGCAGCTTGGCTCGCTGG	0.587													59	98	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30093429	30093429	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30093429T>C	uc001wqh.2	-	13	2015	c.1834A>G	c.(1834-1836)AAA>GAA	p.K612E		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	612	Protein kinase.	ATP.		K->W: Loss of kinase activity.	cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TCAATGATTTTAATAGCTACA	0.318													4	252	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44976161	44976161	+	Silent	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44976161T>C	uc001wvn.2	-	1	339	c.30A>G	c.(28-30)GTA>GTG	p.V10V		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	10						cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		TTTTCTCTATTACATCAGTTT	0.438													176	383	---	---	---	---	PASS
KLHL28	54813	broad.mit.edu	37	14	45400680	45400680	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45400680T>C	uc001wvq.2	-	4	1654	c.1408A>G	c.(1408-1410)ATT>GTT	p.I470V	KLHL28_uc001wvr.2_Missense_Mutation_p.I470V	NM_017658	NP_060128	Q9NXS3	KLH28_HUMAN	BTB (POZ) domain containing 5	470	Kelch 4.									ovary(1)	1						CCAAAGTGAATCCTTTTATCT	0.403													46	80	---	---	---	---	PASS
PTGDR	5729	broad.mit.edu	37	14	52735195	52735195	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52735195C>T	uc001wzq.2	+	1	765	c.663C>T	c.(661-663)GCC>GCT	p.A221A		NM_000953	NP_000944	Q13258	PD2R_HUMAN	prostaglandin D2 receptor	221	Cytoplasmic (Potential).					integral to membrane|plasma membrane	prostaglandin D receptor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	ACCTCGGCGCCATGCGCAACC	0.701													22	63	---	---	---	---	PASS
PELI2	57161	broad.mit.edu	37	14	56746496	56746496	+	Splice_Site	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56746496G>T	uc001xch.2	+	3	595	c.309_splice	c.e3+1	p.Q103_splice		NM_021255	NP_067078	Q9HAT8	PELI2_HUMAN	pellino 2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of protein phosphorylation|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	protein binding			ovary(1)	1						TATGTTTCAGGTAATATTTTT	0.358													69	132	---	---	---	---	PASS
SGPP1	81537	broad.mit.edu	37	14	64153375	64153375	+	Intron	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64153375C>T	uc001xgj.2	-							NM_030791	NP_110418	Q9BX95	SGPP1_HUMAN	sphingosine-1-phosphate phosphatase 1							endoplasmic reticulum membrane|integral to membrane	dihydrosphingosine-1-phosphate phosphatase activity|sphingosine-1-phosphate phosphatase activity			central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0056)|all cancers(60;0.0141)|BRCA - Breast invasive adenocarcinoma(234;0.103)		CAATAATATCCTAGGAAAAGA	0.274													23	53	---	---	---	---	PASS
FUT8	2530	broad.mit.edu	37	14	66096258	66096258	+	Silent	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66096258T>A	uc001xin.2	+	6	1728	c.531T>A	c.(529-531)GGT>GGA	p.G177G	FUT8_uc001xio.2_Silent_p.G177G|FUT8_uc010tsp.1_Silent_p.G14G|FUT8_uc001xir.3_RNA|FUT8_uc001xip.2_Silent_p.G177G|FUT8_uc001xiq.2_Silent_p.G48G	NM_178155	NP_835368	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 isoform a	177	Lumenal (Potential).				in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		ATGGAGCAGGTGATTGGCGGG	0.418													59	185	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68234442	68234442	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68234442C>A	uc001xka.2	-	31	5908	c.5769G>T	c.(5767-5769)CGG>CGT	p.R1923R	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Silent_p.R1923R	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1923					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AAAATTCACTCCGCACCAGCT	0.413													69	180	---	---	---	---	PASS
ADAM21	8747	broad.mit.edu	37	14	70925511	70925511	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70925511C>T	uc001xmd.2	+	1	1295	c.1295C>T	c.(1294-1296)GCC>GTC	p.A432V		NM_003813	NP_003804	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21 preproprotein	432	Disintegrin.|Extracellular (Potential).				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			pancreas(1)|skin(1)	2				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GAACAAGACGCCTGTTGTCTG	0.498													47	135	---	---	---	---	PASS
DIO2	1734	broad.mit.edu	37	14	80669428	80669428	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80669428G>T	uc010tvq.1	-	4	828	c.426C>A	c.(424-426)GCC>GCA	p.A142A	DIO2_uc010tvp.1_Silent_p.A178A|DIO2_uc001xut.2_RNA|DIO2_uc010asx.2_3'UTR|DIO2_uc010tvr.1_Silent_p.A142A|DIO2_uc010asy.2_3'UTR	NM_000793	NP_000784	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II isoform a	142					hormone biosynthetic process|selenocysteine incorporation|thyroid hormone generation	integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|ubiquitin protein ligase binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0281)		GTTTGCGGAAGGCTGGCAGCT	0.572											OREG0022848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	47	---	---	---	---	PASS
GALC	2581	broad.mit.edu	37	14	88452846	88452846	+	Silent	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88452846A>G	uc001xvt.2	-	4	828	c.429T>C	c.(427-429)AAT>AAC	p.N143N	GALC_uc010tvx.1_Silent_p.N117N|GALC_uc010tvy.1_Silent_p.N120N|GALC_uc010tvz.1_Silent_p.N87N|GALC_uc001xvu.1_Silent_p.N143N	NM_000153	NP_000144	P54803	GALC_HUMAN	galactosylceramidase isoform a precursor	143					carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0						TGAGTGTAATATTGGGATTCC	0.378													27	62	---	---	---	---	PASS
SLC24A4	123041	broad.mit.edu	37	14	92959848	92959848	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92959848G>T	uc001yak.2	+	17	1718	c.1694G>T	c.(1693-1695)CGA>CTA	p.R565L	SLC24A4_uc001yai.2_Missense_Mutation_p.R518L|SLC24A4_uc010twm.1_Missense_Mutation_p.R563L|SLC24A4_uc001yaj.2_Missense_Mutation_p.R546L|SLC24A4_uc010auj.2_3'UTR|SLC24A4_uc010twn.1_Missense_Mutation_p.R338L|SLC24A4_uc001yan.2_Missense_Mutation_p.R276L	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1	582	Cytoplasmic (Potential).					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		AACAAGTGGCGACTGGACCGG	0.502													12	43	---	---	---	---	PASS
RIN3	79890	broad.mit.edu	37	14	93151479	93151479	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93151479C>A	uc001yap.2	+	9	2767	c.2615C>A	c.(2614-2616)TCC>TAC	p.S872Y	RIN3_uc010auk.2_Missense_Mutation_p.S534Y|RIN3_uc001yaq.2_Missense_Mutation_p.S797Y|RIN3_uc001yas.1_Missense_Mutation_p.S534Y	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	872					endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				GCCCGGGCCTCCCGCTCCTCC	0.667													12	24	---	---	---	---	PASS
DIO3	1735	broad.mit.edu	37	14	102028707	102028707	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102028707T>A	uc010txq.1	+	2	1020	c.796T>A	c.(796-798)TAT>AAT	p.Y266N	DIO3OS_uc001ykd.1_5'Flank|uc001yke.2_5'Flank|uc001ykf.2_5'Flank|uc001ykg.2_5'Flank|uc001ykh.3_5'Flank|MIR1247_hsa-mir-1247|MI0006382_5'Flank	NM_001362	NP_001353	P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III	266	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process	endosome membrane|integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|thyroxine 5-deiodinase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(303;0.185)				GTTGGAACGCTATGATGAGCA	0.597													48	131	---	---	---	---	PASS
KIF26A	26153	broad.mit.edu	37	14	104641889	104641889	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104641889G>A	uc001yos.3	+	12	2764	c.2764G>A	c.(2764-2766)GAC>AAC	p.D922N		NM_015656	NP_056471	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	922					blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity			pancreas(1)	1		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		TGTCTGGGGTGACCAGAGAGA	0.682													28	25	---	---	---	---	PASS
PLD4	122618	broad.mit.edu	37	14	105396386	105396386	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105396386G>C	uc001ypu.1	+	6	802	c.661G>C	c.(661-663)GAT>CAT	p.D221H	PLD4_uc010tyl.1_Missense_Mutation_p.D228H	NM_138790	NP_620145	Q96BZ4	PLD4_HUMAN	phospholipase D4	221	PLD phosphodiesterase 1.	Potential.			lipid catabolic process	integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity			central_nervous_system(1)|skin(1)	2		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)		Choline(DB00122)	CTGGGTTGTGGATGGACGGCA	0.582													42	144	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105404734	105404734	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105404734G>A	uc010axc.1	-	7	17174	c.17054C>T	c.(17053-17055)GCA>GTA	p.A5685V	AHNAK2_uc001ypx.2_Missense_Mutation_p.A5585V	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5685						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGCAGTTCTGCCTCTGGTCG	0.478													49	60	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106236302	106236302	+	RNA	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106236302G>T	uc010tyt.1	-	3616		c.57642C>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_RNA|uc001ysi.1_RNA					Parts of antibodies, mostly variable regions.												0						GAAGACTGACGGTCCTCCCAG	0.602													71	88	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106963106	106963106	+	RNA	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106963106G>T	uc010tyt.1	-	207		c.9578C>A								Parts of antibodies, mostly variable regions.												0						TTGTCCGGGGGCCTGTCGCAC	0.552													74	177	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25925977	25925977	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25925977C>A	uc010ayu.2	-	19	3764	c.3658G>T	c.(3658-3660)GGC>TGC	p.G1220C		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1220	Helical; (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GTTTCAATGCCCAGGTGGAGC	0.562													33	183	---	---	---	---	PASS
CDAN1	146059	broad.mit.edu	37	15	43020159	43020159	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43020159T>C	uc001zql.2	-	22	3058	c.2941A>G	c.(2941-2943)ATC>GTC	p.I981V	CDAN1_uc001zqj.2_RNA|CDAN1_uc001zqk.2_Missense_Mutation_p.I307V	NM_138477	NP_612486	Q8IWY9	CDAN1_HUMAN	codanin 1	981						integral to membrane	protein binding			ovary(2)	2		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		TTACCTGTGATGTTGGCTGAC	0.532													236	407	---	---	---	---	PASS
ADAL	161823	broad.mit.edu	37	15	43638116	43638116	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43638116G>T	uc010udo.1	+	9	1064	c.490G>T	c.(490-492)GAG>TAG	p.E164*	ADAL_uc001zrh.2_Nonsense_Mutation_p.E164*|ADAL_uc001zri.1_Nonsense_Mutation_p.E49*	NM_001159280	NP_001152752	Q6DHV7	ADAL_HUMAN	adenosine deaminase-like isoform 1	164					adenosine catabolic process|inosine biosynthetic process|purine ribonucleoside monophosphate biosynthetic process		adenosine deaminase activity|metal ion binding				0		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;9.31e-07)		AAAACTTGCCGAGGAGTTCTT	0.393													86	178	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53908408	53908408	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53908408A>C	uc002acj.2	-	15	2037	c.1995T>G	c.(1993-1995)TTT>TTG	p.F665L	WDR72_uc010bfi.1_Missense_Mutation_p.F665L	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	665										lung(1)|skin(1)	2				all cancers(107;0.0511)		GCAAGACATTAAAAGGTCTTG	0.338													22	87	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54630612	54630612	+	Silent	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54630612A>T	uc002ack.2	+	15	4638	c.4638A>T	c.(4636-4638)GTA>GTT	p.V1546V	UNC13C_uc002acl.2_Silent_p.V376V	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1546					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AGGACTGTGTAAGGGCTTGCC	0.423													40	180	---	---	---	---	PASS
PLEKHO2	80301	broad.mit.edu	37	15	65157606	65157606	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65157606C>T	uc002anv.2	+	6	1126	c.992C>T	c.(991-993)TCT>TTT	p.S331F	PLEKHO2_uc010bgz.2_Missense_Mutation_p.S7F|PLEKHO2_uc002anw.2_Missense_Mutation_p.S281F	NM_025201	NP_079477	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O	331	Pro-rich.									ovary(1)|lung(1)	2						ATGCAGGCTTCTGGGCCACCT	0.602													25	78	---	---	---	---	PASS
HEXA	3073	broad.mit.edu	37	15	72643512	72643512	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72643512G>A	uc002aun.3	-	6	841	c.634C>T	c.(634-636)CCA>TCA	p.P212S	uc002aug.2_RNA|CELF6_uc002auk.3_Intron|HEXA_uc010ukn.1_Missense_Mutation_p.P223S|HEXA_uc002auo.3_Missense_Mutation_p.P75S|HEXA_uc010bix.2_Missense_Mutation_p.P212S|HEXA_uc010biy.2_Missense_Mutation_p.P75S|HEXA_uc010uko.1_Missense_Mutation_p.P38S|HEXA_uc010biz.1_RNA	NM_000520	NP_000511	P06865	HEXA_HUMAN	hexosaminidase A preproprotein	212					cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity			ovary(3)|upper_aerodigestive_tract(1)	4						CTCTCATATGGGAAGGAAGGA	0.458													38	53	---	---	---	---	PASS
BBS4	585	broad.mit.edu	37	15	72987552	72987552	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72987552A>T	uc002avb.2	+	2	102	c.59A>T	c.(58-60)AAA>ATA	p.K20I	BBS4_uc010ukv.1_5'UTR|BBS4_uc002avc.2_Intron|BBS4_uc002avd.2_Missense_Mutation_p.K28I	NM_033028	NP_149017	Q96RK4	BBS4_HUMAN	Bardet-Biedl syndrome 4	20	Required for localization to centrosomes.				adult behavior|brain morphogenesis|cell cycle cytokinesis|centrosome organization|cerebral cortex development|convergent extension involved in gastrulation|dendrite development|fat cell differentiation|heart looping|hippocampus development|intracellular transport|maintenance of protein location in nucleus|melanosome transport|microtubule anchoring at centrosome|neural tube closure|nonmotile primary cilium assembly|photoreceptor cell maintenance|pigment granule aggregation in cell center|positive regulation of flagellum assembly|regulation of cilium beat frequency involved in ciliary motility|regulation of cytokinesis|regulation of lipid metabolic process|retina homeostasis|retinal rod cell development|sensory perception of smell|sensory processing|spermatid development|striatum development	BBSome|centriolar satellite|centriole|cilium membrane|microtubule basal body|motile cilium|nonmotile primary cilium|nucleus|pericentriolar material	alpha-tubulin binding|beta-tubulin binding|dynactin binding|microtubule motor activity				0						GAGTCTCAAAAACCCCGGCAG	0.303									Bardet-Biedl_syndrome				32	116	---	---	---	---	PASS
CYP11A1	1583	broad.mit.edu	37	15	74637380	74637380	+	Intron	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74637380C>A	uc002axt.2	-						CYP11A1_uc002axs.2_Intron|CYP11A1_uc010bjm.1_Intron|CYP11A1_uc010bjn.1_Intron|CYP11A1_uc010bjo.1_Intron|CYP11A1_uc010bjp.1_5'Flank|CYP11A1_uc010ulj.1_Intron|CYP11A1_uc010bjq.2_Missense_Mutation_p.K210N	NM_000781	NP_000772	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A,						C21-steroid hormone biosynthetic process|cholesterol metabolic process|vitamin D metabolic process|xenobiotic metabolic process	mitochondrial matrix	cholesterol monooxygenase (side-chain-cleaving) activity|electron carrier activity|heme binding			ovary(2)	2					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Clotrimazole(DB00257)|Digitoxin(DB01396)|Digoxin(DB00390)|Medroxyprogesterone(DB00603)|Ouabain(DB01092)|Progesterone(DB00396)|Testosterone(DB00624)|Trilostane(DB01108)	TGCAAGCCCCCTTACACTCAA	0.567													3	64	---	---	---	---	PASS
CYP1A1	1543	broad.mit.edu	37	15	75014915	75014915	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75014915T>G	uc002ayp.3	-	2	646	c.524A>C	c.(523-525)CAG>CCG	p.Q175P	CYP1A1_uc010bjv.2_RNA|CYP1A1_uc010bjw.2_RNA|CYP1A1_uc010bju.2_Intron|CYP1A1_uc010bjx.2_Intron|CYP1A1_uc002ayq.3_Missense_Mutation_p.Q175P|CYP1A1_uc010bjy.2_Missense_Mutation_p.Q175P|CYP1A1_uc010bjz.1_Intron	NM_000499	NP_000490	P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A,	175					cellular lipid metabolic process|drug metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding|vitamin D 24-hydroxylase activity			ovary(2)|breast(2)|pancreas(1)	5					Arsenic trioxide(DB01169)|Benzphetamine(DB00865)|Bleomycin(DB00290)|Chlorzoxazone(DB00356)|Dacarbazine(DB00851)|Dactinomycin(DB00970)|Esomeprazole(DB00736)|Estrone(DB00655)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Ginseng(DB01404)|Granisetron(DB00889)|Ketoconazole(DB01026)|Menadione(DB00170)|Picrotoxin(DB00466)|Primaquine(DB01087)|Quinidine(DB00908)|Quinine(DB00468)|Thiabendazole(DB00730)	CATCAGCTCCTGCAACGTGCT	0.542									Endometrial_Cancer_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia				41	131	---	---	---	---	PASS
FBXO22	26263	broad.mit.edu	37	15	76225331	76225331	+	Missense_Mutation	SNP	G	T	T	rs141220458		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76225331G>T	uc002bbk.2	+	7	1205	c.1100G>T	c.(1099-1101)CGG>CTG	p.R367L	FBXO22_uc002bbl.2_Missense_Mutation_p.R263L|FBXO22OS_uc002bbm.1_RNA	NM_147188	NP_671717	Q8NEZ5	FBX22_HUMAN	F-box only protein 22 isoform a	367					ubiquitin-dependent protein catabolic process		ubiquitin-protein ligase activity				0						GGATGTGATCGGATAGTCACT	0.388													86	140	---	---	---	---	PASS
ZFAND6	54469	broad.mit.edu	37	15	80423618	80423618	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80423618A>G	uc002bfe.1	+	6	772	c.461A>G	c.(460-462)AAG>AGG	p.K154R	ZFAND6_uc002bff.1_Missense_Mutation_p.K154R|ZFAND6_uc002bfg.1_Missense_Mutation_p.K142R|ZFAND6_uc002bfh.1_Missense_Mutation_p.K154R|ZFAND6_uc002bfi.1_Missense_Mutation_p.K154R	NM_019006	NP_061879	Q6FIF0	ZFAN6_HUMAN	zinc finger, AN1-type domain 6	154	AN1-type.						DNA binding|zinc ion binding				0						ATGTGCAGGAAGAAAGTGGGA	0.348													26	101	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86122469	86122469	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86122469C>T	uc002blv.1	+	7	1340	c.1170C>T	c.(1168-1170)GAC>GAT	p.D390D	AKAP13_uc002blt.1_Silent_p.D390D|AKAP13_uc002blu.1_Silent_p.D390D	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	390					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						CTATTGTGGACTCTGGAACTG	0.483													16	199	---	---	---	---	PASS
MSLNL	401827	broad.mit.edu	37	16	819634	819634	+	Intron	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:819634C>T	uc002cjz.1	-						MIR662_hsa-mir-662|MI0003670_5'Flank	NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like						cell adhesion	integral to membrane				breast(3)|ovary(1)	4						CACAGGCTGCCTGTAGATGGA	0.657													16	2	---	---	---	---	PASS
FLYWCH1	84256	broad.mit.edu	37	16	2983294	2983294	+	Silent	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2983294A>G	uc002csd.2	+	5	1323	c.960A>G	c.(958-960)GGA>GGG	p.G320G	FLYWCH1_uc002csb.2_Silent_p.G319G|FLYWCH1_uc002csc.2_Silent_p.G319G|FLYWCH1_uc010bsv.2_5'UTR	NM_032296	NP_115672	Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1 isoform a	320	FLYWCH-type 2.					nucleus	DNA binding|metal ion binding				0						TCACCCAGGGACAGCGGGTGA	0.682													7	6	---	---	---	---	PASS
XYLT1	64131	broad.mit.edu	37	16	17352836	17352836	+	Intron	SNP	G	T	T	rs79173410	by1000genomes	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17352836G>T	uc002dfa.2	-							NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						CAGCGGGGTTGGAACTTACCC	0.602													32	82	---	---	---	---	PASS
ACSM2A	123876	broad.mit.edu	37	16	20471590	20471590	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20471590G>T	uc010bwe.2	+	3	393	c.154G>T	c.(154-156)GAT>TAT	p.D52Y	ACSM2A_uc010bwd.1_RNA|ACSM2A_uc010vax.1_Intron|ACSM2A_uc002dhf.3_Missense_Mutation_p.D52Y|ACSM2A_uc002dhg.3_Missense_Mutation_p.D52Y|ACSM2A_uc010vay.1_Intron	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member	52					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						TGATGTGTTGGATCACTGGGC	0.433													33	69	---	---	---	---	PASS
PRKCB	5579	broad.mit.edu	37	16	24104168	24104168	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24104168G>T	uc002dmd.2	+	6	783	c.586G>T	c.(586-588)GTA>TTA	p.V196L	PRKCB_uc002dme.2_Missense_Mutation_p.V196L	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	196	C2.				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	AGATCCCTACGTAAAACTGAA	0.408													123	239	---	---	---	---	PASS
SLC5A11	115584	broad.mit.edu	37	16	24895427	24895427	+	Silent	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24895427A>T	uc002dmu.2	+	8	871	c.639A>T	c.(637-639)ATA>ATT	p.I213I	SLC5A11_uc002dms.2_Silent_p.I149I|SLC5A11_uc010vcd.1_Silent_p.I178I|SLC5A11_uc002dmt.2_Silent_p.I149I|SLC5A11_uc010vce.1_Silent_p.I143I|SLC5A11_uc010bxt.2_Silent_p.I149I	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	213	Helical; (Potential).				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		TCATGCTTATAGGAGCGCTCA	0.592													169	328	---	---	---	---	PASS
SLC5A11	115584	broad.mit.edu	37	16	24902199	24902199	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24902199C>T	uc002dmu.2	+	9	906	c.674C>T	c.(673-675)GCG>GTG	p.A225V	SLC5A11_uc002dms.2_Missense_Mutation_p.A161V|SLC5A11_uc010vcd.1_Missense_Mutation_p.A190V|SLC5A11_uc002dmt.2_Intron|SLC5A11_uc010vce.1_Missense_Mutation_p.A155V|SLC5A11_uc010bxt.2_Missense_Mutation_p.A161V	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	225	Helical; (Potential).				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		GGTTTTGCCGCGGTTGGTGGG	0.537													15	376	---	---	---	---	PASS
TRIM72	493829	broad.mit.edu	37	16	31235576	31235576	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31235576G>A	uc002ebn.1	+	7	1163	c.934G>A	c.(934-936)GAG>AAG	p.E312K	uc002ebp.1_5'Flank	NM_001008274	NP_001008275	Q6ZMU5	TRI72_HUMAN	tripartite motif-containing 72	312	B30.2/SPRY.				exocytosis|muscle organ development|muscle system process|plasma membrane repair|protein homooligomerization	cytoplasmic vesicle membrane|sarcolemma	phosphatidylserine binding|zinc ion binding				0						CCGCCGCGTGGAGTGCTCGGA	0.692													6	32	---	---	---	---	PASS
MMP2	4313	broad.mit.edu	37	16	55539246	55539246	+	Intron	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55539246C>G	uc002ehz.3	+						MMP2_uc010vhd.1_Intron|MMP2_uc010ccc.2_Intron|MMP2_uc002eia.3_Intron	NM_004530	NP_004521	P08253	MMP2_HUMAN	matrix metalloproteinase 2 isoform a						angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Marimastat(DB00786)|Sulindac(DB00605)	CTTTCTCTATCCCAGGTCACA	0.483													67	100	---	---	---	---	PASS
CES1	1066	broad.mit.edu	37	16	55844487	55844487	+	Missense_Mutation	SNP	G	T	T	rs139540470		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55844487G>T	uc002eim.2	-	11	1365	c.1257C>A	c.(1255-1257)GAC>GAA	p.D419E	CES1_uc010ccf.2_Missense_Mutation_p.D94E|CES1_uc002eil.2_Missense_Mutation_p.D420E|CES1_uc002ein.2_Missense_Mutation_p.D418E	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor	419					response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	CTGCTATCAAGTCCAGGAACA	0.488													80	255	---	---	---	---	PASS
PSKH1	5681	broad.mit.edu	37	16	67943500	67943500	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67943500T>G	uc002euv.2	+	2	1018	c.848T>G	c.(847-849)CTG>CGG	p.L283R	PSKH1_uc010cet.2_Missense_Mutation_p.L283R	NM_006742	NP_006733	P11801	KPSH1_HUMAN	protein serine kinase H1	283	Protein kinase.					endoplasmic reticulum membrane|Golgi apparatus|microtubule organizing center|nuclear speck|plasma membrane	ATP binding|protein serine/threonine kinase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0044)|Epithelial(162;0.0197)|all cancers(182;0.128)		ATGTGGGCGCTGGGCGTCATT	0.567													31	29	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	70934960	70934960	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70934960G>A	uc002ezr.2	-	53	9120	c.8992C>T	c.(8992-8994)CTG>TTG	p.L2998L		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	2999										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				TGAAAGTACAGGTGCAGGCCG	0.532													24	227	---	---	---	---	PASS
PSMD7	5713	broad.mit.edu	37	16	74338292	74338292	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74338292G>A	uc002fcq.2	+	6	662	c.530G>A	c.(529-531)CGA>CAA	p.R177Q	PSMD7_uc010vmr.1_Missense_Mutation_p.R100Q	NM_002811	NP_002802	P51665	PSD7_HUMAN	proteasome 26S non-ATPase subunit 7	177					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding				0						CACTTGTTACGGTGAGACCCT	0.418													4	96	---	---	---	---	PASS
DPEP1	1800	broad.mit.edu	37	16	89702443	89702443	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89702443G>T	uc010cin.2	+	3	435	c.232G>T	c.(232-234)GGC>TGC	p.G78C	DPEP1_uc002fnr.3_Missense_Mutation_p.G78C|DPEP1_uc002fns.3_Missense_Mutation_p.G78C	NM_001128141	NP_001121613	P16444	DPEP1_HUMAN	dipeptidase 1 precursor	78					proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding			large_intestine(1)	1		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)	CTTTGTGGGAGGCCAGGTACC	0.627													7	7	---	---	---	---	PASS
SCARF1	8578	broad.mit.edu	37	17	1538212	1538212	+	Missense_Mutation	SNP	C	A	A	rs149977313		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1538212C>A	uc002fsz.1	-	11	2383	c.2333G>T	c.(2332-2334)CGG>CTG	p.R778L	SCARF1_uc002fsy.1_3'UTR|SCARF1_uc002fta.1_RNA|SCARF1_uc010cjv.1_Missense_Mutation_p.R692L	NM_003693	NP_003684	Q14162	SREC_HUMAN	scavenger receptor class F, member 1 isoform 1	778	Gly-rich.|Cytoplasmic (Potential).				cell adhesion|neuron remodeling|positive regulation of axon regeneration|receptor-mediated endocytosis	integral to membrane	low-density lipoprotein particle binding|scavenger receptor activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CCCCAGCCCCCGGACCGCTTC	0.647													41	34	---	---	---	---	PASS
MYBBP1A	10514	broad.mit.edu	37	17	4443135	4443135	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4443135C>A	uc002fyb.3	-	26	3624	c.3562G>T	c.(3562-3564)GAT>TAT	p.D1188Y	MYBBP1A_uc002fxz.3_Missense_Mutation_p.D1188Y|SPNS2_uc002fxx.2_3'UTR|SPNS2_uc002fxy.2_3'UTR|MYBBP1A_uc002fya.3_Missense_Mutation_p.D133Y|MYBBP1A_uc010vsa.1_Missense_Mutation_p.D230Y	NM_014520	NP_055335	Q9BQG0	MBB1A_HUMAN	MYB binding protein 1a isoform 2	1188	Required for nuclear and nucleolar localization (By similarity).				nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NLS-dependent protein nuclear import complex|nucleolus	DNA binding|DNA-directed DNA polymerase activity|transcription factor binding			ovary(1)|skin(1)	2						GGCGTGCCATCCTCTGACTTG	0.597													93	84	---	---	---	---	PASS
SLC25A11	8402	broad.mit.edu	37	17	4843194	4843194	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4843194C>A	uc002fzo.1	-	1	125	c.12G>T	c.(10-12)ACG>ACT	p.T4T	SLC25A11_uc002fzp.1_5'UTR|RNF167_uc002fzq.2_5'Flank|RNF167_uc002fzr.2_5'Flank|RNF167_uc002fzs.2_5'Flank|RNF167_uc002fzt.2_5'Flank|RNF167_uc002fzu.2_5'Flank|RNF167_uc002fzv.2_5'Flank|RNF167_uc002fzw.1_5'Flank|RNF167_uc002fzx.2_5'Flank	NM_003562	NP_003553	Q02978	M2OM_HUMAN	solute carrier family 25 member 11 isoform 1	4					gluconeogenesis	integral to plasma membrane|mitochondrial inner membrane	oxoglutarate:malate antiporter activity				0						CGGCACTCGCCGTCGCCGCCA	0.731													3	3	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577106	7577106	+	Missense_Mutation	SNP	G	C	C	rs17849781		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577106G>C	uc002gim.2	-	8	1026	c.832C>G	c.(832-834)CCT>GCT	p.P278A	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.P278A|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.P146A|TP53_uc010cng.1_Missense_Mutation_p.P146A|TP53_uc002gii.1_Missense_Mutation_p.P146A|TP53_uc010cnh.1_Missense_Mutation_p.P278A|TP53_uc010cni.1_Missense_Mutation_p.P278A|TP53_uc002gij.2_Missense_Mutation_p.P278A	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	278	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.P278L(52)|p.P278S(48)|p.P278R(26)|p.P278T(21)|p.P278A(18)|p.P278H(11)|p.0?(7)|p.P278fs*67(5)|p.P278F(3)|p.P278fs*28(2)|p.?(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.V274_P278del(1)|p.P278P(1)|p.C277_P278insXXXXXXX(1)|p.F270_D281del12(1)|p.P278_G279insXXXXX(1)|p.C275_R283delCACPGRDRR(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275fs*20(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCTCTCCCAGGACAGGCACAA	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			31	32	---	---	---	---	PASS
CNTROB	116840	broad.mit.edu	37	17	7851284	7851284	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7851284G>C	uc002gjq.2	+	16	3115	c.2196G>C	c.(2194-2196)TTG>TTC	p.L732F	CNTROB_uc002gjp.2_Missense_Mutation_p.L732F|CNTROB_uc002gjr.2_Missense_Mutation_p.L634F	NM_053051	NP_444279	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	732	Pro-rich.|Required for centrosome localization.				centriole replication|centrosome separation|cytokinesis	centriole	protein domain specific binding			breast(1)|central_nervous_system(1)	2		Prostate(122;0.173)				TCGACCTGTTGCCCCCTAAGT	0.488													177	171	---	---	---	---	PASS
ARHGEF15	22899	broad.mit.edu	37	17	8221893	8221893	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8221893C>A	uc002glc.2	+	11	1906	c.1785C>A	c.(1783-1785)ATC>ATA	p.I595I	ARHGEF15_uc002gld.2_Silent_p.I595I|ARHGEF15_uc010vuw.1_Silent_p.I484I	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	595	DH.				negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						CCTAGATCATCGAGCGTTGCA	0.597													35	38	---	---	---	---	PASS
FLCN	201163	broad.mit.edu	37	17	17129541	17129541	+	Silent	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17129541G>C	uc002gra.3	-	5	849	c.345C>G	c.(343-345)CCC>CCG	p.P115P	PLD6_uc010cpn.2_Intron|FLCN_uc002grb.3_Silent_p.P115P|FLCN_uc002grc.2_Silent_p.P115P	NM_144997	NP_659434	Q8NFG4	FLCN_HUMAN	folliculin isoform 1	115					regulation of protein phosphorylation	cytoplasm|nucleus|plasma membrane	protein binding			thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	3						TGAAGAGCTGGGGGTGGCTGG	0.607									Birt-Hogg-Dub__syndrome|Familial_Non-VHL_Clear_Cell_Renal_Cancer				24	38	---	---	---	---	PASS
TRAF4	9618	broad.mit.edu	37	17	27076391	27076391	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27076391C>T	uc002hcs.2	+	7	1317	c.1209C>T	c.(1207-1209)CAC>CAT	p.H403H	TRAF4_uc002hcq.1_Intron	NM_004295	NP_004286	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	403	MATH.				apoptosis|positive regulation of JNK cascade|positive regulation of protein homodimerization activity|positive regulation of protein kinase activity|regulation of apoptosis|signal transduction	cytoskeleton|nucleus|perinuclear region of cytoplasm|tight junction	DNA binding|ubiquitin-protein ligase activity|WW domain binding|zinc ion binding			upper_aerodigestive_tract(1)|lung(1)	2	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			AACCACAGCACGTCACTGAGA	0.587													12	63	---	---	---	---	PASS
MYO18A	399687	broad.mit.edu	37	17	27425444	27425444	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27425444C>G	uc002hdt.1	-	24	3958	c.3800G>C	c.(3799-3801)CGG>CCG	p.R1267P	MYO18A_uc010wbc.1_Missense_Mutation_p.R809P|MYO18A_uc002hds.2_Missense_Mutation_p.R809P|MYO18A_uc010csa.1_Missense_Mutation_p.R1267P|MYO18A_uc002hdu.1_Missense_Mutation_p.R1267P|MYO18A_uc010wbd.1_Missense_Mutation_p.R936P	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	1267	Potential.				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GAGCTTGCTCCGCAGCTGCTG	0.627													21	21	---	---	---	---	PASS
TMIGD1	388364	broad.mit.edu	37	17	28656433	28656433	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28656433A>G	uc002hfa.1	-	3	270	c.197T>C	c.(196-198)CTC>CCC	p.L66P	TMIGD1_uc010csh.1_Missense_Mutation_p.L66P	NM_206832	NP_996663	Q6UXZ0	TMIG1_HUMAN	transmembrane and immunoglobulin domain	66	Extracellular (Potential).|Ig-like C2-type 1.					integral to membrane					0						TCGGTACCAGAGCAGTTCTTC	0.448													67	103	---	---	---	---	PASS
SP2	6668	broad.mit.edu	37	17	46005109	46005109	+	Silent	SNP	C	T	T	rs75562971	byFrequency	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46005109C>T	uc002imk.2	+	7	1898	c.1761C>T	c.(1759-1761)TGC>TGT	p.C587C	SP2_uc002iml.2_Silent_p.C580C	NM_003110	NP_003101	Q02086	SP2_HUMAN	Sp2 transcription factor	587	C2H2-type 3.				immune response|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|histone deacetylase binding|zinc ion binding				0						GCTTCGAGTGCGCCCAGTGTC	0.587													2	3	---	---	---	---	PASS
GH2	2689	broad.mit.edu	37	17	61959155	61959155	+	Missense_Mutation	SNP	C	T	T	rs148779841		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61959155C>T	uc002jco.1	-	1	69	c.7G>A	c.(7-9)GCA>ACA	p.A3T	GH2_uc002jcj.2_Missense_Mutation_p.A3T|CSH2_uc002jck.2_Intron|GH2_uc002jcl.1_Missense_Mutation_p.A3T|GH2_uc002jcm.1_Missense_Mutation_p.A3T|GH2_uc002jcn.1_Missense_Mutation_p.A3T	NM_002059	NP_002050	P01242	SOM2_HUMAN	growth hormone 2 isoform 1	3						extracellular region	hormone activity			upper_aerodigestive_tract(2)|pancreas(1)	3						CGCTTACCTGCAGCCATTGCC	0.597													4	126	---	---	---	---	PASS
LRRC37A3	374819	broad.mit.edu	37	17	62856503	62856503	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62856503C>G	uc002jey.2	-	11	4292	c.3761G>C	c.(3760-3762)GGC>GCC	p.G1254A	LRRC37A3_uc010wqg.1_Missense_Mutation_p.G372A|LRRC37A3_uc002jex.1_Missense_Mutation_p.G231A|LRRC37A3_uc010wqf.1_Missense_Mutation_p.G292A|LRRC37A3_uc010dek.1_Missense_Mutation_p.G260A	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1254	Extracellular (Potential).					integral to membrane					0						AGAAGGCGCGCCCTTGGAGAA	0.532													107	58	---	---	---	---	PASS
ABCA9	10350	broad.mit.edu	37	17	67041417	67041417	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67041417G>C	uc002jhu.2	-	4	508	c.365C>G	c.(364-366)TCA>TGA	p.S122*	ABCA9_uc010dez.2_Nonsense_Mutation_p.S122*|ABCA9_uc002jhv.2_Nonsense_Mutation_p.S122*	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	122					transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					TGCGTCTATTGAATAGTTCAA	0.393													133	80	---	---	---	---	PASS
ABCA6	23460	broad.mit.edu	37	17	67132311	67132311	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67132311T>C	uc002jhw.1	-	4	557	c.382A>G	c.(382-384)ATC>GTC	p.I128V	ABCA6_uc002jhy.2_Missense_Mutation_p.I126V	NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	128					transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					TCATTAAAGATGATTCCCATA	0.333													41	24	---	---	---	---	PASS
ABCA5	23461	broad.mit.edu	37	17	67273892	67273892	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67273892T>A	uc002jif.2	-	18	3702	c.2484A>T	c.(2482-2484)GAA>GAT	p.E828D	ABCA5_uc002jic.2_Missense_Mutation_p.E51D|ABCA5_uc002jid.2_5'UTR|ABCA5_uc002jie.2_RNA|ABCA5_uc002jig.2_Missense_Mutation_p.E828D|ABCA5_uc002jih.2_Missense_Mutation_p.E828D|ABCA5_uc010dfe.2_Missense_Mutation_p.E828D	NM_018672	NP_061142	Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A , member 5	828					cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)					CAGCCTTGGTTTCAGAAAGAA	0.368													80	55	---	---	---	---	PASS
TRIM47	91107	broad.mit.edu	37	17	73870924	73870924	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73870924G>A	uc002jpw.2	-	6	1584	c.1557C>T	c.(1555-1557)TCC>TCT	p.S519S	TRIM47_uc002jpv.2_Silent_p.S281S	NM_033452	NP_258411	Q96LD4	TRI47_HUMAN	tripartite motif-containing 47	519	B30.2/SPRY.					cytoplasm|nucleus	zinc ion binding			ovary(2)|prostate(1)|lung(1)|breast(1)	5			Epithelial(20;4.23e-06)|all cancers(21;5.24e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCAGGCAGCAGGAGTGGGCGT	0.662													82	44	---	---	---	---	PASS
DSC2	1824	broad.mit.edu	37	18	28666569	28666569	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28666569G>T	uc002kwl.3	-	7	1366	c.912C>A	c.(910-912)ATC>ATA	p.I304I	DSC2_uc002kwk.3_Silent_p.I304I	NM_024422	NP_077740	Q02487	DSC2_HUMAN	desmocollin 2 isoform Dsc2a preproprotein	304	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			ATGTTGTGGTGATCACGCCTG	0.448													85	111	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31323717	31323717	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31323717G>T	uc010dmg.1	+	12	3960	c.3905G>T	c.(3904-3906)AGC>ATC	p.S1302I	ASXL3_uc002kxq.2_Missense_Mutation_p.S1009I	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1302	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						TGTATTGAAAGCACTCCCATT	0.408													56	89	---	---	---	---	PASS
AZU1	566	broad.mit.edu	37	19	828343	828343	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:828343C>T	uc002lpz.1	+	2	188	c.172C>T	c.(172-174)CAT>TAT	p.H58Y		NM_001700	NP_001691	P20160	CAP7_HUMAN	azurocidin 1 preproprotein	58	Peptidase S1.|Hydrophobic.|Possesses antibiotic activity.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cellular extravasation|defense response to Gram-negative bacterium|glial cell migration|induction of positive chemotaxis|inflammatory response|macrophage chemotaxis|microglial cell activation|monocyte activation|positive regulation of cell adhesion|positive regulation of fractalkine biosynthetic process|positive regulation of interleukin-1 beta biosynthetic process|positive regulation of MHC class II biosynthetic process|positive regulation of phagocytosis|positive regulation of tumor necrosis factor biosynthetic process|proteolysis|regulation of vascular permeability	azurophil granule|extracellular region	heparin binding|serine-type endopeptidase activity|toxin binding			pancreas(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCCCTGATCCATGCCCGCTT	0.657													48	91	---	---	---	---	PASS
ABCA7	10347	broad.mit.edu	37	19	1056969	1056969	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1056969G>A	uc002lqw.3	+	34	4881	c.4650G>A	c.(4648-4650)CCG>CCA	p.P1550P	ABCA7_uc002lqy.2_Silent_p.P21P|ABCA7_uc010dsc.2_5'Flank	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	1550	Helical; (Potential).				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTTTGTCCCGGCCAGCTTCA	0.597													6	179	---	---	---	---	PASS
C19orf35	374872	broad.mit.edu	37	19	2279031	2279031	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2279031A>G	uc002lvn.2	-	3	264	c.164T>C	c.(163-165)CTG>CCG	p.L55P	SPPL2B_uc010dsw.1_Intron	NM_198532	NP_940934	Q6ZS72	CS035_HUMAN	hypothetical protein LOC374872	55										pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGTGGGGGCAGGGGCTCTGG	0.677													3	12	---	---	---	---	PASS
MATK	4145	broad.mit.edu	37	19	3789356	3789356	+	5'Flank	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3789356T>A	uc002lyt.2	-						MATK_uc002lyv.2_5'UTR|MATK_uc002lyu.2_5'Flank|MATK_uc010dtq.2_5'Flank	NM_139355	NP_647612	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase isoform						cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		gagagggacatttaagatgct	0.179													11	40	---	---	---	---	PASS
STAP2	55620	broad.mit.edu	37	19	4332010	4332010	+	Intron	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4332010T>A	uc002mab.2	-						STAP2_uc002mac.2_Intron|STAP2_uc002mad.2_Intron	NM_001013841	NP_001013863	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2							cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		AGAGAGCCACTACTCTTACCT	0.383													22	73	---	---	---	---	PASS
MYO1F	4542	broad.mit.edu	37	19	8595448	8595448	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8595448G>T	uc002mkg.2	-	20	2167	c.2053C>A	c.(2053-2055)CTG>ATG	p.L685M		NM_012335	NP_036467	O00160	MYO1F_HUMAN	myosin IF	685						unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3						ACCTCCTCCAGGAGGAAAAGC	0.647													70	130	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9058097	9058097	+	Silent	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9058097A>T	uc002mkp.2	-	3	29553	c.29349T>A	c.(29347-29349)TCT>TCA	p.S9783S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9785	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCAAATTTGGAGATGAACTGG	0.483													30	59	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9068679	9068679	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9068679G>T	uc002mkp.2	-	3	18971	c.18767C>A	c.(18766-18768)ACC>AAC	p.T6256N		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6258	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CAGTGTAGGGGTGGGTACTGA	0.493													52	143	---	---	---	---	PASS
YIPF2	78992	broad.mit.edu	37	19	11038397	11038397	+	Intron	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11038397A>T	uc002mqb.2	-						YIPF2_uc002mqc.2_Intron|C19orf52_uc002mqd.1_5'Flank	NM_024029	NP_076934	Q9BWQ6	YIPF2_HUMAN	Yip1 domain family, member 2							integral to membrane|transport vesicle					0						cAGGAGCTGCACATTGCGGGC	0.532													20	70	---	---	---	---	PASS
DNAJB1	3337	broad.mit.edu	37	19	14627579	14627579	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14627579A>G	uc002myz.1	-	2	531	c.491T>C	c.(490-492)GTC>GCC	p.V164A	DNAJB1_uc010xnr.1_Missense_Mutation_p.V64A	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	164					chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)		GTCGTGGGTGACTGGGGGATC	0.562													81	260	---	---	---	---	PASS
CLEC17A	388512	broad.mit.edu	37	19	14698495	14698495	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14698495C>G	uc010dzn.1	+	3	268	c.191C>G	c.(190-192)CCC>CGC	p.P64R	CLEC17A_uc002mzh.1_Missense_Mutation_p.P64R|CLEC17A_uc010xnt.1_RNA|CLEC17A_uc010xnu.1_Missense_Mutation_p.P64R|CLEC17A_uc010dzo.1_Missense_Mutation_p.P64R			Q6ZS10	CL17A_HUMAN	SubName: Full=CLEC17A protein;	64	Cytoplasmic (Potential).					cell surface|integral to membrane	fucose binding|mannose binding|metal ion binding|receptor activity				0						GACCTTCCTCCCAAGCCAGGT	0.552													8	20	---	---	---	---	PASS
CASP14	23581	broad.mit.edu	37	19	15166787	15166787	+	Intron	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15166787T>A	uc010dzv.1	+						CASP14_uc002naf.2_Intron	NM_012114	NP_036246	P31944	CASPE_HUMAN	caspase 14 precursor						apoptosis|cell differentiation|epidermis development|proteolysis	cytoplasm|nucleus	cysteine-type endopeptidase activity			skin(2)|ovary(1)|lung(1)	4						ACCACACCTGTTGCTGCAGGT	0.547													8	11	---	---	---	---	PASS
GTPBP3	84705	broad.mit.edu	37	19	17449960	17449960	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17449960G>T	uc010eas.2	+	6	758	c.693G>T	c.(691-693)GTG>GTT	p.V231V	GTPBP3_uc010xpo.1_Silent_p.V253V|GTPBP3_uc010ear.1_RNA|GTPBP3_uc002ngh.3_Silent_p.V231V|GTPBP3_uc002ngg.3_Silent_p.V263V|GTPBP3_uc002ngi.3_5'UTR	NM_032620	NP_116009	Q969Y2	GTPB3_HUMAN	GTP binding protein 3 (mitochondrial) isoform V	231					tRNA modification	mitochondrion	GTP binding|GTPase activity			skin(1)	1						CACTGCAGGTGGCCCTGGGTG	0.632													19	57	---	---	---	---	PASS
PDE4C	5143	broad.mit.edu	37	19	18327649	18327649	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18327649C>A	uc010xqc.1	-	12	1867	c.1387G>T	c.(1387-1389)GCT>TCT	p.A463S	PDE4C_uc002nik.3_Missense_Mutation_p.A463S|PDE4C_uc002nil.3_Missense_Mutation_p.A463S|PDE4C_uc002nif.3_Missense_Mutation_p.A232S|PDE4C_uc002nig.3_Missense_Mutation_p.A178S|PDE4C_uc002nih.3_Missense_Mutation_p.A233S|PDE4C_uc010ebk.2_Missense_Mutation_p.A357S|PDE4C_uc002nii.3_Missense_Mutation_p.A431S|PDE4C_uc010ebl.2_Missense_Mutation_p.A177S|PDE4C_uc010xqd.1_Missense_Mutation_p.A232S	NM_001098819	NP_001092289	Q08493	PDE4C_HUMAN	phosphodiesterase 4C isoform PDE4C-2	463					signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|skin(2)|central_nervous_system(1)	5					Dyphylline(DB00651)	AAGCCCACAGCCAGGTGATGG	0.582													52	122	---	---	---	---	PASS
ZNF527	84503	broad.mit.edu	37	19	37879768	37879768	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37879768C>T	uc010efk.1	+	5	928	c.817C>T	c.(817-819)CCC>TCC	p.P273S	ZNF527_uc002ogf.3_Missense_Mutation_p.P241S|ZNF527_uc010xtq.1_RNA	NM_032453	NP_115829	Q8NB42	ZN527_HUMAN	zinc finger protein 527	273					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGGAAAATTACCCCATGGATA	0.383													144	253	---	---	---	---	PASS
RINL	126432	broad.mit.edu	37	19	39361379	39361379	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39361379G>A	uc002ojq.2	-	8	901	c.513C>T	c.(511-513)ATC>ATT	p.I171I	RINL_uc002ojr.1_5'Flank|RINL_uc010xuo.1_Silent_p.I285I	NM_198445	NP_940847	Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	171							GTPase activator activity			pancreas(1)	1						AATCTGAGGCGATGCGCACCC	0.647													35	58	---	---	---	---	PASS
LRFN1	57622	broad.mit.edu	37	19	39798447	39798447	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39798447G>T	uc002okw.2	-	2	2142	c.2142C>A	c.(2140-2142)TTC>TTA	p.F714L		NM_020862	NP_065913	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III	714	Cytoplasmic (Potential).					cell junction|integral to membrane|postsynaptic density|postsynaptic membrane				ovary(2)	2	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			TGTGGCTCTGGAATAGTGCCC	0.731													5	6	---	---	---	---	PASS
SAMD4B	55095	broad.mit.edu	37	19	39869141	39869141	+	Intron	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39869141C>G	uc002olb.2	+						SAMD4B_uc002ola.2_Intron	NM_018028	NP_060498	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B								protein binding				0	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			CATGTCCCCCCAGTGTGCACC	0.567													21	78	---	---	---	---	PASS
HIPK4	147746	broad.mit.edu	37	19	40895578	40895578	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40895578A>G	uc002onp.2	-	1	517	c.232T>C	c.(232-234)TTC>CTC	p.F78L		NM_144685	NP_653286	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	78	Protein kinase.					cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			TCATGGAAGAACTCAAGGAAG	0.572													10	288	---	---	---	---	PASS
CEACAM7	1087	broad.mit.edu	37	19	42181387	42181387	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42181387C>T	uc002ori.1	-	4	753	c.751G>A	c.(751-753)GCT>ACT	p.A251T	CEACAM7_uc010ehx.2_Missense_Mutation_p.A251T|CEACAM7_uc010ehy.1_Missense_Mutation_p.A158T	NM_006890	NP_008821	Q14002	CEAM7_HUMAN	carcinoembryonic antigen-related cell adhesion	251						anchored to membrane|integral to membrane|plasma membrane				ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)		ATGCTGACAGCGGTCCCAGCT	0.463													4	171	---	---	---	---	PASS
PNMAL1	55228	broad.mit.edu	37	19	46973241	46973241	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46973241G>T	uc002peq.3	-	2	1358	c.1052C>A	c.(1051-1053)GCC>GAC	p.A351D	PNMAL1_uc002per.3_Missense_Mutation_p.A351D	NM_018215	NP_060685	Q86V59	PNML1_HUMAN	PNMA-like 1 isoform a	351											0		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		AGACACCCAGGCCACGGCCTT	0.597													134	390	---	---	---	---	PASS
GYS1	2997	broad.mit.edu	37	19	49474215	49474215	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49474215C>A	uc002plp.2	-	13	1856	c.1615G>T	c.(1615-1617)GAG>TAG	p.E539*	GYS1_uc010xzy.1_Nonsense_Mutation_p.E172*|GYS1_uc010emm.2_Nonsense_Mutation_p.E475*|GYS1_uc010xzz.1_Nonsense_Mutation_p.E459*	NM_002103	NP_002094	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle) isoform 1	539					glucose metabolic process|glycogen biosynthetic process	cytosol	glycogen (starch) synthase activity|protein binding			ovary(2)	2		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		ATGTGTTCCTCCATGAAGCAG	0.587											OREG0025611	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	37	109	---	---	---	---	PASS
KLK13	26085	broad.mit.edu	37	19	51563314	51563314	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51563314C>A	uc002pvn.2	-	3	319	c.276G>T	c.(274-276)GGG>GGT	p.G92G	KLK13_uc002pvl.2_RNA|KLK13_uc002pvm.2_RNA|KLK13_uc002pvo.2_RNA|KLK13_uc002pvp.2_RNA|KLK13_uc010eon.2_Silent_p.G92G|KLK13_uc002pvq.2_RNA|KLK13_uc010eoo.2_Intron|KLK13_uc002pvr.2_Silent_p.G92G	NM_015596	NP_056411	Q9UKR3	KLK13_HUMAN	kallikrein 13 precursor	92	Peptidase S1.				proteolysis		protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00432)		CTTCCACACGCCCTAGGGCGT	0.493													68	122	---	---	---	---	PASS
C19orf75	284369	broad.mit.edu	37	19	51768734	51768734	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51768734C>A	uc002pwb.1	+	3	516	c.135C>A	c.(133-135)CCC>CCA	p.P45P	C19orf75_uc010eov.1_Intron|C19orf75_uc010ycw.1_Intron	NM_173635	NP_775906	Q8N7X8	CS075_HUMAN	hypothetical protein LOC284369	45						integral to membrane				ovary(1)|pancreas(1)	2						GAGGAGTCCCCGTGGGTGTGG	0.572													40	86	---	---	---	---	PASS
SIGLEC12	89858	broad.mit.edu	37	19	51994991	51994991	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51994991C>A	uc002pwx.1	-	8	1748	c.1692G>T	c.(1690-1692)CAG>CAT	p.Q564H	SIGLEC12_uc002pww.1_Missense_Mutation_p.Q446H|SIGLEC12_uc010eoy.1_Missense_Mutation_p.Q291H	NM_053003	NP_443729	Q96PQ1	SIG12_HUMAN	sialic acid binding immunoglobulin-like	564	Cytoplasmic (Potential).|ITIM motif.				cell adhesion	integral to membrane	sugar binding			ovary(3)|skin(2)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GGGATGCATACTGGATCTCTC	0.592													65	158	---	---	---	---	PASS
ZNF480	147657	broad.mit.edu	37	19	52825873	52825873	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52825873G>T	uc010ydl.1	+	5	1440	c.1370G>T	c.(1369-1371)TGT>TTT	p.C457F	ZNF480_uc002pyv.2_Missense_Mutation_p.C380F|ZNF480_uc010ydm.1_Missense_Mutation_p.C414F|ZNF480_uc010epn.2_Missense_Mutation_p.C288F|uc002pyw.1_Intron	NM_144684	NP_653285	Q8WV37	ZN480_HUMAN	zinc finger protein 480	457	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		CCTTACAAATGTAGTGAATGT	0.398													87	212	---	---	---	---	PASS
ZNF534	147658	broad.mit.edu	37	19	52941383	52941383	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52941383A>G	uc002pzk.2	+	4	770	c.709A>G	c.(709-711)AGT>GGT	p.S237G	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Missense_Mutation_p.S224G	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	237	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CGAGATCTTTAGTAGCAATTC	0.388													3	128	---	---	---	---	PASS
ZNF320	162967	broad.mit.edu	37	19	53384080	53384080	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53384080C>A	uc002qag.2	-	4	1490	c.1299G>T	c.(1297-1299)AGG>AGT	p.R433S	ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Missense_Mutation_p.R379S|ZNF320_uc002qai.2_Missense_Mutation_p.R433S	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320	433	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		CTGTATGAATCCTCCTATGTC	0.393													40	130	---	---	---	---	PASS
ZNF665	79788	broad.mit.edu	37	19	53668046	53668046	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53668046C>A	uc010eqm.1	-	4	1797	c.1697G>T	c.(1696-1698)GGT>GTT	p.G566V		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	501					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)		AGGTTTCTCACCAGTGTGAAT	0.393													92	254	---	---	---	---	PASS
NLRP12	91662	broad.mit.edu	37	19	54297352	54297352	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54297352C>A	uc002qch.3	-	10	3357	c.3137G>T	c.(3136-3138)AGG>ATG	p.R1046M	NLRP12_uc010eqw.2_Missense_Mutation_p.R272M|NLRP12_uc002qci.3_Missense_Mutation_p.R989M|NLRP12_uc002qcj.3_Missense_Mutation_p.R1047M|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_3'UTR	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	1046	LRR 8.				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CGCTGCCAACCTACTGTGGGT	0.448													43	97	---	---	---	---	PASS
LILRB2	10288	broad.mit.edu	37	19	54784362	54784362	+	5'UTR	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54784362C>T	uc002qfb.2	-	2					LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_5'UTR|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_5'UTR|LILRB2_uc010yet.1_5'UTR|LILRB2_uc010yeu.1_RNA	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGCGTCTCCTCCCACTGCCCT	0.597													67	183	---	---	---	---	PASS
KIR2DL4	3805	broad.mit.edu	37	19	55316354	55316354	+	Silent	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55316354G>C	uc010yfm.1	+	3	223	c.183G>C	c.(181-183)ACG>ACC	p.T61T	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL4_uc010yfl.1_Silent_p.T56T|KIR2DL4_uc002qhg.2_Silent_p.T61T|KIR2DL4_uc002qhi.2_Silent_p.T61T|KIR2DL4_uc002qhh.2_Intron|KIR2DL4_uc002qhj.2_Silent_p.T61T|KIR2DL4_uc002qhf.2_Intron|KIR2DL4_uc010esd.2_Silent_p.T61T|KIR2DL4_uc010ese.2_5'Flank	NM_002255	NP_002246	Q99706	KI2L4_HUMAN	killer cell immunoglobulin-like receptor, two	61	Ig-like C2-type 1.|Extracellular (Potential).				cellular defense response|regulation of immune response	integral to plasma membrane	protein binding|transmembrane receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0192)		ACATCTTCACGCTGTACAAGA	0.547													50	28	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55493895	55493895	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55493895C>T	uc002qij.2	+	6	915	c.829C>T	c.(829-831)CTA>TTA	p.L277L	NLRP2_uc010yfp.1_Silent_p.L254L|NLRP2_uc010esn.2_Silent_p.L253L|NLRP2_uc010eso.2_Silent_p.L274L|NLRP2_uc010esp.2_Silent_p.L255L	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	277	NACHT.				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TCCACACATCCTAGCCCAAGC	0.587													38	79	---	---	---	---	PASS
NLRP11	204801	broad.mit.edu	37	19	56321318	56321318	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56321318C>T	uc010ygf.1	-	5	1369	c.658G>A	c.(658-660)GAT>AAT	p.D220N	NLRP11_uc002qlz.2_Missense_Mutation_p.D121N|NLRP11_uc002qmb.2_Missense_Mutation_p.D121N|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	220	NACHT.						ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		TTCTTGGGATCAGACAGGATG	0.478													59	83	---	---	---	---	PASS
ZNF583	147949	broad.mit.edu	37	19	56925400	56925400	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56925400A>T	uc010ygl.1	+	3	247	c.82A>T	c.(82-84)AGG>TGG	p.R28W	ZNF583_uc002qnc.2_Missense_Mutation_p.R28W|ZNF583_uc010ygm.1_Missense_Mutation_p.R28W	NM_001159860	NP_001153332	Q96ND8	ZN583_HUMAN	zinc finger protein 583	28	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		CCCTGCTCAGAGGAATTTGTA	0.438													62	149	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57326945	57326945	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57326945C>A	uc002qnu.2	-	7	3216	c.2865G>T	c.(2863-2865)CTG>CTT	p.L955L	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Silent_p.L926L|PEG3_uc002qnv.2_Silent_p.L955L|PEG3_uc002qnw.2_Silent_p.L831L|PEG3_uc002qnx.2_Silent_p.L829L|PEG3_uc010etr.2_Silent_p.L955L	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	955					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CACCAAAAGGCAGAGAGTGAA	0.473													77	272	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57326953	57326953	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57326953G>A	uc002qnu.2	-	7	3208	c.2857C>T	c.(2857-2859)CAC>TAC	p.H953Y	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.H924Y|PEG3_uc002qnv.2_Missense_Mutation_p.H953Y|PEG3_uc002qnw.2_Missense_Mutation_p.H829Y|PEG3_uc002qnx.2_Missense_Mutation_p.H827Y|PEG3_uc010etr.2_Missense_Mutation_p.H953Y	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	953					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GGCAGAGAGTGAATTACAGAG	0.468													79	295	---	---	---	---	PASS
ZNF324B	388569	broad.mit.edu	37	19	58967783	58967783	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58967783G>T	uc002qsv.1	+	4	1579	c.1472G>T	c.(1471-1473)CGT>CTT	p.R491L	ZNF324B_uc002qsu.1_Missense_Mutation_p.R481L|ZNF324B_uc010euq.1_Missense_Mutation_p.R491L	NM_207395	NP_997278	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	491	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CGCGCCTTCCGTGAGCGCCCT	0.657													52	87	---	---	---	---	PASS
SIRPB1	10326	broad.mit.edu	37	20	1546881	1546881	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1546881C>A	uc010gai.2	-	5	1216	c.1117G>T	c.(1117-1119)GTA>TTA	p.V373L	SIRPB1_uc002wfk.3_Missense_Mutation_p.V156L	NM_006065	NP_006056	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1 isoform 1	373	Helical; (Potential).				cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding			ovary(1)	1						AGGAGAGCTACGAGGAGTGGA	0.587													6	7	---	---	---	---	PASS
SIRPA	140885	broad.mit.edu	37	20	1896110	1896110	+	Intron	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1896110A>G	uc002wfq.2	+						SIRPA_uc010zps.1_Intron|SIRPA_uc002wfr.2_Intron|SIRPA_uc002wfs.2_Intron|SIRPA_uc002wft.2_Intron	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor						blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CGGTGAGTACAGCGTGGGCCT	0.532													52	60	---	---	---	---	PASS
CST11	140880	broad.mit.edu	37	20	23433377	23433377	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23433377G>T	uc002wtf.1	-	1	106	c.72C>A	c.(70-72)TAC>TAA	p.Y24*	CST11_uc002wtg.1_Nonsense_Mutation_p.Y24*	NM_130794	NP_570612	Q9H112	CST11_HUMAN	cystatin 11 isoform 1 precursor	24					defense response to bacterium	cytoplasm|nucleus	cysteine-type endopeptidase inhibitor activity				0	Colorectal(13;0.0431)|Lung NSC(19;0.235)					TCCTTGCTTGGTAGGGGAGGG	0.517													41	115	---	---	---	---	PASS
C20orf3	57136	broad.mit.edu	37	20	24950913	24950913	+	Silent	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24950913C>T	uc002wty.2	-	6	734	c.633G>A	c.(631-633)AAG>AAA	p.K211K	C20orf3_uc002wtz.2_Silent_p.K211K|C20orf3_uc010zsw.1_Silent_p.K211K	NM_020531	NP_065392	Q9HDC9	APMAP_HUMAN	chromosome 20 open reading frame 3	211	Extracellular (Potential).				biosynthetic process	cell surface|integral to membrane	arylesterase activity|strictosidine synthase activity			ovary(1)	1						TGAAATAAATCTTCCTCCCAT	0.512													105	248	---	---	---	---	PASS
XKR7	343702	broad.mit.edu	37	20	30584970	30584970	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30584970C>T	uc002wxe.2	+	3	1624	c.1450C>T	c.(1450-1452)CGG>TGG	p.R484W		NM_001011718	NP_001011718	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related	484						integral to membrane				ovary(1)|breast(1)|skin(1)	3			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AGGTGCTGAGCGGGATGGGGC	0.687													45	64	---	---	---	---	PASS
C20orf112	140688	broad.mit.edu	37	20	31062443	31062443	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31062443T>A	uc002wxu.3	-	2	227	c.70A>T	c.(70-72)AGG>TGG	p.R24W	C20orf112_uc010gec.2_5'UTR|C20orf112_uc002wxv.3_Missense_Mutation_p.R24W|C20orf112_uc002wxw.1_RNA	NM_080616	NP_542183	Q96MY1	CT112_HUMAN	hypothetical protein LOC140688	24											0						CTCCGCATCCTCTCGTCCTGG	0.627													23	78	---	---	---	---	PASS
ZFP64	55734	broad.mit.edu	37	20	50803458	50803458	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50803458C>A	uc002xwl.2	-	2	548	c.199G>T	c.(199-201)GTC>TTC	p.V67F	ZFP64_uc002xwk.2_Missense_Mutation_p.V67F|ZFP64_uc002xwm.2_Missense_Mutation_p.V65F|ZFP64_uc002xwn.2_Missense_Mutation_p.V67F	NM_018197	NP_060667	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform a	67					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						ACAAACTGGACCGTGCTGGGG	0.572													20	54	---	---	---	---	PASS
KCNQ2	3785	broad.mit.edu	37	20	62038177	62038177	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62038177G>T	uc002yey.1	-	17	2616	c.2439C>A	c.(2437-2439)AAC>AAA	p.N813K	KCNQ2_uc002yez.1_Missense_Mutation_p.N782K|KCNQ2_uc002yfa.1_Missense_Mutation_p.N795K|KCNQ2_uc002yfb.1_Missense_Mutation_p.N785K	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein	813	Cytoplasmic (Potential).				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	GAGCATCCAGGTTCTCCTTGG	0.617													7	28	---	---	---	---	PASS
ZBTB46	140685	broad.mit.edu	37	20	62421833	62421833	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62421833G>A	uc002ygv.1	-	2	479	c.278C>T	c.(277-279)GCG>GTG	p.A93V	ZBTB46_uc002ygu.2_RNA	NM_025224	NP_079500	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	93	BTB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)|ovary(1)	2	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					CGCCAGGTGCGCTGAGTACAT	0.602													5	57	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22838977	22838977	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22838977G>C	uc002yld.1	+	13	1954	c.1705G>C	c.(1705-1707)GTT>CTT	p.V569L	NCAM2_uc011acb.1_Missense_Mutation_p.V427L	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	569	Fibronectin type-III 1.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TGAAATCAGGGTTGCAGCTGT	0.279													35	34	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	32119262	32119262	+	IGR	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32119262G>T								KRTAP20-3 (103807 upstream) : KRTAP21-2 (9 downstream)																							ATGACCTGTAGTGATGATTAG	0.373													75	176	---	---	---	---	PASS
SYNJ1	8867	broad.mit.edu	37	21	34072214	34072214	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34072214C>A	uc002yqh.2	-	4	530	c.530G>T	c.(529-531)AGT>ATT	p.S177I	SYNJ1_uc011ads.1_Missense_Mutation_p.S138I|SYNJ1_uc002yqf.2_Missense_Mutation_p.S138I|SYNJ1_uc002yqg.2_Missense_Mutation_p.S138I|SYNJ1_uc002yqi.2_Missense_Mutation_p.S177I	NM_003895	NP_003886	O43426	SYNJ1_HUMAN	synaptojanin 1 isoform a	138	SAC.						inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			ovary(4)|skin(1)	5						CAAATCTAAACTGATGCCAGA	0.388													4	100	---	---	---	---	PASS
RCAN1	1827	broad.mit.edu	37	21	35893929	35893929	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35893929C>A	uc002yue.2	-	3	526	c.454G>T	c.(454-456)GCT>TCT	p.A152S	RCAN1_uc002yuc.2_Missense_Mutation_p.A71S|RCAN1_uc002yud.2_Missense_Mutation_p.A17S|RCAN1_uc002yub.2_Missense_Mutation_p.A97S|RCAN1_uc011adx.1_Missense_Mutation_p.A97S	NM_004414	NP_004405	P53805	RCAN1_HUMAN	calcipressin 1 isoform a	152					blood circulation|calcium-mediated signaling|central nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						TTTGGCGGAGCCAGGTGTGAG	0.527													9	34	---	---	---	---	PASS
DNMT3L	29947	broad.mit.edu	37	21	45670819	45670819	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45670819G>T	uc002zeg.1	-	10	1267	c.783C>A	c.(781-783)TTC>TTA	p.F261L	DNMT3L_uc002zeh.1_Missense_Mutation_p.F261L	NM_175867	NP_787063	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein	261				F->A: Loss of binding to DNMT3A.	DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		GGTGGAACTGGAACAGGTACC	0.662													3	5	---	---	---	---	PASS
KRTAP10-8	386681	broad.mit.edu	37	21	46032303	46032303	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46032303C>G	uc002zfo.1	+	1	308	c.286C>G	c.(286-288)CCT>GCT	p.P96A	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198695	NP_941968	P60410	KR108_HUMAN	keratin associated protein 10-8	96	19 X 5 AA repeats of C-C-X(3).					keratin filament				large_intestine(1)|breast(1)	2						CTCCTGCACACCTTCATGCTG	0.662													46	53	---	---	---	---	PASS
COL18A1	80781	broad.mit.edu	37	21	46932276	46932276	+	Silent	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46932276C>G	uc011afs.1	+	42	5241	c.5220C>G	c.(5218-5220)CTC>CTG	p.L1740L	COL18A1_uc002zhg.2_Silent_p.L1325L|COL18A1_uc002zhi.2_Silent_p.L1505L|SLC19A1_uc010gpy.1_Intron|COL18A1_uc002zhj.2_Silent_p.L306L|COL18A1_uc002zhk.2_Silent_p.L150L	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor	1743	Nonhelical region 11 (NC11).				cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		ACATCGTGCTCTGCATTGAGA	0.692													13	13	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23077342	23077342	+	RNA	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23077342C>T	uc011aim.1	+	187		c.10033C>T								Parts of antibodies, mostly variable regions.												0						GTCACCATCTCCTGCACTGGA	0.542													127	265	---	---	---	---	PASS
PIWIL3	440822	broad.mit.edu	37	22	25152463	25152463	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25152463C>G	uc003abd.1	-	5	982	c.565G>C	c.(565-567)GAG>CAG	p.E189Q	PIWIL3_uc011ajx.1_Missense_Mutation_p.E80Q|PIWIL3_uc011ajy.1_Missense_Mutation_p.E80Q|PIWIL3_uc010gut.1_Missense_Mutation_p.E189Q	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3	189					cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						TTAACCCGCTCTTTTAGTGGC	0.328													27	44	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26299711	26299711	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26299711G>T	uc003abz.1	+	31	5311	c.5061G>T	c.(5059-5061)AAG>AAT	p.K1687N	MYO18B_uc003aca.1_Missense_Mutation_p.K1568N|MYO18B_uc010guy.1_Missense_Mutation_p.K1569N|MYO18B_uc010guz.1_Missense_Mutation_p.K1567N|MYO18B_uc011aka.1_Missense_Mutation_p.K841N|MYO18B_uc011akb.1_Missense_Mutation_p.K1200N	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1687	Potential.|Tail.|Gln-rich.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						CTGGCTTGAAGGAGAGGCTCT	0.552													6	11	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26299712	26299712	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26299712G>T	uc003abz.1	+	31	5312	c.5062G>T	c.(5062-5064)GAG>TAG	p.E1688*	MYO18B_uc003aca.1_Nonsense_Mutation_p.E1569*|MYO18B_uc010guy.1_Nonsense_Mutation_p.E1570*|MYO18B_uc010guz.1_Nonsense_Mutation_p.E1568*|MYO18B_uc011aka.1_Nonsense_Mutation_p.E842*|MYO18B_uc011akb.1_Nonsense_Mutation_p.E1201*	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1688	Potential.|Tail.|Gln-rich.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						TGGCTTGAAGGAGAGGCTCTG	0.557													6	11	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26351204	26351204	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26351204G>A	uc003abz.1	+	39	6280	c.6030G>A	c.(6028-6030)GCG>GCA	p.A2010A	MYO18B_uc003aca.1_Silent_p.A1891A|MYO18B_uc010guy.1_Silent_p.A1892A|MYO18B_uc010guz.1_Silent_p.A1890A|MYO18B_uc011aka.1_Silent_p.A1164A|MYO18B_uc011akb.1_Silent_p.A1523A|MYO18B_uc010gva.1_Silent_p.A8A	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2010	Tail.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						TTTCACAGGCGGCCACCTCCG	0.647													7	16	---	---	---	---	PASS
ENTHD1	150350	broad.mit.edu	37	22	40161479	40161479	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40161479G>T	uc003ayg.2	-	6	1219	c.968C>A	c.(967-969)GCA>GAA	p.A323E		NM_152512	NP_689725	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	323										ovary(2)|skin(1)	3	Melanoma(58;0.0749)					AAGACCTTCTGCAGCTGATTG	0.398													108	256	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41565529	41565529	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41565529G>A	uc003azl.3	+	26	4590	c.4195G>A	c.(4195-4197)GAT>AAT	p.D1399N		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	1399				D->Y: Does not interact with TFAP2A and inhibits transcriptional coactivation of TFAP2A by CITED2. Does not inhibit interaction with CITED2, DNA-binding of TFAP2A or nuclear localization of TFAP2A or CITED2.	apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding	p.D1399Y(1)		haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						ATCTTACCTCGATAGTGTTCA	0.338			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				133	186	---	---	---	---	PASS
EFCAB6	64800	broad.mit.edu	37	22	43930576	43930576	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43930576G>T	uc003bdy.1	-	30	4440	c.4225C>A	c.(4225-4227)CAC>AAC	p.H1409N	EFCAB6_uc003bdz.1_Missense_Mutation_p.H1257N|EFCAB6_uc010gzi.1_Missense_Mutation_p.H1257N	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	1409	Interaction with AR.|Interaction with PARK7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				ACCATCTTGTGTGCATTCTGG	0.393													42	75	---	---	---	---	PASS
EFCAB6	64800	broad.mit.edu	37	22	43950739	43950739	+	Intron	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43950739C>T	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc010gzj.1_Intron	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				GACTGACTGGCGTTTCTTACC	0.488													54	114	---	---	---	---	PASS
SBF1	6305	broad.mit.edu	37	22	50893648	50893648	+	Intron	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50893648C>T	uc003blh.2	-						SBF1_uc003ble.2_Intron|SBF1_uc003blf.2_Intron|SBF1_uc011arx.1_Intron	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1						protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		CAGCGGCCTGCCCACCTGGTG	0.682													16	24	---	---	---	---	PASS
VCX3A	51481	broad.mit.edu	37	X	6451848	6451848	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6451848C>A	uc004crs.2	-	3	806	c.499G>T	c.(499-501)GAG>TAG	p.E167*	VCX3A_uc010ndk.1_Intron	NM_016379	NP_057463	Q9NNX9	VCX3_HUMAN	variable charge, X-linked 3A	167	8 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.|7.|Glu-rich.				brain development	nucleolus					0						ACCTGGCTCTCCTGACTCAGT	0.577													66	299	---	---	---	---	PASS
GRPR	2925	broad.mit.edu	37	X	16170572	16170572	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16170572T>A	uc004cxj.2	+	3	1612	c.959T>A	c.(958-960)TTT>TAT	p.F320Y		NM_005314	NP_005305	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	320	Helical; Name=7; (Potential).				cell proliferation	integral to plasma membrane	bombesin receptor activity			ovary(3)|lung(1)	4	Hepatocellular(33;0.183)					GTGAACCCCTTTGCCCTCTAC	0.572													84	208	---	---	---	---	PASS
TXLNG	55787	broad.mit.edu	37	X	16858001	16858001	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16858001G>T	uc004cxq.1	+	9	1261	c.1210G>T	c.(1210-1212)GAA>TAA	p.E404*	TXLNG_uc010ney.1_Nonsense_Mutation_p.E272*	NM_018360	NP_060830	Q9NUQ3	TXLNG_HUMAN	gamma-taxilin	404	Potential.				cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane				lung(1)	1						TACCAAATGGGAAAACAATAA	0.368													36	121	---	---	---	---	PASS
SCML2	10389	broad.mit.edu	37	X	18283770	18283770	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18283770G>C	uc004cyl.2	-	8	1040	c.883C>G	c.(883-885)CCC>GCC	p.P295A	SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Missense_Mutation_p.P295A|SCML2_uc011miz.1_Missense_Mutation_p.P229A|SCML2_uc010nfc.2_Missense_Mutation_p.P31A	NM_006089	NP_006080	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2	295					anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(33;0.183)					CTCCTTTTGGGGACTGCAGTA	0.403													68	272	---	---	---	---	PASS
RPS6KA3	6197	broad.mit.edu	37	X	20212297	20212297	+	Intron	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20212297A>G	uc004czu.2	-						RPS6KA3_uc011mjk.1_Intron|RPS6KA3_uc004czv.2_Intron|RPS6KA3_uc011mjl.1_Intron|RPS6KA3_uc011mjm.1_Intron	NM_004586	NP_004577	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|central nervous system development|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|skeletal system development|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(4)|stomach(1)|ovary(1)|lung(1)|breast(1)	8						AATAGAGATTAATTATATACC	0.323													19	54	---	---	---	---	PASS
KLHL34	257240	broad.mit.edu	37	X	21674689	21674689	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21674689C>A	uc004czz.1	-	1	1760	c.1218G>T	c.(1216-1218)ACG>ACT	p.T406T		NM_153270	NP_695002	Q8N239	KLH34_HUMAN	kelch-like 34	406	Kelch 2.									ovary(1)	1						CGGGCACTTCCGTCCAAGCGT	0.731													4	6	---	---	---	---	PASS
ZNF645	158506	broad.mit.edu	37	X	22291404	22291404	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22291404C>A	uc004dai.1	+	1	345	c.296C>A	c.(295-297)CCT>CAT	p.P99H		NM_152577	NP_689790	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	99						intracellular	zinc ion binding			lung(1)|pancreas(1)	2						TGTCGTTATCCTGTGCTGAGA	0.418													4	195	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	31165523	31165523	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31165523C>A	uc004dda.1	-	75	10910	c.10666G>T	c.(10666-10668)GCT>TCT	p.A3556S	DMD_uc004dcq.1_Missense_Mutation_p.A827S|DMD_uc004dcr.1_Missense_Mutation_p.A976S|DMD_uc004dcs.1_Missense_Mutation_p.A986S|DMD_uc004dct.1_Missense_Mutation_p.A1096S|DMD_uc004dcu.1_Missense_Mutation_p.A1096S|DMD_uc004dcv.1_Missense_Mutation_p.A1083S|DMD_uc004dcw.2_Missense_Mutation_p.A2212S|DMD_uc004dcx.2_Missense_Mutation_p.A2215S|DMD_uc004dcz.2_Missense_Mutation_p.A3433S|DMD_uc004dcy.1_Missense_Mutation_p.A3552S|DMD_uc004ddb.1_Missense_Mutation_p.A3548S|DMD_uc004dcm.1_Missense_Mutation_p.A488S|DMD_uc004dcn.1_Missense_Mutation_p.A475S|DMD_uc004dco.1_Missense_Mutation_p.A488S|DMD_uc004dcp.1_Missense_Mutation_p.A475S|DMD_uc011mkb.1_Missense_Mutation_p.A378S	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	3556					muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATGAGCTCAGCATCCCGGGGA	0.552													31	81	---	---	---	---	PASS
USP9X	8239	broad.mit.edu	37	X	41000371	41000371	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41000371C>A	uc004dfb.2	+	8	1556	c.923C>A	c.(922-924)TCA>TAA	p.S308*	USP9X_uc004dfc.2_Nonsense_Mutation_p.S308*	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	308					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						GATGCTCTTTCAATGATTATT	0.289													29	39	---	---	---	---	PASS
CASK	8573	broad.mit.edu	37	X	41383258	41383258	+	Silent	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41383258A>G	uc004dfl.3	-	26	2581	c.2535T>C	c.(2533-2535)TTT>TTC	p.F845F	CASK_uc004dfj.3_Silent_p.F390F|CASK_uc004dfk.3_Silent_p.F665F|CASK_uc004dfm.3_Silent_p.F822F|CASK_uc004dfn.3_Silent_p.F821F	NM_003688	NP_003679	O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein	850	Guanylate kinase-like.				cell adhesion	actin cytoskeleton|cytoplasm|nucleus|plasma membrane	ATP binding|calmodulin binding|guanylate kinase activity|protein serine/threonine kinase activity			ovary(3)|lung(2)|stomach(1)	6						CAAAAGGAGCAAACTCTGCAG	0.353													9	37	---	---	---	---	PASS
USP11	8237	broad.mit.edu	37	X	47101705	47101705	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47101705G>T	uc004dhp.2	+	10	1533	c.1533G>T	c.(1531-1533)CAG>CAT	p.Q511H	USP11_uc004dhq.2_Missense_Mutation_p.Q238H	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	511					protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						AGCCAGAGCAGGTGTGGGGCA	0.547													7	26	---	---	---	---	PASS
TBC1D25	4943	broad.mit.edu	37	X	48418720	48418720	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48418720G>A	uc004dka.1	+	6	1535	c.1424G>A	c.(1423-1425)GGT>GAT	p.G475D	TBC1D25_uc011mly.1_Missense_Mutation_p.G417D|TBC1D25_uc004dkb.1_Missense_Mutation_p.G221D|TBC1D25_uc011mlz.1_Missense_Mutation_p.G221D|TBC1D25_uc011mma.1_Missense_Mutation_p.G221D|TBC1D25_uc004dkc.1_Missense_Mutation_p.G221D|TBC1D25_uc011mmb.1_Missense_Mutation_p.G479D|TBC1D25_uc011mmc.1_Missense_Mutation_p.G221D|TBC1D25_uc011mmd.1_Missense_Mutation_p.G221D	NM_002536	NP_002527	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	475						intracellular	Rab GTPase activator activity			ovary(1)	1						AGGCCTGCTGGTGGAGGAGGT	0.637													15	71	---	---	---	---	PASS
RBM3	5935	broad.mit.edu	37	X	48433599	48433599	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48433599G>T	uc004dkf.1	+	2	170	c.31G>T	c.(31-33)GGA>TGA	p.G11*	RBM3_uc004dkd.1_RNA|RBM3_uc004dkg.2_Nonsense_Mutation_p.G11*	NM_006743	NP_006734	P98179	RBM3_HUMAN	RNA binding motif protein 3	11	RRM.				positive regulation of translation	dendrite|nucleus	nucleotide binding|RNA binding			ovary(1)	1						GCTCTTCGTGGGAGGGCTCAA	0.517											OREG0019765	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	25	---	---	---	---	PASS
GRIPAP1	56850	broad.mit.edu	37	X	48853675	48853675	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48853675G>C	uc004dly.1	-	5	328	c.293C>G	c.(292-294)GCC>GGC	p.A98G	GRIPAP1_uc004dma.2_Missense_Mutation_p.A98G	NM_020137	NP_064522	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1 isoform 1	98	Potential.					early endosome				breast(2)|kidney(1)	3						GCTGAACTCGGCCATTAGTGT	0.537													3	19	---	---	---	---	PASS
CACNA1F	778	broad.mit.edu	37	X	49065139	49065139	+	Silent	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49065139C>A	uc004dnb.2	-	43	5054	c.4992G>T	c.(4990-4992)ACG>ACT	p.T1664T	CACNA1F_uc010nip.2_Silent_p.T1653T	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,	1664	Cytoplasmic (Potential).				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	GGGAGACCATCGTGGCCTGTG	0.562													20	88	---	---	---	---	PASS
CACNA1F	778	broad.mit.edu	37	X	49079264	49079264	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49079264A>T	uc004dnb.2	-	16	2214	c.2152T>A	c.(2152-2154)TAT>AAT	p.Y718N	CACNA1F_uc010nip.2_Missense_Mutation_p.Y707N	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,	718	Extracellular (Potential).|II.				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	ATACCATCATACATGACCACG	0.542													20	121	---	---	---	---	PASS
DGKK	139189	broad.mit.edu	37	X	50114795	50114795	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50114795G>T	uc010njr.1	-	27	3600	c.3540C>A	c.(3538-3540)GCC>GCA	p.A1180A		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	1180					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					TGGCATCCAGGGCGCTTTGTA	0.433													14	23	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53564623	53564623	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53564623C>A	uc004dsp.2	-	78	12433	c.12031G>T	c.(12031-12033)GGG>TGG	p.G4011W	HUWE1_uc004dsn.2_Missense_Mutation_p.G2819W|HUWE1_uc004dsq.1_Missense_Mutation_p.G311W	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	4011					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TTCCGGAGCCCCTCATCTAAA	0.468													12	21	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54265438	54265438	+	Intron	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54265438C>T	uc004dtd.1	-						WNK3_uc004dtc.1_Missense_Mutation_p.G1249E	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2						intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						GCCAAAATATCCACCTCCTGT	0.483													32	71	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54321179	54321179	+	Silent	SNP	A	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54321179A>T	uc004dtd.1	-	8	1939	c.1500T>A	c.(1498-1500)GCT>GCA	p.A500A	WNK3_uc004dtc.1_Silent_p.A500A	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	500					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						CCAAACAGCCAGCAGGCTTCT	0.478													25	108	---	---	---	---	PASS
GNL3L	54552	broad.mit.edu	37	X	54569759	54569759	+	Silent	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54569759G>T	uc004dth.1	+	7	649	c.510G>T	c.(508-510)CTG>CTT	p.L170L	GNL3L_uc004dti.2_RNA	NM_019067	NP_061940	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3	170					ribosome biogenesis	nucleolus	GTP binding			ovary(1)	1						AGCTGGTCCTGGTCTTGAACA	0.547													12	45	---	---	---	---	PASS
ITIH5L	347365	broad.mit.edu	37	X	54784427	54784427	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54784427G>T	uc004dtj.2	-	8	2110	c.2080C>A	c.(2080-2082)CCT>ACT	p.P694T		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	694					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						AGGGTATGAGGGCTCTCTCCC	0.488													27	230	---	---	---	---	PASS
DLG3	1741	broad.mit.edu	37	X	69665408	69665408	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69665408G>T	uc004dyi.1	+	1	685	c.357G>T	c.(355-357)CAG>CAT	p.Q119H		NM_021120	NP_066943	Q92796	DLG3_HUMAN	synapse-associated protein 102 isoform a	119					axon guidance|negative regulation of cell proliferation|synaptic transmission	plasma membrane	guanylate kinase activity			large_intestine(1)|pancreas(1)	2	Renal(35;0.156)					GGTATGAGCAGGTATGGACCA	0.672													6	7	---	---	---	---	PASS
TSIX	9383	broad.mit.edu	37	X	73043319	73043319	+	RNA	SNP	C	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73043319C>T	uc004ebn.2	+	1		c.31280C>T			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0						CCTCATCTCTCTtatcctcag	0.249													13	12	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73071841	73071841	+	RNA	SNP	C	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73071841C>A	uc004ebm.1	-	1		c.748G>T				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						CACCGATGGGCGATGAAAAAA	0.428													17	21	---	---	---	---	PASS
TRMT2B	79979	broad.mit.edu	37	X	100297169	100297169	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100297169G>A	uc004egq.2	-	2	409	c.110C>T	c.(109-111)CCA>CTA	p.P37L	TRMT2B_uc004egp.2_RNA|TRMT2B_uc004egr.2_Missense_Mutation_p.P37L|TRMT2B_uc004egs.2_Missense_Mutation_p.P37L|TRMT2B_uc004egt.2_Missense_Mutation_p.P37L|TRMT2B_uc004egu.2_Intron|TRMT2B_uc004egv.2_Missense_Mutation_p.P37L	NM_024917	NP_079193	Q96GJ1	TRM2_HUMAN	TRM2 tRNA methyltransferase 2 homolog B	37							tRNA (uracil-5-)-methyltransferase activity			ovary(1)	1						TGACCATCCTGGTGGATTTCT	0.483													247	79	---	---	---	---	PASS
RAB40A	142684	broad.mit.edu	37	X	102755638	102755638	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102755638T>A	uc004ekk.2	-	3	389	c.47A>T	c.(46-48)AAG>ATG	p.K16M		NM_080879	NP_543155	Q8WXH6	RB40A_HUMAN	RAB40A, member RAS oncogene family	16					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding				0						CAGCAGGAACTTGAGCAGGAA	0.677													161	45	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105075071	105075071	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105075071G>T	uc004emd.2	+	2	385	c.82G>T	c.(82-84)GAT>TAT	p.D28Y	NRK_uc010npc.1_5'UTR	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	28	Protein kinase.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						ATTCTCACTAGATAAAACCAT	0.284										HNSCC(51;0.14)			149	74	---	---	---	---	PASS
CAPN6	827	broad.mit.edu	37	X	110490620	110490620	+	Silent	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110490620G>A	uc004epc.1	-	12	1887	c.1719C>T	c.(1717-1719)ACC>ACT	p.T573T	CAPN6_uc011msu.1_Silent_p.T318T	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6	573	C2.				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						GAATGTCAGTGGTCCTTCTGT	0.428													65	698	---	---	---	---	PASS
AGTR2	186	broad.mit.edu	37	X	115304522	115304522	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115304522G>T	uc004eqh.3	+	3	1196	c.989G>T	c.(988-990)CGC>CTC	p.R330L		NM_000686	NP_000677	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	330	Cytoplasmic (Potential).				behavior|blood vessel remodeling|brain development|G-protein signaling, coupled to cGMP nucleotide second messenger|intracellular protein kinase cascade|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of heart rate|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of nitric-oxide synthase activity|positive regulation of phosphoprotein phosphatase activity|positive regulation of vasodilation|regulation of systemic arterial blood pressure by circulatory renin-angiotensin		angiotensin type II receptor activity|receptor antagonist activity			ovary(2)|lung(1)	3						CAGAAGCTCCGCAGTGTGTTT	0.463													429	167	---	---	---	---	PASS
SLC6A14	11254	broad.mit.edu	37	X	115582714	115582714	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115582714T>A	uc004eqi.2	+	8	1142	c.1038T>A	c.(1036-1038)GAT>GAA	p.D346E		NM_007231	NP_009162	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid	346					cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)	GCTTCTCTGATGCCATTGTGG	0.408													332	165	---	---	---	---	PASS
BCORL1	63035	broad.mit.edu	37	X	129149114	129149114	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129149114G>T	uc004evb.1	+	4	2480	c.2366G>T	c.(2365-2367)CGC>CTC	p.R789L	BCORL1_uc010nrd.1_Missense_Mutation_p.R691L	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	789					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						ACTCCAGCCCGCATTGCCCCT	0.572													68	43	---	---	---	---	PASS
IGSF1	3547	broad.mit.edu	37	X	130409746	130409746	+	Intron	SNP	A	G	G			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130409746A>G	uc004ewd.2	-						IGSF1_uc004ewe.3_Intron|IGSF1_uc004ewf.2_Intron	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1						regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						GTGTCTAGAAAGAGACCAAGG	0.493													94	77	---	---	---	---	PASS
GPC3	2719	broad.mit.edu	37	X	132795841	132795841	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132795841G>A	uc004exe.1	-	6	1520	c.1330C>T	c.(1330-1332)CAG>TAG	p.Q444*	GPC3_uc004exd.1_Nonsense_Mutation_p.Q316*|GPC3_uc010nrn.1_Nonsense_Mutation_p.Q467*|GPC3_uc011mvh.1_Nonsense_Mutation_p.Q428*|GPC3_uc010nro.1_Nonsense_Mutation_p.Q390*	NM_004484	NP_004475	P51654	GPC3_HUMAN	glypican 3 isoform 2 precursor	444						extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity			lung(2)|prostate(1)|breast(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)					AGATTGAACTGGTTTTTCATT	0.398			T|D|Mis|N|F|S			Wilms tumour			Simpson-Golabi-Behmel_syndrome				19	150	---	---	---	---	PASS
FAM50A	9130	broad.mit.edu	37	X	153678268	153678268	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153678268G>A	uc004fll.3	+	10	916	c.818G>A	c.(817-819)CGG>CAG	p.R273Q		NM_004699	NP_004690	Q14320	FA50A_HUMAN	XAP-5 protein	273					spermatogenesis	nucleus				ovary(1)	1	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACCAAGGCACGGGGGAAGAGT	0.642											OREG0003609	type=REGULATORY REGION|Gene=FAM50A|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	18	59	---	---	---	---	PASS
C1orf135	79000	broad.mit.edu	37	1	26186960	26186960	+	5'Flank	DEL	T	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26186960delT	uc001bkw.1	-							NM_024037	NP_076942	Q9H7T9	CA135_HUMAN	aurora A-binding protein												0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00521)|all_lung(284;0.00764)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.117)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.28e-25)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000787)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		AATTTTGTAATTTTTTTTTTT	0.274													4	2	---	---	---	---	
OSCP1	127700	broad.mit.edu	37	1	36884364	36884364	+	Intron	DEL	A	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36884364delA	uc001cap.2	-						OSCP1_uc001caq.2_Intron	NM_145047	NP_659484	Q8WVF1	OSCP1_HUMAN	oxidored-nitro domain-containing protein isoform						transport	basal plasma membrane				ovary(2)|central_nervous_system(1)|pancreas(1)	4						ctaaaaatacaaaaaaaaaaa	0.000													5	4	---	---	---	---	
COL11A1	1301	broad.mit.edu	37	1	103491446	103491446	+	Intron	DEL	G	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103491446delG	uc001dul.2	-						COL11A1_uc001duk.2_Intron|COL11A1_uc001dum.2_Frame_Shift_Del_p.S281fs|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TAAACTTTTTGGATTTTTCCT	0.343													109	80	---	---	---	---	
HSD3B1	3283	broad.mit.edu	37	1	120050300	120050300	+	Intron	DEL	G	-	-	rs6671149	by1000genomes	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120050300delG	uc001ehv.1	+						HSD3B1_uc001ehw.2_Intron	NM_000862	NP_000853	P14060	3BHS1_HUMAN	3 beta-hydroxysteroid dehydrogenase 1						androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	NADH(DB00157)|Trilostane(DB01108)	GCATGTATGTGGGGGGAGATG	0.388													45	32	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145368208	145368213	+	Intron	DEL	TCTCTG	-	-	rs72354261		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145368208_145368213delTCTCTG	uc001end.3	+						NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GGTCACTTTCtctctgtctctgtctc	0.320													8	6	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148344953	148344953	+	Intron	DEL	G	-	-	rs67971242		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148344953delG	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|NBPF14_uc009wkf.1_Intron|uc001erd.3_Intron|uc001erc.3_Intron|uc010paj.1_Intron|uc010pau.1_5'Flank|uc010pav.1_Intron|uc010paw.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						agaaactcaagggcgcgtcaa	0.174													9	4	---	---	---	---	
PIP5K1A	8394	broad.mit.edu	37	1	151214277	151214277	+	Intron	DEL	A	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151214277delA	uc001exj.2	+						PIP5K1A_uc001exi.2_Intron|PIP5K1A_uc010pcu.1_Intron|PIP5K1A_uc001exk.2_Intron|PIP5K1A_uc010pcv.1_Intron	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type						phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			actccatctcaaaaaaaaaaa	0.184													4	3	---	---	---	---	
DUSP12	11266	broad.mit.edu	37	1	161723252	161723254	+	Intron	DEL	CTT	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161723252_161723254delCTT	uc001gbo.2	+						DUSP12_uc001gbp.2_Intron	NM_007240	NP_009171	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12						positive regulation of glucokinase activity	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity|zinc ion binding			breast(1)	1	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			TAGTGAACTACTTCTGGTTGAGA	0.241													5	3	---	---	---	---	
MGST3	4259	broad.mit.edu	37	1	165623279	165623281	+	Intron	DEL	AGG	-	-	rs140199766		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165623279_165623281delAGG	uc001gdf.2	+						MGST3_uc001gdg.2_Intron	NM_004528	NP_004519	O14880	MGST3_HUMAN	microsomal glutathione S-transferase 3						leukotriene biosynthetic process|leukotriene production involved in inflammatory response|signal transduction|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glutathione peroxidase activity|glutathione transferase activity				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Glutathione(DB00143)	CCACCTGTCTAGGAGAAGGCCAA	0.488													2	7	---	---	---	---	
DENND1B	163486	broad.mit.edu	37	1	197704952	197704953	+	Intron	INS	-	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197704952_197704953insA	uc001guf.3	-						DENND1B_uc010ppe.1_Intron|DENND1B_uc010ppf.1_Intron|DENND1B_uc001gue.3_Intron	NM_144977	NP_659414	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 2							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						CAAAAAGGGACAATTGGAAGAA	0.455													60	32	---	---	---	---	
CD55	1604	broad.mit.edu	37	1	207504820	207504821	+	Intron	DEL	AC	-	-	rs67713531		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207504820_207504821delAC	uc001hfq.3	+						CD55_uc001hfp.3_Intron|CD55_uc001hfr.3_Intron|CD55_uc010psf.1_Intron|CD55_uc009xcf.2_Intron|CD55_uc009xce.2_Intron|CD55_uc009xcg.2_Intron	NM_000574	NP_000565	P08174	DAF_HUMAN	decay accelerating factor for complement isoform						complement activation, classical pathway|elevation of cytosolic calcium ion concentration|innate immune response|respiratory burst	anchored to membrane|extracellular region|integral to plasma membrane|membrane raft|soluble fraction	receptor activity			ovary(1)	1					Chloramphenicol(DB00446)	tggcTTGTATacacacacacac	0.104													6	4	---	---	---	---	
ACTN2	88	broad.mit.edu	37	1	236917238	236917238	+	Intron	DEL	C	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236917238delC	uc001hyf.2	+						ACTN2_uc001hyg.2_Intron|ACTN2_uc009xgi.1_Intron|ACTN2_uc010pxu.1_Intron|ACTN2_uc001hyh.2_Intron	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2						focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TGTCCTTGGGCCCTGACAGGT	0.498													244	113	---	---	---	---	
ELMOD3	84173	broad.mit.edu	37	2	85587802	85587802	+	Intron	DEL	T	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85587802delT	uc002spf.3	+						ELMOD3_uc010fgg.2_Intron|ELMOD3_uc002spg.3_Intron|ELMOD3_uc002sph.3_Intron|ELMOD3_uc010ysn.1_Intron|ELMOD3_uc010yso.1_Intron|ELMOD3_uc010ysp.1_Intron	NM_001135021	NP_001128493	Q96FG2	ELMD3_HUMAN	ELMO/CED-12 domain containing 3 isoform b						phagocytosis	cytoskeleton				ovary(2)	2						GCCTTAATGATTTTTTTTTTC	0.179													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89399858	89399859	+	Intron	INS	-	AA	AA			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89399858_89399859insAA	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GATTCCTGCACAGTCTGACCAG	0.569													4	5	---	---	---	---	
R3HDM1	23518	broad.mit.edu	37	2	136481349	136481357	+	Intron	DEL	AAAAAAAAA	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136481349_136481357delAAAAAAAAA	uc002tuo.2	+						R3HDM1_uc010fni.2_Intron|R3HDM1_uc002tup.2_Intron|R3HDM1_uc010zbh.1_Intron	NM_015361	NP_056176	Q15032	R3HD1_HUMAN	R3H domain containing 1								nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)		tccatctcccaaaaaaaaaaaaaaaaaaa	0.153													5	3	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179422131	179422131	+	Frame_Shift_Del	DEL	T	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179422131delT	uc010zfg.1	-	278	80378	c.80154delA	c.(80152-80154)AAAfs	p.K26718fs	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Frame_Shift_Del_p.K20413fs|TTN_uc010zfi.1_Frame_Shift_Del_p.K20346fs|TTN_uc010zfj.1_Frame_Shift_Del_p.K20221fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	27645							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTTGTTGGCTTTTTGCCATA	0.448													131	106	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179540656	179540656	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179540656delG	uc010zfg.1	-	144	30850	c.30626delC	c.(30625-30627)CCTfs	p.P10209fs	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Frame_Shift_Del_p.P6870fs|TTN_uc010fre.1_Intron|TTN_uc002una.1_RNA|TTN_uc010frf.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11136							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCTTTGGCAGGGGGAGCCTC	0.368													7	11	---	---	---	---	
C2orf67	151050	broad.mit.edu	37	2	210894384	210894386	+	Intron	DEL	TTG	-	-	rs3835772		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210894384_210894386delTTG	uc002vds.2	-						C2orf67_uc002vdt.2_Intron	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050											ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		ATCAAATATATTGTTTTCTAACA	0.212													5	8	---	---	---	---	
ZFAND2B	130617	broad.mit.edu	37	2	220071889	220071889	+	Intron	DEL	T	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220071889delT	uc002vka.2	+						ZFAND2B_uc010zkt.1_Intron|ZFAND2B_uc010fwd.1_Intron|ZFAND2B_uc002vjy.1_Intron|ZFAND2B_uc002vjz.1_Intron|ZFAND2B_uc002vkb.1_5'Flank	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B							endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGGGGGGGTGGTCAGCGGC	0.627													3	3	---	---	---	---	
HJURP	55355	broad.mit.edu	37	2	234762665	234762665	+	Intron	DEL	C	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234762665delC	uc002vvg.2	-						HJURP_uc010znd.1_Intron|HJURP_uc010zne.1_Intron	NM_018410	NP_060880	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein						cell cycle|CenH3-containing nucleosome assembly at centromere|centromeric core chromatin assembly|chromosome segregation|regulation of DNA binding|regulation of protein complex assembly	condensed chromosome kinetochore|cytoplasm|nucleolus|nucleoplasm	DNA binding|histone binding			ovary(1)	1		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		GCCTGGGGCGCCCCAAACGCG	0.711													15	17	---	---	---	---	
NBEAL2	23218	broad.mit.edu	37	3	47046220	47046240	+	Intron	DEL	GTTCCCTGCCAACCCCCAGAG	-	-	rs11283920		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47046220_47046240delGTTCCCTGCCAACCCCCAGAG	uc003cqp.2	+						NBEAL2_uc010hjm.1_Intron|NBEAL2_uc010hjn.1_Intron|NBEAL2_uc010hjo.1_5'Flank	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2								binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CCTGGCCTCTGTTCCCTGCCAACCCCCAGAGGTCCCCAGCC	0.579													3	4	---	---	---	---	
USP19	10869	broad.mit.edu	37	3	49156180	49156180	+	Intron	DEL	A	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49156180delA	uc003cwd.1	-						USP19_uc003cwa.2_5'Flank|USP19_uc003cvz.3_Intron|USP19_uc011bcg.1_Intron|USP19_uc003cwb.2_Intron|USP19_uc003cwc.1_5'Flank|USP19_uc011bch.1_Intron|USP19_uc011bci.1_Intron	NM_006677	NP_006668	O94966	UBP19_HUMAN	ubiquitin thioesterase 19						ER-associated protein catabolic process|positive regulation of cell cycle process|protein deubiquitination|regulation of protein stability|response to endoplasmic reticulum stress|skeletal muscle atrophy	endoplasmic reticulum membrane|integral to membrane	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(4)|breast(2)|lung(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		actccatctcaaaaaaaaaag	0.139													4	2	---	---	---	---	
CCDC36	339834	broad.mit.edu	37	3	49278972	49278973	+	Intron	DEL	AC	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49278972_49278973delAC	uc003cwk.2	+						CCDC36_uc003cwl.3_Intron|CCDC36_uc011bck.1_Intron	NM_178173	NP_835467	Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36											ovary(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		acacacacatacacacacacac	0.079													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	83742548	83742549	+	IGR	INS	-	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83742548_83742549insT								None (None upstream) : None (None downstream)																							tccttccttcctcccttccttc	0.000													4	3	---	---	---	---	
EVC2	132884	broad.mit.edu	37	4	5699473	5699474	+	Intron	INS	-	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5699473_5699474insT	uc003gij.2	-						EVC2_uc011bwb.1_Intron|EVC2_uc003gik.2_Intron	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin							integral to membrane				large_intestine(3)|ovary(2)	5						AGGACATGCACttttttttttt	0.163													20	9	---	---	---	---	
APBB2	323	broad.mit.edu	37	4	40895623	40895623	+	Intron	DEL	A	-	-	rs10714456		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40895623delA	uc003gvl.2	-						APBB2_uc010ifu.2_Intron|APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc011byt.1_Intron	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						tttgctatttaaaaaaatgta	0.060													5	3	---	---	---	---	
PDLIM5	10611	broad.mit.edu	37	4	95578859	95578859	+	Intron	DEL	T	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95578859delT	uc003hti.2	+						PDLIM5_uc011cdx.1_Intron|PDLIM5_uc003hth.2_Intron|PDLIM5_uc003htj.2_Intron|PDLIM5_uc003htk.2_Intron|PDLIM5_uc011cdy.1_Intron|PDLIM5_uc003htl.2_Intron	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a						regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		ACTATGTAGAttttttttttt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	117536546	117536547	+	IGR	INS	-	GGAG	GGAG			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117536546_117536547insGGAG								MIR1973 (315622 upstream) : TRAM1L1 (468169 downstream)																							gaaggaaggaaggaagaaacaa	0.000													4	2	---	---	---	---	
FAM151B	167555	broad.mit.edu	37	5	79794833	79794833	+	Intron	DEL	A	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79794833delA	uc003kgv.1	+						FAM151B_uc010jal.1_Intron	NM_205548	NP_991111	Q6UXP7	F151B_HUMAN	hypothetical protein LOC167555												0		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)		TGGCAGATGGAAAAAAAAAAA	0.408													4	2	---	---	---	---	
UBR2	23304	broad.mit.edu	37	6	42652344	42652345	+	Intron	INS	-	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42652344_42652345insA	uc011dur.1	+						UBR2_uc011dus.1_Intron|UBR2_uc003osh.2_Intron|UBR2_uc011dut.1_Intron|UBR2_uc011duu.1_5'Flank	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			aaaacaaaaacaaaaaaAAAAC	0.193													4	3	---	---	---	---	
PDE1C	5137	broad.mit.edu	37	7	31864342	31864342	+	Intron	DEL	A	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31864342delA	uc003tcm.1	-						PDE1C_uc003tcn.1_Intron|PDE1C_uc003tco.1_Intron|PDE1C_uc003tcr.2_Intron|PDE1C_uc003tcs.2_Intron	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			TGAGAAAAGGAAAGAGGCAGA	0.443													40	19	---	---	---	---	
TFR2	7036	broad.mit.edu	37	7	100239271	100239271	+	5'Flank	DEL	G	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100239271delG	uc003uvv.1	-						TFR2_uc003uvw.1_Intron	NM_003227	NP_003218	Q9UP52	TFR2_HUMAN	transferrin receptor 2						cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CCCCAAGGGTGGGGGCACAGT	0.642													7	4	---	---	---	---	
DPY19L2P2	349152	broad.mit.edu	37	7	102895483	102895484	+	Intron	DEL	TG	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102895483_102895484delTG	uc003vbh.3	-						DPY19L2P2_uc003vbg.3_Intron|DPY19L2P2_uc010lit.2_Intron	NR_003561				RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						TATAAGAgtttgtgtgtgtgtg	0.228													4	2	---	---	---	---	
DENND2A	27147	broad.mit.edu	37	7	140301842	140301842	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140301842delC	uc010lnj.2	-	1	501	c.356delG	c.(355-357)GGAfs	p.G119fs	DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Frame_Shift_Del_p.G119fs|DENND2A_uc003vvw.2_Frame_Shift_Del_p.G119fs|DENND2A_uc003vvx.2_Frame_Shift_Del_p.G119fs	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	119										ovary(3)|breast(1)	4	Melanoma(164;0.00956)					TGGGTCCTGTCCCCCGACGTT	0.577													314	135	---	---	---	---	
ELP3	55140	broad.mit.edu	37	8	27964057	27964071	+	Intron	DEL	AAAAAAAAAAAAAAA	-	-	rs67256773		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27964057_27964071delAAAAAAAAAAAAAAA	uc003xgo.3	+						ELP3_uc003xgn.3_Intron|ELP3_uc011laq.1_Intron|ELP3_uc011lar.1_Intron|ELP3_uc011las.1_Intron|ELP3_uc011lat.1_Intron	NM_018091	NP_060561	Q9H9T3	ELP3_HUMAN	elongation protein 3 homolog						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	histone acetyltransferase activity|iron-sulfur cluster binding|metal ion binding|phosphorylase kinase regulator activity|protein binding				0		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		actccgtctcaaaaaaaaaaaaaaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	34510877	34510878	+	IGR	INS	-	AC	AC	rs150686488	by1000genomes	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34510877_34510878insAC								None (None upstream) : UNC5D (582097 downstream)																							ctctgctagatacacacacaca	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	47531273	47531274	+	IGR	INS	-	CACA	CACA	rs138753775	by1000genomes	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47531273_47531274insCACA								None (None upstream) : BEYLA (221234 downstream)																							GATTTAGCCTGcacacacacac	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58332252	58332252	+	IGR	DEL	T	-	-	rs68140715		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58332252delT								C8orf71 (134964 upstream) : FAM110B (574861 downstream)																							aagttttttcttttttttttt	0.000													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141263210	141263211	+	Intron	DEL	CT	-	-	rs140935423		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141263210_141263211delCT	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						GCAATCACCCCTGTTTATGAAG	0.460													7	5	---	---	---	---	
CBWD6	644019	broad.mit.edu	37	9	69207122	69207122	+	Intron	DEL	G	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69207122delG	uc004afj.3	-						CBWD6_uc004afk.3_Intron|CBWD6_uc011lrf.1_Intron	NM_001085457	NP_001078926	Q4V339	CBWD6_HUMAN	COBW domain containing 6								ATP binding				0						CATATGTGCTGTTTTTTTGGA	0.294													3	4	---	---	---	---	
CAMSAP1	157922	broad.mit.edu	37	9	138718041	138718042	+	Intron	DEL	CA	-	-	rs60377963		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138718041_138718042delCA	uc004cgr.3	-						CAMSAP1_uc004cgq.3_Intron|CAMSAP1_uc010nbg.2_Intron	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein							cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		CGGGCACCAGcacacacacaca	0.550													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385707	42385722	+	IGR	DEL	AATGGAATCATCATTA	-	-	rs33914712		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385707_42385722delAATGGAATCATCATTA								None (None upstream) : LOC441666 (441593 downstream)																							aatggaatcgaatggaatcatcattaaatggaatca	0.042													6	5	---	---	---	---	
SYT15	83849	broad.mit.edu	37	10	46968899	46968912	+	Intron	DEL	CACACACACACACA	-	-	rs72038340	by1000genomes	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46968899_46968912delCACACACACACACA	uc001jea.2	-						SYT15_uc001jdz.2_Intron|SYT15_uc001jeb.2_Intron|SYT15_uc010qfp.1_5'Flank	NM_031912	NP_114118	Q9BQS2	SYT15_HUMAN	synaptotagmin XV isoform a							integral to membrane|plasma membrane					0						cacacacacgcacacacacacacacacacacaca	0.271													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	71193238	71193239	+	IGR	INS	-	AC	AC	rs139709581	by1000genomes	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71193238_71193239insAC								TACR2 (16564 upstream) : TSPAN15 (17987 downstream)																							TATCTATATCTACACACACACA	0.262													4	3	---	---	---	---	
POLR3A	11128	broad.mit.edu	37	10	79741796	79741797	+	Intron	INS	-	A	A	rs11400771		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79741796_79741797insA	uc001jzn.2	-							NM_007055	NP_008986	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide						innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			gactccatctcaaaaaaaaaaa	0.198													6	4	---	---	---	---	
ABLIM1	3983	broad.mit.edu	37	10	116228181	116228182	+	Intron	INS	-	T	T	rs139090094		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116228181_116228182insT	uc010qsg.1	-						ABLIM1_uc010qsh.1_Intron|ABLIM1_uc010qsi.1_Intron|ABLIM1_uc010qsk.1_Intron|ABLIM1_uc009xyp.2_Intron|ABLIM1_uc010qsf.1_Intron|ABLIM1_uc009xyn.2_Intron|ABLIM1_uc010qsj.1_Intron|ABLIM1_uc009xyo.2_Intron	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		ctacaggcgccgccaccacccc	0.000													2	4	---	---	---	---	
MS4A14	84689	broad.mit.edu	37	11	60184378	60184378	+	Frame_Shift_Del	DEL	C	-	-	rs145801550		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60184378delC	uc001npj.2	+	5	2502	c.1937delC	c.(1936-1938)TCCfs	p.S646fs	MS4A14_uc001npi.2_Frame_Shift_Del_p.S534fs|MS4A14_uc001npn.2_Frame_Shift_Del_p.S384fs|MS4A14_uc001npk.2_Frame_Shift_Del_p.S629fs|MS4A14_uc001npl.2_Frame_Shift_Del_p.S384fs|MS4A14_uc001npm.2_Frame_Shift_Del_p.S384fs	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	646	Gln-rich.					integral to membrane	receptor activity			breast(1)	1						GATTCAGAATCCCAAATACAG	0.463													120	62	---	---	---	---	
SF3B2	10992	broad.mit.edu	37	11	65825456	65825458	+	Intron	DEL	AAG	-	-	rs60074596		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65825456_65825458delAAG	uc001ogy.1	+							NM_006842	NP_006833	Q13435	SF3B2_HUMAN	splicing factor 3B subunit 2						interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(2)|breast(1)	3						aaaaaaaaaaaagaaagaaagaa	0.232													9	4	---	---	---	---	
ROBO4	54538	broad.mit.edu	37	11	124757114	124757114	+	Intron	DEL	T	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124757114delT	uc001qbg.2	-						ROBO4_uc010sas.1_Intron|ROBO4_uc001qbh.2_Intron|ROBO4_uc001qbi.2_Intron	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout						angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GGAGGCCTGATTTGCGGGAGA	0.647													193	93	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134037240	134037241	+	Intron	INS	-	ACTT	ACTT	rs72311832		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134037240_134037241insACTT	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron|NCAPD3_uc001qhc.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GGCGCACACTCGTGAGATGAGC	0.589													8	4	---	---	---	---	
MLL2	8085	broad.mit.edu	37	12	49444705	49444706	+	Frame_Shift_Ins	INS	-	A	A			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49444705_49444706insA	uc001rta.3	-	10	2760_2761	c.2760_2761insT	c.(2758-2763)TCTGGGfs	p.S920fs		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	920_921	Pro-rich.			Missing (in Ref. 1; AAC51734).	chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GATGGCTCCCCAGATGGGGACA	0.559			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			115	67	---	---	---	---	
CCT2	10576	broad.mit.edu	37	12	69985660	69985662	+	Intron	DEL	AAC	-	-	rs34385564		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69985660_69985662delAAC	uc001svb.1	+						CCT2_uc009zrm.1_Intron|CCT2_uc009zrn.1_Intron|CCT2_uc010stl.1_Intron	NM_006431	NP_006422	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2						'de novo' posttranslational protein folding	nucleus	ATP binding|unfolded protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			ctaaaagcaaaacaacaacagaa	0.103													3	6	---	---	---	---	
STAB2	55576	broad.mit.edu	37	12	104097120	104097120	+	Intron	DEL	G	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104097120delG	uc001tjw.2	+							NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						ATATAATTTTGGGGGCATAAG	0.224													53	46	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	113453534	113453534	+	IGR	DEL	A	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113453534delA								OAS2 (4007 upstream) : DTX1 (42128 downstream)																							AACGGAGCCTACCATTCAAAA	0.403													13	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	98568321	98568328	+	IGR	DEL	GAATGAAT	-	-	rs9300453		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98568321_98568328delGAATGAAT								RAP2A (448070 upstream) : IPO5 (37601 downstream)																							aagaaagaaagaatgaatgaaagaaaga	0.091													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22694511	22694520	+	Intron	DEL	TGTGTCCGTG	-	-	rs113321665		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22694511_22694520delTGTGTCCGTG	uc001wbw.2	+						uc010aiv.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																		Agtgtgtgtctgtgtccgtgtgtgtgcatg	0.338													2	9	---	---	---	---	
HEATR5A	25938	broad.mit.edu	37	14	31819967	31819970	+	Intron	DEL	TTTG	-	-	rs72055697		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31819967_31819970delTTTG	uc001wrf.3	-						HEATR5A_uc010ami.2_Intron|HEATR5A_uc001wrg.1_Intron|HEATR5A_uc010tpk.1_Intron	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A								binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TAGGTAAGTTtttgtttgtttgtt	0.176													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21890632	21890632	+	Intron	DEL	A	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21890632delA	uc002djr.3	-						uc002djs.3_Intron|uc010vbo.1_RNA	NM_130464	NP_569731			nuclear pore complex interacting protein-like 3																		TTTCTCTTACAAAAAAAAAAA	0.224													8	4	---	---	---	---	
ITGAX	3687	broad.mit.edu	37	16	31383487	31383487	+	Intron	DEL	G	-	-	rs67981265		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31383487delG	uc002ebu.1	+						ITGAX_uc002ebt.2_Intron	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						cgggaggtctgggggggggga	0.144													4	3	---	---	---	---	
FAM117A	81558	broad.mit.edu	37	17	47809948	47809948	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47809948delC	uc002ipk.2	-	2	400	c.331delG	c.(331-333)GCCfs	p.A111fs	FAM117A_uc010wlz.1_5'UTR	NM_030802	NP_110429	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	111										ovary(1)	1						CAGGTGAAGGCCCCATCAGCA	0.592													27	37	---	---	---	---	
POTEC	388468	broad.mit.edu	37	18	14537863	14537864	+	Frame_Shift_Ins	INS	-	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14537863_14537864insT	uc010dln.2	-	3	1200_1201	c.746_747insA	c.(745-747)AATfs	p.N249fs	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	249	ANK 4.									skin(3)	3						ATTTATCTTCATTGTGGACAGC	0.356													128	62	---	---	---	---	
ABCA7	10347	broad.mit.edu	37	19	1047508	1047514	+	Frame_Shift_Del	DEL	GGAGCAG	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1047508_1047514delGGAGCAG	uc002lqw.3	+	16	2355_2361	c.2124_2130delGGAGCAG	c.(2122-2130)GAGGAGCAGfs	p.E708fs	ABCA7_uc010dsb.1_Frame_Shift_Del_p.E570fs	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	708_710					phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCTGCTGGAGGAGCAGGGCGAGGGCG	0.715													6	6	---	---	---	---	
ZNF709	163051	broad.mit.edu	37	19	12597357	12597357	+	5'Flank	DEL	A	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12597357delA	uc002mtv.3	-						ZNF709_uc002mtw.3_Intron|ZNF709_uc002mtx.3_Intron	NM_152601	NP_689814	Q8N972	ZN709_HUMAN	zinc finger protein 709 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ggaaggaaggaaaaaaaaagg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35136441	35136454	+	Intron	DEL	ACACAGACACACAC	-	-	rs72337452	by1000genomes	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35136441_35136454delACACAGACACACAC	uc002nvo.1	-											Homo sapiens cDNA FLJ36176 fis, clone TESTI2026491.																		acacacacagacacagacacacacacacacacac	0.374													6	4	---	---	---	---	
CEACAM4	1089	broad.mit.edu	37	19	42131753	42131754	+	Intron	INS	-	C	C	rs145574063	by1000genomes	TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42131753_42131754insC	uc002orh.1	-						CEACAM4_uc010xwd.1_Intron	NM_001817	NP_001808	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion							integral to plasma membrane|membrane fraction					0						CCCTGCTGAGGCCCCCCCGCCC	0.594													6	5	---	---	---	---	
TULP2	7288	broad.mit.edu	37	19	49393009	49393010	+	Intron	INS	-	T	T			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49393009_49393010insT	uc002pkz.2	-							NM_003323	NP_003314	O00295	TULP2_HUMAN	tubby like protein 2						visual perception	cytoplasm|extracellular region				ovary(1)|kidney(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		ggatgctgttaatctataacct	0.000													11	9	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50309616	50309618	+	Intron	DEL	CCT	-	-	rs35426636		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50309616_50309618delCCT	uc002ppn.2	+						AP2A1_uc002ppo.2_Intron|AP2A1_uc010enk.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCACTTTGACCCTCCTCCTCTCA	0.532													5	5	---	---	---	---	
NLRP5	126206	broad.mit.edu	37	19	56569394	56569395	+	Intron	INS	-	A	A	rs113887962		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56569394_56569395insA	uc002qmj.2	+						NLRP5_uc002qmi.2_Intron	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5							mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		aatgctatctcaaaaaaaaaaa	0.005													6	4	---	---	---	---	
GYG2	8908	broad.mit.edu	37	X	2774840	2774841	+	Intron	INS	-	ATCT	ATCT	rs142965389		TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2774840_2774841insATCT	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				atctatctatcatctatctatc	0.173													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	3442598	3442598	+	IGR	DEL	C	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3442598delC								MXRA5 (177914 upstream) : PRKX (79815 downstream)																							accaccatcaccaccatcacc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	40235064	40235065	+	IGR	DEL	GT	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40235064_40235065delGT								BCOR (198482 upstream) : ATP6AP2 (205151 downstream)																							AACTATAGCAgtgtgtgtgtgt	0.292													4	3	---	---	---	---	
MCF2	4168	broad.mit.edu	37	X	138684423	138684423	+	Intron	DEL	G	-	-			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138684423delG	uc004fau.2	-						MCF2_uc004fav.2_Intron|MCF2_uc011mwl.1_Intron|MCF2_uc010nsh.1_Intron|MCF2_uc011mwm.1_Intron|MCF2_uc011mwn.1_Intron|MCF2_uc004faw.2_Intron|MCF2_uc011mwo.1_Intron	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					TGTGTGTGTTGGGGGGGAGGG	0.209													17	18	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	140233029	140233030	+	IGR	INS	-	AA	AA			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140233029_140233030insAA								SPANXB2 (147159 upstream) : LDOC1 (36910 downstream)																							gactctgcctcaaaaaaaaaaa	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13637365	13637366	+	IGR	INS	-	GGGG	GGGG			TCGA-66-2763-01	TCGA-66-2763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13637365_13637366insGGGG								None (None upstream) : None (None downstream)																							GCCGCGGAGGCGGAGGGCAAAA	0.579													4	2	---	---	---	---	
