Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NADK	65220	broad.mit.edu	37	1	1696810	1696810	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1696810C>A	uc009vkw.2	-	2	157	c.36G>T	c.(34-36)AAG>AAT	p.K12N	NADK_uc001aic.2_Missense_Mutation_p.K12N|NADK_uc001aid.3_Missense_Mutation_p.K12N|NADK_uc001aie.2_Missense_Mutation_p.K12N|NADK_uc009vkx.1_Translation_Start_Site	NM_023018	NP_075394	O95544	NADK_HUMAN	NAD kinase	12					ATP metabolic process|NAD metabolic process|water-soluble vitamin metabolic process	cytosol	ATP binding|metal ion binding|NAD+ kinase activity|protein binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		GACTCAATTCCTTATTCATGG	0.463													11	47	---	---	---	---	PASS
PLCH2	9651	broad.mit.edu	37	1	2415982	2415982	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2415982C>A	uc001aji.1	+	5	1015	c.741C>A	c.(739-741)CTC>CTA	p.L247L	PLCH2_uc010nyz.1_Silent_p.L35L|PLCH2_uc009vle.1_Silent_p.L35L|PLCH2_uc001ajj.1_Silent_p.L35L|PLCH2_uc001ajk.1_Silent_p.L35L	NM_014638	NP_055453	O75038	PLCH2_HUMAN	phospholipase C, eta 2	247					intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			central_nervous_system(3)|ovary(1)|skin(1)	5	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		TCTACCTGCTCATGCTGACCT	0.607													6	34	---	---	---	---	PASS
PLCH2	9651	broad.mit.edu	37	1	2421253	2421253	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2421253G>A	uc001aji.1	+	10	1736	c.1462G>A	c.(1462-1464)GAT>AAT	p.D488N	PLCH2_uc010nyz.1_Missense_Mutation_p.D276N|PLCH2_uc009vle.1_Missense_Mutation_p.D276N|PLCH2_uc001ajj.1_Missense_Mutation_p.D276N|PLCH2_uc001ajk.1_Missense_Mutation_p.D276N	NM_014638	NP_055453	O75038	PLCH2_HUMAN	phospholipase C, eta 2	488					intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			central_nervous_system(3)|ovary(1)|skin(1)	5	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CGAGGTGTCTGATGAGGACAG	0.612													19	80	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7812544	7812544	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7812544G>C	uc001aoi.2	+	21	5116	c.4909G>C	c.(4909-4911)GAT>CAT	p.D1637H	CAMTA1_uc001aok.3_Missense_Mutation_p.D680H|CAMTA1_uc001aoj.2_Missense_Mutation_p.D600H|CAMTA1_uc009vmf.2_Missense_Mutation_p.D227H	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	1637					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CAAAAAGCAGGATCAAGCTGC	0.423													9	56	---	---	---	---	PASS
TNFRSF8	943	broad.mit.edu	37	1	12164593	12164593	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12164593G>C	uc001atq.2	+						TNFRSF8_uc010obc.1_Intron	NM_001243	NP_001234	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily,						cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)		TCCCAGGTCAGTGTCCCCACC	0.587													9	33	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12343540	12343540	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12343540A>G	uc001atv.2	+	21	5522	c.5381A>G	c.(5380-5382)AAG>AGG	p.K1794R	VPS13D_uc001atw.2_Missense_Mutation_p.K1794R|VPS13D_uc001atx.2_Missense_Mutation_p.K982R	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	1794					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TTGGTAGATAAGAAACATCCA	0.408													28	132	---	---	---	---	PASS
CASP9	842	broad.mit.edu	37	1	15844829	15844829	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15844829C>G	uc001awn.2	-	2	289	c.194G>C	c.(193-195)CGA>CCA	p.R65P	CASP9_uc001awm.1_Missense_Mutation_p.R65P|CASP9_uc001awo.2_Missense_Mutation_p.R65P|CASP9_uc001awp.2_5'UTR|CASP9_uc009voi.2_5'UTR|CASP9_uc010obm.1_5'UTR|CASP9_uc001awq.2_5'UTR	NM_001229	NP_001220	P55211	CASP9_HUMAN	caspase 9 isoform alpha preproprotein	65	CARD.				activation of caspase activity by cytochrome c|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol	cysteine-type endopeptidase activity|enzyme activator activity|protein binding			central_nervous_system(1)|kidney(1)	2		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		CTGACTCCCTCGAGTCTCCAG	0.527													4	115	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17250858	17250858	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17250858C>T	uc001azt.2	+	3	304	c.235C>T	c.(235-237)CTG>TTG	p.L79L	CROCC_uc009voy.1_Intron|CROCC_uc009voz.1_Intron	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	79	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GCTGCTGTCGCTGCAGGAGGA	0.642													4	22	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17279892	17279892	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17279892G>C	uc001azt.2	+	21	3171	c.3102G>C	c.(3100-3102)GAG>GAC	p.E1034D	CROCC_uc009voz.1_Missense_Mutation_p.E633D|CROCC_uc001azu.2_Missense_Mutation_p.E337D	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	1034	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TGGAGGCTGAGAAGGAAGAGC	0.667													3	20	---	---	---	---	PASS
PADI1	29943	broad.mit.edu	37	1	17552530	17552530	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17552530C>A	uc001bah.1	+	6	621	c.529C>A	c.(529-531)CTG>ATG	p.L177M		NM_013358	NP_037490	Q9ULC6	PADI1_HUMAN	peptidylarginine deiminase type I	177					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity				0		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	CTCTCCAGACCTGCAGGACAT	0.562													18	86	---	---	---	---	PASS
ACTL8	81569	broad.mit.edu	37	1	18152600	18152600	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18152600G>C	uc001bat.2	+	3	903	c.687G>C	c.(685-687)CAG>CAC	p.Q229H		NM_030812	NP_110439	Q9H568	ACTL8_HUMAN	actin-like 8	229						cytoplasm|cytoskeleton				ovary(4)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		AGAGGCAGCAGAGTGCCTTGG	0.607											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	65	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22214545	22214545	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22214545T>C	uc001bfj.2	-	7	629	c.589A>G	c.(589-591)AGA>GGA	p.R197G	HSPG2_uc009vqd.2_Missense_Mutation_p.R197G|HSPG2_uc009vqe.1_Silent_p.Q95Q	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	197					angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	GTGCAGGCTCTTGGGAACTGG	0.632													8	47	---	---	---	---	PASS
CDC42	998	broad.mit.edu	37	1	22413036	22413036	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22413036G>C	uc001bfq.2	+	5	575	c.283G>C	c.(283-285)GAA>CAA	p.E95Q	CDC42_uc009vqg.1_Missense_Mutation_p.E95Q|CDC42_uc001bfp.2_Missense_Mutation_p.E95Q|CDC42_uc001bfr.2_Missense_Mutation_p.E95Q|CDC42_uc010odr.1_Missense_Mutation_p.E140Q|CDC42_uc010ods.1_Missense_Mutation_p.E137Q|CDC42_uc009vqh.2_Missense_Mutation_p.E54Q	NM_001039802	NP_001034891	P60953	CDC42_HUMAN	cell division cycle 42 isoform 1	95					actin cytoskeleton organization|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|establishment or maintenance of cell polarity|macrophage differentiation|muscle cell differentiation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of protein complex assembly|positive regulation of muscle cell differentiation|positive regulation of pseudopodium assembly|regulation of filopodium assembly|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|filopodium|plasma membrane	GTP binding|GTPase activity|protein binding|thioesterase binding			haematopoietic_and_lymphoid_tissue(1)	1		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)|Prostate(1639;0.0792)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0452)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.35e-07)|COAD - Colon adenocarcinoma(152;7.73e-06)|GBM - Glioblastoma multiforme(114;8.62e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000649)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00767)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.207)		AAACGTGAAAGAAAAGGTAAG	0.373													25	99	---	---	---	---	PASS
NIPAL3	57185	broad.mit.edu	37	1	24795600	24795600	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24795600C>A	uc001bjh.2	+	12	1553	c.1146C>A	c.(1144-1146)GTC>GTA	p.V382V	NIPAL3_uc009vrc.2_Silent_p.V300V	NM_020448	NP_065181	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3	382						integral to membrane					0						CCCTGCCAGTCATGCAAGAAG	0.507													17	77	---	---	---	---	PASS
MAN1C1	57134	broad.mit.edu	37	1	26085168	26085168	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26085168G>A	uc001bkm.2	+	6	1345	c.1015G>A	c.(1015-1017)GAA>AAA	p.E339K	MAN1C1_uc009vry.1_Missense_Mutation_p.E159K	NM_020379	NP_065112	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	339	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(1)	1		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		ACACCTCACTGAACTCTCTGG	0.577													15	116	---	---	---	---	PASS
MAP3K6	9064	broad.mit.edu	37	1	27682180	27682180	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27682180G>T	uc001bny.1	-	28	4017	c.3768C>A	c.(3766-3768)GAC>GAA	p.D1256E	MAP3K6_uc009vsw.1_Missense_Mutation_p.D1248E	NM_004672	NP_004663	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase	1256					activation of JUN kinase activity		ATP binding|magnesium ion binding|MAP kinase kinase kinase activity			breast(4)|lung(3)|ovary(1)|central_nervous_system(1)	9		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TGTAGATGAGGTCATCTCGAG	0.532													14	118	---	---	---	---	PASS
PTPRU	10076	broad.mit.edu	37	1	29638003	29638003	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29638003A>G	uc001bru.2	+	21	3033	c.2923A>G	c.(2923-2925)ATG>GTG	p.M975V	PTPRU_uc001brv.2_Missense_Mutation_p.M971V|PTPRU_uc001brw.2_Missense_Mutation_p.M965V|PTPRU_uc009vtq.2_Missense_Mutation_p.M971V|PTPRU_uc009vtr.2_Missense_Mutation_p.M965V	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	975	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CTTCTGGCGTATGGTGTGGCA	0.627													11	33	---	---	---	---	PASS
BSDC1	55108	broad.mit.edu	37	1	32843566	32843566	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32843566C>T	uc001bvh.3	-						BSDC1_uc010ohg.1_Intron|BSDC1_uc010ohh.1_Intron|BSDC1_uc010ohi.1_Intron|BSDC1_uc001bvg.3_Intron|BSDC1_uc001bvj.2_Intron|BSDC1_uc001bvi.2_Intron	NM_018045	NP_060515	Q9NW68	BSDC1_HUMAN	BSD domain containing 1 isoform b								protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CTCAACGCCTCTTACCTTCCT	0.632													8	37	---	---	---	---	PASS
GJB3	2707	broad.mit.edu	37	1	35250801	35250801	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35250801C>G	uc001bxx.2	+	2	1053	c.438C>G	c.(436-438)CTC>CTG	p.L146L	GJB3_uc001bxy.2_Silent_p.L146L|GJB3_uc001bxz.3_Silent_p.L146L|uc010ohs.1_Intron	NM_024009	NP_076872	O75712	CXB3_HUMAN	connexin 31	146	Helical; (Potential).				cell communication	connexon complex|integral to membrane	gap junction channel activity				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				TCCTCTTCCTCTACCTGCTGC	0.582													32	99	---	---	---	---	PASS
NCDN	23154	broad.mit.edu	37	1	36026776	36026776	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36026776G>C	uc001bza.2	+	4	1151	c.1024G>C	c.(1024-1026)GAG>CAG	p.E342Q	NCDN_uc001bzb.2_Missense_Mutation_p.E342Q|NCDN_uc001bzc.2_Missense_Mutation_p.E325Q	NM_001014839	NP_001014839	Q9UBB6	NCDN_HUMAN	neurochondrin isoform 1	342					neuron projection development	cytosol|dendrite|neuronal cell body				large_intestine(2)|pancreas(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TGCCCTCATGGAGTTGGGGAT	0.602													5	10	---	---	---	---	PASS
CSF3R	1441	broad.mit.edu	37	1	36935300	36935300	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36935300G>A	uc001caw.1	-	11	1605	c.1427C>T	c.(1426-1428)ACC>ATC	p.T476I	CSF3R_uc001cat.1_Missense_Mutation_p.T39I|CSF3R_uc009vvc.1_Missense_Mutation_p.T39I|CSF3R_uc001cau.1_5'UTR|CSF3R_uc001cav.1_Missense_Mutation_p.T476I|CSF3R_uc001cax.1_Missense_Mutation_p.T476I|CSF3R_uc001cay.1_Missense_Mutation_p.T476I	NM_000760	NP_000751	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor isoform a	476	Extracellular (Potential).|Fibronectin type-III 4.				cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity			central_nervous_system(2)|ovary(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	CATCCTCCAGGTCTTGTTGCT	0.627													27	181	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37271697	37271697	+	Intron	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37271697T>A	uc001caz.2	-						GRIK3_uc001cba.1_Intron	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3						negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	AGGCAGCCCCTCGCTCACCCA	0.647													13	42	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39903536	39903536	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39903536G>C	uc010oiu.1	+	36	13536	c.13405G>C	c.(13405-13407)GAC>CAC	p.D4469H	MACF1_uc010ois.1_Missense_Mutation_p.D3967H	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGCTGAAGTAGACAAGATCAG	0.478													53	455	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39914334	39914334	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39914334G>A	uc010oiu.1	+	49	15617	c.15486G>A	c.(15484-15486)CTG>CTA	p.L5162L	MACF1_uc010ois.1_Silent_p.L4660L	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	6728	Spectrin 16.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCAGAGCACTGAAAGAAAAGA	0.418													20	278	---	---	---	---	PASS
COL9A2	1298	broad.mit.edu	37	1	40777372	40777372	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40777372C>T	uc001cfh.1	-	9	503	c.433G>A	c.(433-435)GAT>AAT	p.D145N	COL9A2_uc001cfi.1_5'UTR	NM_001852	NP_001843	Q14055	CO9A2_HUMAN	alpha 2 type IX collagen precursor	145	Triple-helical region 4 (COL4).				axon guidance|skeletal system development	collagen type IX				ovary(2)	2	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			GATGGTCCATCTGGTCCAGGG	0.607													29	294	---	---	---	---	PASS
IPO13	9670	broad.mit.edu	37	1	44422280	44422280	+	Silent	SNP	C	A	A	rs143861524		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44422280C>A	uc001ckx.2	+	4	1806	c.1011C>A	c.(1009-1011)GTC>GTA	p.V337V		NM_014652	NP_055467	O94829	IPO13_HUMAN	importin 13	337	HEAT 5.				protein import into nucleus	cytoplasm|nucleus	protein binding|protein transporter activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				TGGCACTCGTCAACATGATTA	0.542													33	241	---	---	---	---	PASS
RNF220	55182	broad.mit.edu	37	1	45098067	45098067	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45098067G>A	uc001clv.1	+						RNF220_uc001clw.1_Intron|RNF220_uc010okx.1_Intron|RNF220_uc010oky.1_Intron|RNF220_uc010okz.1_Intron|RNF220_uc001clx.1_Intron|RNF220_uc001cly.1_Intron|RNF220_uc001clz.1_Intron|RNF220_uc001cma.1_Intron	NM_018150	NP_060620	Q5VTB9	RN220_HUMAN	ring finger protein 220						protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						GGTGAGTCCTGCCCGGCccct	0.448													14	32	---	---	---	---	PASS
ZSWIM5	57643	broad.mit.edu	37	1	45484142	45484142	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45484142C>T	uc001cnd.2	-	14	3770	c.3542G>A	c.(3541-3543)CGA>CAA	p.R1181Q		NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5	1181							zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					AAAGCGCTCTCGCACCAGCAG	0.542											OREG0013450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	286	---	---	---	---	PASS
NASP	4678	broad.mit.edu	37	1	46073007	46073007	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46073007G>C	uc001coi.1	+	6	526	c.424G>C	c.(424-426)GAG>CAG	p.E142Q	NASP_uc010olq.1_Missense_Mutation_p.E105Q|NASP_uc001coh.1_Missense_Mutation_p.E144Q|NASP_uc001coj.1_Intron|NASP_uc010olr.1_Missense_Mutation_p.E78Q|NASP_uc001cok.1_Missense_Mutation_p.E25Q	NM_002482	NP_002473	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein isoform 2	142	Potential.|Glu-rich (acidic).				blastocyst development|cell cycle|cell proliferation|DNA replication|histone exchange|protein transport	cytoplasm|nucleus	Hsp90 protein binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					AGCAAGGGAAGAGTTGAGAGA	0.368													8	81	---	---	---	---	PASS
MAST2	23139	broad.mit.edu	37	1	46489559	46489559	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46489559A>T	uc001cov.2	+	15	1970	c.1687A>T	c.(1687-1689)ATA>TTA	p.I563L	MAST2_uc001cow.2_Missense_Mutation_p.I563L|MAST2_uc001coy.1_Missense_Mutation_p.I237L|MAST2_uc001coz.1_Missense_Mutation_p.I448L|MAST2_uc009vya.2_Missense_Mutation_p.I485L|MAST2_uc001cpa.2_RNA	NM_015112	NP_055927	Q6P0Q8	MAST2_HUMAN	microtubule associated serine/threonine kinase	563	Protein kinase.				regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|stomach(2)|breast(1)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					GGAGCGTGACATACTGACTTT	0.532													31	91	---	---	---	---	PASS
EPS15	2060	broad.mit.edu	37	1	51822469	51822469	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51822469C>T	uc001csq.1	-	25	2686	c.2594G>A	c.(2593-2595)AGA>AAA	p.R865K	EPS15_uc009vyz.1_Missense_Mutation_p.R731K|EPS15_uc001csp.3_Missense_Mutation_p.R551K	NM_001981	NP_001972	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway	865	UIM 1.				cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2						CTCTTCCTCTCTCTCACTTTC	0.413			T	MLL	ALL								22	156	---	---	---	---	PASS
ZYG11B	79699	broad.mit.edu	37	1	53262027	53262027	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53262027G>C	uc001cuj.2	+	7	1593	c.1398G>C	c.(1396-1398)AGG>AGC	p.R466S	ZYG11B_uc009vzg.2_RNA|ZYG11B_uc010onj.1_Missense_Mutation_p.R457S|ZYG11B_uc009vzh.2_5'Flank	NM_024646	NP_078922	Q9C0D3	ZY11B_HUMAN	zyg-11 homolog B	466							protein binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						ACATGCAAAGGATGGCAGTTG	0.418													4	130	---	---	---	---	PASS
SLC1A7	6512	broad.mit.edu	37	1	53554633	53554633	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53554633C>A	uc001cuy.2	-	10	1548	c.1380G>T	c.(1378-1380)ATG>ATT	p.M460I	SLC1A7_uc001cux.2_Missense_Mutation_p.M113I	NM_006671	NP_006662	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter),	460	Helical; (Potential).					integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)	GCACGTTAATCATGGTGCGGA	0.592													7	99	---	---	---	---	PASS
TTC4	7268	broad.mit.edu	37	1	55194063	55194063	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55194063G>C	uc001cxx.3	+	6	692	c.639G>C	c.(637-639)AAG>AAC	p.K213N	C1orf175_uc001cxq.2_RNA|TTC4_uc001cxw.3_Missense_Mutation_p.K213N|TTC4_uc001cxv.2_Missense_Mutation_p.K224N	NM_004623	NP_004614	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	213							binding				0						TGAAAGAAAAGAAGGAGAGGA	0.418													15	53	---	---	---	---	PASS
TMEM61	199964	broad.mit.edu	37	1	55457683	55457683	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55457683C>G	uc001cyd.2	+	3	814	c.540C>G	c.(538-540)ATC>ATG	p.I180M		NM_182532	NP_872338	Q8N0U2	TMM61_HUMAN	transmembrane protein 61	180						integral to membrane					0						ATGAGAGCATCAGCCTTGCTC	0.622													6	243	---	---	---	---	PASS
C1orf168	199920	broad.mit.edu	37	1	57284973	57284973	+	5'UTR	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57284973C>G	uc001cym.3	-	1					C1orf168_uc009vzu.1_RNA|C1orf168_uc009vzv.1_5'UTR	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN	hypothetical protein LOC199920											ovary(3)|skin(2)	5						TTGCTTTCCTCCAAGGCAGAG	0.547													8	74	---	---	---	---	PASS
DAB1	1600	broad.mit.edu	37	1	57480785	57480785	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57480785C>G	uc001cys.1	-	14	1889	c.1215G>C	c.(1213-1215)AAG>AAC	p.K405N	DAB1_uc001cyt.1_Missense_Mutation_p.K403N|DAB1_uc001cyq.1_Missense_Mutation_p.K403N|DAB1_uc001cyr.1_Missense_Mutation_p.K319N|DAB1_uc009vzw.1_Missense_Mutation_p.K387N|DAB1_uc009vzx.1_Missense_Mutation_p.K405N	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1	438					cell differentiation|nervous system development					skin(2)|ovary(1)	3						TCTGCCTGGGCTTGTCGGTCT	0.602													22	157	---	---	---	---	PASS
C1orf87	127795	broad.mit.edu	37	1	60463500	60463500	+	Intron	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60463500A>G	uc001czs.1	-						C1orf87_uc001czr.1_Intron	NM_152377	NP_689590	Q8N0U7	CA087_HUMAN	hypothetical protein LOC127795								calcium ion binding			ovary(1)|breast(1)	2						TACCAAAACAACAAAAGCATT	0.453													7	45	---	---	---	---	PASS
KANK4	163782	broad.mit.edu	37	1	62739549	62739549	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62739549C>G	uc001dah.3	-	3	1604	c.1227G>C	c.(1225-1227)CAG>CAC	p.Q409H	KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	409										ovary(3)|skin(2)|lung(1)	6						TCACGTCCGTCTGGCCCTGAG	0.512													54	351	---	---	---	---	PASS
DOCK7	85440	broad.mit.edu	37	1	62960018	62960018	+	Silent	SNP	T	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62960018T>G	uc001daq.2	-	40	5152	c.5118A>C	c.(5116-5118)GCA>GCC	p.A1706A	DOCK7_uc001dan.2_Silent_p.A1567A|DOCK7_uc001dao.2_Silent_p.A1567A|DOCK7_uc001dap.2_Silent_p.A1684A|DOCK7_uc001dam.2_Silent_p.A886A|DOCK7_uc010oov.1_Silent_p.A445A	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1715	DHR-2.				activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						CAACAAGTGCTGCTGAGTGGA	0.468													55	87	---	---	---	---	PASS
CACHD1	57685	broad.mit.edu	37	1	65130343	65130343	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65130343G>C	uc001dbo.1	+	15	2209	c.2104G>C	c.(2104-2106)GAT>CAT	p.D702H	CACHD1_uc001dbp.1_Missense_Mutation_p.D457H|CACHD1_uc001dbq.1_Missense_Mutation_p.D457H|CACHD1_uc010opa.1_5'Flank	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN	cache domain containing 1	753	Extracellular (Potential).				calcium ion transport	integral to membrane				ovary(2)	2						CAAAGCATTTGATCCCACTAG	0.453													38	282	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67109381	67109381	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67109381C>A	uc001dcr.2	+	7	655	c.438C>A	c.(436-438)ATC>ATA	p.I146I	SGIP1_uc010opd.1_5'UTR|SGIP1_uc001dcs.2_5'UTR|SGIP1_uc001dct.2_5'UTR	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	146					positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						TAGGCAACATCGCACTTTCCC	0.378													40	381	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70482164	70482164	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70482164T>C	uc001dep.2	+	12	1183	c.1153T>C	c.(1153-1155)TTC>CTC	p.F385L	LRRC7_uc009wbg.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	385	LRR 16.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						GAATTTACCATTCTCATTTAC	0.254													23	163	---	---	---	---	PASS
PTGER3	5733	broad.mit.edu	37	1	71331406	71331406	+	Intron	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71331406T>A	uc001dfg.1	-						PTGER3_uc001dfh.1_Intron|PTGER3_uc001dfi.1_RNA|PTGER3_uc001dfj.1_Intron|PTGER3_uc001dfk.1_Intron|PTGER3_uc001dfl.1_Intron|PTGER3_uc009wbm.1_Intron	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform						cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)	TTAGTGGAAGTTGTGGATGTG	0.453													37	126	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74834918	74834918	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74834918G>T	uc001dgf.1	+	15	1493	c.1442G>T	c.(1441-1443)CGA>CTA	p.R481L	TNNI3K_uc001dgc.1_Missense_Mutation_p.R582L|TNNI3K_uc001dgd.2_Missense_Mutation_p.R582L|TNNI3K_uc001dge.1_Missense_Mutation_p.R582L	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	481	Protein kinase.					cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						TATAAAGGACGATGCAGAAAT	0.313													7	132	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	75005943	75005943	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75005943C>A	uc001dgf.1	+	24	2428	c.2377C>A	c.(2377-2379)CTG>ATG	p.L793M	TNNI3K_uc001dge.1_Missense_Mutation_p.L894M	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	793						cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						CTCTCAAGGTCTGTCTTTGGA	0.348													110	94	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75036851	75036851	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75036851G>T	uc001dgg.2	-	14	4762	c.4543C>A	c.(4543-4545)CAA>AAA	p.Q1515K		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	1515										ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CTTTCTCCTTGCACCATATGC	0.502													311	278	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75097467	75097467	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75097467G>T	uc001dgg.2	-	7	968	c.749C>A	c.(748-750)TCT>TAT	p.S250Y	C1orf173_uc001dgi.3_Missense_Mutation_p.S44Y	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	250										ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CCATGTTTCAGATCTATTTTC	0.373													34	284	---	---	---	---	PASS
CRYZ	1429	broad.mit.edu	37	1	75185054	75185054	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75185054T>A	uc001dgk.2	-	5	772	c.267A>T	c.(265-267)AAA>AAT	p.K89N	CRYZ_uc001dgj.2_Missense_Mutation_p.K89N|CRYZ_uc001dgl.2_Missense_Mutation_p.K89N|CRYZ_uc001dgm.2_Intron	NM_001130042	NP_001123514	Q08257	QOR_HUMAN	crystallin, zeta isoform a	89					protein homotetramerization|visual perception|xenobiotic catabolic process	cytosol|Golgi apparatus	mRNA 3'-UTR binding|NADPH binding|NADPH:quinone reductase activity|zinc ion binding				0					Dicumarol(DB00266)	CTCTGTCACCTTTCTAGGGGA	0.373													12	95	---	---	---	---	PASS
LHX8	431707	broad.mit.edu	37	1	75602794	75602794	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75602794G>A	uc001dgo.2	+	4	779	c.115G>A	c.(115-117)GAG>AAG	p.E39K	LHX8_uc001dgq.2_5'UTR	NM_001001933	NP_001001933	Q68G74	LHX8_HUMAN	LIM homeobox 8	39						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						GGTGAGCCCCGAGGGAGCGGG	0.731													8	94	---	---	---	---	PASS
ST6GALNAC5	81849	broad.mit.edu	37	1	77510165	77510165	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77510165G>C	uc001dhi.2	+	3	713	c.538G>C	c.(538-540)GAC>CAC	p.D180H	ST6GALNAC5_uc010ori.1_Intron|ST6GALNAC5_uc009wbw.2_RNA	NM_030965	NP_112227	Q9BVH7	SIA7E_HUMAN	sialyltransferase 7E	180	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity			pancreas(1)|skin(1)	2						CATGCGGCGGGACGGCAAGGG	0.602													24	147	---	---	---	---	PASS
PRKACB	5567	broad.mit.edu	37	1	84700929	84700929	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84700929G>A	uc001djj.2	+	10	1261	c.997G>A	c.(997-999)GAA>AAA	p.E333K	PRKACB_uc001djl.2_Missense_Mutation_p.E380K|PRKACB_uc010ort.1_Missense_Mutation_p.E340K|PRKACB_uc001djn.2_Missense_Mutation_p.E337K|PRKACB_uc010oru.1_Missense_Mutation_p.E321K|PRKACB_uc001djp.2_Missense_Mutation_p.E339K|PRKACB_uc001djq.2_Missense_Mutation_p.E303K|PRKACB_uc010orv.1_Missense_Mutation_p.E320K	NM_002731	NP_002722	P22694	KAPCB_HUMAN	cAMP-dependent protein kinase catalytic subunit	333	AGC-kinase C-terminal.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding|protein binding			lung(2)|ovary(1)	3				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		TGACTATGAAGAAGAAGATAT	0.368													19	159	---	---	---	---	PASS
SYDE2	84144	broad.mit.edu	37	1	85624809	85624809	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85624809G>C	uc009wcm.2	-	7	3258	c.3209C>G	c.(3208-3210)TCA>TGA	p.S1070*		NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2	1070					activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|central_nervous_system(1)	2				all cancers(265;0.0126)|Epithelial(280;0.0336)		AAGTACTCCTGATGAATCAGT	0.408													10	331	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86374306	86374306	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86374306C>T	uc001dlj.2	-	27	2741	c.2699G>A	c.(2698-2700)GGA>GAA	p.G900E	COL24A1_uc001dli.2_Missense_Mutation_p.G36E|COL24A1_uc010osd.1_Missense_Mutation_p.G200E|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	900	Collagen-like 7.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		ACCGATAGGTCCTGGAACCCC	0.328													3	28	---	---	---	---	PASS
CLCA2	9635	broad.mit.edu	37	1	86907182	86907182	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86907182A>T	uc001dlr.3	+	9	1606	c.1444A>T	c.(1444-1446)AGA>TGA	p.R482*		NM_006536	NP_006527	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2 precursor	482	VWFA.|Extracellular (Potential).				cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity			ovary(1)|breast(1)|skin(1)	3		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		TGCTTTCAGTAGAATTTCCTC	0.378													7	92	---	---	---	---	PASS
GBP4	115361	broad.mit.edu	37	1	89652147	89652147	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89652147C>A	uc001dnb.2	-	10	1692	c.1576G>T	c.(1576-1578)GAG>TAG	p.E526*		NM_052941	NP_443173	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	526	Potential.					cytoplasm	GTP binding|GTPase activity				0				all cancers(265;0.00723)|Epithelial(280;0.0291)		TGCTGCTGCTCCTTCTGTTTT	0.478													16	77	---	---	---	---	PASS
GBP5	115362	broad.mit.edu	37	1	89729533	89729533	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89729533T>C	uc001dnc.2	-	9	1785	c.1248A>G	c.(1246-1248)CTA>CTG	p.L416L	GBP5_uc001dnd.2_Silent_p.L416L|GBP5_uc001dne.1_Silent_p.L416L	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN	guanylate-binding protein 5	416						plasma membrane	GTP binding|GTPase activity			ovary(1)	1				all cancers(265;0.00784)|Epithelial(280;0.0286)		CTGCTTCTTCTAGAGGACCAA	0.418													74	392	---	---	---	---	PASS
GLMN	11146	broad.mit.edu	37	1	92737089	92737089	+	Missense_Mutation	SNP	T	C	C	rs139743855		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92737089T>C	uc001dor.2	-	8	971	c.856A>G	c.(856-858)ATG>GTG	p.M286V	GLMN_uc009wdg.2_RNA|GLMN_uc001dos.2_Missense_Mutation_p.M286V	NM_053274	NP_444504	Q92990	GLMN_HUMAN	glomulin	286	Potential.				muscle cell differentiation|negative regulation of T cell proliferation|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of phosphorylation|regulation of gene expression, epigenetic|vasculogenesis	intracellular	hepatocyte growth factor receptor binding			skin(1)	1		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		AGAGAAGCCATTGAGTCTGCT	0.353									Multiple_Glomus_Tumors_(of_the_Skin)_Familial				26	185	---	---	---	---	PASS
SLC35A3	23443	broad.mit.edu	37	1	100464813	100464813	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100464813C>G	uc001dsp.1	+						SLC35A3_uc001dsq.1_Intron|SLC35A3_uc009wdy.1_Intron|SLC35A3_uc001dsr.1_Intron|SLC35A3_uc001dss.1_Intron	NM_012243	NP_036375	Q9Y2D2	S35A3_HUMAN	solute carrier family 35 member 3A						UDP-N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	sugar:hydrogen symporter activity|UDP-N-acetylglucosamine transmembrane transporter activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.124)|all cancers(265;0.198)|Lung(183;0.199)		ATATTATTTTCTAGAATGTAG	0.194													30	61	---	---	---	---	PASS
DBT	1629	broad.mit.edu	37	1	100671853	100671853	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100671853C>G	uc001dta.2	-	10	1247	c.1214G>C	c.(1213-1215)GGT>GCT	p.G405A	DBT_uc010oug.1_Missense_Mutation_p.G224A	NM_001918	NP_001909	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase	405					branched chain family amino acid catabolic process|fatty-acyl-CoA biosynthetic process	microtubule cytoskeleton|mitochondrial alpha-ketoglutarate dehydrogenase complex|mitochondrial nucleoid	acyltransferase activity|cofactor binding|dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity|protein binding			pancreas(1)	1		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		AAAGGTACCACCAATCtattt	0.323													16	51	---	---	---	---	PASS
RTCD1	8634	broad.mit.edu	37	1	100741282	100741282	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100741282G>C	uc001dtc.2	+						RTCD1_uc001dtd.2_Intron	NM_003729	NP_003720	O00442	RTC1_HUMAN	RNA terminal phosphate cyclase domain 1 isoform						RNA processing	mitochondrion|nucleoplasm	ATP binding|protein binding|RNA binding|RNA-3'-phosphate cyclase activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0513)|all cancers(265;0.0902)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)		GGAATAATGTGAGACAATACT	0.328													25	90	---	---	---	---	PASS
VCAM1	7412	broad.mit.edu	37	1	101190454	101190454	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101190454G>C	uc001dti.2	+						VCAM1_uc001dtj.2_Intron|VCAM1_uc010ouj.1_Intron	NM_001078	NP_001069	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1 isoform a						heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding			central_nervous_system(1)	1		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	AAGGTGAGTAGAATGTGAAAA	0.378													7	75	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103364285	103364285	+	Silent	SNP	G	C	C	rs112577505	byFrequency	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103364285G>C	uc001dul.2	-	56	4503	c.4185C>G	c.(4183-4185)GTC>GTG	p.V1395V	COL11A1_uc001duk.2_Silent_p.V591V|COL11A1_uc001dum.2_Silent_p.V1407V|COL11A1_uc001dun.2_Silent_p.V1356V|COL11A1_uc009weh.2_Silent_p.V1279V	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1395	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCTGAGGACCGACTGGGCCGG	0.473													14	87	---	---	---	---	PASS
C1orf59	113802	broad.mit.edu	37	1	109197375	109197375	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109197375G>A	uc001dvt.3	-	5	599	c.361C>T	c.(361-363)CGT>TGT	p.R121C	C1orf59_uc001dvu.3_Missense_Mutation_p.R121C|C1orf59_uc009wer.2_Missense_Mutation_p.R121C	NM_001102592	NP_001096062	Q5T8I9	HENMT_HUMAN	hypothetical protein LOC113802	121					gene silencing by RNA|piRNA metabolic process	P granule	metal ion binding|O-methyltransferase activity|RNA binding|RNA methyltransferase activity				0		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0152)|Lung(183;0.0895)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.163)		CCAAGCAAACGAGAGTCTCTC	0.403													20	65	---	---	---	---	PASS
AKNAD1	254268	broad.mit.edu	37	1	109391602	109391602	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109391602G>C	uc001dwa.2	-	4	1383	c.1114C>G	c.(1114-1116)CAA>GAA	p.Q372E	AKNAD1_uc010ovb.1_Missense_Mutation_p.Q79E|AKNAD1_uc001dwb.2_RNA	NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN	hypothetical protein LOC254268	372	Potential.									ovary(3)	3						GATATCTTTTGAAATATGTAA	0.343													13	225	---	---	---	---	PASS
AMIGO1	57463	broad.mit.edu	37	1	110050902	110050902	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110050902C>A	uc001dxx.3	-	2	1015	c.633G>T	c.(631-633)TGG>TGT	p.W211C		NM_020703	NP_065754	Q86WK6	AMGO1_HUMAN	AMIGO protein precursor	211	Extracellular (Potential).				axonal fasciculation|heterophilic cell-cell adhesion|homophilic cell adhesion|myelination|positive regulation of axonogenesis	axon|integral to membrane				ovary(1)|breast(1)	2		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0182)|Epithelial(280;0.046)|all cancers(265;0.0492)|READ - Rectum adenocarcinoma(129;0.0689)|LUSC - Lung squamous cell carcinoma(189;0.227)		CATTCTTGATCCAGGCCGGCA	0.527													33	168	---	---	---	---	PASS
GSTM4	2948	broad.mit.edu	37	1	110201676	110201676	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110201676G>C	uc001dyf.2	+	7	825	c.511G>C	c.(511-513)GAG>CAG	p.E171Q	GSTM4_uc001dyg.2_Missense_Mutation_p.E67Q|GSTM4_uc009wfj.2_Missense_Mutation_p.E110Q|GSTM4_uc001dyh.2_Missense_Mutation_p.E171Q|GSTM2_uc001dyi.2_Intron	NM_000850	NP_000841	Q03013	GSTM4_HUMAN	glutathione S-transferase mu 4 isoform 1	171	GST C-terminal.				xenobiotic metabolic process	endoplasmic reticulum membrane	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0123)|Colorectal(144;0.0129)|Epithelial(280;0.0147)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.0471)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	CCGTATATTTGAGCCCAACTG	0.502													122	623	---	---	---	---	PASS
SLC16A4	9122	broad.mit.edu	37	1	110925519	110925519	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110925519C>T	uc001dzo.1	-	3	339	c.157G>A	c.(157-159)GAA>AAA	p.E53K	SLC16A4_uc009wfs.1_Missense_Mutation_p.E53K|SLC16A4_uc001dzp.1_Missense_Mutation_p.E53K|SLC16A4_uc010ovy.1_Intron|SLC16A4_uc001dzq.1_Intron|SLC16A4_uc010ovz.1_Intron	NM_004696	NP_004687	O15374	MOT5_HUMAN	solute carrier family 16, member 4	53	Extracellular (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity			ovary(3)	3		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	GAGGTGCCTTCAAACTCTTCT	0.418													28	128	---	---	---	---	PASS
HIPK1	204851	broad.mit.edu	37	1	114483936	114483936	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114483936C>T	uc001eem.2	+	2	1092	c.931C>T	c.(931-933)CTG>TTG	p.L311L	HIPK1_uc001eel.2_Silent_p.L311L|HIPK1_uc001een.2_Silent_p.L311L	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	311	Protein kinase.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAGTCTTGGTCTGATCCACGC	0.478													31	177	---	---	---	---	PASS
C1orf161	126868	broad.mit.edu	37	1	116666819	116666819	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116666819G>A	uc001egc.1	+	4	587	c.322G>A	c.(322-324)GAG>AAG	p.E108K		NM_152367	NP_689580	Q8N8X9	MB213_HUMAN	hypothetical protein LOC126868	108											0	Lung SC(450;0.184)	all_cancers(81;0.00142)|all_lung(203;0.000139)|all_epithelial(167;0.000401)|Lung NSC(69;0.000705)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GCGGGACCCTGAGGGTCTGCA	0.607													13	88	---	---	---	---	PASS
CD2	914	broad.mit.edu	37	1	117297467	117297467	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117297467G>C	uc001egu.3	+	2	305	c.276G>C	c.(274-276)CTG>CTC	p.L92L	CD2_uc010owz.1_Silent_p.L92L|CD2_uc010oxa.1_Silent_p.L92L	NM_001767	NP_001758	P06729	CD2_HUMAN	CD2 molecule precursor	92	Extracellular (Potential).|Ig-like V-type.				blood coagulation|cell surface receptor linked signaling pathway|cell-cell adhesion|induction of apoptosis|leukocyte migration|membrane raft polarization|natural killer cell activation|positive regulation of myeloid dendritic cell activation|regulation of T cell differentiation|T cell activation	integral to plasma membrane	receptor activity			breast(1)	1	Lung SC(450;0.225)	all_cancers(81;3.15e-06)|Acute lymphoblastic leukemia(138;1.7e-08)|all_epithelial(167;8.38e-07)|all_lung(203;3.37e-06)|Lung NSC(69;2.31e-05)		Epithelial(280;6.71e-26)|OV - Ovarian serous cystadenocarcinoma(397;4.74e-24)|all cancers(265;1.93e-22)|Lung(183;0.0543)|Kidney(133;0.0813)|Colorectal(144;0.174)|KIRC - Kidney renal clear cell carcinoma(1967;0.176)|LUSC - Lung squamous cell carcinoma(189;0.189)|BRCA - Breast invasive adenocarcinoma(282;0.201)	Alefacept(DB00092)	ATGGAACTCTGAAAATTAAGC	0.294													11	85	---	---	---	---	PASS
CD2	914	broad.mit.edu	37	1	117297543	117297543	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117297543T>C	uc001egu.3	+	2	381	c.352T>C	c.(352-354)TTG>CTG	p.L118L	CD2_uc010owz.1_Silent_p.L118L|CD2_uc010oxa.1_Silent_p.L118L	NM_001767	NP_001758	P06729	CD2_HUMAN	CD2 molecule precursor	118	Extracellular (Potential).|LFA-3 (CD58) binding region 2.|Ig-like V-type.				blood coagulation|cell surface receptor linked signaling pathway|cell-cell adhesion|induction of apoptosis|leukocyte migration|membrane raft polarization|natural killer cell activation|positive regulation of myeloid dendritic cell activation|regulation of T cell differentiation|T cell activation	integral to plasma membrane	receptor activity			breast(1)	1	Lung SC(450;0.225)	all_cancers(81;3.15e-06)|Acute lymphoblastic leukemia(138;1.7e-08)|all_epithelial(167;8.38e-07)|all_lung(203;3.37e-06)|Lung NSC(69;2.31e-05)		Epithelial(280;6.71e-26)|OV - Ovarian serous cystadenocarcinoma(397;4.74e-24)|all cancers(265;1.93e-22)|Lung(183;0.0543)|Kidney(133;0.0813)|Colorectal(144;0.174)|KIRC - Kidney renal clear cell carcinoma(1967;0.176)|LUSC - Lung squamous cell carcinoma(189;0.189)|BRCA - Breast invasive adenocarcinoma(282;0.201)	Alefacept(DB00092)	AAAAAATGTGTTGGAAAAAAT	0.308													11	71	---	---	---	---	PASS
PIAS3	10401	broad.mit.edu	37	1	145578463	145578463	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145578463C>G	uc001eoc.1	+	2	517	c.426C>G	c.(424-426)ATC>ATG	p.I142M	NBPF10_uc001emp.3_Intron|PIAS3_uc010oyy.1_Missense_Mutation_p.I133M|PIAS3_uc001eod.1_5'Flank	NM_006099	NP_006090	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3	142	PINIT.				positive regulation of protein sumoylation|protein sumoylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	enzyme binding|nucleic acid binding|protein C-terminus binding|zinc ion binding			ovary(1)	1	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGGAGCTCATCCGGCCCACCA	0.547													12	182	---	---	---	---	PASS
VPS45	11311	broad.mit.edu	37	1	150082657	150082657	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150082657G>C	uc001etp.2	+	14	2113	c.1540G>C	c.(1540-1542)GAG>CAG	p.E514Q	VPS45_uc010pbp.1_RNA|VPS45_uc010pbq.1_Missense_Mutation_p.E478Q|VPS45_uc010pbs.1_Missense_Mutation_p.E409Q|VPS45_uc001etq.2_Missense_Mutation_p.E334Q	NM_007259	NP_009190	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45A	514					blood coagulation|intracellular protein transport|vesicle docking involved in exocytosis	endosome membrane|Golgi membrane|integral to membrane of membrane fraction				central_nervous_system(1)|skin(1)	2	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CACCTATGAAGAGGCTCTAAC	0.418													15	151	---	---	---	---	PASS
CA14	23632	broad.mit.edu	37	1	150236221	150236221	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150236221C>G	uc001etx.2	+	10	1200	c.891C>G	c.(889-891)ATC>ATG	p.I297M		NM_012113	NP_036245	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV precursor	297	Helical; (Potential).					integral to membrane	carbonate dehydratase activity|metal ion binding			ovary(1)	1	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTGTAGGAATCTTGGTTGGCT	0.453													103	691	---	---	---	---	PASS
ADAMTSL4	54507	broad.mit.edu	37	1	150526437	150526437	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150526437C>T	uc001eux.2	+	6	1206	c.970C>T	c.(970-972)CAC>TAC	p.H324Y	ADAMTSL4_uc001euw.2_Missense_Mutation_p.H324Y|ADAMTSL4_uc009wlw.2_Missense_Mutation_p.H324Y|ADAMTSL4_uc010pcg.1_Missense_Mutation_p.H324Y	NM_019032	NP_061905	Q6UY14	ATL4_HUMAN	thrombospondin repeat containing 1 isoform 1	324					apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding			ovary(1)|skin(1)	2	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GGGGACTCCTCACGGGCCCCG	0.711													5	39	---	---	---	---	PASS
CTSS	1520	broad.mit.edu	37	1	150724428	150724428	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150724428C>T	uc001evn.2	-	5	589	c.456G>A	c.(454-456)CTG>CTA	p.L152L	CTSS_uc010pcj.1_Silent_p.L102L|CTSS_uc001evo.1_Silent_p.L152L	NM_004079	NP_004070	P25774	CATS_HUMAN	cathepsin S preproprotein	152					immune response|proteolysis	extracellular region|lysosome	cysteine-type endopeptidase activity				0	all_cancers(9;6.17e-52)|all_epithelial(9;9.7e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.00146)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|Epithelial(6;5.02e-21)|all cancers(9;1.28e-20)|OV - Ovarian serous cystadenocarcinoma(6;1.09e-14)|BRCA - Breast invasive adenocarcinoma(12;0.00501)|LUSC - Lung squamous cell carcinoma(543;0.171)			TTTTCAGCTTCAGCTGTGCTT	0.478													19	153	---	---	---	---	PASS
TNFAIP8L2	79626	broad.mit.edu	37	1	151131683	151131683	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151131683G>C	uc001ewx.2	+	2	636	c.510G>C	c.(508-510)AAG>AAC	p.K170N		NM_024575	NP_078851	Q6P589	TP8L2_HUMAN	tumor necrosis factor, alpha-induced protein	170					innate immune response						0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ACCTTGGCAAGATCTGTGACG	0.542													9	84	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152277254	152277254	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152277254C>G	uc001ezu.1	-	3	10144	c.10108G>C	c.(10108-10110)GAG>CAG	p.E3370Q		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3370	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGTGCGGACTCTTGGTGGCTC	0.582									Ichthyosis				86	759	---	---	---	---	PASS
S100A12	6283	broad.mit.edu	37	1	153346292	153346292	+	3'UTR	SNP	C	T	T	rs111993762		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153346292C>T	uc001fbr.1	-	3						NM_005621	NP_005612	P80511	S10AC_HUMAN	S100 calcium-binding protein A12						defense response to bacterium|defense response to fungus|inflammatory response|innate immune response|killing of cells of other organism|positive regulation of I-kappaB kinase/NF-kappaB cascade|xenobiotic metabolic process	cytosol|extracellular region|insoluble fraction|nucleus	calcium ion binding|RAGE receptor binding|zinc ion binding				0	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)		Amlexanox(DB01025)	AAAAAGCCTTCAGAGAGCTAC	0.473													14	106	---	---	---	---	PASS
S100A13	6284	broad.mit.edu	37	1	153591517	153591517	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153591517G>A	uc001fcf.3	-						S100A14_uc001fce.2_5'Flank|S100A13_uc001fcg.2_Intron|S100A13_uc009woh.2_Intron|S100A13_uc001fch.2_Intron|S100A13_uc001fci.2_Intron|S100A13_uc001fcj.2_Intron	NM_001024213	NP_001019384	Q99584	S10AD_HUMAN	S100 calcium binding protein A13						interleukin-1 alpha secretion|mast cell degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|extracellular space|nucleus|perinuclear region of cytoplasm	calcium ion binding|copper ion binding|fibroblast growth factor 1 binding|lipid binding|protein homodimerization activity|RAGE receptor binding|zinc ion binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Amlexanox(DB01025)	CCCACATCCTGAGGAGACACC	0.498													59	408	---	---	---	---	PASS
C1orf77	26097	broad.mit.edu	37	1	153617731	153617731	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153617731G>T	uc001fcm.1	+	6	1045	c.733G>T	c.(733-735)GAA>TAA	p.E245*	C1orf77_uc001fcn.1_Nonsense_Mutation_p.E246*|C1orf77_uc001fco.1_Nonsense_Mutation_p.E220*|C1orf77_uc001fcp.2_RNA	NM_015607	NP_056422	Q9Y3Y2	CHTOP_HUMAN	small protein rich in arginine and glycine	245					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	protein binding|RNA binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GACAGATCCCGAAACCAATGA	0.448													12	64	---	---	---	---	PASS
CREB3L4	148327	broad.mit.edu	37	1	153945266	153945266	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153945266T>A	uc001fdn.3	+	5	856	c.590T>A	c.(589-591)CTG>CAG	p.L197Q	CREB3L4_uc010pef.1_Missense_Mutation_p.L50Q|CREB3L4_uc001fdo.3_Missense_Mutation_p.L177Q|CREB3L4_uc001fdm.1_Missense_Mutation_p.L197Q|CREB3L4_uc001fdp.1_Missense_Mutation_p.L177Q|CREB3L4_uc001fdr.2_Missense_Mutation_p.L197Q|CREB3L4_uc001fdq.2_Missense_Mutation_p.L177Q	NM_130898	NP_570968	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like	197	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AAGCGTCTGCTGGGGCAGGAA	0.602													23	58	---	---	---	---	PASS
JTB	10899	broad.mit.edu	37	1	153949464	153949464	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153949464C>G	uc001fds.2	-	2	832	c.109G>C	c.(109-111)GAG>CAG	p.E37Q		NM_006694	NP_006685	O76095	JTB_HUMAN	jumping translocation breakpoint precursor	37	Extracellular (Potential).				apoptosis|cell cycle cytokinesis|mitosis|positive regulation of protein kinase activity	integral to plasma membrane|membrane fraction|microtubule organizing center|midbody|mitochondrion|spindle	protein kinase binding				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GACAGCTTCTCTTCCTGCACG	0.532													35	237	---	---	---	---	PASS
ADAR	103	broad.mit.edu	37	1	154562783	154562783	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154562783G>C	uc001ffh.2	-	7	2573	c.2373C>G	c.(2371-2373)GTC>GTG	p.V791V	ADAR_uc001ffj.2_Silent_p.V772V|ADAR_uc001ffi.2_Silent_p.V791V|ADAR_uc001ffk.2_Silent_p.V496V	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a	791	DRBM 3.				adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		CCCCAATCAAGACACGGAGAG	0.557													6	177	---	---	---	---	PASS
THBS3	7059	broad.mit.edu	37	1	155175103	155175103	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155175103C>T	uc001fix.2	-	3	314	c.291G>A	c.(289-291)CTG>CTA	p.L97L	RAG1AP1_uc010pey.1_Intron|THBS3_uc009wqi.2_Silent_p.L97L|THBS3_uc001fiz.2_Silent_p.L97L|THBS3_uc001fiy.2_5'UTR|THBS3_uc010pfu.1_Intron|THBS3_uc010pfv.1_Intron|THBS3_uc001fja.2_RNA|THBS3_uc009wqj.1_Silent_p.L59L	NM_007112	NP_009043	P49746	TSP3_HUMAN	thrombospondin 3 precursor	97	TSP N-terminal.				cell-matrix adhesion	extracellular region|perinuclear region of cytoplasm	calcium ion binding|heparin binding|structural molecule activity			breast(3)|ovary(2)	5	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGTATCGCACCAGTACTGCCC	0.597													31	74	---	---	---	---	PASS
SCAMP3	10067	broad.mit.edu	37	1	155231535	155231535	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155231535G>C	uc001fjs.2	-						RAG1AP1_uc010pey.1_Intron|SCAMP3_uc001fjr.2_5'Flank|SCAMP3_uc001fju.2_Intron|SCAMP3_uc001fjv.2_Intron|SCAMP3_uc001fjt.2_Intron	NM_005698	NP_005689	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3 isoform 1						post-Golgi vesicle-mediated transport|protein transport	integral to membrane				ovary(3)	3	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CCTGAGGGCAGAGACCCGGGT	0.622													6	160	---	---	---	---	PASS
YY1AP1	55249	broad.mit.edu	37	1	155646348	155646348	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155646348C>G	uc001fln.2	-	5	537	c.513G>C	c.(511-513)CAG>CAC	p.Q171H	YY1AP1_uc010pgg.1_Missense_Mutation_p.Q39H|YY1AP1_uc010pgh.1_Missense_Mutation_p.Q94H|YY1AP1_uc010pgi.1_Missense_Mutation_p.Q243H|YY1AP1_uc001flh.2_Missense_Mutation_p.Q243H|YY1AP1_uc009wqt.2_Missense_Mutation_p.Q94H|YY1AP1_uc001flk.2_Missense_Mutation_p.Q94H|YY1AP1_uc001fll.2_Missense_Mutation_p.Q105H|YY1AP1_uc009wqv.2_5'UTR|YY1AP1_uc001flm.2_Missense_Mutation_p.Q94H|YY1AP1_uc001fli.2_Missense_Mutation_p.Q105H|YY1AP1_uc009wqu.2_5'UTR|YY1AP1_uc001flj.2_Missense_Mutation_p.Q105H|YY1AP1_uc009wqw.2_Missense_Mutation_p.Q94H|YY1AP1_uc001flo.2_Missense_Mutation_p.Q39H|YY1AP1_uc001flp.2_Missense_Mutation_p.Q105H|YY1AP1_uc010pgj.1_Missense_Mutation_p.Q171H|YY1AP1_uc009wqx.2_Missense_Mutation_p.Q243H|YY1AP1_uc010pgk.1_Missense_Mutation_p.Q243H	NM_139118	NP_620829	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 2	171					regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CCTGCTGCATCTGCTGCTGGA	0.423													70	466	---	---	---	---	PASS
SYT11	23208	broad.mit.edu	37	1	155838163	155838163	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155838163T>A	uc001fmg.2	+	2	705	c.442T>A	c.(442-444)TCT>ACT	p.S148T	SYT11_uc010pgq.1_Intron	NM_152280	NP_689493	Q9BT88	SYT11_HUMAN	synaptotagmin XI	148	Cytoplasmic (Potential).					cell junction|synaptic vesicle membrane	protein binding|transporter activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			CAAAACCACCTCTCCATCATC	0.498													64	207	---	---	---	---	PASS
ARHGEF2	9181	broad.mit.edu	37	1	155921271	155921271	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155921271G>A	uc001fmt.2	-						ARHGEF2_uc001fmq.2_5'Flank|ARHGEF2_uc001fmr.2_Intron|ARHGEF2_uc001fms.2_Intron|ARHGEF2_uc001fmu.2_Intron	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor 2						actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TTGTCCTACTGACCTGTAGGC	0.552													35	311	---	---	---	---	PASS
SSR2	6746	broad.mit.edu	37	1	155979398	155979398	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155979398C>T	uc001fmx.2	-	6	565	c.485G>A	c.(484-486)GGC>GAC	p.G162D	SSR2_uc001fmv.2_RNA|SSR2_uc001fmw.2_RNA|SSR2_uc001fmy.2_RNA|SSR2_uc010pgv.1_3'UTR	NM_003145	NP_003136	P43308	SSRB_HUMAN	signal sequence receptor, beta precursor	162	Helical; (Potential).				cotranslational protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	signal sequence binding				0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CAGGGGGATGCCGATGGAGGG	0.517													6	348	---	---	---	---	PASS
SEMA4A	64218	broad.mit.edu	37	1	156144870	156144870	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156144870C>T	uc001fnl.2	+						SEMA4A_uc009wrq.2_Intron|SEMA4A_uc001fnm.2_Intron|SEMA4A_uc001fnn.2_Intron|SEMA4A_uc001fno.2_Intron	NM_022367	NP_071762	Q9H3S1	SEM4A_HUMAN	semaphorin B precursor						axon guidance	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					CTCCATCTCTCTTCCAGGGTG	0.607													27	196	---	---	---	---	PASS
CCT3	7203	broad.mit.edu	37	1	156280936	156280936	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156280936G>C	uc001fol.1	-	12	1426	c.1206C>G	c.(1204-1206)CTC>CTG	p.L402L	CCT3_uc001fom.1_Silent_p.L401L|CCT3_uc001fon.1_Silent_p.L364L|CCT3_uc010phj.1_Silent_p.L356L|CCT3_uc010phk.1_Silent_p.L356L|CCT3_uc010phl.1_Silent_p.L356L	NM_005998	NP_005989	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 isoform a	402					'de novo' posttranslational protein folding	cytoskeleton|cytosol|plasma membrane	ATP binding|unfolded protein binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					GAGGGTCCAGGAGAACATTGC	0.532													23	139	---	---	---	---	PASS
IQGAP3	128239	broad.mit.edu	37	1	156509192	156509192	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156509192G>C	uc001fpf.2	-	25	3105	c.3030C>G	c.(3028-3030)TTC>TTG	p.F1010L		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1010	Ras-GAP.				small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTGCTGTCTTGAACAGCTGGA	0.522													17	60	---	---	---	---	PASS
C1orf66	51093	broad.mit.edu	37	1	156703852	156703852	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156703852G>C	uc001fpu.2	+	6	1322	c.688G>C	c.(688-690)GAC>CAC	p.D230H	C1orf66_uc001fpv.2_Intron	NM_015997	NP_057081	Q96FB5	RRNAD_HUMAN	hypothetical protein LOC51093 isoform 1	230						integral to membrane	rRNA (adenine-N6,N6-)-dimethyltransferase activity				0	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TAGGTGGGTAGACCCCACAGC	0.607													28	156	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157509064	157509064	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157509064C>G	uc001fqu.2	-	7	1372	c.1214G>C	c.(1213-1215)AGA>ACA	p.R405T	FCRL5_uc009wsm.2_Missense_Mutation_p.R405T|FCRL5_uc010phv.1_Missense_Mutation_p.R405T|FCRL5_uc010phw.1_Missense_Mutation_p.R320T|FCRL5_uc001fqv.1_Missense_Mutation_p.R405T|FCRL5_uc010phx.1_Missense_Mutation_p.R156T	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	405	Extracellular (Potential).|Ig-like C2-type 4.					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GAGTGAACCTCTCTGGGCTTC	0.557													11	82	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157771948	157771948	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157771948G>A	uc001frg.2	-	5	756	c.643C>T	c.(643-645)CCC>TCC	p.P215S	FCRL1_uc001frf.2_RNA|FCRL1_uc001frh.2_Missense_Mutation_p.P215S|FCRL1_uc001fri.2_Missense_Mutation_p.P215S|FCRL1_uc001frj.2_RNA	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	215	Ig-like C2-type 3.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TGGGCCCTGGGAGCCCTGAGC	0.562													5	111	---	---	---	---	PASS
OR10K2	391107	broad.mit.edu	37	1	158389820	158389820	+	Silent	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158389820A>G	uc010pii.1	-	1	837	c.837T>C	c.(835-837)ACT>ACC	p.T279T		NM_001004476	NP_001004476	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K,	279	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					GAGTTATAATAGTGTAGGATA	0.378													33	154	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158581092	158581092	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158581092C>T	uc001fst.1	-	52	7421	c.7222G>A	c.(7222-7224)GAC>AAC	p.D2408N		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2408				GRSHLSGYDYVGFTNSYFGN -> VEAISLAMTTLASPIPT LATNKQLLVDRRKS (in Ref. 1; AAA60577/ AAA60994).	actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CCAACGTAGTCATAGCCAGAG	0.473													11	111	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158612261	158612261	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158612261G>C	uc001fst.1	-	33	4876	c.4677C>G	c.(4675-4677)ATC>ATG	p.I1559M		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1559	Spectrin 15.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TCCCCAGGTTGATGACGCCAT	0.463													25	189	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158641934	158641934	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158641934C>T	uc001fst.1	-	11	1602	c.1403G>A	c.(1402-1404)CGT>CAT	p.R468H		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	468	Spectrin 5.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CTGACGATGACGCTCGTCCCA	0.438													15	133	---	---	---	---	PASS
OR6K3	391114	broad.mit.edu	37	1	158687704	158687704	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158687704A>T	uc010pip.1	-	1	250	c.250T>A	c.(250-252)TTT>ATT	p.F84I		NM_001005327	NP_001005327	Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K,	84	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					ATCTCCAGAAAGGAAAATATA	0.408													58	423	---	---	---	---	PASS
FCER1A	2205	broad.mit.edu	37	1	159277627	159277627	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159277627C>T	uc001ftq.2	+	6	778	c.679C>T	c.(679-681)CAG>TAG	p.Q227*		NM_002001	NP_001992	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor	227	Cytoplasmic (Potential).					integral to plasma membrane				lung(2)|skin(2)|prostate(1)	5	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	TATCTCAACTCAGCAGCAGGT	0.423													5	266	---	---	---	---	PASS
ATP1A2	477	broad.mit.edu	37	1	160104397	160104397	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160104397C>G	uc001fvc.2	+	14	2083	c.1951C>G	c.(1951-1953)CAA>GAA	p.Q651E	ATP1A2_uc001fvb.2_Missense_Mutation_p.Q651E|ATP1A2_uc001fvd.2_Missense_Mutation_p.Q387E	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein	651	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TCCCATGAGTCAAGTCAACCC	0.557													14	150	---	---	---	---	PASS
LY9	4063	broad.mit.edu	37	1	160765981	160765981	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160765981G>A	uc001fwu.2	+	1	54	c.4G>A	c.(4-6)GTG>ATG	p.V2M	LY9_uc001fwt.2_Missense_Mutation_p.V2M|LY9_uc010pjs.1_Missense_Mutation_p.V2M|LY9_uc001fwv.2_Missense_Mutation_p.V2M|LY9_uc001fww.2_Missense_Mutation_p.V2M|LY9_uc001fwx.2_Missense_Mutation_p.V2M	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	2					cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GATCATCATGGTGGCACCAAA	0.443													25	232	---	---	---	---	PASS
LY9	4063	broad.mit.edu	37	1	160784311	160784311	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160784311G>C	uc001fwu.2	+	4	882	c.832G>C	c.(832-834)GAG>CAG	p.E278Q	LY9_uc010pjs.1_Missense_Mutation_p.E278Q|LY9_uc001fwv.2_Missense_Mutation_p.E278Q|LY9_uc001fww.2_Missense_Mutation_p.E278Q|LY9_uc001fwx.2_Missense_Mutation_p.E278Q|LY9_uc001fwy.1_Missense_Mutation_p.E180Q|LY9_uc001fwz.2_5'UTR	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	278	Extracellular (Potential).|Ig-like V-type 2.				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CCGGGACACAGAGAAGGTTGT	0.542													16	164	---	---	---	---	PASS
LY9	4063	broad.mit.edu	37	1	160788107	160788107	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160788107G>C	uc001fwu.2	+	6	1492	c.1442G>C	c.(1441-1443)CGG>CCG	p.R481P	LY9_uc001fwv.2_Missense_Mutation_p.R481P|LY9_uc001fww.2_Missense_Mutation_p.R391P|LY9_uc001fwx.2_Missense_Mutation_p.R391P|LY9_uc001fwy.1_Missense_Mutation_p.R293P|LY9_uc001fwz.2_Missense_Mutation_p.R133P	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	481	Cytoplasmic (Potential).				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CGAAAAGGACGGTGTGAGTTT	0.532													23	165	---	---	---	---	PASS
CD244	51744	broad.mit.edu	37	1	160811267	160811267	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160811267C>G	uc009wtq.2	-	3	581	c.403G>C	c.(403-405)GAG>CAG	p.E135Q	CD244_uc001fxa.2_Missense_Mutation_p.E130Q|CD244_uc009wtp.2_RNA|CD244_uc009wtr.2_Intron|CD244_uc010pjt.1_Intron	NM_016382	NP_057466	Q9BZW8	CD244_HUMAN	CD244 natural killer cell receptor 2B4	135	Extracellular (Potential).|Ig-like 2.				blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CGGGGTTTCTCAACTTTATCT	0.507													4	119	---	---	---	---	PASS
FCGR3A	2214	broad.mit.edu	37	1	161518423	161518423	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161518423C>T	uc001gat.3	-	4	244	c.107G>A	c.(106-108)AGG>AAG	p.R36K	FCGR3A_uc001gar.2_Missense_Mutation_p.R72K|FCGR3A_uc001gas.2_Missense_Mutation_p.R71K|FCGR3A_uc009wuh.2_Missense_Mutation_p.R35K|FCGR3A_uc009wui.2_Missense_Mutation_p.R36K	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor	36	Ig-like C2-type 1.|Extracellular (Potential).				immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CTCGAGCACCCTGTACCATTG	0.542													23	394	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167097043	167097043	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167097043C>T	uc001geb.1	+	5	2675	c.2675C>T	c.(2674-2676)GCC>GTC	p.A892V		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	892	Ser-rich.				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						ACTGACAGTGCCATAGGGAGC	0.517													25	84	---	---	---	---	PASS
DCAF6	55827	broad.mit.edu	37	1	167962587	167962587	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167962587G>A	uc001gew.2	+	7	1054	c.812G>A	c.(811-813)AGT>AAT	p.S271N	DCAF6_uc001gev.2_Missense_Mutation_p.S271N|DCAF6_uc001gex.2_Missense_Mutation_p.S271N|DCAF6_uc010plk.1_Missense_Mutation_p.S240N|DCAF6_uc001gey.2_Missense_Mutation_p.S124N	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b	271	WD 5.				positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						ATTCTCGTTAGTTACTCTTCA	0.398													43	125	---	---	---	---	PASS
SELP	6403	broad.mit.edu	37	1	169580801	169580801	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169580801C>G	uc001ggi.3	-	7	1141	c.1076G>C	c.(1075-1077)AGA>ACA	p.R359T	SELP_uc001ggh.2_Missense_Mutation_p.R194T|SELP_uc009wvr.2_Missense_Mutation_p.R359T	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	359	Sushi 3.|Extracellular (Potential).				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	GCCCCTCACTCTGTAGCCGGG	0.542													21	177	---	---	---	---	PASS
KIFAP3	22920	broad.mit.edu	37	1	169953797	169953797	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169953797C>T	uc001ggv.2	-	12	1590	c.1319G>A	c.(1318-1320)CGA>CAA	p.R440Q	KIFAP3_uc010plx.1_Missense_Mutation_p.R142Q	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	440					blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CAAGTCAATTCGTTCATCTGA	0.368													18	158	---	---	---	---	PASS
KIFAP3	22920	broad.mit.edu	37	1	170024510	170024510	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170024510C>T	uc001ggv.2	-	2	371	c.100G>A	c.(100-102)GAA>AAA	p.E34K	KIFAP3_uc010ply.1_5'UTR|KIFAP3_uc001ggw.1_Intron	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	34					blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ATGGTAGCTTCCACTTCATAG	0.348													18	137	---	---	---	---	PASS
BAT2L2	23215	broad.mit.edu	37	1	171486904	171486904	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171486904G>C	uc010pmg.1	+	6	961	c.695G>C	c.(694-696)GGA>GCA	p.G232A	BAT2L2_uc001ghr.1_Missense_Mutation_p.G234A	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	232							protein C-terminus binding				0						AAACTGAATGGACAGCAGGCT	0.438													15	70	---	---	---	---	PASS
C1orf105	92346	broad.mit.edu	37	1	172417620	172417620	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172417620G>A	uc001gik.2	+	3	343	c.147G>A	c.(145-147)AAG>AAA	p.K49K		NM_139240	NP_640333	O95561	CA105_HUMAN	hypothetical protein LOC92346	49										skin(1)	1						CTTCATCCAAGAAGAATATGA	0.358													76	198	---	---	---	---	PASS
TNFSF18	8995	broad.mit.edu	37	1	173020013	173020013	+	Silent	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173020013A>G	uc001giu.2	-	1	91	c.90T>C	c.(88-90)AAT>AAC	p.N30N		NM_005092	NP_005083	Q9UNG2	TNF18_HUMAN	tumor necrosis factor (ligand) superfamily,	30	Cytoplasmic (Potential).				anti-apoptosis|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1						TTAAAGGCATATTTTCCAAGT	0.398													14	89	---	---	---	---	PASS
KLHL20	27252	broad.mit.edu	37	1	173735424	173735424	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173735424G>C	uc001gjc.2	+	8	1470	c.1291G>C	c.(1291-1293)GAG>CAG	p.E431Q	KLHL20_uc010pmr.1_Missense_Mutation_p.E242Q|KLHL20_uc009wwf.2_Missense_Mutation_p.E413Q	NM_014458	NP_055273	Q9Y2M5	KLH20_HUMAN	kelch-like 20	431	Kelch 3.				cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity			ovary(1)	1						CAACATTGTTGAGAGGTGATC	0.353													39	344	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175375563	175375563	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175375563C>A	uc001gkp.1	-	1	369	c.288G>T	c.(286-288)GAG>GAT	p.E96D	TNR_uc009wwu.1_Missense_Mutation_p.E96D|TNR_uc010pmz.1_Missense_Mutation_p.E96D	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	96					axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					CTGCCAGAGTCTCGTCTTCTG	0.547													20	189	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176915139	176915139	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176915139G>C	uc001glc.2	-	13	2384	c.2172C>G	c.(2170-2172)CTC>CTG	p.L724L	ASTN1_uc001glb.1_Silent_p.L724L|ASTN1_uc001gld.1_Silent_p.L724L|ASTN1_uc009wwx.1_Silent_p.L724L	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	732					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						TCTCCCCAAAGAGGGTCTGGT	0.507													27	289	---	---	---	---	PASS
FAM20B	9917	broad.mit.edu	37	1	179033588	179033588	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179033588G>A	uc001gmc.2	+	6	1188	c.895G>A	c.(895-897)GAT>AAT	p.D299N		NM_014864	NP_055679	O75063	XYLK_HUMAN	hypothetical protein LOC9917 precursor	299	Lumenal (Potential).					Golgi membrane|integral to membrane	ATP binding|kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(3)	3						CTTTCAAGATGATGAAGGCGC	0.483													14	89	---	---	---	---	PASS
ABL2	27	broad.mit.edu	37	1	179078431	179078431	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179078431C>T	uc001gmj.3	-	12	2258	c.1971G>A	c.(1969-1971)ATG>ATA	p.M657I	ABL2_uc010pnf.1_Missense_Mutation_p.M657I|ABL2_uc010png.1_Missense_Mutation_p.M636I|ABL2_uc010pnh.1_Missense_Mutation_p.M636I|ABL2_uc001gmg.3_Missense_Mutation_p.M642I|ABL2_uc001gmi.3_Missense_Mutation_p.M642I|ABL2_uc001gmh.3_Missense_Mutation_p.M621I|ABL2_uc010pne.1_Missense_Mutation_p.M621I	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b	657					axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TTCTCTTCTTCATGAAGGAGC	0.502			T	ETV6	AML								14	625	---	---	---	---	PASS
C1orf125	126859	broad.mit.edu	37	1	179503872	179503872	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179503872G>C	uc001gmo.2	+	25	2933	c.2806G>C	c.(2806-2808)GAA>CAA	p.E936Q	C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmp.2_Missense_Mutation_p.E862Q|C1orf125_uc009wxh.2_RNA	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	936	Glu-rich.										0						CAGGGAGGTTGAAAATAGAGC	0.343													23	205	---	---	---	---	PASS
TOR1AIP2	163590	broad.mit.edu	37	1	179815465	179815465	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179815465T>A	uc001gnk.2	-	6	1542	c.1154A>T	c.(1153-1155)GAG>GTG	p.E385V	TOR1AIP2_uc001gnl.2_Missense_Mutation_p.E385V	NM_145034	NP_659471	Q8NFQ8	TOIP2_HUMAN	torsin A interacting protein 2	385						endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1						GGCAGCATTCTCATGATCACA	0.478													41	114	---	---	---	---	PASS
EDEM3	80267	broad.mit.edu	37	1	184688712	184688712	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184688712C>T	uc010pok.1	-						EDEM3_uc010pol.1_Intron|EDEM3_uc010pom.1_Intron	NM_025191	NP_079467	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			skin(1)	1						GCTAAAAGATCACAACATGTG	0.338													8	139	---	---	---	---	PASS
FAM129A	116496	broad.mit.edu	37	1	184853879	184853879	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184853879T>C	uc001gra.2	-	5	683	c.489A>G	c.(487-489)CCA>CCG	p.P163P	FAM129A_uc009wyh.1_Intron|FAM129A_uc009wyi.1_Intron	NM_052966	NP_443198	Q9BZQ8	NIBAN_HUMAN	niban protein isoform 2	163					negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4						ACAGGTACACTGGGAATTCCT	0.493													14	81	---	---	---	---	PASS
IVNS1ABP	10625	broad.mit.edu	37	1	185267261	185267261	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185267261C>A	uc001grl.2	-	15	2458	c.1835G>T	c.(1834-1836)GGA>GTA	p.G612V	IVNS1ABP_uc001gri.2_Missense_Mutation_p.G272V|IVNS1ABP_uc001grj.2_Missense_Mutation_p.G272V|IVNS1ABP_uc009wyj.2_Missense_Mutation_p.G394V|IVNS1ABP_uc009wyk.2_RNA	NM_006469	NP_006460	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	612	Kelch 6.				interspecies interaction between organisms|response to virus|RNA splicing|transcription from RNA polymerase III promoter	cytoplasm|cytoskeleton|spliceosomal complex|transcription factor complex				ovary(4)|central_nervous_system(1)	5						ATCGAATCCTCCCACTGCATA	0.393													62	598	---	---	---	---	PASS
IVNS1ABP	10625	broad.mit.edu	37	1	185270568	185270568	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185270568G>C	uc001grl.2	-	9	1516	c.893C>G	c.(892-894)TCA>TGA	p.S298*	IVNS1ABP_uc001gri.2_5'UTR|IVNS1ABP_uc001grj.2_5'UTR|IVNS1ABP_uc009wyj.2_Nonsense_Mutation_p.S80*|IVNS1ABP_uc009wyk.2_RNA|IVNS1ABP_uc001grm.2_5'UTR	NM_006469	NP_006460	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	298	Sufficient for AHR interaction and signaling.				interspecies interaction between organisms|response to virus|RNA splicing|transcription from RNA polymerase III promoter	cytoplasm|cytoskeleton|spliceosomal complex|transcription factor complex				ovary(4)|central_nervous_system(1)	5						ATACTTACTTGAAGTCTTTTC	0.373													34	321	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186099718	186099718	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186099718G>C	uc001grq.1	+	85	13348	c.13119G>C	c.(13117-13119)GTG>GTC	p.V4373V	HMCN1_uc001grs.1_5'UTR	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4373	Ig-like C2-type 43.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						ATTGTGAGGTGAAAGGAGACC	0.478													26	191	---	---	---	---	PASS
RGS13	6003	broad.mit.edu	37	1	192627366	192627366	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192627366G>A	uc001gsj.2	+	6	444	c.163G>A	c.(163-165)GAG>AAG	p.E55K	RGS13_uc001gsk.2_Missense_Mutation_p.E55K	NM_002927	NP_002918	O14921	RGS13_HUMAN	regulator of G-protein signalling 13	55	RGS.					plasma membrane	GTPase activator activity|signal transducer activity				0						TTTAAAAATGGAGCACAGTGA	0.358													25	131	---	---	---	---	PASS
CFHR2	3080	broad.mit.edu	37	1	196928072	196928072	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196928072C>A	uc001gtq.1	+	5	752	c.675C>A	c.(673-675)AAC>AAA	p.N225K	CFHR2_uc001gtr.1_Missense_Mutation_p.N101K	NM_005666	NP_005657	P36980	FHR2_HUMAN	H factor (complement)-like 3 precursor	225	Sushi 4.					extracellular region				skin(2)|ovary(1)	3						AGTGGACAAACCAACAAAAGC	0.284													7	106	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198700751	198700751	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198700751G>A	uc001gur.1	+	18	2044	c.1864G>A	c.(1864-1866)GAA>AAA	p.E622K	PTPRC_uc001gus.1_Missense_Mutation_p.E574K|PTPRC_uc001gut.1_Missense_Mutation_p.E461K|PTPRC_uc009wzf.1_Missense_Mutation_p.E510K|PTPRC_uc010ppg.1_Missense_Mutation_p.E558K	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	622	Cytoplasmic (Potential).				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						TCCAGATGATGAAAAACAACT	0.348													14	174	---	---	---	---	PASS
ZNF281	23528	broad.mit.edu	37	1	200377663	200377663	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200377663G>C	uc001gve.2	-	2	1278	c.1171C>G	c.(1171-1173)CTG>GTG	p.L391V	ZNF281_uc001gvf.1_Missense_Mutation_p.L391V|ZNF281_uc001gvg.1_Missense_Mutation_p.L355V	NM_012482	NP_036614	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	391					negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|breast(1)	2						AACACAGCCAGATTACCCATA	0.403													11	527	---	---	---	---	PASS
CAMSAP1L1	23271	broad.mit.edu	37	1	200801403	200801403	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200801403G>C	uc001gvl.2	+	6	1024	c.754G>C	c.(754-756)GGG>CGG	p.G252R	CAMSAP1L1_uc001gvk.2_Missense_Mutation_p.G241R|CAMSAP1L1_uc001gvm.2_Missense_Mutation_p.G241R	NM_203459	NP_982284	Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein	252	CH.					cytoplasm|microtubule	protein binding			ovary(2)|large_intestine(1)|pancreas(1)	4						GTTGAAGGATGGGACAGATGG	0.383													18	231	---	---	---	---	PASS
CAMSAP1L1	23271	broad.mit.edu	37	1	200801404	200801404	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200801404G>T	uc001gvl.2	+	6	1025	c.755G>T	c.(754-756)GGG>GTG	p.G252V	CAMSAP1L1_uc001gvk.2_Missense_Mutation_p.G241V|CAMSAP1L1_uc001gvm.2_Missense_Mutation_p.G241V	NM_203459	NP_982284	Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein	252	CH.					cytoplasm|microtubule	protein binding			ovary(2)|large_intestine(1)|pancreas(1)	4						TTGAAGGATGGGACAGATGGC	0.383													18	232	---	---	---	---	PASS
CAMSAP1L1	23271	broad.mit.edu	37	1	200825142	200825142	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200825142G>C	uc001gvl.2	+	16	4204	c.3934G>C	c.(3934-3936)GAG>CAG	p.E1312Q	CAMSAP1L1_uc001gvk.2_Missense_Mutation_p.E1301Q|CAMSAP1L1_uc001gvm.2_Missense_Mutation_p.E1285Q	NM_203459	NP_982284	Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein	1312						cytoplasm|microtubule	protein binding			ovary(2)|large_intestine(1)|pancreas(1)	4						AATTAGATCAGAGTCTGTAGA	0.388													52	355	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201047027	201047027	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201047027C>G	uc001gvv.2	-	11	1826	c.1599G>C	c.(1597-1599)CTG>CTC	p.L533L		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	533	II.|Helical; Name=S4 of repeat II; (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TGAAGATCCTCAGGAGGCGGA	0.632													10	86	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201060808	201060808	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201060808G>A	uc001gvv.2	-	5	881	c.654C>T	c.(652-654)TTC>TTT	p.F218F		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	218	Helical; Name=S5 of repeat I; (Potential).|I.				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TCTTGCCCTTGAAGAGCTCCA	0.562													21	234	---	---	---	---	PASS
ZC3H11A	9877	broad.mit.edu	37	1	203819065	203819065	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203819065C>T	uc001hac.2	+	17	2466	c.1850C>T	c.(1849-1851)TCC>TTC	p.S617F	ZC3H11A_uc001had.2_Missense_Mutation_p.S617F|ZC3H11A_uc001hae.2_Missense_Mutation_p.S617F|ZC3H11A_uc001haf.2_Missense_Mutation_p.S617F|ZC3H11A_uc010pqm.1_Missense_Mutation_p.S563F|ZC3H11A_uc001hag.1_Missense_Mutation_p.S617F	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	617							nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ACAAAGTCATCCCAGAAGGTG	0.493													20	127	---	---	---	---	PASS
REN	5972	broad.mit.edu	37	1	204131207	204131207	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204131207G>A	uc001haq.2	-	2	227	c.183C>T	c.(181-183)AGC>AGT	p.S61S		NM_000537	NP_000528	P00797	RENI_HUMAN	renin preproprotein	61					angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity			skin(3)|central_nervous_system(1)	4	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	TCATGGGTTGGCTCCACTCGG	0.592											OREG0014128	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	56	---	---	---	---	PASS
PPP1R15B	84919	broad.mit.edu	37	1	204379147	204379147	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204379147C>G	uc001hav.3	-	1	1798	c.1393G>C	c.(1393-1395)GAC>CAC	p.D465H		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	465					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			AGGTCTGAGTCTGACAGTGAG	0.458													213	325	---	---	---	---	PASS
LRRN2	10446	broad.mit.edu	37	1	204587926	204587926	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204587926C>T	uc001hbe.1	-	3	1583	c.1195G>A	c.(1195-1197)GAG>AAG	p.E399K	MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Missense_Mutation_p.E399K|LRRN2_uc009xbf.1_Missense_Mutation_p.E399K|MDM4_uc001hbc.2_Intron	NM_006338	NP_006329	O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2 precursor	399	Extracellular (Potential).|LRRCT.				cell adhesion	integral to membrane	receptor activity			central_nervous_system(2)	2	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			TCCGGAGGCTCCGCACACAGG	0.662													10	69	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204953167	204953167	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204953167C>T	uc001hbj.2	+						NFASC_uc010pra.1_Missense_Mutation_p.A824V|NFASC_uc001hbi.2_Missense_Mutation_p.A824V|NFASC_uc010prb.1_Missense_Mutation_p.A839V|NFASC_uc010prc.1_Missense_Mutation_p.A395V|NFASC_uc001hbk.1_Missense_Mutation_p.A634V|NFASC_uc001hbl.1_Intron|NFASC_uc001hbm.1_5'Flank	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor						axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCCAGGGCTGCGCCCACTGAA	0.488													5	57	---	---	---	---	PASS
FAIM3	9214	broad.mit.edu	37	1	207085125	207085125	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207085125G>C	uc001hey.2	-	4	839	c.660C>G	c.(658-660)CTC>CTG	p.L220L	FAIM3_uc010prz.1_Silent_p.L108L|FAIM3_uc010psa.1_Silent_p.L129L|FAIM3_uc010psb.1_Silent_p.L220L	NM_005449	NP_005440	O60667	FAIM3_HUMAN	Fas apoptotic inhibitory molecule 3 isoform a	220	Extracellular (Potential).				anti-apoptosis|cellular defense response	integral to membrane				central_nervous_system(1)	1	Breast(84;0.201)					TCTGGGGCTTGAGCAGCCCCT	0.557											OREG0014185	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	140	---	---	---	---	PASS
PFKFB2	5208	broad.mit.edu	37	1	207244530	207244530	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207244530C>G	uc001hfg.2	+						PFKFB2_uc010psc.1_Intron|PFKFB2_uc001hfh.2_Intron|PFKFB2_uc009xcc.2_Intron|PFKFB2_uc010psd.1_Intron	NM_006212	NP_006203	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,						fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity			ovary(1)	1	Prostate(682;0.19)					TTTCTGTTTTCAGATGAGCTA	0.453													30	215	---	---	---	---	PASS
SYT14	255928	broad.mit.edu	37	1	210273457	210273457	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210273457C>G	uc009xcv.2	+	6	887	c.815C>G	c.(814-816)TCA>TGA	p.S272*	SYT14_uc001hhs.3_Nonsense_Mutation_p.S317*|SYT14_uc001hht.3_Nonsense_Mutation_p.S272*|SYT14_uc001hhu.3_RNA|SYT14_uc010psn.1_Nonsense_Mutation_p.S317*|SYT14_uc010pso.1_Nonsense_Mutation_p.S234*	NM_153262	NP_694994	Q8NB59	SYT14_HUMAN	synaptotagmin XIV isoform 4	272	Cytoplasmic (Potential).					integral to membrane				ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.085)		GACTATGACTCACAAGAACAG	0.443													12	126	---	---	---	---	PASS
HHAT	55733	broad.mit.edu	37	1	210761406	210761406	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210761406G>C	uc009xcx.2	+	10	1374	c.1208G>C	c.(1207-1209)CGG>CCG	p.R403P	HHAT_uc010psq.1_Missense_Mutation_p.R266P|HHAT_uc001hhz.3_Missense_Mutation_p.R403P|HHAT_uc010psr.1_Missense_Mutation_p.R404P|HHAT_uc010pss.1_Missense_Mutation_p.R358P|HHAT_uc009xcy.2_Missense_Mutation_p.R338P|HHAT_uc010pst.1_Missense_Mutation_p.R340P|HHAT_uc010psu.1_Missense_Mutation_p.R338P|HHAT_uc001hia.3_Missense_Mutation_p.R93P	NM_001122834	NP_001116306	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	403					multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		AATGGAGTCCGGAGGCTGGTG	0.557													8	28	---	---	---	---	PASS
PPP2R5A	5525	broad.mit.edu	37	1	212502659	212502659	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212502659G>C	uc001hjb.2	+	2	938	c.364G>C	c.(364-366)GAT>CAT	p.D122H	PPP2R5A_uc010ptd.1_Missense_Mutation_p.D63H	NM_006243	NP_006234	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B	122					negative regulation of establishment of protein localization in plasma membrane|negative regulation of lipid kinase activity|positive regulation of protein dephosphorylation|signal transduction	chromosome, centromeric region|cytoplasm|nucleus|protein phosphatase type 2A complex	kinase binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		AGCGTATTCTGATATAGTAAA	0.299													9	97	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214818501	214818501	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214818501C>T	uc001hkm.2	+	13	5762	c.5588C>T	c.(5587-5589)TCT>TTT	p.S1863F		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	1959	Potential.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GTAGAAACTTCTGAAGGCCTC	0.368													5	101	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215824088	215824088	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215824088G>T	uc001hku.1	-	65	14576	c.14189C>A	c.(14188-14190)ACC>AAC	p.T4730N		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4730	Fibronectin type-III 32.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGCTGGCCCGGTTCTGCACCA	0.547										HNSCC(13;0.011)			111	216	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215916526	215916526	+	Silent	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215916526A>G	uc001hku.1	-	59	11928	c.11541T>C	c.(11539-11541)TGT>TGC	p.C3847C		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3847	Fibronectin type-III 23.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CACCATTTTGACATGCTTGTA	0.368										HNSCC(13;0.011)			51	206	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216017714	216017714	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216017714C>A	uc001hku.1	-	46	9567	c.9180G>T	c.(9178-9180)AAG>AAT	p.K3060N		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3060	Fibronectin type-III 17.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCTTGTAGAGCTTATTATTTA	0.398										HNSCC(13;0.011)			40	146	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216251512	216251512	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216251512G>T	uc001hku.1	-	27	5878	c.5491C>A	c.(5491-5493)CTG>ATG	p.L1831M		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1831	Laminin G-like 2.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTCACCACCAGTGGCTGGTCT	0.438										HNSCC(13;0.011)			31	212	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216500961	216500961	+	Silent	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216500961G>T	uc001hku.1	-	5	1207	c.820C>A	c.(820-822)CGA>AGA	p.R274R	USH2A_uc001hkv.2_Silent_p.R274R	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	274	Laminin N-terminal.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGGTATAATCGAAAATCTTGC	0.358										HNSCC(13;0.011)			82	132	---	---	---	---	PASS
MARK1	4139	broad.mit.edu	37	1	220835153	220835153	+	Splice_Site	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220835153G>A	uc001hmn.3	+	18	2631	c.2034_splice	c.e18-1	p.R678_splice	MARK1_uc009xdw.2_Splice_Site_p.R679_splice|MARK1_uc010pun.1_Splice_Site_p.R663_splice|MARK1_uc001hmm.3_Splice_Site_p.R641_splice	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1						intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)		TCTTGTTCCAGAAGTACATCA	0.408													11	45	---	---	---	---	PASS
MOSC2	54996	broad.mit.edu	37	1	220955136	220955136	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220955136C>G	uc001hmq.2	+	7	1099	c.901C>G	c.(901-903)CCT>GCT	p.P301A	MOSC2_uc001hmr.2_Missense_Mutation_p.P301A|MOSC2_uc009xdx.2_Intron	NM_017898	NP_060368	Q969Z3	MOSC2_HUMAN	MOCO sulphurase C-terminal domain containing 2	301	MOSC.					mitochondrial outer membrane|peroxisome	molybdenum ion binding|oxidoreductase activity|pyridoxal phosphate binding				0				GBM - Glioblastoma multiforme(131;0.00499)|all cancers(67;0.204)		CCTGTGTGATCCTTCTGAGAG	0.393													12	364	---	---	---	---	PASS
HLX	3142	broad.mit.edu	37	1	221053614	221053614	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221053614C>T	uc001hmv.3	+	1	872	c.415C>T	c.(415-417)CCG>TCG	p.P139S		NM_021958	NP_068777	Q14774	HLX_HUMAN	H2.0-like homeobox	139	Pro-rich.				cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				GBM - Glioblastoma multiforme(131;0.00914)		gcaacagcCTCCGCCTCCGCC	0.597													5	33	---	---	---	---	PASS
TAF1A	9015	broad.mit.edu	37	1	222732062	222732062	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222732062C>G	uc009xdz.1	-	11	1482	c.1293G>C	c.(1291-1293)AAG>AAC	p.K431N	TAF1A_uc009xdy.1_Missense_Mutation_p.K122N|TAF1A_uc001hni.1_Missense_Mutation_p.K317N|TAF1A_uc001hnj.2_Missense_Mutation_p.K431N|TAF1A_uc001hnk.2_Missense_Mutation_p.K317N	NM_139352	NP_647603	Q15573	TAF1A_HUMAN	TBP-associated factor 1A isoform 2	431					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	RNA polymerase I transcription factor complex	DNA binding				0				GBM - Glioblastoma multiforme(131;0.0186)		GCTTAATTTTCTTCCCTAAGA	0.294													20	140	---	---	---	---	PASS
MIA3	375056	broad.mit.edu	37	1	222838891	222838891	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222838891G>A	uc001hnl.2	+	28	5663	c.5654G>A	c.(5653-5655)AGA>AAA	p.R1885K	MIA3_uc001hnm.2_Missense_Mutation_p.R763K	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1885	Pro-rich.|Cytoplasmic (Potential).				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)		TCAGGCTCTAGAGATGAGCCT	0.512													8	270	---	---	---	---	PASS
AIDA	64853	broad.mit.edu	37	1	222876525	222876525	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222876525G>C	uc001hnn.2	-	2	350	c.145C>G	c.(145-147)CAA>GAA	p.Q49E	AIDA_uc001hno.2_RNA|AIDA_uc010pus.1_Missense_Mutation_p.Q25E	NM_022831	NP_073742	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	49	Potential.				dorsal/ventral pattern formation|negative regulation of JNK cascade|negative regulation of JUN kinase activity|regulation of protein homodimerization activity						0						TTATTGTGTTGAGCTTGGGCC	0.318													12	136	---	---	---	---	PASS
WNT9A	7483	broad.mit.edu	37	1	228109220	228109220	+	Nonstop_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228109220C>G	uc001hri.2	-	4	1185	c.1097G>C	c.(1096-1098)TGA>TCA	p.*366S		NM_003395	NP_003386	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family,	366					anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|cornea development in camera-type eye|embryonic arm morphogenesis|embryonic skeletal joint morphogenesis|endoderm development|iris morphogenesis|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|neuron differentiation|positive regulation of smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding|signal transducer activity			central_nervous_system(1)|pancreas(1)	2		Prostate(94;0.0405)				CCTGGGAACTCAGCCCTTGCA	0.642													12	133	---	---	---	---	PASS
ARF1	375	broad.mit.edu	37	1	228284827	228284827	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228284827C>G	uc001hrr.2	+	2	240	c.12C>G	c.(10-12)ATC>ATG	p.I4M	ARF1_uc001hrs.2_Missense_Mutation_p.I4M|ARF1_uc001hrt.2_Missense_Mutation_p.I4M|ARF1_uc009xev.2_Intron|ARF1_uc001hru.2_Missense_Mutation_p.I4M|ARF1_uc001hrv.2_Missense_Mutation_p.I4M|ARF1_uc001hrw.2_Missense_Mutation_p.I4M	NM_001024226	NP_001019397	P84077	ARF1_HUMAN	ADP-ribosylation factor 1	4					cellular copper ion homeostasis|COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|protein transport|regulation of defense response to virus by virus|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction|viral reproduction	cytosol|Golgi membrane|perinuclear region of cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding|receptor signaling protein activity				0		Prostate(94;0.0405)				TGGGGAACATCTTCGCCAACC	0.547													4	211	---	---	---	---	PASS
ARF1	375	broad.mit.edu	37	1	228285672	228285672	+	Silent	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228285672A>G	uc001hrr.2	+	5	732	c.504A>G	c.(502-504)GAA>GAG	p.E168E	ARF1_uc001hrs.2_Silent_p.E168E|ARF1_uc001hrt.2_3'UTR|ARF1_uc009xev.2_RNA|ARF1_uc001hru.2_Silent_p.E168E|ARF1_uc001hrv.2_Silent_p.E168E|ARF1_uc001hrw.2_Silent_p.E168E	NM_001024226	NP_001019397	P84077	ARF1_HUMAN	ADP-ribosylation factor 1	168					cellular copper ion homeostasis|COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|protein transport|regulation of defense response to virus by virus|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction|viral reproduction	cytosol|Golgi membrane|perinuclear region of cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding|receptor signaling protein activity				0		Prostate(94;0.0405)				GGCTCTATGAAGGACTGGACT	0.597													12	69	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228495998	228495998	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228495998G>T	uc009xez.1	+	47	12697	c.12653G>T	c.(12652-12654)CGG>CTG	p.R4218L	OBSCN_uc001hsn.2_Missense_Mutation_p.R4218L	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	4218	Ig-like 43.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CACACCCTGCGGCTGAAGGGC	0.642													7	24	---	---	---	---	PASS
HIST3H2A	92815	broad.mit.edu	37	1	228645302	228645302	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228645302C>T	uc001hsy.2	-	1	259	c.217G>A	c.(217-219)GAC>AAC	p.D73N	HIST3H2BB_uc001hsz.2_5'Flank	NM_033445	NP_254280	Q7L7L0	H2A3_HUMAN	histone cluster 3, H2a	73					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)	1		Prostate(94;0.183)				TTCTTGTTGTCGCGCGCCGCG	0.682													17	82	---	---	---	---	PASS
RHOU	58480	broad.mit.edu	37	1	228879380	228879380	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228879380C>G	uc001htf.2	+	3	1291	c.670C>G	c.(670-672)CAA>GAA	p.Q224E		NM_021205	NP_067028	Q7L0Q8	RHOU_HUMAN	ras homolog gene family, member U	224					regulation of small GTPase mediated signal transduction	cell projection|cytosol|focal adhesion|Golgi membrane|podosome	GTP binding|metal ion binding|protein binding				0	Breast(184;0.162)	Prostate(94;0.183)				CGCTGGCATTCAATACTCGGA	0.473													12	184	---	---	---	---	PASS
URB2	9816	broad.mit.edu	37	1	229783477	229783477	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229783477C>G	uc001hts.1	+	7	4263	c.4127C>G	c.(4126-4128)TCA>TGA	p.S1376*	URB2_uc009xfd.1_Nonsense_Mutation_p.S1376*	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	1376						nucleolus				central_nervous_system(2)|ovary(1)	3						GTGCTCTTCTCAATCCTGCAG	0.552													6	170	---	---	---	---	PASS
URB2	9816	broad.mit.edu	37	1	229795041	229795041	+	Silent	SNP	C	G	G	rs9988520		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229795041C>G	uc001hts.1	+	10	4708	c.4572C>G	c.(4570-4572)GCC>GCG	p.A1524A	URB2_uc009xfd.1_Silent_p.A1524A	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	1524						nucleolus				central_nervous_system(2)|ovary(1)	3						GATATACGGCCTAAGGCTATG	0.468													74	120	---	---	---	---	PASS
SLC35F3	148641	broad.mit.edu	37	1	234458779	234458779	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234458779C>A	uc001hwa.1	+	7	1284	c.1056C>A	c.(1054-1056)ATC>ATA	p.I352I	SLC35F3_uc001hvy.1_Silent_p.I421I	NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	352	Helical; (Potential).				transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			CCAGTCAGATCGTCTTCAATG	0.577													24	109	---	---	---	---	PASS
GGPS1	9453	broad.mit.edu	37	1	235505377	235505377	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235505377G>C	uc001hwv.2	+	4	277	c.193G>C	c.(193-195)GAT>CAT	p.D65H	GGPS1_uc001hww.2_Missense_Mutation_p.D65H|GGPS1_uc001hwx.2_Missense_Mutation_p.D11H|GGPS1_uc001hwy.2_Missense_Mutation_p.D65H	NM_001037277	NP_001032354	O95749	GGPPS_HUMAN	geranylgeranyl diphosphate synthase 1 isoform A	65					cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	dimethylallyltranstransferase activity|farnesyltranstransferase activity|geranyltranstransferase activity|metal ion binding			central_nervous_system(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;1.39e-05)			ACTCATCGATGATATTGAAGA	0.348													3	103	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235827887	235827887	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235827887C>G	uc001hxj.2	-	51	11248	c.11073G>C	c.(11071-11073)GTG>GTC	p.V3691V	LYST_uc001hxi.2_Silent_p.V915V	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	3691	WD 5.				defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GATCCCCGTTCACCGTCCAGA	0.557									Chediak-Higashi_syndrome				7	107	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235929511	235929511	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235929511C>A	uc001hxj.2	-	21	6164	c.5989G>T	c.(5989-5991)GCA>TCA	p.A1997S	LYST_uc009xgb.1_Intron|LYST_uc010pxs.1_RNA	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	1997					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AGGACTTCTGCTATAATTTTC	0.358									Chediak-Higashi_syndrome				59	456	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235955020	235955020	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235955020C>A	uc001hxj.2	-	12	4697	c.4522G>T	c.(4522-4524)GAT>TAT	p.D1508Y	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_Intron|LYST_uc001hxl.1_Missense_Mutation_p.D1508Y	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	1508					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AAACTGCTATCTGGTAAAATT	0.338									Chediak-Higashi_syndrome				26	262	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237550644	237550644	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237550644G>T	uc001hyl.1	+	9	760	c.640G>T	c.(640-642)GTG>TTG	p.V214L		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	214	Cytoplasmic (By similarity).|MIR 2.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCTCTGGAGCGTGGCCCCAAT	0.512													31	138	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237580371	237580371	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237580371G>C	uc001hyl.1	+	11	916	c.796G>C	c.(796-798)GCT>CCT	p.A266P		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	266	Cytoplasmic (By similarity).|MIR 3.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	p.A264T(1)		ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGAAGGTGGCGCTGTGTCTGT	0.388													13	102	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237794799	237794799	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237794799G>A	uc001hyl.1	+	42	6633	c.6513G>A	c.(6511-6513)GTG>GTA	p.V2171V		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2171	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACGAGACTGTGATGGAGGTCA	0.448													15	63	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237868518	237868518	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237868518G>T	uc001hyl.1	+	67	9575	c.9455G>T	c.(9454-9456)CGT>CTT	p.R3152L	RYR2_uc010pxz.1_Missense_Mutation_p.R107L	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3152					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TATAGGCAACGTTCTGCATTA	0.338													9	42	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237949313	237949313	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237949313C>T	uc001hyl.1	+	91	13425	c.13305C>T	c.(13303-13305)ACC>ACT	p.T4435T	RYR2_uc010pya.1_Silent_p.T850T	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4435	Potential.|Glu-rich (acidic).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			aagaagaaACCAAATCTGAAC	0.323													3	18	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240374396	240374396	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240374396C>T	uc010pyd.1	+	6	4151	c.3926C>T	c.(3925-3927)TCC>TTC	p.S1309F	FMN2_uc010pye.1_Missense_Mutation_p.S1313F	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1309	FH2.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TTTAGAGACTCCAGTACTTCA	0.274													18	184	---	---	---	---	PASS
CEP170	9859	broad.mit.edu	37	1	243289777	243289777	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243289777C>T	uc001hzs.2	-	20	5137	c.4729G>A	c.(4729-4731)GAG>AAG	p.E1577K	CEP170_uc001hzt.2_Missense_Mutation_p.E1453K|CEP170_uc001hzu.2_Missense_Mutation_p.E1479K|CEP170_uc001hzr.2_Missense_Mutation_p.E166K|CEP170_uc001hzv.1_Intron	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	1577	Targeting to microtubules.|Targeting to centrosomes.					centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			ACATCTTCCTCTTCCCCATCG	0.403													4	43	---	---	---	---	PASS
ZNF695	57116	broad.mit.edu	37	1	247150665	247150665	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247150665T>C	uc009xgu.2	-	4	1297	c.1152A>G	c.(1150-1152)GAA>GAG	p.E384E	ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron|ZNF695_uc009xgt.1_Intron|ZNF695_uc001ibx.2_Intron|ZNF695_uc001iby.2_Intron	NM_020394	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein SBZF3	384	C2H2-type 9.				regulation of transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CTTTGCCACATTCCTCACATT	0.408													19	100	---	---	---	---	PASS
ZNF695	57116	broad.mit.edu	37	1	247150970	247150970	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247150970G>C	uc009xgu.2	-	4	992	c.847C>G	c.(847-849)CTT>GTT	p.L283V	ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron|ZNF695_uc009xgt.1_Intron|ZNF695_uc001ibx.2_Intron|ZNF695_uc001iby.2_Intron	NM_020394	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein SBZF3	283	C2H2-type 5.				regulation of transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TGTTTAGTAAGAACTGAGCAC	0.358													10	62	---	---	---	---	PASS
C1orf150	148823	broad.mit.edu	37	1	247726883	247726883	+	Intron	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247726883T>C	uc001idf.2	+						C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	hypothetical protein LOC148823												0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)			ACTATCTCTTTCCTTGTAGGC	0.353													14	56	---	---	---	---	PASS
OR2G3	81469	broad.mit.edu	37	1	247768946	247768946	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247768946A>T	uc010pyz.1	+	1	59	c.59A>T	c.(58-60)CAC>CTC	p.H20L		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	20	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TTCTCAGACCACCCTCGTCTG	0.493													36	272	---	---	---	---	PASS
OR6F1	343169	broad.mit.edu	37	1	247875804	247875804	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247875804A>G	uc001idj.1	-	1	254	c.254T>C	c.(253-255)CTA>CCA	p.L85P		NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TCTCCCCAGTAGGATGGCCAG	0.483													22	161	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004613	248004613	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004613C>T	uc001idn.1	-	1	586	c.586G>A	c.(586-588)GAG>AAG	p.E196K		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	196	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ATGGTCACCTCGGTGATATAA	0.478													16	180	---	---	---	---	PASS
TRIM58	25893	broad.mit.edu	37	1	248031144	248031144	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248031144C>T	uc001ido.2	+						OR2W3_uc001idp.1_5'Flank	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58							intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CTTTCCTTTTCAGGGTGTGAG	0.458													10	129	---	---	---	---	PASS
OR2L13	284521	broad.mit.edu	37	1	248262678	248262678	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248262678A>G	uc001ids.2	+	3	338	c.1A>G	c.(1-3)ATG>GTG	p.M1V		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	1	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			GAAAGTTTTCATGGAGAAATG	0.254													62	209	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248525698	248525698	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525698C>A	uc001ieh.1	+	1	816	c.816C>A	c.(814-816)ACC>ACA	p.T272T		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	272	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCTTTGCCACCTGCTCCTCCC	0.547													85	258	---	---	---	---	PASS
OR2T10	127069	broad.mit.edu	37	1	248756958	248756958	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248756958C>A	uc010pzn.1	-	1	112	c.112G>T	c.(112-114)GCT>TCT	p.A38S		NM_001004693	NP_001004693	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T,	38	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAAGACACAGCCATCAAAAAT	0.443													16	116	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	41603	41603	+	IGR	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41603C>G								None (None upstream) : FAM110C (6 downstream)																							TTCAAGAAGTCTTCATCATCG	0.398													4	223	---	---	---	---	PASS
SNTG2	54221	broad.mit.edu	37	2	1251221	1251221	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1251221G>C	uc002qwq.2	+						SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CTCCGGTAAGGATGCTTTTGA	0.537													20	47	---	---	---	---	PASS
PDIA6	10130	broad.mit.edu	37	2	10931913	10931913	+	Intron	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10931913G>T	uc002rau.2	-						PDIA6_uc010yjg.1_Intron|PDIA6_uc002rav.2_Intron|PDIA6_uc010yjh.1_Intron|PDIA6_uc002raw.2_Intron	NM_005742	NP_005733	Q15084	PDIA6_HUMAN	protein disulfide isomerase A6 precursor						cell redox homeostasis|glycerol ether metabolic process|protein folding	endoplasmic reticulum lumen|ER-Golgi intermediate compartment|melanosome|plasma membrane	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		TTAGTAGAAGGCACTTACTTT	0.388													17	106	---	---	---	---	PASS
TRIB2	28951	broad.mit.edu	37	2	12864907	12864907	+	Intron	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12864907A>T	uc002rbv.3	+						TRIB2_uc010yjp.1_Intron	NM_021643	NP_067675	Q92519	TRIB2_HUMAN	tribbles homolog 2						negative regulation of fat cell differentiation|negative regulation of interleukin-10 biosynthetic process|negative regulation of protein kinase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity	cytoplasm|cytoskeleton|nucleus	ATP binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			stomach(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATTGGCTCTAAGGTCTTTTCA	0.398													59	279	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15417012	15417012	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15417012G>A	uc002rcc.1	-	43	5378	c.5352C>T	c.(5350-5352)CAC>CAT	p.H1784H	NBAS_uc010exl.1_Silent_p.H856H|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	1784				H -> Y (in Ref. 1; AAM93544).						ovary(2)|liver(1)|skin(1)	4						GCAGTCGAATGTGGGTTTCTG	0.408													16	103	---	---	---	---	PASS
SMC6	79677	broad.mit.edu	37	2	17898106	17898106	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17898106T>A	uc002rco.2	-	14	1544	c.1248A>T	c.(1246-1248)AGA>AGT	p.R416S	SMC6_uc010exo.2_Missense_Mutation_p.R416S|SMC6_uc002rcn.2_Missense_Mutation_p.R416S|SMC6_uc002rcp.1_Missense_Mutation_p.R442S|SMC6_uc002rcq.2_Missense_Mutation_p.R442S|SMC6_uc002rcr.1_Missense_Mutation_p.R416S	NM_001142286	NP_001135758	Q96SB8	SMC6_HUMAN	SMC6 protein	416	Potential.				DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AGGCCTTTACTCTCTCTTTTA	0.338													25	122	---	---	---	---	PASS
NT5C1B	93034	broad.mit.edu	37	2	18770719	18770719	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18770719G>A	uc002rcz.2	-	1	120	c.16C>T	c.(16-18)CTC>TTC	p.L6F	NT5C1B_uc002rcy.2_Missense_Mutation_p.L6F|NT5C1B_uc010exr.2_Missense_Mutation_p.L6F|NT5C1B_uc010yju.1_Intron|NT5C1B_uc002rda.2_Missense_Mutation_p.L6F|NT5C1B_uc010yjv.1_Missense_Mutation_p.L6F|NT5C1B_uc010yjw.1_Missense_Mutation_p.L6F|NT5C1B_uc010exs.2_Missense_Mutation_p.L6F	NM_001002006	NP_001002006	Q96P26	5NT1B_HUMAN	5' nucleotidase, cytosolic IB isoform 1	6					purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			skin(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				TTCTGTTTGAGAGATGTTTGA	0.418													22	205	---	---	---	---	PASS
SDC1	6382	broad.mit.edu	37	2	20403562	20403562	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20403562G>C	uc002rdo.1	-						SDC1_uc002rdp.1_Intron|SDC1_uc010exv.2_Intron	NM_002997	NP_002988	P18827	SDC1_HUMAN	syndecan 1 precursor						lipid metabolic process|lipoprotein metabolic process|myoblast development|striated muscle cell development	cytoplasm|extracellular region|focal adhesion|integral to plasma membrane	cytoskeletal protein binding|protein C-terminus binding			ovary(4)|skin(1)	5	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)		AAGGAATGCAGAGGCCACTCA	0.607													19	114	---	---	---	---	PASS
C2orf79	391356	broad.mit.edu	37	2	25016063	25016063	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25016063G>A	uc002rfm.2	-	1	189	c.184C>T	c.(184-186)CAC>TAC	p.H62Y	CENPO_uc002rfn.2_5'Flank|CENPO_uc002rfo.1_5'Flank|CENPO_uc002rfp.1_5'Flank|CENPO_uc002rfq.1_5'Flank	NM_001013663	NP_001013685	Q6GMV3	PTRD1_HUMAN	hypothetical protein LOC391356	62					translation		aminoacyl-tRNA hydrolase activity|protein tyrosine phosphatase activity				0						TGGTCGCGGTGAGTGTGCAAG	0.657													10	51	---	---	---	---	PASS
KHK	3795	broad.mit.edu	37	2	27320448	27320448	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27320448G>C	uc002ril.2	+	5	1012	c.495G>C	c.(493-495)AAG>AAC	p.K165N	KHK_uc002rim.2_Missense_Mutation_p.K165N|KHK_uc002rin.2_Missense_Mutation_p.K166N|KHK_uc002rio.2_Missense_Mutation_p.K81N	NM_000221	NP_000212	P50053	KHK_HUMAN	ketohexokinase isoform a	165					fructose catabolic process	cytosol	ATP binding|ketohexokinase activity|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGAGCAGAAGATCCGGGTGT	0.612													8	122	---	---	---	---	PASS
DNAJC5G	285126	broad.mit.edu	37	2	27500880	27500880	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27500880C>G	uc002rjl.1	+	4	790	c.372C>G	c.(370-372)TTC>TTG	p.F124L	SLC30A3_uc010ylh.1_5'Flank|DNAJC5G_uc010yli.1_Intron|DNAJC5G_uc002rjm.1_Missense_Mutation_p.F124L	NM_173650	NP_775921	Q8N7S2	DNJ5G_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	124					protein folding	membrane	heat shock protein binding|unfolded protein binding			skin(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTGTTGGTTCAAGGTACACA	0.398													6	198	---	---	---	---	PASS
NRBP1	29959	broad.mit.edu	37	2	27659661	27659661	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27659661G>T	uc002rko.2	+	9	1535	c.703G>T	c.(703-705)GAA>TAA	p.E235*	NRBP1_uc002rkq.2_Nonsense_Mutation_p.E235*|NRBP1_uc002rkp.2_Nonsense_Mutation_p.E235*|NRBP1_uc002rkr.2_Nonsense_Mutation_p.E26*	NM_013392	NP_037524	Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein	235	Protein kinase.				ER to Golgi vesicle-mediated transport|gene expression|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cell cortex|endomembrane system|lamellipodium|membrane|nucleoplasm	ATP binding|protein homodimerization activity|protein kinase activity			ovary(2)|lung(1)	3	Acute lymphoblastic leukemia(172;0.155)					GACTTGTCGAGAAGAGCAGAA	0.483													35	63	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27800538	27800538	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27800538A>G	uc002rkz.3	+	1	1150	c.1099A>G	c.(1099-1101)AAG>GAG	p.K367E		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	367										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					GTTGACTTCTAAGTCAGGAGT	0.463													13	80	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27802036	27802036	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27802036C>G	uc002rkz.3	+	1	2648	c.2597C>G	c.(2596-2598)TCT>TGT	p.S866C		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	866										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					CTCATCAAGTCTTTCCCGGGC	0.473													20	92	---	---	---	---	PASS
WDR43	23160	broad.mit.edu	37	2	29158396	29158396	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29158396C>G	uc002rmo.2	+	12	1479	c.1447C>G	c.(1447-1449)CAA>GAA	p.Q483E		NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43	483						nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					GAAAGTACTTCAAACTAGGAA	0.318													19	107	---	---	---	---	PASS
C2orf71	388939	broad.mit.edu	37	2	29296852	29296852	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29296852C>T	uc002rmt.1	-	1	276	c.276G>A	c.(274-276)CTG>CTA	p.L92L		NM_001029883	NP_001025054	A6NGG8	CB071_HUMAN	hypothetical protein LOC388939	92					response to stimulus|visual perception	photoreceptor outer segment				skin(1)	1						TTCCTGGGATCAGTCCTTCCA	0.488													41	271	---	---	---	---	PASS
XDH	7498	broad.mit.edu	37	2	31590862	31590862	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31590862T>C	uc002rnv.1	-	20	2241	c.2162A>G	c.(2161-2163)AAG>AGG	p.K721R		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	721					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	AAACCCCTTCTTTAGGTCCCC	0.443													95	237	---	---	---	---	PASS
NLRC4	58484	broad.mit.edu	37	2	32476252	32476252	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32476252G>C	uc002roi.2	-	4	927	c.681C>G	c.(679-681)ATC>ATG	p.I227M	NLRC4_uc002roj.1_Missense_Mutation_p.I227M|NLRC4_uc010ezt.1_Intron	NM_021209	NP_067032	Q9NPP4	NLRC4_HUMAN	caspase recruitment domain protein 12	227	NACHT.				activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity			ovary(3)|large_intestine(1)|lung(1)|skin(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TCTGCTTCCTGATTGTGCCAG	0.498													24	120	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37229651	37229651	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37229651G>C	uc002rpp.1	-	32	5211	c.5115C>G	c.(5113-5115)CTC>CTG	p.L1705L	HEATR5B_uc002rpo.1_Silent_p.L18L|HEATR5B_uc010ezy.1_Intron	NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1705							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				TTCCAGGAATGAGACCACCGC	0.438													23	147	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37276911	37276911	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37276911G>C	uc002rpp.1	-	18	2677	c.2581C>G	c.(2581-2583)CTG>GTG	p.L861V		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	861	HEAT 1.						binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				GGGTTGTCCAGAGGACCCATA	0.438													20	71	---	---	---	---	PASS
SFRS7	6432	broad.mit.edu	37	2	38975246	38975246	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38975246C>G	uc002rqz.2	-	5	753	c.515G>C	c.(514-516)AGA>ACA	p.R172T	SFRS7_uc002rra.2_RNA|SFRS7_uc010ynp.1_Missense_Mutation_p.R172T	NM_001031684	NP_001026854	Q16629	SRSF7_HUMAN	splicing factor, arginine/serine-rich 7	172	3.|6 X 8 AA repeats of R-R-S-R-S-X-S-X.|Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding|zinc ion binding				0		all_hematologic(82;0.248)				TGAAGCTGATCTTGATCTACG	0.363													21	116	---	---	---	---	PASS
LRPPRC	10128	broad.mit.edu	37	2	44115753	44115753	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44115753C>A	uc002rtr.2	-	38	4229	c.4171G>T	c.(4171-4173)GAA>TAA	p.E1391*		NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	1391	RNA-binding.				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GAAGAGTTTTCCCTCAATTTT	0.333													9	80	---	---	---	---	PASS
LRPPRC	10128	broad.mit.edu	37	2	44139579	44139579	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44139579C>G	uc002rtr.2	-	30	3325	c.3267G>C	c.(3265-3267)GTG>GTC	p.V1089V	LRPPRC_uc010yob.1_Silent_p.V989V	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	1089	PPR 16.				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ACAATGCTTTCACTTCCATTG	0.308													25	120	---	---	---	---	PASS
PREPL	9581	broad.mit.edu	37	2	44566303	44566303	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44566303C>G	uc002ruf.2	-	6	987	c.952G>C	c.(952-954)GAA>CAA	p.E318Q	PREPL_uc002rug.2_Missense_Mutation_p.E318Q|PREPL_uc002ruh.2_Missense_Mutation_p.E318Q|PREPL_uc010fax.2_Missense_Mutation_p.E318Q|PREPL_uc002rui.3_Missense_Mutation_p.E229Q|PREPL_uc002ruj.1_Missense_Mutation_p.E229Q|PREPL_uc002ruk.1_Missense_Mutation_p.E318Q	NM_006036	NP_006027	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like isoform C	318					proteolysis	cytosol	serine-type endopeptidase activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TCTGTAGGTTCTCCAACATTA	0.418													22	115	---	---	---	---	PASS
PRKCE	5581	broad.mit.edu	37	2	46231672	46231672	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46231672C>G	uc002rut.2	+							NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			TGCTTTCTCTCCTCTCTAGCT	0.532													5	16	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55549772	55549772	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55549772C>G	uc002ryv.2	-	18	3893	c.3051G>C	c.(3049-3051)CAG>CAC	p.Q1017H	CCDC88A_uc010yoz.1_Missense_Mutation_p.Q1018H|CCDC88A_uc010ypa.1_Missense_Mutation_p.Q1017H|CCDC88A_uc002ryu.2_Missense_Mutation_p.Q300H|CCDC88A_uc002rys.2_Missense_Mutation_p.Q3H|CCDC88A_uc002ryw.2_Missense_Mutation_p.Q301H|CCDC88A_uc010fby.1_Intron	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	1018	Potential.				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						GAGGAGAGCTCTGTACCATCC	0.338													72	159	---	---	---	---	PASS
CCDC85A	114800	broad.mit.edu	37	2	56603003	56603003	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56603003C>G	uc002rzn.2	+	5	2007	c.1505C>G	c.(1504-1506)TCT>TGT	p.S502C		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	502										breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TCACCCAACTCTGCAGCTAGC	0.433													15	88	---	---	---	---	PASS
BCL11A	53335	broad.mit.edu	37	2	60689006	60689006	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60689006C>G	uc002sae.1	-	4	1269	c.1041G>C	c.(1039-1041)CAG>CAC	p.Q347H	BCL11A_uc002sab.2_Missense_Mutation_p.Q347H|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Intron|BCL11A_uc010ypj.1_Missense_Mutation_p.Q313H|BCL11A_uc002sad.1_Missense_Mutation_p.Q195H|BCL11A_uc002saf.1_Missense_Mutation_p.Q313H	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	347	Pro-rich.				negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TGCTACCTGGCTGGAATGGTT	0.632			T	IGH@	B-CLL								9	145	---	---	---	---	PASS
PEX13	5194	broad.mit.edu	37	2	61275900	61275900	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61275900C>G	uc002sau.3	+	4	1290	c.1207C>G	c.(1207-1209)CTT>GTT	p.L403V		NM_002618	NP_002609	Q92968	PEX13_HUMAN	peroxisomal biogenesis factor 13	403	Cytoplasmic (Potential).				cerebral cortex cell migration|fatty acid alpha-oxidation|locomotory behavior|microtubule-based peroxisome localization|neuron migration|protein import into peroxisome matrix, docking|suckling behavior	integral to peroxisomal membrane|membrane fraction	protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)			AAAGCAAGATCTTTGATATCT	0.333													24	130	---	---	---	---	PASS
TMEM17	200728	broad.mit.edu	37	2	62729924	62729924	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62729924C>T	uc002sbt.2	-	2	446	c.106G>A	c.(106-108)GAA>AAA	p.E36K	TMEM17_uc002sbu.2_Missense_Mutation_p.E36K|TMEM17_uc002sbv.1_Missense_Mutation_p.E11K	NM_198276	NP_938017	Q86X19	TMM17_HUMAN	transmembrane protein 17	36						integral to membrane					0	Lung NSC(7;0.0274)|all_lung(7;0.0568)		LUSC - Lung squamous cell carcinoma(7;1.31e-05)|Epithelial(17;0.169)			GAGACCATTTCATTTTCTACA	0.353													25	161	---	---	---	---	PASS
EHBP1	23301	broad.mit.edu	37	2	63092065	63092065	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63092065C>G	uc002sby.2	+	10	1544	c.1062C>G	c.(1060-1062)CTC>CTG	p.L354L	EHBP1_uc010fcp.2_Silent_p.L319L|EHBP1_uc002sbx.2_Silent_p.L319L|EHBP1_uc002sbz.2_Silent_p.L319L|EHBP1_uc002scb.2_Silent_p.L319L	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1	354						cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			GCAAGTACCTCTATGCTGATA	0.373									Hereditary_Prostate_Cancer				27	174	---	---	---	---	PASS
EHBP1	23301	broad.mit.edu	37	2	63175914	63175914	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63175914G>T	uc002sby.2	+	14	2520	c.2038G>T	c.(2038-2040)GCA>TCA	p.A680S	EHBP1_uc010fcp.2_Missense_Mutation_p.A645S|EHBP1_uc002sbz.2_Missense_Mutation_p.A645S|EHBP1_uc002scb.2_Missense_Mutation_p.A645S	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1	680						cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TTCAACCCAAGCACAGGTTTT	0.413									Hereditary_Prostate_Cancer				26	96	---	---	---	---	PASS
CEP68	23177	broad.mit.edu	37	2	65299333	65299333	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65299333C>G	uc002sdl.3	+	3	1317	c.1103C>G	c.(1102-1104)TCT>TGT	p.S368C	CEP68_uc002sdj.2_Missense_Mutation_p.S368C|CEP68_uc010yqb.1_Missense_Mutation_p.S368C|CEP68_uc002sdk.3_Missense_Mutation_p.S368C|CEP68_uc010yqc.1_Missense_Mutation_p.S368C|CEP68_uc010yqd.1_Missense_Mutation_p.S368C	NM_015147	NP_055962	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	368					centrosome organization	centrosome				skin(1)	1						CTGCCATTTTCTGGGCCCAGA	0.577													20	129	---	---	---	---	PASS
MTHFD2	10797	broad.mit.edu	37	2	74438937	74438937	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74438937G>C	uc002skk.2	+	7	912	c.833G>C	c.(832-834)AGA>ACA	p.R278T	SLC4A5_uc002skl.2_RNA|MTHFD2_uc002skj.2_Missense_Mutation_p.R176T|MTHFD2_uc010yro.1_Missense_Mutation_p.R176T|MTHFD2_uc010ffb.2_Intron|MTHFD2_uc010yrp.1_Missense_Mutation_p.R114T	NM_006636	NP_006627	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase 2	278					folic acid-containing compound biosynthetic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	magnesium ion binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|phosphate binding|protein binding				0					NADH(DB00157)|Tetrahydrofolic acid(DB00116)	GGAATAAATAGAGTTCACGAT	0.358													25	57	---	---	---	---	PASS
DCTN1	1639	broad.mit.edu	37	2	74598706	74598706	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74598706G>C	uc002skx.2	-	8	914	c.603C>G	c.(601-603)CTC>CTG	p.L201L	DCTN1_uc002skv.2_Silent_p.L67L|DCTN1_uc002sku.2_Silent_p.L67L|DCTN1_uc002skw.1_Silent_p.L177L|DCTN1_uc010ffd.2_Silent_p.L181L|DCTN1_uc002sky.2_Silent_p.L164L	NM_004082	NP_004073	Q14203	DCTN1_HUMAN	dynactin 1 isoform 1	201					cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding			ovary(3)|skin(2)	5						CAGGAGAGGTGAGGACCGGCG	0.647													3	12	---	---	---	---	PASS
HTRA2	27429	broad.mit.edu	37	2	74758161	74758161	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74758161C>G	uc002smi.1	+	3	1437	c.835C>G	c.(835-837)CAG>GAG	p.Q279E	AUP1_uc002sme.2_5'Flank|AUP1_uc002smf.2_5'Flank|AUP1_uc002smg.2_5'Flank|AUP1_uc002smh.2_5'Flank|AUP1_uc010yrx.1_5'Flank|AUP1_uc010yry.1_5'Flank|HTRA2_uc002smj.1_Intron|HTRA2_uc002smk.1_Missense_Mutation_p.Q279E|HTRA2_uc002sml.1_Missense_Mutation_p.Q279E|HTRA2_uc002smm.1_Missense_Mutation_p.Q20E|HTRA2_uc002smn.1_Missense_Mutation_p.Q20E|HTRA2_uc010ffl.2_Missense_Mutation_p.Q20E	NM_013247	NP_037379	O43464	HTRA2_HUMAN	HtrA serine peptidase 2 isoform 1 preproprotein	279	Serine protease.				apoptosis|proteolysis|response to stress	CD40 receptor complex|endoplasmic reticulum membrane|internal side of plasma membrane|mitochondrial intermembrane space|mitochondrial membrane|nucleus	serine-type endopeptidase activity|unfolded protein binding			ovary(1)	1						TAGCTCTGCTCAGCGTCCAGC	0.517													57	350	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80801373	80801373	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80801373C>T	uc010ysh.1	+	12	1832	c.1827C>T	c.(1825-1827)TTC>TTT	p.F609F	CTNNA2_uc010yse.1_Silent_p.F609F|CTNNA2_uc010ysf.1_Silent_p.F609F|CTNNA2_uc010ysg.1_Silent_p.F609F|CTNNA2_uc010ysi.1_Silent_p.F241F	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	609					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						AGAATGAGTTCATCGATGCCT	0.512													30	187	---	---	---	---	PASS
ST3GAL5	8869	broad.mit.edu	37	2	86090577	86090577	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86090577C>T	uc002sqq.1	-	2	243	c.114G>A	c.(112-114)CTG>CTA	p.L38L	ST3GAL5_uc010ysy.1_Silent_p.L38L|ST3GAL5_uc010ysz.1_Silent_p.L38L|ST3GAL5_uc010fgq.1_5'Flank|ST3GAL5_uc002sqp.1_Silent_p.L15L	NM_003896	NP_003887	Q9UNP4	SIAT9_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	38	Cytoplasmic (Potential).				ganglioside biosynthetic process|protein glycosylation	integral to Golgi membrane|integral to plasma membrane	lactosylceramide alpha-2,3-sialyltransferase activity|neolactotetraosylceramide alpha-2,3-sialyltransferase activity				0						AATCACTTCTCAGTTTCACAT	0.473													29	119	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90121687	90121687	+	Intron	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90121687G>T	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		CTCAGCTCCTGGGGCTCCTGC	0.522													24	219	---	---	---	---	PASS
CNNM3	26505	broad.mit.edu	37	2	97492602	97492602	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97492602C>G	uc002swy.2	+	3	1426	c.1402C>G	c.(1402-1404)CTG>GTG	p.L468V	CNNM3_uc002swz.2_Missense_Mutation_p.L420V	NM_017623	NP_060093	Q8NE01	CNNM3_HUMAN	cyclin M3 isoform 1	468					ion transport	integral to membrane|plasma membrane	protein binding			ovary(1)	1						GCCTGCTTCTCTGATGGCCCC	0.537													52	305	---	---	---	---	PASS
CNNM3	26505	broad.mit.edu	37	2	97492629	97492629	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97492629G>A	uc002swy.2	+	3	1453	c.1429G>A	c.(1429-1431)GAG>AAG	p.E477K	CNNM3_uc002swz.2_Missense_Mutation_p.E429K	NM_017623	NP_060093	Q8NE01	CNNM3_HUMAN	cyclin M3 isoform 1	477					ion transport	integral to membrane|plasma membrane	protein binding			ovary(1)	1						GCGGAAGGAGGAGTTCTCCTT	0.562													34	273	---	---	---	---	PASS
CNGA3	1261	broad.mit.edu	37	2	99012792	99012792	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99012792G>A	uc002syt.2	+	8	1576	c.1159G>A	c.(1159-1161)GTG>ATG	p.V387M	CNGA3_uc002syu.2_Missense_Mutation_p.V369M|CNGA3_uc010fij.2_Missense_Mutation_p.V391M	NM_001298	NP_001289	Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3 isoform	387	Helical; (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(5)|upper_aerodigestive_tract(1)	6						AGACTTCTTGGTGGGTGTTCT	0.502													75	107	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100168001	100168001	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100168001C>G	uc002tag.2	-	24	3852	c.3616G>C	c.(3616-3618)GAG>CAG	p.E1206Q	AFF3_uc002taf.2_Missense_Mutation_p.E1231Q	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	1206					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						ACCAGGTGCTCCATGCTGCTG	0.592													4	62	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109384287	109384287	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109384287C>A	uc002tem.3	+	20	7418	c.7292C>A	c.(7291-7293)TCG>TAG	p.S2431*		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	2431	RanBD1 3.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						GTTGCAGACTCGTTTAAGAAA	0.393													21	454	---	---	---	---	PASS
ANAPC1	64682	broad.mit.edu	37	2	112615953	112615953	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112615953C>G	uc002thi.2	-	11	1535	c.1288G>C	c.(1288-1290)GTG>CTG	p.V430L		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	430					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						GTAATAAACACTTTTGAGGCT	0.368													6	116	---	---	---	---	PASS
PAX8	7849	broad.mit.edu	37	2	113999695	113999695	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113999695G>T	uc010yxt.1	-	6	657	c.491C>A	c.(490-492)GCT>GAT	p.A164D	PAX8_uc010yxu.1_Missense_Mutation_p.A164D|PAX8_uc010yxv.1_Missense_Mutation_p.A164D|PAX8_uc002tjm.2_Missense_Mutation_p.A164D|PAX8_uc002tjn.2_Missense_Mutation_p.A164D|PAX8_uc010fku.1_Missense_Mutation_p.A164D|LOC654433_uc002tjq.3_Intron|LOC654433_uc010fks.2_Intron|LOC654433_uc010fkt.2_Intron|LOC654433_uc002tjr.3_Intron	NM_003466	NP_003457	Q06710	PAX8_HUMAN	paired box 8 isoform PAX8A	164					branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2						GGGAGTTACAGCTGAGCTGGG	0.627			T	PPARG	follicular thyroid		Thyroid dysgenesis 						6	45	---	---	---	---	PASS
MIR1302-3	100302128	broad.mit.edu	37	2	114340561	114340561	+	RNA	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114340561A>T	hsa-mir-1302-3|MI0006364	-			c.113A>T			WASH2P_uc002tka.2_5'Flank|WASH2P_uc002tkb.2_5'Flank																	0						tgaatctcagataaacaacca	0.124													9	131	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116520161	116520161	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116520161C>A	uc002tla.1	+	12	1545	c.1088C>A	c.(1087-1089)ACA>AAA	p.T363K	DPP10_uc002tlb.1_Missense_Mutation_p.T313K|DPP10_uc002tlc.1_Missense_Mutation_p.T359K|DPP10_uc002tle.2_Missense_Mutation_p.T367K|DPP10_uc002tlf.1_Missense_Mutation_p.T356K	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	363	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TATGAGATGACATCAGATACG	0.358													26	241	---	---	---	---	PASS
PTPN4	5775	broad.mit.edu	37	2	120643436	120643436	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120643436G>C	uc002tmf.1	+	9	1424	c.653G>C	c.(652-654)GGA>GCA	p.G218A	PTPN4_uc010flj.1_5'UTR	NM_002830	NP_002821	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type	218	FERM.					cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity			ovary(2)	2					Alendronate(DB00630)	GAACTCTATGGAGTTGAATTC	0.333													7	289	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125175063	125175063	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125175063A>C	uc002tno.2	+	4	789	c.425A>C	c.(424-426)AAG>ACG	p.K142T	CNTNAP5_uc010flu.2_Missense_Mutation_p.K142T	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	142	F5/8 type C.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GTGCACCACAAGCTATTGCAC	0.507													11	42	---	---	---	---	PASS
IWS1	55677	broad.mit.edu	37	2	128262761	128262761	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128262761C>A	uc002ton.2	-	3	1021	c.718G>T	c.(718-720)GAG>TAG	p.E240*	IWS1_uc010yzl.1_RNA|IWS1_uc010fma.2_RNA	NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog	240	Glu-rich.|1.|3 X approximate tandem repeats.				transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		GGAAGCTCCTCATTTTCAGAG	0.507													12	559	---	---	---	---	PASS
HNMT	3176	broad.mit.edu	37	2	138738854	138738854	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138738854C>T	uc002tvc.2	+						HNMT_uc002tve.2_Nonsense_Mutation_p.Q87*|HNMT_uc002tvf.2_Intron	NM_006895	NP_008826	P50135	HNMT_HUMAN	histamine N-methyltransferase isoform 1						respiratory gaseous exchange	cytoplasm	histamine N-methyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)	TAGCACCCGTCAGAAAGACAA	0.428													26	169	---	---	---	---	PASS
SPOPL	339745	broad.mit.edu	37	2	139316676	139316676	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139316676G>A	uc002tvh.2	+	6	965	c.565G>A	c.(565-567)GAT>AAT	p.D189N		NM_001001664	NP_001001664	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	189						nucleus				skin(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0296)		TCTAGCAGAAGATTTAGGTAA	0.378													66	168	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141055416	141055416	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141055416G>A	uc002tvj.1	-	84	13900	c.12928C>T	c.(12928-12930)CAC>TAC	p.H4310Y		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4310	Extracellular (Potential).|EGF-like 12.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGCTGGCAGTGGCAGTAAGGC	0.468										TSP Lung(27;0.18)			193	307	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141665461	141665461	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141665461C>T	uc002tvj.1	-	22	4477	c.3505G>A	c.(3505-3507)GAA>AAA	p.E1169K	LRP1B_uc010fnl.1_Missense_Mutation_p.E351K	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1169	Extracellular (Potential).|LDL-receptor class A 10.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGATAGCCTTCATCAGAGCCA	0.428										TSP Lung(27;0.18)			47	374	---	---	---	---	PASS
ACVR2A	92	broad.mit.edu	37	2	148653896	148653896	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148653896C>T	uc002twg.2	+	3	351	c.82C>T	c.(82-84)CAG>TAG	p.Q28*	ACVR2A_uc010zbn.1_Intron|ACVR2A_uc002twh.2_Nonsense_Mutation_p.Q28*	NM_001616	NP_001607	P27037	AVR2A_HUMAN	activin A receptor, type IIA precursor	28	Extracellular (Potential).				activin receptor signaling pathway|BMP signaling pathway|positive regulation of activin receptor signaling pathway|positive regulation of bone mineralization|positive regulation of erythrocyte differentiation|positive regulation of osteoblast differentiation|positive regulation of protein phosphorylation	cytoplasm|inhibin-betaglycan-ActRII complex|integral to plasma membrane	ATP binding|coreceptor activity|inhibin beta-A binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|transforming growth factor beta receptor activity			stomach(8)|large_intestine(2)|lung(1)|breast(1)|kidney(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0969)		ATCAGAAACTCAGGAGTGTCT	0.338													31	214	---	---	---	---	PASS
RIF1	55183	broad.mit.edu	37	2	152314350	152314350	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152314350G>C	uc002txm.2	+	24	2858	c.2728G>C	c.(2728-2730)GAA>CAA	p.E910Q	RIF1_uc002txl.2_Missense_Mutation_p.E910Q|RIF1_uc002txn.2_Missense_Mutation_p.E910Q|RIF1_uc002txo.2_Missense_Mutation_p.E910Q	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1	910					cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TGAACTTCTTGAACAACTCTC	0.368													4	184	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152496966	152496966	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152496966C>G	uc010fnx.2	-	61	8779	c.8588G>C	c.(8587-8589)AGC>ACC	p.S2863T	NEB_uc002txu.2_5'Flank	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	2863	Nebulin 77.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GTCCACATCGCTGACTAAGGT	0.567													75	460	---	---	---	---	PASS
PRPF40A	55660	broad.mit.edu	37	2	153537844	153537844	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153537844T>C	uc002tyi.2	-	6	446	c.433A>G	c.(433-435)ATG>GTG	p.M145V	PRPF40A_uc002tyh.3_Missense_Mutation_p.M118V|PRPF40A_uc010zcd.1_Intron|PRPF40A_uc002tyj.2_Missense_Mutation_p.M14V|PRPF40A_uc002tyl.1_Missense_Mutation_p.M145V	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3	145	WW 1.				mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						TCAGTCCACATTGATTTCTAA	0.323													53	312	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155102386	155102386	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155102386G>T	uc002tyr.3	+	7	1315	c.748G>T	c.(748-750)GGG>TGG	p.G250W	GALNT13_uc002tyt.3_Missense_Mutation_p.G250W|GALNT13_uc010foc.1_Missense_Mutation_p.G69W|GALNT13_uc010fod.2_Missense_Mutation_p.G3W	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	250	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						ATATATGGCTGGGTCAGACAT	0.393													23	202	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155102387	155102387	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155102387G>T	uc002tyr.3	+	7	1316	c.749G>T	c.(748-750)GGG>GTG	p.G250V	GALNT13_uc002tyt.3_Missense_Mutation_p.G250V|GALNT13_uc010foc.1_Missense_Mutation_p.G69V|GALNT13_uc010fod.2_Missense_Mutation_p.G3V	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	250	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						TATATGGCTGGGTCAGACATG	0.393													21	200	---	---	---	---	PASS
KCNJ3	3760	broad.mit.edu	37	2	155566136	155566136	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155566136G>A	uc002tyv.1	+	2	919	c.724G>A	c.(724-726)GAG>AAG	p.E242K	KCNJ3_uc010zce.1_Intron	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3	242	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)	ACCTGAGGGTGAGTTCCTTCC	0.453													8	127	---	---	---	---	PASS
GALNT5	11227	broad.mit.edu	37	2	158162286	158162286	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158162286G>A	uc002tzg.2	+	8	2720	c.2465G>A	c.(2464-2466)TGC>TAC	p.C822Y	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	822	Lumenal (Potential).|Ricin B-type lectin.				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						TTGGGTAAATGCATTTCCATT	0.348													12	134	---	---	---	---	PASS
PKP4	8502	broad.mit.edu	37	2	159477908	159477908	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159477908G>C	uc002tzv.2	+	6	838	c.578G>C	c.(577-579)AGA>ACA	p.R193T	PKP4_uc002tzt.1_Missense_Mutation_p.R45T|PKP4_uc002tzu.2_Missense_Mutation_p.R193T|PKP4_uc002tzw.2_Missense_Mutation_p.R193T|PKP4_uc002tzx.2_5'UTR|PKP4_uc002tzy.1_5'UTR|PKP4_uc002tzz.1_Missense_Mutation_p.R191T|PKP4_uc002uaa.2_Missense_Mutation_p.R45T	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a	193					cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						AGGAATTCAAGAGCTGAAGGA	0.388										HNSCC(62;0.18)			7	86	---	---	---	---	PASS
PKP4	8502	broad.mit.edu	37	2	159499115	159499115	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159499115G>A	uc002tzv.2	+	11	2073	c.1813G>A	c.(1813-1815)GAA>AAA	p.E605K	PKP4_uc002tzt.1_Missense_Mutation_p.E457K|PKP4_uc002tzu.2_Missense_Mutation_p.E605K|PKP4_uc002tzw.2_Missense_Mutation_p.E605K|PKP4_uc002tzx.2_Missense_Mutation_p.E262K|PKP4_uc002tzy.1_Missense_Mutation_p.E263K|PKP4_uc002tzz.1_Missense_Mutation_p.E603K|PKP4_uc002uaa.2_Missense_Mutation_p.E457K	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a	605	ARM 4.				cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						GTCTACAGATGAAAATAAAAT	0.423										HNSCC(62;0.18)			20	207	---	---	---	---	PASS
PKP4	8502	broad.mit.edu	37	2	159536975	159536975	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159536975A>G	uc002tzv.2	+	22	3625	c.3365A>G	c.(3364-3366)AAC>AGC	p.N1122S	PKP4_uc002tzw.2_Missense_Mutation_p.N1079S|PKP4_uc002tzx.2_Missense_Mutation_p.N779S|PKP4_uc002uaa.2_Missense_Mutation_p.N931S|uc002uab.1_Intron|PKP4_uc002uac.2_Missense_Mutation_p.N303S|PKP4_uc002uad.2_RNA	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a	1122					cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						GATGACTCCAACAGAAAGAAC	0.328										HNSCC(62;0.18)			39	250	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160205325	160205325	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160205325C>T	uc002uao.2	-	30	5509	c.5157G>A	c.(5155-5157)TGG>TGA	p.W1719*	BAZ2B_uc002uap.2_Nonsense_Mutation_p.W1683*	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1719					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						CAATAATTCTCCACCAACCAA	0.323													8	155	---	---	---	---	PASS
PLA2R1	22925	broad.mit.edu	37	2	160836387	160836387	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160836387C>G	uc002ube.1	-	14	2429	c.2222G>C	c.(2221-2223)AGA>ACA	p.R741T	PLA2R1_uc010zcp.1_Missense_Mutation_p.R741T|PLA2R1_uc002ubf.2_Missense_Mutation_p.R741T	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor	741	Extracellular (Potential).|C-type lectin 4.				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						CAGTGGGTTTCTTTTATTAAA	0.403													21	100	---	---	---	---	PASS
PLA2R1	22925	broad.mit.edu	37	2	160873227	160873227	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160873227C>G	uc002ube.1	-						PLA2R1_uc010zcp.1_Intron|PLA2R1_uc002ubf.2_Intron	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor						endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						GTCCCTCCTACGGAGAAAAAT	0.378													43	101	---	---	---	---	PASS
TANK	10010	broad.mit.edu	37	2	162088005	162088005	+	Silent	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162088005T>A	uc002ubr.1	+	7	1202	c.1044T>A	c.(1042-1044)TCT>TCA	p.S348S	TANK_uc002ubs.2_Silent_p.S348S	NM_004180	NP_004171	Q92844	TANK_HUMAN	TRAF interacting protein TANK isoform a	348						cytosol	metal ion binding|protein binding			ovary(1)	1						TGGACCCATCTGATGCACCTT	0.433													12	151	---	---	---	---	PASS
TANK	10010	broad.mit.edu	37	2	162088022	162088022	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162088022C>G	uc002ubr.1	+	7	1219	c.1061C>G	c.(1060-1062)TCA>TGA	p.S354*	TANK_uc002ubs.2_Nonsense_Mutation_p.S354*	NM_004180	NP_004171	Q92844	TANK_HUMAN	TRAF interacting protein TANK isoform a	354						cytosol	metal ion binding|protein binding			ovary(1)	1						CCTTTTCCCTCACTCGATTCC	0.433													11	132	---	---	---	---	PASS
PSMD14	10213	broad.mit.edu	37	2	162175349	162175349	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162175349C>G	uc002ubu.2	+	3	480	c.13C>G	c.(13-15)CTT>GTT	p.L5V		NM_005805	NP_005796	O00487	PSDE_HUMAN	proteasome 26S subunit, non-ATPase 14	5					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K63-linked deubiquitination|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of proteasomal protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	endopeptidase activator activity|metal ion binding|metallopeptidase activity|proteasome binding|ubiquitin thiolesterase activity			breast(1)	1						GGACAGACTTCTTAGACTTGG	0.368													10	80	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163302603	163302603	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163302603G>A	uc002uch.1	-	7	1691	c.1479C>T	c.(1477-1479)TTC>TTT	p.F493F	KCNH7_uc002uci.2_Silent_p.F486F	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	493	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	ACCAGCCTTTGAAGTAGTGTA	0.343													17	115	---	---	---	---	PASS
TTC21B	79809	broad.mit.edu	37	2	166771904	166771904	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166771904C>T	uc002udk.2	-	15	2078	c.1945G>A	c.(1945-1947)GGA>AGA	p.G649R		NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	649	TPR 8.					cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						TCAGATGTTCCAGAAAATTCA	0.383													74	549	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167279877	167279877	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167279877C>T	uc002udu.1	-	18	3046	c.2919G>A	c.(2917-2919)ATG>ATA	p.M973I	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	973	Helical; Name=S2 of repeat III; (By similarity).				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						AAGTAAAGATCATGTCAGCAT	0.328													30	48	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168099484	168099484	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168099484C>G	uc002udx.2	+	8	1600	c.1582C>G	c.(1582-1584)CAA>GAA	p.Q528E	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.Q353E|XIRP2_uc010fpq.2_Missense_Mutation_p.Q306E|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	353					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TGTTTCTAGTCAAATGAACTC	0.338													9	75	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168106531	168106531	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168106531G>A	uc002udx.2	+	8	8647	c.8629G>A	c.(8629-8631)GCT>ACT	p.A2877T	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.A2702T|XIRP2_uc010fpq.2_Missense_Mutation_p.A2655T|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.A223T	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2702					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						AATACAGACCGCTGAAAGTAA	0.388													28	185	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170090056	170090056	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170090056C>G	uc002ues.2	-	30	5176	c.4963G>C	c.(4963-4965)GTG>CTG	p.V1655L		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1655	LDL-receptor class B 14.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GTCCAGTACACAGAGTCTTCA	0.488													11	107	---	---	---	---	PASS
MYO3B	140469	broad.mit.edu	37	2	171264306	171264306	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171264306G>C	uc002ufy.2	+	22	2745	c.2602G>C	c.(2602-2604)GAA>CAA	p.E868Q	MYO3B_uc002ufv.2_Missense_Mutation_p.E855Q|MYO3B_uc010fqb.1_Missense_Mutation_p.E855Q|MYO3B_uc002ufz.2_Missense_Mutation_p.E868Q|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002ugb.2_RNA	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2	868	Myosin head-like.				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						GAGAACGTCAGAAAACAAGCT	0.453													54	317	---	---	---	---	PASS
ITGA6	3655	broad.mit.edu	37	2	173352699	173352699	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173352699C>G	uc002uhp.1	+	18	2538	c.2335C>G	c.(2335-2337)CAA>GAA	p.Q779E	ITGA6_uc010zdy.1_Missense_Mutation_p.Q660E|ITGA6_uc002uho.1_Missense_Mutation_p.Q779E|ITGA6_uc010fqm.1_Missense_Mutation_p.Q425E	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	818	Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			AACAAGCAATCAAGATAATTT	0.358													24	274	---	---	---	---	PASS
RAPGEF4	11069	broad.mit.edu	37	2	173850168	173850168	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173850168G>C	uc002uhv.3	+	12	1284	c.1097G>C	c.(1096-1098)CGA>CCA	p.R366P	RAPGEF4_uc002uhu.2_Missense_Mutation_p.R366P|RAPGEF4_uc002uhw.3_Missense_Mutation_p.R222P|RAPGEF4_uc010zec.1_Missense_Mutation_p.R213P|RAPGEF4_uc010zed.1_Missense_Mutation_p.R195P|RAPGEF4_uc010zee.1_Missense_Mutation_p.R213P|RAPGEF4_uc010fqo.2_Missense_Mutation_p.R195P|RAPGEF4_uc010zef.1_Missense_Mutation_p.R146P|RAPGEF4_uc010zeg.1_Missense_Mutation_p.R193P|RAPGEF4_uc010fqp.1_Missense_Mutation_p.R146P|RAPGEF4_uc010zeh.1_Missense_Mutation_p.R146P	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	366	cAMP 2.				blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			TAGGTGAAACGAGAGTTAGCA	0.483													6	435	---	---	---	---	PASS
KIAA1715	80856	broad.mit.edu	37	2	176812411	176812411	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176812411T>A	uc002ukc.1	-	9	696	c.503A>T	c.(502-504)CAG>CTG	p.Q168L	KIAA1715_uc010zer.1_Missense_Mutation_p.Q168L|KIAA1715_uc010fqw.1_Missense_Mutation_p.Q234L|KIAA1715_uc010zes.1_Missense_Mutation_p.Q170L|KIAA1715_uc002ukd.1_Missense_Mutation_p.Q45L|KIAA1715_uc010zet.1_RNA	NM_030650	NP_085153	Q9C0E8	LNP_HUMAN	Lunapark	168	Cytoplasmic (Potential).					integral to membrane	protein binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			TGCAGTTCGCTGACGAATCTC	0.413													31	156	---	---	---	---	PASS
DFNB59	494513	broad.mit.edu	37	2	179319148	179319148	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179319148G>C	uc002umi.3	+	3	657	c.301G>C	c.(301-303)GGG>CGG	p.G101R	DFNB59_uc002umj.3_Missense_Mutation_p.G101R	NM_001042702	NP_001036167	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	101					sensory perception of sound						0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			AAATGACGTTGGGATTAACGT	0.338													7	187	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179407873	179407873	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179407873C>G	uc010zfg.1	-	296	89347	c.89123G>C	c.(89122-89124)AGA>ACA	p.R29708T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R23403T|TTN_uc010zfi.1_Missense_Mutation_p.R23336T|TTN_uc010zfj.1_Missense_Mutation_p.R23211T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30635							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCCCTTATTCTAAATAAGTA	0.418													86	540	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179408933	179408933	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179408933C>G	uc010zfg.1	-	294	88543	c.88319G>C	c.(88318-88320)AGA>ACA	p.R29440T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R23135T|TTN_uc010zfi.1_Missense_Mutation_p.R23068T|TTN_uc010zfj.1_Missense_Mutation_p.R22943T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30367							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATACCTATTCTTTCCACGGG	0.373													33	130	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179412489	179412489	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179412489C>T	uc010zfg.1	-	288	86384	c.86160G>A	c.(86158-86160)TTG>TTA	p.L28720L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L22415L|TTN_uc010zfi.1_Silent_p.L22348L|TTN_uc010zfj.1_Silent_p.L22223L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29647							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCCAGGGTCAAGAAGTATC	0.458													57	75	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179426190	179426190	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179426190C>G	uc010zfg.1	-	275	77189	c.76965G>C	c.(76963-76965)CTG>CTC	p.L25655L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L19350L|TTN_uc010zfi.1_Silent_p.L19283L|TTN_uc010zfj.1_Silent_p.L19158L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	26582							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTCATACATCAGTCCTTCAT	0.393													35	232	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179447699	179447699	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179447699G>C	uc010zfg.1	-	262	58351	c.58127C>G	c.(58126-58128)TCT>TGT	p.S19376C	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S13071C|TTN_uc010zfi.1_Missense_Mutation_p.S13004C|TTN_uc010zfj.1_Missense_Mutation_p.S12879C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20303							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCTGATTTAGAACCACTTGA	0.398													7	54	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179471884	179471884	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179471884T>C	uc010zfg.1	-	227	45965	c.45741A>G	c.(45739-45741)ATA>ATG	p.I15247M	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.I8942M|TTN_uc010zfi.1_Missense_Mutation_p.I8875M|TTN_uc010zfj.1_Missense_Mutation_p.I8750M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16174							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTCAGTCTCTATTGGTTGTC	0.418													58	362	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179516856	179516856	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179516856T>C	uc010zfg.1	-	158	32184	c.31960A>G	c.(31960-31962)ATT>GTT	p.I10654V	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc010fre.1_Intron|TTN_uc002umw.1_5'Flank|TTN_uc002umx.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11581							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGGAGGAATAGCTTCAGGC	0.343													25	212	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179638667	179638667	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179638667G>C	uc010zfg.1	-	31	7452	c.7228C>G	c.(7228-7230)CAT>GAT	p.H2410D	TTN_uc010zfh.1_Missense_Mutation_p.H2364D|TTN_uc010zfi.1_Missense_Mutation_p.H2364D|TTN_uc010zfj.1_Missense_Mutation_p.H2364D|TTN_uc002unb.2_Missense_Mutation_p.H2410D|uc002unc.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2410							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCAGCATATGAGATTGTTTG	0.478													20	230	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179640827	179640827	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179640827C>T	uc010zfg.1	-	28	5988	c.5764G>A	c.(5764-5766)GAG>AAG	p.E1922K	TTN_uc010zfh.1_Missense_Mutation_p.E1876K|TTN_uc010zfi.1_Missense_Mutation_p.E1876K|TTN_uc010zfj.1_Missense_Mutation_p.E1876K|TTN_uc002unb.2_Missense_Mutation_p.E1922K|uc002unc.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1922							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTTTATGCTCTATCACACCT	0.463													62	450	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179642692	179642692	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179642692G>A	uc010zfg.1	-	25	4443	c.4219C>T	c.(4219-4221)CCA>TCA	p.P1407S	TTN_uc010zfh.1_Missense_Mutation_p.P1361S|TTN_uc010zfi.1_Missense_Mutation_p.P1361S|TTN_uc010zfj.1_Missense_Mutation_p.P1361S|TTN_uc002unb.2_Missense_Mutation_p.P1407S|uc002unc.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1407							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTGAACGTGGAGAGAGAGAT	0.448													8	67	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179659746	179659746	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179659746T>A	uc010zfg.1	-	7	1372	c.1148A>T	c.(1147-1149)CAG>CTG	p.Q383L	TTN_uc010zfh.1_Missense_Mutation_p.Q383L|TTN_uc010zfi.1_Missense_Mutation_p.Q383L|TTN_uc010zfj.1_Missense_Mutation_p.Q383L|TTN_uc002unb.2_Missense_Mutation_p.Q383L|TTN_uc010frg.1_Missense_Mutation_p.Q57L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	383							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTTGCTCCTGGACACCGTA	0.567													20	139	---	---	---	---	PASS
CCDC141	285025	broad.mit.edu	37	2	179718259	179718259	+	Silent	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179718259G>T	uc002unf.1	-	10	1485	c.1428C>A	c.(1426-1428)CTC>CTA	p.L476L		NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	476							protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			ACTGCTGGTGGAGAATTTTCA	0.423													32	201	---	---	---	---	PASS
CERKL	375298	broad.mit.edu	37	2	182403949	182403949	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182403949T>C	uc002unx.2	-	13	1587	c.1486A>G	c.(1486-1488)AAA>GAA	p.K496E	CERKL_uc002uny.2_Missense_Mutation_p.K470E|CERKL_uc010zfm.1_Missense_Mutation_p.K452E|CERKL_uc002unz.2_Missense_Mutation_p.K218E|CERKL_uc002uoa.2_Missense_Mutation_p.K401E|CERKL_uc002uob.2_Missense_Mutation_p.K218E|CERKL_uc002uoc.2_Missense_Mutation_p.K357E|CERKL_uc010frk.2_RNA|CERKL_uc002unw.2_Missense_Mutation_p.K66E	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b	496					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)			GGATGAACTTTTACTTCCTCA	0.343													30	185	---	---	---	---	PASS
SSFA2	6744	broad.mit.edu	37	2	182763809	182763809	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182763809G>T	uc002uoi.2	+	6	795	c.473G>T	c.(472-474)GGA>GTA	p.G158V	SSFA2_uc002uoh.2_Missense_Mutation_p.G158V|SSFA2_uc002uoj.2_Missense_Mutation_p.G158V|SSFA2_uc002uok.2_RNA|SSFA2_uc010zfo.1_Missense_Mutation_p.G5V|SSFA2_uc002uol.2_Missense_Mutation_p.G5V	NM_001130445	NP_001123917	P28290	SSFA2_HUMAN	sperm specific antigen 2 isoform 1	158						cytoplasm|plasma membrane	actin binding			breast(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			AATTCCACTGGATCTGGGAAA	0.328													35	84	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186671909	186671909	+	Intron	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186671909A>G	uc002upm.2	+						uc010zfu.1_Missense_Mutation_p.Q457R					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		GAAATTTTCCAACGTCAGGTT	0.348													32	228	---	---	---	---	PASS
FAM171B	165215	broad.mit.edu	37	2	187627189	187627189	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187627189C>G	uc002ups.2	+	8	2232	c.2120C>G	c.(2119-2121)TCT>TGT	p.S707C	FAM171B_uc002upr.1_Missense_Mutation_p.S674C|FAM171B_uc002upt.2_Missense_Mutation_p.S176C	NM_177454	NP_803237	Q6P995	F171B_HUMAN	KIAA1946	707	Cytoplasmic (Potential).					integral to membrane	DNA binding			ovary(6)|breast(3)|central_nervous_system(1)	10						AGTCTGGACTCTGGGGTGGAC	0.453													14	98	---	---	---	---	PASS
COL3A1	1281	broad.mit.edu	37	2	189851781	189851781	+	Intron	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189851781A>G	uc002uqj.1	+							NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein						axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	TCTCCTTGCCACAGAACTATT	0.393													16	106	---	---	---	---	PASS
COL3A1	1281	broad.mit.edu	37	2	189851869	189851869	+	Intron	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189851869C>A	uc002uqj.1	+							NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein						axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	ACCAGCTGTACGTACAAATGT	0.403													37	51	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189968994	189968994	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189968994C>T	uc002uqk.2	-	3	607	c.332G>A	c.(331-333)AGA>AAA	p.R111K		NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	111					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			ACTTACCTTTCTTCCTCTACC	0.294													11	223	---	---	---	---	PASS
ASNSD1	54529	broad.mit.edu	37	2	190531684	190531684	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190531684G>A	uc002uqt.2	+	4	1260	c.826G>A	c.(826-828)GAT>AAT	p.D276N		NM_019048	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	276					asparagine biosynthetic process|glutamine metabolic process		asparagine synthase (glutamine-hydrolyzing) activity			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			CTTTCTTACTGATGTACACAT	0.403													20	420	---	---	---	---	PASS
PMS1	5378	broad.mit.edu	37	2	190719442	190719442	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190719442G>A	uc002urh.3	+	9	1973	c.1444G>A	c.(1444-1446)GAG>AAG	p.E482K	PMS1_uc010zga.1_Missense_Mutation_p.E443K|PMS1_uc010zgb.1_Missense_Mutation_p.E421K|PMS1_uc002urk.3_Missense_Mutation_p.E443K|PMS1_uc002uri.3_Missense_Mutation_p.E482K|PMS1_uc010zgc.1_Missense_Mutation_p.E306K|PMS1_uc010zgd.1_Missense_Mutation_p.E306K|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_Missense_Mutation_p.E443K|PMS1_uc010frz.2_Intron|PMS1_uc002url.2_Missense_Mutation_p.E267K|PMS1_uc002urm.2_RNA|PMS1_uc002urn.1_Missense_Mutation_p.E150K	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	482					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TGGGGAAAATGAGGAAGAAGC	0.388			Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					4	151	---	---	---	---	PASS
INPP1	3628	broad.mit.edu	37	2	191233948	191233948	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191233948C>T	uc002ury.3	+	6	1286	c.586C>T	c.(586-588)CCC>TCC	p.P196S	INPP1_uc010fsb.2_Missense_Mutation_p.P196S|INPP1_uc002urx.3_Missense_Mutation_p.P196S	NM_001128928	NP_001122400	P49441	INPP_HUMAN	inositol polyphosphate-1-phosphatase	196					signal transduction		inositol-1,4-bisphosphate 1-phosphatase activity|metal ion binding			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)		Lithium(DB01356)	GACAGGGGTTCCCCTGATGGG	0.413													52	281	---	---	---	---	PASS
SDPR	8436	broad.mit.edu	37	2	192700675	192700675	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192700675C>A	uc002utb.2	-	2	1582	c.1252G>T	c.(1252-1254)GTG>TTG	p.V418L		NM_004657	NP_004648	O95810	SDPR_HUMAN	serum deprivation response protein	418						caveola|cytosol	phosphatidylserine binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0647)		Phosphatidylserine(DB00144)	ACCTGGAGCACGGCGGGCTGC	0.627													59	75	---	---	---	---	PASS
PGAP1	80055	broad.mit.edu	37	2	197740555	197740555	+	Intron	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197740555A>G	uc002utw.2	-						PGAP1_uc002utx.2_Intron|PGAP1_uc002uty.1_Intron	NM_024989	NP_079265	Q75T13	PGAP1_HUMAN	GPI deacylase						attachment of GPI anchor to protein|C-terminal protein lipidation|intracellular protein transport|myo-inositol transport	integral to membrane|intrinsic to endoplasmic reticulum membrane	nuclease activity|phosphoric ester hydrolase activity			ovary(3)|central_nervous_system(1)	4						ACTGAAATATAAAACATTGAT	0.269													14	17	---	---	---	---	PASS
BOLL	66037	broad.mit.edu	37	2	198646462	198646462	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198646462C>G	uc002uus.2	-	2	423	c.113G>C	c.(112-114)GGA>GCA	p.G38A	BOLL_uc002uur.2_Missense_Mutation_p.G44A|BOLL_uc002uut.2_Missense_Mutation_p.G50A|BOLL_uc010zha.1_5'UTR|BOLL_uc002uuu.1_Missense_Mutation_p.G44A	NM_033030	NP_149019	Q8N9W6	BOLL_HUMAN	boule isoform 2	38	RRM.				cell differentiation|meiosis|multicellular organismal development|positive regulation of translational initiation|spermatogenesis	cytoplasm	nucleotide binding|protein binding|RNA binding|translation activator activity			ovary(2)	2						ATCAATTCCTCCTACAAAGAT	0.358													41	300	---	---	---	---	PASS
SATB2	23314	broad.mit.edu	37	2	200193475	200193475	+	Silent	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200193475A>G	uc002uuy.1	-	8	2149	c.1332T>C	c.(1330-1332)AAT>AAC	p.N444N	SATB2_uc010fsq.1_Silent_p.N326N|SATB2_uc002uuz.1_Silent_p.N444N|SATB2_uc002uva.1_Silent_p.N444N	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	444						cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCATGCTCACATTGGGATTCA	0.517													27	164	---	---	---	---	PASS
MPP4	58538	broad.mit.edu	37	2	202545689	202545689	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202545689T>C	uc002uyk.3	-	10	1009	c.801A>G	c.(799-801)GGA>GGG	p.G267G	MPP4_uc010ftj.2_Silent_p.G267G|MPP4_uc010zhq.1_Silent_p.G267G|MPP4_uc010zhr.1_Silent_p.G267G|MPP4_uc010zhs.1_Silent_p.G223G|MPP4_uc002uyj.3_Silent_p.G223G|MPP4_uc010zht.1_Silent_p.G240G|MPP4_uc002uyl.3_RNA|MPP4_uc010ftk.2_Silent_p.G254G|MPP4_uc002uym.1_Silent_p.G236G|MPP4_uc002uyn.2_Silent_p.G223G	NM_033066	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4	267	SH3.					cytoplasm	protein binding				0						GGAAAGGCAATCCAGCGTCCA	0.577											OREG0015145	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	78	---	---	---	---	PASS
CD28	940	broad.mit.edu	37	2	204599596	204599596	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204599596C>T	uc002vah.3	+	4	846	c.624C>T	c.(622-624)CCC>CCT	p.P208P	CD28_uc010zio.1_RNA|CD28_uc010ftx.2_Silent_p.P89P|CD28_uc002vaj.3_RNA	NM_006139	NP_006130	P10747	CD28_HUMAN	CD28 antigen precursor	208	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|cytokine biosynthetic process|humoral immune response|positive regulation of anti-apoptosis|positive regulation of interleukin-2 biosynthetic process|positive regulation of mitosis|positive regulation of translation|positive regulation of viral genome replication|regulation of defense response to virus by virus|regulatory T cell differentiation|T cell costimulation|viral reproduction	cytosol|external side of plasma membrane|integral to plasma membrane	coreceptor activity|protease binding|SH3/SH2 adaptor activity				0						ATTACCAGCCCTATGCCCCAC	0.622													5	149	---	---	---	---	PASS
CPO	130749	broad.mit.edu	37	2	207814364	207814364	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207814364A>T	uc002vby.2	+	2	138	c.92A>T	c.(91-93)GAG>GTG	p.E31V		NM_173077	NP_775100	Q8IVL8	CBPO_HUMAN	carboxypeptidase O precursor	31					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		CACAGACAAGAGATTGTGGAC	0.478													33	123	---	---	---	---	PASS
PIKFYVE	200576	broad.mit.edu	37	2	209201606	209201606	+	Nonsense_Mutation	SNP	C	G	G	rs35021350		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209201606C>G	uc002vcz.2	+	28	4723	c.4565C>G	c.(4564-4566)TCA>TGA	p.S1522*		NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	1522					cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						AAGAGACCTTCAGTTCCTCCA	0.388													18	94	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211502431	211502431	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211502431C>G	uc002vee.3	+	22	2825	c.2693C>G	c.(2692-2694)TCC>TGC	p.S898C	CPS1_uc010fur.2_Missense_Mutation_p.S904C|CPS1_uc010fus.2_Missense_Mutation_p.S447C	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	898					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CCTAGTGAGTCCATGACAGAA	0.413													30	128	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212566791	212566791	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212566791T>C	uc002veg.1	-	12	1488	c.1390A>G	c.(1390-1392)AGC>GGC	p.S464G	ERBB4_uc002veh.1_Missense_Mutation_p.S464G|ERBB4_uc010zji.1_Missense_Mutation_p.S464G|ERBB4_uc010zjj.1_Missense_Mutation_p.S464G|ERBB4_uc010fut.1_Missense_Mutation_p.S464G	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	464	Extracellular (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		CACAGGTTGCTGTTGTCAGTA	0.433										TSP Lung(8;0.080)			62	254	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216257932	216257932	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216257932G>C	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron|FN1_uc002vez.2_5'Flank|FN1_uc010zjp.1_5'Flank	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CACCTCTATTGAGTTACAAAG	0.428													33	73	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216285490	216285490	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216285490C>G	uc002vfa.2	-	11	1847	c.1581G>C	c.(1579-1581)GTG>GTC	p.V527V	FN1_uc002vfb.2_Silent_p.V527V|FN1_uc002vfc.2_Silent_p.V527V|FN1_uc002vfd.2_Silent_p.V527V|FN1_uc002vfe.2_Silent_p.V527V|FN1_uc002vff.2_Silent_p.V527V|FN1_uc002vfg.2_Silent_p.V527V|FN1_uc002vfh.2_Silent_p.V527V|FN1_uc002vfi.2_Silent_p.V527V|FN1_uc002vfj.2_Silent_p.V527V|FN1_uc002vfl.2_Silent_p.V527V	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	527	Collagen-binding.|Fibronectin type-I 8.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ATGTGTCGTTCACATTGTAAG	0.458													18	113	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216289013	216289013	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216289013C>G	uc002vfa.2	-	8	1338	c.1072G>C	c.(1072-1074)GAG>CAG	p.E358Q	FN1_uc002vfb.2_Missense_Mutation_p.E358Q|FN1_uc002vfc.2_Missense_Mutation_p.E358Q|FN1_uc002vfd.2_Missense_Mutation_p.E358Q|FN1_uc002vfe.2_Missense_Mutation_p.E358Q|FN1_uc002vff.2_Missense_Mutation_p.E358Q|FN1_uc002vfg.2_Missense_Mutation_p.E358Q|FN1_uc002vfh.2_Missense_Mutation_p.E358Q|FN1_uc002vfi.2_Missense_Mutation_p.E358Q|FN1_uc002vfj.2_Missense_Mutation_p.E358Q|FN1_uc002vfl.2_Missense_Mutation_p.E358Q	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	358	Fibronectin type-II 1.|Collagen-binding.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ACACATGGCTCTCCATTTGAG	0.478													32	158	---	---	---	---	PASS
TNS1	7145	broad.mit.edu	37	2	218673317	218673317	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218673317G>C	uc002vgt.2	-						TNS1_uc002vgr.2_Intron|TNS1_uc002vgs.2_Intron|TNS1_uc002vgq.2_Intron	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CTGTGTACAAGAGACTTACTT	0.353													11	283	---	---	---	---	PASS
CCDC108	255101	broad.mit.edu	37	2	219870931	219870931	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219870931G>C	uc002vjl.1	-	31	4818	c.4734C>G	c.(4732-4734)ATC>ATG	p.I1578M		NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1	1578						integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCTGGTTCTTGATGGGAGGCA	0.607													4	118	---	---	---	---	PASS
STK16	8576	broad.mit.edu	37	2	220111441	220111441	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220111441G>A	uc002vko.2	+	3	306	c.149G>A	c.(148-150)CGA>CAA	p.R50Q	GLB1L_uc002vkm.2_5'Flank|GLB1L_uc002vkn.2_5'Flank|STK16_uc002vks.2_Intron|STK16_uc010zky.1_Missense_Mutation_p.R50Q|STK16_uc010fwf.2_Missense_Mutation_p.R50Q|STK16_uc002vkp.2_Missense_Mutation_p.R50Q|STK16_uc002vkr.2_5'UTR|STK16_uc002vkq.2_Missense_Mutation_p.R95Q	NM_001008910	NP_001008910	O75716	STK16_HUMAN	serine/threonine kinase 16	50	Protein kinase.				protein complex assembly	membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCCCTGAAGCGAATCCTGTGT	0.567													10	63	---	---	---	---	PASS
CUL3	8452	broad.mit.edu	37	2	225339017	225339017	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225339017C>G	uc002vny.2	-	16	2636	c.2252G>C	c.(2251-2253)AGA>ACA	p.R751T	CUL3_uc010zls.1_Missense_Mutation_p.R685T|CUL3_uc010fwy.1_Missense_Mutation_p.R757T	NM_003590	NP_003581	Q13618	CUL3_HUMAN	cullin 3	751					cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CAAATATTCTCTCTCAATAAG	0.363													9	145	---	---	---	---	PASS
KIAA1486	57624	broad.mit.edu	37	2	226446958	226446958	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226446958C>T	uc002voe.2	+	4	1000	c.825C>T	c.(823-825)ATC>ATT	p.I275I	KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Silent_p.I45I	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	275										ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		AGTACCCTATCTTTGACGACT	0.542													43	106	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228882974	228882974	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228882974T>A	uc002vpq.2	-	7	2643	c.2596A>T	c.(2596-2598)AGC>TGC	p.S866C	SPHKAP_uc002vpp.2_Missense_Mutation_p.S866C|SPHKAP_uc010zlx.1_Missense_Mutation_p.S866C	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	866						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CTGGACTGGCTGACCGTTGGG	0.483													154	771	---	---	---	---	PASS
NCL	4691	broad.mit.edu	37	2	232322396	232322396	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232322396G>C	uc002vru.2	-	9	1546	c.1405C>G	c.(1405-1407)CAA>GAA	p.Q469E	SNORA75_uc002vrv.1_5'Flank|SNORD20_uc002vrw.1_5'Flank	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin	469					angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		TCTTGATTTTGACCTTTCTCT	0.413													25	245	---	---	---	---	PASS
CHRND	1144	broad.mit.edu	37	2	233393325	233393325	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233393325C>G	uc002vsw.2	+	5	472	c.468C>G	c.(466-468)ACC>ACG	p.T156T	CHRND_uc010zmg.1_Silent_p.T141T|CHRND_uc010fyc.2_Missense_Mutation_p.P66R|CHRND_uc010zmh.1_Missense_Mutation_p.P66R	NM_000751	NP_000742	Q07001	ACHD_HUMAN	nicotinic acetylcholine receptor delta	156	Extracellular (Potential).				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)|breast(1)|skin(1)	3		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)		TCTCTGTCACCTATTTCCCCT	0.577													43	110	---	---	---	---	PASS
ILKAP	80895	broad.mit.edu	37	2	239098488	239098488	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239098488G>C	uc002vxv.2	-						ILKAP_uc010zns.1_Intron|ILKAP_uc002vxw.2_Intron|ILKAP_uc010znt.1_Intron	NM_030768	NP_110395	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated protein							cytoplasm|protein serine/threonine phosphatase complex	metal ion binding|protein binding			ovary(3)	3		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		CAAATTGTCTGAAAACCTTTA	0.343													26	180	---	---	---	---	PASS
HDAC4	9759	broad.mit.edu	37	2	239990202	239990202	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239990202T>C	uc002vyk.3	-	23	3629	c.2837A>G	c.(2836-2838)TAC>TGC	p.Y946C	HDAC4_uc010fyy.2_Missense_Mutation_p.Y903C	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4	946	Histone deacetylase.				B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GGAGAGGTTGTAGCCCCCAAG	0.597													8	64	---	---	---	---	PASS
RNPEPL1	57140	broad.mit.edu	37	2	241516041	241516041	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241516041G>C	uc002vzi.2	+	9	1500	c.907G>C	c.(907-909)GAG>CAG	p.E303Q	RNPEPL1_uc010fzf.2_Missense_Mutation_p.E209Q|RNPEPL1_uc002vzj.2_5'UTR	NM_018226	NP_060696	Q9HAU8	RNPL1_HUMAN	arginyl aminopeptidase (aminopeptidase B)-like	303					leukotriene biosynthetic process|proteolysis		aminopeptidase activity|metallopeptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2		all_epithelial(40;1.13e-11)|Breast(86;0.000169)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.204)|Melanoma(123;0.238)		Epithelial(32;3.05e-31)|all cancers(36;8.2e-29)|OV - Ovarian serous cystadenocarcinoma(60;8.55e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.12e-06)|Lung(119;0.00168)|Colorectal(34;0.005)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.0322)		CCGGCCCGTGGAGGCCCTTTT	0.652													3	102	---	---	---	---	PASS
SNED1	25992	broad.mit.edu	37	2	241976764	241976764	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241976764G>C	uc002wah.1	+	6	1039	c.1039G>C	c.(1039-1041)GAG>CAG	p.E347Q		NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor	347	EGF-like 2.				cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		ACCCACCTGTGAGACAGGTAA	0.637													5	16	---	---	---	---	PASS
C2orf85	285093	broad.mit.edu	37	2	242814881	242814881	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242814881G>T	uc010fzu.1	+	2	1197	c.1174G>T	c.(1174-1176)GGA>TGA	p.G392*		NM_173821	NP_776182	Q14D33	CB085_HUMAN	hypothetical protein LOC285093	392						integral to membrane				ovary(1)	1						CGGGAAGGAAGGAGGCGGCCA	0.627													6	42	---	---	---	---	PASS
CHL1	10752	broad.mit.edu	37	3	407692	407692	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:407692G>C	uc003bou.2	+	14	1868	c.1597G>C	c.(1597-1599)GAA>CAA	p.E533Q	CHL1_uc003bot.2_Missense_Mutation_p.E549Q|CHL1_uc003bow.1_Missense_Mutation_p.E533Q|CHL1_uc011asi.1_Missense_Mutation_p.E549Q|uc003box.1_Intron	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	533	Ig-like C2-type 6.|Extracellular (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GCATATGCTTGAATTACATTG	0.353													18	134	---	---	---	---	PASS
CNTN4	152330	broad.mit.edu	37	3	3084769	3084769	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3084769C>T	uc003bpc.2	+	21	2841	c.2620C>T	c.(2620-2622)CAC>TAC	p.H874Y	CNTN4_uc003bpb.1_Missense_Mutation_p.H545Y|CNTN4_uc003bpe.2_Missense_Mutation_p.H546Y|CNTN4_uc003bpf.2_Missense_Mutation_p.H545Y|CNTN4_uc003bpg.2_Missense_Mutation_p.H130Y	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	874	Fibronectin type-III 3.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		TGTGCTGTATCACTTAGCTGT	0.418													16	103	---	---	---	---	PASS
ITPR1	3708	broad.mit.edu	37	3	4716893	4716893	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4716893G>A	uc003bqa.2	+	23	3088	c.2740G>A	c.(2740-2742)GAA>AAA	p.E914K	ITPR1_uc010hca.1_Missense_Mutation_p.E899K|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Missense_Mutation_p.E899K	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	914	Cytoplasmic (Potential).				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		GGCGAAAGGAGAAGAGAATAA	0.448													11	98	---	---	---	---	PASS
RAD18	56852	broad.mit.edu	37	3	8940593	8940593	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8940593G>T	uc003brd.2	-	11	1384	c.1307C>A	c.(1306-1308)TCA>TAA	p.S436*	RAD18_uc003bre.2_RNA	NM_020165	NP_064550	Q9NS91	RAD18_HUMAN	postreplication repair protein hRAD18p	436					DNA repair	nucleus|replication fork	damaged DNA binding|ligase activity|ubiquitin protein ligase binding|Y-form DNA binding|zinc ion binding			skin(3)|ovary(2)	5				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		GCATGAATCTGATTCTGATGA	0.348								Rad6_pathway					11	138	---	---	---	---	PASS
RAD18	56852	broad.mit.edu	37	3	9005080	9005080	+	5'UTR	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9005080G>A	uc003brd.2	-	1					RAD18_uc003bre.2_RNA	NM_020165	NP_064550	Q9NS91	RAD18_HUMAN	postreplication repair protein hRAD18p						DNA repair	nucleus|replication fork	damaged DNA binding|ligase activity|ubiquitin protein ligase binding|Y-form DNA binding|zinc ion binding			skin(3)|ovary(2)	5				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		GGTCGCTCCCGAGGATGCTGG	0.667								Rad6_pathway					3	17	---	---	---	---	PASS
BRPF1	7862	broad.mit.edu	37	3	9784741	9784741	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9784741C>G	uc003bse.2	+	7	2496	c.2097C>G	c.(2095-2097)CTC>CTG	p.L699L	BRPF1_uc003bsf.2_Silent_p.L705L|BRPF1_uc003bsg.2_Silent_p.L699L|BRPF1_uc011ati.1_Silent_p.L699L	NM_004634	NP_004625	P55201	BRPF1_HUMAN	bromodomain and PHD finger-containing protein 1	699	Required for RUNX1 and RUNX2 transcriptional activation.|Interaction with MEAF6 and ING5.|Bromo.				histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Medulloblastoma(99;0.227)					ACTTCAACCTCATCGTCAGCA	0.522													35	104	---	---	---	---	PASS
TTLL3	26140	broad.mit.edu	37	3	9868872	9868872	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9868872G>C	uc003btg.2	+	9	1282	c.1066G>C	c.(1066-1068)GAC>CAC	p.D356H	ARPC4_uc003btc.1_Intron|TTLL3_uc003btd.3_Missense_Mutation_p.D323H|TTLL3_uc003btf.3_Intron|TTLL3_uc010hco.1_Missense_Mutation_p.D292H|TTLL3_uc003bth.3_Missense_Mutation_p.D144H|TTLL3_uc011atj.1_Missense_Mutation_p.D292H|TTLL3_uc003btj.3_Missense_Mutation_p.D144H|TTLL3_uc003bti.3_Missense_Mutation_p.D144H|TTLL3_uc003btk.2_Missense_Mutation_p.D159H	NM_001025930	NP_001021100	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	356	TTL.				axoneme assembly|cilium assembly|protein polyglycylation	cilium axoneme|cytoplasm|microtubule	protein-glycine ligase activity, initiating|tubulin-tyrosine ligase activity			large_intestine(2)	2	Medulloblastoma(99;0.227)					GTTCTACCGCGACAGCTATAT	0.393													9	142	---	---	---	---	PASS
IL17RE	132014	broad.mit.edu	37	3	9956229	9956229	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9956229C>G	uc003btu.2	+						CIDEC_uc003bto.2_Intron|IL17RC_uc010hcr.2_5'Flank|IL17RC_uc011ato.1_5'Flank|IL17RC_uc010hcs.2_5'Flank|IL17RC_uc003btz.2_5'Flank|IL17RC_uc011atp.1_5'Flank|IL17RC_uc003bud.2_5'Flank|IL17RC_uc003bua.2_5'Flank|IL17RC_uc003bub.2_5'Flank|IL17RC_uc010hct.2_5'Flank|IL17RC_uc010hcu.2_5'Flank|IL17RC_uc010hcv.2_5'Flank|IL17RC_uc011atq.1_5'Flank|IL17RC_uc003buc.2_5'Flank|IL17RE_uc003btw.2_Intron|IL17RE_uc003btx.2_Intron|IL17RE_uc010hcq.2_Nonsense_Mutation_p.S456*|IL17RE_uc003bty.2_RNA	NM_153483	NP_705616	Q8NFR9	I17RE_HUMAN	interleukin 17 receptor E isoform 1							cytoplasm|extracellular region|integral to membrane	receptor activity			central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(96;5.34e-64)		TCTGTGCCCTCAGGTGTGGCG	0.632													28	168	---	---	---	---	PASS
PRRT3	285368	broad.mit.edu	37	3	9991146	9991146	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9991146G>A	uc003bul.2	-	2	784	c.654C>T	c.(652-654)GTC>GTT	p.V218V	CIDEC_uc003bto.2_Intron|PRRT3_uc003buk.2_RNA|PRRT3_uc003bum.2_Silent_p.V218V	NM_207351	NP_997234	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3 precursor	218	Extracellular (Potential).					integral to membrane					0						CTGGCCTCTTGACAGTACCTG	0.592													5	81	---	---	---	---	PASS
TATDN2	9797	broad.mit.edu	37	3	10318076	10318076	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10318076C>G	uc003bvg.2	+	5	2446	c.1865C>G	c.(1864-1866)TCT>TGT	p.S622C	TATDN2_uc003bvf.2_Missense_Mutation_p.S622C|TATDN2_uc011atr.1_Missense_Mutation_p.S622C|TATDN2_uc011ats.1_RNA|TATDN2_uc011att.1_RNA|TATDN2_uc011atu.1_5'Flank|TATDN2_uc011atv.1_5'Flank	NM_014760	NP_055575	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	622						nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding			pancreas(2)	2						CTGGCTGTGTCTCTAAAGAAG	0.493													39	106	---	---	---	---	PASS
SEC13	6396	broad.mit.edu	37	3	10343031	10343031	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10343031C>G	uc003bvn.2	-	9	1002	c.883G>C	c.(883-885)GGG>CGG	p.G295R	SEC13_uc003bvl.2_Missense_Mutation_p.G227R|SEC13_uc003bvm.2_Missense_Mutation_p.G281R|SEC13_uc003bvp.2_Missense_Mutation_p.G298R|SEC13_uc003bvo.2_Missense_Mutation_p.G341R|SEC13_uc003bvq.1_Intron	NM_183352	NP_899195	P55735	SEC13_HUMAN	SEC13 protein isoform 1	295	WD 6.				COPII vesicle coating|intracellular protein transport|mitotic prometaphase|mRNA transport|post-translational protein modification|protein N-linked glycosylation via asparagine|transmembrane transport	cytosol|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Nup107-160 complex	protein binding			ovary(1)	1						ACCCACTGCCCATCAACTGAC	0.567													4	85	---	---	---	---	PASS
ATG7	10533	broad.mit.edu	37	3	11399906	11399906	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11399906C>G	uc003bwc.2	+	13	1416	c.1299C>G	c.(1297-1299)TTC>TTG	p.F433L	ATG7_uc003bwd.2_Missense_Mutation_p.F433L|ATG7_uc011aum.1_Missense_Mutation_p.F394L	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a	433					autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						CCAGAGGATTCAACATGAGCA	0.512													63	258	---	---	---	---	PASS
SATB1	6304	broad.mit.edu	37	3	18390710	18390710	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18390710C>G	uc003cbh.2	-	11	3979	c.2244G>C	c.(2242-2244)GAG>GAC	p.E748D	SATB1_uc003cbi.2_Missense_Mutation_p.E780D|SATB1_uc003cbj.2_Missense_Mutation_p.E748D	NM_002971	NP_002962	Q01826	SATB1_HUMAN	special AT-rich sequence binding protein 1	748					cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter	nuclear matrix|PML body	double-stranded DNA binding|sequence-specific DNA binding			skin(2)|ovary(1)|lung(1)	4						CCACTGACAGCTCTTCTTCTA	0.358													40	217	---	---	---	---	PASS
KCNH8	131096	broad.mit.edu	37	3	19554619	19554619	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19554619A>T	uc003cbk.1	+	13	2432	c.2237A>T	c.(2236-2238)AAA>ATA	p.K746I	KCNH8_uc010hex.1_Missense_Mutation_p.K207I	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	746	Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						GGAAGCAATAAAGCCTACCTG	0.438													19	103	---	---	---	---	PASS
TOP2B	7155	broad.mit.edu	37	3	25657068	25657068	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25657068C>G	uc011awn.1	-	26	3404	c.3361G>C	c.(3361-3363)GAG>CAG	p.E1121Q	TOP2B_uc003cdj.2_Missense_Mutation_p.E1116Q|TOP2B_uc011awm.1_5'UTR|TOP2B_uc010hff.1_Intron	NM_001068	NP_001059	Q02880	TOP2B_HUMAN	DNA topoisomerase II, beta isozyme	1121					DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						GTTTCATCCTCTTCTGCTGCC	0.303													5	9	---	---	---	---	PASS
SLC4A7	9497	broad.mit.edu	37	3	27477968	27477968	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27477968G>C	uc003cdv.2	-	5	544	c.473C>G	c.(472-474)TCT>TGT	p.S158C	SLC4A7_uc011awu.1_RNA|SLC4A7_uc011awv.1_RNA|SLC4A7_uc003cdu.3_Missense_Mutation_p.S163C|SLC4A7_uc011aww.1_Missense_Mutation_p.S167C|SLC4A7_uc011awx.1_Missense_Mutation_p.S167C|SLC4A7_uc011awy.1_Missense_Mutation_p.S163C|SLC4A7_uc011awz.1_RNA|SLC4A7_uc011axa.1_Missense_Mutation_p.S163C|SLC4A7_uc011axb.1_Missense_Mutation_p.S167C|SLC4A7_uc010hfm.2_Missense_Mutation_p.S163C|SLC4A7_uc003cdw.2_Missense_Mutation_p.S158C	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate	158	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)|skin(1)	5						ACTGTGCAAAGAGAGAGTTGC	0.383													13	89	---	---	---	---	PASS
SLC4A7	9497	broad.mit.edu	37	3	27498162	27498162	+	Missense_Mutation	SNP	G	A	A	rs144006432		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27498162G>A	uc003cdv.2	-	1	84	c.13C>T	c.(13-15)CGT>TGT	p.R5C	SLC4A7_uc011awu.1_Intron|SLC4A7_uc011awv.1_Intron|SLC4A7_uc003cdu.3_Intron|SLC4A7_uc011aww.1_Intron|SLC4A7_uc011awx.1_Intron|SLC4A7_uc011awy.1_Intron|SLC4A7_uc011awz.1_Intron|SLC4A7_uc011axa.1_Intron|SLC4A7_uc011axb.1_Intron|SLC4A7_uc010hfm.2_Intron|SLC4A7_uc003cdw.2_Missense_Mutation_p.R5C	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate	5	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)|skin(1)	5						TTCTCCAGACGAAATCTTTCC	0.343													25	91	---	---	---	---	PASS
DLEC1	9940	broad.mit.edu	37	3	38158765	38158765	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38158765G>C	uc003cho.1	+	31	4393	c.4372G>C	c.(4372-4374)GAC>CAC	p.D1458H	DLEC1_uc003chp.1_Missense_Mutation_p.D1458H|DLEC1_uc010hgv.1_Missense_Mutation_p.D1461H|DLEC1_uc003chr.1_Missense_Mutation_p.D529H|DLEC1_uc010hgx.1_RNA|DLEC1_uc003chs.1_5'UTR	NM_007335	NP_031361	Q9Y238	DLEC1_HUMAN	deleted in lung and esophageal cancer 1 isoform	1458					negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		CCTGAAACTGGACCTGCATAG	0.597													4	45	---	---	---	---	PASS
CCDC13	152206	broad.mit.edu	37	3	42799624	42799624	+	Missense_Mutation	SNP	C	G	G	rs140850059		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42799624C>G	uc003cly.3	-	2	298	c.214G>C	c.(214-216)GAG>CAG	p.E72Q	CCDC13_uc003clz.2_Missense_Mutation_p.E72Q|CCDC13_uc011azq.1_Missense_Mutation_p.E72Q	NM_144719	NP_653320	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	72	Potential.									ovary(1)	1						TACCTCTTCTCAAAGCTATTT	0.383													10	72	---	---	---	---	PASS
ZNF197	10168	broad.mit.edu	37	3	44685566	44685566	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44685566G>T	uc003cnm.2	+	6	3150	c.2944G>T	c.(2944-2946)GAT>TAT	p.D982Y	ZNF197_uc003cnn.2_Intron|ZNF197_uc003cno.2_Intron|ZNF197_uc003cnp.2_Intron	NM_006991	NP_008922	O14709	ZN197_HUMAN	zinc finger protein 197 isoform 1	982					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|skin(1)	4				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		AATCCACACAGATGAAAAACC	0.373													12	100	---	---	---	---	PASS
LIMD1	8994	broad.mit.edu	37	3	45637322	45637322	+	Silent	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45637322G>T	uc003coq.2	+	1	1000	c.951G>T	c.(949-951)GGG>GGT	p.G317G		NM_014240	NP_055055	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	317					cytoplasmic mRNA processing body assembly|gene silencing by miRNA|multicellular organismal development|negative regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasmic mRNA processing body|nucleus|RNA-induced silencing complex	protein binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		CAAACTCGGGGCTGGGGGGTG	0.602													44	67	---	---	---	---	PASS
XCR1	2829	broad.mit.edu	37	3	46062519	46062519	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46062519G>C	uc003cpe.2	-	3	1145	c.921C>G	c.(919-921)TTC>TTG	p.F307L	uc003cpd.1_5'Flank|XCR1_uc003cpf.2_Missense_Mutation_p.F307L	NM_005283	NP_005274	P46094	XCR1_HUMAN	XC chemokine receptor 1	307	Cytoplasmic (Potential).				chemotaxis|G-protein signaling, coupled to cyclic nucleotide second messenger|inflammatory response	integral to plasma membrane	chemokine receptor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GCAGCCGGCAGAACCAGAACT	0.627													3	22	---	---	---	---	PASS
CAMP	820	broad.mit.edu	37	3	48266924	48266924	+	3'UTR	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48266924T>C	uc003csj.1	+	4						NM_004345	NP_004336	P49913	CAMP_HUMAN	cathelicidin antimicrobial peptide						killing by host of symbiont cells|negative regulation of growth of symbiont on or near host surface	extracellular region				upper_aerodigestive_tract(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000614)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GTGTGTGCCCTACCCTGGCTC	0.448													23	111	---	---	---	---	PASS
C3orf71	646450	broad.mit.edu	37	3	48955980	48955980	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48955980C>G	uc010hkk.1	-	1	839	c.603G>C	c.(601-603)CAG>CAC	p.Q201H	ARIH2_uc003cvb.2_5'Flank|ARIH2_uc003cvc.2_5'Flank	NM_001123040	NP_001116512	Q8N7S6	CC071_HUMAN	hypothetical protein LOC646450	201						integral to membrane					0						CAATGGTTATCTGCTCCACTG	0.582													4	82	---	---	---	---	PASS
MST1	4485	broad.mit.edu	37	3	49724666	49724666	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49724666C>A	uc003cxg.2	-	5	595	c.523G>T	c.(523-525)GAT>TAT	p.D175Y	MST1_uc011bcs.1_Missense_Mutation_p.D175Y|MST1_uc010hkx.2_Missense_Mutation_p.D96Y|MST1_uc011bct.1_Missense_Mutation_p.D175Y|MST1_uc011bcu.1_RNA|RNF123_uc003cxh.2_5'Flank	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	161	Kringle 1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GGGTCGCCATCAGGGTTACGG	0.627													8	49	---	---	---	---	PASS
DUSP7	1849	broad.mit.edu	37	3	52085122	52085122	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52085122C>T	uc003dct.2	-	3	1048	c.969G>A	c.(967-969)AAG>AAA	p.K323K		NM_001947	NP_001938	Q16829	DUS7_HUMAN	dual specificity phosphatase 7	323	Tyrosine-protein phosphatase.				inactivation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein binding|protein tyrosine phosphatase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CACCACACTTCTTGGAGCGGG	0.597													11	50	---	---	---	---	PASS
DUSP7	1849	broad.mit.edu	37	3	52085139	52085139	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52085139C>G	uc003dct.2	-							NM_001947	NP_001938	Q16829	DUS7_HUMAN	dual specificity phosphatase 7						inactivation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein binding|protein tyrosine phosphatase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CGGGCTTCGTCTGAAACACAT	0.607													11	41	---	---	---	---	PASS
DUSP7	1849	broad.mit.edu	37	3	52088272	52088272	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52088272G>C	uc003dct.2	-	2	715	c.636C>G	c.(634-636)ATC>ATG	p.I212M	DUSP7_uc010hma.2_Missense_Mutation_p.I212M	NM_001947	NP_001938	Q16829	DUS7_HUMAN	dual specificity phosphatase 7	212	Ser-rich.				inactivation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein binding|protein tyrosine phosphatase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGTCAGAGCTGATGCGCAGGC	0.657													27	42	---	---	---	---	PASS
ITIH1	3697	broad.mit.edu	37	3	52821623	52821623	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52821623G>C	uc003dfs.2	+	16	1943	c.1919G>C	c.(1918-1920)AGA>ACA	p.R640T	ITIH1_uc010hmn.1_RNA|ITIH1_uc003dft.2_Missense_Mutation_p.R241T|ITIH1_uc010hmo.1_Missense_Mutation_p.R194T|ITIH1_uc003dfu.2_5'Flank	NM_002215	NP_002206	P19827	ITIH1_HUMAN	inter-alpha (globulin) inhibitor H1	640	Hyaluronan-binding.				hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		CTGGGACCCAGAAGGAGTAAG	0.532													14	85	---	---	---	---	PASS
CACNA1D	776	broad.mit.edu	37	3	53766064	53766064	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53766064G>C	uc003dgv.3	+	18	2591	c.2428G>C	c.(2428-2430)GAA>CAA	p.E810Q	CACNA1D_uc003dgu.3_Missense_Mutation_p.E830Q|CACNA1D_uc003dgy.3_Missense_Mutation_p.E810Q|CACNA1D_uc003dgw.3_Missense_Mutation_p.E477Q|CACNA1D_uc003dgx.1_5'UTR	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	810	Cytoplasmic (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	TGACTATAGAGAAGAGGATGA	0.512													14	68	---	---	---	---	PASS
FLNB	2317	broad.mit.edu	37	3	58112437	58112437	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58112437C>T	uc003djj.2	+	24	4335	c.4170C>T	c.(4168-4170)TTC>TTT	p.F1390F	FLNB_uc010hne.2_Silent_p.F1390F|FLNB_uc003djk.2_Silent_p.F1390F|FLNB_uc010hnf.2_Silent_p.F1390F|FLNB_uc003djl.2_Silent_p.F1221F|FLNB_uc003djm.2_Silent_p.F1221F	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B isoform 2	1390	Filamin 12.|Interaction with FBLP1.				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		ACATTCCTTTCGCACCGGGGG	0.488													20	91	---	---	---	---	PASS
PXK	54899	broad.mit.edu	37	3	58368400	58368400	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58368400C>G	uc003djz.1	+	4	460	c.361C>G	c.(361-363)CCA>GCA	p.P121A	PXK_uc003djx.1_Missense_Mutation_p.P121A|PXK_uc003djy.1_Missense_Mutation_p.P104A|PXK_uc003dka.1_Missense_Mutation_p.P121A|PXK_uc003dkb.1_Missense_Mutation_p.P38A|PXK_uc003dkc.1_Missense_Mutation_p.P104A|PXK_uc011bfe.1_Missense_Mutation_p.P88A|PXK_uc010hnj.1_Missense_Mutation_p.P88A|PXK_uc003dkd.1_Intron|PXK_uc010hnk.1_Translation_Start_Site	NM_017771	NP_060241	Q7Z7A4	PXK_HUMAN	PX domain containing serine/threonine kinase	121	Protein kinase.|PX.				cell communication|inflammatory response|negative regulation of ATPase activity|negative regulation of ion transport|regulation of synaptic transmission	centrosome|cytoplasm|nucleus|plasma membrane	actin binding|ATP binding|phosphatidylinositol binding|phosphatidylinositol binding|protein C-terminus binding|protein kinase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		GTTTTTAGATCCAAACAACTA	0.393													15	118	---	---	---	---	PASS
FAM107A	11170	broad.mit.edu	37	3	58555429	58555429	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58555429C>T	uc003dkm.2	-	3	718	c.159G>A	c.(157-159)ATG>ATA	p.M53I	FAM107A_uc003dko.2_Missense_Mutation_p.M84I|FAM107A_uc003dkn.2_Missense_Mutation_p.M53I|FAM107A_uc010hnm.2_Missense_Mutation_p.M81I|FAM107A_uc003dkp.1_Missense_Mutation_p.M53I	NM_007177	NP_009108	O95990	F107A_HUMAN	downregulated in renal cell carcinoma	53					regulation of cell growth	nucleus	protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000189)|Kidney(10;0.000536)|KIRC - Kidney renal clear cell carcinoma(10;0.000716)|OV - Ovarian serous cystadenocarcinoma(275;0.154)		TTCTGTGGTTCATGAGCAGCT	0.617													23	112	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77542411	77542411	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77542411C>G	uc003dpy.3	+	5	1327	c.684C>G	c.(682-684)CTC>CTG	p.L228L	ROBO2_uc003dpz.2_Silent_p.L228L|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Silent_p.L228L	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	228	Ig-like C2-type 3.|Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CCACATTTCTCAGGAGGCCAA	0.378													17	131	---	---	---	---	PASS
HTR1F	3355	broad.mit.edu	37	3	88040884	88040884	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88040884T>C	uc003dqr.2	+	2	1143	c.985T>C	c.(985-987)TCC>CCC	p.S329P		NM_000866	NP_000857	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F	329	Extracellular (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	serotonin binding|serotonin receptor activity			ovary(3)	3	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	TGAAGAAATGTCCAATTTTTT	0.323													17	71	---	---	---	---	PASS
OR5AC2	81050	broad.mit.edu	37	3	97806130	97806130	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97806130C>G	uc011bgs.1	+	1	114	c.114C>G	c.(112-114)CTC>CTG	p.L38L		NM_054106	NP_473447	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC,	38	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TGGTCTATCTCATCACCATGG	0.448													80	408	---	---	---	---	PASS
COL8A1	1295	broad.mit.edu	37	3	99514504	99514504	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99514504G>C	uc003dtg.1	+	5	2004	c.1759G>C	c.(1759-1761)GAT>CAT	p.D587H	COL8A1_uc003dth.1_Missense_Mutation_p.D587H|COL8A1_uc003dti.1_Missense_Mutation_p.D588H	NM_001850	NP_001841	P27658	CO8A1_HUMAN	alpha 1 type VIII collagen precursor	587	Nonhelical region (NC1).				angiogenesis|cell adhesion	basement membrane|collagen type VIII					0						GTATCTGCCAGATATGGGGCT	0.473													12	90	---	---	---	---	PASS
TOMM70A	9868	broad.mit.edu	37	3	100087936	100087936	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100087936T>C	uc003dtw.2	-	10	1928	c.1496A>G	c.(1495-1497)TAT>TGT	p.Y499C		NM_014820	NP_055635	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70	499	Cytoplasmic (Potential).|TPR 8.				protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane translocase complex	protein binding|protein transmembrane transporter activity			ovary(1)	1						ACATTTATCATACATTTCATC	0.313													63	109	---	---	---	---	PASS
ABI3BP	25890	broad.mit.edu	37	3	100471741	100471741	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100471741G>C	uc003dun.2	-	33	2964	c.2879C>G	c.(2878-2880)TCA>TGA	p.S960*	ABI3BP_uc003duj.2_Nonsense_Mutation_p.S540*|ABI3BP_uc003duk.2_Nonsense_Mutation_p.S669*|ABI3BP_uc003dul.2_Nonsense_Mutation_p.S790*|ABI3BP_uc011bhd.1_Nonsense_Mutation_p.S914*|ABI3BP_uc003dum.2_Nonsense_Mutation_p.S371*	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein	960						extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						CTTACACTCTGAGTAAGAGTC	0.393													25	119	---	---	---	---	PASS
ABI3BP	25890	broad.mit.edu	37	3	100569558	100569558	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100569558C>G	uc003dun.2	-	14	1331	c.1246G>C	c.(1246-1248)GAT>CAT	p.D416H	ABI3BP_uc003duo.2_Missense_Mutation_p.D458H	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein	416						extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						GGGATAGAATCCAGAATACGA	0.328													15	130	---	---	---	---	PASS
IMPG2	50939	broad.mit.edu	37	3	100992587	100992587	+	Splice_Site	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100992587C>G	uc003duq.1	-	7	870	c.667_splice	c.e7-1	p.I223_splice	IMPG2_uc011bhe.1_Splice_Site_p.I86_splice	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2						visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						CATTGCTAATCTGAATTTTTA	0.264													17	79	---	---	---	---	PASS
RG9MTD1	54931	broad.mit.edu	37	3	101283965	101283965	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101283965G>A	uc003duz.2	+	2	488	c.340G>A	c.(340-342)GAA>AAA	p.E114K		NM_017819	NP_060289	Q7L0Y3	MRRP1_HUMAN	RNA (guanine-9-) methyltransferase domain	114					tRNA processing	mitochondrion	methyltransferase activity|protein binding			ovary(1)	1						ACACATCACTGAAGAAGAGCT	0.368													27	142	---	---	---	---	PASS
TRAT1	50852	broad.mit.edu	37	3	108572674	108572674	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108572674C>T	uc003dxi.1	+	6	655	c.511C>T	c.(511-513)CCC>TCC	p.P171S	TRAT1_uc010hpx.1_Missense_Mutation_p.P134S	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN	T-cell receptor interacting molecule	171	Cytoplasmic (Potential).				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1						TCATGATGATCCCATCAGACT	0.433													38	214	---	---	---	---	PASS
GUCA1C	9626	broad.mit.edu	37	3	108672423	108672423	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108672423T>C	uc003dxj.2	-	1	255	c.187A>G	c.(187-189)ACC>GCC	p.T63A	GUCA1C_uc003dxk.2_Missense_Mutation_p.T63A	NM_005459	NP_005450	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C	63	EF-hand 2.				signal transduction|visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						GTGTCAAAGGTATTATAAACT	0.348													42	202	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108776334	108776334	+	Splice_Site	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108776334C>T	uc003dxl.2	-	13	1119	c.1032_splice	c.e13-1	p.R344_splice	MORC1_uc011bhn.1_Splice_Site_p.R344_splice	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						TTTTAATTCTCTAGAGTTACA	0.328													42	100	---	---	---	---	PASS
CCDC52	152185	broad.mit.edu	37	3	113222068	113222068	+	Missense_Mutation	SNP	C	A	A	rs141190252	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113222068C>A	uc003eag.3	-	3	397	c.106G>T	c.(106-108)GTG>TTG	p.V36L	CCDC52_uc003eaf.3_RNA|CCDC52_uc011bie.1_Missense_Mutation_p.V48L|CCDC52_uc003eai.1_Missense_Mutation_p.V36L	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52	36					cell division|mitosis	centriole|spindle	protein binding				0						AGATCAGTCACGGTATTCTGT	0.289													8	65	---	---	---	---	PASS
ARHGAP31	57514	broad.mit.edu	37	3	119134125	119134125	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119134125G>T	uc003ecj.3	+	12	3881	c.3349G>T	c.(3349-3351)GAC>TAC	p.D1117Y		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	1117					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						TCCCATTGCTGACCTCTTCTG	0.517													39	173	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121416258	121416258	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121416258C>G	uc003eei.3	-	13	3223	c.3097G>C	c.(3097-3099)GAG>CAG	p.E1033Q	GOLGB1_uc010hrc.2_Missense_Mutation_p.E1038Q|GOLGB1_uc003eej.3_Missense_Mutation_p.E999Q|GOLGB1_uc011bjm.1_Missense_Mutation_p.E919Q|GOLGB1_uc010hrd.1_Missense_Mutation_p.E997Q	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	1033	Cytoplasmic (Potential).				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		TCTCCCCTCTCAGTCTCACTG	0.343													11	263	---	---	---	---	PASS
TPRA1	131601	broad.mit.edu	37	3	127294892	127294892	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127294892C>A	uc003ejl.2	-	6	791	c.500G>T	c.(499-501)GGG>GTG	p.G167V	TPRA1_uc003ejm.2_RNA|TPRA1_uc003ejo.2_Missense_Mutation_p.G167V|TPRA1_uc010hsk.2_Missense_Mutation_p.G167V|TPRA1_uc003ejn.2_Missense_Mutation_p.G167V	NM_016372	NP_057456	Q86W33	TPRA1_HUMAN	G protein-coupled receptor 175 isoform 1	167	Helical; Name=4; (Potential).				aging|lipid metabolic process	integral to membrane	G-protein coupled receptor activity				0						CTCCAGGGTCCCCTGCAGGGG	0.587													5	42	---	---	---	---	PASS
CNBP	7555	broad.mit.edu	37	3	128889288	128889288	+	3'UTR	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128889288G>C	uc003elq.3	-	5					CNBP_uc003elr.3_3'UTR|CNBP_uc011bku.1_3'UTR	NM_003418	NP_003409	P62633	CNBP_HUMAN	zinc finger protein 9 isoform 3						cholesterol biosynthetic process	endoplasmic reticulum	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GGCGACAAAGGAAAATAATTA	0.478													4	249	---	---	---	---	PASS
ASTE1	28990	broad.mit.edu	37	3	130735088	130735088	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130735088C>T	uc003env.1	-	5	2051	c.1609G>A	c.(1609-1611)GAC>AAC	p.D537N	ATP2C1_uc011blh.1_Silent_p.V944V|ATP2C1_uc011bli.1_Silent_p.V973V|ATP2C1_uc003enm.2_3'UTR|ATP2C1_uc003enn.2_Silent_p.V923V|ATP2C1_uc003enp.2_3'UTR|ATP2C1_uc003enr.2_3'UTR|ATP2C1_uc003ens.2_Silent_p.V949V|ATP2C1_uc003ent.2_Silent_p.V939V|ASTE1_uc010htm.1_Missense_Mutation_p.D537N|ASTE1_uc011blj.1_RNA	NM_014065	NP_054784	Q2TB18	ASTE1_HUMAN	asteroid homolog 1	537					DNA repair		nuclease activity				0						TGAGCTGTGTCTAAGTCCAGT	0.522													24	174	---	---	---	---	PASS
RAB6B	51560	broad.mit.edu	37	3	133547652	133547652	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133547652C>G	uc003epy.2	-	8	988	c.607G>C	c.(607-609)GAG>CAG	p.E203Q	RAB6B_uc011blu.1_Missense_Mutation_p.E190Q	NM_016577	NP_057661	Q9NRW1	RAB6B_HUMAN	RAB6B, member RAS oncogene family	203					protein transport|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle|Golgi membrane	GTP binding|GTPase activity|protein binding			pancreas(1)	1						CAGCCGCCCTCGCTGGCCGGG	0.597													47	296	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134960004	134960004	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134960004T>C	uc003eqt.2	+	13	2581	c.2361T>C	c.(2359-2361)CCT>CCC	p.P787P	EPHB1_uc003equ.2_Silent_p.P348P	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	787	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						GGAAGATCCCTGTGAGATGGA	0.502													26	173	---	---	---	---	PASS
PPP2R3A	5523	broad.mit.edu	37	3	135721224	135721224	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135721224A>T	uc003eqv.1	+	2	1449	c.884A>T	c.(883-885)GAA>GTA	p.E295V	PPP2R3A_uc011blz.1_Intron	NM_002718	NP_002709	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'',	295					protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7						TTACCATTTGAATTCATGCAG	0.388													38	143	---	---	---	---	PASS
IL20RB	53833	broad.mit.edu	37	3	136714252	136714252	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136714252C>T	uc003eri.1	+						IL20RB_uc003erj.1_Intron|IL20RB_uc010hud.1_Intron	NM_144717	NP_653318	Q6UXL0	I20RB_HUMAN	interleukin 20 receptor beta precursor							integral to membrane	receptor activity			ovary(1)	1						TCTTTTGTTTCCAGGAGAGGC	0.498													6	378	---	---	---	---	PASS
ESYT3	83850	broad.mit.edu	37	3	138189849	138189849	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138189849C>T	uc003esk.2	+	17	1947	c.1721C>T	c.(1720-1722)TCC>TTC	p.S574F	ESYT3_uc010hug.2_RNA	NM_031913	NP_114119	A0FGR9	ESYT3_HUMAN	family with sequence similarity 62 (C2 domain	574						integral to membrane|plasma membrane					0						AGCCTCATCTCCATGAGGCTG	0.597													35	178	---	---	---	---	PASS
PIK3CB	5291	broad.mit.edu	37	3	138407817	138407817	+	Splice_Site	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138407817C>A	uc011bmq.1	-	14	2037	c.2037_splice	c.e14-1	p.R679_splice	PIK3CB_uc011bmn.1_Splice_Site_p.R191_splice|PIK3CB_uc011bmo.1_Splice_Site_p.R125_splice|PIK3CB_uc011bmp.1_Splice_Site_p.R266_splice	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta						activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						CACTTCTGACCTGCAGAAAGT	0.388													14	53	---	---	---	---	PASS
GK5	256356	broad.mit.edu	37	3	141906625	141906625	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141906625G>A	uc003euq.1	-						GK5_uc010hus.1_Intron	NM_001039547	NP_001034636	Q6ZS86	GLPK5_HUMAN	glycerol kinase 5 (putative)						glycerol metabolic process		ATP binding|glycerol kinase activity				0						TTTGCACCTTGAAAACACAAC	0.328													15	78	---	---	---	---	PASS
XRN1	54464	broad.mit.edu	37	3	142166701	142166701	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142166701C>G	uc003eus.2	-						XRN1_uc003eut.2_Intron|XRN1_uc003euu.2_Intron|XRN1_uc003euw.2_Intron|XRN1_uc011bnh.1_Intron	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						CGTTGCCCCTCGCTCACCCAC	0.597													22	206	---	---	---	---	PASS
XRN1	54464	broad.mit.edu	37	3	142166720	142166720	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142166720C>G	uc003eus.2	-	1	134	c.67G>C	c.(67-69)GAG>CAG	p.E23Q	XRN1_uc003eut.2_Missense_Mutation_p.E23Q|XRN1_uc003euu.2_Missense_Mutation_p.E23Q|XRN1_uc003euw.2_Missense_Mutation_p.E23Q|XRN1_uc011bnh.1_5'UTR	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a	23					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						ACCTGATGCTCTTTCACCACT	0.587													25	238	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142215323	142215323	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142215323C>G	uc003eux.3	-	34	5900	c.5778G>C	c.(5776-5778)CAG>CAC	p.Q1926H		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	1926	FAT.				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						CCCTGGCACTCTGCAGCCAGC	0.473								Other_conserved_DNA_damage_response_genes					27	124	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142224118	142224118	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142224118C>G	uc003eux.3	-	29	5181	c.5059G>C	c.(5059-5061)GAT>CAT	p.D1687H		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	1687	FAT.				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						GCCACTCCATCAGGTTCATGC	0.388								Other_conserved_DNA_damage_response_genes					145	376	---	---	---	---	PASS
SCHIP1	29970	broad.mit.edu	37	3	158980417	158980417	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158980417C>G	uc003fcq.1	+	4	341	c.236C>G	c.(235-237)TCA>TGA	p.S79*	SCHIP1_uc003fcr.1_5'UTR|IQCJ_uc003fco.2_Nonsense_Mutation_p.S79*|IQCJ_uc010hvy.1_Nonsense_Mutation_p.S52*|IQCJ_uc003fcp.1_Nonsense_Mutation_p.S79*	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1	Error:Variant_position_missing_in_Q9P0W5_after_alignment						cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			TCTGTCTCCTCAGAGAAGCTG	0.532													10	199	---	---	---	---	PASS
SMC4	10051	broad.mit.edu	37	3	160132222	160132222	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160132222G>C	uc003fdh.2	+	9	1302	c.1189G>C	c.(1189-1191)GAT>CAT	p.D397H	IFT80_uc003fda.2_Intron|SMC4_uc003fdf.1_RNA|SMC4_uc003fdg.1_Missense_Mutation_p.D397H|SMC4_uc010hwc.1_Missense_Mutation_p.D161H|SMC4_uc003fdi.2_Missense_Mutation_p.D372H|SMC4_uc003fdj.2_Missense_Mutation_p.D397H|SMC4_uc010hwd.2_Missense_Mutation_p.D397H|SMC4_uc003fdl.2_Missense_Mutation_p.D100H	NM_001002800	NP_001002800	Q9NTJ3	SMC4_HUMAN	SMC4 structural maintenance of chromosomes	397	Potential.				cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	ATP binding|protein heterodimerization activity			ovary(1)|breast(1)	2			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AGATTTGGAAGATGTTCAAGT	0.284													14	115	---	---	---	---	PASS
PDCD10	11235	broad.mit.edu	37	3	167413428	167413428	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167413428G>A	uc003fex.2	-	6	749	c.351C>T	c.(349-351)ATC>ATT	p.I117I	PDCD10_uc003fez.2_Silent_p.I117I|PDCD10_uc003fey.2_Silent_p.I117I	NM_007217	NP_009148	Q9BUL8	PDC10_HUMAN	programmed cell death 10	117					angiogenesis|apoptosis|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of MAP kinase activity	cytosol|Golgi membrane|plasma membrane	protein homodimerization activity|protein N-terminus binding			lung(1)|central_nervous_system(1)	2						TCTCATCTGGGATCTTACTGA	0.358									Familial_Cerebral_Cavernous_Angioma				77	266	---	---	---	---	PASS
SLC7A14	57709	broad.mit.edu	37	3	170219054	170219054	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170219054C>A	uc003fgz.2	-	3	701	c.385G>T	c.(385-387)GAA>TAA	p.E129*	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	129	Helical; (Potential).					integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			GCCACAAATTCCCCAACAGTG	0.527													5	49	---	---	---	---	PASS
SLC7A14	57709	broad.mit.edu	37	3	170219055	170219055	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170219055C>A	uc003fgz.2	-	3	700	c.384G>T	c.(382-384)GGG>GGT	p.G128G	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	128	Helical; (Potential).					integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CCACAAATTCCCCAACAGTGA	0.527													5	50	---	---	---	---	PASS
NAALADL2	254827	broad.mit.edu	37	3	175520973	175520973	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175520973C>G	uc003fit.2	+	14	2457	c.2370C>G	c.(2368-2370)GTC>GTG	p.V790V		NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	790	Extracellular (Potential).				proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		TCAAGAGTGTCTTGGATGGGA	0.378													12	63	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			11	100	---	---	---	---	PASS
PEX5L	51555	broad.mit.edu	37	3	179537695	179537695	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179537695C>G	uc003fki.1	-	9	1022	c.892G>C	c.(892-894)GAG>CAG	p.E298Q	PEX5L_uc011bqd.1_Missense_Mutation_p.E255Q|PEX5L_uc011bqe.1_Missense_Mutation_p.E106Q|PEX5L_uc011bqf.1_Missense_Mutation_p.E190Q|PEX5L_uc003fkj.1_Missense_Mutation_p.E263Q|PEX5L_uc010hxd.1_Missense_Mutation_p.E296Q|PEX5L_uc011bqg.1_Missense_Mutation_p.E274Q|PEX5L_uc011bqh.1_Missense_Mutation_p.E239Q	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	298					protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TCTTGGTTCTCAGATATCCAG	0.438													6	188	---	---	---	---	PASS
MCF2L2	23101	broad.mit.edu	37	3	182925608	182925608	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182925608C>A	uc003fli.1	-	23	2590	c.2500G>T	c.(2500-2502)GAT>TAT	p.D834Y		NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor	834	PH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TTTCCAATATCGTCCTTTTGG	0.388													10	71	---	---	---	---	PASS
C3orf59	151963	broad.mit.edu	37	3	192516720	192516720	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192516720G>C	uc011bsp.1	-	2	1252	c.931C>G	c.(931-933)CAG>GAG	p.Q311E		NM_178496	NP_848591	Q8IYB1	M21D2_HUMAN	hypothetical protein LOC151963	311											0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)		TTGCAGGCCTGATAGGCCTGC	0.557													7	85	---	---	---	---	PASS
ATP13A4	84239	broad.mit.edu	37	3	193201797	193201797	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193201797G>C	uc003ftd.2	-						ATP13A4_uc003fte.1_Intron|ATP13A4_uc011bsr.1_Intron	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		ACAGATTGCTGAAAAAGAAGG	0.358													35	196	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196386967	196386967	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196386967C>T	uc003fwv.2	+	3	557	c.453C>T	c.(451-453)CTC>CTT	p.L151L		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	151	Extracellular (Potential).|LRR 4.					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		TGGCAGCCCTCATGCTCCAGA	0.672													7	37	---	---	---	---	PASS
KIAA1530	57654	broad.mit.edu	37	4	1341946	1341946	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1341946G>C	uc003gde.3	+	2	514	c.67G>C	c.(67-69)GAG>CAG	p.E23Q		NM_020894	NP_065945	Q2YD98	K1530_HUMAN	hypothetical protein LOC57654	23											0			OV - Ovarian serous cystadenocarcinoma(23;0.0138)			ACTAAATCCTGAGAAAATGAA	0.443													37	194	---	---	---	---	PASS
PDS5A	23244	broad.mit.edu	37	4	39904022	39904022	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39904022C>T	uc003guv.3	-	13	1984	c.1444G>A	c.(1444-1446)GAG>AAG	p.E482K	PDS5A_uc010ifo.2_Missense_Mutation_p.E442K|PDS5A_uc003guw.3_Missense_Mutation_p.E482K	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog	482					cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						TTCATTCTCTCTTCTGTTTCC	0.333													8	56	---	---	---	---	PASS
RBM47	54502	broad.mit.edu	37	4	40438646	40438646	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40438646C>G	uc003gvc.2	-	5	1852	c.1142G>C	c.(1141-1143)CGA>CCA	p.R381P	RBM47_uc003gvd.2_Intron|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Missense_Mutation_p.R343P	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	381						nucleus	nucleotide binding|RNA binding			breast(3)	3						ACCTCGCCCTCGGCCTCTTAT	0.552													45	202	---	---	---	---	PASS
LIMCH1	22998	broad.mit.edu	37	4	41648662	41648662	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41648662G>C	uc003gvu.3	+	12	1471	c.1417G>C	c.(1417-1419)GAG>CAG	p.E473Q	LIMCH1_uc003gvv.3_Missense_Mutation_p.E473Q|LIMCH1_uc003gvw.3_Missense_Mutation_p.E473Q|LIMCH1_uc003gvx.3_Missense_Mutation_p.E461Q|LIMCH1_uc003gwe.3_Missense_Mutation_p.E473Q|LIMCH1_uc003gvy.3_Missense_Mutation_p.E302Q|LIMCH1_uc003gwa.3_Missense_Mutation_p.E314Q|LIMCH1_uc003gvz.3_Missense_Mutation_p.E858Q|LIMCH1_uc011byu.1_Missense_Mutation_p.E307Q|LIMCH1_uc003gwc.3_Missense_Mutation_p.E319Q|LIMCH1_uc003gwd.3_Missense_Mutation_p.E307Q|LIMCH1_uc011byv.1_Missense_Mutation_p.E224Q	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a	473					actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						CCATTCAACAGAGCCAAATTT	0.478													88	324	---	---	---	---	PASS
TMEM33	55161	broad.mit.edu	37	4	41956198	41956198	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41956198G>A	uc003gwi.2	+	7	1091	c.726G>A	c.(724-726)TTG>TTA	p.L242L	TMEM33_uc010ifw.2_RNA	NM_018126	NP_060596	P57088	TMM33_HUMAN	transmembrane protein 33	242						integral to membrane|melanosome	protein binding			ovary(1)	1						TAAGCAGATTGGCACCAACAG	0.388													47	159	---	---	---	---	PASS
KCTD8	386617	broad.mit.edu	37	4	44450335	44450335	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44450335G>T	uc003gwu.2	-	1	490	c.206C>A	c.(205-207)ACT>AAT	p.T69N		NM_198353	NP_938167	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerisation domain	69	BTB.					cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(2)|ovary(1)	3						GCTGGCCAAAGTACTGTCCGG	0.552										HNSCC(17;0.042)			5	10	---	---	---	---	PASS
CNGA1	1259	broad.mit.edu	37	4	47938785	47938785	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47938785G>A	uc003gxt.3	-	11	1992	c.1726C>T	c.(1726-1728)CTC>TTC	p.L576F	uc003gxr.1_Intron|CNGA1_uc003gxu.2_Missense_Mutation_p.L645F	NM_000087	NP_000078	P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1 isoform	576	cGMP (Potential).|Cytoplasmic (Potential).				response to stimulus|visual perception	integral to plasma membrane	cGMP binding|ion channel activity			ovary(2)	2						TCTTTTGAGAGACAGAACAGG	0.418													95	142	---	---	---	---	PASS
CNGA1	1259	broad.mit.edu	37	4	47939043	47939043	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47939043C>G	uc003gxt.3	-	11	1734	c.1468G>C	c.(1468-1470)GAG>CAG	p.E490Q	uc003gxr.1_Intron|CNGA1_uc003gxu.2_Missense_Mutation_p.E559Q	NM_000087	NP_000078	P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1 isoform	490	cGMP (Potential).|Helical; Name=H6; (Potential).				response to stimulus|visual perception	integral to plasma membrane	cGMP binding|ion channel activity			ovary(2)	2						AAGACCAACTCCACCAACAGA	0.408													47	266	---	---	---	---	PASS
KIAA0114	57291	broad.mit.edu	37	4	53579444	53579444	+	Intron	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53579444T>C	uc003gzo.2	+						KIAA0114_uc003gzp.2_Intron|SNORA26_uc003gzq.1_RNA	NR_024031				Homo sapiens, clone IMAGE:3885428, mRNA.												0						CCCAGTGCTTTAAGAGGCTAA	0.433													33	142	---	---	---	---	PASS
EXOC1	55763	broad.mit.edu	37	4	56744117	56744117	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56744117C>G	uc003hbe.1	+	9	1267	c.1109C>G	c.(1108-1110)TCT>TGT	p.S370C	EXOC1_uc003hbf.1_Missense_Mutation_p.S370C|EXOC1_uc003hbg.1_Missense_Mutation_p.S370C	NM_018261	NP_060731	Q9NV70	EXOC1_HUMAN	exocyst complex component 1 isoform 1	370					exocytosis|protein transport	exocyst	protein binding			ovary(2)|skin(2)|lung(1)|central_nervous_system(1)	6	Glioma(25;0.08)|all_neural(26;0.101)					GCCCAACACTCTGTTGAACTG	0.358													3	130	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57181915	57181915	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57181915C>A	uc003hbk.2	+	8	2638	c.2247C>A	c.(2245-2247)CCC>CCA	p.P749P	KIAA1211_uc010iha.2_Silent_p.P742P|KIAA1211_uc011bzz.1_Silent_p.P659P|KIAA1211_uc003hbm.1_Silent_p.P635P	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	749										ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					GAAAAAGACCCATGCTGGGAC	0.582													28	43	---	---	---	---	PASS
REST	5978	broad.mit.edu	37	4	57797315	57797315	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57797315A>T	uc003hch.2	+	4	2638	c.2291A>T	c.(2290-2292)GAG>GTG	p.E764V	REST_uc003hci.2_Missense_Mutation_p.E764V|REST_uc010ihf.2_Missense_Mutation_p.E438V	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	764	Pro-rich.				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding	p.M753_P768delMEVVQKEPVKIELSPP(1)		skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)					GTTAAGATAGAGCTGTCTCCT	0.562													226	368	---	---	---	---	PASS
TMPRSS11B	132724	broad.mit.edu	37	4	69100194	69100194	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69100194G>A	uc003hdw.3	-	5	592	c.456C>T	c.(454-456)TCC>TCT	p.S152S		NM_182502	NP_872308	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B	152	SEA.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						TGAGTTTAATGGAAGCAGGAA	0.328													50	97	---	---	---	---	PASS
TMPRSS11B	132724	broad.mit.edu	37	4	69100195	69100195	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69100195G>T	uc003hdw.3	-	5	591	c.455C>A	c.(454-456)TCC>TAC	p.S152Y		NM_182502	NP_872308	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B	152	SEA.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						GAGTTTAATGGAAGCAGGAAC	0.328													50	96	---	---	---	---	PASS
ADAMTS3	9508	broad.mit.edu	37	4	73178020	73178020	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73178020C>T	uc003hgk.1	-	13	1946	c.1909G>A	c.(1909-1911)GAA>AAA	p.E637K	ADAMTS3_uc003hgl.2_5'Flank	NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	637	Cys-rich.				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCAGGATGTTCATATGGCAAC	0.488													31	138	---	---	---	---	PASS
AFP	174	broad.mit.edu	37	4	74318154	74318154	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74318154G>A	uc003hgz.1	+	12	1512	c.1465G>A	c.(1465-1467)GAA>AAA	p.E489K	AFP_uc003hha.1_Missense_Mutation_p.E489K|AFP_uc011cbg.1_Missense_Mutation_p.E263K	NM_001134	NP_001125	P02771	FETA_HUMAN	alpha-fetoprotein precursor	489	Albumin 3.				transport		metal ion binding			ovary(1)	1	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TATCAGACATGAAATGACTCC	0.433									Alpha-Fetoprotein_Hereditary_Persistence_of				23	92	---	---	---	---	PASS
MRPL1	65008	broad.mit.edu	37	4	78871002	78871002	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78871002G>C	uc003hku.2	+	8	1027	c.829G>C	c.(829-831)GAA>CAA	p.E277Q	MRPL1_uc010iji.1_Intron	NM_020236	NP_064621	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1 precursor	277							RNA binding				0						AGTTATTAATGAAGTTTGTAG	0.358													4	128	---	---	---	---	PASS
COPS4	51138	broad.mit.edu	37	4	83978197	83978197	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83978197G>A	uc003hoa.2	+	5	668	c.529G>A	c.(529-531)GAA>AAA	p.E177K	COPS4_uc003hob.2_Missense_Mutation_p.E177K|COPS4_uc010ijw.2_Missense_Mutation_p.E177K|COPS4_uc010ijx.2_Missense_Mutation_p.E177K	NM_016129	NP_057213	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	177					cullin deneddylation	cytoplasm|signalosome	protein binding			kidney(1)	1		Hepatocellular(203;0.114)				GCTTCAGAATGAATCAACCAA	0.363													69	92	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85611771	85611771	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85611771C>A	uc003hpd.2	-	61	9659	c.9251G>T	c.(9250-9252)TGT>TTT	p.C3084F		NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	3084	WD 1.					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GCAGATTGCACAGAGAATCTG	0.493													25	59	---	---	---	---	PASS
NUDT9	53343	broad.mit.edu	37	4	88359425	88359425	+	Intron	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88359425A>G	uc003hqq.2	+						NUDT9_uc003hqr.2_Intron|NUDT9_uc010ikl.2_Intron	NM_024047	NP_076952	Q9BW91	NUDT9_HUMAN	nudix-type motif 9 isoform a							mitochondrion	ADP-ribose diphosphatase activity				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		TATTCTCATTACAGTGAAAGT	0.338													24	51	---	---	---	---	PASS
IBSP	3381	broad.mit.edu	37	4	88731925	88731925	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88731925G>A	uc003hqx.3	+							NM_004967	NP_004958	P21815	SIAL_HUMAN	integrin-binding sialoprotein precursor						biomineral tissue development|cell adhesion|ossification						0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		AGGTAACAATGGAATTATTCC	0.398													16	85	---	---	---	---	PASS
HERC6	55008	broad.mit.edu	37	4	89352393	89352393	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89352393C>G	uc011cdi.1	+	17	2369	c.2186C>G	c.(2185-2187)ACC>AGC	p.T729S	HERC6_uc011cdj.1_Missense_Mutation_p.T693S|HERC6_uc011cdk.1_RNA|HERC6_uc011cdl.1_RNA	NM_017912	NP_060382	Q8IVU3	HERC6_HUMAN	hect domain and RLD 6 isoform 1	729	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity			lung(3)|ovary(1)|kidney(1)	5		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		GAAGAGATGACCAAGCCAGAA	0.393													46	233	---	---	---	---	PASS
FAM13A	10144	broad.mit.edu	37	4	89668850	89668850	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89668850T>C	uc003hse.1	-	18	2522	c.2314A>G	c.(2314-2316)ACA>GCA	p.T772A	FAM13A_uc003hsa.1_Missense_Mutation_p.T243A|FAM13A_uc003hsb.1_Missense_Mutation_p.T446A|FAM13A_uc003hsd.1_Missense_Mutation_p.T446A|FAM13A_uc003hsc.1_Missense_Mutation_p.T432A|FAM13A_uc011cdq.1_Missense_Mutation_p.T418A|FAM13A_uc003hsf.1_Missense_Mutation_p.T358A|FAM13A_uc003hsg.1_Missense_Mutation_p.T243A	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1	772					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						GATTCCAATGTGGCTTCAACA	0.478													50	223	---	---	---	---	PASS
PDHA2	5161	broad.mit.edu	37	4	96762179	96762179	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96762179G>C	uc003htr.3	+	1	941	c.878G>C	c.(877-879)AGT>ACT	p.S293T		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	293					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	CACAGTATGAGTGATCCTGGA	0.423													28	60	---	---	---	---	PASS
TACR3	6870	broad.mit.edu	37	4	104512829	104512829	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104512829C>G	uc003hxe.1	-	4	1043	c.900G>C	c.(898-900)ATG>ATC	p.M300I		NM_001059	NP_001050	P29371	NK3R_HUMAN	tachykinin receptor 3	300	Helical; Name=6; (Potential).					integral to plasma membrane	tachykinin receptor activity			ovary(3)|lung(2)|breast(1)|skin(1)	7		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		CAATAATCATCATTTTGACAA	0.308													12	45	---	---	---	---	PASS
UGT8	7368	broad.mit.edu	37	4	115597237	115597237	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115597237T>G	uc003ibs.2	+	6	1941	c.1419T>G	c.(1417-1419)TTT>TTG	p.F473L	UGT8_uc003ibt.2_Missense_Mutation_p.F473L|UGT8_uc011cge.1_RNA	NM_001128174	NP_001121646	Q16880	CGT_HUMAN	UDP-galactose-ceramide galactosyltransferase 8	473	Helical; (Potential).				central nervous system development|peripheral nervous system development	integral to membrane	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity			ovary(1)|skin(1)	2		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		GTCAGTATTTTTTACTGGATA	0.383													42	160	---	---	---	---	PASS
TNIP3	79931	broad.mit.edu	37	4	122082298	122082298	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122082298C>T	uc010ing.2	-	2	336	c.140G>A	c.(139-141)AGA>AAA	p.R47K	TNIP3_uc010inh.2_Missense_Mutation_p.R47K|TNIP3_uc011cgj.1_Missense_Mutation_p.R105K|TNIP3_uc010ini.2_Missense_Mutation_p.R47K	NM_024873	NP_079149	Q96KP6	TNIP3_HUMAN	TNFAIP3 interacting protein 3	47	Potential.									ovary(1)	1						TACCTCTTTTCTTTGTTTTTC	0.313													4	23	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123179939	123179939	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123179939G>C	uc003ieh.2	+	40	6748	c.6703G>C	c.(6703-6705)GAG>CAG	p.E2235Q	KIAA1109_uc003iel.1_Missense_Mutation_p.E170Q|KIAA1109_uc003iek.2_Missense_Mutation_p.E854Q	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	2235					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						AACTGGAGCTGAGATAATGAG	0.403													29	107	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123270402	123270402	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123270402G>A	uc003ieh.2	+	76	13415	c.13370G>A	c.(13369-13371)AGA>AAA	p.R4457K	KIAA1109_uc003iem.2_Missense_Mutation_p.R813K	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	4457					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						GGTCTGGGAAGATCACAATTA	0.413													5	107	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126241507	126241507	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126241507C>G	uc003ifj.3	+	1	3941	c.3941C>G	c.(3940-3942)TCT>TGT	p.S1314C		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1314	Cadherin 12.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						AATACCCCTTCTTTCCCTAAA	0.373													41	177	---	---	---	---	PASS
SCLT1	132320	broad.mit.edu	37	4	129891542	129891542	+	Missense_Mutation	SNP	C	T	T	rs141863899	byFrequency	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129891542C>T	uc003igp.2	-	10	1274	c.768G>A	c.(766-768)ATG>ATA	p.M256I	SCLT1_uc003ign.2_5'UTR|SCLT1_uc003igo.2_5'UTR|SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1	256	Potential.					centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						CCTTCTTTTTCATCTGTCCCT	0.328													17	72	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134073056	134073056	+	Silent	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134073056T>A	uc003iha.2	+	1	2587	c.1761T>A	c.(1759-1761)CGT>CGA	p.R587R	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Silent_p.R587R	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	587	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		CTCCAGCGCGTGAGGTGCTGC	0.662													8	53	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134073059	134073059	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134073059G>T	uc003iha.2	+	1	2590	c.1764G>T	c.(1762-1764)GAG>GAT	p.E588D	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.E588D	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	588	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		CAGCGCGTGAGGTGCTGCCCC	0.662													8	53	---	---	---	---	PASS
OTUD4	54726	broad.mit.edu	37	4	146080657	146080657	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146080657G>C	uc003ika.3	-	7	570	c.432C>G	c.(430-432)TGC>TGG	p.C144W	OTUD4_uc003ijz.3_Missense_Mutation_p.C144W|OTUD4_uc003ikb.3_Missense_Mutation_p.C144W	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	209							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					ATTCTTACTTGCAACTGTCAT	0.303													80	177	---	---	---	---	PASS
EDNRA	1909	broad.mit.edu	37	4	148453689	148453689	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148453689C>T	uc003iky.2	+	4	1272	c.580C>T	c.(580-582)CAG>TAG	p.Q194*	EDNRA_uc011cid.1_5'UTR|EDNRA_uc010ipe.1_Missense_Mutation_p.S151L|EDNRA_uc010ipf.1_Intron|EDNRA_uc010ipg.1_Intron	NM_001957	NP_001948	P25101	EDNRA_HUMAN	endothelin receptor type A isoform a precursor	194	Cytoplasmic (Potential).				activation of adenylate cyclase activity|artery smooth muscle contraction|cell proliferation|glucose transport|respiratory gaseous exchange	integral to plasma membrane	endothelin-A receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)|breast(1)	2	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Bosentan(DB00559)	GAGTCGTGTTCAGGGAATTGG	0.408													65	234	---	---	---	---	PASS
SH3D19	152503	broad.mit.edu	37	4	152054354	152054354	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152054354C>A	uc010ipl.1	-	17	2840	c.1750G>T	c.(1750-1752)GGA>TGA	p.G584*	SH3D19_uc003imb.2_Nonsense_Mutation_p.G339*|SH3D19_uc003imc.2_Nonsense_Mutation_p.G525*|SH3D19_uc003ime.2_Nonsense_Mutation_p.G561*|SH3D19_uc010ipm.2_Nonsense_Mutation_p.G561*	NM_001009555	NP_001009555	Q5HYK7	SH319_HUMAN	SH3 domain containing 19 isoform a	584	SH3 3.				cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding			ovary(1)|skin(1)	2	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TTCTGCTCTCCAATATATTCA	0.388													4	133	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155249247	155249247	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155249247G>A	uc003inw.2	-	12	2651	c.2651C>T	c.(2650-2652)TCA>TTA	p.S884L	DCHS2_uc003inx.2_Missense_Mutation_p.S1339L	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	884	Cadherin 7.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AGTTTTACCTGAAGATACTGA	0.358													24	121	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155249256	155249256	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155249256G>C	uc003inw.2	-	12	2642	c.2642C>G	c.(2641-2643)TCA>TGA	p.S881*	DCHS2_uc003inx.2_Nonsense_Mutation_p.S1336*	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	881	Cadherin 7.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TGAAGATACTGAGTATGTAAC	0.358													24	141	---	---	---	---	PASS
FGB	2244	broad.mit.edu	37	4	155490729	155490729	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155490729T>C	uc003ioa.3	+	7	1061	c.1022T>C	c.(1021-1023)TTG>TCG	p.L341S	FGB_uc003iob.3_Intron|FGB_uc010ipv.2_Missense_Mutation_p.L279S|FGB_uc010ipw.2_Intron|FGB_uc003ioc.3_Missense_Mutation_p.L122S	NM_005141	NP_005132	P02675	FIBB_HUMAN	fibrinogen, beta chain preproprotein	341	Fibrinogen C-terminal.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen|soluble fraction	chaperone binding|eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	ACAGAACTTTTGATAGAAATG	0.368													49	71	---	---	---	---	PASS
C4orf45	152940	broad.mit.edu	37	4	159956200	159956200	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159956200G>C	uc003iqf.1	-	1	134	c.49C>G	c.(49-51)CAA>GAA	p.Q17E	C4orf45_uc010iqt.1_Intron	NM_152543	NP_689756	Q96LM5	CD045_HUMAN	hypothetical protein LOC152940	17											0						AAAATCATTTGTTTTCCCACA	0.328													20	24	---	---	---	---	PASS
GPM6A	2823	broad.mit.edu	37	4	176622910	176622910	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176622910C>G	uc003iuf.2	-	2	850	c.46G>C	c.(46-48)GAA>CAA	p.E16Q	GPM6A_uc011ckj.1_Missense_Mutation_p.E9Q|GPM6A_uc003iug.2_Missense_Mutation_p.E16Q|GPM6A_uc003iuh.2_Missense_Mutation_p.E5Q	NM_201591	NP_963885	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 2	16	Cytoplasmic (Potential).					cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		ATACAGCATTCAAAACACCCT	0.418													24	123	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177070988	177070988	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177070988C>G	uc003iuj.2	+	15	2156	c.2000C>G	c.(1999-2001)ACT>AGT	p.T667S	WDR17_uc003iuk.2_Missense_Mutation_p.T643S|WDR17_uc003ium.3_Missense_Mutation_p.T643S|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_5'Flank	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	667	WD 12.									ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CGCCCCTTCACTATGGCCTCT	0.383													11	291	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177070997	177070997	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177070997C>G	uc003iuj.2	+	15	2165	c.2009C>G	c.(2008-2010)TCT>TGT	p.S670C	WDR17_uc003iuk.2_Missense_Mutation_p.S646C|WDR17_uc003ium.3_Missense_Mutation_p.S646C|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_5'Flank	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	670	WD 12.									ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		ACTATGGCCTCTTGCTCCCGT	0.368													9	294	---	---	---	---	PASS
STOX2	56977	broad.mit.edu	37	4	184932482	184932482	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184932482G>C	uc003ivz.1	+	3	3926	c.2491G>C	c.(2491-2493)GAC>CAC	p.D831H	STOX2_uc003iwa.1_Missense_Mutation_p.D520H	NM_020225	NP_064610	Q9P2F5	STOX2_HUMAN	storkhead box 2	831					embryo development|maternal placenta development						0		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		AAAAGAAACCGACAGCAGCAG	0.557													9	36	---	---	---	---	PASS
KLKB1	3818	broad.mit.edu	37	4	187173216	187173216	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187173216C>G	uc003iyy.2	+	11	1261	c.1190C>G	c.(1189-1191)TCT>TGT	p.S397C	KLKB1_uc011clc.1_Missense_Mutation_p.S195C|KLKB1_uc011cld.1_Missense_Mutation_p.S359C	NM_000892	NP_000883	P03952	KLKB1_HUMAN	plasma kallikrein B1 precursor	397	Peptidase S1.				blood coagulation, intrinsic pathway|Factor XII activation|fibrinolysis|plasminogen activation|positive regulation of fibrinolysis	cytoplasm|extracellular space|plasma membrane	serine-type endopeptidase activity			ovary(1)	1		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		GGAACAAACTCTTCTTGGGGA	0.517													19	117	---	---	---	---	PASS
TRIML2	205860	broad.mit.edu	37	4	189020233	189020233	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189020233C>A	uc003izl.2	-	4	463	c.427G>T	c.(427-429)GAG>TAG	p.E143*	TRIML2_uc003izj.1_5'UTR|TRIML2_uc003izk.1_5'UTR|TRIML2_uc011cle.1_Nonsense_Mutation_p.E193*|TRIML2_uc011clf.1_Nonsense_Mutation_p.E193*	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	143	Potential.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		TTCTCAAGCTCCACGATGAGC	0.483													19	134	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5200278	5200278	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5200278G>T	uc003jdl.2	+	9	1485	c.1347G>T	c.(1345-1347)ATG>ATT	p.M449I	ADAMTS16_uc003jdk.1_Missense_Mutation_p.M449I|ADAMTS16_uc003jdj.1_Missense_Mutation_p.M449I	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	449	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						AAGGGAACATGTGCAAAAAGT	0.403													8	62	---	---	---	---	PASS
FLJ33360	401172	broad.mit.edu	37	5	6337260	6337260	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6337260C>T	uc003jdn.1	-							NM_001001702	NP_001001702			SubName: Full=FLJ33360 protein; SubName: Full=cDNA FLJ33360 fis, clone BRACE2005253;												0						GCAACAGACTCACCATCACGA	0.502													34	178	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7727363	7727363	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7727363C>A	uc003jdz.1	+	14	1927	c.1860C>A	c.(1858-1860)CTC>CTA	p.L620L	ADCY2_uc011cmo.1_Silent_p.L440L	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	620	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						TGCAGATTCTCGTGCTGCCAA	0.483													31	140	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7727364	7727364	+	Missense_Mutation	SNP	G	A	A	rs149172094		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7727364G>A	uc003jdz.1	+	14	1928	c.1861G>A	c.(1861-1863)GTG>ATG	p.V621M	ADCY2_uc011cmo.1_Missense_Mutation_p.V441M	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	621	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						GCAGATTCTCGTGCTGCCAAA	0.483													31	140	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7802487	7802487	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7802487G>C	uc003jdz.1	+						ADCY2_uc011cmo.1_Intron|ADCY2_uc010itm.1_Intron	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						TGTAGGTACTGAGAGTTGCCC	0.468													6	61	---	---	---	---	PASS
C5orf49	134121	broad.mit.edu	37	5	7835508	7835508	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7835508T>C	uc003jea.3	-	2	381	c.251A>G	c.(250-252)CAT>CGT	p.H84R		NM_001089584	NP_001083053	A4QMS7	CE049_HUMAN	hypothetical protein LOC134121	84											0						TTCGTTAACATGAAGTCCCAG	0.294													56	241	---	---	---	---	PASS
MTRR	4552	broad.mit.edu	37	5	7900156	7900156	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7900156G>C	uc003jed.2	+	15	2193	c.2163G>C	c.(2161-2163)CAG>CAC	p.Q721H	MTRR_uc003jee.3_Missense_Mutation_p.Q694H|MTRR_uc003jef.3_RNA|MTRR_uc003jeg.3_RNA|MTRR_uc010ito.2_RNA	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2	721					methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	GCTACCTTCAGGATATTTGGT	0.338													42	117	---	---	---	---	PASS
FAM173B	134145	broad.mit.edu	37	5	10236624	10236624	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10236624C>A	uc003jeo.2	-	3	439	c.410G>T	c.(409-411)GGA>GTA	p.G137V	FAM173B_uc003jep.2_RNA|FAM173B_uc010itr.2_Missense_Mutation_p.G137V	NM_199133	NP_954584	Q6P4H8	F173B_HUMAN	hypothetical protein LOC134145	137						integral to membrane				kidney(1)|central_nervous_system(1)	2						TTTGGCAGATCCATGCACACC	0.408													16	157	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11117664	11117664	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11117664G>A	uc003jfa.1	-	13	2320	c.2175C>T	c.(2173-2175)GCC>GCT	p.A725A	CTNND2_uc010itt.2_Silent_p.A634A|CTNND2_uc011cmy.1_Silent_p.A388A|CTNND2_uc011cmz.1_Silent_p.A292A|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Silent_p.A292A	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	725				A -> P (in Ref. 1; AAC63103).	multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						CCTCCTCTCCGGCCGAACTAA	0.527													35	107	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21765088	21765088	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21765088T>A	uc010iuc.2	-	9	1972	c.1514A>T	c.(1513-1515)CAG>CTG	p.Q505L	CDH12_uc011cno.1_Missense_Mutation_p.Q465L|CDH12_uc003jgk.2_Missense_Mutation_p.Q505L|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	505	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						ATAAGATACCTGTCCTGGCTT	0.338										HNSCC(59;0.17)			79	238	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	22078562	22078562	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22078562A>G	uc010iuc.2	-	2	682	c.224T>C	c.(223-225)GTG>GCG	p.V75A	CDH12_uc011cno.1_Missense_Mutation_p.V75A|CDH12_uc003jgk.2_Missense_Mutation_p.V75A	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	75	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						TACCTTTCCCACATACTGAGG	0.443										HNSCC(59;0.17)			42	114	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	22078567	22078567	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22078567C>A	uc010iuc.2	-	2	677	c.219G>T	c.(217-219)CAG>CAT	p.Q73H	CDH12_uc011cno.1_Missense_Mutation_p.Q73H|CDH12_uc003jgk.2_Missense_Mutation_p.Q73H	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	73	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						TTCCCACATACTGAGGCTCGG	0.448										HNSCC(59;0.17)			47	122	---	---	---	---	PASS
RNASEN	29102	broad.mit.edu	37	5	31468104	31468104	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31468104G>A	uc003jhg.2	-	17	2667	c.2308C>T	c.(2308-2310)CCG>TCG	p.P770S	RNASEN_uc003jhh.2_Missense_Mutation_p.P733S|RNASEN_uc003jhi.2_Missense_Mutation_p.P733S	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1	770	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						ACGATAATCGGAAAAGTAATC	0.428													10	35	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33684141	33684141	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33684141C>G	uc003jia.1	-	4	817	c.654G>C	c.(652-654)CAG>CAC	p.Q218H	ADAMTS12_uc010iuq.1_Missense_Mutation_p.Q218H	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	218					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						GCTCTTGCTTCTGGGAGATGT	0.458										HNSCC(64;0.19)			5	70	---	---	---	---	PASS
UGT3A2	167127	broad.mit.edu	37	5	36037942	36037942	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36037942C>A	uc003jjz.1	-	6	1345	c.1252G>T	c.(1252-1254)GAG>TAG	p.E418*	UGT3A2_uc011cos.1_Nonsense_Mutation_p.E384*|UGT3A2_uc011cot.1_Nonsense_Mutation_p.E116*	NM_174914	NP_777574	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	418	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCCAATGTCTCTGCCTTGAGC	0.443													47	358	---	---	---	---	PASS
SKP2	6502	broad.mit.edu	37	5	36168476	36168476	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36168476G>T	uc003jkc.1	+	5	780	c.598G>T	c.(598-600)GGC>TGC	p.G200C	SKP2_uc011cou.1_Intron|SKP2_uc003jkd.2_Missense_Mutation_p.G200C	NM_005983	NP_005974	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2 isoform 1	200	LRR 3.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|G1/S transition of mitotic cell cycle|S phase of mitotic cell cycle	nucleoplasm|SCF ubiquitin ligase complex	protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CACCCTCCACGGCATACTGTC	0.507													141	333	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	37048604	37048604	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37048604G>T	uc003jkl.3	+	39	7089	c.6590G>T	c.(6589-6591)GGA>GTA	p.G2197V	NIPBL_uc003jkk.3_Missense_Mutation_p.G2197V|NIPBL_uc003jkn.2_5'Flank	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	2197					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TCTCCCATAGGATTTGCCTTT	0.244													38	141	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37183312	37183312	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37183312G>C	uc011cpa.1	-	26	5202	c.4971C>G	c.(4969-4971)ATC>ATG	p.I1657M	C5orf42_uc011coy.1_Missense_Mutation_p.I158M|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.I732M|C5orf42_uc011cpb.1_Missense_Mutation_p.I538M	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	1657										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			AAAAAGGTTTGATCCCTTGAT	0.308													12	89	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37183337	37183337	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37183337G>A	uc011cpa.1	-	26	5177	c.4946C>T	c.(4945-4947)TCA>TTA	p.S1649L	C5orf42_uc011coy.1_Missense_Mutation_p.S150L|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.S724L|C5orf42_uc011cpb.1_Missense_Mutation_p.S530L	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	1649										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CAGTACTGATGATGAAAGTTT	0.333													13	104	---	---	---	---	PASS
GDNF	2668	broad.mit.edu	37	5	37816081	37816081	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37816081G>C	uc011cpi.1	-	3	508	c.308C>G	c.(307-309)TCC>TGC	p.S103C	GDNF_uc011cpc.1_Missense_Mutation_p.S25C|GDNF_uc011cpd.1_Missense_Mutation_p.S51C|GDNF_uc011cpe.1_Missense_Mutation_p.S77C|GDNF_uc011cpf.1_Missense_Mutation_p.S77C|GDNF_uc011cpg.1_Missense_Mutation_p.S120C|GDNF_uc011cph.1_Missense_Mutation_p.S94C	NM_000514	NP_000505	P39905	GDNF_HUMAN	glial cell derived neurotrophic factor isoform 1	103					adult locomotory behavior|anti-apoptosis|axon guidance|branching involved in ureteric bud morphogenesis|enteric nervous system development|mRNA stabilization|negative regulation of neuron apoptosis|neural crest cell migration|peristalsis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of dopamine secretion|positive regulation of monooxygenase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of ureteric bud formation|postganglionic parasympathetic nervous system development|regulation of dopamine uptake|signal transduction|sympathetic nervous system development	extracellular region	growth factor activity|protein homodimerization activity				0	all_lung(31;0.00118)					TTTTCCTCTGGAATTCTCTGG	0.493													29	167	---	---	---	---	PASS
OSMR	9180	broad.mit.edu	37	5	38921868	38921868	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38921868C>T	uc003jln.1	+	12	2104	c.1737C>T	c.(1735-1737)CCC>CCT	p.P579P	OSMR_uc011cpj.1_5'UTR	NM_003999	NP_003990	Q99650	OSMR_HUMAN	oncostatin M receptor precursor	579	Fibronectin type-III 3.|Extracellular (Potential).				cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_lung(31;0.000365)					ATGTAGGTCCCAATACCACAA	0.453													57	98	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40972703	40972703	+	Intron	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40972703G>T	uc003jmh.2	+						C7_uc011cpn.1_Intron	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor						complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				AAAGGTGAGTGGCTTCCATGT	0.507													33	201	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41051135	41051135	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41051135C>T	uc003jmj.3	-	13	1778	c.1288G>A	c.(1288-1290)GAA>AAA	p.E430K	HEATR7B2_uc003jmi.3_5'UTR	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	430	HEAT 5.						binding			ovary(6)|central_nervous_system(2)	8						AGGCTTGTTTCTCGGACAGAT	0.408													6	57	---	---	---	---	PASS
PAIP1	10605	broad.mit.edu	37	5	43547890	43547890	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43547890C>T	uc003job.2	-	3	808	c.561G>A	c.(559-561)CTG>CTA	p.L187L	PAIP1_uc003joa.2_Silent_p.L108L|PAIP1_uc010ivp.2_Silent_p.L108L|PAIP1_uc010ivo.2_RNA|PAIP1_uc003joc.2_Silent_p.L75L	NM_006451	NP_006442	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	187	MIF4G.				mRNA stabilization|nuclear-transcribed mRNA poly(A) tail shortening|translational initiation	cytosol	protein binding|RNA binding|translation activator activity			ovary(1)	1	Lung NSC(6;2.07e-05)					CACAACCATTCAGGGTCTCTG	0.388													63	158	---	---	---	---	PASS
MRPS30	10884	broad.mit.edu	37	5	44809298	44809298	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44809298G>A	uc003joh.2	+	1	272	c.234G>A	c.(232-234)GAG>GAA	p.E78E	MRPS30_uc003joi.1_5'Flank	NM_016640	NP_057724	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	78					apoptosis|translation	mitochondrion|ribosome	structural constituent of ribosome				0	Lung NSC(6;8.08e-07)					CGGTAGACGAGAAGCTGCGAA	0.597													4	21	---	---	---	---	PASS
MRPS30	10884	broad.mit.edu	37	5	44813255	44813255	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44813255C>T	uc003joh.2	+	4	939	c.901C>T	c.(901-903)CTG>TTG	p.L301L		NM_016640	NP_057724	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	301					apoptosis|translation	mitochondrion|ribosome	structural constituent of ribosome				0	Lung NSC(6;8.08e-07)					CCAGTTTCATCTGTTACCTGA	0.383													20	172	---	---	---	---	PASS
ACTBL2	345651	broad.mit.edu	37	5	56778368	56778368	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56778368C>G	uc003jrm.2	-	1	269	c.167G>C	c.(166-168)GGA>GCA	p.G56A		NM_001017992	NP_001017992	Q562R1	ACTBL_HUMAN	actin, beta-like 2	56						cytoplasm|cytoskeleton	ATP binding			ovary(3)	3		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		AGCCTCATCTCCCACGTAGCA	0.582													5	26	---	---	---	---	PASS
SFRS12	140890	broad.mit.edu	37	5	65449396	65449396	+	5'UTR	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65449396A>C	uc003juo.2	+	2					SFRS12_uc003jum.2_Missense_Mutation_p.R89S|SFRS12_uc003jun.2_Missense_Mutation_p.R89S|SFRS12_uc010iwy.2_5'UTR	NM_139168	NP_631907	Q8WXA9	SREK1_HUMAN	splicing factor, arginine/serine-rich 12 isoform						mRNA processing|RNA splicing	spliceosomal complex	nucleic acid binding|nucleotide binding|protein binding				0		Lung NSC(167;9.34e-06)|Prostate(74;0.00187)|Ovarian(174;0.0545)|Breast(144;0.0928)|Colorectal(97;0.234)		Lung(70;0.00449)		TTATTGACAGAGCTCTGATAG	0.408													62	277	---	---	---	---	PASS
PIK3R1	5295	broad.mit.edu	37	5	67592064	67592064	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67592064G>C	uc003jva.2	+	15	2440	c.1880G>C	c.(1879-1881)GGA>GCA	p.G627A	PIK3R1_uc003jvb.2_Missense_Mutation_p.G627A|PIK3R1_uc003jvc.2_Missense_Mutation_p.G327A|PIK3R1_uc003jvd.2_Missense_Mutation_p.G357A|PIK3R1_uc003jve.2_Missense_Mutation_p.G306A	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	627	SH2 2.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	TGGAATGTTGGAAGCAGCAAC	0.473			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			20	94	---	---	---	---	PASS
FAM169A	26049	broad.mit.edu	37	5	74134873	74134873	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74134873C>A	uc003kdm.2	-	4	278	c.235G>T	c.(235-237)GTG>TTG	p.V79L	FAM169A_uc010izm.2_Missense_Mutation_p.V79L|FAM169A_uc003kdl.2_5'UTR	NM_015566	NP_056381	Q9Y6X4	F169A_HUMAN	hypothetical protein LOC26049	79											0						TAAAGTGCCACAGCTAAAATA	0.333													52	181	---	---	---	---	PASS
RASGRF2	5924	broad.mit.edu	37	5	80408537	80408537	+	Silent	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80408537A>G	uc003kha.1	+	14	1947	c.1947A>G	c.(1945-1947)GAA>GAG	p.E649E	RASGRF2_uc011ctn.1_RNA	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine	649	N-terminal Ras-GEF.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		GCCTCTTGGAACGACTGACAG	0.488													70	251	---	---	---	---	PASS
XRCC4	7518	broad.mit.edu	37	5	82554407	82554407	+	Silent	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82554407A>T	uc003kib.2	+	7	932	c.804A>T	c.(802-804)CCA>CCT	p.P268P	XRCC4_uc003kia.1_Silent_p.P268P|XRCC4_uc003kid.2_Silent_p.P268P|XRCC4_uc003kic.2_Silent_p.P268P|XRCC4_uc003kie.2_Silent_p.P268P|XRCC4_uc003kif.1_Silent_p.P268P|XRCC4_uc003kig.2_RNA	NM_022406	NP_071801	Q13426	XRCC4_HUMAN	X-ray repair cross complementing protein 4	268					DNA ligation involved in DNA repair|double-strand break repair via nonhomologous end joining|initiation of viral infection|positive regulation of ligase activity|provirus integration|response to X-ray	cytosol|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|nucleoplasm	DNA binding|protein C-terminus binding			skin(3)	3		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		ATATTGCACCAAGTAGAAAAA	0.363								NHEJ					27	117	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82833254	82833254	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82833254G>C	uc003kii.3	+	8	4788	c.4432G>C	c.(4432-4434)GAA>CAA	p.E1478Q	VCAN_uc003kij.3_Missense_Mutation_p.E491Q|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Missense_Mutation_p.E142Q	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	1478	GAG-beta.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		TGAGTCTCTTGAAGTTACATG	0.423													27	75	---	---	---	---	PASS
POU5F2	134187	broad.mit.edu	37	5	93076968	93076968	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93076968G>A	uc003kkl.1	-	1	342	c.302C>T	c.(301-303)CCG>CTG	p.P101L	FAM172A_uc010jbd.2_Intron|FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron	NM_153216	NP_694948	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	101						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		GTAGGGCCCCGGGAGGGCGCC	0.637													12	43	---	---	---	---	PASS
ARSK	153642	broad.mit.edu	37	5	94903634	94903634	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94903634G>C	uc003kld.2	+	3	455	c.297G>C	c.(295-297)TGG>TGC	p.W99C	ARSK_uc010jbg.2_5'UTR|ARSK_uc011cum.1_RNA	NM_198150	NP_937793	Q6UWY0	ARSK_HUMAN	arylsulfatase K precursor	99						extracellular region	arylsulfatase activity|metal ion binding			pancreas(1)	1		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		CAGAATCTTGGAATAATTTTA	0.363													18	73	---	---	---	---	PASS
ELL2	22936	broad.mit.edu	37	5	95224604	95224604	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95224604C>T	uc003klr.3	-	12	2244	c.1894G>A	c.(1894-1896)GAC>AAC	p.D632N		NM_012081	NP_036213	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	632					regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		TGCTGTTGGTCAAATTCACCT	0.363													12	101	---	---	---	---	PASS
ELL2	22936	broad.mit.edu	37	5	95224673	95224673	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95224673C>A	uc003klr.3	-	12	2175	c.1825G>T	c.(1825-1827)GAA>TAA	p.E609*		NM_012081	NP_036213	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	609					regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		TATTTTTCTTCATGGTAATTG	0.348													11	49	---	---	---	---	PASS
CHD1	1105	broad.mit.edu	37	5	98262090	98262090	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98262090T>C	uc003knf.2	-	1	149	c.1A>G	c.(1-3)ATG>GTG	p.M1V		NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1	Ser-rich.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	TGTCCATTCATTGTAAATTAT	0.279													18	51	---	---	---	---	PASS
MCC	4163	broad.mit.edu	37	5	112487112	112487112	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112487112G>T	uc003kqj.3	-	2	595	c.65C>A	c.(64-66)TCA>TAA	p.S22*	MCC_uc003kqk.3_RNA|MCC_uc003kql.3_Nonsense_Mutation_p.S212*|MCC_uc011cwb.1_Nonsense_Mutation_p.S22*|MCC_uc010jcd.1_Intron	NM_002387	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 2	22					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		CAGGGCTGCTGAATGGAGCTG	0.413													19	41	---	---	---	---	PASS
KCNN2	3781	broad.mit.edu	37	5	113831614	113831614	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113831614T>A	uc003kqo.2	+	8	1932	c.1475T>A	c.(1474-1476)ATG>AAG	p.M492K	KCNN2_uc003kqp.2_Missense_Mutation_p.M144K|KCNN2_uc010jcg.2_RNA|uc003kqr.1_Intron	NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	492						integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		ATGTATGATATGATTTCTGAC	0.418													58	197	---	---	---	---	PASS
ZNF474	133923	broad.mit.edu	37	5	121487777	121487777	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121487777G>T	uc003ksv.2	+	2	468	c.92G>T	c.(91-93)GGG>GTG	p.G31V		NM_207317	NP_997200	Q6S9Z5	ZN474_HUMAN	zinc finger protein 474	31						intracellular	zinc ion binding				0		all_cancers(142;0.229)|Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)		AACCAAGCTGGGCTTCTCTCT	0.383													54	196	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127671680	127671680	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127671680C>G	uc003kuu.2	-	28	4163	c.3724G>C	c.(3724-3726)GAT>CAT	p.D1242H	FBN2_uc003kuv.2_Missense_Mutation_p.D1209H	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1242	EGF-like 19; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CTCCCCTTACCTGTACAGCCC	0.458													13	36	---	---	---	---	PASS
CAMLG	819	broad.mit.edu	37	5	134086449	134086449	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134086449A>T	uc003kzt.2	+	4	805	c.700A>T	c.(700-702)AGT>TGT	p.S234C	CAMLG_uc003kzu.2_Missense_Mutation_p.E80V	NM_001745	NP_001736	P49069	CAMLG_HUMAN	calcium modulating ligand	234	Extracellular (Potential).				defense response	endoplasmic reticulum|integral to membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Cyclosporine(DB00091)	CTCTACACAGAGTGAAAAGAA	0.358													13	62	---	---	---	---	PASS
DDX46	9879	broad.mit.edu	37	5	134131738	134131738	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134131738G>C	uc003kzw.2	+	15	2020	c.1852G>C	c.(1852-1854)GAG>CAG	p.E618Q	DDX46_uc003kzv.1_RNA	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	618	Helicase C-terminal.				mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCATTATCAAGAGTCAGGATC	0.348													6	118	---	---	---	---	PASS
TXNDC15	79770	broad.mit.edu	37	5	134223872	134223872	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134223872G>A	uc003lac.1	+	2	1249	c.591G>A	c.(589-591)CAG>CAA	p.Q197Q	TXNDC15_uc010jdy.1_Intron|TXNDC15_uc011cxv.1_RNA	NM_024715	NP_078991	Q96J42	TXD15_HUMAN	disulfide isomerase precursor	197	Extracellular (Potential).|Thioredoxin.				cell redox homeostasis	integral to membrane				ovary(1)|breast(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ATATGTCACAGGTAAGGAAAA	0.303													8	67	---	---	---	---	PASS
SLC4A9	83697	broad.mit.edu	37	5	139747319	139747319	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139747319C>G	uc003lfm.2	+	16	2297	c.2262C>G	c.(2260-2262)TTC>TTG	p.F754L	SLC4A9_uc003lfj.2_Missense_Mutation_p.F730L|SLC4A9_uc011czg.1_Missense_Mutation_p.F667L|SLC4A9_uc003lfl.2_Missense_Mutation_p.F730L|SLC4A9_uc003lfk.2_Missense_Mutation_p.F716L	NM_031467	NP_113655	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate	754	Membrane (anion exchange).					integral to membrane|plasma membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCTGGCTTCCACCTGGACC	0.587													3	45	---	---	---	---	PASS
ZMAT2	153527	broad.mit.edu	37	5	140080051	140080051	+	Silent	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140080051G>T	uc003lgy.1	+	1	20	c.6G>T	c.(4-6)GCG>GCT	p.A2A		NM_144723	NP_653324	Q96NC0	ZMAT2_HUMAN	zinc finger, matrin type 2	2						nucleus	DNA binding|zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAAGATGGCGTCGGGCAGCG	0.542													17	65	---	---	---	---	PASS
PCDHA3	56145	broad.mit.edu	37	5	140180824	140180824	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140180824G>C	uc003lhf.2	+	1	42	c.42G>C	c.(40-42)CTG>CTC	p.L14L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Silent_p.L14L	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	14					homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCAGTGCCTGCTGCTTTCTC	0.512													20	115	---	---	---	---	PASS
PCDHA9	9752	broad.mit.edu	37	5	140229714	140229714	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140229714T>C	uc003lhu.2	+	1	2358	c.1634T>C	c.(1633-1635)CTG>CCG	p.L545P	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Missense_Mutation_p.L545P	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	545	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			large_intestine(2)|ovary(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCCGCCTCTGGGCAGCAAC	0.682													17	97	---	---	---	---	PASS
PCDHB6	56130	broad.mit.edu	37	5	140530988	140530988	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140530988G>T	uc003lir.2	+	1	1150	c.1150G>T	c.(1150-1152)GAG>TAG	p.E384*	PCDHB6_uc011dah.1_Nonsense_Mutation_p.E248*	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	384	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTGTTCAATAGAGAACAATCT	0.463													21	168	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140553281	140553281	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140553281C>T	uc003lit.2	+	1	1039	c.865C>T	c.(865-867)CTC>TTC	p.L289F		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	289	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGAAAGAATTCTCAAAACGTT	0.418													32	140	---	---	---	---	PASS
PCDHB12	56124	broad.mit.edu	37	5	140588647	140588647	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140588647G>C	uc003liz.2	+	1	357	c.168G>C	c.(166-168)GTG>GTC	p.V56V	PCDHB12_uc011dak.1_Intron	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	56	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACTCGAGGTGAGTGAGCTGT	0.517													20	125	---	---	---	---	PASS
PCDHGA12	26025	broad.mit.edu	37	5	140811775	140811775	+	Missense_Mutation	SNP	G	C	C	rs150518735	byFrequency	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140811775G>C	uc003lkt.1	+	1	1618	c.1449G>C	c.(1447-1449)GAG>GAC	p.E483D	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_Missense_Mutation_p.E483D	NM_003735	NP_003726	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12 isoform 1	483	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTGTGAAGAGAACGCCCAGA	0.562													5	69	---	---	---	---	PASS
PCDHGC4	56098	broad.mit.edu	37	5	140866045	140866045	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140866045C>G	uc003lky.1	+	1	1305	c.1305C>G	c.(1303-1305)CTC>CTG	p.L435L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc011dbb.1_Silent_p.L435L|PCDHGC5_uc011dbc.1_5'Flank|PCDHGC5_uc003lla.1_5'Flank	NM_018928	NP_061751	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4 isoform 1	435	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCCTCCTCTCAGTACCCACA	0.468													29	129	---	---	---	---	PASS
SPINK5	11005	broad.mit.edu	37	5	147516558	147516558	+	3'UTR	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147516558G>T	uc003lox.2	+	33					SPINK5_uc003loy.2_3'UTR	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform						anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAATGACAGGAAGATTGTTG	0.388													7	321	---	---	---	---	PASS
AFAP1L1	134265	broad.mit.edu	37	5	148695757	148695757	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148695757G>C	uc003lqh.2	+	11	1289	c.1158G>C	c.(1156-1158)ATG>ATC	p.M386I	AFAP1L1_uc010jgy.2_Missense_Mutation_p.M386I|AFAP1L1_uc003lqi.1_Missense_Mutation_p.M1I	NM_152406	NP_689619	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	386							protein binding			breast(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGGCTCAATGAGCAGGGCTG	0.592													26	80	---	---	---	---	PASS
SYNPO	11346	broad.mit.edu	37	5	150028853	150028853	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150028853C>G	uc003lsn.2	+	3	2122	c.1748C>G	c.(1747-1749)TCA>TGA	p.S583*	SYNPO_uc003lso.3_Nonsense_Mutation_p.S339*|SYNPO_uc003lsp.2_Nonsense_Mutation_p.S339*	NM_001109974	NP_001103444	Q8N3V7	SYNPO_HUMAN	synaptopodin isoform B	583	PPxY motif.				positive regulation of actin filament bundle assembly|regulation of stress fiber assembly	actin cytoskeleton|cytoplasm|dendritic spine|perikaryon|postsynaptic density|postsynaptic membrane|tight junction	actin binding|protein binding			large_intestine(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCTCCTCCCTCATATTCTGTC	0.607													31	118	---	---	---	---	PASS
ZNF300	91975	broad.mit.edu	37	5	150275763	150275763	+	Silent	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150275763A>T	uc003lsy.1	-	6	1305	c.1038T>A	c.(1036-1038)GTT>GTA	p.V346V	IRGM_uc011dcl.1_Intron	NM_052860	NP_443092	Q96RE9	ZN300_HUMAN	zinc finger protein 300	346	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCCAGTGTGAACTCTCTGAT	0.413													37	146	---	---	---	---	PASS
TNIP1	10318	broad.mit.edu	37	5	150436437	150436437	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150436437C>T	uc003ltf.2	-	6	1106	c.517G>A	c.(517-519)GAG>AAG	p.E173K	TNIP1_uc010jhl.2_RNA|TNIP1_uc010jhm.2_Missense_Mutation_p.E173K|TNIP1_uc010jhn.2_Missense_Mutation_p.E173K|TNIP1_uc011dco.1_Missense_Mutation_p.E173K|TNIP1_uc003lth.2_RNA|TNIP1_uc003lti.2_Missense_Mutation_p.E173K|TNIP1_uc003ltg.2_Missense_Mutation_p.E120K|TNIP1_uc003ltj.2_Missense_Mutation_p.E173K|TNIP1_uc010jho.1_RNA|TNIP1_uc010jhq.1_Missense_Mutation_p.E120K|TNIP1_uc010jhp.1_Missense_Mutation_p.E120K|TNIP1_uc010jhr.1_Missense_Mutation_p.E173K|TNIP1_uc003ltk.2_Missense_Mutation_p.E173K	NM_006058	NP_006049	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	173	Interacts with Nef.				defense response|glycoprotein biosynthetic process|negative regulation of viral genome replication|translation	cytoplasm|nucleus	protein binding			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCGGCTCCTCGGCACACACA	0.667													10	60	---	---	---	---	PASS
CYFIP2	26999	broad.mit.edu	37	5	156787316	156787316	+	Silent	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156787316G>T	uc003lwq.2	+	27	2982	c.2844G>T	c.(2842-2844)GTG>GTT	p.V948V	CYFIP2_uc011ddn.1_Silent_p.V922V|CYFIP2_uc011ddo.1_Silent_p.V752V|CYFIP2_uc003lwr.2_Silent_p.V948V|CYFIP2_uc003lws.2_Silent_p.V948V|CYFIP2_uc003lwt.2_Silent_p.V851V|CYFIP2_uc011ddp.1_Silent_p.V682V	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2	973					apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCAGTATGTGAAAACACTGA	0.507													33	148	---	---	---	---	PASS
EBF1	1879	broad.mit.edu	37	5	158223456	158223456	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158223456G>C	uc010jip.2	-	9	1108	c.806C>G	c.(805-807)CCG>CGG	p.P269R	EBF1_uc011ddw.1_Missense_Mutation_p.P137R|EBF1_uc011ddx.1_Missense_Mutation_p.P270R|EBF1_uc003lxl.3_Missense_Mutation_p.P238R	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor	269	IPT/TIG.				multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCCTTCACTCGGGCTGATGGC	0.458			T	HMGA2	lipoma								16	46	---	---	---	---	PASS
STK10	6793	broad.mit.edu	37	5	171520427	171520427	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171520427G>C	uc003mbo.1	-	9	1843	c.1543C>G	c.(1543-1545)CTG>GTG	p.L515V		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	515							ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTGATGGACAGAGAGCCCATC	0.537													21	67	---	---	---	---	PASS
SH3PXD2B	285590	broad.mit.edu	37	5	171765617	171765617	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171765617T>C	uc003mbr.2	-	13	2663	c.2492A>G	c.(2491-2493)AAG>AGG	p.K831R		NM_001017995	NP_001017995	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	831					adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTCTCCAATCTTGCCGGTCCC	0.587													5	30	---	---	---	---	PASS
CDHR2	54825	broad.mit.edu	37	5	176001165	176001165	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176001165A>G	uc003mem.1	+	7	553	c.487A>G	c.(487-489)ATA>GTA	p.I163V	CDHR2_uc003men.1_Missense_Mutation_p.I163V	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor	163	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2						CGTGTACTCCATAGAGAAGGT	0.627											OREG0017077	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	29	---	---	---	---	PASS
FGFR4	2264	broad.mit.edu	37	5	176520456	176520456	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176520456G>A	uc003mfl.2	+	10	1468	c.1301G>A	c.(1300-1302)CGA>CAA	p.R434Q	FGFR4_uc003mfm.2_Missense_Mutation_p.R434Q|FGFR4_uc011dfu.1_Missense_Mutation_p.E383K|FGFR4_uc003mfo.2_Missense_Mutation_p.R394Q	NM_002011	NP_002002	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4 isoform 1	434	Cytoplasmic (Potential).				insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity			lung(11)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|prostate(1)	16	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)	TCCCTGGTACGAGGCGTGCGT	0.617										TSP Lung(9;0.080)			38	113	---	---	---	---	PASS
RUFY1	80230	broad.mit.edu	37	5	179016623	179016623	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179016623G>A	uc003mka.1	+	9	1103	c.1103G>A	c.(1102-1104)CGA>CAA	p.R368Q	RUFY1_uc003mkb.1_Missense_Mutation_p.R260Q|RUFY1_uc003mkc.1_Missense_Mutation_p.R260Q|RUFY1_uc003mkd.1_5'Flank	NM_025158	NP_079434	Q96T51	RUFY1_HUMAN	RUN and FYVE domain-containing 1 isoform a	368	Potential.				endocytosis|protein transport	early endosome membrane	lipid binding|zinc ion binding			ovary(4)|breast(1)	5	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAATTAATTCGAGAAAGAAGT	0.388										HNSCC(44;0.11)			16	86	---	---	---	---	PASS
MAML1	9794	broad.mit.edu	37	5	179201470	179201470	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179201470C>G	uc003mkm.2	+	5	2906	c.2643C>G	c.(2641-2643)TTC>TTG	p.F881L	MAML1_uc003mkn.1_Intron	NM_014757	NP_055572	Q92585	MAML1_HUMAN	mastermind-like 1	881					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	peptide antigen binding|protein kinase binding|transcription coactivator activity			lung(4)|ovary(2)	6	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCCGCAATTCTCCCAGGCAG	0.627													14	42	---	---	---	---	PASS
DUSP22	56940	broad.mit.edu	37	6	311868	311868	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:311868C>G	uc003msx.2	+						DUSP22_uc011dhn.1_Intron|DUSP22_uc003msy.1_Intron	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22						apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		CATCCCCTTTCTTCTCTGACA	0.403													4	79	---	---	---	---	PASS
FOXF2	2295	broad.mit.edu	37	6	1390815	1390815	+	Silent	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1390815G>T	uc003mtm.2	+	1	747	c.633G>T	c.(631-633)GTG>GTT	p.V211V	FOXF2_uc003mtn.2_Silent_p.V211V	NM_001452	NP_001443	Q12947	FOXF2_HUMAN	forkhead box F2	211					epithelial to mesenchymal transition|genitalia development|palate development|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding				0	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)		ACCGCGTGGTGAGCGGCTTGG	0.736													5	53	---	---	---	---	PASS
SERPINB9	5272	broad.mit.edu	37	6	2890510	2890510	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2890510C>G	uc003mug.2	-	7	1139	c.1018G>C	c.(1018-1020)GAG>CAG	p.E340Q	uc003mue.2_Intron|SERPINB9_uc003muf.2_Missense_Mutation_p.E143Q	NM_004155	NP_004146	P50453	SPB9_HUMAN	serpin peptidase inhibitor, clade B, member 9	340		Reactive bond (By similarity).			anti-apoptosis|cellular response to estrogen stimulus|immune response|mast cell mediated immunity|regulation of proteolysis	cytosol|extracellular space|nucleus	caspase inhibitor activity|protease binding|serine-type endopeptidase inhibitor activity				0	Ovarian(93;0.0412)	all_hematologic(90;0.108)				ATGCAGCACTCTGCAACTACA	0.532													24	102	---	---	---	---	PASS
PRPF4B	8899	broad.mit.edu	37	6	4044260	4044260	+	Intron	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4044260G>T	uc003mvv.2	+						PRPF4B_uc003mvw.2_Intron|PRPF4B_uc011dhv.1_Intron	NM_003913	NP_003904	Q13523	PRP4B_HUMAN	serine/threonine-protein kinase PRP4K							catalytic step 2 spliceosome	ATP binding|protein binding|protein serine/threonine kinase activity			breast(5)	5	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				GAATAATGGTGAGAGAGTTTT	0.378													16	98	---	---	---	---	PASS
FARS2	10667	broad.mit.edu	37	6	5431349	5431349	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5431349G>A	uc010jnv.1	+	4	1184	c.848G>A	c.(847-849)GGA>GAA	p.G283E	FARS2_uc003mwr.2_Missense_Mutation_p.G283E|FARS2_uc003mws.1_Missense_Mutation_p.G283E	NM_006567	NP_006558	O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2 precursor	283					phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	AACTTTCATGGAGAATGGCTG	0.418													53	257	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7584134	7584134	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7584134C>G	uc003mxp.1	+	24	6918	c.6639C>G	c.(6637-6639)ATC>ATG	p.I2213M	DSP_uc003mxq.1_Missense_Mutation_p.I1614M	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	2213	Plectin 6.|Globular 2.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TCCAAGGAATCAGACAACCTG	0.468													13	127	---	---	---	---	PASS
GCM2	9247	broad.mit.edu	37	6	10877569	10877569	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10877569G>C	uc003mzn.3	-	2	219	c.147C>G	c.(145-147)ATC>ATG	p.I49M	SYCP2L_uc011dim.1_Intron	NM_004752	NP_004743	O75603	GCM2_HUMAN	glial cells missing homolog 2	49	GCM.				cellular calcium ion homeostasis|cellular phosphate ion homeostasis|parathyroid gland development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				CGCTGCTGTAGATGAAGCGCA	0.567													9	98	---	---	---	---	PASS
SOX4	6659	broad.mit.edu	37	6	21595968	21595968	+	Missense_Mutation	SNP	C	G	G	rs145209759	byFrequency	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21595968C>G	uc003ndi.2	+	1	1997	c.1203C>G	c.(1201-1203)TTC>TTG	p.F401L		NM_003107	NP_003098	Q06945	SOX4_HUMAN	SRY (sex determining region Y)-box 4	401					canonical Wnt receptor signaling pathway|cardiac ventricle formation|cellular response to glucose stimulus|DNA damage response, detection of DNA damage|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|glial cell development|glial cell proliferation|limb bud formation|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein export from nucleus|negative regulation of protein ubiquitination|neural tube formation|neuroepithelial cell differentiation|noradrenergic neuron differentiation|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|positive regulation of insulin secretion|positive regulation of N-terminal peptidyl-lysine acetylation|positive regulation of translation|pro-B cell differentiation|protein stabilization|skeletal system development|spinal cord motor neuron differentiation|sympathetic nervous system development|T cell differentiation	mitochondrion|nucleus	core promoter sequence-specific DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|RNA polymerase II transcription coactivator activity				0	Ovarian(93;0.163)		all cancers(50;0.0751)|Epithelial(50;0.155)			ACGACGAGTTCGAAGACGACC	0.463													22	10	---	---	---	---	PASS
FAM65B	9750	broad.mit.edu	37	6	24848350	24848350	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24848350G>C	uc003neo.1	-	12	1156	c.980C>G	c.(979-981)TCA>TGA	p.S327*	FAM65B_uc011djs.1_Nonsense_Mutation_p.S356*|FAM65B_uc011dju.1_Nonsense_Mutation_p.S361*|FAM65B_uc003nep.2_Nonsense_Mutation_p.S327*|FAM65B_uc011djt.1_Nonsense_Mutation_p.S327*	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN	hypothetical protein LOC9750 isoform 1	327					cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1						CCCAGCGCCTGAGGATGCGGT	0.527													5	42	---	---	---	---	PASS
HIST1H1E	3008	broad.mit.edu	37	6	26156617	26156617	+	5'UTR	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26156617A>G	uc003ngq.2	+	1					HIST1H2BD_uc003ngr.2_5'Flank|HIST1H2BD_uc003ngs.2_5'Flank	NM_005321	NP_005312	P10412	H14_HUMAN	histone cluster 1, H1e						nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			large_intestine(1)|ovary(1)	2						CTTGCCTTCAACATGTCCGAG	0.682													15	108	---	---	---	---	PASS
HIST1H1E	3008	broad.mit.edu	37	6	26157146	26157146	+	Silent	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26157146G>T	uc003ngq.2	+	1	588	c.528G>T	c.(526-528)GCG>GCT	p.A176A	HIST1H2BD_uc003ngr.2_5'Flank|HIST1H2BD_uc003ngs.2_5'Flank	NM_005321	NP_005312	P10412	H14_HUMAN	histone cluster 1, H1e	176					nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			large_intestine(1)|ovary(1)	2						CGAAAAAGGCGAAAGCAGCCA	0.587													5	26	---	---	---	---	PASS
HIST1H2BD	3017	broad.mit.edu	37	6	26158469	26158469	+	Silent	SNP	G	A	A	rs145666937	byFrequency	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26158469G>A	uc003ngr.2	+	1	121	c.72G>A	c.(70-72)AAG>AAA	p.K24K	HIST1H2BD_uc003ngs.2_Silent_p.K24K	NM_021063	NP_066407	P58876	H2B1D_HUMAN	histone cluster 1, H2bd	24					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)|pancreas(1)	2						AGGCTCAGAAGAAGGACGGGA	0.537													42	229	---	---	---	---	PASS
HIST1H3D	8351	broad.mit.edu	37	6	26197163	26197163	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26197163C>G	uc003ngv.2	-	2	713	c.316G>C	c.(316-318)GAG>CAG	p.E106Q	HIST1H2BF_uc003ngx.2_5'Flank	NM_003530	NP_003521	P68431	H31_HUMAN	histone cluster 1, H3d	106					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0		all_hematologic(11;0.196)				TTGGTGTCCTCAAACAGCCCC	0.592													51	62	---	---	---	---	PASS
HIST1H3D	8351	broad.mit.edu	37	6	26197472	26197472	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26197472G>C	uc003ngv.2	-	2	404	c.7C>G	c.(7-9)CGT>GGT	p.R3G	HIST1H2BF_uc003ngx.2_5'Flank	NM_003530	NP_003521	P68431	H31_HUMAN	histone cluster 1, H3d	3					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0		all_hematologic(11;0.196)				TGCTTGGTACGAGCCATTGCG	0.542													11	84	---	---	---	---	PASS
BTN2A1	11120	broad.mit.edu	37	6	26465625	26465625	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26465625C>G	uc003nib.1	+	5	1137	c.925C>G	c.(925-927)CAA>GAA	p.Q309E	BTN2A1_uc003nic.1_Missense_Mutation_p.Q309E|BTN2A1_uc003nid.1_Missense_Mutation_p.Q157E|BTN2A1_uc011dko.1_Missense_Mutation_p.Q248E|BTN2A1_uc010jqk.1_Missense_Mutation_p.Q69E	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1	309	Cytoplasmic (Potential).				lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						GGAAGAACTTCAAGTAAAAGG	0.219													12	131	---	---	---	---	PASS
PRSS16	10279	broad.mit.edu	37	6	27216714	27216714	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27216714C>T	uc003nja.2	+	3	338	c.326C>T	c.(325-327)TCA>TTA	p.S109L	PRSS16_uc011dkt.1_RNA|PRSS16_uc003njb.2_Intron|PRSS16_uc010jqq.1_5'UTR|PRSS16_uc010jqr.1_5'UTR|PRSS16_uc003njc.1_RNA|PRSS16_uc003njd.2_5'Flank	NM_005865	NP_005856	Q9NQE7	TSSP_HUMAN	protease, serine, 16 precursor	109					protein catabolic process|proteolysis	cytoplasmic membrane-bounded vesicle	serine-type peptidase activity			ovary(2)|central_nervous_system(2)|skin(1)	5						GGGCCTGGCTCAGTGATGAGA	0.567													37	127	---	---	---	---	PASS
ZNF184	7738	broad.mit.edu	37	6	27420473	27420473	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27420473C>T	uc003njj.2	-	5	1676	c.865G>A	c.(865-867)GAG>AAG	p.E289K	ZNF184_uc010jqv.2_Missense_Mutation_p.E289K|ZNF184_uc003nji.2_Missense_Mutation_p.E289K	NM_007149	NP_009080	Q99676	ZN184_HUMAN	zinc finger protein 184	289	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GATGGACCCTCAATGAAGCCT	0.378													40	175	---	---	---	---	PASS
OR2B3	442184	broad.mit.edu	37	6	29054830	29054830	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29054830G>C	uc003nlx.2	-	1	261	c.196C>G	c.(196-198)CTC>GTC	p.L66V		NM_001005226	NP_001005226			olfactory receptor, family 2, subfamily B,											skin(1)	1						AAGATGGAGAGATTAGTGAGA	0.403													22	196	---	---	---	---	PASS
OR14J1	442191	broad.mit.edu	37	6	29274746	29274746	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29274746C>G	uc011dln.1	+	1	280	c.280C>G	c.(280-282)CAG>GAG	p.Q94E		NM_030946	NP_112208	Q9UGF5	O14J1_HUMAN	olfactory receptor, family 5, subfamily U member	94	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TTCTCTTGTTCAGTGCATTCT	0.458													6	438	---	---	---	---	PASS
OR14J1	442191	broad.mit.edu	37	6	29275385	29275385	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29275385G>C	uc011dln.1	+	1	919	c.919G>C	c.(919-921)GAG>CAG	p.E307Q		NM_030946	NP_112208	Q9UGF5	O14J1_HUMAN	olfactory receptor, family 5, subfamily U member	307	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GTCAAAGGAAGAGCTTCCTCA	0.294													53	138	---	---	---	---	PASS
TRIM40	135644	broad.mit.edu	37	6	30104956	30104956	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30104956C>G	uc003npk.2	+	2	529	c.143C>G	c.(142-144)TCT>TGT	p.S48C	TRIM40_uc003npl.1_RNA|TRIM40_uc003npm.2_Missense_Mutation_p.S48C	NM_138700	NP_619645	Q6P9F5	TRI40_HUMAN	tripartite motif-containing 40	48	RING-type.					intracellular	zinc ion binding			ovary(1)	1						GCCTCAGCCTCTGGGGTCTTC	0.607													14	89	---	---	---	---	PASS
TRIM40	135644	broad.mit.edu	37	6	30105078	30105078	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30105078C>T	uc003npk.2	+	2	651	c.265C>T	c.(265-267)CTA>TTA	p.L89L	TRIM40_uc003npl.1_RNA|TRIM40_uc003npm.2_Silent_p.L89L	NM_138700	NP_619645	Q6P9F5	TRI40_HUMAN	tripartite motif-containing 40	89	B box-type.					intracellular	zinc ion binding			ovary(1)	1						CAGACTTCTTCTATGTGTGGA	0.542													34	221	---	---	---	---	PASS
GNL1	2794	broad.mit.edu	37	6	30523492	30523492	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30523492G>C	uc003nqh.2	-	2	1107	c.79C>G	c.(79-81)CAA>GAA	p.Q27E	GNL1_uc011dmi.1_5'UTR|GNL1_uc011dmj.1_Missense_Mutation_p.Q25E|GNL1_uc011dmk.1_Intron|PRR3_uc003nqi.1_5'Flank|PRR3_uc003nqj.1_5'Flank	NM_005275	NP_005266	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	27					response to DNA damage stimulus|signal transduction|T cell mediated immunity	extracellular space|intracellular	GTP binding|structural molecule activity			ovary(3)	3						AGCCCATCTTGAAGCCCTGCG	0.652													10	71	---	---	---	---	PASS
DHX16	8449	broad.mit.edu	37	6	30624726	30624726	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30624726G>C	uc003nqz.2	-						DHX16_uc003nqy.2_Intron|DHX16_uc011dmo.1_Intron	NM_003587	NP_003578	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16						mRNA processing|RNA splicing	nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity			ovary(2)|kidney(2)	4						TCCCCAGGCTGACCTTGCTGC	0.587													18	175	---	---	---	---	PASS
TCF19	6941	broad.mit.edu	37	6	31129585	31129585	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31129585G>C	uc003nss.2	+	3	1124	c.600G>C	c.(598-600)AAG>AAC	p.K200N	TCF19_uc003nst.2_Missense_Mutation_p.K200N	NM_001077511	NP_001070979	Q9Y242	TCF19_HUMAN	transcription factor 19	200	Pro-rich.				cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GTGGACCAAAGAGCCTGCCTG	0.622													4	36	---	---	---	---	PASS
BAT2	7916	broad.mit.edu	37	6	31593854	31593854	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31593854G>T	uc003nvb.3	+	9	1146	c.897G>T	c.(895-897)GAG>GAT	p.E299D	BAT2_uc011dnv.1_RNA|BAT2_uc003nvc.3_Missense_Mutation_p.E299D|BAT2_uc003nve.2_3'UTR	NM_080686	NP_542417	P48634	PRC2A_HUMAN	HLA-B associated transcript-2	299	1-3.|4 X 57 AA type A repeats.					cytoplasm|nucleus	protein binding				0						GCTTAGTAGAGCCTGTGGGTC	0.473													6	123	---	---	---	---	PASS
BAT2	7916	broad.mit.edu	37	6	31599685	31599685	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31599685C>T	uc003nvb.3	+	16	3484	c.3235C>T	c.(3235-3237)CCC>TCC	p.P1079S	BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Missense_Mutation_p.P1079S	NM_080686	NP_542417	P48634	PRC2A_HUMAN	HLA-B associated transcript-2	1079	4 X 57 AA type A repeats.					cytoplasm|nucleus	protein binding				0						CCCTCCTGCTCCCCGAGGCCG	0.657													6	35	---	---	---	---	PASS
NEU1	4758	broad.mit.edu	37	6	31829147	31829147	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31829147C>T	uc003nxq.3	-	3	589	c.433G>A	c.(433-435)GAT>AAT	p.D145N	NEU1_uc010jtg.2_RNA|NEU1_uc003nxr.3_RNA|NEU1_uc010jth.2_5'UTR|NEU1_uc003nxs.3_Missense_Mutation_p.D145N	NM_000434	NP_000425	Q99519	NEUR1_HUMAN	neuraminidase precursor	145						cytoplasmic membrane-bounded vesicle|lysosomal lumen|lysosomal membrane|plasma membrane	exo-alpha-sialidase activity|protein binding			ovary(1)	1					Oseltamivir(DB00198)|Zanamivir(DB00558)	GTCTCAACATCGCTCACTACT	0.512													8	128	---	---	---	---	PASS
C4A	720	broad.mit.edu	37	6	31996957	31996957	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31996957C>G	uc011dpd.1	+	28	3569	c.3518C>G	c.(3517-3519)TCA>TGA	p.S1173*	C4A_uc011dpe.1_Nonsense_Mutation_p.S1173*	NM_007293	NP_009224	P0C0L4	CO4A_HUMAN	complement component 4A preproprotein	1173					complement activation, classical pathway|inflammatory response|innate immune response	extracellular space	endopeptidase inhibitor activity				0						GCCTCCATCTCAAAGGCAAGC	0.612													36	261	---	---	---	---	PASS
C6orf81	221481	broad.mit.edu	37	6	35715427	35715427	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35715427G>A	uc003ola.2	+						C6orf81_uc003olb.1_Intron	NM_145028	NP_659465	Q5T9G4	CF081_HUMAN	hypothetical protein LOC221481								binding			ovary(1)	1						ACTGCCAGGTGAGAAAGAAAT	0.458													21	202	---	---	---	---	PASS
MAPK14	1432	broad.mit.edu	37	6	36041850	36041850	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36041850G>A	uc003olp.2	+	6	953	c.472G>A	c.(472-474)GTG>ATG	p.V158M	MAPK14_uc011dth.1_Missense_Mutation_p.V158M|MAPK14_uc003olo.2_Missense_Mutation_p.V158M|MAPK14_uc003olq.2_Missense_Mutation_p.V158M|MAPK14_uc003olr.2_Missense_Mutation_p.V158M|MAPK14_uc011dti.1_Missense_Mutation_p.V81M	NM_001315	NP_001306	Q16539	MK14_HUMAN	mitogen-activated protein kinase 14 isoform 1	158	Protein kinase.				activation of MAPK activity|cellular component movement|cellular response to ionizing radiation|chemotaxis|innate immune response|mRNA metabolic process|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of muscle cell differentiation|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|signal transduction in response to DNA damage|stress-activated MAPK cascade|stress-induced premature senescence|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|MAP kinase kinase activity|protein binding			ovary(2)|stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	6						TAATCTAGCTGTGAATGAAGA	0.378													68	127	---	---	---	---	PASS
C6orf89	221477	broad.mit.edu	37	6	36870107	36870107	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36870107C>A	uc003omx.2	+	4	584	c.300C>A	c.(298-300)CTC>CTA	p.L100L	C6orf89_uc003omv.2_5'UTR|C6orf89_uc003omw.2_Silent_p.L107L|C6orf89_uc011dtr.1_5'UTR	NM_152734	NP_689947	Q6UWU4	CF089_HUMAN	hypothetical protein LOC221477	100						integral to membrane				ovary(1)	1						GGCGCTCACTCATCCATCACA	0.493													11	259	---	---	---	---	PASS
PI16	221476	broad.mit.edu	37	6	36922627	36922627	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36922627G>T	uc003ona.2	+	1	419	c.91G>T	c.(91-93)GAG>TAG	p.E31*	PI16_uc003omz.1_Nonsense_Mutation_p.E31*|PI16_uc003onb.2_Nonsense_Mutation_p.E31*	NM_153370	NP_699201	Q6UXB8	PI16_HUMAN	protease inhibitor 16 precursor	31	Extracellular (Potential).					extracellular region|integral to membrane	peptidase inhibitor activity				0						CCTCACAGATGAGGAGAAACG	0.512													6	93	---	---	---	---	PASS
RNF8	9025	broad.mit.edu	37	6	37344705	37344705	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37344705G>C	uc003onq.3	+	6	1325	c.1132G>C	c.(1132-1134)GAG>CAG	p.E378Q	RNF8_uc003onr.3_Missense_Mutation_p.E378Q|RNF8_uc011dtx.1_Missense_Mutation_p.E310Q	NM_003958	NP_003949	O76064	RNF8_HUMAN	ring finger protein 8 isoform 1	378					cell division|double-strand break repair|histone H2A ubiquitination|histone H2B ubiquitination|mitosis|positive regulation of DNA repair|response to ionizing radiation	midbody|nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1						CTTGCAGGAAGAGAAGGAGAA	0.403													13	107	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38850814	38850814	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38850814G>T	uc003ooe.1	+	52	7936	c.7336G>T	c.(7336-7338)GCA>TCA	p.A2446S		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						AGACACCATTGCAAAACAACA	0.328													78	251	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38866091	38866091	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38866091G>C	uc003ooe.1	+	59	8947	c.8347G>C	c.(8347-8349)GAA>CAA	p.E2783Q		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						ACAGTTCAATGAAATCATTAG	0.328													44	324	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38883047	38883047	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38883047A>T	uc003ooe.1	+	66	9983	c.9383A>T	c.(9382-9384)GAC>GTC	p.D3128V	uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GAGGTAAAGGACAAAGCCCAA	0.418													37	57	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38942315	38942315	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38942315G>C	uc003ooe.1	+						DNAH8_uc003oog.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GGTAACTGCAGAAAGCAGTTT	0.468													21	175	---	---	---	---	PASS
LRFN2	57497	broad.mit.edu	37	6	40399929	40399929	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40399929G>A	uc003oph.1	-	2	1389	c.924C>T	c.(922-924)CTC>CTT	p.L308L		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	308	Extracellular (Potential).|Ig-like.					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTTTGCACTTGAGTGTGGCCG	0.597													19	94	---	---	---	---	PASS
PGC	5225	broad.mit.edu	37	6	41704736	41704736	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41704736C>A	uc003ora.1	-	9	1070	c.1021G>T	c.(1021-1023)GGC>TGC	p.G341C	TFEB_uc003oqs.1_5'Flank|TFEB_uc003oqt.1_5'Flank|TFEB_uc003oqu.1_5'Flank|TFEB_uc010jxq.1_5'Flank	NM_002630	NP_002621	P20142	PEPC_HUMAN	progastricsin (pepsinogen C) precursor	341					digestion|proteolysis	extracellular space	aspartic-type endopeptidase activity				0	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			GTGCAGTAGCCGTTGTTCTGC	0.378													3	35	---	---	---	---	PASS
TRERF1	55809	broad.mit.edu	37	6	42237280	42237280	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42237280C>G	uc003osd.2	-	5	612	c.49G>C	c.(49-51)GAG>CAG	p.E17Q	TRERF1_uc011duq.1_Missense_Mutation_p.E17Q|TRERF1_uc003osb.2_5'UTR|TRERF1_uc003osc.2_5'UTR|TRERF1_uc003ose.2_Missense_Mutation_p.E17Q|TRERF1_uc010jxu.1_RNA	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	17					cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			AAAAGGTTCTCACTACCATGG	0.527													14	140	---	---	---	---	PASS
SRF	6722	broad.mit.edu	37	6	43143550	43143550	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43143550C>G	uc003oui.2	+	3	1362	c.887C>G	c.(886-888)TCC>TGC	p.S296C	SRF_uc011dvf.1_Missense_Mutation_p.S92C	NM_003131	NP_003122	P11831	SRF_HUMAN	serum response factor (c-fos serum response	296					angiogenesis involved in wound healing|cell migration involved in sprouting angiogenesis|cellular senescence|heart looping|muscle cell homeostasis|neuron development|positive regulation of cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription via serum response element binding|regulation of smooth muscle cell differentiation|response to cytokine stimulus|response to hormone stimulus|response to toxin|transcription from RNA polymerase II promoter|trophectodermal cell differentiation	endoplasmic reticulum	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|serum response element binding|transcription factor binding			ovary(1)|breast(1)|central_nervous_system(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.011)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			AGCGGCCCCTCCTTTCCCATC	0.592													34	187	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43153205	43153205	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43153205C>G	uc003ouk.2	+	3	682	c.607C>G	c.(607-609)CAC>GAC	p.H203D	CUL9_uc003ouj.1_Missense_Mutation_p.H203D|CUL9_uc003oul.2_Missense_Mutation_p.H203D|CUL9_uc010jyk.2_5'UTR|CUL9_uc003oum.1_5'Flank	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	203					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						GAGTCGGGCTCACGTCCTTCT	0.488													14	88	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43153813	43153813	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43153813A>G	uc003ouk.2	+	4	946	c.871A>G	c.(871-873)AGA>GGA	p.R291G	CUL9_uc003ouj.1_Missense_Mutation_p.R291G|CUL9_uc003oul.2_Missense_Mutation_p.R291G|CUL9_uc010jyk.2_5'UTR|CUL9_uc003oum.1_5'Flank	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	291					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						ATGTGCCACAAGAGAGAAAAG	0.592													32	131	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43400778	43400778	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43400778C>A	uc003ouy.1	+	3	1275	c.1060C>A	c.(1060-1062)CAG>AAG	p.Q354K	ABCC10_uc003ouz.1_Missense_Mutation_p.Q311K|ABCC10_uc010jyo.1_5'Flank	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	354	ABC transmembrane type-1 1.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	p.Q311*(1)		ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			GGTAACACTTCAGGCACGGGG	0.592													8	191	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43417159	43417159	+	Splice_Site	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43417159G>C	uc003ouy.1	+	21	4419	c.4204_splice	c.e21-1	p.I1402_splice	ABCC10_uc003ouz.1_Splice_Site_p.I1374_splice|ABCC10_uc010jyo.1_Splice_Site_p.I508_splice	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10							integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CCATATTCCAGATCCTGTGTA	0.567													9	140	---	---	---	---	PASS
TJAP1	93643	broad.mit.edu	37	6	43473279	43473279	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43473279G>C	uc003ovd.2	+	11	1736	c.1360G>C	c.(1360-1362)GAT>CAT	p.D454H	TJAP1_uc003ovf.2_Missense_Mutation_p.D444H|TJAP1_uc003ove.2_Missense_Mutation_p.D444H|TJAP1_uc003ovc.2_Missense_Mutation_p.D444H|TJAP1_uc010jyp.2_Missense_Mutation_p.D413H|TJAP1_uc011dvh.1_Missense_Mutation_p.D444H|TJAP1_uc003ovg.2_Missense_Mutation_p.D320H|TJAP1_uc011dvi.1_Missense_Mutation_p.D454H|TJAP1_uc011dvj.1_Missense_Mutation_p.D254H|TJAP1_uc003ovi.2_Missense_Mutation_p.D320H	NM_001146016	NP_001139488	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 isoform a	454						Golgi apparatus|tight junction	protein binding				0	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CGCTGACAGAGATGAGGTGGT	0.607													16	250	---	---	---	---	PASS
TMEM63B	55362	broad.mit.edu	37	6	44107446	44107446	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44107446G>C	uc003owr.2	+	8	616	c.552G>C	c.(550-552)GAG>GAC	p.E184D	TMEM63B_uc003owq.1_Missense_Mutation_p.E184D|TMEM63B_uc010jyy.1_Missense_Mutation_p.E87D|TMEM63B_uc003ows.2_Missense_Mutation_p.E87D|TMEM63B_uc010jyz.2_RNA	NM_018426	NP_060896	Q5T3F8	TM63B_HUMAN	transmembrane protein 63B	184						integral to membrane	nucleotide binding|protein binding			pancreas(2)|central_nervous_system(1)	3	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			ACCCCACAGAGAACAATGCCT	0.592													7	280	---	---	---	---	PASS
TMEM63B	55362	broad.mit.edu	37	6	44116030	44116030	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44116030G>A	uc003owr.2	+	13	1093	c.1029G>A	c.(1027-1029)CTG>CTA	p.L343L	TMEM63B_uc003owq.1_Silent_p.L343L|TMEM63B_uc003ows.2_Silent_p.L246L|TMEM63B_uc010jyz.2_RNA	NM_018426	NP_060896	Q5T3F8	TM63B_HUMAN	transmembrane protein 63B	343						integral to membrane	nucleotide binding|protein binding			pancreas(2)|central_nervous_system(1)	3	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			AGCAGAAGCTGAAGGAAGACT	0.547													21	178	---	---	---	---	PASS
HSP90AB1	3326	broad.mit.edu	37	6	44217143	44217143	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44217143G>C	uc003oxa.1	+	3	261	c.177G>C	c.(175-177)CTG>CTC	p.L59L	HSP90AB1_uc011dvr.1_Silent_p.L59L|HSP90AB1_uc003oxb.1_Silent_p.L59L|HSP90AB1_uc011dvs.1_5'UTR|HSP90AB1_uc003oxc.1_5'Flank	NM_007355	NP_031381	P08238	HS90B_HUMAN	heat shock 90kDa protein 1, beta	59					axon guidance|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of nitric oxide biosynthetic process|protein folding|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to unfolded protein	cytosol|melanosome	ATP binding|nitric-oxide synthase regulator activity|TPR domain binding|unfolded protein binding			lung(3)|breast(1)	4	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ATGAGAGCCTGACAGACCCTT	0.368													16	162	---	---	---	---	PASS
TDRD6	221400	broad.mit.edu	37	6	46669616	46669616	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46669616G>T	uc003oyj.2	+	4	6283	c.6283G>T	c.(6283-6285)GAG>TAG	p.E2095*	TDRD6_uc010jze.2_Nonsense_Mutation_p.E2059*	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	2095					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			GGAGGTGATGGAGATTTAACC	0.383													42	346	---	---	---	---	PASS
OPN5	221391	broad.mit.edu	37	6	47762984	47762984	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47762984G>C	uc003ozc.2	+	4	446	c.441G>C	c.(439-441)AAG>AAC	p.K147N	OPN5_uc003ozd.2_5'UTR	NM_181744	NP_859528	Q6U736	OPN5_HUMAN	opsin 5 isoform 1	147	Cytoplasmic (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to membrane	G-protein coupled receptor activity|photoreceptor activity			ovary(1)	1						TGAAAAGAAAGCACGCCTACA	0.517													13	59	---	---	---	---	PASS
CRISP2	7180	broad.mit.edu	37	6	49660474	49660474	+	3'UTR	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49660474T>A	uc003ozq.2	-	10					CRISP2_uc003ozl.2_3'UTR|CRISP2_uc003ozn.2_3'UTR|CRISP2_uc003ozr.2_3'UTR|CRISP2_uc003ozo.2_3'UTR|CRISP2_uc003ozm.2_3'UTR|CRISP2_uc003ozp.2_3'UTR	NM_001142408	NP_001135880	P16562	CRIS2_HUMAN	cysteine-rich secretory protein 2 precursor							extracellular space				skin(1)	1	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			TGCACAATGCTCACTAGGTAA	0.383													99	188	---	---	---	---	PASS
ICK	22858	broad.mit.edu	37	6	52874338	52874338	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52874338G>A	uc003pbh.2	-	13	2010	c.1520C>T	c.(1519-1521)TCG>TTG	p.S507L	ICK_uc003pbi.2_Missense_Mutation_p.S507L	NM_016513	NP_057597	Q9UPZ9	ICK_HUMAN	intestinal cell kinase	507					intracellular protein kinase cascade|multicellular organismal development	cytosol|nucleus	ATP binding|cyclin-dependent protein kinase activity|magnesium ion binding			ovary(1)|large_intestine(1)|lung(1)|kidney(1)|central_nervous_system(1)	5	Lung NSC(77;0.103)					GCCTGGATTCGAGAGTATgcc	0.264													81	138	---	---	---	---	PASS
TINAG	27283	broad.mit.edu	37	6	54254727	54254727	+	3'UTR	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54254727A>G	uc003pcj.2	+	11					TINAG_uc010jzt.2_RNA	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen						cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			ACCATAACATATCATTAAATT	0.398													53	193	---	---	---	---	PASS
GFRAL	389400	broad.mit.edu	37	6	55214895	55214895	+	Missense_Mutation	SNP	G	T	T	rs147652095	byFrequency	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55214895G>T	uc003pcm.1	+	4	408	c.322G>T	c.(322-324)GTG>TTG	p.V108L		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor	108	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TCTAGATAACGTGAAAGAGGA	0.299													45	91	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56470023	56470023	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56470023C>G	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Missense_Mutation_p.E2598Q	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCAAGATTCTCAAACTGAACA	0.323													27	57	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56482885	56482885	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56482885C>G	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Missense_Mutation_p.E1983Q	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTTATCTTCTCAATTTCAGAC	0.413													37	272	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56504285	56504285	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56504285C>G	uc003pdf.2	-	20	2751	c.2723G>C	c.(2722-2724)AGA>ACA	p.R908T	DST_uc003pcz.3_Missense_Mutation_p.R730T|DST_uc011dxj.1_Missense_Mutation_p.R759T|DST_uc011dxk.1_Missense_Mutation_p.R770T|DST_uc011dxl.1_Missense_Mutation_p.R759T|DST_uc003pcy.3_Missense_Mutation_p.R404T|DST_uc003pdb.2_Missense_Mutation_p.R404T|DST_uc003pdc.3_Missense_Mutation_p.R404T|DST_uc003pdd.3_Missense_Mutation_p.R404T|DST_uc003pde.2_Missense_Mutation_p.R846T	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	730	Spectrin 1.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTTGGTGTTTCTCTCACTCCA	0.353													46	332	---	---	---	---	PASS
PHF3	23469	broad.mit.edu	37	6	64421998	64421998	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64421998C>G	uc003pep.1	+	15	4540	c.4514C>G	c.(4513-4515)TCA>TGA	p.S1505*	PHF3_uc003pen.2_Nonsense_Mutation_p.S1417*|PHF3_uc011dxs.1_Nonsense_Mutation_p.S774*	NM_015153	NP_055968	Q92576	PHF3_HUMAN	PHD finger protein 3	1505					multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			CAGACCAACTCAAAAATAGAG	0.358													26	140	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69703688	69703688	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69703688G>C	uc003pev.3	+	11	2211	c.1763G>C	c.(1762-1764)CGA>CCA	p.R588P	BAI3_uc010kak.2_Missense_Mutation_p.R588P	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	588	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				AAGGGGCAGCGAATGCTGGCA	0.418													58	509	---	---	---	---	PASS
LMBRD1	55788	broad.mit.edu	37	6	70386398	70386398	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70386398G>A	uc003pfa.2	-	15	1568	c.1453C>T	c.(1453-1455)CAC>TAC	p.H485Y	LMBRD1_uc003pey.2_Missense_Mutation_p.H281Y|LMBRD1_uc003pez.2_Missense_Mutation_p.H412Y|LMBRD1_uc010kal.2_Missense_Mutation_p.H412Y|LMBRD1_uc003pfb.2_RNA	NM_018368	NP_060838	Q9NUN5	LMBD1_HUMAN	liver regeneration p-53 related protein	485	Extracellular (Potential).				interspecies interaction between organisms|transport	integral to membrane|lysosomal membrane	cobalamin binding			ovary(1)	1						CAGAACTTGTGAAGGAATAGG	0.383													14	97	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70859600	70859600	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70859600C>G	uc003pfc.1	+	28	2015	c.1898C>G	c.(1897-1899)GCC>GGC	p.A633G	COL19A1_uc010kam.1_Missense_Mutation_p.A529G	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	633	Triple-helical region 3 (COL3).				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						ACTCAGGGCGCCCAAGGACCA	0.378													44	81	---	---	---	---	PASS
FAM135A	57579	broad.mit.edu	37	6	71236201	71236201	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71236201G>C	uc003pfj.2	+	13	3547	c.3414G>C	c.(3412-3414)CTG>CTC	p.L1138L	FAM135A_uc003pfi.2_Silent_p.L942L|FAM135A_uc003pfh.2_Silent_p.L925L|FAM135A_uc003pfl.2_Silent_p.L805L|FAM135A_uc003pfn.2_Silent_p.L344L|FAM135A_uc003pfo.1_Silent_p.L509L|FAM135A_uc010kan.1_5'Flank	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN	hypothetical protein LOC57579 isoform c	1138										central_nervous_system(1)	1						GTGACTATCTGAGAGATGGTA	0.368													45	385	---	---	---	---	PASS
KCNQ5	56479	broad.mit.edu	37	6	73815019	73815019	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73815019C>A	uc003pgk.2	+	6	1305	c.958C>A	c.(958-960)CTA>ATA	p.L320I	KCNQ5_uc003pgj.3_Missense_Mutation_p.L320I|KCNQ5_uc011dyh.1_Missense_Mutation_p.L320I|KCNQ5_uc011dyi.1_Missense_Mutation_p.L320I|KCNQ5_uc010kat.2_Missense_Mutation_p.L320I|KCNQ5_uc011dyj.1_Missense_Mutation_p.L320I|KCNQ5_uc011dyk.1_Missense_Mutation_p.L79I	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	320					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		CAAAACTCCCCTAACTTGGCT	0.408													123	432	---	---	---	---	PASS
CD109	135228	broad.mit.edu	37	6	74466381	74466381	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74466381C>G	uc003php.2	+	6	1074	c.649C>G	c.(649-651)CAA>GAA	p.Q217E	CD109_uc010kaz.2_Missense_Mutation_p.Q217E|CD109_uc003phq.2_Missense_Mutation_p.Q217E|CD109_uc010kba.2_Missense_Mutation_p.Q140E	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor	217						anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						GACATACTATCAATCATTTCA	0.313													34	275	---	---	---	---	PASS
SENP6	26054	broad.mit.edu	37	6	76372932	76372932	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76372932C>G	uc003pid.3	+						SENP6_uc003pie.3_Intron|SENP6_uc003pic.2_Intron|SENP6_uc003pif.1_Intron	NM_015571	NP_056386	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6 isoform 1						proteolysis	cytoplasm|nucleus	cysteine-type peptidase activity			breast(2)|urinary_tract(1)|ovary(1)|lung(1)|skin(1)	6		all_hematologic(105;0.189)				GTTCTTTTTTCTAAGGATTTG	0.348													17	169	---	---	---	---	PASS
IRAK1BP1	134728	broad.mit.edu	37	6	79607914	79607914	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79607914G>C	uc003pim.2	+	4	751	c.646G>C	c.(646-648)GAT>CAT	p.D216H	IRAK1BP1_uc010kbg.1_Intron|IRAK1BP1_uc003pin.2_Missense_Mutation_p.D129H	NM_001010844	NP_001010844	Q5VVH5	IKBP1_HUMAN	interleukin-1 receptor-associated kinase 1	216					I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus					0		all_cancers(76;0.0398)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)		BRCA - Breast invasive adenocarcinoma(397;0.21)		AGGCCAAATAGATGATCACCA	0.363													3	127	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79650830	79650830	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79650830G>C	uc003pir.2	-	40	5272	c.5046C>G	c.(5044-5046)ATC>ATG	p.I1682M	PHIP_uc003piq.2_Missense_Mutation_p.I706M|PHIP_uc011dyp.1_Missense_Mutation_p.I1681M|IRAK1BP1_uc010kbg.1_Intron|PHIP_uc003pio.3_Missense_Mutation_p.I568M	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1682					insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CTTCATCTCTGATGGGATGCA	0.363													18	553	---	---	---	---	PASS
UBE2CBP	90025	broad.mit.edu	37	6	83748181	83748181	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83748181T>C	uc003pjp.2	-	5	729	c.621A>G	c.(619-621)GTA>GTG	p.V207V	UBE2CBP_uc011dyx.1_RNA|UBE2CBP_uc003pjr.2_Silent_p.V175V	NM_198920	NP_944602	Q7Z6J8	UB2CB_HUMAN	ubiquitin-conjugating enzyme E2C binding	207						cytoplasm	ligase activity			ovary(1)	1		all_cancers(76;0.000374)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0548)		BRCA - Breast invasive adenocarcinoma(397;0.0944)		GCTTACAAATTACTTTGGTAT	0.348													61	196	---	---	---	---	PASS
ANKRD6	22881	broad.mit.edu	37	6	90333770	90333770	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90333770G>A	uc003pni.3	+	12	1553	c.1212G>A	c.(1210-1212)GTG>GTA	p.V404V	ANKRD6_uc003pne.3_Silent_p.V404V|ANKRD6_uc003pnf.3_Silent_p.V369V|ANKRD6_uc011dzy.1_Silent_p.V404V|ANKRD6_uc010kcd.2_Silent_p.V345V|LYRM2_uc010kce.1_Intron|LYRM2_uc003png.2_Intron|ANKRD6_uc003pnh.3_5'UTR|LYRM2_uc010kcf.1_Intron|ANKRD6_uc003pnj.3_5'UTR	NM_014942	NP_055757	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	404							protein binding			ovary(2)|pancreas(1)	3		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		ATGGGAAAGTGATGCAGGTAC	0.527													11	25	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90382322	90382322	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90382322C>G	uc003pnn.1	-	81	13690	c.13574G>C	c.(13573-13575)AGA>ACA	p.R4525T		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	4525					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TTCATTCTTTCTTTCTTCTAA	0.403													5	229	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90440532	90440532	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90440532C>G	uc003pnn.1	-	35	5169	c.5053G>C	c.(5053-5055)GAG>CAG	p.E1685Q		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	1685					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ATCTTCAACTCATTTTTCTGA	0.368													24	186	---	---	---	---	PASS
CASP8AP2	9994	broad.mit.edu	37	6	90574048	90574048	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90574048G>C	uc003pnr.2	+	7	2816	c.2620G>C	c.(2620-2622)GAA>CAA	p.E874Q	CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Missense_Mutation_p.E874Q|CASP8AP2_uc011dzz.1_Missense_Mutation_p.E874Q	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN	caspase 8 associated protein 2	874					cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity			ovary(2)	2		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TCTTAGAAATGAAAGCCCACC	0.358													3	28	---	---	---	---	PASS
CASP8AP2	9994	broad.mit.edu	37	6	90576206	90576206	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90576206A>G	uc003pnr.2	+	8	3393	c.3197A>G	c.(3196-3198)CAC>CGC	p.H1066R	CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Missense_Mutation_p.H1066R|CASP8AP2_uc011dzz.1_Missense_Mutation_p.H1066R	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN	caspase 8 associated protein 2	1066					cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity			ovary(2)	2		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		ATACAATTTCACAGAATTATT	0.284													10	22	---	---	---	---	PASS
CASP8AP2	9994	broad.mit.edu	37	6	90578413	90578413	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90578413C>A	uc003pnr.2	+	8	5600	c.5404C>A	c.(5404-5406)CCC>ACC	p.P1802T	CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Missense_Mutation_p.P1802T|CASP8AP2_uc011dzz.1_Missense_Mutation_p.P1802T	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN	caspase 8 associated protein 2	1802	NCOA2-binding.				cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity			ovary(2)	2		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CACAGAATCTCCCAGTTCATG	0.383													34	52	---	---	---	---	PASS
EPHA7	2045	broad.mit.edu	37	6	93956688	93956688	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93956688C>G	uc003poe.2	-	15	2789	c.2548G>C	c.(2548-2550)GAA>CAA	p.E850Q	EPHA7_uc003pof.2_Missense_Mutation_p.E845Q|EPHA7_uc011eac.1_Missense_Mutation_p.E846Q	NM_004440	NP_004431	Q15375	EPHA7_HUMAN	ephrin receptor EphA7 precursor	850	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TAACCTTCTTCTATTGCTTTT	0.378													10	113	---	---	---	---	PASS
POU3F2	5454	broad.mit.edu	37	6	99283482	99283482	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99283482C>T	uc003ppe.2	+	1	903	c.733C>T	c.(733-735)CCG>TCG	p.P245S		NM_005604	NP_005595	P20265	PO3F2_HUMAN	POU domain, class 3, transcription factor 2	245					positive regulation of cell proliferation		identical protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		cccgccgcccccgcAGGGTCC	0.627													20	69	---	---	---	---	PASS
PRDM13	59336	broad.mit.edu	37	6	100062549	100062549	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100062549A>G	uc003pqg.1	+	4	2299	c.2038A>G	c.(2038-2040)AAG>GAG	p.K680E		NM_021620	NP_067633	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	680					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		TGGGGATCCCAAGAGCGACGA	0.692													32	73	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	101095199	101095199	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101095199C>G	uc003pqk.2	-	21	3710	c.3381G>C	c.(3379-3381)TTG>TTC	p.L1127F	ASCC3_uc011eai.1_Missense_Mutation_p.L1029F	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1127	SEC63 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		AAAATTGTCTCAAAGGGCTAG	0.413													20	187	---	---	---	---	PASS
AKD1	221264	broad.mit.edu	37	6	109867070	109867070	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109867070C>G	uc003ptn.2	-	26	3302	c.3225G>C	c.(3223-3225)CAG>CAC	p.Q1075H	AKD1_uc011eat.1_Missense_Mutation_p.Q154H	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1	1075					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						AGATTACTACCTGCTTTTTTG	0.224													27	222	---	---	---	---	PASS
CDC40	51362	broad.mit.edu	37	6	110540693	110540693	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110540693C>G	uc003pua.2	+							NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		GTAAGTCTTTCACAGTATTTT	0.333													12	108	---	---	---	---	PASS
REV3L	5980	broad.mit.edu	37	6	111634600	111634600	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111634600T>C	uc003puy.3	-	28	8882	c.8559A>G	c.(8557-8559)AAA>AAG	p.K2853K	REV3L_uc003pux.3_Silent_p.K2775K|REV3L_uc003puz.3_Silent_p.K2775K|REV3L_uc003pva.1_RNA	NM_002912	NP_002903	O60673	DPOLZ_HUMAN	DNA polymerase zeta	2853					DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding			large_intestine(2)|ovary(2)|skin(2)	6		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TTTCTATTCCTTTTGCATCAA	0.383								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					28	203	---	---	---	---	PASS
REV3L	5980	broad.mit.edu	37	6	111737632	111737632	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111737632G>C	uc003puy.3	-	2	506	c.183C>G	c.(181-183)CTC>CTG	p.L61L	REV3L_uc003pux.3_5'UTR|REV3L_uc003puz.3_5'UTR	NM_002912	NP_002903	O60673	DPOLZ_HUMAN	DNA polymerase zeta	61					DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding			large_intestine(2)|ovary(2)|skin(2)	6		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		ATGGCACATAGAGGTAAGGAA	0.388								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					21	65	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112439049	112439049	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112439049C>A	uc003pvu.2	-	35	5183	c.4874G>T	c.(4873-4875)GGG>GTG	p.G1625V	LAMA4_uc003pvv.2_Missense_Mutation_p.G1618V|LAMA4_uc003pvt.2_Missense_Mutation_p.G1618V	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	1625	Laminin G-like 4.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GATGGAGGCCCCATTGAGCTG	0.438													45	112	---	---	---	---	PASS
DSE	29940	broad.mit.edu	37	6	116747819	116747819	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116747819A>C	uc003pws.2	+	3	693	c.499A>C	c.(499-501)AAC>CAC	p.N167H	DSE_uc011ebf.1_Missense_Mutation_p.N167H|DSE_uc011ebg.1_Missense_Mutation_p.N186H|DSE_uc003pwt.2_Missense_Mutation_p.N167H	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN	dermatan sulfate epimerase precursor	167					dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		CTTCTTGTACAACTACCTGAG	0.443													29	170	---	---	---	---	PASS
SLC35F1	222553	broad.mit.edu	37	6	118635325	118635325	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118635325C>G	uc003pxx.3	+	8	1338	c.1137C>G	c.(1135-1137)GAC>GAG	p.D379E	SLC35F1_uc003pxy.1_Missense_Mutation_p.D184E	NM_001029858	NP_001025029	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	379					transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)		CTGTTGTGGACTTACCGACCA	0.592													42	183	---	---	---	---	PASS
NCOA7	135112	broad.mit.edu	37	6	126176272	126176272	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126176272G>C	uc010kes.2	+	5	606	c.157G>C	c.(157-159)GAC>CAC	p.D53H	NCOA7_uc003qae.3_Missense_Mutation_p.D53H|NCOA7_uc003qah.2_Missense_Mutation_p.D53H|NCOA7_uc003qai.2_Missense_Mutation_p.D53H|NCOA7_uc010ket.2_Intron|NCOA7_uc003qaf.2_Missense_Mutation_p.D53H|NCOA7_uc003qag.2_Missense_Mutation_p.D53H|NCOA7_uc003qaj.2_Missense_Mutation_p.D53H	NM_181782	NP_861447	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7 isoform 1	53					cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		TTTAGAGCCAGACAAGTGCAA	0.378													28	292	---	---	---	---	PASS
PTPRK	5796	broad.mit.edu	37	6	128304106	128304106	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128304106T>C	uc003qbk.2	-	24	3771	c.3404A>G	c.(3403-3405)CAT>CGT	p.H1135R	PTPRK_uc003qbj.2_Missense_Mutation_p.H1136R|PTPRK_uc010kfc.2_Missense_Mutation_p.H1142R|PTPRK_uc011ebu.1_Missense_Mutation_p.H1158R	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1135	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		AATGGCATCATGAATAAAAAT	0.318													52	112	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129691052	129691052	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129691052C>T	uc003qbn.2	+	34	4981	c.4876C>T	c.(4876-4878)CAG>TAG	p.Q1626*	LAMA2_uc003qbo.2_Nonsense_Mutation_p.Q1626*	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	1626	Domain II and I.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GCTGTCACCTCAGCGGGCCCC	0.443													5	138	---	---	---	---	PASS
L3MBTL3	84456	broad.mit.edu	37	6	130372465	130372465	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130372465G>A	uc003qbt.2	+	6	531	c.361G>A	c.(361-363)GAG>AAG	p.E121K	L3MBTL3_uc003qbu.2_Missense_Mutation_p.E96K	NM_032438	NP_115814	Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 isoform a	121					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		TCAGTTCTGTGAGAACTGTTG	0.418													5	202	---	---	---	---	PASS
TAAR1	134864	broad.mit.edu	37	6	132967047	132967047	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132967047G>C	uc003qdm.1	-	1	96	c.96C>G	c.(94-96)CTC>CTG	p.L32L		NM_138327	NP_612200	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	32	Helical; Name=1; (Potential).					plasma membrane					0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)	TCAGAATTATGAGCACCATTA	0.383													71	365	---	---	---	---	PASS
SGK1	6446	broad.mit.edu	37	6	134495197	134495197	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134495197C>G	uc003qen.3	-	3	263	c.174G>C	c.(172-174)TTG>TTC	p.L58F	SGK1_uc003qeo.3_Missense_Mutation_p.L153F|SGK1_uc011ect.1_Missense_Mutation_p.L48F|SGK1_uc011ecu.1_Missense_Mutation_p.L58F|SGK1_uc011ecv.1_Missense_Mutation_p.L72F|SGK1_uc011ecw.1_Missense_Mutation_p.L86F	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	58	Necessary for localization to the cytoplasm.				apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		GGGAGATCTTCAAGATGGACT	0.498													31	155	---	---	---	---	PASS
PDE7B	27115	broad.mit.edu	37	6	136512787	136512787	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136512787G>T	uc003qgp.2	+	13	1465	c.1162G>T	c.(1162-1164)GAA>TAA	p.E388*	uc003qgq.1_Intron|PDE7B_uc003qgr.2_Nonsense_Mutation_p.E440*	NM_018945	NP_061818	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B	388	Catalytic (By similarity).				signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)	GCTCTTCCGGGAATGGGCCCA	0.587													5	36	---	---	---	---	PASS
MAP3K5	4217	broad.mit.edu	37	6	136904834	136904834	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136904834G>C	uc003qhc.2	-	24	3631	c.3270C>G	c.(3268-3270)CTC>CTG	p.L1090L	MAP3K5_uc011edj.1_Silent_p.L337L|MAP3K5_uc011edk.1_Silent_p.L936L	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase	1090					activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		GGCTTGCAATGAGGGTTGTGA	0.448													29	185	---	---	---	---	PASS
NMBR	4829	broad.mit.edu	37	6	142409670	142409670	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142409670G>C	uc003qiu.2	-	1	267	c.126C>G	c.(124-126)ATC>ATG	p.I42M		NM_002511	NP_002502	P28336	NMBR_HUMAN	neuromedin B receptor	42	Helical; Name=1; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	cytoplasm|integral to plasma membrane	bombesin receptor activity			central_nervous_system(3)|breast(1)	4	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		TCACACAGCGGATCACCAACT	0.607													11	56	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144878290	144878290	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144878290C>G	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		ACTTGCACCTCAGATACTGCT	0.443													15	82	---	---	---	---	PASS
C6orf72	116254	broad.mit.edu	37	6	149899972	149899972	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149899972C>G	uc003qmq.1	+	4	319	c.292C>G	c.(292-294)CTT>GTT	p.L98V	C6orf72_uc010kie.1_Translation_Start_Site	NM_138785	NP_620140	Q9NU53	CF072_HUMAN	hypothetical protein LOC116254 precursor	98	Extracellular (Potential).					integral to membrane					0		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;9.66e-12)|GBM - Glioblastoma multiforme(68;0.171)		GAATGAAAATCTTGAAAATTT	0.318													5	54	---	---	---	---	PASS
C6orf72	116254	broad.mit.edu	37	6	149901832	149901832	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149901832C>G	uc003qmq.1	+	6	717	c.690C>G	c.(688-690)CTC>CTG	p.L230L	C6orf72_uc010kie.1_Silent_p.L110L	NM_138785	NP_620140	Q9NU53	CF072_HUMAN	hypothetical protein LOC116254 precursor	230	Extracellular (Potential).					integral to membrane					0		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;9.66e-12)|GBM - Glioblastoma multiforme(68;0.171)		AAACTCCTCTCAGAGCAGAGC	0.388													4	142	---	---	---	---	PASS
C6orf97	80129	broad.mit.edu	37	6	151917551	151917551	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151917551G>T	uc003qol.2	+	9	1638	c.1549G>T	c.(1549-1551)GAG>TAG	p.E517*		NM_025059	NP_079335	Q8IYT3	CF097_HUMAN	hypothetical protein LOC80129	517	Potential.										0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)		GCTGGAGGAGGAGAAGCAGGC	0.522													12	88	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152532704	152532704	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152532704A>C	uc010kiw.2	-	124	23116	c.22514T>G	c.(22513-22515)TTC>TGC	p.F7505C	SYNE1_uc010kiv.2_Missense_Mutation_p.F2029C|SYNE1_uc003qos.3_Missense_Mutation_p.F2029C|SYNE1_uc003qot.3_Missense_Mutation_p.F7434C|SYNE1_uc003qou.3_Missense_Mutation_p.F7505C|SYNE1_uc003qor.3_Missense_Mutation_p.F405C	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7505	Cytoplasmic (Potential).|Spectrin 25.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGACGACTGAACATCTCGGC	0.333										HNSCC(10;0.0054)			25	100	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152629663	152629663	+	Silent	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152629663A>G	uc010kiw.2	-	91	17909	c.17307T>C	c.(17305-17307)AGT>AGC	p.S5769S	SYNE1_uc010kiv.2_Silent_p.S293S|SYNE1_uc003qos.3_Silent_p.S293S|SYNE1_uc003qot.3_Silent_p.S5698S|SYNE1_uc003qou.3_Silent_p.S5769S	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5769	Cytoplasmic (Potential).|Spectrin 19.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTGTATGTTACTGGTGGCAA	0.443										HNSCC(10;0.0054)			97	209	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152697611	152697611	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152697611G>A	uc010kiw.2	-	58	9831	c.9229C>T	c.(9229-9231)CAG>TAG	p.Q3077*	SYNE1_uc003qot.3_Nonsense_Mutation_p.Q3084*|SYNE1_uc003qou.3_Nonsense_Mutation_p.Q3077*|SYNE1_uc010kja.1_5'UTR|SYNE1_uc003qov.2_Nonsense_Mutation_p.Q155*|SYNE1_uc010kjb.1_3'UTR	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3077	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AACCACTGCTGGAAATCCCTG	0.388										HNSCC(10;0.0054)			24	116	---	---	---	---	PASS
VIP	7432	broad.mit.edu	37	6	153078286	153078286	+	3'UTR	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153078286C>A	uc003qpe.2	+	6					VIP_uc003qpf.2_3'UTR|VIP_uc010kjd.2_3'UTR	NM_003381	NP_003372	P01282	VIP_HUMAN	vasoactive intestinal peptide isoform 1						body fluid secretion|G-protein coupled receptor protein signaling pathway|positive regulation of cell proliferation	extracellular region	neuropeptide hormone activity				0		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;4.5e-11)|BRCA - Breast invasive adenocarcinoma(81;0.144)		ATGAAAAAGACCTTTGGAGCA	0.408													10	47	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	6	153603440	153603440	+	IGR	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153603440G>T								RGS17 (151051 upstream) : OPRM1 (728196 downstream)																							CCAGGACACAGGCCCCCCCAA	0.423													15	65	---	---	---	---	PASS
FNDC1	84624	broad.mit.edu	37	6	159670162	159670162	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159670162C>G	uc010kjv.2	+	16	4982	c.4782C>G	c.(4780-4782)ATC>ATG	p.I1594M		NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1594						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		AAGGCGCCATCAGTTCCTTTC	0.448													5	23	---	---	---	---	PASS
WTAP	9589	broad.mit.edu	37	6	160176217	160176217	+	Silent	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160176217A>T	uc003qsl.2	+	8	987	c.765A>T	c.(763-765)ACA>ACT	p.T255T	WTAP_uc003qso.2_Silent_p.T136T	NM_004906	NP_004897	Q15007	FL2D_HUMAN	Wilms' tumour 1-associating protein isoform 1	255					cell cycle|mRNA processing|RNA splicing	nuclear membrane|nucleolus					0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		GCAGGACTACAGCTTCTGAAC	0.552													15	52	---	---	---	---	PASS
ACAT2	39	broad.mit.edu	37	6	160198422	160198422	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160198422C>G	uc010kjy.2	+	7	977	c.846C>G	c.(844-846)TCC>TCG	p.S282S	ACAT2_uc011efw.1_Silent_p.S311S	NM_005891	NP_005882	Q9BWD1	THIC_HUMAN	acetyl-Coenzyme A acetyltransferase 2	282						mitochondrion|nucleolus	acetyl-CoA C-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GGATAGTTTCCTGGTCCCAAG	0.428													31	87	---	---	---	---	PASS
IGF2R	3482	broad.mit.edu	37	6	160468358	160468358	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160468358C>G	uc003qta.2	+	16	2367	c.2219C>G	c.(2218-2220)CCT>CGT	p.P740R		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	740	5.|Lumenal (Potential).				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		GTGGGCTTCCCTGAATATCAG	0.512													7	66	---	---	---	---	PASS
MAP3K4	4216	broad.mit.edu	37	6	161470172	161470172	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161470172G>C	uc003qtn.2	+	3	1010	c.868G>C	c.(868-870)GCC>CCC	p.A290P	MAP3K4_uc010kkc.1_Missense_Mutation_p.A290P|MAP3K4_uc003qto.2_Missense_Mutation_p.A290P|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_5'UTR	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	290					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AGCCCGTCAAGCCATCCCAGA	0.423													25	146	---	---	---	---	PASS
FAM120B	84498	broad.mit.edu	37	6	170639566	170639566	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170639566G>C	uc003qxp.2	+	4	2053	c.1945G>C	c.(1945-1947)GAG>CAG	p.E649Q	FAM120B_uc003qxo.1_Missense_Mutation_p.E649Q|FAM120B_uc011ehd.1_5'UTR	NM_032448	NP_115824	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	649					cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		AGCTGTCAAGGAGTGGTTTGT	0.542													10	101	---	---	---	---	PASS
TNRC18	84629	broad.mit.edu	37	7	5413681	5413681	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5413681C>G	uc003soi.3	-							NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18								DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TCAGCTGCATCCTACCTGAGA	0.512													13	28	---	---	---	---	PASS
COL28A1	340267	broad.mit.edu	37	7	7546791	7546791	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7546791C>T	uc003src.1	-	10	1046	c.929G>A	c.(928-930)GGA>GAA	p.G310E	COL28A1_uc011jxe.1_5'UTR|COL28A1_uc003srd.2_5'UTR	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor	310	Collagen-like 2.				cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		CCCTGGGGATCCCTGTGGAAT	0.363													43	262	---	---	---	---	PASS
ARL4A	10124	broad.mit.edu	37	7	12728313	12728313	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12728313C>G	uc003ssp.2	+	2	711	c.434C>G	c.(433-435)TCA>TGA	p.S145*	ARL4A_uc003ssq.2_Nonsense_Mutation_p.S145*|ARL4A_uc003ssr.2_Nonsense_Mutation_p.S145*|ARL4A_uc003sss.2_Nonsense_Mutation_p.S145*	NM_001037164	NP_001032241	P40617	ARL4A_HUMAN	ADP-ribosylation factor-like 4A	145					small GTPase mediated signal transduction	cytoplasm|nucleolus|plasma membrane	GTP binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (126;0.176)		TTGTCACTTTCAGAAATTGAG	0.393													56	151	---	---	---	---	PASS
DGKB	1607	broad.mit.edu	37	7	14724925	14724925	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14724925G>A	uc003ssz.2	-	9	961	c.774C>T	c.(772-774)TGC>TGT	p.C258C	DGKB_uc011jxt.1_Silent_p.C251C|DGKB_uc003sta.2_Silent_p.C258C|DGKB_uc011jxu.1_Silent_p.C258C|DGKB_uc011jxv.1_Silent_p.C258C	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1	258	Phorbol-ester/DAG-type 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	GGCAAAGGTTGCAATAGGCAG	0.493													7	89	---	---	---	---	PASS
SNX13	23161	broad.mit.edu	37	7	17833857	17833857	+	3'UTR	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17833857C>G	uc003stw.1	-	25					SNX13_uc003stv.2_Missense_Mutation_p.E896Q|SNX13_uc010kuc.2_Missense_Mutation_p.E693Q|SNX13_uc010kub.2_Missense_Mutation_p.E302Q			Q9Y5W8	SNX13_HUMAN	SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;						cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TGAAACATTTCAAAAACACGA	0.353													15	56	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20782508	20782508	+	Nonsense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20782508T>A	uc003suw.3	+	16	2244	c.1698T>A	c.(1696-1698)TGT>TGA	p.C566*	ABCB5_uc010kuh.2_Nonsense_Mutation_p.C1011*	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	566	Cytoplasmic (Potential).				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						AGGACACATGTGAAGGGAATT	0.428													30	73	---	---	---	---	PASS
SP8	221833	broad.mit.edu	37	7	20825394	20825394	+	5'UTR	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20825394C>G	uc003suy.2	-	3					SP8_uc003suz.2_Silent_p.S14S	NM_198956	NP_945194	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						CCAGAGGAGTCGATCCCAACC	0.602													6	75	---	---	---	---	PASS
FAM126A	84668	broad.mit.edu	37	7	23030703	23030703	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23030703C>G	uc003svm.3	-	2	283	c.28G>C	c.(28-30)GAG>CAG	p.E10Q	FAM126A_uc003svn.3_Intron|FAM126A_uc011jyr.1_Missense_Mutation_p.E10Q	NM_032581	NP_115970	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	10						cytoplasm|membrane	signal transducer activity			central_nervous_system(1)	1						AACCATTCCTCCACAACCCCT	0.303													4	165	---	---	---	---	PASS
HOXA11	3207	broad.mit.edu	37	7	27224326	27224326	+	Silent	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27224326T>A	uc003syx.2	-	1	510	c.438A>T	c.(436-438)ACA>ACT	p.T146T	HOXA11_uc003syy.2_RNA|HOXA11AS_uc003syz.1_5'Flank	NM_005523	NP_005514	P31270	HXA11_HUMAN	homeobox A11	146					branching involved in ureteric bud morphogenesis|cartilage development involved in endochondral bone morphogenesis|developmental growth|dorsal/ventral pattern formation|mesodermal cell fate specification|positive regulation of cell development|positive regulation of chondrocyte differentiation	protein-DNA complex|transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)	2						TGCCGTAGGCTGTCTCGAAAA	0.542			T	NUP98	CML								6	59	---	---	---	---	PASS
ZNRF2	223082	broad.mit.edu	37	7	30402003	30402003	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30402003G>C	uc003tat.2	+	4	1733	c.682G>C	c.(682-684)GAA>CAA	p.E228Q		NM_147128	NP_667339	Q8NHG8	ZNRF2_HUMAN	zinc finger/RING finger 2	228	RING-type; atypical.					cell junction|endosome membrane|lysosomal membrane|presynaptic membrane	ligase activity|zinc ion binding				0						CTGCATAGATGAATGGTTTGA	0.303													18	119	---	---	---	---	PASS
FKBP9	11328	broad.mit.edu	37	7	33014871	33014871	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33014871C>G	uc003tdh.2	+	3	626	c.445C>G	c.(445-447)CAG>GAG	p.Q149E	AVL9_uc011kai.1_Intron|FKBP9_uc011kak.1_RNA|FKBP9_uc011kal.1_Missense_Mutation_p.Q202E|FKBP9_uc003tdg.2_Missense_Mutation_p.Q149E|FKBP9_uc010kwm.2_Missense_Mutation_p.Q56E	NM_007270	NP_009201	O95302	FKBP9_HUMAN	FK506 binding protein 9 precursor	149					protein folding	endoplasmic reticulum|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity			central_nervous_system(13)|ovary(1)	14			GBM - Glioblastoma multiforme(11;0.0156)			AGACCAGGTTCAGATTCACAC	0.463													32	182	---	---	---	---	PASS
PGAM2	5224	broad.mit.edu	37	7	44102386	44102386	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44102386C>T	uc003tjs.2	-	3	774	c.739G>A	c.(739-741)GCT>ACT	p.A247T		NM_000290	NP_000281	P15259	PGAM2_HUMAN	phosphoglycerate mutase 2	247					gluconeogenesis|glycolysis|striated muscle contraction	cytosol	2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity				0						CCCTGGGCAGCCACAGCCTCC	0.617													18	51	---	---	---	---	PASS
GCK	2645	broad.mit.edu	37	7	44186117	44186117	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44186117C>T	uc003tkl.2	-	8	1434	c.964G>A	c.(964-966)GAG>AAG	p.E322K	GCK_uc003tkh.1_5'Flank|GCK_uc003tki.1_5'Flank|GCK_uc003tkj.1_Missense_Mutation_p.E321K|GCK_uc003tkk.1_Missense_Mutation_p.E323K	NM_000162	NP_000153	P35557	HXK4_HUMAN	glucokinase isoform 1	322					cellular response to insulin stimulus|cellular response to leptin stimulus|detection of glucose|endocrine pancreas development|glucose homeostasis|glucose transport|glycolysis|negative regulation of gluconeogenesis|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|regulation of glucose transport|regulation of glycolysis|transmembrane transport	cytosol|nucleoplasm	ATP binding|glucokinase activity|glucose binding|protein binding			skin(3)|lung(1)	4						CGCAGCTGCTCGGAGGCCTCC	0.647													11	107	---	---	---	---	PASS
TMED4	222068	broad.mit.edu	37	7	44621733	44621733	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44621733T>C	uc003tli.2	-	1	95	c.73A>G	c.(73-75)ACA>GCA	p.T25A	TMED4_uc003tlj.2_5'UTR|TMED4_uc003tlk.2_Missense_Mutation_p.T25A|uc003tll.2_5'Flank	NM_182547	NP_872353	Q7Z7H5	TMED4_HUMAN	transmembrane emp24 protein transport domain	25					positive regulation of I-kappaB kinase/NF-kappaB cascade|transport	endoplasmic reticulum membrane|integral to membrane	signal transducer activity				0						TGGGCGCCTGTGGCGCACAGC	0.687													3	1	---	---	---	---	PASS
MYO1G	64005	broad.mit.edu	37	7	45006449	45006449	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45006449G>C	uc003tmh.2	-						MYO1G_uc003tmf.2_Intron|MYO1G_uc003tmg.2_Intron|MYO1G_uc010kym.2_Intron|MYO1G_uc003tmi.1_Intron	NM_033054	NP_149043	B0I1T2	MYO1G_HUMAN	myosin IG							myosin complex|plasma membrane	actin binding|ATP binding|calmodulin binding|motor activity			breast(2)|ovary(1)|pancreas(1)	4						TGCAGGGACAGAGGGGACTTG	0.617													49	176	---	---	---	---	PASS
C7orf42	55069	broad.mit.edu	37	7	66416110	66416110	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66416110G>A	uc003tvk.2	+	5	1032	c.768G>A	c.(766-768)GTG>GTA	p.V256V	C7orf42_uc010lah.2_Intron|C7orf42_uc003tvl.2_Silent_p.V256V	NM_017994	NP_060464	Q9NWD8	CG042_HUMAN	hypothetical protein LOC55069	256	Helical; (Potential).					integral to membrane				ovary(1)	1						AGCTTACAGTGATTGTTCCAG	0.328													25	129	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	70885909	70885909	+	Silent	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70885909A>T	uc003tvy.2	+	5	780	c.780A>T	c.(778-780)CTA>CTT	p.L260L	WBSCR17_uc003tvz.2_5'UTR	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	260	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				AGCCGGTTCTATCCCGCATCC	0.522													125	310	---	---	---	---	PASS
DNAJC30	84277	broad.mit.edu	37	7	73097249	73097249	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73097249G>C	uc003tys.1	-	1	533	c.505C>G	c.(505-507)CAG>GAG	p.Q169E	WBSCR22_uc010lbi.1_5'Flank|WBSCR22_uc003tyt.2_5'Flank|WBSCR22_uc003tyu.2_5'Flank|WBSCR22_uc003tyv.2_5'Flank|WBSCR22_uc003tyw.1_5'Flank	NM_032317	NP_115693	Q96LL9	DJC30_HUMAN	DnaJ (Hsp40) homolog subfamily C member 30	169					protein folding		heat shock protein binding|unfolded protein binding				0						TAGTGGGCCTGGTAGAAGGCG	0.692													14	82	---	---	---	---	PASS
TMEM60	85025	broad.mit.edu	37	7	77423415	77423415	+	Silent	SNP	G	C	C	rs145350174		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77423415G>C	uc003ugn.2	-	2	503	c.276C>G	c.(274-276)CTC>CTG	p.L92L		NM_032936	NP_116325	Q9H2L4	TMM60_HUMAN	transmembrane protein 60	92	Helical; (Potential).					integral to membrane					0						CACAGAGTGCGAGGCAGAAGG	0.438													29	236	---	---	---	---	PASS
TMEM60	85025	broad.mit.edu	37	7	77423646	77423646	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77423646G>C	uc003ugn.2	-	2	272	c.45C>G	c.(43-45)TTC>TTG	p.F15L		NM_032936	NP_116325	Q9H2L4	TMM60_HUMAN	transmembrane protein 60	15	Helical; (Potential).					integral to membrane					0						AGAGTAGTGTGAAAAGCCAGG	0.403													5	116	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	78636448	78636448	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78636448G>A	uc003ugx.2	-	2	630	c.376C>T	c.(376-378)CAG>TAG	p.Q126*	MAGI2_uc003ugy.2_Nonsense_Mutation_p.Q126*	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	126	Guanylate kinase-like.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				ATGATTTGCTGAAGCTCATGG	0.373													23	215	---	---	---	---	PASS
SEMA3C	10512	broad.mit.edu	37	7	80378224	80378224	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80378224C>A	uc003uhj.2	-	17	2394	c.1832G>T	c.(1831-1833)AGG>ATG	p.R611M	SEMA3C_uc011kgw.1_Missense_Mutation_p.R629M	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	611	Ig-like C2-type.				immune response|response to drug	membrane	receptor activity			ovary(1)	1						CTCTTTCCTCCTGTCTTTGTC	0.458													33	142	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86394595	86394595	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86394595T>A	uc003uid.2	+	2	1233	c.134T>A	c.(133-135)TTT>TAT	p.F45Y	GRM3_uc010lef.2_Missense_Mutation_p.F43Y|GRM3_uc010leg.2_Intron|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	45	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	GGGGGCCTGTTTCCTATTAAC	0.408													67	151	---	---	---	---	PASS
ABCB4	5244	broad.mit.edu	37	7	87035754	87035754	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87035754G>C	uc003uiv.1	-	26	3433	c.3357C>G	c.(3355-3357)CTC>CTG	p.L1119L	ABCB4_uc003uiw.1_Silent_p.L1112L|ABCB4_uc003uix.1_Silent_p.L1065L	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	1119	ABC transporter 2.|Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					ACACGATTCCGAGTTGAGCTC	0.438													11	219	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87135326	87135326	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87135326G>A	uc003uiz.1	-	28	3941	c.3523C>T	c.(3523-3525)CAG>TAG	p.Q1175*	ABCB1_uc011khc.1_Nonsense_Mutation_p.Q1111*	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	1175	Cytoplasmic (Potential).|ABC transporter 2.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	CCAGAGAGCTGAGTTCCTTTG	0.408													17	152	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87178835	87178835	+	Splice_Site	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87178835C>T	uc003uiz.1	-	15	1973	c.1555_splice	c.e15-1	p.K519_splice	ABCB1_uc011khc.1_Splice_Site_p.K455_splice	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1						G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	TGTCAAATTTCTACCACAGAA	0.483													21	157	---	---	---	---	PASS
DBF4	10926	broad.mit.edu	37	7	87526605	87526605	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87526605C>G	uc003ujf.1	+						DBF4_uc003ujh.1_Intron|DBF4_uc003ujg.1_Intron|DBF4_uc011khf.1_Intron	NM_006716	NP_006707	Q9UBU7	DBF4A_HUMAN	activator of S phase kinase						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	enzyme activator activity|nucleic acid binding|protein binding|zinc ion binding			lung(2)	2	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				TCTATGTTCTCAAGCAGGAAG	0.308													70	538	---	---	---	---	PASS
ADAM22	53616	broad.mit.edu	37	7	87778317	87778317	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87778317G>C	uc003ujn.2	+	18	1590	c.1511G>C	c.(1510-1512)CGA>CCA	p.R504P	ADAM22_uc003ujk.1_Missense_Mutation_p.R504P|ADAM22_uc003ujl.1_Missense_Mutation_p.R504P|ADAM22_uc003ujm.2_Missense_Mutation_p.R504P|ADAM22_uc003ujo.2_Missense_Mutation_p.R504P|ADAM22_uc003ujp.1_Missense_Mutation_p.R556P	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22 isoform 1	504	Disintegrin.|Extracellular (Potential).				cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			ACTGTGTGCCGAGAAGCAGTA	0.348													10	56	---	---	---	---	PASS
STEAP4	79689	broad.mit.edu	37	7	87912107	87912107	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87912107C>G	uc003ujs.2	-	3	938	c.833G>C	c.(832-834)CGA>CCA	p.R278P	STEAP4_uc010lek.2_Intron|STEAP4_uc003ujt.2_Missense_Mutation_p.R278P	NM_024636	NP_078912	Q687X5	STEA4_HUMAN	tumor necrosis factor, alpha-induced protein 9	278	Ferric oxidoreductase.				fat cell differentiation|ion transport|iron ion homeostasis	Golgi membrane|integral to membrane|plasma membrane	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	Esophageal squamous(14;0.00802)					GTCTGGGAATCGACGGTATTT	0.478													8	83	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88965543	88965543	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88965543A>G	uc011khi.1	+	4	3785	c.3247A>G	c.(3247-3249)ACT>GCT	p.T1083A		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1083						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TAATAAATATACTGGTGTGAC	0.353										HNSCC(36;0.09)			49	105	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88965729	88965729	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88965729C>T	uc011khi.1	+	4	3971	c.3433C>T	c.(3433-3435)CAA>TAA	p.Q1145*		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1145						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CCCTTTAATTCAACAGCCCAT	0.383										HNSCC(36;0.09)			23	159	---	---	---	---	PASS
PEX1	5189	broad.mit.edu	37	7	92120593	92120593	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92120593G>C	uc003uly.2	-	21	3527	c.3431C>G	c.(3430-3432)TCT>TGT	p.S1144C	PEX1_uc011khr.1_Missense_Mutation_p.S936C|PEX1_uc010ley.2_Missense_Mutation_p.S1087C|PEX1_uc011khs.1_Missense_Mutation_p.S822C	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1	1144					microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TACCAAATCAGAAGAGGTTCC	0.383													21	164	---	---	---	---	PASS
C7orf64	84060	broad.mit.edu	37	7	92161714	92161714	+	Intron	SNP	T	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92161714T>G	uc003ulz.2	+						C7orf64_uc011khu.1_Intron|C7orf64_uc003uma.2_Intron	NM_032120	NP_115496	Q5RL73	CG064_HUMAN	hypothetical protein LOC84060								nucleotide binding			ovary(2)	2						GTATTTCCATTCAGGACAGCC	0.358													38	251	---	---	---	---	PASS
SAMD9L	219285	broad.mit.edu	37	7	92760988	92760988	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92760988G>A	uc003umh.1	-	5	5513	c.4297C>T	c.(4297-4299)CTG>TTG	p.L1433L	SAMD9L_uc003umj.1_Silent_p.L1433L|SAMD9L_uc003umi.1_Silent_p.L1433L|SAMD9L_uc010lfb.1_Silent_p.L1433L|SAMD9L_uc003umk.1_Silent_p.L1433L|SAMD9L_uc010lfc.1_Silent_p.L1433L|SAMD9L_uc010lfd.1_Silent_p.L1433L|SAMD9L_uc011khx.1_3'UTR	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1433										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			GGCCAGAACAGGAGGCAGGCC	0.403													103	308	---	---	---	---	PASS
SAMD9L	219285	broad.mit.edu	37	7	92760989	92760989	+	Silent	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92760989G>T	uc003umh.1	-	5	5512	c.4296C>A	c.(4294-4296)CTC>CTA	p.L1432L	SAMD9L_uc003umj.1_Silent_p.L1432L|SAMD9L_uc003umi.1_Silent_p.L1432L|SAMD9L_uc010lfb.1_Silent_p.L1432L|SAMD9L_uc003umk.1_Silent_p.L1432L|SAMD9L_uc010lfc.1_Silent_p.L1432L|SAMD9L_uc010lfd.1_Silent_p.L1432L|SAMD9L_uc011khx.1_3'UTR	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1432										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			GCCAGAACAGGAGGCAGGCCA	0.403													102	309	---	---	---	---	PASS
SAMD9L	219285	broad.mit.edu	37	7	92761651	92761651	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92761651G>A	uc003umh.1	-	5	4850	c.3634C>T	c.(3634-3636)CAG>TAG	p.Q1212*	SAMD9L_uc003umj.1_Nonsense_Mutation_p.Q1212*|SAMD9L_uc003umi.1_Nonsense_Mutation_p.Q1212*|SAMD9L_uc010lfb.1_Nonsense_Mutation_p.Q1212*|SAMD9L_uc003umk.1_Nonsense_Mutation_p.Q1212*|SAMD9L_uc010lfc.1_Nonsense_Mutation_p.Q1212*|SAMD9L_uc010lfd.1_Nonsense_Mutation_p.Q1212*|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1212										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			GGAGTGAGCTGAAGAATCTGG	0.393													121	306	---	---	---	---	PASS
SAMD9L	219285	broad.mit.edu	37	7	92762173	92762173	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92762173G>C	uc003umh.1	-	5	4328	c.3112C>G	c.(3112-3114)CTT>GTT	p.L1038V	SAMD9L_uc003umj.1_Missense_Mutation_p.L1038V|SAMD9L_uc003umi.1_Missense_Mutation_p.L1038V|SAMD9L_uc010lfb.1_Missense_Mutation_p.L1038V|SAMD9L_uc003umk.1_Missense_Mutation_p.L1038V|SAMD9L_uc010lfc.1_Missense_Mutation_p.L1038V|SAMD9L_uc010lfd.1_Missense_Mutation_p.L1038V|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1038										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			GTAAGCAGAAGAGTTTGAACA	0.338													71	212	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98508016	98508016	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98508016G>A	uc003upp.2	+	15	1897	c.1688G>A	c.(1687-1689)GGC>GAC	p.G563D	TRRAP_uc011kis.1_Missense_Mutation_p.G563D|TRRAP_uc003upr.2_Missense_Mutation_p.G255D	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	563					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			ATCACGTGGGGCATAACATCA	0.393													44	265	---	---	---	---	PASS
PTCD1	26024	broad.mit.edu	37	7	99022723	99022723	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99022723T>C	uc003uqh.2	-	6	1563	c.1432A>G	c.(1432-1434)ATG>GTG	p.M478V	PTCD1_uc011kiw.1_Missense_Mutation_p.M527V	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	478										ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TGCTCTGCCATCTTGCTCAGG	0.662													22	102	---	---	---	---	PASS
ZNF394	84124	broad.mit.edu	37	7	99091386	99091386	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99091386G>C	uc003uqs.2	-	3	1613	c.1452C>G	c.(1450-1452)CTC>CTG	p.L484L	ZNF394_uc003uqt.2_Silent_p.L277L	NM_032164	NP_115540	Q53GI3	ZN394_HUMAN	zinc finger protein 394	484	C2H2-type 5.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GGTGTTTAAAGAGGTCAGAGC	0.448													11	251	---	---	---	---	PASS
CYP3A7	1551	broad.mit.edu	37	7	99306722	99306722	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99306722G>C	uc003uru.2	-	11	1294	c.1189C>G	c.(1189-1191)CCA>GCA	p.P397A	ZNF498_uc003urn.2_Intron|CYP3A5_uc003urs.2_Intron|CYP3A5_uc010lgg.2_Intron	NM_000765	NP_000756	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A,	397					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)	1	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)					ACATAGCTTGGAATCATCACC	0.483													28	205	---	---	---	---	PASS
CYP3A43	64816	broad.mit.edu	37	7	99445849	99445849	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99445849G>C	uc003urx.1	+	6	596	c.493G>C	c.(493-495)GAG>CAG	p.E165Q	CYP3A43_uc003ury.1_Missense_Mutation_p.E165Q|CYP3A43_uc003urz.1_Missense_Mutation_p.E165Q|CYP3A43_uc003usa.1_RNA|CYP3A43_uc010lgi.1_Intron|CYP3A43_uc003usb.1_Missense_Mutation_p.R27T	NM_057095	NP_476436	Q9HB55	CP343_HUMAN	cytochrome P450, family 3, subfamily A,	165			Missing (in allele CYP3A43*2).		xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)|skin(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Cetirizine(DB00341)|Doxycycline(DB00254)	GCAGGAAGCAGAGAACAGCAA	0.493													6	64	---	---	---	---	PASS
MOSPD3	64598	broad.mit.edu	37	7	100211221	100211221	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100211221C>T	uc003uvq.2	+	4	605	c.403C>T	c.(403-405)CTG>TTG	p.L135L	MOSPD3_uc003uvr.2_Silent_p.L135L|MOSPD3_uc003uvs.2_Silent_p.L135L|MOSPD3_uc003uvt.2_Silent_p.L125L	NM_001040097	NP_001035186	O75425	MSPD3_HUMAN	motile sperm domain containing 3 isoform a	135	MSP.					integral to membrane	structural molecule activity			ovary(2)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					TACCTCCATTCTGAGAGCCCC	0.622													15	123	---	---	---	---	PASS
EPHB4	2050	broad.mit.edu	37	7	100421299	100421299	+	Silent	SNP	G	A	A	rs145080354	byFrequency	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100421299G>A	uc003uwn.1	-	3	869	c.378C>T	c.(376-378)CTC>CTT	p.L126L	EPHB4_uc003uwm.1_Silent_p.L33L|EPHB4_uc010lhj.1_Silent_p.L126L|EPHB4_uc011kkf.1_Silent_p.L126L|EPHB4_uc011kkg.1_Silent_p.L126L|EPHB4_uc011kkh.1_Silent_p.L126L	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor	126	Extracellular (Potential).				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					AGGCTGGCGTGAGGGCCGTGG	0.657													10	89	---	---	---	---	PASS
SLC12A9	56996	broad.mit.edu	37	7	100459086	100459086	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100459086C>G	uc003uwp.2	+	11	1558	c.1416C>G	c.(1414-1416)CTC>CTG	p.L472L	SLC12A9_uc003uwq.2_Silent_p.L383L|SLC12A9_uc011kki.1_Silent_p.L3L|SLC12A9_uc003uwr.2_Silent_p.L208L|SLC12A9_uc003uws.2_Silent_p.L3L|SLC12A9_uc003uwt.2_Silent_p.L208L|SLC12A9_uc003uwv.2_Silent_p.L3L	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride	472	Helical; (Potential).					integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)					TGATGTTCCTCATCAGTCCTG	0.677													18	187	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100684352	100684352	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100684352G>A	uc003uxp.1	+	3	9708	c.9655G>A	c.(9655-9657)GAA>AAA	p.E3219K	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3219	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|52.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AACTCCTAGTGAAGGAATGAC	0.498													73	509	---	---	---	---	PASS
PLOD3	8985	broad.mit.edu	37	7	100852175	100852175	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100852175C>G	uc003uyd.2	-	16	2203	c.1747G>C	c.(1747-1749)GAG>CAG	p.E583Q	PLOD3_uc010lhs.2_Missense_Mutation_p.E148Q	NM_001084	NP_001075	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	583					protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	TGCTCCATCTCTGCCACCAGC	0.627													12	105	---	---	---	---	PASS
FIS1	51024	broad.mit.edu	37	7	100884108	100884108	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100884108C>T	uc003uyj.3	-						CLDN15_uc003uyg.1_5'Flank|CLDN15_uc003uyh.1_5'Flank|FIS1_uc010lht.2_Intron|FIS1_uc010lhu.2_Intron	NM_016068	NP_057152	Q9Y3D6	FIS1_HUMAN	tetratricopeptide repeat domain 11						apoptosis|mitochondrial fission|peroxisome fission	integral to mitochondrial outer membrane|integral to peroxisomal membrane	protein binding				0	Lung NSC(181;0.168)|all_lung(186;0.215)					GTCCCCACCTCACCTTGAGCC	0.632													22	160	---	---	---	---	PASS
NAMPT	10135	broad.mit.edu	37	7	105913032	105913032	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105913032G>C	uc003vdq.2	-	4	699	c.391C>G	c.(391-393)CTC>GTC	p.L131V	NAMPT_uc003vdr.1_Missense_Mutation_p.L131V|NAMPT_uc011klu.1_Missense_Mutation_p.L44V	NM_005746	NP_005737	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	131					cell-cell signaling|NAD biosynthetic process|nicotinamide metabolic process|positive regulation of cell proliferation|positive regulation of nitric-oxide synthase biosynthetic process|signal transduction|water-soluble vitamin metabolic process	cytosol	cytokine activity|nicotinamide phosphoribosyltransferase activity|nicotinate phosphoribosyltransferase activity|nicotinate-nucleotide diphosphorylase (carboxylating) activity			large_intestine(1)	1						ACCGTGAAGAGAACATTTCCT	0.333													26	154	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106508159	106508159	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106508159C>G	uc003vdv.3	+	2	238	c.153C>G	c.(151-153)TGC>TGG	p.C51W	PIK3CG_uc003vdu.2_Missense_Mutation_p.C51W|PIK3CG_uc003vdw.2_Missense_Mutation_p.C51W	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	51					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						AGCGCAAATGCAAGAGCCCCG	0.682													19	62	---	---	---	---	PASS
BCAP29	55973	broad.mit.edu	37	7	107240935	107240935	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107240935A>T	uc003vej.2	+	6	913	c.574A>T	c.(574-576)AGG>TGG	p.R192W	BCAP29_uc011kly.1_Missense_Mutation_p.R98W|BCAP29_uc011klz.1_Missense_Mutation_p.R192W|BCAP29_uc011kma.1_Missense_Mutation_p.R192W	NM_018844	NP_061332	Q9UHQ4	BAP29_HUMAN	B-cell receptor-associated protein BAP29 isoform	192	Cytoplasmic (Potential).				apoptosis|intracellular protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|integral to membrane				large_intestine(1)|ovary(1)	2						AACTGAATTAAGGAAGACTTC	0.318													30	61	---	---	---	---	PASS
SLC26A4	5172	broad.mit.edu	37	7	107314718	107314718	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107314718G>C	uc003vep.2	+	5	749	c.525G>C	c.(523-525)ATG>ATC	p.M175I		NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin	175	Extracellular (Potential).				regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						ATACTACTATGATAGACACTG	0.433									Pendred_syndrome				8	188	---	---	---	---	PASS
NRCAM	4897	broad.mit.edu	37	7	107849976	107849976	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107849976C>T	uc003vfb.2	-	12	1435	c.964G>A	c.(964-966)GAG>AAG	p.E322K	NRCAM_uc003vfc.2_Missense_Mutation_p.E316K|NRCAM_uc011kmk.1_Missense_Mutation_p.E317K|NRCAM_uc003vfd.2_Missense_Mutation_p.E298K|NRCAM_uc003vfe.2_Missense_Mutation_p.E298K	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A	322	Ig-like 3.|Extracellular (Potential).				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						AAGGTTTTCTCAAAGTTCTTA	0.373													16	241	---	---	---	---	PASS
C7orf66	154907	broad.mit.edu	37	7	108524189	108524189	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108524189C>G	uc003vfo.2	-	2	271	c.223G>C	c.(223-225)GAT>CAT	p.D75H		NM_001024607	NP_001019778	A4D0T2	CG066_HUMAN	hypothetical protein LOC154907	75						integral to membrane				ovary(2)	2						TATCTCTGATCCATCATGTGA	0.413													28	248	---	---	---	---	PASS
TMEM168	64418	broad.mit.edu	37	7	112415351	112415351	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112415351C>T	uc003vgn.2	-	3	1543	c.1151G>A	c.(1150-1152)AGC>AAC	p.S384N	TMEM168_uc010lju.2_Missense_Mutation_p.S384N|TMEM168_uc011kmr.1_5'UTR	NM_022484	NP_071929	Q9H0V1	TM168_HUMAN	transmembrane protein 168	384	Helical; (Potential).					integral to membrane|transport vesicle				ovary(1)|central_nervous_system(1)	2						TAGAAACATGCTCAAGAAAAT	0.358													12	77	---	---	---	---	PASS
C7orf60	154743	broad.mit.edu	37	7	112461888	112461888	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112461888C>G	uc003vgo.1	-	5	1256	c.1129G>C	c.(1129-1131)GAT>CAT	p.D377H	C7orf60_uc011kms.1_Missense_Mutation_p.D403H	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN	hypothetical protein LOC154743	377										ovary(2)|skin(1)	3						TATGGCGCATCAGGGAgttct	0.308													30	166	---	---	---	---	PASS
MET	4233	broad.mit.edu	37	7	116397818	116397818	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116397818A>T	uc003vij.2	+	8	2279	c.2092A>T	c.(2092-2094)ACT>TCT	p.T698S	MET_uc010lkh.2_Missense_Mutation_p.T698S|MET_uc011kne.1_Missense_Mutation_p.T670S|MET_uc011knf.1_Missense_Mutation_p.T698S|MET_uc011kng.1_Missense_Mutation_p.T698S|MET_uc011knh.1_Missense_Mutation_p.T698S|MET_uc011kni.1_Missense_Mutation_p.T698S|MET_uc011knj.1_Missense_Mutation_p.T268S	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor	698	Extracellular (Potential).|IPT/TIG 2.				axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			AAAAACATGTACTTTAAAAAG	0.323			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				51	171	---	---	---	---	PASS
ANKRD7	56311	broad.mit.edu	37	7	117864918	117864918	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117864918A>T	uc003vji.2	+	1	207	c.34A>T	c.(34-36)AAT>TAT	p.N12Y		NM_019644	NP_062618	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	12					male gonad development						0						GAAGAGGAAGAATGAGACCCG	0.507													9	109	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119915141	119915141	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119915141C>A	uc003vjj.1	+	1	1420	c.455C>A	c.(454-456)GCG>GAG	p.A152E		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	152	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					CAGGACGACGCGGATACCGAC	0.632													47	122	---	---	---	---	PASS
PTPRZ1	5803	broad.mit.edu	37	7	121653533	121653533	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121653533C>T	uc003vjy.2	+	12	4828	c.4433C>T	c.(4432-4434)TCT>TTT	p.S1478F	PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	1478	Extracellular (Potential).				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						TACTCACTATCTGAGAATTCT	0.393													19	116	---	---	---	---	PASS
CADPS2	93664	broad.mit.edu	37	7	122261611	122261611	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122261611G>C	uc010lkp.2	-	5	1191	c.1028C>G	c.(1027-1029)TCT>TGT	p.S343C	CADPS2_uc003vkg.3_Missense_Mutation_p.S43C|CADPS2_uc010lkq.2_Missense_Mutation_p.S343C	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	343					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						CAAAAATGCAGAGTTCTGTGA	0.398													25	221	---	---	---	---	PASS
CADPS2	93664	broad.mit.edu	37	7	122261629	122261629	+	Nonsense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122261629A>C	uc010lkp.2	-	5	1173	c.1010T>G	c.(1009-1011)TTA>TGA	p.L337*	CADPS2_uc003vkg.3_Nonsense_Mutation_p.L37*|CADPS2_uc010lkq.2_Nonsense_Mutation_p.L337*	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	337					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TGAACGTTTTAATTTTTGTAA	0.388													17	207	---	---	---	---	PASS
WASL	8976	broad.mit.edu	37	7	123344718	123344718	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123344718G>C	uc003vkz.2	-							NM_003941	NP_003932	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome gene-like protein						actin polymerization or depolymerization|axon guidance|cellular component movement|nitric oxide metabolic process|protein complex assembly|regulation of nitric-oxide synthase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|cytosol|nucleolus|plasma membrane	actin binding|small GTPase regulator activity				0						TTCTCTGTTAGAAAATAAATT	0.269													7	43	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126410082	126410082	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126410082C>A	uc003vlr.2	-	6	1505	c.1194G>T	c.(1192-1194)CAG>CAT	p.Q398H	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.Q398H|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_Missense_Mutation_p.Q119H	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	398	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	CCTTTCCTTCCTGTTCATAAG	0.403										HNSCC(24;0.065)			27	65	---	---	---	---	PASS
GCC1	79571	broad.mit.edu	37	7	127222843	127222843	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127222843T>A	uc003vma.2	-	2	1971	c.1553A>T	c.(1552-1554)GAG>GTG	p.E518V		NM_024523	NP_078799	Q96CN9	GCC1_HUMAN	Golgi coiled-coil protein 1	518	Potential.					Golgi membrane|plasma membrane	protein binding			ovary(2)	2						CTGGGCTGCCTCCAGCTCCTT	0.527													28	189	---	---	---	---	PASS
CALD1	800	broad.mit.edu	37	7	134643009	134643009	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134643009A>C	uc003vrz.2	+	11	2488	c.2029A>C	c.(2029-2031)AGC>CGC	p.S677R	CALD1_uc003vry.2_Missense_Mutation_p.S422R|CALD1_uc003vsa.2_Missense_Mutation_p.S448R|CALD1_uc003vsb.2_Missense_Mutation_p.S422R|CALD1_uc010lmm.2_Missense_Mutation_p.S447R|CALD1_uc011kpt.1_Missense_Mutation_p.S196R|CALD1_uc003vsc.2_Missense_Mutation_p.S442R|CALD1_uc003vsd.2_Missense_Mutation_p.S416R|CALD1_uc011kpu.1_Missense_Mutation_p.S427R|CALD1_uc011kpv.1_Missense_Mutation_p.S286R|CALD1_uc003vse.2_Missense_Mutation_p.S540R|CALD1_uc010lmn.2_5'Flank	NM_033138	NP_149129	Q05682	CALD1_HUMAN	caldesmon 1 isoform 1	677	Strong actin-binding (By similarity).				cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0						CAAGATTGACAGCAGACTGGA	0.393													46	243	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135291576	135291576	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135291576C>G	uc003vsw.2	+	21	3014	c.2983C>G	c.(2983-2985)CTG>GTG	p.L995V		NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	995					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						CATTACCTCTCTGGAATGCAA	0.378													37	255	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135304536	135304536	+	Splice_Site	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135304536A>C	uc003vsw.2	+	30	4263	c.4232_splice	c.e30-2	p.G1411_splice	NUP205_uc003vsx.2_5'Flank	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						TAATCTCCCTAGGTGGTGGAT	0.358													99	652	---	---	---	---	PASS
DGKI	9162	broad.mit.edu	37	7	137237103	137237103	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137237103G>C	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						GGTAGGCCATGAGCAGACTCA	0.507													4	172	---	---	---	---	PASS
SVOPL	136306	broad.mit.edu	37	7	138314878	138314878	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138314878G>A	uc011kqh.1	-						SVOPL_uc003vue.2_Intron	NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1							integral to membrane	transmembrane transporter activity				0						CTGGGGTAATGAAAAGGAGAC	0.403													22	122	---	---	---	---	PASS
ZC3HAV1	56829	broad.mit.edu	37	7	138764635	138764635	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138764635G>A	uc003vun.2	-	4	1440	c.1052C>T	c.(1051-1053)TCC>TTC	p.S351F	ZC3HAV1_uc003vuo.2_5'Flank|ZC3HAV1_uc003vup.2_Missense_Mutation_p.S351F	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1	351					response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1						TGTTGAATTGGAAGCAAGGTA	0.542													27	194	---	---	---	---	PASS
UBN2	254048	broad.mit.edu	37	7	138968151	138968151	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138968151G>T	uc011kqr.1	+	15	2500	c.2500G>T	c.(2500-2502)GCT>TCT	p.A834S		NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2	834										ovary(1)|skin(1)	2						AAGTCTTATTGCTGGTCACAC	0.423													25	156	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141752640	141752640	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141752640C>T	uc003vwy.2	+	26	3069	c.3015C>T	c.(3013-3015)GTC>GTT	p.V1005V		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	1005	Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TATACTCTGTCAGTGATGTTC	0.473													8	322	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142364528	142364528	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142364528C>G	uc011krp.1	+						uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_5'Flank|uc011ksg.1_Intron|uc003vzx.3_Missense_Mutation_p.R55G					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		GTACTGGTATCGACAAGACCC	0.433													13	63	---	---	---	---	PASS
TRPV5	56302	broad.mit.edu	37	7	142606708	142606708	+	Missense_Mutation	SNP	G	A	A	rs148001669		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142606708G>A	uc003wby.1	-	14	2107	c.1843C>T	c.(1843-1845)CGC>TGC	p.R615C		NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	615	Cytoplasmic (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					ATCCCGGAGCGAGGCCACAGG	0.592													24	86	---	---	---	---	PASS
TPK1	27010	broad.mit.edu	37	7	144380014	144380014	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144380014C>A	uc003weq.2	-	4	276	c.173G>T	c.(172-174)GGA>GTA	p.G58V	TPK1_uc003weo.2_Nonsense_Mutation_p.E13*|TPK1_uc003wep.2_RNA|TPK1_uc003wer.2_Missense_Mutation_p.G58V|TPK1_uc003wes.2_RNA	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a	58					thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	TTCTCTCTCTCCTTCGGTGAT	0.378													52	367	---	---	---	---	PASS
ZNF786	136051	broad.mit.edu	37	7	148769427	148769427	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148769427G>C	uc003wfh.2	-	4	574	c.437C>G	c.(436-438)GCC>GGC	p.A146G	ZNF786_uc011kuk.1_Missense_Mutation_p.A109G|ZNF786_uc003wfi.2_Missense_Mutation_p.A60G	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786	146					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			AGGAGCCCTGGCGTCGTGTCT	0.542													7	17	---	---	---	---	PASS
ATP6V0E2	155066	broad.mit.edu	37	7	149572732	149572732	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149572732C>G	uc003wgr.2	+	2	1248	c.297C>G	c.(295-297)CTC>CTG	p.L99L	LOC401431_uc003wgn.3_5'Flank|LOC401431_uc011kur.1_5'Flank|ATP6V0E2_uc003wgo.1_RNA|ATP6V0E2_uc003wgs.2_Silent_p.L99L|ATP6V0E2_uc003wgp.2_Silent_p.L99L|ATP6V0E2_uc003wgq.2_RNA	NM_145230	NP_660265	Q8NHE4	VA0E2_HUMAN	ATPase, H+ transporting, V0 subunit isoform 1	50	Helical; (Potential).				ATP hydrolysis coupled proton transport|cell growth|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport|vacuolar acidification	endosome membrane|integral to membrane|proton-transporting V-type ATPase, V0 domain|vacuole	ATPase activity, coupled to transmembrane movement of ions|hydrogen ion transmembrane transporter activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.00256)			GCTGTTACCTCTTGTAAGTAC	0.547													8	221	---	---	---	---	PASS
SLC4A2	6522	broad.mit.edu	37	7	150767389	150767389	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150767389C>G	uc003wit.3	+	10	1661	c.1405C>G	c.(1405-1407)CTC>GTC	p.L469V	SLC4A2_uc011kve.1_Missense_Mutation_p.L460V|SLC4A2_uc003wiu.3_Missense_Mutation_p.L455V|SLC4A2_uc003wiv.3_5'Flank	NM_003040	NP_003031	P04920	B3A2_HUMAN	solute carrier family 4, anion exchanger, member	469	Cytoplasmic (Potential).			LLGHHHGQGAESDPHVTEPLMGGVPE -> CWGITMVRGLR VTPTSPSLSWEVFLR (in Ref. 6; CAA27556).	bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CACCGAGCCTCTCATGGGAGG	0.672													14	75	---	---	---	---	PASS
GBX1	2636	broad.mit.edu	37	7	150846114	150846114	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150846114G>T	uc011kvg.1	-	2	886	c.654C>A	c.(652-654)TTC>TTA	p.F218L		NM_001098834	NP_001092304	Q14549	GBX1_HUMAN	gastrulation brain homeo box 1	218						nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AACTGTCCAGGAAACCGTCAT	0.622													101	640	---	---	---	---	PASS
PRKAG2	51422	broad.mit.edu	37	7	151269752	151269752	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151269752C>A	uc003wkk.2	-	9	1660	c.1049G>T	c.(1048-1050)AGG>ATG	p.R350M	PRKAG2_uc003wki.2_Missense_Mutation_p.R109M|PRKAG2_uc011kvl.1_Missense_Mutation_p.R225M|PRKAG2_uc003wkj.2_Missense_Mutation_p.R306M|PRKAG2_uc003wkl.2_Intron|PRKAG2_uc010lqe.1_RNA	NM_016203	NP_057287	Q9UGJ0	AAKG2_HUMAN	AMP-activated protein kinase gamma2 subunit	350			R -> RL (in CMH-WPWS; severe).		ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)		GTGCTTACCCCTCCATGTTTC	0.269													18	110	---	---	---	---	PASS
PRKAG2	51422	broad.mit.edu	37	7	151292541	151292541	+	Splice_Site	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151292541C>G	uc003wkk.2	-	6	1366	c.755_splice	c.e6-1	p.A252_splice	PRKAG2_uc003wki.2_Splice_Site_p.A11_splice|PRKAG2_uc011kvl.1_Intron|PRKAG2_uc003wkj.2_Splice_Site_p.A208_splice|PRKAG2_uc003wkl.2_5'Flank|PRKAG2_uc010lqe.1_Splice_Site	NM_016203	NP_057287	Q9UGJ0	AAKG2_HUMAN	AMP-activated protein kinase gamma2 subunit						ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)		TCTTCTACTGCTAAAAGAAAA	0.224													19	92	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151946970	151946970	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151946970G>C	uc003wla.2	-	13	2023	c.1804C>G	c.(1804-1806)CTT>GTT	p.L602V		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	602					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CCAGCAATAAGAAGACTATCT	0.358			N		medulloblastoma								33	107	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	152144116	152144116	+	IGR	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152144116G>A								FABP5L3 (4018 upstream) : LOC100128822 (17093 downstream)																							GACTGTAGATGAAATCGTAGT	0.473													5	299	---	---	---	---	PASS
XRCC2	7516	broad.mit.edu	37	7	152345752	152345752	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152345752C>G	uc003wld.2	-	3	904	c.818G>C	c.(817-819)GGA>GCA	p.G273A		NM_005431	NP_005422	O43543	XRCC2_HUMAN	X-ray repair cross complementing protein 2	273					meiosis	nucleus	ATP binding|DNA binding|DNA-dependent ATPase activity			breast(1)|liver(1)	2		all_hematologic(28;0.0592)|Prostate(32;0.081)	OV - Ovarian serous cystadenocarcinoma(82;0.0423)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0429)		CCCACTTTCTCCAATAATAAA	0.254								Homologous_recombination					25	104	---	---	---	---	PASS
MCPH1	79648	broad.mit.edu	37	8	6302244	6302244	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6302244C>T	uc003wqi.2	+	8	1069	c.1001C>T	c.(1000-1002)CCT>CTT	p.P334L	MCPH1_uc003wqh.2_Missense_Mutation_p.P334L|MCPH1_uc011kwl.1_Missense_Mutation_p.P286L	NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin	334						microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		CGTTTGTCTCCTACCTTATCT	0.438													11	42	---	---	---	---	PASS
LONRF1	91694	broad.mit.edu	37	8	12583331	12583331	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12583331G>A	uc003wwd.1	-	11	2131	c.2068C>T	c.(2068-2070)CAA>TAA	p.Q690*	LONRF1_uc011kxv.1_Nonsense_Mutation_p.Q279*|LONRF1_uc010lsp.1_Nonsense_Mutation_p.Q290*	NM_152271	NP_689484	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger	690	Lon.				proteolysis		ATP-dependent peptidase activity|zinc ion binding			ovary(1)	1				READ - Rectum adenocarcinoma(644;0.236)		CTGCAGGCTTGAGAGTAAACC	0.413													23	95	---	---	---	---	PASS
TUSC3	7991	broad.mit.edu	37	8	15531304	15531304	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15531304G>A	uc003wwt.2	+	6	967	c.757G>A	c.(757-759)GGA>AGA	p.G253R	TUSC3_uc003wwr.2_Missense_Mutation_p.G253R|TUSC3_uc003wws.2_Missense_Mutation_p.G253R|TUSC3_uc003wwu.2_Missense_Mutation_p.G253R|TUSC3_uc003wwv.2_Missense_Mutation_p.G253R|TUSC3_uc003www.2_Missense_Mutation_p.G253R|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Missense_Mutation_p.G253R	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	253					cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)		CCATATCCGTGGACCTCCATA	0.373													30	135	---	---	---	---	PASS
PSD3	23362	broad.mit.edu	37	8	18662066	18662066	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18662066C>G	uc003wza.2	-	6	1979	c.1876G>C	c.(1876-1878)GAT>CAT	p.D626H	PSD3_uc003wyy.2_Missense_Mutation_p.D92H|PSD3_uc003wyz.2_5'UTR	NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN	ADP-ribosylation factor guanine nucleotide	626	SEC7.				regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		CCTGTAAAATCAAAAAACTTC	0.343													24	83	---	---	---	---	PASS
LGI3	203190	broad.mit.edu	37	8	22006032	22006032	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22006032G>C	uc003xav.2	-	8	1577	c.1288C>G	c.(1288-1290)CGT>GGT	p.R430G	LGI3_uc010ltu.2_Missense_Mutation_p.R406G	NM_139278	NP_644807	Q8N145	LGI3_HUMAN	leucine-rich repeat LGI family, member 3	430	EAR 5.				exocytosis	cell junction|extracellular region|synaptic vesicle|synaptosome				ovary(1)	1				Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)		CGGCCGGCACGAAAGTGTTTC	0.632													5	15	---	---	---	---	PASS
POLR3D	661	broad.mit.edu	37	8	22105711	22105711	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22105711C>G	uc003xbl.2	+	5	489	c.406C>G	c.(406-408)CAT>GAT	p.H136D	POLR3D_uc003xbm.2_Missense_Mutation_p.H136D|POLR3D_uc011kze.1_Intron	NM_001722	NP_001713	P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	136					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity				0				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		GGGACCTTCTCATATCATCAA	0.483													24	125	---	---	---	---	PASS
SLC39A14	23516	broad.mit.edu	37	8	22272336	22272336	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22272336C>G	uc003xbq.3	+	5	846	c.671C>G	c.(670-672)TCT>TGT	p.S224C	SLC39A14_uc011kzg.1_Missense_Mutation_p.S224C|SLC39A14_uc003xbp.3_Missense_Mutation_p.S224C|SLC39A14_uc011kzh.1_Missense_Mutation_p.S224C	NM_001128431	NP_001121903	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter),	224	Extracellular (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|lamellipodium|plasma membrane	zinc ion transmembrane transporter activity				0				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		GTCTCCAAGTCTGCAGTGGTG	0.383													17	236	---	---	---	---	PASS
EBF2	64641	broad.mit.edu	37	8	25899692	25899692	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25899692G>A	uc003xes.1	-	2	224	c.207C>T	c.(205-207)TTC>TTT	p.F69F	PPP2R2A_uc003xek.2_Intron|EBF2_uc003xet.1_Silent_p.F69F	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	69					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GCGCCAGGACGAAGTGAAAGA	0.577													23	61	---	---	---	---	PASS
EPHX2	2053	broad.mit.edu	37	8	27361127	27361127	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27361127C>A	uc003xfu.2	+	3	274	c.193C>A	c.(193-195)CCA>ACA	p.P65T	EPHX2_uc010lut.1_Missense_Mutation_p.P65T|EPHX2_uc010luu.2_Missense_Mutation_p.P65T|EPHX2_uc010luv.2_5'UTR|EPHX2_uc003xfv.2_Missense_Mutation_p.P12T|EPHX2_uc010luw.2_5'UTR|EPHX2_uc011lam.1_5'Flank	NM_001979	NP_001970	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	65	Phosphatase.				aromatic compound catabolic process|cellular calcium ion homeostasis|drug metabolic process|inflammatory response|positive regulation of vasodilation|reactive oxygen species metabolic process|regulation of blood pressure|response to toxin|xenobiotic metabolic process	cytosol|focal adhesion|Golgi apparatus|nucleolus|peroxisome|soluble fraction	epoxide hydrolase activity|metal ion binding|protein homodimerization activity			ovary(1)	1		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)	Tamoxifen(DB00675)	ACAGTGGATACCACTCATGGA	0.303													4	24	---	---	---	---	PASS
FUT10	84750	broad.mit.edu	37	8	33246663	33246663	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33246663C>G	uc003xje.2	-	4	1386	c.1030G>C	c.(1030-1032)GAC>CAC	p.D344H	FUT10_uc003xjc.2_Missense_Mutation_p.D351H|FUT10_uc003xjd.2_Missense_Mutation_p.D316H|FUT10_uc011lbi.1_Missense_Mutation_p.D394H|FUT10_uc003xjf.2_Missense_Mutation_p.D282H|FUT10_uc003xjg.2_Missense_Mutation_p.D316H|FUT10_uc003xjh.2_Missense_Mutation_p.D344H	NM_032664	NP_116053	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10	344	Lumenal (Potential).				embryo development|fertilization|hemopoiesis|L-fucose catabolic process|nervous system development|protein folding|protein glycosylation|protein targeting|wound healing	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			ovary(1)|pancreas(1)	2				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		TACAATCTGTCATCAGAATCC	0.463													28	99	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38187168	38187168	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38187168C>G	uc003xli.2	-	6	1827	c.1309G>C	c.(1309-1311)GAG>CAG	p.E437Q	WHSC1L1_uc011lbm.1_Missense_Mutation_p.E437Q|WHSC1L1_uc010lwe.2_Missense_Mutation_p.E437Q|WHSC1L1_uc003xlj.2_Missense_Mutation_p.E437Q	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	437					cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			GAGGCCACCTCCCCTGCATTG	0.502			T	NUP98	AML								18	169	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41591515	41591515	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41591515C>G	uc003xok.2	-	3	286	c.202G>C	c.(202-204)GAA>CAA	p.E68Q	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Missense_Mutation_p.E68Q|ANK1_uc003xoj.2_Missense_Mutation_p.E68Q|ANK1_uc003xol.2_Missense_Mutation_p.E68Q|ANK1_uc003xom.2_Missense_Mutation_p.E101Q	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	68	ANK 1.|89 kDa domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			AGAATGATTTCTTTGTGCAGA	0.463													10	192	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41834549	41834549	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41834549G>C	uc010lxb.2	-	8	1884	c.1340C>G	c.(1339-1341)TCA>TGA	p.S447*	MYST3_uc010lxc.2_Nonsense_Mutation_p.S447*|MYST3_uc003xon.3_Nonsense_Mutation_p.S447*|MYST3_uc010lxd.2_Nonsense_Mutation_p.S447*	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	447	Interaction with RUNX1-1.				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			TGAAGTGCTTGATTTCCTGTT	0.418													18	111	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41834802	41834802	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41834802C>A	uc010lxb.2	-	8	1631	c.1087G>T	c.(1087-1089)GGT>TGT	p.G363C	MYST3_uc010lxc.2_Missense_Mutation_p.G363C|MYST3_uc003xon.3_Missense_Mutation_p.G363C|MYST3_uc010lxd.2_Missense_Mutation_p.G363C	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	363	Interaction with RUNX1-1.				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			CGTTTCCTACCCCTTCCAGGG	0.413													28	112	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41838388	41838388	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41838388G>C	uc010lxb.2	-	6	1427	c.883C>G	c.(883-885)CCG>GCG	p.P295A	MYST3_uc010lxc.2_Missense_Mutation_p.P295A|MYST3_uc003xon.3_Missense_Mutation_p.P295A|MYST3_uc010lxd.2_Missense_Mutation_p.P295A	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	295	PHD-type 2.				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			GTGAGTGGCGGATCACAACAC	0.368													53	223	---	---	---	---	PASS
AP3M2	10947	broad.mit.edu	37	8	42022586	42022586	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42022586C>G	uc003xop.2	+						AP3M2_uc003xoo.2_Intron|AP3M2_uc010lxe.2_Intron|AP3M2_uc003xoq.1_Intron|AP3M2_uc003xor.1_Intron	NM_001134296	NP_001127768	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|Golgi apparatus					0	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			ATTCCTGTCTCAGGCTCCACA	0.368													8	52	---	---	---	---	PASS
SNAI2	6591	broad.mit.edu	37	8	49832466	49832466	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49832466C>T	uc003xqp.2	-	2	778	c.614G>A	c.(613-615)AGA>AAA	p.R205K		NM_003068	NP_003059	O43623	SNAI2_HUMAN	snail 2	205	C2H2-type 3.				canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				CGTGTGAGTTCTAATGTGTCC	0.483													26	110	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55541287	55541287	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55541287C>A	uc003xsd.1	+	4	4993	c.4845C>A	c.(4843-4845)GGC>GGA	p.G1615G	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1615					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			ATGACAGTGGCGAACTTACCC	0.398													27	115	---	---	---	---	PASS
TMEM68	137695	broad.mit.edu	37	8	56663694	56663694	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56663694C>A	uc003xsg.1	-	3	585	c.516G>T	c.(514-516)GTG>GTT	p.V172V	TMEM68_uc003xsh.1_Silent_p.V172V	NM_152417	NP_689630	Q96MH6	TMM68_HUMAN	transmembrane protein 68	172						integral to membrane	acyltransferase activity			skin(1)	1			Epithelial(17;0.000361)|all cancers(17;0.00326)			GAGCACAAAACACATCCAGTA	0.353													14	114	---	---	---	---	PASS
MOS	4342	broad.mit.edu	37	8	57025860	57025860	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57025860C>G	uc011leb.1	-	1	682	c.682G>C	c.(682-684)GAT>CAT	p.D228H		NM_005372	NP_005363	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene	228	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|ovary(1)|central_nervous_system(1)	4			Epithelial(17;0.00117)|all cancers(17;0.00879)			CACAGCAGATCTTCCAACTTC	0.542													21	72	---	---	---	---	PASS
MOS	4342	broad.mit.edu	37	8	57025872	57025872	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57025872C>G	uc011leb.1	-	1	670	c.670G>C	c.(670-672)GAG>CAG	p.E224Q		NM_005372	NP_005363	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene	224	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|ovary(1)|central_nervous_system(1)	4			Epithelial(17;0.00117)|all cancers(17;0.00879)			TCCAACTTCTCAGAGCAACCG	0.542													12	75	---	---	---	---	PASS
ARFGEF1	10565	broad.mit.edu	37	8	68151048	68151048	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68151048C>G	uc003xxo.1	-	21	3450	c.3060G>C	c.(3058-3060)CAG>CAC	p.Q1020H	ARFGEF1_uc003xxl.1_Missense_Mutation_p.Q474H|ARFGEF1_uc003xxn.1_Missense_Mutation_p.Q3H	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	1020					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CAATGTTCTTCTGTTTCATTT	0.353													23	98	---	---	---	---	PASS
SLCO5A1	81796	broad.mit.edu	37	8	70591617	70591617	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70591617G>T	uc003xyl.2	-	8	2727	c.2020C>A	c.(2020-2022)CTC>ATC	p.L674I	SLCO5A1_uc010lzb.2_Missense_Mutation_p.L619I|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_Missense_Mutation_p.L674I	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	674	Helical; Name=10; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TCTCACCTGAGTGTTACTATG	0.423													38	177	---	---	---	---	PASS
SLCO5A1	81796	broad.mit.edu	37	8	70744042	70744042	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70744042T>C	uc003xyl.2	-	2	1574	c.867A>G	c.(865-867)TTA>TTG	p.L289L	SLCO5A1_uc010lzb.2_Silent_p.L289L|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_Silent_p.L289L|SLCO5A1_uc010lzc.2_Silent_p.L289L	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	289	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			CATTGTCATCTAAGTAGGTTG	0.418													32	131	---	---	---	---	PASS
MSC	9242	broad.mit.edu	37	8	72754891	72754891	+	3'UTR	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72754891C>A	uc003xyx.1	-	2					uc011lff.1_5'Flank|uc003xyy.2_5'Flank	NM_005098	NP_005089	O60682	MUSC_HUMAN	musculin						transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0	Breast(64;0.176)		Epithelial(68;0.137)|BRCA - Breast invasive adenocarcinoma(89;0.203)			GAGTTCCAGTCCGATTTAAGC	0.507													107	667	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72936152	72936152	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72936152G>A	uc003xza.2	-						uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1							integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	ATATGCTGTCGGATAAAAAAT	0.264													24	97	---	---	---	---	PASS
C8orf84	157869	broad.mit.edu	37	8	73979610	73979610	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73979610G>C	uc003xzf.2	-	5	966	c.761C>G	c.(760-762)TCT>TGT	p.S254C		NM_153225	NP_694957	Q8IVN8	RPESP_HUMAN	RPE-spondin precursor	254					immune response	extracellular region	polysaccharide binding|scavenger receptor activity				0						AGCTGGACAAGAACACTGGTC	0.353													51	105	---	---	---	---	PASS
FAM164A	51101	broad.mit.edu	37	8	79610757	79610757	+	Intron	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79610757A>G	uc003ybd.2	+							NM_016010	NP_057094	Q96GY0	F164A_HUMAN	hypothetical protein LOC51101											ovary(1)	1						GGGTAAGTCTACACTGGATAT	0.353													17	114	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87616376	87616376	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87616376C>G	uc003ydx.2	-	15	1772	c.1726G>C	c.(1726-1728)GAT>CAT	p.D576H	CNGB3_uc010maj.2_Missense_Mutation_p.D438H	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	576	Cytoplasmic (Potential).|cGMP (By similarity).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						TTAGTACCATCAGGGCCTCCA	0.373													27	99	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87656908	87656908	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87656908A>T	uc003ydx.2	-	9	1043	c.997T>A	c.(997-999)TCA>ACA	p.S333T	CNGB3_uc010maj.2_Missense_Mutation_p.S195T	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	333	Extracellular (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						TCAAAAAATGAAGTGTACTAT	0.249													19	96	---	---	---	---	PASS
RUNX1T1	862	broad.mit.edu	37	8	92982954	92982954	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92982954C>T	uc003yfd.2	-	10	1555	c.1471G>A	c.(1471-1473)GCC>ACC	p.A491T	RUNX1T1_uc003yfc.1_Missense_Mutation_p.A464T|RUNX1T1_uc003yfe.1_Missense_Mutation_p.A454T|RUNX1T1_uc010mao.2_Missense_Mutation_p.A464T|RUNX1T1_uc011lgi.1_Missense_Mutation_p.A502T|RUNX1T1_uc010man.1_Missense_Mutation_p.A116T|RUNX1T1_uc003yfb.1_Missense_Mutation_p.A454T	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1	491					generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TTGGCCTCGGCGACCGTGCGC	0.602													21	35	---	---	---	---	PASS
KIAA1429	25962	broad.mit.edu	37	8	95503956	95503956	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95503956C>G	uc003ygo.1	-	22	5003	c.4990G>C	c.(4990-4992)GAA>CAA	p.E1664Q	KIAA1429_uc010maz.1_Intron	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	1664					mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			GGAACCACTTCTTTACTTTCA	0.443													36	206	---	---	---	---	PASS
ESRP1	54845	broad.mit.edu	37	8	95677150	95677150	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95677150C>G	uc003ygq.3	+						ESRP1_uc003ygr.3_Intron|ESRP1_uc003ygs.3_Intron|ESRP1_uc003ygt.3_Intron|ESRP1_uc003ygu.3_Intron|ESRP1_uc003ygv.2_Intron|ESRP1_uc003ygw.2_Intron	NM_017697	NP_060167	Q6NXG1	ESRP1_HUMAN	RNA binding motif protein 35A isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	nucleus|plasma membrane	mRNA binding|nucleotide binding		ESRP1/RAF1(4)	prostate(4)	4						TTATTATTCTCAAAGGGGAGG	0.398													13	218	---	---	---	---	PASS
C8orf37	157657	broad.mit.edu	37	8	96275974	96275974	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96275974C>G	uc003yho.1	-	2	204	c.184G>C	c.(184-186)GAT>CAT	p.D62H		NM_177965	NP_808880	Q96NL8	CH037_HUMAN	hypothetical protein LOC157657	62											0	Breast(36;3.41e-05)					CTGTCAAGATCATCTTCTTTT	0.318													15	99	---	---	---	---	PASS
GDF6	392255	broad.mit.edu	37	8	97172861	97172861	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97172861C>T	uc003yhp.2	-	1	160	c.60G>A	c.(58-60)TTG>TTA	p.L20L		NM_001001557	NP_001001557	Q6KF10	GDF6_HUMAN	growth differentiation factor 6 precursor	20					activin receptor signaling pathway|BMP signaling pathway|growth|pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(1)|breast(1)|pancreas(1)	3	Breast(36;2.67e-05)					GGAAACCGGGCAAATCCCACA	0.637													39	66	---	---	---	---	PASS
PTDSS1	9791	broad.mit.edu	37	8	97316271	97316271	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97316271C>T	uc003yht.1	+	7	858	c.756C>T	c.(754-756)GAC>GAT	p.D252D	PTDSS1_uc003yhu.1_Silent_p.D106D	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	252					phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	CTTACAGGGACATTCATACCA	0.433													42	271	---	---	---	---	PASS
TSPYL5	85453	broad.mit.edu	37	8	98290039	98290039	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98290039G>T	uc003yhy.2	-	1	138	c.34C>A	c.(34-36)CGC>AGC	p.R12S		NM_033512	NP_277047	Q86VY4	TSYL5_HUMAN	TSPY-like 5	12					cellular response to gamma radiation|nucleosome assembly|positive regulation of cell proliferation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|regulation of growth	nucleus	protein binding	p.R12H(1)		large_intestine(1)|ovary(1)	2	Breast(36;2.56e-06)					TTTTTGGCGCGGGAGGACTTT	0.692													4	12	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100568706	100568706	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100568706G>T	uc003yiv.2	+	31	4960	c.4849G>T	c.(4849-4851)GAT>TAT	p.D1617Y	VPS13B_uc003yiw.2_Missense_Mutation_p.D1592Y	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	1617					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AATTCTTCGAGATCCTGGATC	0.358													13	67	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100865863	100865863	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100865863G>C	uc003yiv.2	+	56	10432	c.10321G>C	c.(10321-10323)GAA>CAA	p.E3441Q	VPS13B_uc003yiw.2_Missense_Mutation_p.E3416Q	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3441					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TGCGTTGTTTGAACTTTACTG	0.522													18	88	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	100990140	100990140	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100990140C>G	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TGAGTCTTGTCTCACCTTTCC	0.303													20	113	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	100999760	100999760	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100999760G>C	uc003yjb.1	-	21	3301	c.3106C>G	c.(3106-3108)CAA>GAA	p.Q1036E	RGS22_uc003yja.1_Missense_Mutation_p.Q855E|RGS22_uc003yjc.1_Missense_Mutation_p.Q1024E	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	1036	RGS 2.				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			ACAAAACGTTGAAATTGTCTT	0.358													3	113	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103307771	103307771	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103307771G>C	uc003ykr.1	-						UBR5_uc003yks.1_Intron	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin						cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CTGCAAAACAGAATGTTGTCG	0.473													23	105	---	---	---	---	PASS
DPYS	1807	broad.mit.edu	37	8	105436529	105436529	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105436529C>G	uc003yly.3	-	7	1310	c.1181G>C	c.(1180-1182)AGA>ACA	p.R394T		NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	394					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TACAGCTATTCTTCCTTTTCT	0.378													7	233	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106431476	106431476	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106431476G>T	uc003ymd.2	+	2	168	c.145G>T	c.(145-147)GAA>TAA	p.E49*		NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	49					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CTTTTCCACAGAATTTGGGCC	0.398													24	119	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110413772	110413772	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110413772G>T	uc003yne.2	+	14	1432	c.1328G>T	c.(1327-1329)AGT>ATT	p.S443I		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	443	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TATTTTTCCAGTCCAACACAA	0.348										HNSCC(38;0.096)			23	57	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113314138	113314138	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113314138G>C	uc003ynu.2	-	53	8483	c.8324C>G	c.(8323-8325)ACT>AGT	p.T2775S	CSMD3_uc003yns.2_Missense_Mutation_p.T1977S|CSMD3_uc003ynt.2_Missense_Mutation_p.T2735S|CSMD3_uc011lhx.1_Missense_Mutation_p.T2606S	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2775	Extracellular (Potential).|Sushi 17.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GCCATATGAAGTTTGAGTTCC	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			26	102	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113668386	113668386	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113668386C>T	uc003ynu.2	-	18	3160	c.3001G>A	c.(3001-3003)GAA>AAA	p.E1001K	CSMD3_uc003yns.2_Missense_Mutation_p.E273K|CSMD3_uc003ynt.2_Missense_Mutation_p.E961K|CSMD3_uc011lhx.1_Missense_Mutation_p.E897K	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1001	Extracellular (Potential).|CUB 5.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TACTTACTTTCATAATGAATC	0.294										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			13	100	---	---	---	---	PASS
ENPP2	5168	broad.mit.edu	37	8	120594819	120594819	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120594819G>C	uc003yot.1	-	18	1653	c.1567C>G	c.(1567-1569)CCT>GCT	p.P523A	ENPP2_uc011lic.1_Missense_Mutation_p.P40A|ENPP2_uc003yor.1_Missense_Mutation_p.P162A|ENPP2_uc003yos.1_Missense_Mutation_p.P575A|ENPP2_uc010mdd.1_Missense_Mutation_p.P523A	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	523					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CCATTATTAGGAGCTGGCTTC	0.413													41	359	---	---	---	---	PASS
FAM83A	84985	broad.mit.edu	37	8	124206350	124206350	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124206350C>T	uc003ypv.2	+	4	2749	c.735C>T	c.(733-735)ATC>ATT	p.I245I	FAM83A_uc003ypw.2_Silent_p.I245I|FAM83A_uc003ypy.2_Silent_p.I189I|FAM83A_uc003ypx.2_Silent_p.I245I|FAM83A_uc003ypz.2_Silent_p.I245I	NM_032899	NP_116288	Q86UY5	FA83A_HUMAN	hypothetical protein LOC84985 isoform a	245										ovary(3)|skin(1)	4	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			AGAAGTTCATCATCTCGGACT	0.498													15	138	---	---	---	---	PASS
C8orf76	84933	broad.mit.edu	37	8	124253535	124253535	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124253535C>G	uc003yqc.1	-	1	83	c.52G>C	c.(52-54)GAG>CAG	p.E18Q	C8orf76_uc003yqd.2_Intron	NM_032847	NP_116236	Q96K31	CH076_HUMAN	hypothetical protein LOC84933	18							binding			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			GGCCTCTCCTCGAACACCGAG	0.672													4	22	---	---	---	---	PASS
ATAD2	29028	broad.mit.edu	37	8	124349909	124349909	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124349909C>G	uc003yqh.3	-	21	3115	c.3007G>C	c.(3007-3009)GAC>CAC	p.D1003H	ATAD2_uc011lii.1_Missense_Mutation_p.D794H|ATAD2_uc003yqi.3_RNA	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1003	Bromo.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			AATCGCTTGTCAATAGCAAGC	0.373													14	171	---	---	---	---	PASS
ANXA13	312	broad.mit.edu	37	8	124707798	124707798	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124707798C>G	uc003yqu.2	-	6	488	c.415G>C	c.(415-417)GAT>CAT	p.D139H	ANXA13_uc003yqt.2_Missense_Mutation_p.D180H	NM_004306	NP_004297	P27216	ANX13_HUMAN	annexin A13 isoform a	139	Annexin 2.				cell differentiation	plasma membrane	calcium ion binding|calcium-dependent phospholipid binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			CCTTTGACATCTGATTCGAGG	0.388													51	455	---	---	---	---	PASS
SQLE	6713	broad.mit.edu	37	8	126011914	126011914	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126011914A>C	uc011liq.1	+	1	1195	c.269A>C	c.(268-270)AAG>ACG	p.K90T		NM_003129	NP_003120	Q14534	ERG1_HUMAN	squalene epoxidase	90					cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome	flavin adenine dinucleotide binding|squalene monooxygenase activity			ovary(1)|breast(1)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)		Butenafine(DB01091)|Naftifine(DB00735)|Terbinafine(DB00857)	TCAGAAAATAAGGAGCAGCTC	0.483													4	49	---	---	---	---	PASS
MYC	4609	broad.mit.edu	37	8	128752800	128752800	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128752800C>G	uc003ysi.2	+	3	1486	c.961C>G	c.(961-963)CAG>GAG	p.Q321E		NM_002467	NP_002458	P01106	MYC_HUMAN	myc proto-oncogene protein	306					branching involved in ureteric bud morphogenesis|cell cycle arrest|cell proliferation|cellular iron ion homeostasis|positive regulation of metanephric cap mesenchymal cell proliferation|positive regulation of transcription, DNA-dependent|regulation of telomere maintenance|regulation of transcription from RNA polymerase II promoter|response to drug	nucleolus|nucleoplasm	E-box binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(3)|ovary(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)		CTCCACACATCAGCACAACTA	0.562		3	A|T	IGK@|BCL5|BCL7A |BTG1|TRA@|IGH@	Burkitt lymphoma| amplified in other cancers|B-CLL								8	72	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131955589	131955589	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131955589C>G	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AAATTAAATTCAACTCACATG	0.468										HNSCC(32;0.087)			4	65	---	---	---	---	PASS
PHF20L1	51105	broad.mit.edu	37	8	133806669	133806669	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133806669A>G	uc003ytt.2	+	3	422	c.97A>G	c.(97-99)ATT>GTT	p.I33V	PHF20L1_uc003ytr.2_Missense_Mutation_p.I33V|PHF20L1_uc010mdv.2_Missense_Mutation_p.I33V|PHF20L1_uc003yts.2_Missense_Mutation_p.I33V|PHF20L1_uc011lja.1_Missense_Mutation_p.I33V|PHF20L1_uc003ytu.1_RNA|PHF20L1_uc003ytq.2_Missense_Mutation_p.I33V	NM_016018	NP_057102	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1 isoform 1	33	Tudor 1.						nucleic acid binding|zinc ion binding			ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TCCATCACGAATTGAAAAAAT	0.348													16	159	---	---	---	---	PASS
KHDRBS3	10656	broad.mit.edu	37	8	136619262	136619262	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136619262A>G	uc003yuv.2	+	7	1266	c.872A>G	c.(871-873)TAT>TGT	p.Y291C	KHDRBS3_uc003yuw.2_Intron|KHDRBS3_uc010mek.2_RNA	NM_006558	NP_006549	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal	291	Tyr-rich.				regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			GATAACAGCTATAGCACCCCA	0.403													38	307	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139601674	139601674	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139601674C>A	uc003yvd.2	-	65	5150	c.4703G>T	c.(4702-4704)GGG>GTG	p.G1568V	COL22A1_uc011ljo.1_Missense_Mutation_p.G848V	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1568	Pro-rich.|Gly-rich.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCCAGGTTCCCCGGGTTGACC	0.582										HNSCC(7;0.00092)			6	26	---	---	---	---	PASS
PTK2	5747	broad.mit.edu	37	8	141745438	141745438	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141745438G>A	uc003yvu.2	-	22	2172	c.1942C>T	c.(1942-1944)CCT>TCT	p.P648S	PTK2_uc003yvo.2_Missense_Mutation_p.P276S|PTK2_uc011ljq.1_Missense_Mutation_p.P343S|PTK2_uc003yvp.2_Missense_Mutation_p.P316S|PTK2_uc003yvq.2_Missense_Mutation_p.P174S|PTK2_uc003yvr.2_Missense_Mutation_p.P588S|PTK2_uc003yvs.2_Missense_Mutation_p.P648S|PTK2_uc003yvt.2_Missense_Mutation_p.P670S|PTK2_uc003yvv.2_Missense_Mutation_p.P548S|PTK2_uc011ljr.1_Missense_Mutation_p.P648S|MIR151_hsa-mir-151|MI0000809_5'Flank	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a	648	Protein kinase.				axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			AGGGTAGGAGGACAATTTGGA	0.478													36	129	---	---	---	---	PASS
SLURP1	57152	broad.mit.edu	37	8	143823764	143823764	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143823764C>T	uc003ywy.2	-	1	66	c.40G>A	c.(40-42)GCC>ACC	p.A14T		NM_020427	NP_065160	P55000	SLUR1_HUMAN	ARS component B precursor	14					cell activation|cell adhesion	extracellular space	cytokine activity				0	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					ATGCTCCAGGCTGCCACGAGC	0.637													13	45	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143960579	143960579	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143960579C>A	uc003yxi.2	-	2	271	c.264G>T	c.(262-264)ATG>ATT	p.M88I	CYP11B1_uc003yxh.2_5'Flank|CYP11B1_uc003yxj.2_Missense_Mutation_p.M88I|CYP11B1_uc010mey.2_Missense_Mutation_p.M133I	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	88					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	TCACACACACCATGCCTGCTC	0.632									Familial_Hyperaldosteronism_type_I				29	124	---	---	---	---	PASS
CYP11B2	1585	broad.mit.edu	37	8	143996191	143996191	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143996191G>T	uc003yxk.1	-	4	732	c.729C>A	c.(727-729)AGC>AGA	p.S243R		NM_000498	NP_000489	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B,	243					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity				0	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Candesartan(DB00796)|Metyrapone(DB01011)	AGCGAGACAGGCTCCTGGGCA	0.607									Familial_Hyperaldosteronism_type_I				7	40	---	---	---	---	PASS
ZNF707	286075	broad.mit.edu	37	8	144776412	144776412	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144776412C>G	uc003yze.3	+	7	1143	c.828C>G	c.(826-828)CTC>CTG	p.L276L	ZNF707_uc010mfh.2_Silent_p.L276L|ZNF707_uc010mfi.2_Silent_p.L276L|ZNF707_uc003yzf.3_Silent_p.L276L|ZNF707_uc003yzh.3_Silent_p.L203L|ZNF707_uc011lkq.1_RNA|BREA2_uc010mfj.1_5'Flank	NM_173831	NP_776192	Q96C28	ZN707_HUMAN	zinc finger protein 707	276	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(1)	1	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;5.6e-41)|Epithelial(56;1.02e-39)|all cancers(56;9.65e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CCAACCTTCTCAGACACCAGC	0.632													9	9	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144992859	144992859	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144992859G>C	uc003zaf.1	-	32	11711	c.11541C>G	c.(11539-11541)CTC>CTG	p.L3847L	PLEC_uc003zab.1_Silent_p.L3710L|PLEC_uc003zac.1_Silent_p.L3714L|PLEC_uc003zad.2_Silent_p.L3710L|PLEC_uc003zae.1_Silent_p.L3678L|PLEC_uc003zag.1_Silent_p.L3688L|PLEC_uc003zah.2_Silent_p.L3696L|PLEC_uc003zaj.2_Silent_p.L3737L	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3847	Globular 2.|Plectin 17.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GCCCTTTCTTGAGAGCCTGGT	0.662													12	114	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144998187	144998187	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144998187C>T	uc003zaf.1	-	31	6491	c.6321G>A	c.(6319-6321)GCG>GCA	p.A2107A	PLEC_uc003zab.1_Silent_p.A1970A|PLEC_uc003zac.1_Silent_p.A1974A|PLEC_uc003zad.2_Silent_p.A1970A|PLEC_uc003zae.1_Silent_p.A1938A|PLEC_uc003zag.1_Silent_p.A1948A|PLEC_uc003zah.2_Silent_p.A1956A|PLEC_uc003zaj.2_Silent_p.A1997A	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2107	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GCCGCTGCCTCGCAGCCTCCA	0.746													6	17	---	---	---	---	PASS
GPAA1	8733	broad.mit.edu	37	8	145138624	145138624	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145138624C>G	uc003zax.2	+	4	484	c.374C>G	c.(373-375)TCG>TGG	p.S125W	GPAA1_uc003zav.1_Missense_Mutation_p.S3W|GPAA1_uc003zaw.1_Missense_Mutation_p.S65W	NM_003801	NP_003792	O43292	GPAA1_HUMAN	glycosylphosphatidylinositol anchor attachment	125	Lumenal (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation|protein complex assembly|protein retention in ER lumen	GPI-anchor transamidase complex	tubulin binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAGATGGTGTCGGGCACCAAC	0.637													11	68	---	---	---	---	PASS
ZNF34	80778	broad.mit.edu	37	8	145999641	145999641	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145999641G>C	uc003zdy.3	-	6	795	c.693C>G	c.(691-693)ATC>ATG	p.I231M	ZNF34_uc010mgb.2_Missense_Mutation_p.I128M|ZNF34_uc003zdx.3_Missense_Mutation_p.I210M	NM_030580	NP_085057	Q8IZ26	ZNF34_HUMAN	zinc finger protein 34	231					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)		TTGCACTGAAGATTTCCCCAG	0.358													9	77	---	---	---	---	PASS
SMARCA2	6595	broad.mit.edu	37	9	2096651	2096651	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2096651C>G	uc003zhc.2	+						SMARCA2_uc003zhd.2_Intron|SMARCA2_uc010mha.2_Intron	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		GTTCTCTTTTCTGCAGGTGGA	0.483													59	87	---	---	---	---	PASS
IFNA10	3446	broad.mit.edu	37	9	21206859	21206859	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21206859G>A	uc003zoq.1	-	1	284	c.238C>T	c.(238-240)CTC>TTC	p.L80F	IFNA14_uc003zoo.1_Intron	NM_002171	NP_002162	P01566	IFN10_HUMAN	interferon, alpha 10 precursor	80					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		ATCTCATGGAGGACAGAGATG	0.483													4	96	---	---	---	---	PASS
IFNA10	3446	broad.mit.edu	37	9	21206861	21206861	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21206861A>G	uc003zoq.1	-	1	282	c.236T>C	c.(235-237)GTC>GCC	p.V79A	IFNA14_uc003zoo.1_Intron	NM_002171	NP_002162	P01566	IFN10_HUMAN	interferon, alpha 10 precursor	79					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		CTCATGGAGGACAGAGATGGC	0.488													4	99	---	---	---	---	PASS
UBAP1	51271	broad.mit.edu	37	9	34241603	34241603	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34241603C>G	uc003ztx.2	+	4	815	c.580C>G	c.(580-582)CAG>GAG	p.Q194E	UBAP1_uc010mka.1_Missense_Mutation_p.Q230E|UBAP1_uc003zty.2_Missense_Mutation_p.Q194E|UBAP1_uc011loi.1_Missense_Mutation_p.Q230E|UBAP1_uc011loj.1_Missense_Mutation_p.Q258E|KIF24_uc010mkb.2_Intron|UBAP1_uc003ztz.2_Missense_Mutation_p.Q194E	NM_016525	NP_057609	Q9NZ09	UBAP1_HUMAN	ubiquitin associated protein 1	194						cytoplasm					0			LUSC - Lung squamous cell carcinoma(29;0.00272)			CATTATGGCTCAGTTATTGGA	0.468													3	81	---	---	---	---	PASS
TMEM8B	51754	broad.mit.edu	37	9	35853186	35853186	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35853186G>C	uc003zym.2	+	13	2030	c.1015G>C	c.(1015-1017)GAC>CAC	p.D339H	TMEM8B_uc003zyo.2_Missense_Mutation_p.D339H	NM_001042589	NP_001036054	A6NDV4	TMM8B_HUMAN	transmembrane protein 8B isoform a	339	Extracellular (Potential).				cell-matrix adhesion|regulation of growth|regulation of mitotic cell cycle	cell surface|endoplasmic reticulum|integral to membrane|mitochondrion|nucleus|plasma membrane	protein binding			ovary(1)	1						TCTGCAGCTTGACCGACATGG	0.602													41	240	---	---	---	---	PASS
OR2S2	56656	broad.mit.edu	37	9	35957495	35957495	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35957495C>G	uc011lpi.1	-	1	657	c.601G>C	c.(601-603)GAG>CAG	p.E201Q		NM_019897	NP_063950	Q9NQN1	OR2S1_HUMAN	olfactory receptor, family 2, subfamily S,	201	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(32;0.00613)|STAD - Stomach adenocarcinoma(86;0.194)			TTCGTCACCTCCATGCTGATC	0.493													21	133	---	---	---	---	PASS
OR2S2	56656	broad.mit.edu	37	9	35957889	35957889	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35957889G>C	uc011lpi.1	-	1	263	c.207C>G	c.(205-207)TTC>TTG	p.F69L		NM_019897	NP_063950	Q9NQN1	OR2S1_HUMAN	olfactory receptor, family 2, subfamily S,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(32;0.00613)|STAD - Stomach adenocarcinoma(86;0.194)			AGATGTCCAGGAAGGAGAGGT	0.567													19	35	---	---	---	---	PASS
PIP5K1B	8395	broad.mit.edu	37	9	71478840	71478840	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71478840C>G	uc004agu.2	+	5	462	c.157C>G	c.(157-159)CTT>GTT	p.L53V	PIP5K1B_uc011lrq.1_Missense_Mutation_p.L53V|PIP5K1B_uc004agv.2_RNA	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	53	PIPK.					endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		ACGAGATGTTCTTATGCAAGA	0.403													7	301	---	---	---	---	PASS
HNRNPK	3190	broad.mit.edu	37	9	86584254	86584254	+	3'UTR	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86584254C>T	uc004ang.3	-	17					HNRNPK_uc011lsw.1_3'UTR|HNRNPK_uc004and.3_3'UTR|HNRNPK_uc004ank.3_3'UTR|HNRNPK_uc004anf.3_3'UTR|HNRNPK_uc004anh.3_3'UTR|HNRNPK_uc011lsx.1_3'UTR|HNRNPK_uc004ani.3_3'UTR|HNRNPK_uc004anj.3_3'UTR|HNRNPK_uc004ann.3_3'UTR|HNRNPK_uc004anl.3_3'UTR|HNRNPK_uc004anm.3_3'UTR	NM_031262	NP_112552	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K						interspecies interaction between organisms|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of receptor-mediated endocytosis|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of low-density lipoprotein particle clearance|signal transduction	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nuclear chromatin|nucleoplasm	protein binding|RNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|single-stranded DNA binding			skin(1)	1						TCCTTCAGTTCTTCACTAGTC	0.348													24	140	---	---	---	---	PASS
DAPK1	1612	broad.mit.edu	37	9	90312079	90312079	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90312079C>G	uc004apc.2	+	22	2709	c.2571C>G	c.(2569-2571)CTC>CTG	p.L857L	DAPK1_uc004apd.2_Silent_p.L857L|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Silent_p.L594L	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	857					apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						TTTTCTGGCTCAGTTTCCTGA	0.488									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				18	96	---	---	---	---	PASS
FAM22G	441457	broad.mit.edu	37	9	99694157	99694157	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99694157C>G	uc004awq.1	+	2	885	c.170C>G	c.(169-171)TCT>TGT	p.S57C		NM_001045477	NP_001038942	Q5VZR2	FA22G_HUMAN	hypothetical protein LOC441457	57										skin(1)	1		Acute lymphoblastic leukemia(62;0.0527)				CTGGTGCTCTCTGCCTTCCCC	0.657													3	18	---	---	---	---	PASS
C9orf125	84302	broad.mit.edu	37	9	104238938	104238938	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104238938A>G	uc004bbm.2	-	2	759	c.437T>C	c.(436-438)GTG>GCG	p.V146A	uc004bbl.1_5'Flank	NM_032342	NP_115718	Q9BRR3	CI125_HUMAN	hypothetical protein LOC84302	146						integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)				ACTACGCTCCACGTTGCACAG	0.557													20	80	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107560723	107560723	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107560723G>C	uc004bcl.2	-	37	5413	c.5100C>G	c.(5098-5100)CTC>CTG	p.L1700L		NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	1700					Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CAAAATTAGAGAGCCAGTAGA	0.483													32	67	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107560846	107560846	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107560846G>A	uc004bcl.2	-	37	5290	c.4977C>T	c.(4975-4977)ATC>ATT	p.I1659I		NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	1659	Helical; (Potential).				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AGATGACACAGATGGACACAA	0.498													3	62	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113265483	113265483	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113265483G>A	uc010mtz.2	-	6	1655	c.1318C>T	c.(1318-1320)CAT>TAT	p.H440Y	SVEP1_uc010mua.1_Missense_Mutation_p.H440Y|SVEP1_uc004beu.2_Missense_Mutation_p.H440Y	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	440	Sushi 2.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						TGGCGGAGATGAGGACATGTT	0.373													59	84	---	---	---	---	PASS
ZFP37	7539	broad.mit.edu	37	9	115818839	115818839	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115818839C>T	uc004bgm.1	-	1	158	c.130G>A	c.(130-132)GCG>ACG	p.A44T	ZFP37_uc011lwz.1_Missense_Mutation_p.A44T|ZFP37_uc011lxa.1_Missense_Mutation_p.A44T	NM_003408	NP_003399	Q9Y6Q3	ZFP37_HUMAN	zinc finger protein 37 homolog	44	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						GCTCTCACCGCGGCGCTGGCC	0.592													109	177	---	---	---	---	PASS
POLE3	54107	broad.mit.edu	37	9	116172501	116172501	+	Intron	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116172501T>C	uc011lxg.1	-						POLE3_uc004bhn.2_Intron|C9orf43_uc004bho.3_5'Flank|C9orf43_uc004bhp.2_5'Flank	NM_017443	NP_059139	Q9NRF9	DPOE3_HUMAN	DNA-directed DNA polymerase epsilon 3						DNA replication|histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex	DNA-directed DNA polymerase activity|protein binding|sequence-specific DNA binding				0						CCCCCCGAGCTGCTCACCGCC	0.652													5	22	---	---	---	---	PASS
RABGAP1	23637	broad.mit.edu	37	9	125782649	125782649	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125782649G>A	uc011lzh.1	+	13	1839	c.1705G>A	c.(1705-1707)GAA>AAA	p.E569K	RABGAP1_uc004bnl.3_RNA	NM_012197	NP_036329	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	569	Rab-GAP TBC.				cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5						CGGTGTCCCTGAAGCTCTTCG	0.443													20	104	---	---	---	---	PASS
RALGPS1	9649	broad.mit.edu	37	9	129937052	129937052	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129937052G>T	uc004bqo.1	+	11	1168	c.901G>T	c.(901-903)GAT>TAT	p.D301Y	RALGPS1_uc011mab.1_Missense_Mutation_p.D301Y|RALGPS1_uc011mac.1_Missense_Mutation_p.D301Y|RALGPS1_uc004bqq.3_Missense_Mutation_p.D301Y	NM_014636	NP_055451	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1	301					small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1						TTCCAAGGAAGATCTTGCAGG	0.493													7	212	---	---	---	---	PASS
LCN2	3934	broad.mit.edu	37	9	130911799	130911799	+	5'UTR	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130911799G>C	uc004bto.1	+	1					LCN2_uc010mxq.1_5'UTR|LCN2_uc011map.1_5'UTR	NM_005564	NP_005555	P80188	NGAL_HUMAN	lipocalin 2 precursor						apoptosis|innate immune response|regulation of apoptosis|siderophore transport		iron ion binding|transporter activity				0						CCTCGGCCCTGAAATCATGCC	0.657													9	170	---	---	---	---	PASS
DNM1	1759	broad.mit.edu	37	9	130984795	130984795	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130984795C>G	uc011mau.1	+	8	1135	c.1048C>G	c.(1048-1050)CAG>GAG	p.Q350E	DNM1_uc010mxr.2_Missense_Mutation_p.Q350E|DNM1_uc011mat.1_Missense_Mutation_p.Q350E	NM_004408	NP_004399	Q05193	DYN1_HUMAN	dynamin 1 isoform 1	350					receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity			ovary(2)	2						CTCAGGAGATCAGATCGACAC	0.607													18	101	---	---	---	---	PASS
SPTAN1	6709	broad.mit.edu	37	9	131345472	131345472	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131345472C>A	uc004bvl.3	+	15	2036	c.1923C>A	c.(1921-1923)GTC>GTA	p.V641V	SPTAN1_uc011mbg.1_Silent_p.V641V|SPTAN1_uc011mbh.1_Silent_p.V653V|SPTAN1_uc004bvm.3_Silent_p.V641V|SPTAN1_uc004bvn.3_Silent_p.V641V	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	641	Spectrin 7.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						TGATTGATGTCAACCACTATG	0.463													3	62	---	---	---	---	PASS
TBC1D13	54662	broad.mit.edu	37	9	131568141	131568141	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131568141G>A	uc010myj.2	+	10	1045	c.922G>A	c.(922-924)GAG>AAG	p.E308K	TBC1D13_uc010myk.2_Missense_Mutation_p.E183K|TBC1D13_uc010myl.2_Missense_Mutation_p.E127K	NM_018201	NP_060671	Q9NVG8	TBC13_HUMAN	TBC1 domain family, member 13	308	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0						TCCCCAGCAAGAGCAGAACAT	0.597													6	30	---	---	---	---	PASS
BAT2L1	84726	broad.mit.edu	37	9	134348896	134348896	+	Silent	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134348896A>G	uc004can.3	+	14	2164	c.2109A>G	c.(2107-2109)GGA>GGG	p.G703G	BAT2L1_uc010mzj.1_Silent_p.G286G|BAT2L1_uc004cao.3_Silent_p.G61G	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	703							protein binding				0						CTTCTTCAGGACTGATGAAGC	0.502													3	13	---	---	---	---	PASS
C9orf98	158067	broad.mit.edu	37	9	135702386	135702386	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135702386G>C	uc004cbu.1	-	8	1168	c.612C>G	c.(610-612)CTC>CTG	p.L204L	C9orf98_uc010mzx.1_RNA|C9orf98_uc004cbv.1_5'UTR	NM_152572	NP_689785	Q96MA6	KAD8_HUMAN	putative adenylate kinase-like protein C9orf98	204						cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)		CTGGCACCATGAGACGGTTCT	0.517													52	283	---	---	---	---	PASS
TSC1	7248	broad.mit.edu	37	9	135804213	135804213	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135804213G>C	uc004cca.2	-	3	281	c.47C>G	c.(46-48)TCC>TGC	p.S16C	TSC1_uc004ccb.3_Missense_Mutation_p.S16C|TSC1_uc011mcq.1_Missense_Mutation_p.S16C|TSC1_uc011mcr.1_Intron|TSC1_uc011mcs.1_5'UTR|TSC1_uc004ccc.1_Missense_Mutation_p.S16C|TSC1_uc004ccd.2_Missense_Mutation_p.S16C|TSC1_uc004cce.1_Missense_Mutation_p.S16C	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1	16					activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding			lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CAGCATGGGGGAGTCCAGCAT	0.502			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				24	116	---	---	---	---	PASS
BRD3	8019	broad.mit.edu	37	9	136917502	136917502	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136917502T>A	uc004cew.2	-	3	465	c.277A>T	c.(277-279)AAT>TAT	p.N93Y	BRD3_uc004cex.2_Missense_Mutation_p.N93Y	NM_007371	NP_031397	Q15059	BRD3_HUMAN	bromodomain containing protein 3	93	Bromo 1.					nucleus	protein binding		BRD3/C15orf55(3)	stomach(4)|midline_organs(3)|kidney(1)	8				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		CAATAATAATTATTTTCTAGT	0.358			T	NUT|C15orf55	lethal midline carcinoma of young people								25	98	---	---	---	---	PASS
SNAPC4	6621	broad.mit.edu	37	9	139272375	139272375	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139272375G>A	uc004chh.2	-	21	3913	c.3904C>T	c.(3904-3906)CCC>TCC	p.P1302S		NM_003086	NP_003077	Q5SXM2	SNPC4_HUMAN	small nuclear RNA activating complex,	1302	SNAPC2-binding.				snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter	snRNA-activating protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		GGCTGATAGGGCAGTCTGCTG	0.701													9	24	---	---	---	---	PASS
C9orf86	55684	broad.mit.edu	37	9	139734662	139734662	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139734662G>C	uc004cji.1	+	14	2255	c.1987G>C	c.(1987-1989)GAG>CAG	p.E663Q	C9orf86_uc004cjj.1_Missense_Mutation_p.E664Q|C9orf86_uc004cjk.1_RNA|C9orf86_uc010nbr.1_Intron|C9orf86_uc004cjl.1_RNA|C9orf86_uc010nbs.1_Missense_Mutation_p.E548Q|C9orf86_uc004cjn.1_Missense_Mutation_p.E457Q	NM_024718	NP_078994	Q3YEC7	PARF_HUMAN	Rab-like GTP-binding protein 1 isoform 1	663	Interaction with CDKN2A.|Lys-rich.				small GTPase mediated signal transduction	cytoplasm|nucleus	GTP binding|protein binding				0	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.61e-05)|Epithelial(140;0.000183)		aaaAGGCAAAGAGGTACTGGC	0.537													10	35	---	---	---	---	PASS
RNF208	727800	broad.mit.edu	37	9	140115307	140115307	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140115307G>C	uc004clz.1	-	1	469	c.358C>G	c.(358-360)CAG>GAG	p.Q120E		NM_031297	NP_112587	Q9H0X6	RN208_HUMAN	ring finger protein 208	120							zinc ion binding				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		ATCACGTACTGATTCACAATG	0.682													12	21	---	---	---	---	PASS
FAM166A	401565	broad.mit.edu	37	9	140140245	140140245	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140140245C>T	uc004cmi.1	-	2	172	c.117G>A	c.(115-117)ACG>ACA	p.T39T		NM_001001710	NP_001001710	Q6J272	F166A_HUMAN	hypothetical protein LOC401565	39										ovary(1)	1						GCAGCTGCCCCGTGGTACGCC	0.602													16	51	---	---	---	---	PASS
WDR85	92715	broad.mit.edu	37	9	140449841	140449841	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140449841C>T	uc004cnk.1	-	9	1367	c.1209G>A	c.(1207-1209)ATG>ATA	p.M403I	WDR85_uc004cnj.1_Missense_Mutation_p.M132I|WDR85_uc004cnl.1_Missense_Mutation_p.M227I|WDR85_uc004cnm.1_Missense_Mutation_p.M164I|WDR85_uc004cnn.1_Missense_Mutation_p.M132I|WDR85_uc004cni.2_RNA	NM_138778	NP_620133	Q9BTV6	WDR85_HUMAN	WD repeat domain 85	403					peptidyl-diphthamide biosynthetic process from peptidyl-histidine						0	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.00029)|Epithelial(140;0.000509)		CATTCTTCCTCATGCCCTCTG	0.582													17	69	---	---	---	---	PASS
DIP2C	22982	broad.mit.edu	37	10	468776	468776	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:468776G>A	uc001ifp.2	-	5	682	c.592C>T	c.(592-594)CAG>TAG	p.Q198*	DIP2C_uc009xhk.1_Silent_p.L199L	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	198						nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		ATGTGGGTCTGAGCCATGACG	0.607													22	119	---	---	---	---	PASS
AKR1C2	1646	broad.mit.edu	37	10	5040915	5040915	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5040915C>A	uc010qan.1	-	5	651	c.472G>T	c.(472-474)GGA>TGA	p.G158*	AKR1E2_uc001ihl.1_Intron|AKR1C3_uc001ihr.2_Intron|AKR1C2_uc009xhy.2_Nonsense_Mutation_p.G132*|AKR1C2_uc001ihs.2_Nonsense_Mutation_p.G158*|AKR1C2_uc001iht.2_Nonsense_Mutation_p.G158*	NM_205845	NP_995317	P52895	AK1C2_HUMAN	aldo-keto reductase family 1, member C2	158					digestion|prostaglandin metabolic process|steroid metabolic process	cytoplasm	androsterone dehydrogenase (A-specific) activity|bile acid binding|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity				0					NADH(DB00157)|Ursodeoxycholic acid(DB01586)	TTGGCCAATCCTGCATCTTTA	0.473													51	107	---	---	---	---	PASS
PRKCQ	5588	broad.mit.edu	37	10	6533699	6533699	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6533699C>T	uc001ijj.1	-	8	811	c.736G>A	c.(736-738)GAA>AAA	p.E246K	PRKCQ_uc009xim.1_Missense_Mutation_p.E246K|PRKCQ_uc001iji.1_Missense_Mutation_p.E279K|PRKCQ_uc009xin.1_Missense_Mutation_p.E210K|PRKCQ_uc010qax.1_Missense_Mutation_p.E121K	NM_006257	NP_006248	Q04759	KPCT_HUMAN	protein kinase C, theta	246	Phorbol-ester/DAG-type 2.				axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6						CCACAGTGTTCACAGAAGGTC	0.517													29	156	---	---	---	---	PASS
DHTKD1	55526	broad.mit.edu	37	10	12150012	12150012	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12150012C>G	uc001ild.3	+	12	2251	c.2152C>G	c.(2152-2154)CAG>GAG	p.Q718E		NM_018706	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain	718					glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			ovary(1)|central_nervous_system(1)	2		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			GCGTTTCCTGCAGGTAAGGGT	0.527													15	97	---	---	---	---	PASS
CDC123	8872	broad.mit.edu	37	10	12279228	12279228	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12279228C>G	uc001ill.2	+	9	935	c.651C>G	c.(649-651)TTC>TTG	p.F217L	CDC123_uc001ilm.2_Missense_Mutation_p.F229L	NM_006023	NP_006014	O75794	CD123_HUMAN	cell division cycle 123	217					cell cycle arrest|cell division|positive regulation of cell proliferation|regulation of mitotic cell cycle	cytoplasm				central_nervous_system(1)	1						AAGACTTTTTCAAGAAACACA	0.289													8	141	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16911750	16911750	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16911750G>A	uc001ioo.2	-	59	9391	c.9339C>T	c.(9337-9339)TGC>TGT	p.C3113C	CUBN_uc009xjq.1_RNA|CUBN_uc009xjr.1_Silent_p.C469C	NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3113	CUB 23.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GCTTGGAACCGCAGAATTTGC	0.478													40	225	---	---	---	---	PASS
PRTFDC1	56952	broad.mit.edu	37	10	25231336	25231336	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25231336C>G	uc001ise.1	-	2	107	c.78G>C	c.(76-78)TTG>TTC	p.L26F	PRTFDC1_uc010qdd.1_Missense_Mutation_p.L26F|PRTFDC1_uc001isf.1_RNA|PRTFDC1_uc009xkm.1_RNA	NM_020200	NP_064585	Q9NRG1	PRDC1_HUMAN	phosphoribosyl transferase domain containing 1	26					adenine salvage|central nervous system neuron development|cerebral cortex neuron differentiation|cytolysis|dendrite morphogenesis|GMP salvage|grooming behavior|hypoxanthine metabolic process|IMP salvage|lymphocyte proliferation|positive regulation of dopamine metabolic process|purine ribonucleoside salvage|response to amphetamine|striatum development	cytosol	hypoxanthine phosphoribosyltransferase activity|magnesium ion binding|nucleotide binding|protein homodimerization activity			ovary(1)	1						TGAATAAATTCAAGTCATACC	0.358													32	180	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26359029	26359029	+	Intron	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26359029T>C	uc001isn.2	+						MYO3A_uc009xko.1_Intron|MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA						protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						TGTATTCTTTTTAACCTTTAG	0.294													40	49	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27306664	27306664	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27306664T>A	uc001ith.2	-	30	4442	c.4270A>T	c.(4270-4272)ACA>TCA	p.T1424S	ANKRD26_uc001itg.2_Missense_Mutation_p.T1111S|ANKRD26_uc009xku.1_Missense_Mutation_p.T1425S	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1424	Potential.					centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TGGTTCTTTGTATCCAGATGT	0.328													39	110	---	---	---	---	PASS
PARD3	56288	broad.mit.edu	37	10	34620181	34620181	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34620181C>G	uc010qej.1	-	19	2706	c.2706G>C	c.(2704-2706)TTG>TTC	p.L902F	PARD3_uc010qek.1_Missense_Mutation_p.L899F|PARD3_uc010qel.1_Missense_Mutation_p.L902F|PARD3_uc010qem.1_Missense_Mutation_p.L886F|PARD3_uc010qen.1_Missense_Mutation_p.L856F|PARD3_uc010qeo.1_Missense_Mutation_p.L856F|PARD3_uc010qep.1_Missense_Mutation_p.L812F|PARD3_uc010qeq.1_Missense_Mutation_p.L827F|PARD3_uc001ixo.1_Missense_Mutation_p.L615F|PARD3_uc001ixp.1_Missense_Mutation_p.L733F|PARD3_uc001ixq.1_Missense_Mutation_p.L856F|PARD3_uc001ixr.1_Missense_Mutation_p.L899F|PARD3_uc001ixt.1_Missense_Mutation_p.L720F|PARD3_uc001ixu.1_Missense_Mutation_p.L844F|PARD3_uc001ixs.1_Missense_Mutation_p.L525F	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog	902	Interacts with PRKCZ (By similarity).				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				TATCCCCATTCAAAGTCACCT	0.532													21	105	---	---	---	---	PASS
CUL2	8453	broad.mit.edu	37	10	35333489	35333489	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35333489C>G	uc001ixv.2	-						CUL2_uc009xma.2_Intron|CUL2_uc010qer.1_Intron|CUL2_uc001ixw.2_Intron|CUL2_uc010qes.1_Intron	NM_003591	NP_003582	Q13617	CUL2_HUMAN	cullin 2						cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding			ovary(3)	3						TGTTTTATTTCTTACCTTTTC	0.303													14	71	---	---	---	---	PASS
ZNF33A	7581	broad.mit.edu	37	10	38345149	38345149	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38345149G>A	uc001izh.2	+	5	2272	c.2094G>A	c.(2092-2094)GGG>GGA	p.G698G	ZNF33A_uc001izg.2_Silent_p.G699G|ZNF33A_uc010qev.1_Silent_p.G705G|ZNF33A_uc001izi.1_Intron	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b	698	C2H2-type 14.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						ATGAATGTGGGAAATTCTTCA	0.383													24	174	---	---	---	---	PASS
ZNF33B	7582	broad.mit.edu	37	10	43088960	43088960	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43088960G>A	uc001jaf.1	-	5	1553	c.1438C>T	c.(1438-1440)CAA>TAA	p.Q480*	ZNF33B_uc009xmg.1_Intron|ZNF33B_uc001jae.1_Intron|ZNF33B_uc001jag.1_Nonsense_Mutation_p.Q368*|ZNF33B_uc001jad.2_Intron	NM_006955	NP_008886	Q06732	ZN33B_HUMAN	zinc finger protein 33B	480	C2H2-type 6.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TGTGACTTTTGACAAAAGGAT	0.393													29	251	---	---	---	---	PASS
RET	5979	broad.mit.edu	37	10	43615124	43615124	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43615124C>T	uc001jal.2	+	14	2728	c.2538C>T	c.(2536-2538)CTC>CTT	p.L846L	RET_uc001jak.1_Silent_p.L846L|RET_uc010qez.1_Silent_p.L592L	NM_020975	NP_066124	P07949	RET_HUMAN	ret proto-oncogene isoform a	846	Protein kinase.|Cytoplasmic (Potential).				homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity			thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451		Ovarian(717;0.0423)			Sunitinib(DB01268)	AGCGGGCCCTCACCATGGGCG	0.647		1	T|Mis|N|F	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma	Hirschsprung disease		Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma				19	71	---	---	---	---	PASS
PPYR1	5540	broad.mit.edu	37	10	47086923	47086923	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47086923C>T	uc001jee.2	+	3	559	c.140C>T	c.(139-141)TCC>TTC	p.S47F	ANXA8_uc001jed.3_Intron|PPYR1_uc009xna.2_Missense_Mutation_p.S47F	NM_005972	NP_005963	P50391	NPY4R_HUMAN	pancreatic polypeptide receptor 1	47	Helical; Name=1; (Potential).				blood circulation|digestion|feeding behavior	integral to plasma membrane				ovary(1)|skin(1)	2						ATCGTCACTTCCTACAGCATT	0.522													15	304	---	---	---	---	PASS
RBP3	5949	broad.mit.edu	37	10	48389546	48389546	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48389546G>A	uc001jez.2	-	1	1446	c.1332C>T	c.(1330-1332)TTC>TTT	p.F444F		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	444	4 X approximate tandem repeats.|2.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	CAAAACTATCGAAGCGCAGGT	0.617													14	63	---	---	---	---	PASS
CSTF2T	23283	broad.mit.edu	37	10	53458459	53458459	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53458459C>G	uc001jjp.2	-	1	897	c.851G>C	c.(850-852)GGA>GCA	p.G284A	PRKG1_uc001jjm.2_Intron|PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_015235	NP_056050	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit	284	Gly-rich.				mRNA processing	nucleus	nucleotide binding|RNA binding			ovary(1)	1				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		CTGCATTGCTCCTCCAGGAGT	0.577													24	157	---	---	---	---	PASS
ADO	84890	broad.mit.edu	37	10	64565598	64565598	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64565598G>C	uc001jmg.2	+	1	1083	c.779G>C	c.(778-780)GGA>GCA	p.G260A		NM_032804	NP_116193	Q96SZ5	AEDO_HUMAN	2-aminoethanethiol (cysteamine) dioxygenase	260							cysteamine dioxygenase activity|metal ion binding				0	Prostate(12;0.0297)|all_hematologic(501;0.228)					TGGTGCGAGGGAGAACCCTAT	0.652													2	2	---	---	---	---	PASS
EGR2	1959	broad.mit.edu	37	10	64573644	64573644	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64573644G>T	uc010qim.1	-	3	908	c.754C>A	c.(754-756)CCA>ACA	p.P252T	EGR2_uc010qin.1_Missense_Mutation_p.P202T|EGR2_uc001jmi.2_Missense_Mutation_p.P252T|EGR2_uc010qio.1_Missense_Mutation_p.P265T|EGR2_uc009xph.2_Missense_Mutation_p.P252T	NM_001136177	NP_001129649	P11161	EGR2_HUMAN	early growth response 2 protein isoform a	252					fat cell differentiation|protein export from nucleus|transcription from RNA polymerase II promoter	cytoplasm|nucleus	chromatin binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding			ovary(2)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					GTGTCCAGTGGGCAGGGAAAG	0.597													26	62	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69934114	69934114	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69934114G>C	uc001jnm.3	+	12	2450	c.2265G>C	c.(2263-2265)CAG>CAC	p.Q755H	MYPN_uc001jnn.3_Missense_Mutation_p.Q480H|MYPN_uc001jno.3_Missense_Mutation_p.Q755H|MYPN_uc009xpt.2_Missense_Mutation_p.Q755H|MYPN_uc010qit.1_Missense_Mutation_p.Q461H|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	755						nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						AAACTATTCAGAGGACAGTGA	0.542													40	178	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69961666	69961666	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69961666G>C	uc001jnm.3	+	19	3759	c.3574G>C	c.(3574-3576)GAG>CAG	p.E1192Q	MYPN_uc001jnn.3_Missense_Mutation_p.E917Q|MYPN_uc001jno.3_Missense_Mutation_p.E1192Q|MYPN_uc009xpt.2_Missense_Mutation_p.E1192Q|MYPN_uc010qit.1_Missense_Mutation_p.E898Q|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	1192	Interaction with ACTN.|Ig-like 5.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						CGTGAGACTGGAGTGCCGCGT	0.547													36	153	---	---	---	---	PASS
CCAR1	55749	broad.mit.edu	37	10	70525822	70525822	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70525822G>C	uc001joo.2	+	17	2403	c.2284G>C	c.(2284-2286)GAA>CAA	p.E762Q	CCAR1_uc001jol.1_RNA|CCAR1_uc001jom.1_Missense_Mutation_p.E567Q|CCAR1_uc009xpx.1_Missense_Mutation_p.E736Q|CCAR1_uc001jon.1_Missense_Mutation_p.E708Q|CCAR1_uc010qiz.1_Missense_Mutation_p.E747Q|CCAR1_uc010qja.1_Missense_Mutation_p.E747Q|CCAR1_uc010qjb.1_RNA	NM_018237	NP_060707	Q8IX12	CCAR1_HUMAN	cell-cycle and apoptosis regulatory protein 1	762	Glu-rich.				apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7						GGATAATAAAGAACATTCATT	0.239													14	111	---	---	---	---	PASS
SYNPO2L	79933	broad.mit.edu	37	10	75407379	75407379	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75407379C>G	uc001jut.3	-	4	2183	c.2031G>C	c.(2029-2031)CTG>CTC	p.L677L	SYNPO2L_uc001jus.3_Silent_p.L453L	NM_001114133	NP_001107605	Q9H987	SYP2L_HUMAN	synaptopodin 2-like isoform a	677	Pro-rich.					cytoplasm|cytoskeleton	actin binding			ovary(1)	1	Prostate(51;0.0112)					CCCCGAGGCTCAGAGCATCTT	0.597													27	129	---	---	---	---	PASS
SFTPA1	653509	broad.mit.edu	37	10	81373854	81373854	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81373854C>T	uc001kap.2	+	6	853	c.732C>T	c.(730-732)ACC>ACT	p.T244T	SFTPA1_uc001kaq.2_Silent_p.T244T|SFTPA1_uc009xry.2_Silent_p.T259T|SFTPA1_uc001kar.2_Silent_p.T244T|SFTPA1_uc010qlt.1_Silent_p.T185T|SFTPA1_uc009xrz.2_Silent_p.T174T|SFTPA1_uc009xsa.2_Silent_p.T244T|SFTPA1_uc009xsf.2_RNA	NM_005411	NP_005402	Q8IWL2	SFTA1_HUMAN	surfactant protein A1 isoform 1	244	C-type lectin.				cell junction assembly|respiratory gaseous exchange	collagen|extracellular space	lipid transporter activity|sugar binding				0	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			CCCGACTGACCATCTGTGAGT	0.582													30	95	---	---	---	---	PASS
GHITM	27069	broad.mit.edu	37	10	85904678	85904678	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85904678A>T	uc001kcs.1	+	5	593	c.389A>T	c.(388-390)TAC>TTC	p.Y130F	GHITM_uc010qma.1_Intron|GHITM_uc010qmb.1_Missense_Mutation_p.Y60F	NM_014394	NP_055209	Q9H3K2	GHITM_HUMAN	growth hormone inducible transmembrane protein	130	Helical; (Potential).				apoptosis	integral to membrane|mitochondrial inner membrane					0						ACCTATATGTACTTAGCAGGG	0.363													66	118	---	---	---	---	PASS
BTAF1	9044	broad.mit.edu	37	10	93741417	93741417	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93741417G>C	uc001khr.2	+	16	1871	c.1773G>C	c.(1771-1773)TTG>TTC	p.L591F	BTAF1_uc001khs.1_Missense_Mutation_p.L261F|BTAF1_uc001kht.1_Missense_Mutation_p.L29F	NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription	591	HEAT 4.				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				TGGAACTGTTGAGTAAGGCTT	0.403													29	163	---	---	---	---	PASS
BTAF1	9044	broad.mit.edu	37	10	93749178	93749178	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93749178C>T	uc001khr.2	+	20	2793	c.2695C>T	c.(2695-2697)CAG>TAG	p.Q899*	BTAF1_uc001khs.1_Nonsense_Mutation_p.Q569*|BTAF1_uc001kht.1_Nonsense_Mutation_p.Q337*	NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription	899	HEAT 6.				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				CTATGCAGCTCAGTGCATAGC	0.398													15	86	---	---	---	---	PASS
LGI1	9211	broad.mit.edu	37	10	95557191	95557191	+	Silent	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95557191G>T	uc001kjc.3	+	8	1641	c.1305G>T	c.(1303-1305)GTG>GTT	p.V435V	LGI1_uc010qnv.1_Silent_p.V387V|LGI1_uc001kjd.3_Intron|LGI1_uc009xui.2_RNA|LGI1_uc001kje.2_Intron	NM_005097	NP_005088	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1 precursor	435	EAR 5.				axon guidance|cell proliferation|positive regulation of cell growth|positive regulation of synaptic transmission	cell junction|extracellular space|synapse	receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4		Colorectal(252;0.124)				TGTACGCAGTGAAGCACTTCT	0.433													19	98	---	---	---	---	PASS
TMEM20	159371	broad.mit.edu	37	10	95658372	95658372	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95658372A>C	uc001kjg.1	+	2	284	c.223A>C	c.(223-225)ACA>CCA	p.T75P	TMEM20_uc001kji.2_Intron|TMEM20_uc001kjf.1_Missense_Mutation_p.T74P|TMEM20_uc001kjh.2_Intron|TMEM20_uc010qnw.1_Missense_Mutation_p.T58P|TMEM20_uc001kjj.2_Intron	NM_001134658	NP_001128130	Q2M3R5	TMM20_HUMAN	transmembrane protein 20 isoform 1	75	Helical; (Potential).					integral to membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;3.46e-05)|Renal(717;0.018)|Ovarian(717;0.0228)|all_hematologic(284;0.189)		STAD - Stomach adenocarcinoma(243;0.00345)		CTTGTTTTACACATTATTGTC	0.398													24	127	---	---	---	---	PASS
ALDH18A1	5832	broad.mit.edu	37	10	97392719	97392719	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97392719C>G	uc001kkz.2	-	7	1047	c.805G>C	c.(805-807)GAA>CAA	p.E269Q	ALDH18A1_uc001kky.2_Missense_Mutation_p.E267Q|ALDH18A1_uc010qog.1_Missense_Mutation_p.E158Q|ALDH18A1_uc010qoh.1_Missense_Mutation_p.E57Q	NM_002860	NP_002851	P54886	P5CS_HUMAN	pyrroline-5-carboxylate synthetase isoform 1	269	Glutamate 5-kinase.				proline biosynthetic process	mitochondrial inner membrane	ATP binding|glutamate 5-kinase activity|glutamate-5-semialdehyde dehydrogenase activity			pancreas(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)	L-Glutamic Acid(DB00142)	TTTGTACCTTCTACATCTGAA	0.383													5	88	---	---	---	---	PASS
TLL2	7093	broad.mit.edu	37	10	98273363	98273363	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98273363C>G	uc001kml.1	-	1	306	c.80G>C	c.(79-81)GGG>GCG	p.G27A	TLL2_uc009xvf.1_Missense_Mutation_p.G27A	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor	27					cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CGGGCGCTCCCCGAGTCCCCC	0.726													3	17	---	---	---	---	PASS
CPN1	1369	broad.mit.edu	37	10	101802191	101802191	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101802191G>T	uc001kql.2	-	9	1630	c.1370C>A	c.(1369-1371)CCT>CAT	p.P457H		NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor	457					proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		GTTTCAGGCAGGGCCTCTCTG	0.512													50	76	---	---	---	---	PASS
PCGF6	84108	broad.mit.edu	37	10	105110820	105110820	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105110820C>G	uc001kwt.2	-	1	72	c.4G>C	c.(4-6)GAG>CAG	p.E2Q	PCGF6_uc001kwu.2_Missense_Mutation_p.E2Q|PCGF6_uc009xxk.2_RNA|PCGF6_uc009xxl.2_RNA|PCGF6_uc009xxm.2_RNA	NM_001011663	NP_001011663	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6 isoform a	2					negative regulation of transcription, DNA-dependent	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			kidney(1)	1		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		GCGACCCCCTCCATGGTCGGG	0.612													3	22	---	---	---	---	PASS
C10orf79	80217	broad.mit.edu	37	10	105912413	105912413	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105912413C>G	uc001kxw.2	-	28	3728	c.3612G>C	c.(3610-3612)TTG>TTC	p.L1204F	C10orf79_uc009xxq.2_Missense_Mutation_p.L512F	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217	1204	Potential.										0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		AAAGTCTTTTCAAATGTTCAT	0.318													30	178	---	---	---	---	PASS
ITPRIP	85450	broad.mit.edu	37	10	106075282	106075282	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106075282C>G	uc001kye.2	-	2	601	c.528G>C	c.(526-528)AGG>AGC	p.R176S	ITPRIP_uc001kyf.2_Missense_Mutation_p.R176S|ITPRIP_uc001kyg.2_Missense_Mutation_p.R176S	NM_033397	NP_203755	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-triphosphate receptor interacting	176						plasma membrane					0						TGCAGAGGCTCCTCAGGGCTT	0.627													9	88	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108430994	108430994	+	Splice_Site	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108430994C>G	uc001kym.2	-	16	2197	c.2189_splice	c.e16+1	p.C730_splice	SORCS1_uc001kyl.2_Splice_Site_p.C730_splice|SORCS1_uc009xxs.2_Splice_Site_p.C730_splice|SORCS1_uc001kyn.1_Splice_Site_p.C730_splice|SORCS1_uc001kyo.2_Splice_Site_p.C730_splice	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CACAAGCTCACCAATCAAAAT	0.408													32	68	---	---	---	---	PASS
TECTB	6975	broad.mit.edu	37	10	114059307	114059307	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114059307G>C	uc001kzr.1	+	8	892	c.892G>C	c.(892-894)GAG>CAG	p.E298Q		NM_058222	NP_478129	Q96PL2	TECTB_HUMAN	tectorin beta precursor	298						anchored to membrane|plasma membrane|proteinaceous extracellular matrix					0		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		CCTGGTCGTGGAGCTCTCCCT	0.587													17	79	---	---	---	---	PASS
TDRD1	56165	broad.mit.edu	37	10	115980379	115980379	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115980379G>C	uc001lbg.1	+	19	2700	c.2547G>C	c.(2545-2547)CAG>CAC	p.Q849H	TDRD1_uc001lbf.2_Missense_Mutation_p.Q726H|TDRD1_uc001lbh.1_Missense_Mutation_p.Q840H|TDRD1_uc001lbi.1_Missense_Mutation_p.Q840H|TDRD1_uc010qsc.1_Missense_Mutation_p.Q453H|TDRD1_uc001lbj.2_Missense_Mutation_p.Q558H	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	849					DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		CAAGATTCCAGATGTGTGTTG	0.388													24	99	---	---	---	---	PASS
C10orf84	63877	broad.mit.edu	37	10	120095918	120095918	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120095918C>A	uc001ldo.2	-	3	277	c.10G>T	c.(10-12)GGG>TGG	p.G4W	C10orf84_uc010qss.1_Missense_Mutation_p.G4W	NM_022063	NP_071346	Q9H8W3	F204A_HUMAN	hypothetical protein LOC63877	4											0		Colorectal(252;0.101)		all cancers(201;0.0244)		GGTAGCAGCCCACTCCACATC	0.388													13	64	---	---	---	---	PASS
C10orf119	79892	broad.mit.edu	37	10	121600347	121600347	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121600347C>T	uc001ler.2	-						C10orf119_uc001leq.1_Intron|C10orf119_uc001les.1_Intron	NM_024834	NP_079110	Q9BTE3	MCMBP_HUMAN	chromosome 10 open reading frame 119						cell division|DNA-dependent DNA replication|mitosis|S phase of mitotic cell cycle|sister chromatid cohesion	nucleus	chromatin binding				0		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.0044)		TATTTATATTCATCTTACTGC	0.303													13	89	---	---	---	---	PASS
C10orf137	26098	broad.mit.edu	37	10	127434418	127434418	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127434418G>A	uc001liq.1	+	19	3026	c.2733G>A	c.(2731-2733)CGG>CGA	p.R911R	C10orf137_uc001lin.2_Silent_p.R877R|C10orf137_uc001lio.1_Silent_p.R877R|C10orf137_uc001lip.1_Silent_p.R615R|C10orf137_uc001lis.1_Silent_p.R237R	NM_015608	NP_056423	Q3B7T1	EDRF1_HUMAN	erythroid differentiation-related factor 1	911					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding			ovary(5)|large_intestine(3)|lung(2)	10		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GGCTCATGCGGATTTGTGCGC	0.428													30	139	---	---	---	---	PASS
FANK1	92565	broad.mit.edu	37	10	127693455	127693455	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127693455T>C	uc001ljh.3	+	7	646	c.542T>C	c.(541-543)CTA>CCA	p.L181P	FANK1_uc009yan.2_Missense_Mutation_p.L207P|FANK1_uc001lji.2_Missense_Mutation_p.L175P	NM_145235	NP_660278	Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains	181	ANK 3.					cytoplasm|nucleus				ovary(1)	1		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				TGTTGCAGTCTAATGCTGGCG	0.488													50	79	---	---	---	---	PASS
RIC8A	60626	broad.mit.edu	37	11	212522	212522	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:212522G>C	uc001log.2	+						RIC8A_uc001lof.2_Intron|RIC8A_uc001loh.2_Intron	NM_021932	NP_068751	Q9NPQ8	RIC8A_HUMAN	resistance to inhibitors of cholinesterase 8							cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity				0		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		GTATAAGGCTGAGGAGCTGGT	0.617													3	18	---	---	---	---	PASS
RASSF7	8045	broad.mit.edu	37	11	562244	562244	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:562244C>G	uc001lqc.2	+	3	325	c.290C>G	c.(289-291)TCA>TGA	p.S97*	C11orf35_uc001lpx.2_5'Flank|RASSF7_uc001lqa.2_Nonsense_Mutation_p.S97*|RASSF7_uc001lqb.2_Nonsense_Mutation_p.S97*|RASSF7_uc001lqd.2_Nonsense_Mutation_p.S97*	NM_003475	NP_003466	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family	97					regulation of transcription, DNA-dependent|signal transduction	nucleus	DNA binding|protein binding			skin(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGGCCCTCCTCAGACAGCTGT	0.662													11	52	---	---	---	---	PASS
PHRF1	57661	broad.mit.edu	37	11	601622	601622	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:601622C>G	uc001lqe.2	+	10	1204	c.1073C>G	c.(1072-1074)TCC>TGC	p.S358C	PHRF1_uc010qwc.1_Missense_Mutation_p.S358C|PHRF1_uc010qwd.1_Missense_Mutation_p.S357C|PHRF1_uc010qwe.1_Missense_Mutation_p.S354C|PHRF1_uc009ybz.1_Missense_Mutation_p.S149C	NM_020901	NP_065952	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	358	Arg-rich.						RNA polymerase binding|zinc ion binding				0						TCCGGACCATCCGCAAAAAGT	0.522													12	34	---	---	---	---	PASS
DRD4	1815	broad.mit.edu	37	11	639799	639799	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:639799G>A	uc001lqp.1	+	3	550	c.550G>A	c.(550-552)GTG>ATG	p.V184M		NM_000797	NP_000788	P21917	DRD4_HUMAN	dopamine receptor D4	184	Extracellular (Potential).				activation of MAPK activity|adult locomotory behavior|arachidonic acid secretion|behavioral fear response|behavioral response to cocaine|behavioral response to ethanol|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cAMP biosynthetic process|negative regulation of protein secretion|positive regulation of sodium:hydrogen antiporter activity|regulation of dopamine metabolic process|regulation of inhibitory postsynaptic membrane potential|response to amphetamine|response to histamine|social behavior	integral to plasma membrane	dopamine D4 receptor activity|drug binding|potassium channel regulator activity|SH3 domain binding				0		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.36e-28)|Epithelial(43;2.59e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Apomorphine(DB00714)|Clozapine(DB00363)|Olanzapine(DB00334)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Ropinirole(DB00268)|Thiethylperazine(DB00372)|Ziprasidone(DB00246)	CGACCCCGCCGTGTGCCGCCT	0.711													6	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	4790208	4790208	+	IGR	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4790208T>C								OR51E2 (71132 upstream) : OR51F1 (2 downstream)																							ACTATGTCTGTTCATTTTGTA	0.403													23	60	---	---	---	---	PASS
OR51A4	401666	broad.mit.edu	37	11	4967872	4967872	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4967872C>G	uc010qys.1	-	1	459	c.459G>C	c.(457-459)AAG>AAC	p.K153N		NM_001005329	NP_001005329	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A,	153	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGAGCATGCTCTTAAAGGAGA	0.423													127	182	---	---	---	---	PASS
OR51B2	79345	broad.mit.edu	37	11	5344952	5344952	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5344952G>C	uc001mao.1	-	1	631	c.576C>G	c.(574-576)TTC>TTG	p.F192L	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033180	NP_149420	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B,	192	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAAGTCTATTGAAAGTTATGT	0.363													7	70	---	---	---	---	PASS
OR52N4	390072	broad.mit.edu	37	11	5776200	5776200	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5776200C>G	uc001mbu.2	+	1	278	c.230C>G	c.(229-231)TCT>TGT	p.S77C	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001005175	NP_001005175	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N,	77	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		GTTATGTGCTCTAGTACAATC	0.448													7	133	---	---	---	---	PASS
SMPD1	6609	broad.mit.edu	37	11	6413202	6413202	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6413202G>A	uc001mcw.2	+	2	1081	c.907G>A	c.(907-909)GCA>ACA	p.A303T	SMPD1_uc001mcv.1_Intron|SMPD1_uc009yex.2_RNA|SMPD1_uc001mcx.2_Missense_Mutation_p.A303T|SMPD1_uc009yew.2_Missense_Mutation_p.A302T	NM_000543	NP_000534	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid	301					cell death|ceramide biosynthetic process|negative regulation of MAP kinase activity|nervous system development|positive regulation of protein dephosphorylation|signal transduction|sphingomyelin catabolic process|termination of signal transduction	lysosome	hydrolase activity, acting on glycosyl bonds|sphingomyelin phosphodiesterase activity				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Desipramine(DB01151)	CACCGTCACAGCACTTGTGAG	0.577													52	82	---	---	---	---	PASS
OR2AG1	144125	broad.mit.edu	37	11	6807104	6807104	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6807104C>G	uc001mer.1	+	1	836	c.836C>G	c.(835-837)ACA>AGA	p.T279R		NM_001004489	NP_001004489	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG,	279	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GTTTTCTACACAATTGTCACT	0.498													3	134	---	---	---	---	PASS
C11orf17	56672	broad.mit.edu	37	11	8934078	8934078	+	Missense_Mutation	SNP	G	C	C	rs146611149		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8934078G>C	uc001mgx.2	+	3	377	c.301G>C	c.(301-303)GGG>CGG	p.G101R	ST5_uc001mgv.2_5'Flank|C11orf17_uc001mgz.2_Missense_Mutation_p.G101R|C11orf17_uc001mgy.2_Intron|C11orf17_uc010rbr.1_Missense_Mutation_p.G101R|C11orf17_uc010rbs.1_Intron|C11orf17_uc001mha.2_Missense_Mutation_p.G101R	NM_020642	NP_065693	Q9NQ31	AKIP1_HUMAN	chromosome 11 open reading frame 17	101						nucleus	protein binding				0				Epithelial(150;5.08e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0243)		AAGTCAGTGTGGGGTAAGTTG	0.448													12	62	---	---	---	---	PASS
SPON1	10418	broad.mit.edu	37	11	14277308	14277308	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14277308T>G	uc001mle.2	+	10	1746	c.1208T>G	c.(1207-1209)GTT>GGT	p.V403G		NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein	403					cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		GTAGCCAGAGTTGTCATCGAG	0.557													15	109	---	---	---	---	PASS
PDE3B	5140	broad.mit.edu	37	11	14889102	14889102	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14889102T>C	uc001mln.2	+	15	3290	c.2937T>C	c.(2935-2937)CGT>CGC	p.R979R	PDE3B_uc010rcr.1_Silent_p.R928R	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	979	Catalytic (By similarity).				cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						TCATGGATCGTTCTTCTCCTC	0.423													26	123	---	---	---	---	PASS
INSC	387755	broad.mit.edu	37	11	15247260	15247260	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15247260C>T	uc001mly.2	+	9	1243	c.1197C>T	c.(1195-1197)ATC>ATT	p.I399I	INSC_uc001mlz.2_Silent_p.I352I|INSC_uc001mma.2_Silent_p.I352I|INSC_uc010rcs.1_Silent_p.I387I|INSC_uc001mmb.2_Silent_p.I352I|INSC_uc001mmc.2_Silent_p.I310I	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a	399					cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						TTGCCAACATCACGTTCTTTG	0.507													12	56	---	---	---	---	PASS
SOX6	55553	broad.mit.edu	37	11	16068081	16068081	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16068081C>G	uc001mme.2	-	12	1674	c.1641G>C	c.(1639-1641)CTG>CTC	p.L547L	SOX6_uc001mmd.2_Silent_p.L510L|SOX6_uc001mmf.2_Silent_p.L507L|SOX6_uc001mmg.2_Silent_p.L534L	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	534					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						TGCAGCTGTTCAGCCCCATAT	0.512													33	172	---	---	---	---	PASS
PTPN5	84867	broad.mit.edu	37	11	18755112	18755112	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18755112G>T	uc001mpd.2	-	10	1502	c.1071C>A	c.(1069-1071)AAC>AAA	p.N357K	PTPN5_uc001mpb.2_Missense_Mutation_p.N325K|PTPN5_uc001mpc.2_Missense_Mutation_p.N357K|PTPN5_uc001mpe.2_Missense_Mutation_p.N325K|PTPN5_uc010rdj.1_Missense_Mutation_p.N301K|PTPN5_uc001mpf.2_Missense_Mutation_p.N333K|PTPN5_uc010rdk.1_Missense_Mutation_p.N302K	NM_006906	NP_008837	P54829	PTN5_HUMAN	protein-tyrosine-phosphatase non-receptor 5	357	Tyrosine-protein phosphatase.					integral to membrane	phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(2)	2						CCCGGATGTAGTTGGCATTGA	0.582													41	110	---	---	---	---	PASS
PRMT3	10196	broad.mit.edu	37	11	20483558	20483558	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20483558G>A	uc001mqb.2	+	12	1322	c.1105G>A	c.(1105-1107)GCA>ACA	p.A369T	PRMT3_uc001mqc.2_Missense_Mutation_p.A292T|PRMT3_uc010rdn.1_Missense_Mutation_p.A307T	NM_005788	NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3 isoform 1	369							zinc ion binding				0						CAGCCTTGTAGCAGTGAGTGA	0.368													85	230	---	---	---	---	PASS
PRMT3	10196	broad.mit.edu	37	11	20515483	20515483	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20515483G>T	uc001mqb.2	+	14	1583	c.1366G>T	c.(1366-1368)GAT>TAT	p.D456Y	PRMT3_uc001mqc.2_Missense_Mutation_p.D379Y|PRMT3_uc010rdn.1_Missense_Mutation_p.D394Y	NM_005788	NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3 isoform 1	456							zinc ion binding				0						TGGCTACTTTGATATATATTT	0.269													16	140	---	---	---	---	PASS
KCNA4	3739	broad.mit.edu	37	11	30033664	30033664	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30033664C>T	uc001msk.2	-	2	1714	c.562G>A	c.(562-564)GAG>AAG	p.E188K		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	188						voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						ATTTGGGTCTCAAAGCGTAGG	0.498													20	100	---	---	---	---	PASS
FSHB	2488	broad.mit.edu	37	11	30255159	30255159	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30255159A>T	uc001msl.2	+	3	271	c.202A>T	c.(202-204)ACA>TCA	p.T68S	FSHB_uc001msm.2_Missense_Mutation_p.T68S|FSHB_uc001msn.2_Missense_Mutation_p.T68S	NM_000510	NP_000501	P01225	FSHB_HUMAN	follicle stimulating hormone, beta polypeptide	68					cellular nitrogen compound metabolic process|female gamete generation|female pregnancy|ovarian follicle development|peptide hormone processing|progesterone biosynthetic process|spermatogenesis|transforming growth factor beta receptor signaling pathway	cytoplasm|extracellular region|soluble fraction	follicle-stimulating hormone activity|protein heterodimerization activity			ovary(3)	3					Follitropin beta(DB00066)|Thyrotropin Alfa(DB00024)|Urofollitropin(DB00094)	AATCCAGAAAACATGTACCTT	0.463													7	106	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	30937170	30937170	+	RNA	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30937170G>C	uc001mss.1	-	5		c.644C>G			uc009yjk.1_Missense_Mutation_p.Q629E					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		AAGACTAGCTGAGGAGCAGCA	0.468													4	122	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40136590	40136590	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40136590A>C	uc001mxa.1	-	2	3217	c.1253T>G	c.(1252-1254)GTG>GGG	p.V418G	LRRC4C_uc001mxc.1_Missense_Mutation_p.V414G|LRRC4C_uc001mxd.1_Missense_Mutation_p.V414G|LRRC4C_uc001mxb.1_Missense_Mutation_p.V414G	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	418	Ig-like C2-type.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				TGTATCTTGCACAGTTACATT	0.443													51	370	---	---	---	---	PASS
TTC17	55761	broad.mit.edu	37	11	43436245	43436245	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43436245G>C	uc001mxi.2	+	16	2184	c.2170G>C	c.(2170-2172)GAG>CAG	p.E724Q	TTC17_uc001mxh.2_Missense_Mutation_p.E724Q|TTC17_uc010rfj.1_Missense_Mutation_p.E667Q|TTC17_uc001mxj.2_Missense_Mutation_p.E494Q	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	724							binding			ovary(5)	5						CAAATGTCCAGAGTGTGAAAA	0.438													45	251	---	---	---	---	PASS
KIAA0652	9776	broad.mit.edu	37	11	46690091	46690091	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46690091C>T	uc009yld.2	+	15	1879	c.1195C>T	c.(1195-1197)CCC>TCC	p.P399S	KIAA0652_uc001nda.2_Missense_Mutation_p.P432S|KIAA0652_uc001ndb.2_Missense_Mutation_p.P399S|KIAA0652_uc001ncz.2_Missense_Mutation_p.P362S|KIAA0652_uc001ndc.2_Missense_Mutation_p.P362S|KIAA0652_uc010rgv.1_Missense_Mutation_p.P283S	NM_001142673	NP_001136145	O75143	ATG13_HUMAN	autophagy-related protein 13 isoform 1	399					autophagic vacuole assembly	cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding				0				GBM - Glioblastoma multiforme(35;0.226)		CATGTTTGCTCCCAAGAATTT	0.512													41	145	---	---	---	---	PASS
ARFGAP2	84364	broad.mit.edu	37	11	47188357	47188357	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47188357T>C	uc001ndt.2	-	13	1301	c.1286A>G	c.(1285-1287)AAA>AGA	p.K429R	ARFGAP2_uc010rha.1_Missense_Mutation_p.K160R|ARFGAP2_uc010rhb.1_Missense_Mutation_p.K401R|ARFGAP2_uc001ndu.2_Missense_Mutation_p.K293R|ARFGAP2_uc010rhc.1_Missense_Mutation_p.K160R	NM_032389	NP_115765	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating	429	Required for interaction with coatomer.				protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding			ovary(1)	1						TGAGATGGCTTTGGCTCCTGC	0.582													62	368	---	---	---	---	PASS
DDB2	1643	broad.mit.edu	37	11	47256812	47256812	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47256812C>G	uc001neb.2	+						DDB2_uc001nec.2_Intron|DDB2_uc009yli.1_Intron|DDB2_uc001ned.2_Intron|DDB2_uc001nee.2_Intron|DDB2_uc001nef.2_Intron|DDB2_uc001neg.2_Intron|DDB2_uc001neh.2_Intron	NM_000107	NP_000098	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2						nucleotide-excision repair, DNA damage removal|protein autoubiquitination|protein polyubiquitination|response to UV	nucleoplasm|protein complex	damaged DNA binding|protein binding			kidney(2)|ovary(1)	3						GGGCTTTTCACTTTGCCAGCT	0.597			Mis|N			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				4	238	---	---	---	---	PASS
SPI1	6688	broad.mit.edu	37	11	47397209	47397209	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47397209G>A	uc001nfc.1	-	2	340	c.117C>T	c.(115-117)CTC>CTT	p.L39L	SPI1_uc001nfb.1_Silent_p.L40L|SLC39A13_uc001nfd.2_Intron|SPI1_uc009ylp.1_Silent_p.L33L	NM_003120	NP_003111	P17947	SPI1_HUMAN	hematopoietic transcription factor PU.1 isoform	39					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of erythrocyte differentiation	nucleus	protein binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|central_nervous_system(1)	2				Lung(87;0.0967)		CATCACTGCTGAGATAGGGGT	0.597													62	134	---	---	---	---	PASS
FNBP4	23360	broad.mit.edu	37	11	47776136	47776136	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47776136C>G	uc009ylv.2	-	3	547	c.394G>C	c.(394-396)GAG>CAG	p.E132Q	FNBP4_uc001ngj.2_Missense_Mutation_p.E39Q|FNBP4_uc001ngl.2_Intron	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	132										ovary(1)	1						CCATTTGTCTCTTTGGATTGT	0.408													26	184	---	---	---	---	PASS
OR4X2	119764	broad.mit.edu	37	11	48266731	48266731	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48266731T>C	uc001ngs.1	+	1	76	c.76T>C	c.(76-78)TTG>CTG	p.L26L		NM_001004727	NP_001004727	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X,	26	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATTTCTGTTCTTGTACACAGC	0.458													46	318	---	---	---	---	PASS
OR4P4	81300	broad.mit.edu	37	11	55406327	55406327	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55406327C>G	uc010rij.1	+	1	494	c.494C>G	c.(493-495)CCA>CGA	p.P165R		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						ATCTTTGTACCATTTTGTGGC	0.373													33	230	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55418433	55418433	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55418433C>A	uc001nhs.1	+	1	54	c.54C>A	c.(52-54)AGC>AGA	p.S18R		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	18	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				TTTCTCAGAGCCCAGAGATTG	0.373													76	202	---	---	---	---	PASS
OR8H2	390151	broad.mit.edu	37	11	55873189	55873189	+	Missense_Mutation	SNP	C	T	T	rs138370909		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55873189C>T	uc010riy.1	+	1	671	c.671C>T	c.(670-672)ACC>ATC	p.T224I		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	224	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					ATTCTCTTTACCATCCTGAAA	0.388										HNSCC(53;0.14)			71	209	---	---	---	---	PASS
OR8H2	390151	broad.mit.edu	37	11	55873190	55873190	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55873190C>G	uc010riy.1	+	1	672	c.672C>G	c.(670-672)ACC>ACG	p.T224T		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	224	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					TTCTCTTTACCATCCTGAAAA	0.383										HNSCC(53;0.14)			69	209	---	---	---	---	PASS
OR5T3	390154	broad.mit.edu	37	11	56020666	56020666	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56020666G>T	uc010rjd.1	+	1	991	c.991G>T	c.(991-993)GTG>TTG	p.V331L		NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T,	331	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(21;0.00448)					AAAAAAGGCAGTGAAGAAAAT	0.299													20	66	---	---	---	---	PASS
OR8H1	219469	broad.mit.edu	37	11	56057802	56057802	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56057802C>G	uc010rje.1	-	1	737	c.737G>C	c.(736-738)GGA>GCA	p.G246A		NM_001005199	NP_001005199	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H,	246	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	Esophageal squamous(21;0.00448)					GATGGTGACTCCCAAGAGATG	0.358													32	176	---	---	---	---	PASS
SMTNL1	219537	broad.mit.edu	37	11	57310459	57310459	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57310459A>T	uc009ymh.1	+	2	398	c.398A>T	c.(397-399)AAA>ATA	p.K133I		NM_001105565	NP_001099035	E9PPJ3	E9PPJ3_HUMAN	smoothelin-like 1	115										ovary(1)	1						ACTGGCAGGAAAGAAGAGACC	0.517													4	15	---	---	---	---	PASS
CLP1	10978	broad.mit.edu	37	11	57428587	57428587	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57428587C>A	uc001nkw.2	+	3	1096	c.957C>A	c.(955-957)GTC>GTA	p.V319V	CLP1_uc010rjw.1_Silent_p.V255V|CLP1_uc009yml.2_Silent_p.V319V	NM_006831	NP_006822	Q92989	CLP1_HUMAN	ATP/GTP-binding protein isoform 1	319					mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|siRNA loading onto RISC involved in RNA interference|targeting of mRNA for destruction involved in RNA interference|termination of RNA polymerase II transcription|tRNA splicing, via endonucleolytic cleavage and ligation	nucleoplasm|tRNA-intron endonuclease complex	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|ATP-dependent polyribonucleotide 5'-hydroxyl-kinase activity			ovary(1)	1						CCTTCAATGTCAAATTTTCAG	0.478													57	360	---	---	---	---	PASS
OR6Q1	219952	broad.mit.edu	37	11	57799089	57799089	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57799089A>T	uc010rjz.1	+	1	665	c.665A>T	c.(664-666)TAT>TTT	p.Y222F	OR9Q1_uc001nmj.2_Intron	NM_001005186	NP_001005186	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q,	222	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(1)	1		Breast(21;0.0707)|all_epithelial(135;0.142)				GCTGTGTCCTATGGCAACATC	0.557													78	145	---	---	---	---	PASS
OR10W1	81341	broad.mit.edu	37	11	58034692	58034692	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58034692C>T	uc001nmq.1	-	1	1041	c.639G>A	c.(637-639)GTG>GTA	p.V213V		NM_207374	NP_997257	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W,	213	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.0589)				GCAGAGCAGCCACTATGAAGG	0.577													12	33	---	---	---	---	PASS
GLYATL1	92292	broad.mit.edu	37	11	58715439	58715439	+	Splice_Site	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58715439G>A	uc001nnf.2	+	5	562	c.186_splice	c.e5+1	p.Q62_splice	uc001nng.1_Intron|GLYATL1_uc001nnh.1_Splice_Site_p.Q93_splice|GLYATL1_uc001nni.1_Splice_Site_p.Q62_splice|GLYATL1_uc001nnj.1_Splice_Site_p.Q62_splice			Q969I3	GLYL1_HUMAN	SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;							mitochondrion	glycine N-acyltransferase activity			ovary(1)	1					Glycine(DB00145)	TCAAAAGCAGGTAGGCACACA	0.522													22	69	---	---	---	---	PASS
MPEG1	219972	broad.mit.edu	37	11	58978605	58978605	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58978605G>C	uc001nnu.3	-	1	1890	c.1734C>G	c.(1732-1734)GTC>GTG	p.V578V		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	578	Extracellular (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				GCCCGGATTTGACGCAATAGG	0.597													73	186	---	---	---	---	PASS
OR5AN1	390195	broad.mit.edu	37	11	59131934	59131934	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59131934G>C	uc010rks.1	+	1	3	c.3G>C	c.(1-3)ATG>ATC	p.M1I		NM_001004729	NP_001004729	Q8NGI8	O5AN1_HUMAN	olfactory receptor, family 5, subfamily AN,	1	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CTGAGCCAATGACTGGGGGAG	0.398													18	151	---	---	---	---	PASS
OSBP	5007	broad.mit.edu	37	11	59368769	59368769	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59368769T>G	uc001noc.1	-	5	1591	c.1111A>C	c.(1111-1113)AAT>CAT	p.N371H	OSBP_uc009ymr.1_5'Flank	NM_002556	NP_002547	P22059	OSBP1_HUMAN	oxysterol binding protein	371					lipid transport	Golgi membrane	oxysterol binding			large_intestine(1)	1		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TGGCCCAAATTTTCAGGCATG	0.378													21	122	---	---	---	---	PASS
OSBP	5007	broad.mit.edu	37	11	59368814	59368814	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59368814C>G	uc001noc.1	-	5	1546	c.1066G>C	c.(1066-1068)GAG>CAG	p.E356Q	OSBP_uc009ymr.1_5'Flank	NM_002556	NP_002547	P22059	OSBP1_HUMAN	oxysterol binding protein	356					lipid transport	Golgi membrane	oxysterol binding			large_intestine(1)	1		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		AATTCATTCTCATCATCTTCA	0.393													21	143	---	---	---	---	PASS
MS4A8B	83661	broad.mit.edu	37	11	60470904	60470904	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60470904G>C	uc001npv.2	+	3	476	c.273G>C	c.(271-273)GCG>GCC	p.A91A	MS4A8B_uc009yne.1_Silent_p.A91A	NM_031457	NP_113645	Q9BY19	M4A8B_HUMAN	membrane-spanning 4-domains, subfamily A, member	91	Helical; (Potential).					integral to membrane	receptor activity				0						CCATCATGGCGACGGTTCTCG	0.557													39	209	---	---	---	---	PASS
SLC15A3	51296	broad.mit.edu	37	11	60714117	60714117	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60714117G>C	uc001nqn.2	-	2	969	c.735C>G	c.(733-735)CTC>CTG	p.L245L	SLC15A3_uc001nqo.2_Silent_p.L245L	NM_016582	NP_057666	Q8IY34	S15A3_HUMAN	solute carrier family 15, member 3	245	Helical; (Potential).				oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity				0						GGGTGGCAAAGAGGAAGATGA	0.572													26	164	---	---	---	---	PASS
FTH1	2495	broad.mit.edu	37	11	61732578	61732578	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61732578C>T	uc001nsu.2	-	3	503	c.268G>A	c.(268-270)GAC>AAC	p.D90N		NM_002032	NP_002023	P02794	FRIH_HUMAN	ferritin, heavy polypeptide 1	90	Ferritin-like diiron.				cell proliferation|cellular membrane organization|immune response|intracellular sequestering of iron ion|iron ion transport|negative regulation of cell proliferation|post-Golgi vesicle-mediated transport	cytosol|intracellular ferritin complex	ferric iron binding|ferroxidase activity|protein binding			ovary(1)	1					Iron Dextran(DB00893)	TCATCACAGTCTGGTTTCTGA	0.443													51	486	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62288670	62288670	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62288670G>C	uc001ntl.2	-	5	13519	c.13219C>G	c.(13219-13221)CTG>GTG	p.L4407V	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4407					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				ACTTTGGGCAGAGAGACATCC	0.473													65	404	---	---	---	---	PASS
ZBTB3	79842	broad.mit.edu	37	11	62519630	62519630	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62519630C>G	uc001nuz.2	-	2	1779	c.1657G>C	c.(1657-1659)GAC>CAC	p.D553H		NM_024784	NP_079060	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	553					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3						CTCTGTCTGTCTGCTGTTGGG	0.552													30	121	---	---	---	---	PASS
TAF6L	10629	broad.mit.edu	37	11	62554031	62554031	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62554031G>C	uc001nvc.2	+	11	1233	c.1132G>C	c.(1132-1134)GAG>CAG	p.E378Q	TMEM179B_uc001nvd.3_5'Flank	NM_006473	NP_006464	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II	378					chromatin remodeling|histone H3 acetylation|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	histone deacetylase complex|STAGA complex	DNA binding|protein binding|transcription coactivator activity			ovary(3)	3						CCAGGCAGCAGAGCCCAACAG	0.612											OREG0021030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	20	---	---	---	---	PASS
SLC3A2	6520	broad.mit.edu	37	11	62650436	62650436	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62650436T>C	uc001nwd.2	+	6	1182	c.958T>C	c.(958-960)TCC>CCC	p.S320P	SLC3A2_uc001nwb.2_Missense_Mutation_p.S351P|SLC3A2_uc001nwc.2_Missense_Mutation_p.S321P|SLC3A2_uc001nwe.2_Missense_Mutation_p.S289P|SLC3A2_uc001nwf.2_Missense_Mutation_p.S258P|SLC3A2_uc001nwg.2_Missense_Mutation_p.S219P|SLC3A2_uc010rml.1_RNA	NM_002394	NP_002385	P08195	4F2_HUMAN	solute carrier family 3, member 2 isoform c	320	Extracellular (Potential).			S -> F (in Ref. 5; AAA35489).	blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding				0						CTCGTGGTTCTCCACTCAGGT	0.532													50	141	---	---	---	---	PASS
SLC22A25	387601	broad.mit.edu	37	11	62933655	62933655	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62933655C>G	uc001nwr.1	-	7	1146	c.1146G>C	c.(1144-1146)CAG>CAC	p.Q382H	SLC22A10_uc010rmo.1_Intron|SLC22A25_uc009yoq.1_RNA|SLC22A25_uc001nws.1_RNA|SLC22A25_uc001nwt.1_3'UTR	NM_199352	NP_955384	Q6T423	S22AP_HUMAN	putative UST1-like organic anion transporter	382	Helical; Name=8; (Potential).				transmembrane transport	integral to membrane				ovary(3)|skin(1)	4						CAAAGAGAGTCTGCAACAGGA	0.498													23	78	---	---	---	---	PASS
LGALS12	85329	broad.mit.edu	37	11	63276044	63276044	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63276044C>G	uc001nxa.2	+	2	496	c.155C>G	c.(154-156)ACG>AGG	p.T52R	LGALS12_uc001nxb.2_Missense_Mutation_p.T52R|LGALS12_uc001nxc.2_Missense_Mutation_p.T52R|LGALS12_uc001nxd.2_5'UTR|LGALS12_uc001nxe.2_5'UTR|LGALS12_uc009yot.2_Missense_Mutation_p.D14E	NM_033101	NP_149092	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12 isoform	52	Galectin 1.				apoptosis|induction of apoptosis by intracellular signals	nucleus	lactose binding			ovary(2)	2						TATGTCACGACGATTTTTGGA	0.547													17	76	---	---	---	---	PASS
STIP1	10963	broad.mit.edu	37	11	63961973	63961973	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63961973C>G	uc001nyk.1	+	4	531	c.384C>G	c.(382-384)TTC>TTG	p.F128L	STIP1_uc001nyj.2_Missense_Mutation_p.F128L|STIP1_uc010rnb.1_Missense_Mutation_p.F104L	NM_006819	NP_006810	P31948	STIP1_HUMAN	stress-induced-phosphoprotein 1	128					axon guidance|response to stress	Golgi apparatus|nucleus				ovary(2)|liver(1)	3						TGAACCCTTTCAACATGCCTA	0.438													4	143	---	---	---	---	PASS
STIP1	10963	broad.mit.edu	37	11	63963170	63963170	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63963170A>T	uc001nyk.1	+	5	704	c.557A>T	c.(556-558)GAT>GTT	p.D186V	STIP1_uc001nyj.2_Missense_Mutation_p.D186V|STIP1_uc010rnb.1_Missense_Mutation_p.D162V	NM_006819	NP_006810	P31948	STIP1_HUMAN	stress-induced-phosphoprotein 1	186					axon guidance|response to stress	Golgi apparatus|nucleus				ovary(2)|liver(1)	3						CTTGGGGTCGATCTGGGCAGT	0.468													10	55	---	---	---	---	PASS
PYGM	5837	broad.mit.edu	37	11	64521716	64521716	+	Intron	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64521716G>T	uc001oax.3	-						PYGM_uc001oay.3_Intron	NM_005609	NP_005600	P11217	PYGM_HUMAN	muscle glycogen phosphorylase isoform 1						glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding			ovary(2)	2					Pyridoxal Phosphate(DB00114)	GAGGGGCCCTGAAGCCCACCT	0.612													17	133	---	---	---	---	PASS
SLC22A20	440044	broad.mit.edu	37	11	64990981	64990981	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64990981T>G	uc010roc.1	+	7	976	c.973T>G	c.(973-975)TCC>GCC	p.S325A	SLC22A20_uc010rob.1_Missense_Mutation_p.L268R	NM_001004326	NP_001004326	A6NK97	S22AK_HUMAN	solute carrier family 22, member 20	325	Cytoplasmic (Potential).				ion transport	integral to membrane	transmembrane transporter activity			central_nervous_system(1)	1						TGTCTGCACCTCCAACTCAAT	0.542													7	56	---	---	---	---	PASS
FRMD8	83786	broad.mit.edu	37	11	65161798	65161798	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65161798C>G	uc001odu.3	+	6	675	c.483C>G	c.(481-483)TAC>TAG	p.Y161*	FRMD8_uc009yqj.2_Nonsense_Mutation_p.Y105*|FRMD8_uc010rof.1_Nonsense_Mutation_p.Y127*	NM_031904	NP_114110	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	161	FERM.					cytoskeleton	binding			lung(1)|pancreas(1)	2						CTGCACGGTACCCGTGCGACG	0.701													3	8	---	---	---	---	PASS
LTBP3	4054	broad.mit.edu	37	11	65308030	65308030	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65308030C>T	uc001oej.2	-	22	3302	c.3033G>A	c.(3031-3033)GTG>GTA	p.V1011V	LTBP3_uc001oef.2_Silent_p.V14V|LTBP3_uc001oeg.2_Silent_p.V14V|LTBP3_uc001oeh.2_Silent_p.V441V|LTBP3_uc010roi.1_Silent_p.V894V|LTBP3_uc001oei.2_Silent_p.V1011V|LTBP3_uc010roj.1_Silent_p.V712V|LTBP3_uc010rok.1_Silent_p.V922V	NM_001130144	NP_001123616	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding	1011	EGF-like 10; calcium-binding (Potential).					extracellular region	calcium ion binding|growth factor binding			central_nervous_system(2)|lung(1)	3						GCTGCGTGTTCACGCACTTGC	0.642											OREG0021080	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	118	---	---	---	---	PASS
SSH3	54961	broad.mit.edu	37	11	67074336	67074336	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67074336C>T	uc001okj.2	+	4	545	c.367C>T	c.(367-369)CCC>TCC	p.P123S	SSH3_uc001okk.2_RNA|SSH3_uc001okl.2_5'UTR	NM_017857	NP_060327	Q8TE77	SSH3_HUMAN	slingshot homolog 3	123					regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton|nucleus	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			ACCCCGGCCTCCCCGGCTCCG	0.652													8	40	---	---	---	---	PASS
CHKA	1119	broad.mit.edu	37	11	67832066	67832066	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67832066G>C	uc001onj.2	-	10	1372	c.1158C>G	c.(1156-1158)TTC>TTG	p.F386L	CHKA_uc001onk.2_Missense_Mutation_p.F368L	NM_001277	NP_001268	P35790	CHKA_HUMAN	choline kinase alpha isoform a	386					lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)	AGTCATTTTGGAATGCAGGCA	0.294													3	106	---	---	---	---	PASS
SUV420H1	51111	broad.mit.edu	37	11	67934503	67934503	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67934503G>C	uc001onm.1	-	10	1376	c.1120C>G	c.(1120-1122)CAA>GAA	p.Q374E	SUV420H1_uc009yse.1_5'UTR|SUV420H1_uc001onn.1_Missense_Mutation_p.Q202E|SUV420H1_uc009ysf.2_Missense_Mutation_p.Q134E|SUV420H1_uc001ono.1_Missense_Mutation_p.Q374E|SUV420H1_uc001onp.2_Missense_Mutation_p.Q374E|SUV420H1_uc010rqa.1_Missense_Mutation_p.Q351E|SUV420H1_uc001onq.2_Missense_Mutation_p.Q374E	NM_017635	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 isoform	374					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(2)|kidney(1)	3						CTGACAGATTGACTGTCTGAA	0.353													13	135	---	---	---	---	PASS
SUV420H1	51111	broad.mit.edu	37	11	67953375	67953375	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67953375C>G	uc001onm.1	-	3	437	c.181G>C	c.(181-183)GAA>CAA	p.E61Q	SUV420H1_uc009yse.1_5'UTR|SUV420H1_uc001onn.1_5'UTR|SUV420H1_uc009ysf.2_5'UTR|SUV420H1_uc001ono.1_Missense_Mutation_p.E61Q|SUV420H1_uc001onp.2_Missense_Mutation_p.E61Q|SUV420H1_uc010rqa.1_Missense_Mutation_p.E61Q|SUV420H1_uc001onq.2_Missense_Mutation_p.E61Q	NM_017635	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 isoform	61					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(2)|kidney(1)	3						CTCTGTCCTTCAAATCCCGAG	0.408													25	130	---	---	---	---	PASS
TPCN2	219931	broad.mit.edu	37	11	68855388	68855388	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68855388G>A	uc001oos.2	+	25	2342	c.2226G>A	c.(2224-2226)CTG>CTA	p.L742L	TPCN2_uc010rqg.1_Silent_p.L560L|TPCN2_uc001oot.2_RNA	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	742	Cytoplasmic (Potential).				cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CAGAGAGGCTGAGCCAGCACC	0.642													4	19	---	---	---	---	PASS
FADD	8772	broad.mit.edu	37	11	70049751	70049751	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70049751C>T	uc001opm.2	+	1	483	c.186C>T	c.(184-186)CTC>CTT	p.L62L		NM_003824	NP_003815	Q13158	FADD_HUMAN	Fas-associated via death domain	62	DED.				activation of caspase activity|activation of pro-apoptotic gene products|cellular response to mechanical stimulus|defense response to virus|induction of apoptosis via death domain receptors|innate immune response|interspecies interaction between organisms|necrotic cell death|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|signal transduction	cytosol	death receptor binding|identical protein binding			ovary(1)|lung(1)|pancreas(1)	3	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			ACACCGAGCTCCTGCGCGAGC	0.567													14	48	---	---	---	---	PASS
SHANK2	22941	broad.mit.edu	37	11	70333442	70333442	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70333442C>G	uc001oqc.2	-	21	3034	c.2956G>C	c.(2956-2958)GAA>CAA	p.E986Q	SHANK2_uc010rqn.1_Missense_Mutation_p.E398Q|SHANK2_uc001opz.2_Missense_Mutation_p.E391Q|uc009ysn.1_Intron|SHANK2_uc001opy.2_Intron	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	607					intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TATGGGTTTTCTGGCATCTGG	0.602													28	253	---	---	---	---	PASS
NADSYN1	55191	broad.mit.edu	37	11	71175151	71175151	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71175151C>T	uc001oqn.2	+	5	496	c.370C>T	c.(370-372)CGC>TGC	p.R124C	NADSYN1_uc001oqm.2_RNA|NADSYN1_uc001oqo.2_5'UTR	NM_018161	NP_060631	Q6IA69	NADE_HUMAN	NAD synthetase 1	124	CN hydrolase.				NAD biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds|NAD+ synthase (glutamine-hydrolyzing) activity|protein binding			ovary(2)	2					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	AGGCAACTACCGCGAGCTGCG	0.607													11	24	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71724238	71724238	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71724238C>T	uc001orl.1	-	15	4483	c.4311G>A	c.(4309-4311)CTG>CTA	p.L1437L	NUMA1_uc009ysw.1_Silent_p.L1000L|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Silent_p.L1437L|NUMA1_uc001orn.2_Silent_p.L1000L|NUMA1_uc009ysx.1_Silent_p.L1437L|NUMA1_uc001oro.1_Silent_p.L1437L	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	1437	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						TCAGCATGCTCAGCTGCTCTG	0.637			T	RARA	APL								26	142	---	---	---	---	PASS
INPPL1	3636	broad.mit.edu	37	11	71940529	71940529	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71940529C>G	uc001osf.2	+	6	827	c.680C>G	c.(679-681)TCA>TGA	p.S227*	INPPL1_uc001osg.2_5'UTR	NM_001567	NP_001558	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	227					actin filament organization|cell adhesion|endocytosis	actin cortical patch|cytosol	actin binding|SH2 domain binding|SH3 domain binding			skin(2)|ovary(1)|breast(1)	4						AAGGTCCTGTCAGGCCTGGAG	0.572													28	166	---	---	---	---	PASS
CHCHD8	51287	broad.mit.edu	37	11	73584241	73584241	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73584241G>C	uc001ouj.2	-	2	288	c.183C>G	c.(181-183)TTC>TTG	p.F61L	CHCHD8_uc009ytw.2_RNA	NM_016565	NP_057649	Q9NYJ1	CHCH8_HUMAN	coiled-coil-helix-coiled-coil-helix domain	61	CHCH.										0	Breast(11;7.42e-05)					TGCAATCCTTGAACGCCTGCA	0.617													14	80	---	---	---	---	PASS
SLCO2B1	11309	broad.mit.edu	37	11	74862428	74862428	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74862428T>C	uc001owb.2	+	1	389	c.2T>C	c.(1-3)ATG>ACG	p.M1T	SLCO2B1_uc010rrp.1_Intron|SLCO2B1_uc010rrq.1_Missense_Mutation_p.M1T|SLCO2B1_uc010rrr.1_Missense_Mutation_p.M1T|SLCO2B1_uc010rrs.1_5'UTR|SLCO2B1_uc001owc.2_5'UTR	NM_007256	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family,	1	Cytoplasmic (Potential).				sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|breast(1)	2					Ergoloid mesylate(DB01049)	CCAGCAGTCATGGGACCCAGG	0.552													8	27	---	---	---	---	PASS
C11orf82	220042	broad.mit.edu	37	11	82642927	82642927	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82642927C>G	uc001ozt.2	+	6	791	c.547C>G	c.(547-549)CAA>GAA	p.Q183E	C11orf82_uc010rsr.1_Translation_Start_Site|C11orf82_uc010rss.1_Translation_Start_Site|C11orf82_uc009yvd.2_Intron	NM_145018	NP_659455	Q8IXT1	NOXIN_HUMAN	nitric oxide-inducible gene protein	183					apoptosis|cell cycle arrest	cytoplasm|nucleus				ovary(2)	2						CTACTTCCATCAACTTTTGCA	0.418													42	299	---	---	---	---	PASS
C11orf82	220042	broad.mit.edu	37	11	82643305	82643305	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82643305G>C	uc001ozt.2	+	6	1169	c.925G>C	c.(925-927)GAA>CAA	p.E309Q	C11orf82_uc010rsr.1_Missense_Mutation_p.E8Q|C11orf82_uc010rss.1_Missense_Mutation_p.E8Q|C11orf82_uc009yvd.2_Intron	NM_145018	NP_659455	Q8IXT1	NOXIN_HUMAN	nitric oxide-inducible gene protein	309					apoptosis|cell cycle arrest	cytoplasm|nucleus				ovary(2)	2						GAGTACAGCAGAAAAGTTGGG	0.418													28	142	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83170885	83170885	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83170885C>A	uc001paj.2	-	23	2892	c.2589G>T	c.(2587-2589)TGG>TGT	p.W863C	DLG2_uc001pai.2_Missense_Mutation_p.W742C|DLG2_uc010rsy.1_Missense_Mutation_p.W812C|DLG2_uc010rsz.1_Missense_Mutation_p.W859C|DLG2_uc010rta.1_Missense_Mutation_p.W845C|DLG2_uc001pak.2_Missense_Mutation_p.W968C|DLG2_uc010rsw.1_Missense_Mutation_p.W327C|DLG2_uc010rsx.1_Missense_Mutation_p.W340C	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	863						cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TTGAGGGAATCCAGATGAAAG	0.363													24	85	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83641521	83641521	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83641521G>A	uc001paj.2	-	10	1334	c.1031C>T	c.(1030-1032)CCG>CTG	p.P344L	DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Missense_Mutation_p.P311L|DLG2_uc010rsz.1_Missense_Mutation_p.P344L|DLG2_uc010rta.1_Missense_Mutation_p.P344L|DLG2_uc001pak.2_Missense_Mutation_p.P449L|DLG2_uc010rtb.1_Missense_Mutation_p.P311L|DLG2_uc001pal.1_Missense_Mutation_p.P344L|DLG2_uc001pam.1_Missense_Mutation_p.P383L	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	344						cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				AACAGGTTCCGGAGGCCTGGT	0.458													17	124	---	---	---	---	PASS
TYR	7299	broad.mit.edu	37	11	88911272	88911272	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88911272G>A	uc001pcs.2	+	1	233	c.151G>A	c.(151-153)GGC>AGC	p.G51S		NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor	51	Lumenal, melanosome (Potential).				eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)	CCAGCTTTCAGGCAGAGGTTC	0.562									Oculocutaneous_Albinism				7	70	---	---	---	---	PASS
NOX4	50507	broad.mit.edu	37	11	89073286	89073286	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89073286C>T	uc001pct.2	-	15	1630	c.1391G>A	c.(1390-1392)AGA>AAA	p.R464K	NOX4_uc009yvr.2_Missense_Mutation_p.R439K|NOX4_uc001pcu.2_Missense_Mutation_p.R390K|NOX4_uc001pcw.2_Missense_Mutation_p.R157K|NOX4_uc001pcx.2_Missense_Mutation_p.R117K|NOX4_uc001pcv.2_Missense_Mutation_p.R424K|NOX4_uc009yvo.2_RNA|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Missense_Mutation_p.R228K|NOX4_uc010rtv.1_Missense_Mutation_p.R400K|NOX4_uc009yvq.2_Missense_Mutation_p.R440K	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	464	Cytoplasmic (Potential).|Mediates interaction with TLR4.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				CTGGATATCTCTGCATACCCA	0.338													29	185	---	---	---	---	PASS
NOX4	50507	broad.mit.edu	37	11	89135642	89135642	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89135642C>G	uc001pct.2	-	9	937	c.698G>C	c.(697-699)AGC>ACC	p.S233T	NOX4_uc009yvr.2_Missense_Mutation_p.S208T|NOX4_uc001pcu.2_Missense_Mutation_p.S159T|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Missense_Mutation_p.S233T|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Missense_Mutation_p.S67T|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Missense_Mutation_p.S209T|NOX4_uc009yvq.2_Missense_Mutation_p.S209T|NOX4_uc009yvs.1_RNA	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	233	Extracellular (Potential).|Ferric oxidoreductase.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				ATTCTGAGAGCTGGTTCGGTT	0.393													39	257	---	---	---	---	PASS
NAALAD2	10003	broad.mit.edu	37	11	89882195	89882195	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89882195G>C	uc001pdf.3	+	4	512	c.403G>C	c.(403-405)GAA>CAA	p.E135Q	NAALAD2_uc009yvx.2_Missense_Mutation_p.E135Q|NAALAD2_uc009yvy.2_Missense_Mutation_p.E135Q|NAALAD2_uc001pdd.2_Missense_Mutation_p.E135Q|NAALAD2_uc001pde.2_Missense_Mutation_p.E135Q	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	135	Extracellular (Potential).				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				ATCATACCTTGAACCACCACC	0.318													29	275	---	---	---	---	PASS
SLC36A4	120103	broad.mit.edu	37	11	92882014	92882014	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92882014G>C	uc001pdn.2	-						uc001pdl.1_5'Flank|SLC36A4_uc001pdm.2_Intron	NM_152313	NP_689526	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid						L-alanine transport|proline transport|tryptophan transport	integral to membrane	symporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CCGGCACCTAGAAAATGAAAA	0.333													16	66	---	---	---	---	PASS
KIAA1377	57562	broad.mit.edu	37	11	101834523	101834523	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101834523G>A	uc001pgm.2	+	6	3027	c.2757G>A	c.(2755-2757)CCG>CCA	p.P919P	KIAA1377_uc001pgn.2_Silent_p.P875P|KIAA1377_uc010run.1_Silent_p.P720P|KIAA1377_uc009yxa.1_Silent_p.P720P	NM_020802	NP_065853	Q9P2H0	K1377_HUMAN	hypothetical protein LOC57562	919							protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		AAAGTTATCCGTCTGTGACTC	0.403													38	253	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105797515	105797515	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105797515C>T	uc001pix.2	+	13	2342	c.1896C>T	c.(1894-1896)CTC>CTT	p.L632L	GRIA4_uc001piw.2_Silent_p.L632L	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	632	Helical; (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	TCTTTACACTCATCATTATAT	0.338													32	217	---	---	---	---	PASS
GUCY1A2	2977	broad.mit.edu	37	11	106888687	106888687	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106888687G>A	uc001pjg.1	-	1	485	c.95C>T	c.(94-96)TCT>TTT	p.S32F	GUCY1A2_uc010rvo.1_Missense_Mutation_p.S32F|GUCY1A2_uc009yxn.1_Missense_Mutation_p.S32F	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	32					intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		GCAGAGCCTAGACAGGGGGCA	0.532													4	26	---	---	---	---	PASS
CWF19L2	143884	broad.mit.edu	37	11	107263540	107263540	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107263540G>C	uc010rvp.1	-	11	1729	c.1699C>G	c.(1699-1701)CTG>GTG	p.L567V	CWF19L2_uc001pjh.3_RNA|CWF19L2_uc009yxo.2_RNA	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control	567							catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		TGTGATTCCAGAGATTTTCCG	0.388													14	88	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108383146	108383146	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108383146G>A	uc001pkk.2	-	6	3199	c.3088C>T	c.(3088-3090)CTC>TTC	p.L1030F	EXPH5_uc010rvy.1_Missense_Mutation_p.L842F|EXPH5_uc010rvz.1_Missense_Mutation_p.L874F|EXPH5_uc010rwa.1_Missense_Mutation_p.L954F	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	1030					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CCATGTATGAGAAAACTGCTT	0.408													11	130	---	---	---	---	PASS
ANKK1	255239	broad.mit.edu	37	11	113265686	113265686	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113265686G>A	uc001pny.2	+	3	610	c.516G>A	c.(514-516)CAG>CAA	p.Q172Q		NM_178510	NP_848605	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	172	Protein kinase.						ATP binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|ovary(1)|breast(1)	8		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		GGATGGAACAGTCCACCCGGA	0.567													7	26	---	---	---	---	PASS
ZBTB16	7704	broad.mit.edu	37	11	113934591	113934591	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113934591C>T	uc001pop.2	+	2	833	c.569C>T	c.(568-570)TCA>TTA	p.S190L	ZBTB16_uc001poo.1_Missense_Mutation_p.S190L|ZBTB16_uc001poq.2_Missense_Mutation_p.S190L	NM_006006	NP_005997	Q05516	ZBT16_HUMAN	promyelocytic leukemia zinc finger protein	190					apoptosis|central nervous system development|mesonephros development|myeloid cell differentiation|negative regulation of myeloid cell differentiation|negative regulation of transcription, DNA-dependent	nuclear speck|PML body|transcriptional repressor complex	protein homodimerization activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		GTCTCCACTTCATTTGGTCTT	0.567													6	101	---	---	---	---	PASS
FAM55D	54827	broad.mit.edu	37	11	114452443	114452443	+	Intron	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114452443T>C	uc001ppc.2	-						FAM55D_uc001ppd.2_Intron	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN	hypothetical protein LOC54827 isoform 1							extracellular region				ovary(2)|skin(2)	4		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)		ACAGGAGTACTTACTGTTGCA	0.378													9	69	---	---	---	---	PASS
PCSK7	9159	broad.mit.edu	37	11	117090469	117090469	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117090469G>A	uc001pqr.2	-	10	1362	c.1161C>T	c.(1159-1161)ACC>ACT	p.T387T		NM_004716	NP_004707	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	387	Catalytic.|Extracellular (Potential).				peptide hormone processing	integral to Golgi membrane	serine-type endopeptidase activity				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		CCCAGTCAGTGGTCACCTGGA	0.418			T	IGH@	MLCLS								3	53	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117335878	117335878	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117335878C>G	uc001prh.1	-	17	3227	c.3225G>C	c.(3223-3225)CAG>CAC	p.Q1075H		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1015	Extracellular (Potential).|Fibronectin type-III 2.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TGACACCGTTCTGCAGCTCCT	0.483													4	114	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117351983	117351983	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117351983G>C	uc001prh.1	-	13	2744	c.2742C>G	c.(2740-2742)CTC>CTG	p.L914L		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	854	Extracellular (Potential).|Ig-like C2-type 9.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CAGCGGGCTTGAGCTGGGAGA	0.592													10	79	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117389208	117389208	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117389208C>G	uc001prh.1	-	7	1665	c.1663G>C	c.(1663-1665)GAA>CAA	p.E555Q	DSCAML1_uc001pri.1_Missense_Mutation_p.E359Q	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	495	Extracellular (Potential).|Ig-like C2-type 5.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCCTGATATTCAGCACTGCCC	0.522													7	176	---	---	---	---	PASS
TMPRSS4	56649	broad.mit.edu	37	11	117973862	117973862	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117973862C>G	uc010rxo.1	+	4	495	c.204C>G	c.(202-204)CTC>CTG	p.L68L	TMPRSS4_uc010rxp.1_Silent_p.L68L|TMPRSS4_uc010rxq.1_5'UTR|TMPRSS4_uc010rxr.1_Silent_p.L43L|TMPRSS4_uc010rxs.1_Silent_p.L28L|TMPRSS4_uc009yzu.2_RNA|TMPRSS4_uc010rxt.1_Silent_p.L43L	NM_019894	NP_063947	Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4 isoform 1	68	Extracellular (Potential).|LDL-receptor class A.				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		GGCAGCCTCTCCACTTCATCC	0.592													5	283	---	---	---	---	PASS
UBE4A	9354	broad.mit.edu	37	11	118247311	118247311	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118247311G>A	uc001psw.2	+	10	1602	c.1473G>A	c.(1471-1473)TTG>TTA	p.L491L	UBE4A_uc001psv.2_Silent_p.L498L	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A	491					ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		AAACCTGTTTGATCCCAGCTG	0.418													85	183	---	---	---	---	PASS
PHLDB1	23187	broad.mit.edu	37	11	118521218	118521218	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118521218C>T	uc001ptr.1	+	21	4193	c.3840C>T	c.(3838-3840)TTC>TTT	p.F1280F	PHLDB1_uc001pts.2_Silent_p.F1280F|PHLDB1_uc001ptt.2_Silent_p.F1233F|PHLDB1_uc001ptu.1_RNA|PHLDB1_uc001ptv.1_Silent_p.F1095F|PHLDB1_uc001ptw.1_Silent_p.F635F|PHLDB1_uc009zai.1_Silent_p.F316F|PHLDB1_uc001ptx.1_Silent_p.F316F	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B,	1280	PH.										0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GGTTTGTCTTCGACCGGCTCA	0.572													22	108	---	---	---	---	PASS
HYOU1	10525	broad.mit.edu	37	11	118919196	118919196	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118919196C>G	uc001puu.2	-	19	2438	c.2245G>C	c.(2245-2247)GAG>CAG	p.E749Q	HYOU1_uc001put.2_Missense_Mutation_p.E714Q|HYOU1_uc010ryu.1_Missense_Mutation_p.E707Q|HYOU1_uc010ryv.1_Missense_Mutation_p.E638Q|HYOU1_uc001pux.3_Missense_Mutation_p.E749Q|HYOU1_uc010ryw.1_RNA	NM_006389	NP_006380	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1 precursor	749						endoplasmic reticulum lumen	ATP binding|protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		ACCTGGGTCTCAAATATGAAT	0.562													22	160	---	---	---	---	PASS
HYOU1	10525	broad.mit.edu	37	11	118919543	118919543	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118919543C>G	uc001puu.2	-	18	2241	c.2048G>C	c.(2047-2049)GGA>GCA	p.G683A	HYOU1_uc001put.2_Missense_Mutation_p.G648A|HYOU1_uc010ryu.1_Missense_Mutation_p.G641A|HYOU1_uc010ryv.1_Missense_Mutation_p.G572A|HYOU1_uc001pux.3_Missense_Mutation_p.G683A|HYOU1_uc010ryw.1_RNA	NM_006389	NP_006380	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1 precursor	683						endoplasmic reticulum lumen	ATP binding|protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		CTTCTTCTCTCCCTCTGGGGC	0.612													6	83	---	---	---	---	PASS
C2CD2L	9854	broad.mit.edu	37	11	118984642	118984642	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118984642G>A	uc001pvo.2	+	12	1926	c.1567G>A	c.(1567-1569)GTG>ATG	p.V523M	C2CD2L_uc001pvn.2_Missense_Mutation_p.V524M	NM_014807	NP_055622	O14523	C2C2L_HUMAN	transmembrane protein 24	523						integral to membrane					0						CAGTGGGCGGGTGGCCAAGAA	0.597													17	66	---	---	---	---	PASS
ABCG4	64137	broad.mit.edu	37	11	119029033	119029033	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119029033C>G	uc001pvs.2	+	10	1494	c.1158C>G	c.(1156-1158)CTC>CTG	p.L386L	ABCG4_uc009zar.2_Silent_p.L386L	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN	ATP-binding cassette, subfamily G, member 4	386	Cytoplasmic (Potential).|ABC transmembrane type-2.				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		TGTCCATCCTCAGGGACACGG	0.582													61	305	---	---	---	---	PASS
MFRP	83552	broad.mit.edu	37	11	119210417	119210417	+	3'UTR	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119210417G>C	uc001pwj.2	-	15					MFRP_uc010rzf.1_Intron	NM_031433	NP_113621	Q9BXJ0	C1QT5_HUMAN	membrane frizzled-related protein							collagen					0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		GGGTGCGTCAGACGGCGGAGG	0.711													8	46	---	---	---	---	PASS
POU2F3	25833	broad.mit.edu	37	11	120178198	120178198	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120178198G>A	uc001pxc.2	+	9	882	c.780G>A	c.(778-780)CCG>CCA	p.P260P	POU2F3_uc010rzk.1_Silent_p.P214P|POU2F3_uc010rzl.1_Silent_p.P190P|POU2F3_uc001pxe.1_Silent_p.P45P	NM_014352	NP_055167	Q9UKI9	PO2F3_HUMAN	POU transcription factor	260					negative regulation by host of viral transcription	cytoplasm	sequence-specific DNA binding			ovary(1)|skin(1)	2		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		AGTCCTCTCCGTCAGACCCCT	0.577													27	157	---	---	---	---	PASS
ARHGEF12	23365	broad.mit.edu	37	11	120346150	120346150	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120346150G>C	uc001pxl.1	+	33	3218	c.3211G>C	c.(3211-3213)GAT>CAT	p.D1071H	ARHGEF12_uc009zat.2_Missense_Mutation_p.D1052H|ARHGEF12_uc010rzn.1_Missense_Mutation_p.D968H|ARHGEF12_uc009zau.1_Missense_Mutation_p.D968H	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	1071	PH.				apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		ATCTACAGCTGATAGCAAACA	0.408			T	MLL	AML								31	213	---	---	---	---	PASS
GRIK4	2900	broad.mit.edu	37	11	120744930	120744930	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120744930G>A	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	TGCGCATGGTGAGGAGCGGCT	0.612													11	20	---	---	---	---	PASS
BSX	390259	broad.mit.edu	37	11	122850019	122850019	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122850019T>A	uc010rzs.1	-	2	409	c.409A>T	c.(409-411)ACG>TCG	p.T137S		NM_001098169	NP_001091639	Q3C1V8	BSH_HUMAN	brain specific homeobox	137	Homeobox.										0		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)		CGTTCTGGCGTGGACAGGTAG	0.662													17	121	---	---	---	---	PASS
OR10G9	219870	broad.mit.edu	37	11	123894542	123894542	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123894542T>A	uc010sad.1	+	1	823	c.823T>A	c.(823-825)TAC>AAC	p.Y275N		NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G,	275	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GGCCATTTTCTACACTGTGCT	0.488													33	168	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124766924	124766924	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124766924C>A	uc001qbg.2	-	2	444	c.304G>T	c.(304-306)GGC>TGC	p.G102C	ROBO4_uc010sas.1_5'UTR|ROBO4_uc001qbh.2_Intron|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'Flank	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	102	Ig-like C2-type 1.				angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		AGGGCCTGGCCATCGTGGGCA	0.667													10	38	---	---	---	---	PASS
STT3A	3703	broad.mit.edu	37	11	125483013	125483013	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125483013A>G	uc001qcd.2	+	13	1605	c.1495A>G	c.(1495-1497)AGG>GGG	p.R499G	STT3A_uc001qce.2_Missense_Mutation_p.R499G|STT3A_uc010sbg.1_Missense_Mutation_p.R407G|STT3A_uc009zbn.2_Missense_Mutation_p.R221G	NM_152713	NP_689926	P46977	STT3A_HUMAN	integral membrane protein 1	499	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity				0	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		GGATGGCAGTAGGATCATATT	0.478													50	276	---	---	---	---	PASS
ST14	6768	broad.mit.edu	37	11	130064532	130064532	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130064532C>G	uc001qfw.2	+						ST14_uc010sca.1_Intron	NM_021978	NP_068813	Q9Y5Y6	ST14_HUMAN	matriptase						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CCTTCCCTCTCAGGCTGTGGA	0.617													10	68	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134086933	134086933	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134086933G>C	uc001qhd.1	-	3	885	c.279C>G	c.(277-279)TTC>TTG	p.F93L	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	93					cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CAAAATGATAGAACAATGCCA	0.408													17	107	---	---	---	---	PASS
THYN1	29087	broad.mit.edu	37	11	134118800	134118800	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134118800G>C	uc001qhf.2	-	7	636	c.534C>G	c.(532-534)CTC>CTG	p.L178L	THYN1_uc001qhg.2_Silent_p.L178L|THYN1_uc001qhh.2_Silent_p.L178L|THYN1_uc001qhi.2_Intron|THYN1_uc001qhj.2_Intron	NM_001037305	NP_001032382	Q9P016	THYN1_HUMAN	thymocyte nuclear protein 1 isoform 1	178						nucleus					0	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;1.68e-10)|all cancers(11;1.95e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00148)|Lung(977;0.207)		GATAGGATTTGAGCTCAGCCA	0.413													44	213	---	---	---	---	PASS
IQSEC3	440073	broad.mit.edu	37	12	247613	247613	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:247613G>C	uc001qhw.1	+	1	181	c.175G>C	c.(175-177)GAG>CAG	p.E59Q	IQSEC3_uc001qhu.1_Missense_Mutation_p.E59Q|IQSEC3_uc001qht.1_Missense_Mutation_p.E144Q|uc001qhv.1_RNA	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	362					regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		ACCCACGGCCGAGAGCCTGGC	0.677													7	23	---	---	---	---	PASS
ADIPOR2	79602	broad.mit.edu	37	12	1889746	1889746	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1889746C>T	uc001qjm.2	+	5	790	c.593C>T	c.(592-594)TCA>TTA	p.S198L	ADIPOR2_uc001qjn.2_Missense_Mutation_p.S198L	NM_024551	NP_078827	Q86V24	ADR2_HUMAN	adiponectin receptor 2	198	Helical; Name=2; (Potential).				fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane	hormone binding|receptor activity				0	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)			CTTTCTTTTTCATGGCTCTTC	0.438													150	647	---	---	---	---	PASS
C12orf32	83695	broad.mit.edu	37	12	2994677	2994677	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2994677G>A	uc001qlh.2	+	2	313	c.145G>A	c.(145-147)GAC>AAC	p.D49N	TULP3_uc010sef.1_Intron|C12orf32_uc010see.1_Intron|C12orf32_uc001qli.2_Intron	NR_027363				RecName: Full=Uncharacterized protein C12orf32;												0			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			CAAGCCCATTGACCACAGCAC	0.413													6	151	---	---	---	---	PASS
PRMT8	56341	broad.mit.edu	37	12	3701394	3701394	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3701394C>T	uc001qmf.2	+						PRMT8_uc009zed.2_Intron|PRMT8_uc001qmg.2_Intron|PRMT8_uc001qmh.2_RNA	NM_019854	NP_062828	Q9NR22	ANM8_HUMAN	HMT1 hnRNP methyltransferase-like 4						regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity			ovary(3)|central_nervous_system(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			TCTCACCCCTCAGCCCCTGAT	0.567													49	774	---	---	---	---	PASS
ANO2	57101	broad.mit.edu	37	12	5756892	5756892	+	Splice_Site	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5756892C>A	uc001qnm.2	-	16	1692	c.1620_splice	c.e16+1	p.M540_splice		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						AAGGAAATTACCATGAATAAG	0.443													4	38	---	---	---	---	PASS
ANO2	57101	broad.mit.edu	37	12	5756893	5756893	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5756893C>A	uc001qnm.2	-	16	1692	c.1620G>T	c.(1618-1620)ATG>ATT	p.M540I		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	545	Helical; (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						AGGAAATTACCATGAATAAGA	0.443													4	38	---	---	---	---	PASS
PLEKHG6	55200	broad.mit.edu	37	12	6424818	6424818	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6424818G>C	uc001qnr.2	+						PLEKHG6_uc001qns.2_Intron|PLEKHG6_uc010sew.1_Intron|PLEKHG6_uc010sex.1_Intron	NM_018173	NP_060643	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain-containing family G						regulation of Rho protein signal transduction	cleavage furrow|cytoplasm|spindle pole	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|skin(1)	2						TGACTGATGTGAGCCCCCCTC	0.627													8	68	---	---	---	---	PASS
IFFO1	25900	broad.mit.edu	37	12	6657950	6657950	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6657950G>A	uc001qpd.1	-	5	1147	c.1113C>T	c.(1111-1113)GCC>GCT	p.A371A	IFFO1_uc001qoy.2_RNA|IFFO1_uc001qpa.1_Silent_p.A11A|IFFO1_uc001qpb.1_Silent_p.A48A|IFFO1_uc001qpe.1_RNA|IFFO1_uc010sfe.1_Silent_p.A382A|IFFO1_uc001qpf.1_Silent_p.A374A|IFFO1_uc001qoz.1_Silent_p.A11A|IFFO1_uc001qpc.1_Silent_p.A374A|IFFO1_uc001qpg.2_Silent_p.A11A	NM_080730	NP_542768	Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan isoform 2	371						intermediate filament					0						CCTCCTCGACGGCAGCCTTGC	0.642													5	66	---	---	---	---	PASS
LAG3	3902	broad.mit.edu	37	12	6886553	6886553	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6886553C>G	uc001qqt.3	+	6	1530	c.1181C>G	c.(1180-1182)TCA>TGA	p.S394*	LAG3_uc001qqu.2_Nonsense_Mutation_p.S224*	NM_002286	NP_002277	P18627	LAG3_HUMAN	lymphocyte-activation protein 3 precursor	394	Extracellular (Potential).|Ig-like C2-type 3.					integral to membrane	antigen binding|MHC class II protein binding				0						AGGAGTTTCTCAGGACCTTGG	0.582													37	347	---	---	---	---	PASS
TPI1	7167	broad.mit.edu	37	12	6976808	6976808	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6976808C>T	uc001qrk.2	+	1	116	c.78C>T	c.(76-78)ATC>ATT	p.I26I	TPI1_uc010sfo.1_5'Flank	NM_000365	NP_000356	P60174	TPIS_HUMAN	triosephosphate isomerase 1 isoform 1	26					fatty acid biosynthetic process|gluconeogenesis|glycolysis|pentose-phosphate shunt	cytosol	triose-phosphate isomerase activity				0						GGGAGCTCATCGGCACTCTGA	0.572													4	66	---	---	---	---	PASS
TPI1	7167	broad.mit.edu	37	12	6978455	6978455	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6978455G>C	uc001qrk.2	+	4	396	c.358G>C	c.(358-360)GAG>CAG	p.E120Q	TPI1_uc010sfo.1_Missense_Mutation_p.E38Q	NM_000365	NP_000356	P60174	TPIS_HUMAN	triosephosphate isomerase 1 isoform 1	120					fatty acid biosynthetic process|gluconeogenesis|glycolysis|pentose-phosphate shunt	cytosol	triose-phosphate isomerase activity				0						TGCTCTGGCAGAGGGACTCGG	0.502											OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	851	---	---	---	---	PASS
C1RL	51279	broad.mit.edu	37	12	7249728	7249728	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7249728C>G	uc001qsn.2	-	6	740	c.723G>C	c.(721-723)CAG>CAC	p.Q241H	C1RL_uc009zft.2_Missense_Mutation_p.R257T	NM_016546	NP_057630	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	241					complement activation, classical pathway|innate immune response|proteolysis		serine-type endopeptidase activity			pancreas(1)	1						TCGTCTGATTCTGGGCAATGG	0.627													10	97	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7651770	7651770	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7651770C>G	uc001qsz.3	-	4	600	c.472G>C	c.(472-474)GAA>CAA	p.E158Q	CD163_uc001qta.3_Missense_Mutation_p.E158Q|CD163_uc009zfw.2_Missense_Mutation_p.E158Q	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	158	Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						AGCCTCATTTCCAAATTGGAT	0.413													47	714	---	---	---	---	PASS
APOBEC1	339	broad.mit.edu	37	12	7803718	7803718	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7803718C>A	uc001qtb.2	-	4	496	c.462G>T	c.(460-462)AGG>AGT	p.R154S	APOBEC1_uc001qtc.2_Missense_Mutation_p.R109S|APOBEC1_uc010sgf.1_Missense_Mutation_p.R154S	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme	154					cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0						TGACAAAATTCCTCCAGCAGT	0.448													14	263	---	---	---	---	PASS
NECAP1	25977	broad.mit.edu	37	12	8248226	8248226	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8248226C>A	uc001qtx.2	+	7	784	c.706C>A	c.(706-708)CCT>ACT	p.P236T	NECAP1_uc001qty.2_Missense_Mutation_p.P94T	NM_015509	NP_056324	Q8NC96	NECP1_HUMAN	NECAP endocytosis associated 1	236					endocytosis|protein transport	clathrin coated vesicle membrane|plasma membrane				ovary(1)	1				Kidney(36;0.0915)		TTCTCCTGCTCCTGTCACGAC	0.373													15	317	---	---	---	---	PASS
KLRB1	3820	broad.mit.edu	37	12	9747874	9747874	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9747874G>C	uc010sgt.1	-	6	736	c.674C>G	c.(673-675)TCT>TGT	p.S225C		NM_002258	NP_002249	Q12918	KLRB1_HUMAN	killer cell lectin-like receptor subfamily B,	225	Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	sugar binding|transmembrane receptor activity				0						TCATAGTCAAGAGTCAGGATA	0.378													30	323	---	---	---	---	PASS
CLEC12A	160364	broad.mit.edu	37	12	10133172	10133172	+	Intron	SNP	T	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10133172T>G	uc001qwr.3	+						CLEC12A_uc001qwq.2_Intron|CLEC12A_uc001qws.3_Intron|CLEC12A_uc001qwt.2_Intron	NM_138337	NP_612210	Q5QGZ9	CL12A_HUMAN	myeloid inhibitory C-type lectin-like receptor							integral to membrane|plasma membrane	receptor activity|sugar binding			skin(1)	1						AACTATGTTCTTCTTCCAGAG	0.363													60	309	---	---	---	---	PASS
KLRC1	3821	broad.mit.edu	37	12	10603638	10603638	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10603638A>G	uc001qyl.2	-	2	282	c.118T>C	c.(118-120)TAT>CAT	p.Y40H	KLRC1_uc009zhm.1_Missense_Mutation_p.Y40H|KLRC1_uc001qym.2_Missense_Mutation_p.Y40H|KLRC1_uc001qyn.2_Missense_Mutation_p.Y40H|KLRC1_uc001qyo.2_Missense_Mutation_p.Y40H	NM_002259	NP_002250	P26715	NKG2A_HUMAN	killer cell lectin-like receptor subfamily C,	40	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|regulation of immune response	integral to plasma membrane	sugar binding|transmembrane receptor activity				0						AATTCCGCATAGGTTATTTCC	0.378													49	473	---	---	---	---	PASS
TAS2R9	50835	broad.mit.edu	37	12	10961880	10961880	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10961880C>G	uc001qyx.2	-	1	888	c.795G>C	c.(793-795)ATG>ATC	p.M265I	TAS2R8_uc010shh.1_5'Flank	NM_023917	NP_076406	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	265	Helical; Name=7; (Potential).				sensory perception of taste	integral to membrane	taste receptor activity			skin(1)	1						TGTCACCAATCATCAACACTA	0.403													27	303	---	---	---	---	PASS
TAS2R19	259294	broad.mit.edu	37	12	11174300	11174300	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11174300G>C	uc010shj.1	-	1	871	c.871C>G	c.(871-873)CTT>GTT	p.L291V	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176888	NP_795369	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	291	Cytoplasmic (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			skin(1)	1						AAAACTGAAAGAAAGGTCTGT	0.428													33	248	---	---	---	---	PASS
TAS2R19	259294	broad.mit.edu	37	12	11174553	11174553	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11174553G>C	uc010shj.1	-	1	618	c.618C>G	c.(616-618)CTC>CTG	p.L206L	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176888	NP_795369	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	206	Cytoplasmic (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			skin(1)	1						GCATCTTCTTGAGATGTTTAC	0.413													18	544	---	---	---	---	PASS
PRB4	5545	broad.mit.edu	37	12	11461171	11461171	+	3'UTR	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11461171G>C	uc001qzf.1	-	3					PRB4_uc001qzt.2_3'UTR	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1						TTGAATCCTAGATTACTGGGG	0.438										HNSCC(22;0.051)			44	484	---	---	---	---	PASS
ETV6	2120	broad.mit.edu	37	12	12006363	12006363	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12006363G>A	uc001qzz.2	+	4	605	c.331G>A	c.(331-333)GAT>AAT	p.D111N		NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6	111	PNT.					cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				CTTTCCAGGTGATGTGCTCTA	0.453			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								33	416	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13906545	13906545	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13906545T>A	uc001rbt.2	-	3	895	c.716A>T	c.(715-717)TAC>TTC	p.Y239F		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	239	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TTCAAAGATGTAGGTGGCTTC	0.512													57	190	---	---	---	---	PASS
GUCY2C	2984	broad.mit.edu	37	12	14796593	14796593	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14796593C>G	uc001rcd.2	-	17	1982	c.1845G>C	c.(1843-1845)CTG>CTC	p.L615L		NM_004963	NP_004954	P25092	GUC2C_HUMAN	guanylate cyclase 2C precursor	615	Cytoplasmic (Potential).|Protein kinase.				intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6						TGGTAGATTTCAGACGACCAT	0.398													63	371	---	---	---	---	PASS
RERG	85004	broad.mit.edu	37	12	15262294	15262294	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15262294C>G	uc001rcs.2	-	4	490	c.350G>C	c.(349-351)GGA>GCA	p.G117A	RERG_uc001rct.2_Missense_Mutation_p.G117A|RERG_uc010shu.1_Missense_Mutation_p.G98A	NM_032918	NP_116307	Q96A58	RERG_HUMAN	RAS-like, estrogen-regulated, growth inhibitor	117					negative regulation of cell growth|negative regulation of cell proliferation|response to hormone stimulus|small GTPase mediated signal transduction	cytosol|membrane|nucleus	estrogen receptor binding|GDP binding|GTP binding|GTPase activity			lung(1)	1						AGCTTTGTTTCCAACCAAGAT	0.473													58	362	---	---	---	---	PASS
PLCZ1	89869	broad.mit.edu	37	12	18889229	18889229	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18889229G>T	uc010sid.1	-	3	252	c.61C>A	c.(61-63)CTA>ATA	p.L21I	PLCZ1_uc001rdv.3_5'UTR|PLCZ1_uc001rdw.3_5'UTR|CAPZA3_uc001rdy.2_5'Flank	NM_033123	NP_149114	Q86YW0	PLCZ1_HUMAN	phospholipase C, zeta 1	21					intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					GTTTTTTCTAGGTTAATTTTT	0.338													22	67	---	---	---	---	PASS
RASSF8	11228	broad.mit.edu	37	12	26217997	26217997	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26217997G>C	uc001rgx.2	+	3	891	c.670G>C	c.(670-672)GAA>CAA	p.E224Q	RASSF8_uc001rgy.2_Missense_Mutation_p.E224Q|RASSF8_uc001rgz.2_Missense_Mutation_p.E224Q|RASSF8_uc009zjd.1_Missense_Mutation_p.E224Q|RASSF8_uc009zje.1_Missense_Mutation_p.E224Q	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family	224	Glu-rich.				signal transduction						0	Colorectal(261;0.0847)					TGAGGAGGAAGAATTCTGGGA	0.328													19	146	---	---	---	---	PASS
TM7SF3	51768	broad.mit.edu	37	12	27135731	27135731	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27135731G>C	uc010sjl.1	-	7	1168	c.930C>G	c.(928-930)TTC>TTG	p.F310L		NM_016551	NP_057635	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3 precursor	310	Phe-rich.|Helical; (Potential).					integral to membrane|plasma membrane				upper_aerodigestive_tract(2)	2	Colorectal(261;0.0847)					TGTGTCCAAAGAAACAAATGA	0.368													7	40	---	---	---	---	PASS
OVCH1	341350	broad.mit.edu	37	12	29639178	29639178	+	Splice_Site	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29639178C>G	uc001rix.1	-	8	995	c.995_splice	c.e8+1	p.I332_splice		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor						proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TAGAACCACACATACCCTTTC	0.428													19	128	---	---	---	---	PASS
IPO8	10526	broad.mit.edu	37	12	30823885	30823885	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30823885C>G	uc001rjd.2	-						IPO8_uc010sjt.1_Intron	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8						intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					GAGCTGCTCTCTGACACTAAC	0.363													11	223	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	32945394	32945394	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32945394G>T	uc001rlj.3	-	14	2725	c.2610C>A	c.(2608-2610)AGC>AGA	p.S870R	PKP2_uc001rlk.3_Missense_Mutation_p.S826R|PKP2_uc010skj.1_Missense_Mutation_p.S823R	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	870					cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TGGCAGTCCGGCTGTTGACAA	0.398													43	123	---	---	---	---	PASS
SLC2A13	114134	broad.mit.edu	37	12	40158639	40158639	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40158639G>C	uc010skm.1	-	8	1518	c.1467C>G	c.(1465-1467)TTC>TTG	p.F489L	C12orf40_uc009zjv.1_Intron	NM_052885	NP_443117	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose	489	Extracellular (Potential).					integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)				CTTCTGTTTTGAACTTGGTTT	0.328										HNSCC(50;0.14)			9	90	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40637414	40637414	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40637414A>G	uc001rmg.3	+	7	890	c.769A>G	c.(769-771)ATG>GTG	p.M257V		NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	257					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GGTGGAAGCTATGAAAGCATT	0.363													39	219	---	---	---	---	PASS
PUS7L	83448	broad.mit.edu	37	12	44148331	44148331	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44148331C>A	uc001rnq.3	-	2	1207	c.718G>T	c.(718-720)GAC>TAC	p.D240Y	PUS7L_uc001rnr.3_Missense_Mutation_p.D240Y|PUS7L_uc001rns.3_Missense_Mutation_p.D240Y|PUS7L_uc009zkb.2_Intron	NM_001098615	NP_001092085	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S.	240					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			pancreas(1)	1	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		TTTCTGTGGTCTTTGTTTGTA	0.328													32	187	---	---	---	---	PASS
NELL2	4753	broad.mit.edu	37	12	44913929	44913929	+	Silent	SNP	C	A	A	rs139052675	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44913929C>A	uc001rog.2	-	19	2854	c.2259G>T	c.(2257-2259)CCG>CCT	p.P753P	NELL2_uc001rof.3_Silent_p.P752P|NELL2_uc001roh.2_Silent_p.P753P|NELL2_uc009zkd.2_Silent_p.P705P|NELL2_uc010skz.1_Silent_p.P803P|NELL2_uc010sla.1_Silent_p.P776P	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	753	VWFC 4.				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		TGACACAGCGCGGGCAGCACT	0.537													6	52	---	---	---	---	PASS
ANO6	196527	broad.mit.edu	37	12	45744461	45744461	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45744461C>G	uc001roo.2	+	7	1102	c.767C>G	c.(766-768)TCA>TGA	p.S256*	ANO6_uc010sld.1_Nonsense_Mutation_p.S256*|ANO6_uc010sle.1_Nonsense_Mutation_p.S256*|ANO6_uc010slf.1_Nonsense_Mutation_p.S277*|ANO6_uc010slg.1_Nonsense_Mutation_p.S238*	NM_001025356	NP_001020527	Q4KMQ2	ANO6_HUMAN	anoctamin 6 isoform a	256	Cytoplasmic (Potential).				activation of blood coagulation via clotting cascade|phosphatidylserine exposure on blood platelet	chloride channel complex|plasma membrane	chloride channel activity			ovary(1)|kidney(1)	2						CGCCGTCAGTCAGAGGATCCC	0.443													7	46	---	---	---	---	PASS
ARID2	196528	broad.mit.edu	37	12	46231199	46231199	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46231199A>C	uc001ros.1	+	9	1119	c.1119A>C	c.(1117-1119)AGA>AGC	p.R373S	ARID2_uc001ror.2_Missense_Mutation_p.R373S|ARID2_uc009zkg.1_5'UTR|ARID2_uc009zkh.1_Missense_Mutation_p.R19S|ARID2_uc001rot.1_Missense_Mutation_p.R19S	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	373					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TAAAGATGAGAGGTGAGTTTT	0.308													65	137	---	---	---	---	PASS
FAM113B	91523	broad.mit.edu	37	12	47629398	47629398	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47629398G>C	uc001rpn.2	+	4	1283	c.552G>C	c.(550-552)CAG>CAC	p.Q184H	FAM113B_uc010slj.1_Missense_Mutation_p.Q64H|FAM113B_uc001rpq.2_Missense_Mutation_p.Q184H	NM_138371	NP_612380	Q96HM7	F113B_HUMAN	hypothetical protein LOC91523	184							hydrolase activity			skin(3)|ovary(2)	5	Renal(347;0.138)|Lung SC(27;0.192)					TCCGGCGGCAGAAGGCCACCT	0.582													3	54	---	---	---	---	PASS
WNT1	7471	broad.mit.edu	37	12	49375060	49375060	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49375060C>A	uc001rsu.2	+	4	948	c.750C>A	c.(748-750)TTC>TTA	p.F250L		NM_005430	NP_005421	P04628	WNT1_HUMAN	wingless-type MMTV integration site family,	250					brain segmentation|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|central nervous system morphogenesis|cerebellum formation|dermatome development|diencephalon development|embryonic axis specification|forebrain anterior/posterior pattern formation|fourth ventricle development|hemopoietic stem cell proliferation|hepatocyte differentiation|inner ear morphogenesis|mesoderm morphogenesis|midbrain development|midbrain-hindbrain boundary maturation during brain development|negative regulation of cell-cell adhesion|negative regulation of cell-substrate adhesion|negative regulation of DNA damage checkpoint|negative regulation of fat cell differentiation|neuron fate determination|positive regulation of fibroblast proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of lamellipodium assembly|positive regulation of Notch signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|response to wounding|signal transduction in response to DNA damage|Spemann organizer formation|T cell differentiation in thymus|Wnt receptor signaling pathway, calcium modulating pathway	early endosome|extracellular space|late endosome|membrane raft|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled-2 binding|transcription regulatory region DNA binding			kidney(1)	1				BRCA - Breast invasive adenocarcinoma(357;0.244)		GCGACCGCTTCGACGGCGCCT	0.726													3	11	---	---	---	---	PASS
AQP6	363	broad.mit.edu	37	12	50368169	50368169	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50368169G>A	uc001rvr.1	+	2	802	c.465G>A	c.(463-465)CTG>CTA	p.L155L	AQP6_uc001rvp.1_5'UTR|AQP6_uc001rvq.1_RNA	NM_001652	NP_001643	Q13520	AQP6_HUMAN	aquaporin 6	155	Helical; (Potential).				excretion|odontogenesis	integral to plasma membrane|transport vesicle membrane	anion channel activity|water channel activity				0						CCCTGCAGCTGGTGCTCTGTG	0.617											OREG0021809	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	66	---	---	---	---	PASS
AQP6	363	broad.mit.edu	37	12	50369453	50369453	+	Nonstop_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50369453G>C	uc001rvr.1	+	4	1185	c.848G>C	c.(847-849)TGA>TCA	p.*283S	AQP6_uc001rvp.1_Nonstop_Mutation_p.*109S|AQP6_uc001rvq.1_RNA	NM_001652	NP_001643	Q13520	AQP6_HUMAN	aquaporin 6	283					excretion|odontogenesis	integral to plasma membrane|transport vesicle membrane	anion channel activity|water channel activity				0						GAGAGTGTGTGAAACAGCCTA	0.672													3	20	---	---	---	---	PASS
METTL7A	25840	broad.mit.edu	37	12	51319290	51319290	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51319290C>T	uc001rxb.2	+	1	757	c.469C>T	c.(469-471)CTC>TTC	p.L157F	METTL7A_uc010smv.1_Intron	NM_014033	NP_054752	Q9H8H3	MET7A_HUMAN	methyltransferase like 7A precursor	157						endoplasmic reticulum|lipid particle|membrane	methyltransferase activity				0						GGAGCGGATTCTCCGCGAGGT	0.562													9	45	---	---	---	---	PASS
TFCP2	7024	broad.mit.edu	37	12	51495742	51495742	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51495742C>G	uc001rxw.2	-	11	1586	c.1127G>C	c.(1126-1128)AGA>ACA	p.R376T	TFCP2_uc001rxv.1_Missense_Mutation_p.R376T|TFCP2_uc009zlx.1_Missense_Mutation_p.R325T|TFCP2_uc001rxx.2_Intron|TFCP2_uc009zly.1_Missense_Mutation_p.R278T	NM_005653	NP_005644	Q12800	TFCP2_HUMAN	transcription factor CP2	376	DNA-binding.				regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						ATTAAAAAGTCTGATTCCATC	0.343													18	151	---	---	---	---	PASS
ANKRD33	341405	broad.mit.edu	37	12	52282470	52282470	+	5'UTR	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52282470G>T	uc001rzf.3	+	2					ANKRD33_uc001rzh.3_Missense_Mutation_p.E88D|ANKRD33_uc001rzd.2_Missense_Mutation_p.E88D|ANKRD33_uc001rze.2_5'UTR|ANKRD33_uc001rzg.3_5'UTR|ANKRD33_uc001rzi.3_5'UTR	NM_001130015	NP_001123487	Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33 isoform 1												0				BRCA - Breast invasive adenocarcinoma(357;0.0969)		CGGGCAAGGAGACCCCCACCC	0.632													52	86	---	---	---	---	PASS
KRT77	374454	broad.mit.edu	37	12	53086361	53086361	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53086361G>T	uc001saw.2	-	7	1300	c.1271C>A	c.(1270-1272)GCG>GAG	p.A424E	KRT77_uc009zmi.2_Missense_Mutation_p.A182E	NM_175078	NP_778253	Q7Z794	K2C1B_HUMAN	keratin 77	424	Rod.|Coil 2.					keratin filament	structural molecule activity			ovary(1)	1						CTTCTGCCACGCATCCTGGAG	0.592													25	56	---	---	---	---	PASS
MAP3K12	7786	broad.mit.edu	37	12	53879117	53879117	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53879117C>G	uc001sdm.1	-	6	963	c.865G>C	c.(865-867)GAG>CAG	p.E289Q	MAP3K12_uc001sdn.1_Missense_Mutation_p.E322Q	NM_006301	NP_006292	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase	289	Protein kinase.				histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			lung(2)|ovary(1)|breast(1)|skin(1)	5						TCGACCTTCTCAGACACAGGT	0.552													7	283	---	---	---	---	PASS
HOXC10	3226	broad.mit.edu	37	12	54379177	54379177	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54379177G>A	uc001sen.2	+	1	232	c.134G>A	c.(133-135)AGG>AAG	p.R45K		NM_017409	NP_059105	Q9NYD6	HXC10_HUMAN	homeobox C10	45					positive regulation of cell proliferation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1						GGGGTGATGAGGGGCTGCGGG	0.662													14	89	---	---	---	---	PASS
ANKRD52	283373	broad.mit.edu	37	12	56637078	56637078	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56637078C>T	uc001skm.3	-	28	3169	c.3079G>A	c.(3079-3081)GTC>ATC	p.V1027I		NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	1027							protein binding			ovary(2)	2						AAAGGACTGACGGCGTCCTTG	0.627													10	33	---	---	---	---	PASS
STAT6	6778	broad.mit.edu	37	12	57490445	57490445	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57490445C>G	uc009zpe.2	-	22	2705	c.2454G>C	c.(2452-2454)TTG>TTC	p.L818F	STAT6_uc009zpf.2_Missense_Mutation_p.L818F|STAT6_uc001sna.2_Missense_Mutation_p.L818F|STAT6_uc010srb.1_Missense_Mutation_p.L708F|STAT6_uc010src.1_Missense_Mutation_p.L708F|STAT6_uc010srd.1_Missense_Mutation_p.L708F|STAT6_uc009zpg.2_Missense_Mutation_p.L867F	NM_003153	NP_003144	P42226	STAT6_HUMAN	signal transducer and activator of transcription	818					regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(2)|lung(1)|skin(1)	4						GCTGTGCCCCCAAGGACCCTC	0.607													13	88	---	---	---	---	PASS
NDUFA4L2	56901	broad.mit.edu	37	12	57630802	57630802	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57630802G>C	uc001sno.2	-						NDUFA4L2_uc010srk.1_Intron|NDUFA4L2_uc010srl.1_Intron	NM_020142	NP_064527	Q9NRX3	NUA4L_HUMAN	NADH:ubiquinone oxidoreductase MLRQ subunit												0					NADH(DB00157)	CTGAGGTTCTGAGGACTCACC	0.572													9	239	---	---	---	---	PASS
GLI1	2735	broad.mit.edu	37	12	57857804	57857804	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57857804C>A	uc001snx.2	+	3	201	c.123C>A	c.(121-123)TGC>TGA	p.C41*	GLI1_uc009zpp.2_RNA|GLI1_uc009zpq.2_Intron|GLI1_uc009zpr.1_Intron	NM_005269	NP_005260	P08151	GLI1_HUMAN	GLI family zinc finger 1 isoform 1	41					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding			skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15			GBM - Glioblastoma multiforme(3;3.99e-32)			CGCCCTTCTGCCACCAAGCTA	0.552													43	288	---	---	---	---	PASS
AGAP2	116986	broad.mit.edu	37	12	58127952	58127952	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58127952G>A	uc001spq.2	-	5	1406	c.1406C>T	c.(1405-1407)TCA>TTA	p.S469L	AGAP2_uc001spp.2_Missense_Mutation_p.S469L|AGAP2_uc001spr.2_Missense_Mutation_p.S133L	NM_001122772	NP_001116244	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-L	469	G domain.				axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						TGCCCAGCCTGAGAACTTGCG	0.562													8	58	---	---	---	---	PASS
USP15	9958	broad.mit.edu	37	12	62790074	62790074	+	Splice_Site	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62790074G>A	uc001src.1	+	20	2580	c.2571_splice	c.e20-1	p.N857_splice	USP15_uc001srb.1_Splice_Site_p.N828_splice	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15						protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		TTTTTAAACAGTGACTTGGAT	0.348													38	94	---	---	---	---	PASS
MON2	23041	broad.mit.edu	37	12	62931381	62931381	+	Splice_Site	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62931381G>T	uc001sre.2	+	16	2405	c.2014_splice	c.e16-1	p.L672_splice	MON2_uc009zqj.2_Splice_Site_p.L672_splice|MON2_uc010ssl.1_Splice_Site_p.L600_splice|MON2_uc010ssm.1_Splice_Site_p.L649_splice|MON2_uc010ssn.1_Splice_Site_p.L672_splice|MON2_uc001srf.2_Splice_Site_p.L435_splice	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog						Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTAAAATATAGCTGACTTCCA	0.308													45	128	---	---	---	---	PASS
C12orf66	144577	broad.mit.edu	37	12	64587969	64587969	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64587969G>C	uc001srw.3	-	3	1050	c.991C>G	c.(991-993)CAC>GAC	p.H331D	C12orf66_uc009zql.2_Missense_Mutation_p.H278D	NM_152440	NP_689653	Q96MD2	CL066_HUMAN	hypothetical protein LOC144577	331										ovary(1)	1						TGGGGGTGGTGATAACCATGA	0.488													41	191	---	---	---	---	PASS
GNS	2799	broad.mit.edu	37	12	65113896	65113896	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65113896C>G	uc001ssg.3	-	13	1656	c.1486G>C	c.(1486-1488)GAC>CAC	p.D496H	GNS_uc001ssf.2_Missense_Mutation_p.D440H|GNS_uc010ssq.1_Missense_Mutation_p.D528H|GNS_uc010ssr.1_Missense_Mutation_p.D476H	NM_002076	NP_002067	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase precursor	496						lysosome	metal ion binding|N-acetylglucosamine-6-sulfatase activity|protein binding			central_nervous_system(1)	1	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		AGCTCTGGGTCTATGGTTTTA	0.443													70	450	---	---	---	---	PASS
GRIP1	23426	broad.mit.edu	37	12	66849292	66849292	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66849292C>G	uc001stk.2	-	10	1336	c.1095G>C	c.(1093-1095)CTG>CTC	p.L365L	GRIP1_uc010sta.1_Silent_p.L309L|GRIP1_uc001stj.2_Silent_p.L147L|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Silent_p.L365L	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	417					androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TCAGGGAACTCAGGCTGTATG	0.512													28	138	---	---	---	---	PASS
DYRK2	8445	broad.mit.edu	37	12	68051554	68051554	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68051554G>A	uc001str.3	+	3	1269	c.867G>A	c.(865-867)GAG>GAA	p.E289E	DYRK2_uc001sts.3_Silent_p.E216E	NM_006482	NP_006473	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	289	Protein kinase.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|positive regulation of glycogen biosynthetic process|smoothened signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|manganese ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(1)|central_nervous_system(1)	4			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		ATATGCTGGAGAATTTCACCT	0.498													43	291	---	---	---	---	PASS
LGR5	8549	broad.mit.edu	37	12	71950478	71950478	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71950478G>C	uc001swl.2	+						LGR5_uc001swm.2_Intron|LGR5_uc001swn.1_Intron	NM_003667	NP_003658	O75473	LGR5_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to plasma membrane	protein-hormone receptor activity			lung(4)|skin(3)|ovary(1)|pancreas(1)	9						TTTGTGAGTTGACCTTTTATT	0.368													40	179	---	---	---	---	PASS
ZFC3H1	196441	broad.mit.edu	37	12	72025649	72025649	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72025649C>T	uc001swo.2	-	16	3738	c.3379G>A	c.(3379-3381)GAT>AAT	p.D1127N		NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	1127					RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						GTGACAAAATCCACATCTACA	0.343													24	154	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78598824	78598824	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78598824G>T	uc001syp.2	+	39	7117	c.6944G>T	c.(6943-6945)CGA>CTA	p.R2315L	NAV3_uc001syo.2_Missense_Mutation_p.R2293L|NAV3_uc010sub.1_Missense_Mutation_p.R1772L|NAV3_uc009zsf.2_Missense_Mutation_p.R1124L	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	2315						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CTTCAGCTGCGACCAGAAGAT	0.507										HNSCC(70;0.22)			18	43	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80761331	80761331	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80761331C>G	uc009zsg.1	+						uc001szd.2_Intron					RecName: Full=Uncharacterized protein C12orf64;																		ACTATGTTTTCTGTTCTTAGA	0.313													4	8	---	---	---	---	PASS
PPFIA2	8499	broad.mit.edu	37	12	81675037	81675037	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81675037G>A	uc001szo.1	-	27	3372	c.3211C>T	c.(3211-3213)CGA>TGA	p.R1071*	PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA|PPFIA2_uc010suf.1_RNA|PPFIA2_uc009zsh.2_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	970										ovary(3)|lung(2)|pancreas(1)	6						AACACCTACCGATGGAAACTA	0.313													15	33	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85441104	85441104	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85441104G>A	uc001tac.2	+	6	645	c.534G>A	c.(532-534)CAG>CAA	p.Q178Q	LRRIQ1_uc001tab.1_Silent_p.Q178Q|LRRIQ1_uc001taa.1_Silent_p.Q178Q|LRRIQ1_uc001tad.2_Silent_p.Q86Q	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	178	Glu-rich.									ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		AAGAGAAACAGAAGGAATTAG	0.353													18	117	---	---	---	---	PASS
POC1B	282809	broad.mit.edu	37	12	89861417	89861417	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89861417C>A	uc001tbc.2	-	8	961	c.856G>T	c.(856-858)GCA>TCA	p.A286S	POC1B_uc001tba.2_Missense_Mutation_p.A244S|POC1B_uc001tbb.2_Missense_Mutation_p.A156S|POC1B_uc010sun.1_RNA|POC1B_uc009zsp.2_RNA|POC1B_uc009zsq.2_RNA	NM_172240	NP_758440	Q8TC44	POC1B_HUMAN	WD repeat domain 51B	286	WD 7.				cell projection organization	centriole|microtubule basal body				ovary(1)	1						CCTCCTGATGCAAATAGCTCT	0.388													4	73	---	---	---	---	PASS
LUM	4060	broad.mit.edu	37	12	91498030	91498030	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91498030C>A	uc001tbm.2	-	3	1318	c.929G>T	c.(928-930)CGT>CTT	p.R310L	LUM_uc001tbn.2_RNA	NM_002345	NP_002336	P51884	LUM_HUMAN	lumican precursor	310	LRR 11.				collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent			central_nervous_system(2)	2						GCCATCCAAACGCAAATGCTT	0.373													22	122	---	---	---	---	PASS
MRPL42	28977	broad.mit.edu	37	12	93863109	93863109	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93863109G>C	uc001tcr.2	+	2	206	c.48G>C	c.(46-48)TTG>TTC	p.L16F	MRPL42_uc001tcq.2_Missense_Mutation_p.E10Q|MRPL42_uc001tcs.2_Missense_Mutation_p.L16F|MRPL42_uc001tct.2_RNA	NM_172177	NP_751917	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42 isoform a	16					translation	mitochondrial small ribosomal subunit	structural constituent of ribosome			ovary(2)	2						GAACTATCTTGAAACATTTAT	0.254													17	84	---	---	---	---	PASS
PLXNC1	10154	broad.mit.edu	37	12	94634451	94634451	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94634451G>A	uc001tdc.2	+							NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						GTACTTTCTAGATTCATAATC	0.388													48	249	---	---	---	---	PASS
TMCC3	57458	broad.mit.edu	37	12	94976028	94976028	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94976028G>A	uc001tdj.2	-	2	483	c.365C>T	c.(364-366)TCA>TTA	p.S122L	TMCC3_uc001tdi.2_Missense_Mutation_p.S91L	NM_020698	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	122	Potential.					integral to membrane				ovary(1)|skin(1)	2						GGAGTGAGCTGATTTCTGATT	0.488													31	167	---	---	---	---	PASS
VEZT	55591	broad.mit.edu	37	12	95676299	95676299	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95676299G>A	uc001tdz.2	+	8	1312	c.1207G>A	c.(1207-1209)GAA>AAA	p.E403K	VEZT_uc009ztb.1_RNA|VEZT_uc009ztc.1_Intron|VEZT_uc001tdy.2_RNA	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	403						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						TCGGTACTTTGAAACTCAGCA	0.453													92	234	---	---	---	---	PASS
DEPDC4	120863	broad.mit.edu	37	12	100656172	100656172	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100656172C>T	uc001thi.2	-	3	573	c.570G>A	c.(568-570)ATG>ATA	p.M190I	DEPDC4_uc001thh.1_RNA|DEPDC4_uc001thj.1_Missense_Mutation_p.M123I|DEPDC4_uc009ztv.1_Missense_Mutation_p.M190I|DEPDC4_uc001thk.1_Missense_Mutation_p.M1I|DEPDC4_uc001thl.1_RNA	NM_152317	NP_689530	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	190					intracellular signal transduction						0						GATTTGAAATCATTTCATATC	0.279													5	157	---	---	---	---	PASS
UTP20	27340	broad.mit.edu	37	12	101721006	101721006	+	Silent	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101721006T>A	uc001tia.1	+	26	3345	c.3189T>A	c.(3187-3189)CCT>CCA	p.P1063P		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	1063					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						TGTTTGAACCTGTGAGGCATT	0.512													81	213	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104134505	104134505	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104134505G>A	uc001tjw.2	+	55	6038	c.5852G>A	c.(5851-5853)TGC>TAC	p.C1951Y	STAB2_uc009zug.2_RNA	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1951	Extracellular (Potential).				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						CCCAGGTGCTGCAAGGGCTAC	0.567													32	153	---	---	---	---	PASS
HSP90B1	7184	broad.mit.edu	37	12	104331551	104331551	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104331551C>G	uc001tkb.1	+	6	927	c.822C>G	c.(820-822)TTC>TTG	p.F274L	HSP90B1_uc010swg.1_Intron|HSP90B1_uc009zui.1_Missense_Mutation_p.F274L	NM_003299	NP_003290	P14625	ENPL_HUMAN	heat shock protein 90kDa beta, member 1	274					actin rod assembly|anti-apoptosis|cellular response to ATP|ER-associated protein catabolic process|protein folding|protein transport|regulation of phosphoprotein phosphatase activity|response to hypoxia|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|melanosome|microsome|midbody|perinuclear region of cytoplasm	ATP binding|calcium ion binding|low-density lipoprotein particle receptor binding|protein phosphatase binding|RNA binding|unfolded protein binding|virion binding			ovary(2)|skin(1)	3					Rifabutin(DB00615)	ATTCACAGTTCATAAACTTTC	0.284													5	44	---	---	---	---	PASS
APPL2	55198	broad.mit.edu	37	12	105583854	105583854	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105583854C>G	uc001tlf.1	-	15	1539	c.1321G>C	c.(1321-1323)GAG>CAG	p.E441Q	APPL2_uc010swt.1_Missense_Mutation_p.E398Q|APPL2_uc001tlg.1_Missense_Mutation_p.E195Q|APPL2_uc010swu.1_Missense_Mutation_p.E447Q|APPL2_uc009zuq.2_Missense_Mutation_p.E398Q	NM_018171	NP_060641	Q8NEU8	DP13B_HUMAN	adaptor protein, phosphotyrosine interaction, PH	441					cell cycle|cell proliferation|signal transduction	early endosome membrane|nucleus	protein binding			upper_aerodigestive_tract(1)	1						ATCAGCTCCTCTGCTTCAGGT	0.453													21	116	---	---	---	---	PASS
NUAK1	9891	broad.mit.edu	37	12	106477715	106477715	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106477715G>A	uc001tlj.1	-							NM_014840	NP_055655	O60285	NUAK1_HUMAN	AMPK-related protein kinase 5								ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|central_nervous_system(1)	2						GTTCTGAAATGAGAAGACAAA	0.463													5	81	---	---	---	---	PASS
RIC8B	55188	broad.mit.edu	37	12	107208966	107208966	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107208966G>C	uc001tlx.2	+	3	750	c.625G>C	c.(625-627)GAA>CAA	p.E209Q	RIC8B_uc001tlw.2_Missense_Mutation_p.E209Q|RIC8B_uc001tly.2_Missense_Mutation_p.E169Q|RIC8B_uc001tlz.2_RNA	NM_018157	NP_060627	Q9NVN3	RIC8B_HUMAN	resistance to inhibitors of cholinesterase 8	209					regulation of G-protein coupled receptor protein signaling pathway	cell cortex|cytosol|plasma membrane	G-protein alpha-subunit binding|guanyl-nucleotide exchange factor activity			ovary(1)	1						CGATGAGTATGAATCGGCCAT	0.512													38	172	---	---	---	---	PASS
WSCD2	9671	broad.mit.edu	37	12	108589996	108589996	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108589996G>C	uc001tms.2	+						WSCD2_uc001tmt.2_Intron	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2							integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3						AGCGAGGTAAGAGCGAGGAAC	0.542													4	29	---	---	---	---	PASS
USP30	84749	broad.mit.edu	37	12	109510129	109510129	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109510129C>G	uc010sxi.1	+	6	703	c.599C>G	c.(598-600)CCC>CGC	p.P200R	USP30_uc001tnu.3_Missense_Mutation_p.P169R	NM_032663	NP_116052	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	200	Cytoplasmic (Potential).				ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1						GAAATAACTCCCAAACAAATT	0.368													17	99	---	---	---	---	PASS
TRPV4	59341	broad.mit.edu	37	12	110252356	110252356	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110252356G>A	uc001tpj.1	-	1	341	c.246C>T	c.(244-246)CCC>CCT	p.P82P	TRPV4_uc001tpg.1_Silent_p.P48P|TRPV4_uc001tph.1_Silent_p.P82P|TRPV4_uc001tpi.1_Silent_p.P82P|TRPV4_uc001tpk.1_Silent_p.P82P|TRPV4_uc001tpl.1_Silent_p.P82P	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,	82	Cytoplasmic (Potential).				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						GCAGATCGATGGGGTTGGGCA	0.622													5	73	---	---	---	---	PASS
IFT81	28981	broad.mit.edu	37	12	110643430	110643430	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110643430G>C	uc001tqi.2	+	17	1877	c.1747G>C	c.(1747-1749)GAT>CAT	p.D583H	IFT81_uc001tqh.2_Missense_Mutation_p.D583H|IFT81_uc001tqj.2_RNA	NM_001143779	NP_001137251	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81-like isoform 1	583	Potential.				cell differentiation|multicellular organismal development|spermatogenesis	intraflagellar transport particle B|microtubule-based flagellum				ovary(1)	1						TCGTGCTACTGATGAGATGAA	0.313													44	265	---	---	---	---	PASS
BRAP	8315	broad.mit.edu	37	12	112119646	112119646	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112119646C>G	uc001tsn.3	-						BRAP_uc010syh.1_5'Flank|BRAP_uc009zvv.2_Intron	NM_006768	NP_006759	Q7Z569	BRAP_HUMAN	BRCA1 associated protein						MAPKKK cascade|negative regulation of signal transduction|Ras protein signal transduction	cytoplasm|ubiquitin ligase complex	identical protein binding|nuclear localization sequence binding|nucleotide binding|ubiquitin-protein ligase activity|zinc ion binding			lung(1)	1						TCATCTTTCACCAGTTAAAAA	0.353													7	85	---	---	---	---	PASS
ACAD10	80724	broad.mit.edu	37	12	112143635	112143635	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112143635C>G	uc001tsq.2	+	4	630	c.430C>G	c.(430-432)CAA>GAA	p.Q144E	ACAD10_uc009zvw.2_Missense_Mutation_p.Q144E|ACAD10_uc001tso.3_Missense_Mutation_p.Q144E|ACAD10_uc001tsp.2_Missense_Mutation_p.Q144E|ACAD10_uc009zvx.2_Missense_Mutation_p.Q144E	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10	144							acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						GGCCATAACTCAAATTCGGGC	0.453													7	138	---	---	---	---	PASS
TRAFD1	10906	broad.mit.edu	37	12	112589597	112589597	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112589597C>G	uc001ttp.2	+						TRAFD1_uc001tto.2_Intron	NM_006700	NP_006691	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1						negative regulation of innate immune response	intracellular	protein binding|zinc ion binding				0						ACCATTTTCTCTTCTCAGGAG	0.463													38	60	---	---	---	---	PASS
TBX5	6910	broad.mit.edu	37	12	114793393	114793393	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114793393G>C	uc001tvo.2	-	9	1996	c.1501C>G	c.(1501-1503)CAG>GAG	p.Q501E	TBX5_uc001tvp.2_Missense_Mutation_p.Q501E|TBX5_uc001tvq.2_Missense_Mutation_p.Q451E	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	501				PRTLSPHQYHSVHGVGMVPEWSDNS -> QGLYPLISTTLC TELAWCRVERQ (in Ref. 1; CAA70592).	cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GAGTGGTACTGATGAGGGGAT	0.537													20	53	---	---	---	---	PASS
PXN	5829	broad.mit.edu	37	12	120649813	120649813	+	3'UTR	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120649813G>C	uc001txt.2	-	12					uc001txs.1_Intron|PXN_uc001txu.2_3'UTR|PXN_uc001txv.2_3'UTR|PXN_uc001txx.2_3'UTR|PXN_uc001txy.2_3'UTR|PXN_uc001txz.2_RNA	NM_001080855	NP_001074324	P49023	PAXI_HUMAN	paxillin isoform 1						cell junction assembly|cell-matrix adhesion|cellular response to reactive oxygen species|epidermal growth factor receptor signaling pathway|growth hormone receptor signaling pathway|muscle contraction|signal complex assembly	cytoplasm|focal adhesion|lamellipodium|microtubule associated complex	beta-catenin binding|vinculin binding|zinc ion binding			ovary(1)|breast(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGGGTGCTGGCCAGGCCAGT	0.627													16	34	---	---	---	---	PASS
PXN	5829	broad.mit.edu	37	12	120652667	120652667	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120652667G>C	uc001txt.2	-	9	1370	c.1239C>G	c.(1237-1239)TTC>TTG	p.F413L	PXN_uc001txu.2_Missense_Mutation_p.F225L|PXN_uc001txv.2_Missense_Mutation_p.F294L|PXN_uc001txx.2_Missense_Mutation_p.F246L|PXN_uc001txy.2_Missense_Mutation_p.F379L|PXN_uc001txz.2_RNA	NM_001080855	NP_001074324	P49023	PAXI_HUMAN	paxillin isoform 1	413	LIM zinc-binding 1.			F -> S (in Ref. 5; CAI46024).	cell junction assembly|cell-matrix adhesion|cellular response to reactive oxygen species|epidermal growth factor receptor signaling pathway|growth hormone receptor signaling pathway|muscle contraction|signal complex assembly	cytoplasm|focal adhesion|lamellipodium|microtubule associated complex	beta-catenin binding|vinculin binding|zinc ion binding			ovary(1)|breast(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGCGCGGGGAGAAGAGGTTGT	0.607													12	66	---	---	---	---	PASS
PXN	5829	broad.mit.edu	37	12	120652718	120652718	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120652718G>C	uc001txt.2	-	9	1319	c.1188C>G	c.(1186-1188)TTC>TTG	p.F396L	PXN_uc001txu.2_Missense_Mutation_p.F208L|PXN_uc001txv.2_Missense_Mutation_p.F277L|PXN_uc001txx.2_Missense_Mutation_p.F229L|PXN_uc001txy.2_Missense_Mutation_p.F362L|PXN_uc001txz.2_RNA	NM_001080855	NP_001074324	P49023	PAXI_HUMAN	paxillin isoform 1	396	LIM zinc-binding 1.				cell junction assembly|cell-matrix adhesion|cellular response to reactive oxygen species|epidermal growth factor receptor signaling pathway|growth hormone receptor signaling pathway|muscle contraction|signal complex assembly	cytoplasm|focal adhesion|lamellipodium|microtubule associated complex	beta-catenin binding|vinculin binding|zinc ion binding			ovary(1)|breast(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCCGCTCGAAGAAGTTCCGGG	0.592													5	54	---	---	---	---	PASS
OASL	8638	broad.mit.edu	37	12	121465579	121465579	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121465579G>C	uc001tzj.1	-	4	705	c.699C>G	c.(697-699)CTC>CTG	p.L233L	OASL_uc001tzk.1_Intron	NM_003733	NP_003724	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like isoform a	233					interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoplasm|nucleolus	ATP binding|DNA binding|double-stranded RNA binding|thyroid hormone receptor binding|transferase activity			skin(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CAAGAGCATAGAGAGGGGGCA	0.453													17	66	---	---	---	---	PASS
CLIP1	6249	broad.mit.edu	37	12	122803817	122803817	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122803817C>A	uc001ucg.1	-	17	3434	c.3328G>T	c.(3328-3330)GAG>TAG	p.E1110*	CLIP1_uc001uch.1_Nonsense_Mutation_p.E1099*|CLIP1_uc001uci.1_Nonsense_Mutation_p.E1064*|CLIP1_uc001ucj.1_Nonsense_Mutation_p.E685*	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	1110	Potential.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TTGGTGTCCTCCAAGGAGGCC	0.403													48	112	---	---	---	---	PASS
RSRC2	65117	broad.mit.edu	37	12	122991435	122991435	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122991435C>T	uc001ucr.2	-	9	1217	c.1071G>A	c.(1069-1071)TTG>TTA	p.L357L	RSRC2_uc001uco.2_Silent_p.L126L|RSRC2_uc001ucp.2_Silent_p.L298L|RSRC2_uc001ucq.2_Silent_p.L125L|RSRC2_uc001ucs.2_Silent_p.L126L|RSRC2_uc001uct.2_Silent_p.L309L|RSRC2_uc001ucu.2_Silent_p.L358L	NM_023012	NP_075388	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2 isoform a	357										ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		TTCCAAAATTCAATTTTTCCC	0.313													17	151	---	---	---	---	PASS
SBNO1	55206	broad.mit.edu	37	12	123805125	123805125	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123805125G>A	uc010tap.1	-	18	2521	c.2521C>T	c.(2521-2523)CTT>TTT	p.L841F	SBNO1_uc010tao.1_Missense_Mutation_p.L840F|SBNO1_uc010taq.1_Intron	NM_018183	NP_060653	A3KN83	SBNO1_HUMAN	sno, strawberry notch homolog 1	841							ATP binding|DNA binding|hydrolase activity			breast(5)|skin(2)|ovary(1)|kidney(1)	9	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		CTTGTTATAAGGCTACTGTTA	0.353													39	270	---	---	---	---	PASS
DDX55	57696	broad.mit.edu	37	12	124103976	124103976	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124103976C>G	uc001ufi.2	+						DDX55_uc001ufh.2_Intron|DDX55_uc001ufk.2_Intron|DDX55_uc001ufl.2_Intron	NM_020936	NP_065987	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		CTGATTGAATCAGATCTTGAT	0.418													61	119	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124297756	124297756	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124297756C>T	uc001uft.3	+	19	2861	c.2836C>T	c.(2836-2838)CAG>TAG	p.Q946*	DNAH10_uc010tav.1_Nonsense_Mutation_p.Q488*|DNAH10_uc010taw.1_Nonsense_Mutation_p.Q431*	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	946	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ATGCCCACCTCAGAAGGGGGA	0.388													20	77	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124311323	124311323	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124311323C>G	uc001uft.3	+	24	3940	c.3915C>G	c.(3913-3915)CTC>CTG	p.L1305L		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1305	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TCAGGGCTCTCAGAAAGCTAC	0.453													22	172	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124882735	124882735	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124882735G>C	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		AGGCTGAAAAGAAGATGCCAG	0.542													25	103	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	129822368	129822368	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129822368G>C	uc009zyl.1	-							NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CCGCACTGGAGAGAAGACACA	0.587													24	114	---	---	---	---	PASS
RIMBP2	23504	broad.mit.edu	37	12	130884263	130884263	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130884263G>A	uc001uil.2	-	18	3257	c.3093C>T	c.(3091-3093)CAC>CAT	p.H1031H		NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	1031						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CTTGAGAGTAGTGGGATGGAG	0.458													34	145	---	---	---	---	PASS
RIMBP2	23504	broad.mit.edu	37	12	130926707	130926707	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130926707A>T	uc001uil.2	-	8	1303	c.1139T>A	c.(1138-1140)CTG>CAG	p.L380Q	RIMBP2_uc001uim.2_Missense_Mutation_p.L288Q|RIMBP2_uc001uin.1_Missense_Mutation_p.L39Q	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	380						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CGTGCACTGCAGCTCATCCGA	0.642													16	55	---	---	---	---	PASS
RIMBP2	23504	broad.mit.edu	37	12	130935770	130935770	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130935770G>A	uc001uil.2	-	5	587	c.423C>T	c.(421-423)TCC>TCT	p.S141S	RIMBP2_uc001uim.2_Silent_p.S49S	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	141						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TTGCGCTACCGGATCTCGACA	0.637													19	57	---	---	---	---	PASS
PGAM5	192111	broad.mit.edu	37	12	133294611	133294611	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133294611C>T	uc009zyv.2	+	5	651	c.624C>T	c.(622-624)TTC>TTT	p.F208F	PGAM5_uc010tbr.1_RNA|PGAM5_uc001uku.2_Silent_p.F208F	NM_138575	NP_612642	Q96HS1	PGAM5_HUMAN	phosphoglycerate mutase family member 5	208						integral to membrane|mitochondrial outer membrane	phosphoprotein phosphatase activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)		AGGCCGCCTTCCGGAACTACA	0.617													13	87	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133373127	133373127	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133373127G>A	uc001ukz.1	-	10	2657	c.2098C>T	c.(2098-2100)CAG>TAG	p.Q700*	GOLGA3_uc001ula.1_Nonsense_Mutation_p.Q700*|GOLGA3_uc001ulb.2_Nonsense_Mutation_p.Q700*	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	700	Gln-rich.|Potential.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GGACTTACCTGCTCCAGCTGC	0.647													24	117	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23912025	23912025	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23912025G>C	uc001uon.2	-	10	6579	c.5990C>G	c.(5989-5991)TCT>TGT	p.S1997C	SACS_uc001uoo.2_Missense_Mutation_p.S1850C|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1997					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TTTAAGTATAGAGTCATCTAG	0.378													20	83	---	---	---	---	PASS
GPR12	2835	broad.mit.edu	37	13	27333804	27333804	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27333804G>C	uc010aal.2	-	2	383	c.161C>G	c.(160-162)TCG>TGG	p.S54W	GPR12_uc010tdl.1_Intron	NM_005288	NP_005279	P47775	GPR12_HUMAN	G protein-coupled receptor 12	54	Helical; Name=1; (Potential).					integral to plasma membrane					0	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		GAGGGTTCCCGAGGTACACAA	0.572													31	97	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	28964033	28964033	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28964033G>C	uc001usb.3	-	13	2154	c.1869C>G	c.(1867-1869)ATC>ATG	p.I623M	FLT1_uc010aar.1_Missense_Mutation_p.I623M|FLT1_uc001usc.3_Missense_Mutation_p.I623M|FLT1_uc010aas.1_RNA|FLT1_uc010aat.1_Missense_Mutation_p.I106M	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	623	Ig-like C2-type 6.|Extracellular (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	AAACATTCATGATGGTAAGAT	0.413													64	213	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29599656	29599656	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29599656C>A	uc001usl.3	+	1	909	c.851C>A	c.(850-852)ACA>AAA	p.T284K		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	274						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						AGTGAGCACACATCACATTCC	0.512													5	24	---	---	---	---	PASS
NBEA	26960	broad.mit.edu	37	13	35644898	35644898	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35644898C>T	uc001uvb.2	+	11	1686	c.1480C>T	c.(1480-1482)CAT>TAT	p.H494Y		NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	494						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TAGTGCAATTCATTCAATTGG	0.333													55	75	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39433451	39433451	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39433451G>C	uc001uwv.2	+	14	7552	c.7243G>C	c.(7243-7245)GAT>CAT	p.D2415H	FREM2_uc001uww.2_Missense_Mutation_p.D501H	NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	2415	Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TTCAGACTACGATAAAACAGG	0.498													39	158	---	---	---	---	PASS
AKAP11	11215	broad.mit.edu	37	13	42873499	42873499	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42873499G>C	uc001uys.1	+	8	792	c.617G>C	c.(616-618)GGA>GCA	p.G206A		NM_016248	NP_057332	Q9UKA4	AKA11_HUMAN	A-kinase anchor protein 11	206					intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		TTTCCTATAGGAATGAACATT	0.318													21	58	---	---	---	---	PASS
DIAPH3	81624	broad.mit.edu	37	13	60566331	60566331	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60566331G>C	uc001vht.2	-						DIAPH3_uc001vhu.2_Intron|DIAPH3_uc001vhv.2_5'Flank|DIAPH3_uc001vhw.1_Intron|DIAPH3_uc010aed.1_Intron|DIAPH3_uc010aee.1_Intron	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		CTAGAGATATGAAATAGAAAT	0.264													14	38	---	---	---	---	PASS
KLF5	688	broad.mit.edu	37	13	73649905	73649905	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73649905G>C	uc001vje.2	+	4	1579	c.1255G>C	c.(1255-1257)GAG>CAG	p.E419Q	KLF5_uc001vjd.2_Missense_Mutation_p.E328Q	NM_001730	NP_001721	Q13887	KLF5_HUMAN	Kruppel-like factor 5	419	C2H2-type 2.				transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|pancreas(1)	3		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		GCGATCGGATGAGCTGACCCG	0.592													12	67	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77695532	77695532	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77695532C>G	uc001vkf.2	-	56	8093	c.8002G>C	c.(8002-8004)GAT>CAT	p.D2668H	MYCBP2_uc010aev.2_Missense_Mutation_p.D2072H|MYCBP2_uc001vkg.1_Missense_Mutation_p.D131H	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	2668					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AGTCCATAATCAAATCCTTGG	0.358													9	167	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88329935	88329935	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88329935C>T	uc001vln.2	+	2	2511	c.2292C>T	c.(2290-2292)ATC>ATT	p.I764I	SLITRK5_uc010tic.1_Silent_p.I523I	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	764	Cytoplasmic (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					AAAACCCCATCTACCGCTCCC	0.557													15	68	---	---	---	---	PASS
TPP2	7174	broad.mit.edu	37	13	103296993	103296993	+	Silent	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103296993G>T	uc001vpi.3	+	18	2365	c.2262G>T	c.(2260-2262)GGG>GGT	p.G754G		NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II	754					proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTTTCCATGGGATAGTGTGTA	0.368													22	104	---	---	---	---	PASS
TPP2	7174	broad.mit.edu	37	13	103309403	103309403	+	Intron	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103309403T>C	uc001vpi.3	+							NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II						proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCCACATTCGTAGGATGTAAT	0.343													44	85	---	---	---	---	PASS
MCF2L	23263	broad.mit.edu	37	13	113730391	113730391	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113730391G>C	uc001vsu.2	+	12	1613	c.1591G>C	c.(1591-1593)GAG>CAG	p.E531Q	MCF2L_uc001vsq.2_Missense_Mutation_p.E531Q|MCF2L_uc010tjr.1_Missense_Mutation_p.E474Q|MCF2L_uc001vsr.2_Missense_Mutation_p.E478Q|MCF2L_uc001vss.3_Missense_Mutation_p.E472Q|MCF2L_uc010tjs.1_Missense_Mutation_p.E472Q|MCF2L_uc001vst.1_Missense_Mutation_p.E436Q	NM_001112732	NP_001106203	O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming	504	Potential.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				GAAGTTTTTGGAGACCGGTGC	0.532													12	36	---	---	---	---	PASS
CDC16	8881	broad.mit.edu	37	13	115009418	115009418	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115009418C>A	uc001vuk.1	+	8	919	c.721C>A	c.(721-723)CAT>AAT	p.H241N	CDC16_uc001vul.1_Missense_Mutation_p.H241N|CDC16_uc001vum.1_Missense_Mutation_p.H147N|CDC16_uc001vun.1_Missense_Mutation_p.H240N|CDC16_uc001vuo.1_Missense_Mutation_p.H240N	NM_003903	NP_003894	Q13042	CDC16_HUMAN	anaphase-promoting complex, subunit 6	241					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cell proliferation|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	binding				0	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			AGCTGAGAGACATTATTATAA	0.378													24	101	---	---	---	---	PASS
RNASE12	493901	broad.mit.edu	37	14	21058430	21058430	+	3'UTR	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21058430G>C	uc001vxt.2	-	1					RNASE11_uc010ahv.2_5'Flank|RNASE11_uc010ahx.2_5'Flank|RNASE11_uc010ahw.2_5'Flank|RNASE11_uc001vxs.2_5'Flank|uc001vxu.1_5'Flank	NM_001024822	NP_001019993	Q5GAN4	RNS12_HUMAN	ribonuclease, RNase A family, 12 (non-active)							extracellular region	nucleic acid binding|pancreatic ribonuclease activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(95;0.00238)		Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.013)		CTCGGGAGCTGATCTTGAGTT	0.522													10	85	---	---	---	---	PASS
OR6S1	341799	broad.mit.edu	37	14	21109424	21109424	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21109424A>C	uc001vxv.1	-	1	427	c.427T>G	c.(427-429)TGC>GGC	p.C143G		NM_001001968	NP_001001968	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S,	143	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		ACACGAAAGCACACAGCCCCA	0.607													9	55	---	---	---	---	PASS
RNASE3	6037	broad.mit.edu	37	14	21359978	21359978	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21359978C>G	uc001vyj.2	+	2	187	c.133C>G	c.(133-135)CTG>GTG	p.L45V		NM_002935	NP_002926	P12724	ECP_HUMAN	ribonuclease, RNase A family, 3 (eosinophil	45					defense response to bacterium|RNA catabolic process	extracellular region|soluble fraction	nucleic acid binding|pancreatic ribonuclease activity				0	all_cancers(95;0.00453)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	Pranlukast(DB01411)	GCACATCAGTCTGAACCCCCC	0.488													34	179	---	---	---	---	PASS
TPPP2	122664	broad.mit.edu	37	14	21500246	21500246	+	3'UTR	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21500246T>C	uc001vzh.2	+	4					NDRG2_uc010tll.1_Intron	NM_173846	NP_776245	P59282	TPPP2_HUMAN	tubulin polymerization-promoting protein family							cytoplasm					0	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		GAGAGGAGCTTCATCTCAGCC	0.507													11	92	---	---	---	---	PASS
FLJ10357	55701	broad.mit.edu	37	14	21552086	21552086	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21552086G>A	uc001vzp.2	+	17	3695	c.3666G>A	c.(3664-3666)CTG>CTA	p.L1222L	FLJ10357_uc001vzo.1_Silent_p.L301L|FLJ10357_uc010aij.2_RNA|FLJ10357_uc010tln.1_Silent_p.L508L	NM_018071	NP_060541	Q8TER5	ARH40_HUMAN	hypothetical protein LOC55701	1222	DH.				regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)		AGGAGCTCCTGAGGGAAGCTG	0.667													12	66	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22265790	22265790	+	Intron	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22265790C>A	uc010tmf.1	+						uc010air.1_Missense_Mutation_p.Q25K					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		GTCTGTGAGCCAGCATAACCA	0.413													39	222	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22694873	22694873	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22694873G>C	uc001wbw.2	+						uc010aiv.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Missense_Mutation_p.E22Q					SubName: Full=Alpha-chain C region; Flags: Fragment;																		GGTGAGCAGTGAAGACAAGGT	0.448													18	114	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22968719	22968719	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22968719G>A	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wee.3_Intron|uc010tmt.1_Intron|uc010ajv.1_Intron|uc001weg.2_Intron|uc001weh.1_Intron|uc001wei.2_Intron|uc001wej.2_Intron|uc001wek.2_Intron|uc001wel.2_Intron|uc001wem.3_Intron|uc001wen.1_Intron|uc001weo.2_Intron|uc001wep.2_Intron|uc001weq.2_Intron|uc001wer.2_Intron|uc001wes.1_5'Flank|uc001wet.2_Intron|uc001weu.2_5'UTR|uc001wev.2_5'Flank|uc001wew.2_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																		GCACCAGGCTGAAGGTTTTAG	0.403													24	132	---	---	---	---	PASS
PRMT5	10419	broad.mit.edu	37	14	23393852	23393852	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23393852G>A	uc001whm.1	-	9	1097	c.1006C>T	c.(1006-1008)CAG>TAG	p.Q336*	PRMT5_uc001whl.1_Nonsense_Mutation_p.Q319*|PRMT5_uc010akd.1_RNA|PRMT5_uc010tnf.1_Nonsense_Mutation_p.Q230*|PRMT5_uc010tng.1_Nonsense_Mutation_p.Q275*|PRMT5_uc010tnh.1_Nonsense_Mutation_p.Q292*|PRMT5_uc001whn.1_Nonsense_Mutation_p.Q165*	NM_006109	NP_006100	O14744	ANM5_HUMAN	protein arginine methyltransferase 5 isoform a	336					cell proliferation|histone H4-R3 methylation|ncRNA metabolic process|regulation of mitosis|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	histone-arginine N-methyltransferase activity|protein binding|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding	p.Q336E(1)		ovary(1)	1	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		TGCTGGTACTGAGAGTATTTG	0.493													10	112	---	---	---	---	PASS
AP1G2	8906	broad.mit.edu	37	14	24030804	24030804	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24030804C>T	uc001wkl.2	-	18	2111	c.1774G>A	c.(1774-1776)GGC>AGC	p.G592S	AP1G2_uc001wkj.2_Missense_Mutation_p.G211S|AP1G2_uc001wkk.3_Missense_Mutation_p.G520S|AP1G2_uc001wkn.2_Missense_Mutation_p.G211S|uc001wko.1_RNA|AP1G2_uc001wkp.1_RNA	NM_003917	NP_003908	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2	592					interspecies interaction between organisms|intracellular protein transport|vesicle-mediated transport	AP-1 adaptor complex|endosome membrane	protein binding|protein transporter activity			ovary(1)	1	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		GCCTGAGGGCCATCTCGCTCC	0.552													5	79	---	---	---	---	PASS
PSME2	5721	broad.mit.edu	37	14	24614467	24614467	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24614467G>C	uc001wmj.2	-	5	312	c.247C>G	c.(247-249)CAG>GAG	p.Q83E	PSME2_uc001wmk.2_Missense_Mutation_p.Q6E|RNF31_uc001wml.1_5'Flank|RNF31_uc001wmm.1_5'Flank|RNF31_uc001wmn.1_5'Flank|RNF31_uc010alg.1_5'Flank	NM_002818	NP_002809	Q9UL46	PSME2_HUMAN	proteasome activator subunit 2	83					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome activator complex					0				GBM - Glioblastoma multiforme(265;0.00839)		TTCTTCTCCTGCTTATCTGTT	0.458													21	134	---	---	---	---	PASS
TGM1	7051	broad.mit.edu	37	14	24723420	24723420	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24723420G>A	uc001wod.2	-	14	2287	c.2163C>T	c.(2161-2163)CTC>CTT	p.L721L	TGM1_uc010tog.1_Silent_p.L279L	NM_000359	NP_000350	P22735	TGM1_HUMAN	transglutaminase 1	721					cell envelope organization|keratinization|peptide cross-linking	cornified envelope|intrinsic to membrane	acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	CGACATTGGTGAGGGTGACGG	0.572													13	48	---	---	---	---	PASS
COCH	1690	broad.mit.edu	37	14	31354661	31354661	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31354661G>C	uc001wqr.2	+	10	875	c.795G>C	c.(793-795)GGG>GGC	p.G265G	COCH_uc001wqp.2_Silent_p.G265G|COCH_uc001wqq.3_Silent_p.G265G|uc001wqs.2_RNA|COCH_uc001wqt.1_Silent_p.G116G	NM_004086	NP_004077	O43405	COCH_HUMAN	cochlin precursor	265	VWFA 1.				sensory perception of sound	proteinaceous extracellular matrix				pancreas(1)|central_nervous_system(1)|skin(1)	3	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		TAAGAAAAGGGATCCCCAAAG	0.418													20	172	---	---	---	---	PASS
COCH	1690	broad.mit.edu	37	14	31355340	31355340	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31355340C>T	uc001wqr.2	+	11	1379	c.1299C>T	c.(1297-1299)GTC>GTT	p.V433V	COCH_uc001wqp.2_Silent_p.V433V|COCH_uc001wqq.3_Silent_p.V433V|uc001wqs.2_RNA|COCH_uc001wqt.1_Silent_p.V284V	NM_004086	NP_004077	O43405	COCH_HUMAN	cochlin precursor	433	VWFA 2.				sensory perception of sound	proteinaceous extracellular matrix				pancreas(1)|central_nervous_system(1)|skin(1)	3	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		TCCTAGCTGTCATCAGAAACA	0.463													30	211	---	---	---	---	PASS
BAZ1A	11177	broad.mit.edu	37	14	35263991	35263991	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35263991C>G	uc001wsk.2	-	11	1895	c.1327G>C	c.(1327-1329)GAT>CAT	p.D443H	BAZ1A_uc001wsl.2_Missense_Mutation_p.D443H	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	443	DDT.				chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		TCTTGAAGATCAAAAAGTTCC	0.299													15	160	---	---	---	---	PASS
BAZ1A	11177	broad.mit.edu	37	14	35295249	35295249	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35295249G>C	uc001wsk.2	-	4	1074	c.506C>G	c.(505-507)TCA>TGA	p.S169*	BAZ1A_uc001wsl.2_Nonsense_Mutation_p.S169*|BAZ1A_uc001wsm.1_Nonsense_Mutation_p.S169*	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	169					chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		TTGTGTTTCTGAATCATCACT	0.313													5	21	---	---	---	---	PASS
NKX2-1	7080	broad.mit.edu	37	14	36986504	36986504	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36986504C>T	uc001wtt.2	-	2	1436	c.1095G>A	c.(1093-1095)TTG>TTA	p.L365L	SFTA3_uc001wts.2_Intron|NKX2-1_uc001wtu.2_Silent_p.L395L|NKX2-1_uc001wtv.2_Silent_p.L365L|uc001wtw.1_5'Flank	NM_003317	NP_003308	P43699	NKX21_HUMAN	thyroid transcription factor 1 isoform 2	365					epithelial tube branching involved in lung morphogenesis|globus pallidus development|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|thyroid gland development		protein binding|transcription regulatory region DNA binding			skin(1)	1	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)		GACCGTATAGCAAGGTGGAGC	0.697			A		NSCLC								3	12	---	---	---	---	PASS
PNN	5411	broad.mit.edu	37	14	39649715	39649715	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39649715G>C	uc001wuw.3	+	9	899	c.802G>C	c.(802-804)GAA>CAA	p.E268Q		NM_002687	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	268	Necessary for interaction with RNPS1.|Glu-rich.			E -> D (in Ref. 1; AAB48304).	cell adhesion|regulation of transcription, DNA-dependent|transcription, DNA-dependent	catalytic step 2 spliceosome|desmosome|intermediate filament|nuclear speck	DNA binding|protein binding|structural molecule activity			ovary(1)	1	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		AGCTTTATTTGAAGGTAGACG	0.318													9	72	---	---	---	---	PASS
MIA2	117153	broad.mit.edu	37	14	39722273	39722273	+	Splice_Site	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39722273A>T	uc001wux.2	+	6	1981	c.1787_splice	c.e6-2	p.E596_splice		NM_054024	NP_473365	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2							extracellular region				ovary(1)|breast(1)	2	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		ATAAATCAACAGAAGATGCTT	0.254													23	53	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44975997	44975997	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44975997C>A	uc001wvn.2	-	1	503	c.194G>T	c.(193-195)GGA>GTA	p.G65V		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	65						cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		CATTTCCTGTCCATGCTTTCT	0.418													50	329	---	---	---	---	PASS
KLHDC1	122773	broad.mit.edu	37	14	50176427	50176427	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50176427G>A	uc001www.2	+	3	196	c.168G>A	c.(166-168)TGG>TGA	p.W56*	SDCCAG1_uc010anj.1_Intron|KLHDC1_uc010tqg.1_Missense_Mutation_p.G20E|KLHDC1_uc010tqh.1_5'UTR	NM_172193	NP_751943	Q8N7A1	KLDC1_HUMAN	kelch domain containing 1	56	Kelch 1.					cytoplasm				pancreas(1)	1	all_epithelial(31;0.00244)|Breast(41;0.00964)					CTTGCTGCAGGAGAATGCACC	0.413													23	88	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51223634	51223634	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51223634C>G	uc001wym.2	-	18	4305	c.4114G>C	c.(4114-4116)GAG>CAG	p.E1372Q	NIN_uc001wyi.2_Missense_Mutation_p.E1372Q|NIN_uc001wyj.2_Intron|NIN_uc001wyk.2_Intron|NIN_uc010tqp.1_Missense_Mutation_p.E1378Q|NIN_uc001wyo.2_Missense_Mutation_p.E1372Q	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	1372					centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					ggcacacactcttccagtgtc	0.020			T	PDGFRB	MPD								3	12	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51224085	51224085	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51224085T>A	uc001wym.2	-	18	3854	c.3663A>T	c.(3661-3663)AAA>AAT	p.K1221N	NIN_uc001wyi.2_Missense_Mutation_p.K1221N|NIN_uc001wyj.2_Intron|NIN_uc001wyk.2_Intron|NIN_uc010tqp.1_Missense_Mutation_p.K1227N|NIN_uc001wyo.2_Missense_Mutation_p.K1221N	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	1221	Potential.				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					GTAGGTCCTGTTTCTTTTCAG	0.418			T	PDGFRB	MPD								62	314	---	---	---	---	PASS
DDHD1	80821	broad.mit.edu	37	14	53521243	53521243	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53521243C>G	uc001xai.2	-	11	2580	c.2350G>C	c.(2350-2352)GAG>CAG	p.E784Q	DDHD1_uc001xaj.2_Missense_Mutation_p.E791Q|DDHD1_uc001xah.2_Missense_Mutation_p.E784Q|DDHD1_uc001xag.2_Missense_Mutation_p.E366Q|DDHD1_uc001xak.1_Missense_Mutation_p.E180Q	NM_001160148	NP_001153620	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1 isoform c	784	DDHD.				lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding			ovary(2)	2	Breast(41;0.037)					GGCTTCTTCTCATCTTCCATT	0.453													24	146	---	---	---	---	PASS
WDHD1	11169	broad.mit.edu	37	14	55475034	55475034	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55475034C>A	uc001xbm.1	-	6	582	c.504G>T	c.(502-504)CAG>CAT	p.Q168H	WDHD1_uc001xbn.1_Missense_Mutation_p.Q45H	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	168	WD 4.					cytoplasm|nucleoplasm	DNA binding			skin(1)	1						CTGAGTTTACCTGATCTGAAA	0.328													13	72	---	---	---	---	PASS
SOCS4	122809	broad.mit.edu	37	14	55510378	55510378	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55510378G>C	uc001xbo.2	+	3	1184	c.619G>C	c.(619-621)GAA>CAA	p.E207Q	SOCS4_uc001xbp.2_Missense_Mutation_p.E207Q	NM_199421	NP_955453	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4	207					intracellular signal transduction|negative regulation of signal transduction|regulation of growth					ovary(1)|kidney(1)	2						TTTGTGTAGAGAAGGTCCTAT	0.383													34	198	---	---	---	---	PASS
SOCS4	122809	broad.mit.edu	37	14	55510516	55510516	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55510516G>T	uc001xbo.2	+	3	1322	c.757G>T	c.(757-759)GAT>TAT	p.D253Y	SOCS4_uc001xbp.2_Missense_Mutation_p.D253Y	NM_199421	NP_955453	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4	253					intracellular signal transduction|negative regulation of signal transduction|regulation of growth					ovary(1)|kidney(1)	2						GGATTTGGATGATGAAATCCT	0.383													24	107	---	---	---	---	PASS
LGALS3	3958	broad.mit.edu	37	14	55605173	55605173	+	Intron	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55605173T>A	uc001xbr.2	+							NM_002306	NP_002297	P17931	LEG3_HUMAN	galectin 3						cell differentiation|innate immune response|mRNA processing|RNA splicing	mitochondrial inner membrane|plasma membrane|spliceosomal complex	IgE binding|sugar binding				0						TTAGAGCCACTTCTCAAGGGC	0.453													14	69	---	---	---	---	PASS
ACTR10	55860	broad.mit.edu	37	14	58701237	58701237	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58701237C>T	uc001xdf.2	+	13	1325	c.1222C>T	c.(1222-1224)CTG>TTG	p.L408L	C14orf37_uc010tro.1_Intron|ACTR10_uc001xdg.2_Silent_p.L210L|ACTR10_uc001xdh.2_Silent_p.L210L|ACTR10_uc010trp.1_RNA|ACTR10_uc010apc.2_Silent_p.L198L	NM_018477	NP_060947	Q9NZ32	ARP10_HUMAN	uncharacterized hypothalamus protein HARP11	408						cytoplasm				central_nervous_system(1)	1						TCAACCACCTCTGATGAAGAG	0.348													30	150	---	---	---	---	PASS
C14orf149	112849	broad.mit.edu	37	14	59951017	59951017	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59951017C>T	uc001xee.1	-	1	57	c.18G>A	c.(16-18)GCG>GCA	p.A6A	C14orf149_uc010trx.1_Silent_p.A6A|JKAMP_uc001xef.3_5'Flank|JKAMP_uc001xeh.3_5'Flank|JKAMP_uc001xeg.3_5'Flank|JKAMP_uc010try.1_5'Flank|JKAMP_uc001xei.3_5'Flank|JKAMP_uc001xej.3_5'Flank	NM_144581	NP_653182	Q96EM0	PRCM_HUMAN	proline racemase-like	6							proline racemase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.14)	L-Proline(DB00172)	GCCGGGGCACCGCCAGCGCGC	0.706													9	38	---	---	---	---	PASS
SIX4	51804	broad.mit.edu	37	14	61180302	61180302	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61180302C>A	uc001xfc.2	-	3	2169	c.2169G>T	c.(2167-2169)GAG>GAT	p.E723D		NM_017420	NP_059116	Q9UIU6	SIX4_HUMAN	sine oculis homeobox homolog 4	723						nucleus				breast(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		ATAAGAAATTCTCTTTCATGT	0.423													20	108	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64416564	64416564	+	Missense_Mutation	SNP	C	G	G	rs142000273	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64416564C>G	uc001xgm.2	+	7	660	c.430C>G	c.(430-432)CTT>GTT	p.L144V	SYNE2_uc001xgk.2_Missense_Mutation_p.L144V|SYNE2_uc001xgl.2_Missense_Mutation_p.L144V	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	144	Cytoplasmic (Potential).|Actin-binding.				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGCCCAGACTCTTTCTTGCAA	0.423													50	308	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64644158	64644158	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64644158C>T	uc001xgm.2	+	96	17743	c.17513C>T	c.(17512-17514)CCA>CTA	p.P5838L	SYNE2_uc001xgl.2_Missense_Mutation_p.P5838L|SYNE2_uc010apy.2_Missense_Mutation_p.P2223L|SYNE2_uc001xgn.2_Missense_Mutation_p.P800L|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_5'UTR|SYNE2_uc001xgq.2_Missense_Mutation_p.P203L	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5838	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GATCCTCTTCCAGAGCTTCAC	0.393													24	110	---	---	---	---	PASS
FUT8	2530	broad.mit.edu	37	14	66135954	66135954	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66135954C>G	uc001xin.2	+						FUT8_uc001xio.2_Intron|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_Intron|FUT8_uc001xip.2_Intron|FUT8_uc001xiq.2_Intron|FUT8_uc001xis.2_5'Flank	NM_178155	NP_835368	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 isoform a						in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		CTCTTTCTCCCTGACAGAATC	0.338													13	77	---	---	---	---	PASS
MPP5	64398	broad.mit.edu	37	14	67768844	67768844	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67768844C>G	uc001xjc.2	+						MPP5_uc001xjd.2_Intron|ATP6V1D_uc001xje.2_Intron	NM_022474	NP_071919	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5						tight junction assembly	cytoplasm|endomembrane system|tight junction	protein domain specific binding			ovary(1)	1				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		TGGTAAGTGTCCCACATACTG	0.353													24	130	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68256264	68256264	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68256264G>C	uc001xka.2	-	16	2946	c.2807C>G	c.(2806-2808)TCT>TGT	p.S936C	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.S936C	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	936					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GGGGTCTCCAGAGGTGTTGAG	0.522													6	179	---	---	---	---	PASS
C14orf181	400223	broad.mit.edu	37	14	69263020	69263020	+	5'UTR	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69263020C>G	uc001xkj.1	-	1						NM_207442	NP_997325			hypothetical protein LOC400223												0				all cancers(60;0.002)|BRCA - Breast invasive adenocarcinoma(234;0.00204)|OV - Ovarian serous cystadenocarcinoma(108;0.0399)		ATCGGCCAATCTGGACCCCAG	0.607													16	115	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71444958	71444958	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71444958C>G	uc001xmo.2	+	6	2350	c.1904C>G	c.(1903-1905)TCT>TGT	p.S635C	PCNX_uc001xmn.3_Missense_Mutation_p.S635C|PCNX_uc010are.1_Missense_Mutation_p.S635C	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	635	Ser-rich.					integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		TCCTGTCAGTCTCCTGAGGGC	0.463													26	148	---	---	---	---	PASS
DPF3	8110	broad.mit.edu	37	14	73190343	73190343	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73190343G>A	uc001xnc.2	-	5	536	c.523C>T	c.(523-525)CGG>TGG	p.R175W	DPF3_uc001xnd.1_RNA|DPF3_uc001xnf.2_RNA|DPF3_uc010ari.1_Missense_Mutation_p.R175W|DPF3_uc010ttq.1_Missense_Mutation_p.R185W	NM_012074	NP_036206	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	175					chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		CAACTTACCCGTCCTCTAGTC	0.478													49	235	---	---	---	---	PASS
PTGR2	145482	broad.mit.edu	37	14	74340877	74340877	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74340877G>T	uc001xow.2	+	4	468	c.308G>T	c.(307-309)TGG>TTG	p.W103L	PTGR2_uc010tue.1_Missense_Mutation_p.W103L|PTGR2_uc001xox.2_Missense_Mutation_p.W103L|ZNF410_uc001xoy.1_RNA	NM_001146154	NP_001139626	Q8N8N7	PTGR2_HUMAN	prostaglandin reductase 2	103					prostaglandin metabolic process		15-oxoprostaglandin 13-oxidase activity|zinc ion binding				0						TATTGGCCCTGGCAAACCAAG	0.353													16	159	---	---	---	---	PASS
ZNF410	57862	broad.mit.edu	37	14	74370752	74370752	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74370752G>C	uc001xoz.1	+	6	852	c.670G>C	c.(670-672)GAA>CAA	p.E224Q	ZNF410_uc001xoy.1_RNA|ZNF410_uc010ary.1_RNA|ZNF410_uc010tuf.1_Intron|ZNF410_uc010tug.1_5'UTR|ZNF410_uc010tuh.1_Missense_Mutation_p.E151Q|ZNF410_uc010tui.1_RNA|ZNF410_uc010arz.1_Missense_Mutation_p.E241Q|ZNF410_uc001xpa.1_Missense_Mutation_p.L37F|ZNF410_uc001xpb.1_Missense_Mutation_p.E224Q|ZNF410_uc001xpc.1_Missense_Mutation_p.E171Q|ZNF410_uc010tuj.1_Missense_Mutation_p.L37F	NM_021188	NP_067011	Q86VK4	ZN410_HUMAN	zinc finger protein 410	224	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00369)		GTGTACAGTTGAAGGTTGTGA	0.453													5	154	---	---	---	---	PASS
C14orf45	80127	broad.mit.edu	37	14	74516731	74516731	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74516731G>C	uc010tup.1	+	8	1242	c.1119G>C	c.(1117-1119)CAG>CAC	p.Q373H	C14orf45_uc001xpm.1_RNA	NM_025057	NP_079333	Q8ND07	CN045_HUMAN	hypothetical protein LOC80127	373											0				BRCA - Breast invasive adenocarcinoma(234;0.00351)		TGAAGCAACAGATCCTAATTA	0.398													12	78	---	---	---	---	PASS
KIAA0317	9870	broad.mit.edu	37	14	75151330	75151330	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75151330C>G	uc001xqb.2	-	4	575	c.70G>C	c.(70-72)GAG>CAG	p.E24Q	KIAA0317_uc010tut.1_Intron|KIAA0317_uc001xqc.2_Missense_Mutation_p.E24Q|KIAA0317_uc001xqd.1_Intron	NM_001039479	NP_001034568	O15033	K0317_HUMAN	hypothetical protein LOC9870	24					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|intracellular	ubiquitin-protein ligase activity			ovary(2)|kidney(1)|central_nervous_system(1)|pancreas(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00404)		GCGGCAAGCTCAAAGAGGAAC	0.502													9	52	---	---	---	---	PASS
NEK9	91754	broad.mit.edu	37	14	75574085	75574085	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75574085G>A	uc001xrl.2	-	11	1442	c.1288C>T	c.(1288-1290)CAG>TAG	p.Q430*	NEK9_uc001xrk.2_5'UTR	NM_033116	NP_149107	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	430	RCC1 1.				cell division|mitosis	mitochondrion|nucleus	ATP binding|metal ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(2)|stomach(2)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00718)		CATGACACCTGACGGATAGCT	0.473													20	96	---	---	---	---	PASS
NGB	58157	broad.mit.edu	37	14	77732898	77732898	+	Missense_Mutation	SNP	C	G	G	rs150881015		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77732898C>G	uc001xtg.1	-	4	812	c.437G>C	c.(436-438)CGA>CCA	p.R146P		NM_021257	NP_067080	Q9NPG2	NGB_HUMAN	neuroglobin	146	Globin.					hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		ATCCCAGCCTCGACTCATGGC	0.632													9	73	---	---	---	---	PASS
TMED8	283578	broad.mit.edu	37	14	77808183	77808183	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77808183G>C	uc001xto.1	-	6	909	c.909C>G	c.(907-909)CTC>CTG	p.L303L	TMED8_uc010ast.1_RNA|TMED8_uc001xtn.1_Silent_p.L147L	NM_213601	NP_998766	Q6PL24	TMED8_HUMAN	transmembrane emp24 protein transport domain	303	GOLD.				transport	integral to membrane					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		TGTCGAACTTGAGCAGGTAGA	0.587													11	73	---	---	---	---	PASS
ISM2	145501	broad.mit.edu	37	14	77948773	77948773	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77948773C>G	uc001xtz.2	-	4	939	c.865G>C	c.(865-867)GAG>CAG	p.E289Q	ISM2_uc001xua.2_Intron|ISM2_uc001xty.2_Missense_Mutation_p.E201Q|ISM2_uc010tvl.1_Missense_Mutation_p.E208Q	NM_199296	NP_954993	Q6H9L7	ISM2_HUMAN	isthmin 2 homolog isoform 1	289						extracellular region				skin(1)	1						tcatcttcctctttgtcctct	0.289													19	70	---	---	---	---	PASS
SPATA7	55812	broad.mit.edu	37	14	88895815	88895815	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88895815G>C	uc001xwq.2	+						SPATA7_uc001xwr.2_Intron|SPATA7_uc001xws.2_Intron|SPATA7_uc001xwt.2_Intron|SPATA7_uc001xwu.2_Intron	NM_018418	NP_060888	Q9P0W8	SPAT7_HUMAN	spermatogenesis-associated protein 7 isoform a						response to stimulus|visual perception					ovary(1)	1						AAGGTAAACAGTTCACAGGAG	0.368													44	82	---	---	---	---	PASS
TTC7B	145567	broad.mit.edu	37	14	91110546	91110546	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91110546C>G	uc001xyp.2	-	15	1719	c.1597G>C	c.(1597-1599)GAG>CAG	p.E533Q	TTC7B_uc001xyo.2_5'UTR|TTC7B_uc010ats.2_RNA|uc001xyq.2_Intron	NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	533	TPR 6.						binding			ovary(2)	2		Melanoma(154;0.222)				CCCAGAGCCTCTGGGATCTGG	0.398													25	121	---	---	---	---	PASS
CCDC88C	440193	broad.mit.edu	37	14	91779949	91779949	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91779949C>A	uc010aty.2	-	15	2310	c.2211G>T	c.(2209-2211)AAG>AAT	p.K737N		NM_001080414	NP_001073883	Q9P219	DAPLE_HUMAN	DVL-binding protein DAPLE	737	Potential.				microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association			ovary(3)	3		all_cancers(154;0.0468)				TCAGCTCCTCCTTCTCACGCT	0.617													46	99	---	---	---	---	PASS
UBR7	55148	broad.mit.edu	37	14	93688728	93688728	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93688728G>C	uc001ybm.3	+						UBR7_uc001ybn.3_Intron|UBR7_uc010auq.2_Intron	NM_175748	NP_786924	Q8N806	UBR7_HUMAN	ubiquitin protein ligase E3 component n-recognin								ubiquitin-protein ligase activity|zinc ion binding				0						ACGGTATGTTGAGTTAAAGAA	0.289													9	76	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94084612	94084612	+	Silent	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94084612G>T	uc001ybv.1	+	27	3917	c.3834G>T	c.(3832-3834)GCG>GCT	p.A1278A	KIAA1409_uc001ybs.1_Silent_p.A1256A	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1433						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		CACTCAATGCGCAGTATCATA	0.428													13	91	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94158226	94158226	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94158226G>A	uc001ybv.1	+	45	7139	c.7056G>A	c.(7054-7056)CTG>CTA	p.L2352L	KIAA1409_uc001ybs.1_Silent_p.L2330L	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	2507						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		CGGCGATACTGACAGCACTAG	0.473													19	114	---	---	---	---	PASS
IFI27	3429	broad.mit.edu	37	14	94578051	94578051	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94578051C>T	uc010tws.1	+	2	211	c.90C>T	c.(88-90)CTC>CTT	p.L30L	IFI27_uc001ycm.1_RNA|IFI27_uc001ycn.1_Intron|IFI27_uc001yco.2_Missense_Mutation_p.S8L	NM_005532	NP_005523	P40305	IFI27_HUMAN	interferon, alpha-inducible protein 27 isoform	Error:Variant_position_missing_in_P40305_after_alignment					activation of caspase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|type I interferon-mediated signaling pathway	integral to membrane|mitochondrion					0				Epithelial(152;0.112)|all cancers(159;0.187)|COAD - Colon adenocarcinoma(157;0.206)		GCTCTCACCTCATCAGCAGTG	0.602													15	59	---	---	---	---	PASS
CLMN	79789	broad.mit.edu	37	14	95669505	95669505	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95669505G>C	uc001yef.2	-	9	2297	c.2181C>G	c.(2179-2181)TTC>TTG	p.F727L		NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin	727						integral to membrane	actin binding				0				Epithelial(152;0.193)		GTGGGAAATAGAAGAGGTCGT	0.517													23	65	---	---	---	---	PASS
CLMN	79789	broad.mit.edu	37	14	95670395	95670395	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95670395C>G	uc001yef.2	-	9	1407	c.1291G>C	c.(1291-1293)GAC>CAC	p.D431H		NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin	431						integral to membrane	actin binding				0				Epithelial(152;0.193)		TTGTAGGTGTCAGCCTCAAAG	0.473													24	162	---	---	---	---	PASS
BDKRB2	624	broad.mit.edu	37	14	96706942	96706942	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96706942G>C	uc010avm.1	+	3	473	c.277G>C	c.(277-279)GAG>CAG	p.E93Q	BDKRB2_uc010avl.1_3'UTR|BDKRB2_uc010twu.1_Missense_Mutation_p.E66Q|BDKRB2_uc001yfg.2_Missense_Mutation_p.E93Q	NM_000623	NP_000614	P30411	BKRB2_HUMAN	bradykinin receptor B2	93	Cytoplasmic (Potential).				arachidonic acid secretion|elevation of cytosolic calcium ion concentration|transmembrane receptor protein tyrosine kinase signaling pathway	endosome|integral to plasma membrane	bradykinin receptor activity|phosphatidylinositol phospholipase C activity|protease binding|protein heterodimerization activity|type 1 angiotensin receptor binding			ovary(3)|breast(1)|kidney(1)	5		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)		CACGGTGGCAGAGATCTACCT	0.612													6	270	---	---	---	---	PASS
AK7	122481	broad.mit.edu	37	14	96937902	96937902	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96937902G>A	uc001yfn.2	+	13	1489	c.1445G>A	c.(1444-1446)GGA>GAA	p.G482E		NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7	482	Adenylate kinase.				cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		ATTTTGGATGGATTCCCAAAG	0.303													6	108	---	---	---	---	PASS
SETD3	84193	broad.mit.edu	37	14	99865289	99865289	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99865289C>G	uc001ygc.2	-	13	1682	c.1512G>C	c.(1510-1512)GAG>GAC	p.E504D		NM_032233	NP_115609	Q86TU7	SETD3_HUMAN	SET domain containing 3 isoform a	504					peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity				0		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				CAAGGTTACTCTCTTCATATT	0.522													78	376	---	---	---	---	PASS
MIR496	574454	broad.mit.edu	37	14	101526956	101526956	+	RNA	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101526956T>C	hsa-mir-496|MI0003136	+			c.47T>C			uc010awh.1_5'Flank|MIR377_hsa-mir-377|MI0000785_5'Flank																	0						GTGTTCATTTTATTTATGATG	0.537													6	23	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102481630	102481630	+	Missense_Mutation	SNP	A	C	C	rs150888094	byFrequency	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102481630A>C	uc001yks.2	+	35	7367	c.7203A>C	c.(7201-7203)AAA>AAC	p.K2401N	DYNC1H1_uc001ykt.1_5'UTR	NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	2401	AAA 2 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GTAAGGGCAAAGAGGATGAGG	0.582													3	32	---	---	---	---	PASS
PPP1R13B	23368	broad.mit.edu	37	14	104209151	104209151	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104209151C>G	uc001yof.1	-	10	1443	c.1160G>C	c.(1159-1161)GGA>GCA	p.G387A	PPP1R13B_uc010awv.1_RNA|PPP1R13B_uc001yog.1_Missense_Mutation_p.G254A	NM_015316	NP_056131	Q96KQ4	ASPP1_HUMAN	apoptosis-stimulating protein of p53, 1	387					apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				TGGCCAGTTTCCATCATTAGC	0.443													5	175	---	---	---	---	PASS
TDRD9	122402	broad.mit.edu	37	14	104472825	104472825	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104472825C>G	uc001yom.3	+	16	1843	c.1813C>G	c.(1813-1815)CAG>GAG	p.Q605E	TDRD9_uc001yon.3_Missense_Mutation_p.Q343E	NM_153046	NP_694591	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	605					cell differentiation|DNA methylation involved in gamete generation|fertilization|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	nucleus|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				TCCTGTAAATCAGCAACTTGG	0.408													20	92	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105415937	105415937	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105415937G>C	uc010axc.1	-	7	5971	c.5851C>G	c.(5851-5853)CTG>GTG	p.L1951V	AHNAK2_uc001ypx.2_Missense_Mutation_p.L1851V	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1951						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ATGCTGGGCAGAGACACCTCG	0.622													50	278	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105420834	105420834	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105420834C>G	uc010axc.1	-	7	1074	c.954G>C	c.(952-954)CAG>CAC	p.Q318H	AHNAK2_uc001ypx.2_Missense_Mutation_p.Q218H	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	318						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCGCCTCCTCTGGCTGCCCG	0.642													3	20	---	---	---	---	PASS
BTBD6	90135	broad.mit.edu	37	14	105716777	105716777	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105716777G>T	uc010tyq.1	+	5	1334	c.1226G>T	c.(1225-1227)GGA>GTA	p.G409V	BRF1_uc010tyo.1_Intron|BRF1_uc010typ.1_Intron|BRF1_uc001yql.2_5'Flank|BRF1_uc001yqo.2_5'Flank|BRF1_uc010axg.1_Intron|BRF1_uc001yqp.2_Intron|BRF1_uc001yqn.2_5'Flank|BRF1_uc010axh.1_5'Flank|BRF1_uc010axj.1_5'Flank	NM_033271	NP_150374	Q96KE9	BTBD6_HUMAN	BTB domain protein BDPL	409						cytoplasmic mRNA processing body					0		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	Epithelial(152;0.18)		ATGTCAGACGGATCCAGTAAC	0.567													4	100	---	---	---	---	PASS
MTA1	9112	broad.mit.edu	37	14	105905016	105905016	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105905016C>G	uc001yqx.2	+	2	223	c.36C>G	c.(34-36)GTC>GTG	p.V12V	MTA1_uc001yqy.2_RNA|MTA1_uc001yqz.1_5'UTR|MTA1_uc001yra.1_5'UTR	NM_004689	NP_004680	Q13330	MTA1_HUMAN	metastasis associated protein	12	BAH.				signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		CAGACTACGTCTACTTTGAGA	0.617													43	229	---	---	---	---	PASS
CYFIP1	23191	broad.mit.edu	37	15	22962537	22962537	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22962537A>T	uc001yus.2	+	20	2361	c.2257A>T	c.(2257-2259)AGG>TGG	p.R753W	CYFIP1_uc001yut.2_Missense_Mutation_p.R753W|CYFIP1_uc010aya.1_Missense_Mutation_p.R781W|CYFIP1_uc001yuu.2_Missense_Mutation_p.R322W	NM_014608	NP_055423	Q7L576	CYFP1_HUMAN	cytoplasmic FMR1 interacting protein 1 isoform	753					axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GCTGAAGCAGAGGCATGTGCA	0.468													7	48	---	---	---	---	PASS
MAGEL2	54551	broad.mit.edu	37	15	23890133	23890133	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23890133C>G	uc001ywj.3	-	1	1043	c.948G>C	c.(946-948)CTG>CTC	p.L316L		NM_019066	NP_061939			MAGE-like protein 2												0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CCCAGTCACTCAGATTTAGAT	0.612													19	91	---	---	---	---	PASS
NDN	4692	broad.mit.edu	37	15	23931634	23931634	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23931634T>C	uc001ywk.2	-	1	817	c.731A>G	c.(730-732)TAC>TGC	p.Y244C		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	244	MAGE.				negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GTACTTCAGGTAATTCATTTG	0.587									Prader-Willi_syndrome				18	51	---	---	---	---	PASS
NDN	4692	broad.mit.edu	37	15	23931908	23931908	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23931908G>T	uc001ywk.2	-	1	543	c.457C>A	c.(457-459)CTG>ATG	p.L153M		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	153	MAGE.				negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		CTCAGGTGCAGCCCGAACACC	0.622									Prader-Willi_syndrome				9	31	---	---	---	---	PASS
SNORD115-11	100033448	broad.mit.edu	37	15	25432748	25432748	+	5'Flank	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25432748G>A	uc001yze.1	+						SNORD115-10_uc001yzd.1_RNA	NR_003358				Homo sapiens small nucleolar RNA, C/D box 115-11 (SNORD115-11), non-coding RNA.												0						TGCTCAATAGGATTACGCTGA	0.483													72	354	---	---	---	---	PASS
OCA2	4948	broad.mit.edu	37	15	28228542	28228542	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28228542G>A	uc001zbh.3	-	14	1562	c.1452C>T	c.(1450-1452)ATC>ATT	p.I484I	OCA2_uc010ayv.2_Silent_p.I460I	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	484	Extracellular (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GAGGGTCCCCGATGGCAGTGG	0.493									Oculocutaneous_Albinism				14	92	---	---	---	---	PASS
FMN1	342184	broad.mit.edu	37	15	33359865	33359865	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33359865G>T	uc001zhf.3	-	1	221	c.221C>A	c.(220-222)TCC>TAC	p.S74Y	FMN1_uc001zhg.2_Missense_Mutation_p.S74Y	NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1	Error:Variant_position_missing_in_Q68DA7_after_alignment					actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GCCATTGCTGGAATCATCCTG	0.458													17	104	---	---	---	---	PASS
ATPBD4	89978	broad.mit.edu	37	15	35703105	35703105	+	Intron	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35703105G>T	uc001zja.2	-						ATPBD4_uc001ziz.2_Intron	NM_080650	NP_542381	Q7L8W6	ATBD4_HUMAN	ATP binding domain 4 isoform 1												0		all_epithelial(112;2.11e-09)|Lung NSC(122;2.38e-08)|all_lung(180;3.65e-07)		all cancers(64;9.9e-19)|GBM - Glioblastoma multiforme(113;2.01e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)		AACCTGCCAAGAAAGGTTACA	0.378													23	215	---	---	---	---	PASS
CASC5	57082	broad.mit.edu	37	15	40902467	40902467	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40902467G>C	uc010bbs.1	+	6	383	c.222G>C	c.(220-222)ATG>ATC	p.M74I	CASC5_uc010ucq.1_5'UTR|CASC5_uc001zme.2_Missense_Mutation_p.M74I|CASC5_uc010bbt.1_Missense_Mutation_p.M74I	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	74	Interaction with BUB1 and BUB1B.				acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGTCTCATATGAAAATAGTGA	0.308													37	152	---	---	---	---	PASS
CASC5	57082	broad.mit.edu	37	15	40912985	40912985	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40912985A>C	uc010bbs.1	+	11	762	c.601A>C	c.(601-603)ACC>CCC	p.T201P	CASC5_uc010ucq.1_Missense_Mutation_p.T25P|CASC5_uc001zme.2_Missense_Mutation_p.T175P|CASC5_uc010bbt.1_Missense_Mutation_p.T175P	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	201	Interaction with BUB1 and BUB1B.				acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TGAAAAGTCCACCAAGATAGA	0.363													19	125	---	---	---	---	PASS
SPINT1	6692	broad.mit.edu	37	15	41146845	41146845	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41146845G>C	uc001zna.2	+	8	1327	c.1123G>C	c.(1123-1125)GGC>CGC	p.G375R	SPINT1_uc001znb.2_Missense_Mutation_p.G359R|SPINT1_uc001znc.2_Missense_Mutation_p.G359R|SPINT1_uc010ucs.1_Missense_Mutation_p.G366R	NM_181642	NP_857593	O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	375						extracellular region|membrane fraction	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		AGACACGAGTGGCTTTGACGA	0.592													34	145	---	---	---	---	PASS
EHD4	30844	broad.mit.edu	37	15	42192959	42192959	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42192959A>C	uc001zot.2	-	6	1573	c.1510T>G	c.(1510-1512)TTC>GTC	p.F504V		NM_139265	NP_644670	Q9H223	EHD4_HUMAN	EH-domain containing 4	504	EF-hand.|EH.				endocytic recycling|protein homooligomerization	early endosome membrane|endoplasmic reticulum|nucleus|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			ovary(2)	2		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)		GCCAGCGCGAACTCCTCCTCA	0.632													24	43	---	---	---	---	PASS
TTBK2	146057	broad.mit.edu	37	15	43044761	43044761	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43044761C>G	uc001zqo.2	-	14	3122	c.2683G>C	c.(2683-2685)GAC>CAC	p.D895H	TTBK2_uc010bcy.2_Missense_Mutation_p.D826H	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	895					cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		GTAGAGAGGTCTCCTTGATGA	0.418													40	144	---	---	---	---	PASS
ZSCAN29	146050	broad.mit.edu	37	15	43661911	43661911	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43661911C>G	uc001zrk.1	-	1	348	c.201G>C	c.(199-201)CTG>CTC	p.L67L	ZSCAN29_uc001zrj.1_5'Flank|ZSCAN29_uc010bdf.1_Silent_p.L66L|ZSCAN29_uc001zrl.1_RNA|ZSCAN29_uc010bdg.1_Silent_p.L66L|ZSCAN29_uc001zrm.2_Silent_p.L66L|TUBGCP4_uc001zrn.2_5'Flank|TUBGCP4_uc001zro.2_5'Flank	NM_152455	NP_689668	Q8IWY8	ZSC29_HUMAN	zinc finger protein 690	67	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		GTAAGACGGTCAGGAACTGCT	0.522													28	161	---	---	---	---	PASS
MAP1A	4130	broad.mit.edu	37	15	43821418	43821418	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43821418G>A	uc001zrt.2	+	4	8214	c.7747G>A	c.(7747-7749)GAG>AAG	p.E2583K		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2583						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GGCTGACCCCGAGGGGCTCAG	0.667													9	43	---	---	---	---	PASS
SPG11	80208	broad.mit.edu	37	15	44943814	44943814	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44943814T>C	uc001ztx.2	-	6	1362	c.1331A>G	c.(1330-1332)GAA>GGA	p.E444G	SPG11_uc010ueh.1_Missense_Mutation_p.E444G|SPG11_uc010uei.1_Missense_Mutation_p.E444G|SPG11_uc001zua.1_Missense_Mutation_p.E444G	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1	444	Extracellular (Potential).				cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		GCCCATCCTTTCCACTTCCCA	0.453													39	284	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51828679	51828679	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51828679C>G	uc002abf.2	-	12	2223	c.1998G>C	c.(1996-1998)TTG>TTC	p.L666F	DMXL2_uc010ufy.1_Missense_Mutation_p.L666F|DMXL2_uc010bfa.2_Missense_Mutation_p.L666F	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	666						cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		GAGAGGATGTCAATAACAGTG	0.363													31	155	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54793028	54793028	+	Intron	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54793028C>A	uc002ack.2	+							NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CTCCTCTCCCCACAGTTCCAG	0.428													13	88	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54847657	54847657	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54847657G>C	uc002ack.2	+	27	5905	c.5905G>C	c.(5905-5907)GGT>CGT	p.G1969R		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1969	MHD2.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GGATGCCAGGGGTCTGACGCC	0.423													7	48	---	---	---	---	PASS
PIGB	9488	broad.mit.edu	37	15	55611485	55611485	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55611485G>C	uc002act.2	+	1	353	c.37G>C	c.(37-39)GGG>CGG	p.G13R	uc002acs.2_5'Flank|PIGB_uc010ugg.1_5'UTR	NM_004855	NP_004846	Q92521	PIGB_HUMAN	phosphatidylinositol glycan, class B	13					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	integral to membrane|intrinsic to endoplasmic reticulum membrane	glycolipid mannosyltransferase activity				0				all cancers(107;0.0255)		AATGGAGCCGGGGGGCGGAGA	0.577													3	11	---	---	---	---	PASS
TPM1	7168	broad.mit.edu	37	15	63356324	63356324	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63356324C>G	uc002alg.2	+	9	1025	c.834C>G	c.(832-834)CTC>CTG	p.L278L	TPM1_uc002alh.2_Silent_p.L278L|TPM1_uc010bgn.2_Intron|TPM1_uc002ali.2_Intron|TPM1_uc002alj.2_Intron|TPM1_uc002alk.2_Intron|TPM1_uc002all.2_Intron|TPM1_uc002alm.2_Intron|TPM1_uc010uie.1_Silent_p.L278L|TPM1_uc002alp.2_Silent_p.L278L|TPM1_uc002alr.2_Intron|TPM1_uc002als.2_Intron|TPM1_uc010uig.1_Intron|TPM1_uc002alt.2_Intron|TPM1_uc010bgp.2_Intron	NM_001018005	NP_001018005	P09493	TPM1_HUMAN	tropomyosin 1 alpha chain isoform 1	278	By similarity.				cardiac muscle contraction|cellular component movement|cellular response to reactive oxygen species|muscle filament sliding|negative regulation of cell migration|positive regulation of ATPase activity|positive regulation of cell adhesion|positive regulation of heart rate by epinephrine|positive regulation of stress fiber assembly|regulation of muscle contraction|ruffle organization|sarcomere organization|ventricular cardiac muscle tissue morphogenesis|wound healing	bleb|cytosol|muscle thin filament tropomyosin|ruffle membrane|stress fiber	actin binding|structural constituent of cytoskeleton|structural constituent of muscle				0						ACCACGCTCTCAACGATATGA	0.502													5	42	---	---	---	---	PASS
CSNK1G1	53944	broad.mit.edu	37	15	64497059	64497059	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64497059C>T	uc002anf.2	-						CSNK1G1_uc002ane.2_Intron|CSNK1G1_uc002ang.1_Intron|CSNK1G1_uc002anh.1_Intron|CSNK1G1_uc002anj.2_Intron	NM_022048	NP_071331	Q9HCP0	KC1G1_HUMAN	casein kinase 1, gamma 1						Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity				0						TTTTTAGCATCCCACCTGGAA	0.408													17	131	---	---	---	---	PASS
ZNF609	23060	broad.mit.edu	37	15	64967613	64967613	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64967613G>T	uc002ann.2	+	4	2560	c.2560G>T	c.(2560-2562)GAT>TAT	p.D854Y		NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609	854						nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						TGCTGGGGAGGATGGGGAGGG	0.522													23	124	---	---	---	---	PASS
ANKDD1A	348094	broad.mit.edu	37	15	65235752	65235752	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65235752G>T	uc002aoa.2	+	11	1068	c.1039G>T	c.(1039-1041)GGG>TGG	p.G347W	ANKDD1A_uc002aoc.2_RNA|ANKDD1A_uc010bha.2_Missense_Mutation_p.G256W	NM_182703	NP_874362	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	347	ANK 10.				signal transduction					ovary(1)	1						CCTCATTGCTGGGGTTGACTT	0.358													74	391	---	---	---	---	PASS
DPP8	54878	broad.mit.edu	37	15	65793003	65793003	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65793003G>C	uc002aov.2	-	4	2113	c.535C>G	c.(535-537)CTG>GTG	p.L179V	DPP8_uc002aow.2_Missense_Mutation_p.L179V|DPP8_uc010uiv.1_RNA|DPP8_uc002aox.2_Missense_Mutation_p.L163V|DPP8_uc002aoy.2_Missense_Mutation_p.L179V|DPP8_uc002aoz.2_Missense_Mutation_p.L163V|DPP8_uc010bhj.2_Missense_Mutation_p.L179V|DPP8_uc002apa.2_Missense_Mutation_p.L76V	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1	179					immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						GCTTGAAACAGAAATGTTCCA	0.403													63	282	---	---	---	---	PASS
RPL4	6124	broad.mit.edu	37	15	66793360	66793360	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66793360C>T	uc002apv.2	-	7	816	c.760G>A	c.(760-762)GAA>AAA	p.E254K	RPL4_uc010bhr.2_Missense_Mutation_p.E160K|RPL4_uc002apw.2_Missense_Mutation_p.E160K|RPL4_uc002apx.2_Missense_Mutation_p.E160K|RPL4_uc010ujq.1_3'UTR	NM_000968	NP_000959	P36578	RL4_HUMAN	ribosomal protein L4	254					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						AAAGCACTTTCAGTCCAAATG	0.418													24	130	---	---	---	---	PASS
CCDC33	80125	broad.mit.edu	37	15	74573101	74573101	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74573101A>G	uc002axo.2	+	9	1376	c.982A>G	c.(982-984)AAA>GAA	p.K328E	CCDC33_uc002axp.2_Missense_Mutation_p.K150E	NM_025055	NP_079331	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33 isoform 1	531				K -> E (in Ref. 1; BAG51911).			protein binding			ovary(3)|skin(2)	5						GCTGACAGGGAAAGGCTTGGA	0.552													19	104	---	---	---	---	PASS
CCDC33	80125	broad.mit.edu	37	15	74627443	74627443	+	Intron	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74627443C>A	uc002axo.2	+						CCDC33_uc002axp.2_Intron|CCDC33_uc002axq.2_Missense_Mutation_p.P345H|CCDC33_uc002axr.2_Missense_Mutation_p.P311H	NM_025055	NP_079331	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33 isoform 1								protein binding			ovary(3)|skin(2)	5						AGTGACCCCCCTGGAGTAGCT	0.572													71	132	---	---	---	---	PASS
MAN2C1	4123	broad.mit.edu	37	15	75652298	75652298	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75652298C>T	uc002baf.2	-	15	1755	c.1738G>A	c.(1738-1740)GTG>ATG	p.V580M	MAN2C1_uc002bag.2_Missense_Mutation_p.V580M|MAN2C1_uc002bah.2_Missense_Mutation_p.V580M|MAN2C1_uc010bkk.2_Missense_Mutation_p.V481M|MAN2C1_uc010umi.1_Missense_Mutation_p.V362M	NM_006715	NP_006706	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	580					mannose metabolic process		alpha-mannosidase activity|carbohydrate binding|protein binding|zinc ion binding				0						CTTCCAGTCACCACATCATGG	0.577													8	36	---	---	---	---	PASS
CHRNB4	1143	broad.mit.edu	37	15	78921302	78921302	+	Intron	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78921302A>G	uc002bed.1	-						CHRNB4_uc002bee.1_Intron	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4						regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0						GCTGGTTAGCAACTTACACTC	0.522													9	88	---	---	---	---	PASS
CHRNB4	1143	broad.mit.edu	37	15	78922232	78922232	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78922232C>A	uc002bed.1	-	5	527	c.415G>T	c.(415-417)GGC>TGC	p.G139C	CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_5'UTR	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	139	Extracellular (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0						AGGACGCTGCCGTTGGACCGG	0.572													15	41	---	---	---	---	PASS
BNC1	646	broad.mit.edu	37	15	83933054	83933054	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83933054T>C	uc002bjt.1	-	4	1037	c.949A>G	c.(949-951)AGC>GGC	p.S317G	BNC1_uc010uos.1_Missense_Mutation_p.S305G	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	317					epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						AAATGGGTGCTGTCTTCTTTT	0.428													62	139	---	---	---	---	PASS
ZNF592	9640	broad.mit.edu	37	15	85326210	85326210	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85326210C>T	uc002bld.2	+	4	640	c.304C>T	c.(304-306)CCA>TCA	p.P102S	ZNF592_uc010upb.1_RNA	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	102					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(2)	6			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AGATCTGCCTCCAGATCCCCA	0.502													37	88	---	---	---	---	PASS
SLC28A1	9154	broad.mit.edu	37	15	85478750	85478750	+	Splice_Site	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85478750G>A	uc002blg.2	+	15	1783	c.1581_splice	c.e15+1	p.S527_splice	SLC28A1_uc010bnb.2_Splice_Site_p.S527_splice|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Splice_Site_p.S527_splice|SLC28A1_uc010upg.1_Splice_Site_p.S527_splice	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GTGGATCTCCGTGAGTGTCCC	0.647													56	93	---	---	---	---	PASS
AGBL1	123624	broad.mit.edu	37	15	86807964	86807964	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86807964C>A	uc002blz.1	+	10	1504	c.1424C>A	c.(1423-1425)ACC>AAC	p.T475N	AGBL1_uc002bma.1_Missense_Mutation_p.T206N|AGBL1_uc002bmb.1_Missense_Mutation_p.T169N	NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	475					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						GCCAGAAGAACCAGCTCTGTG	0.483													70	148	---	---	---	---	PASS
DET1	55070	broad.mit.edu	37	15	89074044	89074044	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89074044C>A	uc002bmr.2	-	2	1045	c.893G>T	c.(892-894)CGG>CTG	p.R298L	DET1_uc002bmp.3_RNA|DET1_uc010bnk.2_RNA|DET1_uc002bmq.2_Missense_Mutation_p.R309L	NM_001144074	NP_001137546	Q7L5Y6	DET1_HUMAN	de-etiolated 1 isoform 2	298						nucleus				lung(1)|pancreas(1)	2	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TACCAGCAACCGGTGTTTGAG	0.532													12	72	---	---	---	---	PASS
C15orf42	90381	broad.mit.edu	37	15	90149999	90149999	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90149999G>C	uc002boe.2	+	14	2665	c.2665G>C	c.(2665-2667)GAG>CAG	p.E889Q		NM_152259	NP_689472	Q7Z2Z1	TICRR_HUMAN	leucine-rich repeat kinase 1	889					cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CATGTTTCAGGAGAACTCTCA	0.303													8	82	---	---	---	---	PASS
IQGAP1	8826	broad.mit.edu	37	15	90996132	90996132	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90996132C>G	uc002bpl.1	+	12	1389	c.1288C>G	c.(1288-1290)CAG>GAG	p.Q430E		NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	430					energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CGATCTCTATCAGAAGGAGCT	0.512													4	53	---	---	---	---	PASS
SV2B	9899	broad.mit.edu	37	15	91827444	91827444	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91827444G>C	uc002bqv.2	+	10	2092	c.1701G>C	c.(1699-1701)AAG>AAC	p.K567N	SV2B_uc010uqv.1_Missense_Mutation_p.K416N|SV2B_uc002bqu.3_RNA	NM_014848	NP_055663	Q7L1I2	SV2B_HUMAN	synaptic vesicle protein 2B homolog	567	Helical; (Potential).				neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			GAAGGCTCAAGATGATTGGTG	0.473													28	139	---	---	---	---	PASS
LASS3	204219	broad.mit.edu	37	15	100996212	100996212	+	Silent	SNP	G	C	C	rs149637953		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100996212G>C	uc002bvz.2	-	12	1387	c.885C>G	c.(883-885)CTC>CTG	p.L295L	LASS3_uc002bwa.2_Silent_p.L306L|LASS3_uc002bwb.2_Silent_p.L295L	NM_178842	NP_849164	Q8IU89	CERS3_HUMAN	LAG1 longevity assurance homolog 3	295	TLC.					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(2)|pancreas(1)|skin(1)	4	Lung NSC(78;0.0018)|all_lung(78;0.00278)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000867)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)			AGAAAGGCTCGAGGTGATACA	0.388													18	63	---	---	---	---	PASS
PCSK6	5046	broad.mit.edu	37	15	101905241	101905241	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101905241C>G	uc002bwy.2	-						PCSK6_uc010bpd.2_Intron|PCSK6_uc010bpe.2_Intron|PCSK6_uc002bxa.2_Intron|PCSK6_uc002bxb.2_Intron|PCSK6_uc002bxc.1_Missense_Mutation_p.E623Q|PCSK6_uc002bxd.1_Intron|PCSK6_uc002bxe.2_Missense_Mutation_p.E623Q	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4						glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			acaggagtctcaagatcacct	0.000													11	52	---	---	---	---	PASS
RAB11FIP3	9727	broad.mit.edu	37	16	553072	553072	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:553072G>C	uc002chf.2	+	7	1709	c.1370G>C	c.(1369-1371)GGC>GCC	p.G457A	RAB11FIP3_uc010uuf.1_Missense_Mutation_p.G161A|RAB11FIP3_uc010uug.1_Missense_Mutation_p.G192A	NM_014700	NP_055515	O75154	RFIP3_HUMAN	rab11-family interacting protein 3 isoform 1	457					cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding				0		Hepatocellular(16;0.0218)				CTCATGGAGGGCCCAGAGGAG	0.602													20	114	---	---	---	---	PASS
MSLN	10232	broad.mit.edu	37	16	815722	815722	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:815722C>T	uc002cjw.1	+	10	878	c.827C>T	c.(826-828)TCT>TTT	p.S276F	MSLN_uc002cjt.1_Missense_Mutation_p.S276F|MSLN_uc002cju.1_Missense_Mutation_p.S276F|MSLN_uc010brd.1_Missense_Mutation_p.S275F|MSLN_uc002cjv.1_Missense_Mutation_p.S276F|MSLN_uc002cjx.1_Missense_Mutation_p.S276F|MSLN_uc002cjy.1_5'Flank	NM_013404	NP_037536	Q13421	MSLN_HUMAN	mesothelin isoform 2 preproprotein	276	Required for megakaryocyte-potentiating factor activity.				cell adhesion	anchored to membrane|extracellular region|Golgi apparatus|plasma membrane				pancreas(1)	1		Hepatocellular(780;0.00335)				CAACGCTCCTCTCGGGACCCA	0.716													5	46	---	---	---	---	PASS
RPUSD1	113000	broad.mit.edu	37	16	837161	837161	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:837161C>G	uc002cka.2	-	3	559	c.325G>C	c.(325-327)GAG>CAG	p.E109Q	RPUSD1_uc002ckb.2_Missense_Mutation_p.E109Q|RPUSD1_uc002ckc.2_5'UTR|RPUSD1_uc002ckd.2_Intron|CHTF18_uc010uus.1_5'Flank|CHTF18_uc010bre.1_5'Flank|CHTF18_uc002cke.3_5'Flank|CHTF18_uc002ckf.3_5'Flank|CHTF18_uc010brf.2_5'Flank|CHTF18_uc002ckg.3_5'Flank	NM_058192	NP_478072	Q9UJJ7	RUSD1_HUMAN	RNA pseudouridylate synthase domain containing	109					pseudouridine synthesis		pseudouridine synthase activity|RNA binding				0		Hepatocellular(780;0.00335)				ACCCGGCTCTCCTGGATGTGC	0.662													3	24	---	---	---	---	PASS
LMF1	64788	broad.mit.edu	37	16	919873	919873	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:919873C>T	uc002ckj.2	-						LMF1_uc010brg.2_5'Flank|LMF1_uc010brh.2_Intron|LMF1_uc010bri.2_Intron|LMF1_uc002ckk.2_Intron	NM_022773	NP_073610	Q96S06	LMF1_HUMAN	lipase maturation factor 1							endoplasmic reticulum membrane|integral to membrane					0		Hepatocellular(780;0.00308)				CGCCAGGGACCGTCCCCCACC	0.662													7	8	---	---	---	---	PASS
CACNA1H	8912	broad.mit.edu	37	16	1257399	1257399	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1257399T>C	uc002cks.2	+	14	3280	c.3032T>C	c.(3031-3033)GTG>GCG	p.V1011A	CACNA1H_uc002ckt.2_Missense_Mutation_p.V1011A|CACNA1H_uc002cku.2_5'Flank|CACNA1H_uc010brj.2_5'Flank|CACNA1H_uc002ckv.2_5'Flank	NM_021098	NP_066921	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type,	1011	II.|Helical; Name=S6 of repeat II; (Potential).				aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(2)	2		Hepatocellular(780;0.00369)			Flunarizine(DB04841)|Mibefradil(DB01388)	AACCTGCTGGTGGCCATCCTC	0.647													4	22	---	---	---	---	PASS
UBE2I	7329	broad.mit.edu	37	16	1374720	1374720	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1374720G>C	uc002clc.1	+						UBE2I_uc002cld.1_Intron|UBE2I_uc002clf.1_Intron|UBE2I_uc002clg.1_Intron	NM_194261	NP_919237	P63279	UBC9_HUMAN	ubiquitin-conjugating enzyme E2I						cell division|chromosome segregation|interspecies interaction between organisms|mitosis|negative regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|protein sumoylation	cytoplasm|PML body|synaptonemal complex	ATP binding|enzyme binding|ubiquitin-protein ligase activity			breast(1)|skin(1)	2		Hepatocellular(780;0.00369)				CTTCTCTTTTGACCTCCTCAG	0.592													3	79	---	---	---	---	PASS
CRAMP1L	57585	broad.mit.edu	37	16	1712840	1712840	+	Intron	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1712840A>T	uc010uvh.1	+						CRAMP1L_uc002cmf.2_Intron	NM_020825	NP_065876	Q96RY5	CRML_HUMAN	Crm, cramped-like							nucleus	DNA binding				0						GGTCCAGGTCAGGGTCTTCTC	0.577													4	15	---	---	---	---	PASS
TRAF7	84231	broad.mit.edu	37	16	2223818	2223818	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2223818G>A	uc002cow.2	+	12	1215	c.1116G>A	c.(1114-1116)CTG>CTA	p.L372L		NM_032271	NP_115647	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7	372					activation of MAPKKK activity|apoptosis|regulation of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic membrane-bounded vesicle|ubiquitin ligase complex	identical protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3						ACGCGCGGCTGAACATGGGCA	0.697													3	35	---	---	---	---	PASS
MLST8	64223	broad.mit.edu	37	16	2257038	2257038	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2257038C>T	uc002coz.2	+	5	466	c.347C>T	c.(346-348)TCC>TTC	p.S116F	MLST8_uc002coy.2_Missense_Mutation_p.S116F|MLST8_uc002cpa.2_5'UTR|MLST8_uc002cpb.2_Missense_Mutation_p.S115F|MLST8_uc010uvx.1_Missense_Mutation_p.S50F|MLST8_uc002cpc.2_Missense_Mutation_p.S116F|MLST8_uc002cpd.2_Missense_Mutation_p.S50F|MLST8_uc002cpe.2_Missense_Mutation_p.S116F|MLST8_uc002cpg.2_Missense_Mutation_p.S135F|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_Missense_Mutation_p.S116F	NM_022372	NP_071767	Q9BVC4	LST8_HUMAN	G protein beta subunit-like	116	WD 3.				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0						GCCCGCAGGTCCCGGAACCTG	0.662													36	117	---	---	---	---	PASS
C16orf79	283870	broad.mit.edu	37	16	2260557	2260557	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2260557C>G	uc010bsh.2	-	2	323	c.146G>C	c.(145-147)GGA>GCA	p.G49A	C16orf79_uc002cpi.1_Missense_Mutation_p.G49A	NM_182563	NP_872369	Q6PL45	CP079_HUMAN	hypothetical protein LOC283870	49	Helical; (Potential).					integral to membrane				central_nervous_system(1)	1						AAGAAGCCCTCCAGCCACAAC	0.557													11	24	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2814714	2814714	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2814714G>A	uc002crk.2	+	11	4734	c.4185G>A	c.(4183-4185)GGG>GGA	p.G1395G	SRRM2_uc002crj.1_Silent_p.G1299G|SRRM2_uc002crl.1_Silent_p.G1395G|SRRM2_uc010bsu.1_Silent_p.G1299G	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	1395	Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						AAAAGGCAGGGATGTCTTCAA	0.458													284	384	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2818169	2818169	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2818169C>G	uc002crk.2	+	11	8189	c.7640C>G	c.(7639-7641)TCA>TGA	p.S2547*	SRRM2_uc002crj.1_Nonsense_Mutation_p.S2451*|SRRM2_uc002crl.1_Nonsense_Mutation_p.S2547*|SRRM2_uc010bsu.1_Nonsense_Mutation_p.S2451*	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	2547	Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						tcttcttcatcatcgtcgtcg	0.403													5	40	---	---	---	---	PASS
MEFV	4210	broad.mit.edu	37	16	3304485	3304485	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3304485C>G	uc002cun.1	-	2	623	c.583G>C	c.(583-585)GAG>CAG	p.E195Q		NM_000243	NP_000234	O15553	MEFV_HUMAN	Mediterranean fever protein	195					inflammatory response	cytoplasm|microtubule|microtubule associated complex|nucleus	actin binding|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|lung(1)	6					Colchicine(DB01394)	TGGCCCCCCTCTAGCGCCCTG	0.781													3	17	---	---	---	---	PASS
ZNF75A	7627	broad.mit.edu	37	16	3367379	3367379	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3367379G>C	uc002cut.3	+	6	927	c.401G>C	c.(400-402)AGA>ACA	p.R134T	ZNF75A_uc002cuv.3_RNA	NM_153028	NP_694573	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	134					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1						GTGAAGAAAAGAAAGAAACTT	0.398													18	95	---	---	---	---	PASS
ZNF75A	7627	broad.mit.edu	37	16	3367399	3367399	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3367399A>C	uc002cut.3	+	6	947	c.421A>C	c.(421-423)AAA>CAA	p.K141Q	ZNF75A_uc002cuv.3_RNA	NM_153028	NP_694573	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	141					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1						TTCAACCTGGAAACAAGAGCT	0.398													14	109	---	---	---	---	PASS
ZNF434	54925	broad.mit.edu	37	16	3433224	3433224	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3433224C>G	uc002cuz.2	-	6	1888	c.1086G>C	c.(1084-1086)GAG>GAC	p.E362D	ZNF434_uc002cux.3_Missense_Mutation_p.E573D|ZNF434_uc010uwx.1_Missense_Mutation_p.E285D|ZNF434_uc002cuy.3_Missense_Mutation_p.E285D	NM_017810	NP_060280	Q9NX65	ZN434_HUMAN	zinc finger protein 434	362					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GATAGGGCCTCTCCCCTGTGT	0.562													21	131	---	---	---	---	PASS
ADCY9	115	broad.mit.edu	37	16	4164000	4164000	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4164000C>G	uc002cvx.2	-	2	1983	c.1444G>C	c.(1444-1446)GAG>CAG	p.E482Q		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	482	Cytoplasmic (Potential).|Guanylate cyclase 1.				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						TTCACCATCTCCTTCTTCTCC	0.597													41	177	---	---	---	---	PASS
ERCC4	2072	broad.mit.edu	37	16	14026042	14026042	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14026042G>A	uc002dce.2	+	6	1011	c.1002G>A	c.(1000-1002)TCG>TCA	p.S334S	ERCC4_uc010bva.2_Silent_p.S334S|ERCC4_uc010uyz.1_5'UTR	NM_005236	NP_005227	Q92889	XPF_HUMAN	excision repair cross-complementing rodent	334					double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity			lung(4)|ovary(3)|skin(2)|pancreas(1)	10						CCAGCACCTCGATGTTTATAA	0.338			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				34	187	---	---	---	---	PASS
MPV17L	255027	broad.mit.edu	37	16	15494693	15494693	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15494693G>C	uc002ddn.2	+	2	504	c.360G>C	c.(358-360)CAG>CAC	p.Q120H	MPV17L_uc002ddm.2_Intron	NM_001128423	NP_001121895	Q2QL34	MP17L_HUMAN	MPV17 mitochondrial membrane protein-like	120	Lumenal.					integral to membrane|peroxisomal membrane					0						ACCTGAAACAGAAATTCTGGA	0.254													8	28	---	---	---	---	PASS
KIAA0430	9665	broad.mit.edu	37	16	15702352	15702352	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15702352C>G	uc002ddr.2	-	21	4171	c.3978G>C	c.(3976-3978)AAG>AAC	p.K1326N	KIAA0430_uc002ddq.2_Missense_Mutation_p.K1160N|KIAA0430_uc010uzv.1_Missense_Mutation_p.K1322N|KIAA0430_uc010uzw.1_Missense_Mutation_p.K1325N	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1	1325						peroxisome	nucleotide binding|RNA binding				0						GAGTAAGGATCTTTTCTTCTC	0.423													13	62	---	---	---	---	PASS
ABCC1	4363	broad.mit.edu	37	16	16205279	16205279	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16205279C>A	uc010bvi.2	+	22	3094	c.2919C>A	c.(2917-2919)TTC>TTA	p.F973L	ABCC1_uc010bvj.2_Missense_Mutation_p.F914L|ABCC1_uc010bvk.2_Missense_Mutation_p.F917L|ABCC1_uc010bvl.2_Missense_Mutation_p.F973L|ABCC1_uc010bvm.2_Missense_Mutation_p.F858L|ABCC1_uc002del.3_Missense_Mutation_p.F867L	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	973	Helical; Name=12.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	TCGGACTCTTCATCTCCTTCC	0.493													38	170	---	---	---	---	PASS
ACSM1	116285	broad.mit.edu	37	16	20636813	20636813	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20636813C>T	uc002dhm.1	-	11	1527	c.1459G>A	c.(1459-1461)GCT>ACT	p.A487T	ACSM1_uc002dhn.1_Intron|ACSM1_uc010bwg.1_Missense_Mutation_p.A487T	NM_052956	NP_443188	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member	487					benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)|skin(1)	2						TCCACCAAAGCGCTTTCAACC	0.602													8	38	---	---	---	---	PASS
TNRC6A	27327	broad.mit.edu	37	16	24788259	24788259	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24788259G>C	uc002dmm.2	+	5	283	c.169G>C	c.(169-171)GAA>CAA	p.E57Q	TNRC6A_uc010bxs.2_5'UTR	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	57					negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		ATTAGTGCCAGAACAGATAAA	0.433													13	79	---	---	---	---	PASS
SLC5A11	115584	broad.mit.edu	37	16	24902291	24902291	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24902291G>A	uc002dmu.2	+	9	998	c.766G>A	c.(766-768)GAT>AAT	p.D256N	SLC5A11_uc002dms.2_Missense_Mutation_p.D192N|SLC5A11_uc010vcd.1_Missense_Mutation_p.D221N|SLC5A11_uc002dmt.2_Intron|SLC5A11_uc010vce.1_Missense_Mutation_p.D186N|SLC5A11_uc010bxt.2_Missense_Mutation_p.D192N	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	256	Extracellular (Potential).				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		GCCCCGGGAAGATGCCTTCCA	0.577													41	157	---	---	---	---	PASS
JMJD5	79831	broad.mit.edu	37	16	27221543	27221543	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27221543G>C	uc002doh.2	+	2	281	c.99G>C	c.(97-99)CTG>CTC	p.L33L	JMJD5_uc010bxv.2_Silent_p.L33L|JMJD5_uc010vcn.1_Silent_p.L71L|JMJD5_uc010bxw.2_Silent_p.L33L	NM_024773	NP_079049	Q8N371	KDM8_HUMAN	jumonji domain containing 5 isoform 2	33					G2/M transition of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|histone demethylase activity (H3-K36 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(2)|upper_aerodigestive_tract(1)	3						AAGAAGACCTGAAGTTGGACC	0.612													11	64	---	---	---	---	PASS
IL4R	3566	broad.mit.edu	37	16	27363887	27363887	+	Silent	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27363887A>G	uc002don.2	+	7	782	c.540A>G	c.(538-540)CTA>CTG	p.L180L	IL4R_uc002dom.2_Silent_p.L180L|IL4R_uc002dop.3_Silent_p.L165L|IL4R_uc010bxy.2_Silent_p.L180L|IL4R_uc002doo.2_Silent_p.L20L	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	180	Extracellular (Potential).|Fibronectin type-III.				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						TGACCTACCTAGAACCCTCCC	0.597													31	95	---	---	---	---	PASS
ATP2A1	487	broad.mit.edu	37	16	28914161	28914161	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28914161C>T	uc002dro.1	+	19	2857	c.2673C>T	c.(2671-2673)TTC>TTT	p.F891F	uc010vct.1_Intron|ATP2A1_uc002drn.1_Silent_p.F891F|ATP2A1_uc002drp.1_Silent_p.F766F	NM_173201	NP_775293	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, fast twitch 1 isoform	891	Lumenal (By similarity).				apoptosis in response to endoplasmic reticulum stress|apoptotic mitochondrial changes|ATP biosynthetic process|calcium ion import|elevation of endoplasmic reticulum calcium ion concentration|elevation of mitochondrial calcium ion concentration|maintenance of mitochondrion location|negative regulation of striated muscle contraction|platelet activation|positive regulation of fast-twitch skeletal muscle fiber contraction|reduction of endoplasmic reticulum calcium ion concentration|relaxation of skeletal muscle|response to endoplasmic reticulum stress	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|H zone|I band|microsome|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum|sarcoplasmic reticulum membrane	ATP binding|ATP binding|calcium ion binding|calcium ion binding|calcium-transporting ATPase activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GTGAGGTCTTCGAGGCCCCCG	0.617													7	23	---	---	---	---	PASS
ZNF48	197407	broad.mit.edu	37	16	30409555	30409555	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30409555G>A	uc002dya.1	+	2	1043	c.984G>A	c.(982-984)GAG>GAA	p.E328E	ZNF48_uc002dxz.1_Silent_p.E205E	NM_152652	NP_689865	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	328					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACACGGGTGAGAAGCCCTACC	0.637													13	68	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31091514	31091514	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31091514G>A	uc002eap.2	+	2	4158	c.3869G>A	c.(3868-3870)CGA>CAA	p.R1290Q		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	1290					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						GGGGGCACCCGAAAGGCGACT	0.701													6	27	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31091695	31091695	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31091695G>C	uc002eap.2	+	2	4339	c.4050G>C	c.(4048-4050)GAG>GAC	p.E1350D		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	1350					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						TGCACTCAGAGAATCGGCGGC	0.687													8	52	---	---	---	---	PASS
PRSS53	339105	broad.mit.edu	37	16	31098057	31098057	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31098057G>C	uc002eaq.2	-	4	405	c.405C>G	c.(403-405)GCC>GCG	p.A135A	PRSS53_uc002ear.2_5'UTR	NM_001039503	NP_001034592	Q2L4Q9	PRS53_HUMAN	polyserase 3 precursor	135	Peptidase S1 1.				proteolysis	extracellular region	serine-type endopeptidase activity				0						TCGTGGGGTGGGCGAGCTGCA	0.687													10	41	---	---	---	---	PASS
PRSS36	146547	broad.mit.edu	37	16	31150511	31150511	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31150511G>T	uc002ebd.2	-	15	2575	c.2516C>A	c.(2515-2517)TCC>TAC	p.S839Y	PRSS36_uc010vff.1_Missense_Mutation_p.S614Y|PRSS36_uc010vfg.1_Missense_Mutation_p.S834Y|PRSS36_uc010vfh.1_Missense_Mutation_p.S736Y	NM_173502	NP_775773	Q5K4E3	POLS2_HUMAN	protease, serine, 36 precursor	839					proteolysis	cytoplasm|proteinaceous extracellular matrix	serine-type endopeptidase activity			ovary(1)	1						TGCATGCGGGGATCCCGAGGC	0.637													16	74	---	---	---	---	PASS
GPT2	84706	broad.mit.edu	37	16	46931634	46931634	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46931634C>T	uc002eel.2	+	3	412	c.318C>T	c.(316-318)ATC>ATT	p.I106I	GPT2_uc002eem.2_Silent_p.I6I	NM_133443	NP_597700	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase 2 isoform 1	106					2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	AGCAGCCAATCACCTTCCTCC	0.662													35	32	---	---	---	---	PASS
ADCY7	113	broad.mit.edu	37	16	50348317	50348317	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50348317G>T	uc002egd.1	+	23	3239	c.2971G>T	c.(2971-2973)GGC>TGC	p.G991C		NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7	991	Cytoplasmic (Potential).|Guanylate cyclase 2.				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)	CCTCCGCGTCGGTGAGCCCGG	0.607													14	16	---	---	---	---	PASS
NKD1	85407	broad.mit.edu	37	16	50655581	50655581	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50655581G>A	uc002egg.1	+	5	552	c.328G>A	c.(328-330)GAA>AAA	p.E110K		NM_033119	NP_149110	Q969G9	NKD1_HUMAN	naked cuticle homolog 1	110					Wnt receptor signaling pathway	cytoplasm|plasma membrane	calcium ion binding|protein binding				0		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		GAGAGTGAGCGAACCCTGCCC	0.567													8	47	---	---	---	---	PASS
CYLD	1540	broad.mit.edu	37	16	50821699	50821699	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50821699C>A	uc002egp.1	+	14	2459	c.2044C>A	c.(2044-2046)CCT>ACT	p.P682T	CYLD_uc010cbs.1_Missense_Mutation_p.P679T|CYLD_uc002egq.1_Missense_Mutation_p.P679T|CYLD_uc002egr.1_Missense_Mutation_p.P679T	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN	ubiquitin carboxyl-terminal hydrolase CYLD	682					cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28		all_cancers(37;0.0156)				TCTCCTAGATCCTGAGGAATT	0.254			Mis|N|F|S		cylindroma	cylindroma			Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial				18	32	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51175747	51175747	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51175747G>T	uc010vgs.1	-	2	417	c.386C>A	c.(385-387)GCC>GAC	p.A129D	SALL1_uc010vgr.1_Missense_Mutation_p.A32D|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	129					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AGCAACCGGGGCCTCCACCTC	0.438													54	58	---	---	---	---	PASS
GNAO1	2775	broad.mit.edu	37	16	56362712	56362712	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56362712C>T	uc002eit.3	+						GNAO1_uc002eiu.3_Intron	NM_138736	NP_620073	P09471	GNAO_HUMAN	guanine nucleotide binding protein, alpha						dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity			lung(1)|breast(1)	2		all_neural(199;0.159)				TAGTGAGTGTCCCAGCGGGCG	0.607													8	48	---	---	---	---	PASS
SLC12A3	6559	broad.mit.edu	37	16	56933518	56933518	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56933518C>G	uc010ccm.2	+	23	2739	c.2710C>G	c.(2710-2712)CGG>GGG	p.R904G	SLC12A3_uc002ekd.3_Missense_Mutation_p.R913G|SLC12A3_uc010ccn.2_Missense_Mutation_p.R912G	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	904	Cytoplasmic (Potential).				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CCAGAACCCTCGGGCTGAGCA	0.547													6	172	---	---	---	---	PASS
KIAA0895L	653319	broad.mit.edu	37	16	67214480	67214480	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67214480G>C	uc002ert.2	-	2	809	c.34C>G	c.(34-36)CAG>GAG	p.Q12E	KIAA0895L_uc002err.2_5'Flank|KIAA0895L_uc002ers.2_5'Flank|KIAA0895L_uc002eru.2_Missense_Mutation_p.Q12E|EXOC3L_uc002erv.1_RNA	NM_001040715	NP_001035805	Q68EN5	K895L_HUMAN	hypothetical protein LOC653319	12											0						GGGGGTGCCTGATCATACGCC	0.642													10	39	---	---	---	---	PASS
FHOD1	29109	broad.mit.edu	37	16	67264021	67264021	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67264021C>G	uc002esl.2	-	20	3274	c.3162G>C	c.(3160-3162)AAG>AAC	p.K1054N	FHOD1_uc002esk.2_Missense_Mutation_p.K113N|FHOD1_uc010ced.2_Missense_Mutation_p.K861N	NM_013241	NP_037373	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	1054					actin cytoskeleton organization	cytoplasm|cytoskeleton|nucleus	actin binding			breast(2)|ovary(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		TCAGCAGACTCTTCATACTAG	0.627													36	198	---	---	---	---	PASS
PLEKHG4	25894	broad.mit.edu	37	16	67314196	67314196	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67314196G>C	uc002eso.3	+	1	2784	c.249G>C	c.(247-249)CAG>CAC	p.Q83H	PLEKHG4_uc002esp.3_5'UTR|PLEKHG4_uc002esq.3_Missense_Mutation_p.Q83H|PLEKHG4_uc002esr.1_Intron|PLEKHG4_uc010cef.2_Missense_Mutation_p.Q83H|PLEKHG4_uc002ess.3_Missense_Mutation_p.Q83H|PLEKHG4_uc010ceg.2_Missense_Mutation_p.Q83H	NM_015432	NP_056247	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G	83					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)|pancreas(1)	2				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		GGGATGCCCAGAGGGGCACAG	0.627													6	51	---	---	---	---	PASS
LRRC36	55282	broad.mit.edu	37	16	67409289	67409289	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67409289C>G	uc002esv.2	+	10	1653	c.1634C>G	c.(1633-1635)TCC>TGC	p.S545C	LRRC36_uc002esw.2_RNA|LRRC36_uc002esx.2_Missense_Mutation_p.S424C|LRRC36_uc010vjk.1_Intron|LRRC36_uc010vjl.1_Missense_Mutation_p.P66A|LRRC36_uc002esy.2_Missense_Mutation_p.S55C	NM_018296	NP_060766	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36 isoform 1	545											0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		GGCTCCGGCTCCCTCCTCCTC	0.542													77	290	---	---	---	---	PASS
EDC4	23644	broad.mit.edu	37	16	67912273	67912273	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67912273G>A	uc002eur.2	+	9	1181	c.1015G>A	c.(1015-1017)GAG>AAG	p.E339K	EDC4_uc010cer.2_5'UTR|EDC4_uc010vkg.1_Missense_Mutation_p.E271K|EDC4_uc010ces.1_Missense_Mutation_p.E182K|EDC4_uc002eus.2_Missense_Mutation_p.E69K	NM_014329	NP_055144	Q6P2E9	EDC4_HUMAN	autoantigen RCD8	339					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|central_nervous_system(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		GTGTCTGCACGAGTGGAAACC	0.607													5	166	---	---	---	---	PASS
SLC12A4	6560	broad.mit.edu	37	16	67980942	67980942	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67980942G>C	uc002euz.2	-	17	2280	c.2139C>G	c.(2137-2139)ACC>ACG	p.T713T	LCAT_uc002euy.1_5'Flank|SLC12A4_uc010ceu.2_Silent_p.T707T|SLC12A4_uc010vkh.1_Silent_p.T682T|SLC12A4_uc010vki.1_Silent_p.T713T|SLC12A4_uc010vkj.1_Silent_p.T715T|SLC12A4_uc002eva.2_Silent_p.T713T|SLC12A4_uc010cev.1_RNA|SLC12A4_uc002evb.2_RNA	NM_005072	NP_005063	Q9UP95	S12A4_HUMAN	solute carrier family 12, member 4 isoform a	713					cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GGGAGGCGAAGGTGAGGAGCC	0.657													6	31	---	---	---	---	PASS
CIRH1A	84916	broad.mit.edu	37	16	69199280	69199280	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69199280G>T	uc002ews.3	+	15	1780	c.1684G>T	c.(1684-1686)GAT>TAT	p.D562Y	CIRH1A_uc002ewr.2_Missense_Mutation_p.D562Y|CIRH1A_uc002ewt.3_Missense_Mutation_p.D479Y|CIRH1A_uc010cfi.2_Missense_Mutation_p.D364Y	NM_032830	NP_116219	Q969X6	CIR1A_HUMAN	cirhin	562	WD 11.					nucleolus	protein binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.125)		ACAGTATACAGATTGGAGCCG	0.488													16	86	---	---	---	---	PASS
NFAT5	10725	broad.mit.edu	37	16	69704136	69704136	+	Intron	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69704136C>A	uc002exm.1	+						NFAT5_uc002exh.1_Intron|NFAT5_uc002exi.2_Intron|NFAT5_uc002exj.1_Intron|NFAT5_uc002exk.1_Intron|NFAT5_uc002exl.1_Intron|NFAT5_uc002exn.1_Intron	NM_006599	NP_006590	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform c						excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						TTATTTCAATCAGATGAAAAC	0.254													15	47	---	---	---	---	PASS
COG4	25839	broad.mit.edu	37	16	70557265	70557265	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70557265C>G	uc002ezc.2	-						COG4_uc010cfu.2_Intron|COG4_uc002ezd.2_Intron|COG4_uc002eze.2_Intron|SF3B3_uc002ezf.2_5'Flank	NM_015386	NP_056201	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4						Golgi organization|Golgi vesicle prefusion complex stabilization|protein transport|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0		Ovarian(137;0.0694)				AGAAGAGGCTCGACCCCGCAC	0.587													14	78	---	---	---	---	PASS
KIAA0174	9798	broad.mit.edu	37	16	71956497	71956497	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71956497G>C	uc002fbj.1	+	9	995	c.712G>C	c.(712-714)GAT>CAT	p.D238H	KIAA0174_uc010cgh.1_Missense_Mutation_p.D238H|KIAA0174_uc002fbk.1_Missense_Mutation_p.D225H|KIAA0174_uc002fbm.1_Missense_Mutation_p.D225H|KIAA0174_uc002fbl.1_Missense_Mutation_p.D225H|KIAA0174_uc002fbn.1_Missense_Mutation_p.D77H|KIAA0174_uc010cgi.1_5'UTR|KIAA0174_uc010cgj.1_Missense_Mutation_p.D157H|KIAA0174_uc010vml.1_RNA|KIAA0174_uc010vmk.1_Missense_Mutation_p.D77H			P53990	IST1_HUMAN	SubName: Full=cDNA FLJ32696 fis, clone TESTI2000358; SubName: Full=cDNA FLJ77725;	225	Interaction with VPS37B.|Interaction with VTA1.				cell cycle|cell division	cytoplasmic membrane-bounded vesicle|ER-Golgi intermediate compartment	protein binding			ovary(1)	1						TGGTGGACCTGATGGAACGGt	0.388													3	135	---	---	---	---	PASS
CHST6	4166	broad.mit.edu	37	16	75512624	75512624	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75512624C>G	uc002fef.2	-	3	1283	c.1103G>C	c.(1102-1104)CGC>CCC	p.R368P	CHST6_uc002feg.1_RNA|CHST6_uc002feh.1_Missense_Mutation_p.R368P	NM_021615	NP_067628	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	368	Lumenal (Potential).				keratan sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						GGCGAGGTTGCGCTGCTCGTC	0.637													54	53	---	---	---	---	PASS
ADAT1	23536	broad.mit.edu	37	16	75642805	75642805	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75642805C>G	uc002feo.1	-	8	1227	c.1125G>C	c.(1123-1125)CAG>CAC	p.Q375H	ADAT1_uc002fep.1_Missense_Mutation_p.Q226H	NM_012091	NP_036223	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	375	A to I editase.				tRNA processing		metal ion binding|RNA binding|tRNA-specific adenosine deaminase activity			ovary(1)|skin(1)	2						CACTGCGGCTCTGTTCAAATA	0.463													22	97	---	---	---	---	PASS
ADAT1	23536	broad.mit.edu	37	16	75642880	75642880	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75642880C>G	uc002feo.1	-	8	1152	c.1050G>C	c.(1048-1050)CAG>CAC	p.Q350H	ADAT1_uc002fep.1_Missense_Mutation_p.Q201H	NM_012091	NP_036223	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	350	A to I editase.				tRNA processing		metal ion binding|RNA binding|tRNA-specific adenosine deaminase activity			ovary(1)|skin(1)	2						CAGACACATTCTGACACCTAA	0.428													22	94	---	---	---	---	PASS
KIAA1609	57707	broad.mit.edu	37	16	84514298	84514298	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84514298T>C	uc002fib.2	-	7	1201	c.1094A>G	c.(1093-1095)CAC>CGC	p.H365R	KIAA1609_uc010vod.1_Missense_Mutation_p.H338R|KIAA1609_uc002fic.2_RNA	NM_020947	NP_065998	Q6P9B6	K1609_HUMAN	hypothetical protein LOC57707	365	TLD.						protein binding			ovary(2)	2						AAAGTAATTGTGCTGCCCCCC	0.557													24	56	---	---	---	---	PASS
CBFA2T3	863	broad.mit.edu	37	16	88945803	88945803	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88945803C>G	uc002fmm.1	-	11	1723	c.1537G>C	c.(1537-1539)GAG>CAG	p.E513Q	CBFA2T3_uc002fml.1_Missense_Mutation_p.E427Q|CBFA2T3_uc002fmk.1_Missense_Mutation_p.E12Q	NM_005187	NP_005178	O75081	MTG16_HUMAN	myeloid translocation gene on chromosome 16	513	Potential.				cell proliferation|granulocyte differentiation	Golgi membrane|nucleolus|nucleoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(3)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0275)		GCTTTGCGCTCCGCGTCCGAC	0.662			T	RUNX1	AML								7	51	---	---	---	---	PASS
ZNF778	197320	broad.mit.edu	37	16	89293455	89293455	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89293455G>A	uc002fmv.2	+	6	1014	c.675G>A	c.(673-675)TGG>TGA	p.W225*	ZNF778_uc010vpf.1_Intron|ZNF778_uc002fmw.1_Nonsense_Mutation_p.W183*|ZNF778_uc010vpg.1_5'UTR	NM_182531	NP_872337	Q96MU6	ZN778_HUMAN	zinc finger protein 778	225					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0269)		AAGAAACATGGAAATGGAAGC	0.522													37	221	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1554484	1554484	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1554484C>G	uc002fte.2	-	42	6885	c.6771G>C	c.(6769-6771)GAG>GAC	p.E2257D	RILP_uc002ftd.2_5'Flank	NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	2257						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TCTGCACCCTCTCATAGTGTG	0.582													6	47	---	---	---	---	PASS
KIAA0664	23277	broad.mit.edu	37	17	2604712	2604712	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2604712C>T	uc002fuy.1	-	6	819	c.733G>A	c.(733-735)GAG>AAG	p.E245K	KIAA0664_uc002fux.1_Missense_Mutation_p.E177K	NM_015229	NP_056044	O75153	K0664_HUMAN	hypothetical protein LOC23277	245							binding			breast(2)	2						TGCCGGTCCTCGGCTGTGATC	0.622													6	9	---	---	---	---	PASS
ITGAE	3682	broad.mit.edu	37	17	3665221	3665221	+	Missense_Mutation	SNP	G	T	T	rs112400595		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3665221G>T	uc002fwo.3	-	4	402	c.303C>A	c.(301-303)CAC>CAA	p.H101Q		NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor	101	FG-GAP 2.|Extracellular (Potential).				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		AAACACCGTGGTGGCTCCGGA	0.612													17	38	---	---	---	---	PASS
ANKFY1	51479	broad.mit.edu	37	17	4085544	4085544	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4085544C>G	uc002fxq.1	-	15	2091	c.2053G>C	c.(2053-2055)GAT>CAT	p.D685H	ANKFY1_uc002fxn.2_Missense_Mutation_p.D727H|ANKFY1_uc002fxo.2_Missense_Mutation_p.D686H|ANKFY1_uc002fxp.2_Missense_Mutation_p.D684H|ANKFY1_uc010ckp.2_Missense_Mutation_p.D627H	NM_016376	NP_057460	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	685						endosome membrane	metal ion binding|protein binding			ovary(2)|skin(1)	3						CCCTTCTCATCTGGCACAGAC	0.562													49	200	---	---	---	---	PASS
VMO1	284013	broad.mit.edu	37	17	4689561	4689561	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4689561C>G	uc002fyx.2	-	1	169	c.87G>C	c.(85-87)CGG>CGC	p.R29R	VMO1_uc010vsh.1_Silent_p.R29R|VMO1_uc010vsi.1_Silent_p.R29R|VMO1_uc002fyy.2_Silent_p.R29R|GLTPD2_uc002fza.1_5'Flank	NM_182566	NP_872372	Q7Z5L0	VMO1_HUMAN	vitelline membrane outer layer 1 isoform 1	29					vitelline membrane formation	extracellular region				ovary(1)	1						TGTAGCCGTTCCGGCCATCTG	0.557													7	44	---	---	---	---	PASS
SPEM1	374768	broad.mit.edu	37	17	7324338	7324338	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7324338G>A	uc002ggv.2	+	3	369	c.344G>A	c.(343-345)CGA>CAA	p.R115Q	FGF11_uc010vtw.1_Intron	NM_199339	NP_955371	Q8N4L4	SPEM1_HUMAN	spermatid maturation 1	115					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm|integral to membrane					0		Prostate(122;0.173)				CATCGCCGTCGAGGCTCTCCC	0.607													14	57	---	---	---	---	PASS
EIF4A1	1973	broad.mit.edu	37	17	7481183	7481183	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7481183G>C	uc002gho.1	+	17	2270	c.945G>C	c.(943-945)ATG>ATC	p.M315I	EIF4A1_uc002ghr.1_Missense_Mutation_p.M315I|EIF4A1_uc002ghq.1_Missense_Mutation_p.M315I|EIF4A1_uc002ghp.1_Missense_Mutation_p.M315I|SNORA67_uc010cml.1_5'Flank|CD68_uc002ghv.2_5'Flank|CD68_uc002ghu.2_5'Flank	NM_001416	NP_001407	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A	315	Helicase C-terminal.				nuclear-transcribed mRNA poly(A) tail shortening	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA cap binding|translation initiation factor activity			ovary(1)	1						ACGTGATTATGAGGGAGTTTC	0.498													4	98	---	---	---	---	PASS
EIF4A1	1973	broad.mit.edu	37	17	7481745	7481745	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7481745G>C	uc002gho.1	+	19	2487	c.1162G>C	c.(1162-1164)GAG>CAG	p.E388Q	EIF4A1_uc002ghr.1_3'UTR|EIF4A1_uc002ghq.1_3'UTR|EIF4A1_uc002ghp.1_Missense_Mutation_p.E388Q|CD68_uc002ghv.2_5'Flank|CD68_uc002ghu.2_5'Flank	NM_001416	NP_001407	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A	388	Helicase C-terminal.				nuclear-transcribed mRNA poly(A) tail shortening	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA cap binding|translation initiation factor activity			ovary(1)	1						TCGAGACATTGAGACCTTCTA	0.522													4	128	---	---	---	---	PASS
FXR2	9513	broad.mit.edu	37	17	7498076	7498076	+	Splice_Site	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7498076C>G	uc002gia.1	-	9	1059	c.832_splice	c.e9-1	p.T278_splice	FXR2_uc010vud.1_Splice_Site_p.T278_splice	NM_004860	NP_004851	P51116	FXR2_HUMAN	fragile X mental retardation syndrome related							cytosolic large ribosomal subunit	protein binding|RNA binding				0				READ - Rectum adenocarcinoma(115;0.17)		CCTCGGGAGTCTAAAGGAAGA	0.363													12	76	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7695336	7695336	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7695336G>C	uc002giu.1	+	44	7016	c.7002G>C	c.(7000-7002)CGG>CGC	p.R2334R		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2334					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AGGAGGGCCGGAAGAGGATCG	0.547													31	158	---	---	---	---	PASS
KDM6B	23135	broad.mit.edu	37	17	7751800	7751800	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7751800C>G	uc002giw.1	+	11	2570	c.2194C>G	c.(2194-2196)CTG>GTG	p.L732V	KDM6B_uc002gix.2_Missense_Mutation_p.L34V	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	732	Pro-rich.				inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2						CTTTGCATCTCTGCAGTCTCC	0.478													26	74	---	---	---	---	PASS
GAS7	8522	broad.mit.edu	37	17	9830003	9830003	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9830003G>A	uc002gmg.1	-	10	1130	c.969C>T	c.(967-969)GCC>GCT	p.A323A	GAS7_uc010vvc.1_Silent_p.A137A|GAS7_uc002gmh.1_Silent_p.A183A|GAS7_uc010vvd.1_Silent_p.A275A|GAS7_uc002gmi.2_Silent_p.A259A|GAS7_uc002gmj.1_Silent_p.A263A|GAS7_uc010coh.1_Silent_p.A263A	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c	323	Potential.				cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						TGCGAAGGTCGGCAATGTGGT	0.592			T	MLL	AML*								12	79	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10231375	10231375	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10231375C>G	uc002gmk.1	-	22	2589	c.2499G>C	c.(2497-2499)TGG>TGC	p.W833C		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	833					muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						ACAGGTTCATCCAGGGCCAGT	0.483											OREG0024177	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	28	58	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10417367	10417367	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10417367C>A	uc002gmo.2	-	7	702	c.608G>T	c.(607-609)GGG>GTG	p.G203V	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	203	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						CTTCTTCTCCCCAGTAACTGC	0.473													50	76	---	---	---	---	PASS
MYOCD	93649	broad.mit.edu	37	17	12666889	12666889	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12666889C>G	uc002gnn.2	+	13	3044	c.2745C>G	c.(2743-2745)TTC>TTG	p.F915L	MYOCD_uc002gno.2_Missense_Mutation_p.F963L|MYOCD_uc002gnq.2_Missense_Mutation_p.F639L	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	915					cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CCAGCATCTTCAACATCGATT	0.517													33	58	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	16068284	16068284	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16068284G>C	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron|NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron|NCOR1_uc002gpu.2_Silent_p.V209V	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ATTAAGCAAAGACATTTACTT	0.199													16	89	---	---	---	---	PASS
PRPSAP2	5636	broad.mit.edu	37	17	18775920	18775920	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18775920C>G	uc002gup.1	+	5	408	c.197C>G	c.(196-198)TCT>TGT	p.S66C	PRPSAP2_uc002guo.1_5'UTR|PRPSAP2_uc010vyi.1_Intron|PRPSAP2_uc010vyj.1_5'UTR|PRPSAP2_uc010vyk.1_Missense_Mutation_p.S54C	NM_002767	NP_002758	O60256	KPRB_HUMAN	phosphoribosyl pyrophosphate	66					nucleotide biosynthetic process		enzyme inhibitor activity|magnesium ion binding|ribose phosphate diphosphokinase activity			skin(1)	1						ATTCAAGAGTCTGTGAGGGGA	0.353													57	283	---	---	---	---	PASS
USP22	23326	broad.mit.edu	37	17	20922416	20922416	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20922416G>A	uc002gym.3	-	4	705	c.501C>T	c.(499-501)ATC>ATT	p.I167I	USP22_uc002gyn.3_Silent_p.I155I|USP22_uc002gyl.3_Silent_p.I62I	NM_015276	NP_056091	Q9UPT9	UBP22_HUMAN	ubiquitin thiolesterase 22	167					cell cycle|embryo development|histone deubiquitination|histone H4 acetylation|histone ubiquitination|positive regulation of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1						AGTTCGAGGTGATCTTTCTCC	0.468													5	260	---	---	---	---	PASS
LIG3	3980	broad.mit.edu	37	17	33323664	33323664	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33323664G>A	uc002hik.1	+	11	1923	c.1815G>A	c.(1813-1815)TTG>TTA	p.L605L	LIG3_uc002hij.2_Silent_p.L605L	NM_013975	NP_039269	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent isoform alpha	605					base-excision repair|cell division|DNA ligation involved in DNA repair|DNA replication|reciprocal meiotic recombination|spermatogenesis	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|protein binding|zinc ion binding			skin(3)|lung(2)|ovary(2)|large_intestine(1)|pancreas(1)	9		Ovarian(249;0.17)			Bleomycin(DB00290)	ATGTCAGCTTGATGGACAGGT	0.438								Other_BER_factors					45	214	---	---	---	---	PASS
MMP28	79148	broad.mit.edu	37	17	34095265	34095265	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34095265G>A	uc002hjy.1	-	8	1243	c.984C>T	c.(982-984)TTC>TTT	p.F328F	MMP28_uc002hjw.1_RNA|MMP28_uc002hjz.1_RNA	NM_024302	NP_077278	Q9H239	MMP28_HUMAN	matrix metalloproteinase 28 isoform 1	328	Hemopexin-like 1.				proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TGATGGCATCGAAGGAAGAGT	0.532													26	30	---	---	---	---	PASS
PLEKHH3	79990	broad.mit.edu	37	17	40825296	40825296	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40825296C>G	uc002iau.2	-	6	1134	c.667G>C	c.(667-669)GAG>CAG	p.E223Q	PLEKHH3_uc010cyl.1_5'Flank|PLEKHH3_uc002iat.1_RNA|PLEKHH3_uc002iav.2_RNA|PLEKHH3_uc010cym.1_Intron|PLEKHH3_uc002iaw.2_Missense_Mutation_p.E223Q	NM_024927	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H	223					signal transduction	cytoskeleton				large_intestine(1)|ovary(1)	2		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		GCAACGGCCTCTGGGTCCCCG	0.607													34	136	---	---	---	---	PASS
NBR1	4077	broad.mit.edu	37	17	41355694	41355694	+	Intron	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41355694G>T	uc010czd.2	+						NBR1_uc010diz.2_Intron|NBR1_uc010whu.1_Intron|NBR1_uc010whv.1_Intron|NBR1_uc010whw.1_Intron	NM_031862	NP_114068	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1						macroautophagy|protein oligomerization	autophagic vacuole|cytoplasmic vesicle|cytosol|late endosome|lysosome|sarcomere	ubiquitin binding|zinc ion binding			skin(1)	1		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		GTTTTCCTCTGCAGGCACCAT	0.463													7	21	---	---	---	---	PASS
GPATCH8	23131	broad.mit.edu	37	17	42513912	42513912	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42513912C>T	uc002igw.1	-	4	259	c.195G>A	c.(193-195)GGG>GGA	p.G65G	GPATCH8_uc002igv.1_5'UTR|GPATCH8_uc010wiz.1_5'UTR	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	65	G-patch.					intracellular	nucleic acid binding|zinc ion binding			ovary(2)|kidney(1)|skin(1)	4		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		GATCTGTTCTCCCTGTAACAG	0.423													51	70	---	---	---	---	PASS
PLEKHM1	9842	broad.mit.edu	37	17	43531171	43531171	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43531171C>G	uc002ija.2	-	7	2217	c.2047G>C	c.(2047-2049)GAT>CAT	p.D683H	PLEKHM1_uc010wjm.1_Missense_Mutation_p.D655H|PLEKHM1_uc002ijb.2_Missense_Mutation_p.D158H|PLEKHM1_uc010wjn.1_Missense_Mutation_p.D632H|PLEKHM1_uc002ijc.2_Missense_Mutation_p.D137H	NM_014798	NP_055613	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M	683	PH 2.				intracellular signal transduction	cytoplasm	metal ion binding				0	Renal(3;0.0405)					TTGATGGCATCTGGCTCTGGA	0.592													23	120	---	---	---	---	PASS
OSBPL7	114881	broad.mit.edu	37	17	45895988	45895988	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45895988G>C	uc002ilx.1	-						OSBPL7_uc002ilw.1_5'Flank	NM_145798	NP_665741	Q9BZF2	OSBL7_HUMAN	oxysterol-binding protein-like protein 7						lipid transport		lipid binding				0						TTGATCTGCAGAAGTGATGGA	0.602													7	43	---	---	---	---	PASS
CDK5RAP3	80279	broad.mit.edu	37	17	46056184	46056184	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46056184C>T	uc002imr.2	+						CDK5RAP3_uc010wlc.1_Intron|CDK5RAP3_uc002imq.1_Intron|CDK5RAP3_uc002imu.2_Intron|CDK5RAP3_uc002ims.2_Intron|CDK5RAP3_uc002imv.2_Intron|CDK5RAP3_uc002imw.2_Intron|CDK5RAP3_uc002imx.2_Intron	NM_176096	NP_788276	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3						brain development|regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation		neuronal Cdc2-like kinase binding				0						TTCTCTGTCTCTTCCTGGCAG	0.512											OREG0024508	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	41	103	---	---	---	---	PASS
HOXB9	3219	broad.mit.edu	37	17	46700471	46700471	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46700471C>T	uc002inx.2	-	2	748	c.544G>A	c.(544-546)GCT>ACT	p.A182T		NM_024017	NP_076922	P17482	HXB9_HUMAN	homeobox B9	182					canonical Wnt receptor signaling pathway|cell chemotaxis	mitochondrion|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GAAGAGCGAGCGTGCAGCCAG	0.547													35	158	---	---	---	---	PASS
COL1A1	1277	broad.mit.edu	37	17	48263143	48263143	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48263143C>A	uc002iqm.2	-	50	4370	c.4244G>T	c.(4243-4245)TGC>TTC	p.C1415F		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	1415	Fibrillar collagen NC1.				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	ACTCACCGTGCAGCCATCGAC	0.637			T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						13	50	---	---	---	---	PASS
EPN3	55040	broad.mit.edu	37	17	48616632	48616632	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48616632G>C	uc002ira.3	+	5	1282	c.847G>C	c.(847-849)GAG>CAG	p.E283Q	EPN3_uc010wms.1_Missense_Mutation_p.E311Q|EPN3_uc010wmt.1_RNA|EPN3_uc010wmu.1_Missense_Mutation_p.E256Q	NM_017957	NP_060427	Q9H201	EPN3_HUMAN	epsin 3	283						clathrin-coated vesicle|nucleus|perinuclear region of cytoplasm	lipid binding			ovary(1)	1	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			CAGAGAGCCTGAGAGAGAAGA	0.577													14	79	---	---	---	---	PASS
MMD	23531	broad.mit.edu	37	17	53499048	53499048	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53499048G>C	uc002iui.2	-	1	294	c.9C>G	c.(7-9)TTC>TTG	p.F3L		NM_012329	NP_036461	Q15546	PAQRB_HUMAN	monocyte to macrophage	3	Cytoplasmic (Potential).				cytolysis	integral to plasma membrane|late endosome membrane|lysosomal membrane|membrane fraction	receptor activity				0						ATCGATTCTTGAACCGCATTG	0.577													4	127	---	---	---	---	PASS
ANKFN1	162282	broad.mit.edu	37	17	54428250	54428250	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54428250G>A	uc002iun.1	+	4	356	c.321G>A	c.(319-321)CTG>CTA	p.L107L		NM_153228	NP_694960	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain	107										large_intestine(1)|ovary(1)	2						CTGAGAAACTGAAAGGGAGCC	0.443													17	83	---	---	---	---	PASS
COIL	8161	broad.mit.edu	37	17	55027748	55027748	+	Silent	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55027748A>T	uc002iuu.2	-	2	886	c.855T>A	c.(853-855)TCT>TCA	p.S285S		NM_004645	NP_004636	P38432	COIL_HUMAN	coilin	285						Cajal body|nucleolus	protein C-terminus binding			ovary(1)	1	Breast(9;6.15e-08)					TATTTTTGGTAGAGGGTTCTT	0.438													52	273	---	---	---	---	PASS
SKA2	348235	broad.mit.edu	37	17	57208656	57208656	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57208656C>G	uc002ixd.2	-	2	382	c.106G>C	c.(106-108)GAT>CAT	p.D36H	SKA2_uc002ixc.2_RNA|SKA2_uc010dde.1_Silent_p.L67L|SKA2_uc002ixe.2_RNA	NM_182620	NP_872426	Q8WVK7	SKA2_HUMAN	spindle and KT associated 2 isoform 1	36					cell division|chromosome segregation|mitotic anaphase|mitotic prometaphase|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytosol|spindle microtubule	microtubule binding				0						CTTGCTGAATCAGGATGATTA	0.328													3	14	---	---	---	---	PASS
PPM1D	8493	broad.mit.edu	37	17	58725246	58725246	+	Intron	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58725246C>A	uc002iyt.1	+						PPM1D_uc010ddm.1_Intron	NM_003620	NP_003611	O15297	PPM1D_HUMAN	protein phosphatase 1D						negative regulation of cell proliferation|protein dephosphorylation|response to radiation	nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein binding|protein serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			CTGCTCCCTTCCCCCAGGTGA	0.323													17	111	---	---	---	---	PASS
ICAM2	3384	broad.mit.edu	37	17	62081218	62081218	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62081218G>C	uc002jdu.3	-	3	667	c.435C>G	c.(433-435)CTC>CTG	p.L145L	C17orf72_uc002jdt.3_3'UTR|C17orf72_uc010wpu.1_3'UTR|C17orf72_uc010wpv.1_3'UTR|C17orf72_uc010wpw.1_3'UTR|ICAM2_uc002jdw.3_Silent_p.L145L|ICAM2_uc010ded.2_Silent_p.L145L|ICAM2_uc002jdx.3_Silent_p.L145L|ICAM2_uc002jdv.3_Silent_p.L145L	NM_000873	NP_000864	P13598	ICAM2_HUMAN	intercellular adhesion molecule 2 precursor	145	Ig-like C2-type 2.|Extracellular (Potential).				cell-cell adhesion|regulation of immune response	integral to plasma membrane	integrin binding			ovary(1)	1						GGAAGAGGGTGAGGCTGTCCA	0.607													15	75	---	---	---	---	PASS
RGS9	8787	broad.mit.edu	37	17	63221470	63221470	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63221470G>C	uc002jfe.2	+	18	1868	c.1758G>C	c.(1756-1758)CTG>CTC	p.L586L	RGS9_uc010dem.2_Silent_p.L583L|RGS9_uc002jfd.2_Silent_p.L583L|RGS9_uc002jff.2_RNA|RGS9_uc002jfg.2_Silent_p.L357L	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1	586					intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						GCAGGTTTCTGAGACGAGGCT	0.682													24	220	---	---	---	---	PASS
CCDC46	201134	broad.mit.edu	37	17	63898434	63898434	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63898434C>G	uc002jfl.2	-	20	2218	c.1999G>C	c.(1999-2001)GAG>CAG	p.E667Q	CCDC46_uc010deo.2_Missense_Mutation_p.E409Q|CCDC46_uc002jfm.2_Missense_Mutation_p.E667Q|CCDC46_uc010dep.2_Missense_Mutation_p.E625Q	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a	667	Potential.					centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			TGTTCATGCTCCAGCTTCAGC	0.438													16	99	---	---	---	---	PASS
MIR548D2	693131	broad.mit.edu	37	17	65467626	65467626	+	RNA	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65467626G>C	hsa-mir-548d-2|MI0003671	-			c.76G>C			PITPNC1_uc002jgb.2_Intron|PITPNC1_uc002jgc.2_Intron																	0						tggtgcaaaagaaactgtggt	0.095													4	18	---	---	---	---	PASS
ABCA9	10350	broad.mit.edu	37	17	66992106	66992106	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66992106A>G	uc002jhu.2	-	26	3628	c.3485T>C	c.(3484-3486)CTA>CCA	p.L1162P	ABCA9_uc010dez.2_Missense_Mutation_p.L1124P	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	1162					transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					AAATAGCCCTAGAAATCCATA	0.373													18	90	---	---	---	---	PASS
DNAI2	64446	broad.mit.edu	37	17	72285829	72285829	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72285829G>T	uc002jkf.2	+	5	663	c.564G>T	c.(562-564)CAG>CAT	p.Q188H	DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA	NM_023036	NP_075462	Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate polypeptide 2	188	WD 1.				cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity			ovary(2)|central_nervous_system(1)	3						TGGATTTTCAGCGGGCACCTG	0.622									Kartagener_syndrome				13	65	---	---	---	---	PASS
CASKIN2	57513	broad.mit.edu	37	17	73499763	73499763	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73499763C>T	uc002joc.2	-	16	2207	c.1657G>A	c.(1657-1659)GAG>AAG	p.E553K	CASKIN2_uc010wsc.1_Missense_Mutation_p.E471K	NM_020753	NP_065804	Q8WXE0	CSKI2_HUMAN	cask-interacting protein 2 isoform a	553						cytoplasm				pancreas(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGCAGCCACTCGGCGATGCTG	0.617													16	43	---	---	---	---	PASS
ACOX1	51	broad.mit.edu	37	17	73945286	73945286	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73945286G>C	uc002jqf.2	-						ACOX1_uc010wsq.1_Intron|ACOX1_uc002jqe.2_Intron|ACOX1_uc010wsr.1_Intron	NM_007292	NP_009223	Q15067	ACOX1_HUMAN	acyl-Coenzyme A oxidase 1 isoform b						fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|prostaglandin metabolic process|very long-chain fatty acid metabolic process	peroxisomal matrix	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity|flavin adenine dinucleotide binding|protein N-terminus binding			ovary(1)	1						CTTATACTTAGAAAATACTGA	0.249													11	115	---	---	---	---	PASS
EVPL	2125	broad.mit.edu	37	17	74011346	74011346	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74011346C>T	uc002jqi.2	-	16	2218	c.1990G>A	c.(1990-1992)GAA>AAA	p.E664K	EVPL_uc010wss.1_Missense_Mutation_p.E686K|EVPL_uc010wst.1_Missense_Mutation_p.E134K	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	664	Globular 1.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						GCCCCCGGTTCAGCAGGGATG	0.682													3	19	---	---	---	---	PASS
RNF157	114804	broad.mit.edu	37	17	74148493	74148493	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74148493C>G	uc002jqz.2	-	18	1933	c.1864G>C	c.(1864-1866)GAC>CAC	p.D622H	RNF157_uc002jra.2_Missense_Mutation_p.D600H|uc002jqy.1_Intron	NM_052916	NP_443148	Q96PX1	RN157_HUMAN	ring finger protein 157	622							zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.187)			CTTGCGATGTCAAAGTCATTG	0.488													23	131	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76433779	76433779	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76433779C>G	uc010dhp.1	-	19	3199	c.2977G>C	c.(2977-2979)GAG>CAG	p.E993Q	DNAH17_uc002jvq.2_Missense_Mutation_p.E278Q|DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GTGGGGGGCTCGTTGGTGATC	0.657													12	30	---	---	---	---	PASS
TIMP2	7077	broad.mit.edu	37	17	76869934	76869934	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76869934G>C	uc002jwf.2	-	2	500	c.198C>G	c.(196-198)ATC>ATG	p.I66M	TIMP2_uc002jwe.2_Translation_Start_Site|TIMP2_uc010wty.1_Translation_Start_Site	NM_003255	NP_003246	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2 precursor	66	NTR.						metal ion binding|metalloendopeptidase inhibitor activity			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			GGATCCTCTTGATAGGGTTGC	0.527													29	96	---	---	---	---	PASS
CCDC40	55036	broad.mit.edu	37	17	78021137	78021137	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78021137C>G	uc010dht.2	+	4	639	c.612C>G	c.(610-612)TTC>TTG	p.F204L	CCDC40_uc010wub.1_Missense_Mutation_p.F204L|CCDC40_uc002jxm.3_5'Flank	NM_017950	NP_060420	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	204					axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			AGCACCGCTTCCGGCTGAGCC	0.617													7	39	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	78272248	78272248	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78272248C>G	uc002jyf.2	+	11	2283	c.2140C>G	c.(2140-2142)CAG>GAG	p.Q714E	uc002jyg.1_Missense_Mutation_p.Q445E	NM_020954	NP_066005			hypothetical protein LOC57714																		TGCCTGGAGACAGCCTGAGGA	0.582													18	53	---	---	---	---	PASS
BAIAP2	10458	broad.mit.edu	37	17	79077806	79077806	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79077806A>G	uc002jzg.2	+	9	1072	c.964A>G	c.(964-966)AAA>GAA	p.K322E	BAIAP2_uc002jyz.3_Missense_Mutation_p.K322E|BAIAP2_uc002jza.2_Missense_Mutation_p.K322E|BAIAP2_uc002jzc.2_Missense_Mutation_p.K322E|BAIAP2_uc002jzb.2_Missense_Mutation_p.K79E|BAIAP2_uc002jzd.2_Missense_Mutation_p.K322E|BAIAP2_uc002jzf.2_Missense_Mutation_p.K322E|BAIAP2_uc002jze.2_Missense_Mutation_p.K355E|BAIAP2_uc010wuh.1_Missense_Mutation_p.K244E|BAIAP2_uc002jzh.2_Missense_Mutation_p.K323E|BAIAP2_uc010wui.1_Missense_Mutation_p.K185E	NM_017451	NP_059345	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2 isoform 2	322					axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TGCCCAGCCCAAATCCCTGTC	0.622													27	86	---	---	---	---	PASS
ACTG1	71	broad.mit.edu	37	17	79477708	79477708	+	3'UTR	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79477708G>A	uc002kaj.1	-	5					ACTG1_uc002kah.1_3'UTR|ACTG1_uc002kai.1_3'UTR|ACTG1_uc002kak.1_3'UTR|ACTG1_uc010wun.1_3'UTR|ACTG1_uc002kal.1_3'UTR|ACTG1_uc002kag.2_RNA	NM_001614	NP_001605	P63261	ACTG_HUMAN	actin, gamma 1 propeptide						adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol	ATP binding|identical protein binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			CGCATCTGCTGAGTCCGTTTA	0.517													26	89	---	---	---	---	PASS
DCXR	51181	broad.mit.edu	37	17	79994269	79994269	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79994269C>G	uc002kdg.2	-	6	519	c.504G>C	c.(502-504)GGG>GGC	p.G168G		NM_016286	NP_057370	Q7Z4W1	DCXR_HUMAN	dicarbonyl/L-xylulose reductase	168					D-xylose metabolic process|glucose metabolic process|protein homotetramerization|xylulose metabolic process	membrane	binding|L-xylulose reductase (NADP+) activity				0	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			CCTTGTGGGGCCCGAGCTCTA	0.552													13	55	---	---	---	---	PASS
NARF	26502	broad.mit.edu	37	17	80430437	80430437	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80430437C>T	uc002kfg.3	+						NARF_uc002kff.3_Intron|NARF_uc010wvo.1_Intron|NARF_uc010wvp.1_Intron|NARF_uc010dit.2_Intron|NARF_uc002kfj.3_Intron|NARF_uc002kfi.3_Intron|NARF_uc002kfh.3_Intron|NARF_uc002kfk.2_Intron	NM_012336	NP_036468	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor isoform a							lamin filament	lamin binding			skin(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			CTCTCTCCTGCAGGGGTGCAC	0.353													44	67	---	---	---	---	PASS
TBCD	6904	broad.mit.edu	37	17	80897338	80897338	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80897338C>G	uc002kfz.2	+	37	3595	c.3465C>G	c.(3463-3465)CTC>CTG	p.L1155L	TBCD_uc002kfy.1_Silent_p.L1193L|TBCD_uc002kgc.2_Silent_p.L274L|TBCD_uc002kgd.2_Silent_p.L147L	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D	1155					'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			TGACTGTGCTCAGTGACACTG	0.632													3	16	---	---	---	---	PASS
ZFP161	7541	broad.mit.edu	37	18	5291254	5291254	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5291254G>T	uc002kmq.2	-	4	1114	c.953C>A	c.(952-954)GCC>GAC	p.A318D	ZFP161_uc002kmr.2_Missense_Mutation_p.A318D|ZFP161_uc010dkp.2_Missense_Mutation_p.A318D	NM_003409	NP_003400	O43829	ZF161_HUMAN	zinc finger protein 161 homolog	318	C2H2-type 2.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTTCAGGTGGGCCTGTGTGGT	0.453													5	105	---	---	---	---	PASS
GATA6	2627	broad.mit.edu	37	18	19780785	19780785	+	Nonstop_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19780785G>C	uc002ktt.1	+	7	2052	c.1787G>C	c.(1786-1788)TGA>TCA	p.*596S	GATA6_uc002ktu.1_Nonstop_Mutation_p.*596S	NM_005257	NP_005248	Q92908	GATA6_HUMAN	GATA binding protein 6	596					blood coagulation|cardiac vascular smooth muscle cell differentiation|cellular response to hypoxia|intestinal epithelial cell differentiation|male gonad development|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor-beta1 production|negative regulation of transforming growth factor-beta2 production|outflow tract septum morphogenesis|positive regulation of angiogenesis|positive regulation of cell cycle arrest|positive regulation of transcription from RNA polymerase II promoter|response to drug|response to growth factor stimulus		protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(3)	3	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			GCCCTGGCCTGAGCCCACGCC	0.682													7	26	---	---	---	---	PASS
OSBPL1A	114876	broad.mit.edu	37	18	21913048	21913048	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21913048G>A	uc002kve.2	-	7	657	c.483C>T	c.(481-483)CTC>CTT	p.L161L		NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN	oxysterol-binding protein-like 1A isoform B	161					cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					TGGGCCTGTTGAGCTAACAAT	0.418													18	79	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22805569	22805569	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22805569C>T	uc002kvk.2	-	4	2560	c.2313G>A	c.(2311-2313)GTG>GTA	p.V771V	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Silent_p.V771V|ZNF521_uc002kvl.2_Silent_p.V551V	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	771	C2H2-type 18.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GGTTGTGTTTCACATGGAGCT	0.498			T	PAX5	ALL								9	93	---	---	---	---	PASS
SS18	6760	broad.mit.edu	37	18	23619391	23619391	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23619391G>C	uc002kvm.2	-	6	715	c.637C>G	c.(637-639)CAG>GAG	p.Q213E	SS18_uc002kvn.2_Missense_Mutation_p.Q213E|SS18_uc010xbf.1_Missense_Mutation_p.Q131E|SS18_uc010xbg.1_Missense_Mutation_p.Q161E|SS18_uc010xbh.1_Missense_Mutation_p.Q161E|SS18_uc010xbi.1_Missense_Mutation_p.Q190E|SS18_uc010dlz.1_Missense_Mutation_p.Q161E	NM_001007559	NP_001007560	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18	213	Gln-rich.				positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	ligand-dependent nuclear receptor transcription coactivator activity|protein binding		SS18/SSX1(1169)|SS18/SSX2(702)|SS18/SSX4(12)	soft_tissue(1883)|ovary(1)	1884	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)					TTGTATTGCTGAGAAGGAGGC	0.408			T	SSX1| SSX2	synovial sarcoma								24	153	---	---	---	---	PASS
KATNAL2	83473	broad.mit.edu	37	18	44627345	44627345	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44627345C>T	uc002lco.2	+	15	1564	c.1370C>T	c.(1369-1371)TCA>TTA	p.S457L	KATNAL2_uc002lcp.3_Missense_Mutation_p.S384L	NM_031303	NP_112593	Q8IYT4	KATL2_HUMAN	katanin p60 subunit A-like 2	529						cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						CAGAGATACTCAGACTGGCAA	0.488											OREG0024959	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	54	---	---	---	---	PASS
CCDC11	220136	broad.mit.edu	37	18	47787576	47787576	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47787576C>G	uc002lee.2	-	3	422	c.331G>C	c.(331-333)GAG>CAG	p.E111Q		NM_145020	NP_659457	Q96M91	CCD11_HUMAN	coiled-coil domain containing 11	111	Potential.									ovary(1)|pancreas(1)|skin(1)	3				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)		GTAAAATACTCATTTTCTTCT	0.284													4	91	---	---	---	---	PASS
ME2	4200	broad.mit.edu	37	18	48450551	48450551	+	Silent	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48450551A>G	uc002ley.2	+	11	1396	c.1140A>G	c.(1138-1140)GCA>GCG	p.A380A	ME2_uc010dpd.2_Silent_p.A380A	NM_002396	NP_002387	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial	380					malate metabolic process	mitochondrial matrix	electron carrier activity|malate dehydrogenase (decarboxylating) activity|malate dehydrogenase (oxaloacetate-decarboxylating) activity|metal ion binding|NAD binding				0		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)	NADH(DB00157)	TTGAAGATGCAGTGAATATAC	0.348													28	125	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56205344	56205344	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56205344G>C	uc002lhj.3	-	5	2289	c.2075C>G	c.(2074-2076)TCA>TGA	p.S692*	ALPK2_uc002lhk.1_Nonsense_Mutation_p.S23*	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	692							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						TCCTAAGTTTGAGAAGGAAAT	0.493													32	107	---	---	---	---	PASS
ZNF516	9658	broad.mit.edu	37	18	74091239	74091239	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74091239G>A	uc010dqx.1	-	3	3066	c.2831C>T	c.(2830-2832)TCG>TTG	p.S944L	ZNF516_uc002lme.2_RNA|ZNF516_uc002lmd.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	944					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		GCTATTGGCCGAGGGCTGCGC	0.682													9	39	---	---	---	---	PASS
PRSSL1	400668	broad.mit.edu	37	19	694935	694935	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:694935C>G	uc002lpl.1	-	2	146	c.115G>C	c.(115-117)GAG>CAG	p.E39Q	PRSSL1_uc010xfs.1_Missense_Mutation_p.E38Q	NM_214710	NP_999875	Q6UWY2	PRS57_HUMAN	protease, serine-like 1 precursor	39	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGTCACCTCGTGGCCCCCG	0.706													6	0	---	---	---	---	PASS
ELANE	1991	broad.mit.edu	37	19	855618	855618	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:855618C>G	uc002lqb.2	+	4	459	c.421C>G	c.(421-423)CAG>GAG	p.Q141E		NM_001972	NP_001963	P08246	ELNE_HUMAN	neutrophil elastase preproprotein	141	Peptidase S1.				cellular calcium ion homeostasis|negative regulation of chemokine biosynthetic process|negative regulation of chemotaxis|negative regulation of inflammatory response|negative regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of MAP kinase activity|positive regulation of smooth muscle cell proliferation|protein catabolic process|proteolysis|response to UV	cell surface|extracellular region|stored secretory granule	bacterial cell surface binding|cytokine binding|heparin binding			pancreas(1)	1					Alpha-1-proteinase inhibitor(DB00058)|Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GCTGCCGGCTCAGGGACGCCG	0.692									Kostmann_syndrome				19	39	---	---	---	---	PASS
CNN2	1265	broad.mit.edu	37	19	1036486	1036486	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1036486C>G	uc002lqu.2	+	6	942	c.579C>G	c.(577-579)CCC>CCG	p.P193P	CNN2_uc002lqt.1_Silent_p.P154P|CNN2_uc010drz.1_Silent_p.P45P|CNN2_uc002lqv.2_Silent_p.P154P|CNN2_uc010xgb.1_Silent_p.P182P|CNN2_uc010xgc.1_Silent_p.P214P	NM_004368	NP_004359	Q99439	CNN2_HUMAN	calponin 2 isoform a	193				RRHLYDPKNHILPPMD -> AGISMTPRTISCPPWT (in Ref. 4; BAA20887).	actomyosin structure organization|cellular response to mechanical stimulus|regulation of actin filament-based process	cell-cell junction|stress fiber	actin binding|calmodulin binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTATGACCCCAAGAACCATA	0.627													14	101	---	---	---	---	PASS
MIDN	90007	broad.mit.edu	37	19	1255491	1255491	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1255491C>T	uc002lrp.2	+	7	1442	c.927C>T	c.(925-927)ATC>ATT	p.I309I		NM_177401	NP_796375	Q504T8	MIDN_HUMAN	midnolin	309						nucleolus					0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCTGCAGATCCTGAACGACC	0.721													5	15	---	---	---	---	PASS
AP3D1	8943	broad.mit.edu	37	19	2115421	2115421	+	Intron	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2115421C>A	uc002luz.2	-						AP3D1_uc002luy.2_Intron|AP3D1_uc002lva.2_Intron	NM_003938	NP_003929	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1						eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCAGCCCTGCGGGCCGGCAG	0.577													6	18	---	---	---	---	PASS
SH2D3A	10045	broad.mit.edu	37	19	6754983	6754983	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6754983G>T	uc002mft.2	-	5	1034	c.840C>A	c.(838-840)TTC>TTA	p.F280L	SH2D3A_uc010xjg.1_Missense_Mutation_p.F158L	NM_005490	NP_005481	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	280					JNK cascade|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			breast(2)	2						CATGGGGGCAGAAAGAGATCT	0.612													89	325	---	---	---	---	PASS
INSR	3643	broad.mit.edu	37	19	7141796	7141796	+	Silent	SNP	C	G	G	rs79490496		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7141796C>G	uc002mgd.1	-	13	2683	c.2574G>C	c.(2572-2574)ACG>ACC	p.T858T	INSR_uc002mge.1_Silent_p.T846T	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	858	Fibronectin type-III 3.|Extracellular (Potential).		T -> A (in NIDDM).		activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AGATTTCATGCGTCACAGGGC	0.323													13	59	---	---	---	---	PASS
HNRNPM	4670	broad.mit.edu	37	19	8527476	8527476	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8527476G>C	uc010dwe.2	+						HNRNPM_uc010dwc.1_Intron|HNRNPM_uc010xke.1_Intron|HNRNPM_uc010dwd.2_Intron|HNRNPM_uc002mka.2_5'Flank	NM_005968	NP_005959	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding				0						GTAAGTGTCTGAGAGAATTTC	0.423													38	597	---	---	---	---	PASS
HNRNPM	4670	broad.mit.edu	37	19	8530377	8530377	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8530377G>T	uc010dwe.2	+	6	688	c.608G>T	c.(607-609)GGA>GTA	p.G203V	HNRNPM_uc010dwc.1_Missense_Mutation_p.G203V|HNRNPM_uc010xke.1_Missense_Mutation_p.G164V|HNRNPM_uc010dwd.2_Missense_Mutation_p.G164V|HNRNPM_uc002mka.2_Missense_Mutation_p.G83V	NM_005968	NP_005959	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	203					alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding				0						GGAAGACTTGGAAGCACAGTA	0.378													19	337	---	---	---	---	PASS
ADAMTS10	81794	broad.mit.edu	37	19	8651080	8651080	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8651080G>A	uc002mkj.1	-	22	2860	c.2586C>T	c.(2584-2586)GCC>GCT	p.A862A	ADAMTS10_uc002mki.1_Silent_p.A349A|ADAMTS10_uc002mkk.1_Silent_p.A494A	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	862	TSP type-1 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						AGTAGTGGGGGGCGACCGCGG	0.692											OREG0025221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	75	---	---	---	---	PASS
ZNF558	148156	broad.mit.edu	37	19	8922163	8922163	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8922163G>C	uc002mkn.1	-	6	1233	c.1003C>G	c.(1003-1005)CTT>GTT	p.L335V	ZNF558_uc010xkh.1_Missense_Mutation_p.L264V|ZNF558_uc010dwg.1_Missense_Mutation_p.L335V	NM_144693	NP_653294	Q96NG5	ZN558_HUMAN	zinc finger protein 558	335	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			central_nervous_system(1)	1						TGCACAGTAAGAGAAAAGCTA	0.433													27	440	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9002184	9002184	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9002184G>A	uc002mkp.2	-	52	40524	c.40320C>T	c.(40318-40320)TTC>TTT	p.F13440F	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.F257F|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13442	Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCTGATGGGTGAAACCTGCAT	0.507													4	69	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9002196	9002196	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9002196G>C	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AACCTGCATTGAGATGGAGGG	0.493													5	72	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9009662	9009662	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9009662G>A	uc002mkp.2	-	39	39268	c.39064C>T	c.(39064-39066)CTG>TTG	p.L13022L	MUC16_uc010dwi.2_5'Flank|MUC16_uc010dwj.2_5'Flank|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13024	Extracellular (Potential).|SEA 7.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCATACTGCAGATTGGTGATG	0.537													31	378	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9048215	9048215	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9048215G>C	uc002mkp.2	-	5	33620	c.33416C>G	c.(33415-33417)TCA>TGA	p.S11139*		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11141	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TAGAACAGCTGAGCTGGCTTC	0.468													14	219	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9048822	9048822	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9048822G>C	uc002mkp.2	-	5	33013	c.32809C>G	c.(32809-32811)CTG>GTG	p.L10937V		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10939	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTAGTGACCAGAGAGGTCACC	0.498													32	445	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9064726	9064726	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9064726C>A	uc002mkp.2	-	3	22924	c.22720G>T	c.(22720-22722)GTC>TTC	p.V7574F		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	7576	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTCCTGGAGACCTCAGTAGTA	0.507													24	446	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9072073	9072073	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9072073C>G	uc002mkp.2	-	3	15577	c.15373G>C	c.(15373-15375)GAG>CAG	p.E5125Q		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5127	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ACATTGGTCTCTTCTGTGTTT	0.438													42	480	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9085379	9085379	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9085379G>C	uc002mkp.2	-	1	6640	c.6436C>G	c.(6436-6438)CTT>GTT	p.L2146V		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2146	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GCCATTGGAAGAGGGACTTCA	0.498													37	259	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9086274	9086274	+	Silent	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9086274G>T	uc002mkp.2	-	1	5745	c.5541C>A	c.(5539-5541)CTC>CTA	p.L1847L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1847	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCCCATGGCTGAGGTCAAGTG	0.502													33	201	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9087316	9087316	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9087316G>C	uc002mkp.2	-	1	4703	c.4499C>G	c.(4498-4500)TCA>TGA	p.S1500*		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1500	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTCTGACTTTGAAAGTTCATG	0.428													118	742	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9087418	9087418	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9087418G>C	uc002mkp.2	-	1	4601	c.4397C>G	c.(4396-4398)ACA>AGA	p.T1466R		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1466	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CATTTCCTCTGTCAAACTGGT	0.473													66	405	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9087899	9087899	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9087899C>G	uc002mkp.2	-	1	4120	c.3916G>C	c.(3916-3918)GAG>CAG	p.E1306Q		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1306	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GCTGTCATCTCAGGTGAAGAC	0.498													31	388	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9087904	9087904	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9087904G>A	uc002mkp.2	-	1	4115	c.3911C>T	c.(3910-3912)TCA>TTA	p.S1304L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1304	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CATCTCAGGTGAAGACCCAGA	0.493													51	373	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9088081	9088081	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9088081G>C	uc002mkp.2	-	1	3938	c.3734C>G	c.(3733-3735)TCA>TGA	p.S1245*		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1245	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGTGTTTGTTGATTCAGGGTA	0.507													133	802	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9089023	9089023	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9089023G>C	uc002mkp.2	-	1	2996	c.2792C>G	c.(2791-2793)TCA>TGA	p.S931*		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	931	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGAACCAGTTGAGTTTGTAAC	0.498													48	238	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9089301	9089301	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9089301G>C	uc002mkp.2	-	1	2718	c.2514C>G	c.(2512-2514)CTC>CTG	p.L838L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	838	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTGGGAGGCTGAGAGTGCTAG	0.473													88	462	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9089422	9089422	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9089422G>A	uc002mkp.2	-	1	2597	c.2393C>T	c.(2392-2394)TCA>TTA	p.S798L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	798	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTCTTCCCCTGATGGAGATGG	0.522													14	798	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9090194	9090194	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9090194G>C	uc002mkp.2	-	1	1825	c.1621C>G	c.(1621-1623)CCT>GCT	p.P541A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	541	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTCATGCTAGGACTTGTCTCC	0.532													24	249	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9091309	9091309	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9091309G>A	uc002mkp.2	-	1	710	c.506C>T	c.(505-507)TCA>TTA	p.S169L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	169	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTCAGTTGTTGAGGTCTCAGT	0.443													17	329	---	---	---	---	PASS
OR7D2	162998	broad.mit.edu	37	19	9296535	9296535	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9296535C>G	uc002mkz.1	+	1	266	c.78C>G	c.(76-78)TTC>TTG	p.F26L		NM_175883	NP_787079	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D,	26	Helical; Name=1; (Potential).				regulation of transcription, DNA-dependent|sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|upper_aerodigestive_tract(1)	3						TACAGCCGTTCATATTTGGGC	0.493													7	220	---	---	---	---	PASS
ZNF562	54811	broad.mit.edu	37	19	9763789	9763789	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9763789G>C	uc010xks.1	-	6	1280	c.1117C>G	c.(1117-1119)CAG>GAG	p.Q373E	ZNF562_uc002mly.2_Missense_Mutation_p.Q373E|ZNF562_uc002mlx.2_Missense_Mutation_p.Q301E|ZNF562_uc010xkt.1_Missense_Mutation_p.Q336E|ZNF562_uc010xku.1_Missense_Mutation_p.Q304E|ZNF562_uc010xkv.1_Missense_Mutation_p.Q372E|ZNF562_uc010xkw.1_Missense_Mutation_p.Q257E	NM_001130032	NP_001123504	Q6V9R5	ZN562_HUMAN	zinc finger protein 562 isoform a	373	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCCTTACACTGATAGGGTTTC	0.423													25	671	---	---	---	---	PASS
OLFM2	93145	broad.mit.edu	37	19	9965171	9965171	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9965171C>T	uc002mmp.2	-	6	1084	c.1056G>A	c.(1054-1056)CCG>CCA	p.P352P	OLFM2_uc002mmo.2_Silent_p.P274P	NM_058164	NP_477512	O95897	NOE2_HUMAN	olfactomedin 2 precursor	352	Olfactomedin-like.					extracellular region				large_intestine(1)|skin(1)	2						CGAGGGTGTGCGGGTCCAGCC	0.642													6	284	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10104292	10104292	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10104292C>T	uc002mmq.1	-							NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein						collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			CTCACACACTCACCCTTTGGC	0.587													12	161	---	---	---	---	PASS
PPAN-P2RY11	692312	broad.mit.edu	37	19	10224736	10224736	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10224736G>C	uc002mna.2	+	13	1707	c.1707G>C	c.(1705-1707)GTG>GTC	p.V569V	PPAN-P2RY11_uc010xla.1_3'UTR|P2RY11_uc002mnc.2_Silent_p.V149V	NM_001040664	NP_001035754	Q9NQ55	SSF1_HUMAN	PPAN-P2RY11 protein	Error:Variant_position_missing_in_Q9NQ55_after_alignment					RNA splicing	nucleolus	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			CCTGGGCCGTGAGCGCTGCCG	0.682													16	95	---	---	---	---	PASS
ICAM1	3383	broad.mit.edu	37	19	10395132	10395132	+	Missense_Mutation	SNP	G	A	A	rs143008699		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10395132G>A	uc002mnq.2	+	5	1298	c.979G>A	c.(979-981)GAG>AAG	p.E327K	ICAM1_uc010xle.1_Missense_Mutation_p.E105K|ICAM4_uc002mnr.1_5'Flank|ICAM4_uc002mns.1_5'Flank|ICAM4_uc002mnt.1_5'Flank	NM_000201	NP_000192	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1 precursor	327	Ig-like C2-type 4.|Extracellular (Potential).				adhesion to symbiont|heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking|positive regulation of cellular extravasation|regulation of immune response|regulation of leukocyte mediated cytotoxicity|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell|virion attachment, binding of host cell surface receptor	extracellular space|integral to plasma membrane	integrin binding|transmembrane receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Natalizumab(DB00108)|Simvastatin(DB00641)	AGAAGGGACCGAGGTGACAGT	0.642													23	333	---	---	---	---	PASS
ICAM5	7087	broad.mit.edu	37	19	10403472	10403472	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10403472C>G	uc002mnu.3	+	5	1211	c.1146C>G	c.(1144-1146)TTC>TTG	p.F382L	ICAM5_uc002mnv.3_Missense_Mutation_p.F257L	NM_003259	NP_003250	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5 precursor	382	Extracellular (Potential).|Ig-like C2-type 4.				cell-cell adhesion	integral to plasma membrane				breast(3)	3			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			GCAGCTTCTTCTGCGACGCCA	0.622													19	181	---	---	---	---	PASS
ATG4D	84971	broad.mit.edu	37	19	10657529	10657529	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10657529G>A	uc002mov.2	+	4	628	c.508G>A	c.(508-510)GAG>AAG	p.E170K	ATG4D_uc010xlg.1_Missense_Mutation_p.E193K|ATG4D_uc010xlh.1_Missense_Mutation_p.E107K|ATG4D_uc010dxh.2_RNA|ATG4D_uc010dxi.2_Intron|ATG4D_uc010dxj.2_Intron	NM_032885	NP_116274	Q86TL0	ATG4D_HUMAN	APG4 autophagy 4 homolog D	170					autophagy|protein transport	cytoplasm	cysteine-type endopeptidase activity				0			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			GACATGGGCCGAGGGCATGGG	0.647													13	198	---	---	---	---	PASS
YIPF2	78992	broad.mit.edu	37	19	11034586	11034586	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11034586C>G	uc002mqb.2	-	7	698	c.574G>C	c.(574-576)GAG>CAG	p.E192Q	YIPF2_uc002mqc.2_Missense_Mutation_p.E192Q	NM_024029	NP_076934	Q9BWQ6	YIPF2_HUMAN	Yip1 domain family, member 2	192	Cytoplasmic (Potential).					integral to membrane|transport vesicle					0						CCCATGCGCTCCTGGACACCC	0.647													4	58	---	---	---	---	PASS
SMARCA4	6597	broad.mit.edu	37	19	11144055	11144055	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11144055G>C	uc002mqf.3	+	26	3920	c.3636G>C	c.(3634-3636)GAG>GAC	p.E1212D	SMARCA4_uc010dxp.2_Missense_Mutation_p.E1212D|SMARCA4_uc010dxo.2_Missense_Mutation_p.E1212D|SMARCA4_uc010dxq.2_Missense_Mutation_p.E1212D|SMARCA4_uc010dxr.2_Missense_Mutation_p.E1212D|SMARCA4_uc002mqj.3_Missense_Mutation_p.E1212D|SMARCA4_uc010dxs.2_Missense_Mutation_p.E1212D|SMARCA4_uc010dxt.1_Missense_Mutation_p.E432D|SMARCA4_uc002mqh.3_Missense_Mutation_p.E335D|SMARCA4_uc002mqi.1_Missense_Mutation_p.E415D	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated	1212	Helicase C-terminal.				chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity			lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GCGTGGAGGAGAAGATCCTAG	0.632			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				6	412	---	---	---	---	PASS
LDLR	3949	broad.mit.edu	37	19	11215973	11215973	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11215973G>C	uc002mqk.3	+	4	559	c.391G>C	c.(391-393)GAC>CAC	p.D131H	LDLR_uc010xlk.1_Missense_Mutation_p.D131H|LDLR_uc010xll.1_Missense_Mutation_p.D90H|LDLR_uc010xlm.1_Intron|LDLR_uc010xln.1_Intron|LDLR_uc010xlo.1_Intron	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	131	Extracellular (Potential).|LDL-receptor class A 3.				cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)	CTGTGACTCAGACCGGGACTG	0.642													103	723	---	---	---	---	PASS
KANK2	25959	broad.mit.edu	37	19	11280562	11280562	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11280562G>C	uc010dxv.2	-	14	3051	c.2493C>G	c.(2491-2493)ATC>ATG	p.I831M	KANK2_uc002mqm.2_Missense_Mutation_p.I839M|KANK2_uc002mqo.3_Missense_Mutation_p.I831M|KANK2_uc002mqp.1_Missense_Mutation_p.I640M	NM_015493	NP_056308	Q63ZY3	KANK2_HUMAN	ankyrin repeat domain 25 isoform 1	831	ANK 5.										0						CCGAGCACTTGATGTTCATGC	0.478													10	170	---	---	---	---	PASS
RGL3	57139	broad.mit.edu	37	19	11517430	11517430	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11517430C>T	uc002mrp.2	-	6	812	c.748G>A	c.(748-750)GAG>AAG	p.E250K	RGL3_uc002mrn.2_Missense_Mutation_p.E14K|RGL3_uc002mrm.2_Missense_Mutation_p.E14K|RGL3_uc002mro.2_Missense_Mutation_p.E250K	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation	250	Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						TCGGCCACCTCGTCCACGCTG	0.602													4	57	---	---	---	---	PASS
ZNF491	126069	broad.mit.edu	37	19	11917204	11917204	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11917204T>C	uc002mso.1	+	3	721	c.436T>C	c.(436-438)TAC>CAC	p.Y146H		NM_152356	NP_689569	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	146	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						TCTCAGTTTATACCTTACCCA	0.408													26	112	---	---	---	---	PASS
PODNL1	79883	broad.mit.edu	37	19	14044810	14044810	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14044810G>C	uc002mxr.2	-						PODNL1_uc010xni.1_Intron|PODNL1_uc010xnj.1_Intron|PODNL1_uc002mxs.2_Intron	NM_024825	NP_079101	Q6PEZ8	PONL1_HUMAN	podocan-like 1 isoform 1							proteinaceous extracellular matrix				central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			GATTGTTCTGGAGAAGGAAGA	0.577													5	9	---	---	---	---	PASS
LPHN1	22859	broad.mit.edu	37	19	14262404	14262404	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14262404C>G	uc010xnn.1	-	24	4002	c.3706G>C	c.(3706-3708)GCC>CCC	p.A1236P	LPHN1_uc010xno.1_Missense_Mutation_p.A1231P|uc002myf.2_Intron	NM_001008701	NP_001008701	O94910	LPHN1_HUMAN	latrophilin 1 isoform 1 precursor	1236	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			ovary(2)|lung(2)|central_nervous_system(1)	5						ATGCCACAGGCTTCCCGGCCT	0.642													27	128	---	---	---	---	PASS
AKAP8	10270	broad.mit.edu	37	19	15465941	15465941	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15465941C>T	uc002nav.2	-	14	1925	c.1864G>A	c.(1864-1866)GAA>AAA	p.E622K	AKAP8_uc010dzy.2_Missense_Mutation_p.E171K	NM_005858	NP_005849	O43823	AKAP8_HUMAN	A-kinase anchor protein 8	622					signal transduction	nuclear matrix				ovary(1)|breast(1)	2						AGCAGCTGTTCGGCTTGAGGA	0.657													12	67	---	---	---	---	PASS
RASAL3	64926	broad.mit.edu	37	19	15575156	15575156	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15575156G>T	uc002nbe.2	-	2	100	c.14C>A	c.(13-15)TCG>TAG	p.S5*		NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	5					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						CCGGCTTGGCGACGGTGGGTC	0.602													4	7	---	---	---	---	PASS
CYP4F12	66002	broad.mit.edu	37	19	15807231	15807231	+	Intron	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15807231C>A	uc002nbl.2	+							NM_023944	NP_076433			cytochrome P450, family 4, subfamily F,											skin(3)|ovary(2)|central_nervous_system(2)	7	Acute lymphoblastic leukemia(2;0.0367)					TTCTTTGTCTCACCTGCAGGT	0.527													6	187	---	---	---	---	PASS
OR10H2	26538	broad.mit.edu	37	19	15839699	15839699	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15839699C>A	uc002nbm.2	+	1	866	c.846C>A	c.(844-846)CTC>CTA	p.L282L		NM_013939	NP_039227	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H,	282	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					ACGCAGTCCTCACGCCCTTCC	0.547													19	114	---	---	---	---	PASS
CHERP	10523	broad.mit.edu	37	19	16641589	16641589	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16641589C>A	uc002nei.1	-	6	851	c.777G>T	c.(775-777)AAG>AAT	p.K259N	MED26_uc002nee.2_Intron	NM_006387	NP_006378	Q8IWX8	CHERP_HUMAN	calcium homeostasis endoplasmic reticulum	259	CID.				cellular calcium ion homeostasis|negative regulation of cell proliferation|nervous system development|RNA processing	endoplasmic reticulum|perinuclear region of cytoplasm	RNA binding			ovary(2)	2						CCCGGGCGATCTTCTGCTGCT	0.692													18	34	---	---	---	---	PASS
NWD1	284434	broad.mit.edu	37	19	16910739	16910739	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16910739G>A	uc002neu.3	+	17	3924	c.3502G>A	c.(3502-3504)GAA>AAA	p.E1168K	NWD1_uc002net.3_Missense_Mutation_p.E1033K|NWD1_uc002nev.3_Missense_Mutation_p.E962K			Q149M9	NWD1_HUMAN	RecName: Full=NACHT and WD repeat domain-containing protein 1;	1168	WD 9.						ATP binding			skin(3)|ovary(2)|pancreas(2)	7						GGACATCCTGGAAGGCGTCGG	0.592													7	62	---	---	---	---	PASS
MYO9B	4650	broad.mit.edu	37	19	17312971	17312971	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17312971G>C	uc010eak.2	+	28	4847	c.4695G>C	c.(4693-4695)CTG>CTC	p.L1565L	MYO9B_uc002nfi.2_Silent_p.L1565L|MYO9B_uc002nfj.1_Silent_p.L1565L|MYO9B_uc002nfl.1_Silent_p.L114L	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	1565	Tail.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						ACAAGGATCTGATGGAGAACT	0.577													8	36	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17743637	17743637	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17743637C>T	uc002nhd.2	-	28	3646	c.3646G>A	c.(3646-3648)GTG>ATG	p.V1216M		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	1128	MHD1.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						AGTTCCGTCACATACTCATTG	0.552													50	115	---	---	---	---	PASS
RAB3A	5864	broad.mit.edu	37	19	18313413	18313413	+	Silent	SNP	C	A	A	rs144222621		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18313413C>A	uc002nie.2	-	2	307	c.138G>T	c.(136-138)TCG>TCT	p.S46S		NM_002866	NP_002857	P20336	RAB3A_HUMAN	RAB3A, member RAS oncogene family	46					glutamate secretion|protein transport|small GTPase mediated signal transduction	clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|plasma membrane|synaptic vesicle	GTP binding|GTPase activity				0						CAGGCGTGAACGAGTCGTCAG	0.542											OREG0025360	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	198	---	---	---	---	PASS
LSM4	25804	broad.mit.edu	37	19	18423448	18423448	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18423448T>C	uc002niq.2	-	3	281	c.110A>G	c.(109-111)AAC>AGC	p.N37S		NM_012321	NP_036453	Q9Y4Z0	LSM4_HUMAN	U6 snRNA-associated Sm-like protein 4	37					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|mRNA processing|RNA splicing	cytosol|U6 snRNP	protein binding|RNA binding				0						CAGGTTAATGTTCATCCAGTT	0.582													57	120	---	---	---	---	PASS
CILP2	148113	broad.mit.edu	37	19	19655002	19655002	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19655002G>C	uc002nmv.3	+	8	1733	c.1648G>C	c.(1648-1650)GAG>CAG	p.E550Q	CILP2_uc002nmw.3_Missense_Mutation_p.E556Q	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	550						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1						CGTGTACCACGAGGTCAAGGC	0.617													20	156	---	---	---	---	PASS
CILP2	148113	broad.mit.edu	37	19	19655137	19655137	+	Missense_Mutation	SNP	G	C	C	rs147931006		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19655137G>C	uc002nmv.3	+	8	1868	c.1783G>C	c.(1783-1785)GAC>CAC	p.D595H	CILP2_uc002nmw.3_Missense_Mutation_p.D601H	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	595						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1						CCGCAGAGCCGACGGCAAACC	0.672													22	153	---	---	---	---	PASS
ZNF429	353088	broad.mit.edu	37	19	21719720	21719720	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21719720G>C	uc002nqd.1	+	4	1002	c.865G>C	c.(865-867)GAA>CAA	p.E289Q	ZNF429_uc010ecu.1_Intron	NM_001001415	NP_001001415	Q86V71	ZN429_HUMAN	zinc finger protein 429	289	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CAAATGTGATGAATGTGGCAA	0.378													11	92	---	---	---	---	PASS
ZNF100	163227	broad.mit.edu	37	19	21910188	21910188	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21910188C>G	uc002nqi.2	-	5	1125	c.926G>C	c.(925-927)AGA>ACA	p.R309T	ZNF100_uc002nqh.2_Missense_Mutation_p.R245T	NM_173531	NP_775802	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	309	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGTATGAATTCTTTTATGTGT	0.388													55	118	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22154213	22154213	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22154213C>A	uc002nqp.2	-	6	3388	c.3239G>T	c.(3238-3240)TGG>TTG	p.W1080L	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				GGTTGAGGGCCACTTATAGGC	0.393													17	78	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22157406	22157406	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22157406C>T	uc002nqp.2	-	4	579	c.430G>A	c.(430-432)GTA>ATA	p.V144I	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				CGTTGAAATACTTTGCTCTGT	0.318													29	175	---	---	---	---	PASS
ZNF492	57615	broad.mit.edu	37	19	22846700	22846700	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22846700G>A	uc002nqw.3	+	4	473	c.229G>A	c.(229-231)GAA>AAA	p.E77K		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	77					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				ATGTGGATGTGAAAATTTACA	0.348													8	25	---	---	---	---	PASS
ZNF675	171392	broad.mit.edu	37	19	23836981	23836981	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23836981G>A	uc002nri.2	-	4	936	c.754C>T	c.(754-756)CGA>TGA	p.R252*		NM_138330	NP_612203	Q8TD23	ZN675_HUMAN	zinc finger protein 675	252					bone resorption|cytokine-mediated signaling pathway|hemopoiesis|I-kappaB kinase/NF-kappaB cascade|negative regulation of JNK cascade|negative regulation of osteoclast differentiation|negative regulation of protein kinase activity|negative regulation of transcription, DNA-dependent|regulation of ossification|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GGTTTCTCTCGAGCATAATCT	0.333													6	141	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31768443	31768443	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31768443C>G	uc002nsy.3	-	2	2321	c.2256G>C	c.(2254-2256)AAG>AAC	p.K752N		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	752					negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					TGTTGCTCATCTTGAAAAGCA	0.602													4	135	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31770267	31770267	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31770267C>T	uc002nsy.3	-	2	497	c.432G>A	c.(430-432)GAG>GAA	p.E144E		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	144	Ser-rich.				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					cgttgTTCTTCTCCGAGGAGG	0.438													9	19	---	---	---	---	PASS
ZNF507	22847	broad.mit.edu	37	19	32844814	32844814	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32844814G>C	uc002nte.2	+	3	1350	c.1078G>C	c.(1078-1080)GAA>CAA	p.E360Q	ZNF507_uc002ntc.2_Missense_Mutation_p.E360Q|ZNF507_uc010xrn.1_Missense_Mutation_p.E360Q|ZNF507_uc002ntd.2_Missense_Mutation_p.E360Q	NM_001136156	NP_001129628	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	360					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)|kidney(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(110;0.162)					CAATGAGGAAGAAATGCTAGA	0.438													28	175	---	---	---	---	PASS
ANKRD27	84079	broad.mit.edu	37	19	33117720	33117720	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33117720G>C	uc002ntn.1	-	16	1590	c.1434C>G	c.(1432-1434)CTC>CTG	p.L478L		NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	478	ANK 2.				early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					GGAGGTCGATGAGGGATGCCT	0.572													8	31	---	---	---	---	PASS
ZNF181	339318	broad.mit.edu	37	19	35232200	35232200	+	Missense_Mutation	SNP	T	G	G	rs143797666		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35232200T>G	uc002nvu.3	+	4	1377	c.914T>G	c.(913-915)GTC>GGC	p.V305G	ZNF181_uc010xsa.1_Missense_Mutation_p.V304G|ZNF181_uc010xsb.1_Missense_Mutation_p.V304G|ZNF181_uc010xsc.1_Missense_Mutation_p.V240G	NM_001029997	NP_001025168	Q2M3W8	ZN181_HUMAN	zinc finger protein 181 isoform 1	305	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTTAGCCATGTCTCATCACTT	0.413													5	260	---	---	---	---	PASS
ATP4A	495	broad.mit.edu	37	19	36054161	36054161	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36054161G>C	uc002oal.1	-	3	195	c.166C>G	c.(166-168)CAG>GAG	p.Q56E		NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	56	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	ACTGACAGCTGGTGGTCGTTC	0.592													11	305	---	---	---	---	PASS
RBM42	79171	broad.mit.edu	37	19	36123829	36123829	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36123829C>G	uc002oan.2	+						RBM42_uc010eef.2_Intron|RBM42_uc002oao.2_Intron|RBM42_uc002oap.2_Intron|RBM42_uc002oaq.2_Intron|RBM42_uc010eeg.2_Intron	NM_024321	NP_077297	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42							cytoplasm|nucleus	nucleotide binding|RNA binding				0	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCATCTCTCTCTCCCACAGCT	0.532													14	75	---	---	---	---	PASS
MLL4	9757	broad.mit.edu	37	19	36227820	36227820	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36227820G>A	uc010eei.2	+	33	7305	c.7305G>A	c.(7303-7305)TGG>TGA	p.W2435*		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	2435	FYR C-terminal.				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAGGGGCGTGGAGAACTCTGA	0.607													10	74	---	---	---	---	PASS
APLP1	333	broad.mit.edu	37	19	36370332	36370332	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36370332G>C	uc002oce.2	+	17	2080	c.1942G>C	c.(1942-1944)GAA>CAA	p.E648Q	APLP1_uc010xsz.1_Missense_Mutation_p.E609Q|APLP1_uc002ocf.2_Missense_Mutation_p.E649Q|APLP1_uc002ocg.2_Missense_Mutation_p.E552Q|APLP1_uc010xta.1_Missense_Mutation_p.E642Q	NM_005166	NP_005157	P51693	APLP1_HUMAN	amyloid precursor-like protein 1 isoform 2	648	Cytoplasmic (Potential).				apoptosis|cell adhesion|cellular response to norepinephrine stimulus|endocytosis|negative regulation of cAMP biosynthetic process|nervous system development|organ morphogenesis	basement membrane|integral to membrane|perinuclear region of cytoplasm|plasma membrane	alpha-2A adrenergic receptor binding|alpha-2B adrenergic receptor binding|alpha-2C adrenergic receptor binding|heparin binding|identical protein binding|metal ion binding			ovary(2)	2	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTTCCTGGAGGAACGACCCTG	0.662													5	136	---	---	---	---	PASS
ZNF829	374899	broad.mit.edu	37	19	37383109	37383109	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37383109C>G	uc002ofa.1	-	6	946	c.584G>C	c.(583-585)CGT>CCT	p.R195P	ZNF345_uc002oez.2_Intron	NM_001037232	NP_001032309	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	195	C2H2-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAGTGAGCCACGACTAAAGGA	0.368													56	89	---	---	---	---	PASS
ZNF573	126231	broad.mit.edu	37	19	38229665	38229665	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38229665G>C	uc002ohe.2	-	4	1748	c.1726C>G	c.(1726-1728)CAT>GAT	p.H576D	ZNF573_uc010efs.2_Missense_Mutation_p.H489D|ZNF573_uc002ohd.2_Missense_Mutation_p.H574D|ZNF573_uc002ohf.2_Missense_Mutation_p.H518D|ZNF573_uc002ohg.2_Missense_Mutation_p.H488D	NM_152360	NP_689573	Q86YE8	ZN573_HUMAN	zinc finger protein 573	556	C2H2-type 16.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			TTATCAGCATGAATGCTCTGA	0.373													30	212	---	---	---	---	PASS
CATSPERG	57828	broad.mit.edu	37	19	38853195	38853195	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38853195C>G	uc002oih.3	+	19	2424	c.2337C>G	c.(2335-2337)TTC>TTG	p.F779L	CATSPERG_uc002oig.3_Missense_Mutation_p.F739L|CATSPERG_uc002oif.3_Missense_Mutation_p.F419L|CATSPERG_uc010efw.2_RNA	NM_021185	NP_067008	Q6ZRH7	CTSRG_HUMAN	cation channel, sperm-associated, gamma	779	Extracellular (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)|skin(1)	2						GCCACTCGTTCCGGACGCAGT	0.657													14	91	---	---	---	---	PASS
RASGRP4	115727	broad.mit.edu	37	19	38905767	38905767	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38905767G>C	uc002oir.2	-						RASGRP4_uc010efz.1_Intron|RASGRP4_uc010ega.1_Intron|RASGRP4_uc010xua.1_Intron|RASGRP4_uc010xub.1_Intron|RASGRP4_uc010xuc.1_Intron|RASGRP4_uc010xud.1_Intron|RASGRP4_uc010xue.1_Intron|RASGRP4_uc010egb.2_Intron	NM_170604	NP_733749	Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4 isoform a						activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity			pancreas(1)|lung(1)|skin(1)	3	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGAGGGCCTGGGGAGGAGGGA	0.652													9	7	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38934255	38934255	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38934255C>A	uc002oit.2	+	4	458	c.328C>A	c.(328-330)CAT>AAT	p.H110N	RYR1_uc002oiu.2_Missense_Mutation_p.H110N	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	110	Cytoplasmic.|MIR 1.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CCTGCTCCGGCATGCACACAG	0.647													8	58	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38991553	38991553	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38991553G>T	uc002oit.2	+	47	7667	c.7537G>T	c.(7537-7539)GAG>TAG	p.E2513*	RYR1_uc002oiu.2_Nonsense_Mutation_p.E2513*|RYR1_uc002oiv.1_5'UTR	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2513	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GTATGGCATCGAGAACCAGGA	0.632													14	77	---	---	---	---	PASS
MAP4K1	11184	broad.mit.edu	37	19	39086203	39086203	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39086203G>A	uc002oix.1	-						MAP4K1_uc002oiw.1_Intron|MAP4K1_uc002oiy.1_Intron	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TAGCTGGGGAGAAAGCAATGC	0.597													43	65	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40362766	40362766	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40362766G>C	uc002omp.3	-	32	15312	c.15304C>G	c.(15304-15306)CAG>GAG	p.Q5102E		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	5102						extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCAGCTGCCTGACAGGCCGCC	0.637													7	76	---	---	---	---	PASS
ZNF780A	284323	broad.mit.edu	37	19	40580841	40580841	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40580841C>G	uc002omy.2	-	6	1733	c.1508G>C	c.(1507-1509)TGT>TCT	p.C503S	ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Missense_Mutation_p.C503S|ZNF780A_uc010xvh.1_Missense_Mutation_p.C504S	NM_001010880	NP_001010880	O75290	Z780A_HUMAN	zinc finger protein 780A isoform b	503	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					ACACTCCTTACATTCATAGGG	0.428													9	264	---	---	---	---	PASS
PRX	57716	broad.mit.edu	37	19	40902216	40902216	+	Silent	SNP	G	C	C	rs56743160	byFrequency	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40902216G>C	uc002onr.2	-	7	2312	c.2043C>G	c.(2041-2043)CCC>CCG	p.P681P	PRX_uc002onq.2_Silent_p.P542P|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	681	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTGCACCTCGGGGAGTCGAA	0.582													8	362	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41063159	41063159	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41063159C>G	uc002ony.2	+	26	5606	c.5520C>G	c.(5518-5520)TTC>TTG	p.F1840L	SPTBN4_uc002onx.2_Missense_Mutation_p.F1840L|SPTBN4_uc002onz.2_Missense_Mutation_p.F1840L|SPTBN4_uc010egx.2_Missense_Mutation_p.F583L|SPTBN4_uc002ooa.2_Missense_Mutation_p.F516L	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	1840	Spectrin 16.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ATAAGTTCTTCAGTGACGCCC	0.652													18	51	---	---	---	---	PASS
RAB4B	53916	broad.mit.edu	37	19	41285940	41285940	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41285940C>G	uc002opd.1	+	2	143	c.33C>G	c.(31-33)TTC>TTG	p.F11L	MIA_uc010xvt.1_RNA|RAB4B_uc002opc.1_RNA|RAB4B_uc002ope.1_RNA|EGLN2_uc010ehd.2_5'UTR|RAB4B_uc002opf.1_Missense_Mutation_p.F37L	NM_016154	NP_057238	P61018	RAB4B_HUMAN	ras-related GTP-binding protein 4b	11					protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	intracellular|plasma membrane	GTP binding|GTPase activity			skin(1)	1			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			TCTTCAAATTCCTGGTGATTG	0.468													9	183	---	---	---	---	PASS
CYP2S1	29785	broad.mit.edu	37	19	41707208	41707208	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41707208G>T	uc002opw.2	+	6	962	c.907G>T	c.(907-909)GGG>TGG	p.G303W	CYP2F1_uc010xvw.1_Intron|CYP2S1_uc010xvx.1_Missense_Mutation_p.G28W	NM_030622	NP_085125	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S,	303					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity			skin(1)	1						GCTGTTTGCTGGGACGATGAC	0.507													43	236	---	---	---	---	PASS
CEACAM5	1048	broad.mit.edu	37	19	42213743	42213743	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42213743G>C	uc002ork.2	+	2	330	c.209G>C	c.(208-210)GGT>GCT	p.G70A	CEACAM5_uc010ehz.1_Missense_Mutation_p.G70A|CEACAM5_uc002orj.1_Missense_Mutation_p.G70A|CEACAM5_uc002orl.2_Missense_Mutation_p.G70A	NM_004363	NP_004354	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion	70	Ig-like 1.					anchored to membrane|basolateral plasma membrane|integral to plasma membrane				skin(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		TGGTACAAAGGTGAAAGAGTG	0.483													33	128	---	---	---	---	PASS
LIPE	3991	broad.mit.edu	37	19	42910326	42910326	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42910326G>C	uc002otr.2	-	7	2629	c.2352C>G	c.(2350-2352)GTC>GTG	p.V784V	uc010eif.1_Intron	NM_005357	NP_005348	Q05469	LIPS_HUMAN	hormone-sensitive lipase	784					cholesterol metabolic process|protein phosphorylation|triglyceride catabolic process	caveola|cytosol	hormone-sensitive lipase activity|protein binding			ovary(1)|breast(1)	2		Prostate(69;0.00682)				CATAGGCGCTGACACACTTGG	0.488													13	79	---	---	---	---	PASS
APOC2	344	broad.mit.edu	37	19	45452058	45452058	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45452058G>C	uc002pah.2	+	3	259	c.156G>C	c.(154-156)AAG>AAC	p.K52N		NM_000483	NP_000474	P02655	APOC2_HUMAN	apolipoprotein C-II precursor	52					cholesterol efflux|chylomicron remnant clearance|high-density lipoprotein particle clearance|lipid catabolic process|lipoprotein metabolic process|negative regulation of cholesterol transport|negative regulation of lipid metabolic process|negative regulation of receptor-mediated endocytosis|negative regulation of very-low-density lipoprotein particle clearance|phospholipid efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of phospholipase activity|positive regulation of phospholipid catabolic process|positive regulation of triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	chylomicron|intermediate-density lipoprotein particle|low-density lipoprotein particle|spherical high-density lipoprotein particle|very-low-density lipoprotein particle	lipase inhibitor activity|lipid binding|lipoprotein lipase activator activity|phospholipase activator activity|phospholipase binding|protein homodimerization activity			kidney(1)	1	Lung NSC(12;0.00858)|all_lung(12;0.0197)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)		AGTCAGCAAAGACAGCCGCCC	0.572													87	81	---	---	---	---	PASS
MARK4	57787	broad.mit.edu	37	19	45803085	45803085	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45803085G>C	uc002pbb.1	+	16	1899	c.1894G>C	c.(1894-1896)GAG>CAG	p.E632Q	MARK4_uc002pba.1_Silent_p.L658L			Q96L34	MARK4_HUMAN	RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;	632					microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		AGACGAACCTGAGAGAATCGG	0.622													11	39	---	---	---	---	PASS
NPAS1	4861	broad.mit.edu	37	19	47548655	47548655	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47548655C>T	uc002pfw.2	+	12	1715	c.1519C>T	c.(1519-1521)CCG>TCG	p.P507S	NPAS1_uc002pfx.2_Missense_Mutation_p.P332S|NPAS1_uc002pfy.2_Missense_Mutation_p.P507S|NPAS1_uc010xyj.1_3'UTR	NM_002517	NP_002508	Q99742	NPAS1_HUMAN	neuronal PAS domain protein 1	507					central nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0		all_cancers(25;4.31e-08)|all_epithelial(76;2.96e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.102)		all cancers(93;6.02e-05)|OV - Ovarian serous cystadenocarcinoma(262;7.35e-05)|Epithelial(262;0.00389)|GBM - Glioblastoma multiforme(486;0.0252)		GAAGCAGGATCCGGTGCGGCC	0.741													30	18	---	---	---	---	PASS
CA11	770	broad.mit.edu	37	19	49142645	49142645	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49142645G>C	uc002pjz.1	-	7	1274	c.712C>G	c.(712-714)CAG>GAG	p.Q238E	SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|DBP_uc002pjx.3_5'Flank|DBP_uc002pjy.2_5'Flank|DBP_uc010elz.1_5'Flank	NM_001217	NP_001208	O75493	CAH11_HUMAN	carbonic anhydrase XI precursor	238						extracellular region					0		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)		AGAGAGCCCTGATAGGTGATG	0.562													3	72	---	---	---	---	PASS
CA11	770	broad.mit.edu	37	19	49143373	49143373	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49143373G>C	uc002pjz.1	-	4	1012	c.450C>G	c.(448-450)AAC>AAG	p.N150K	SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|DBP_uc002pjx.3_5'Flank|DBP_uc002pjy.2_5'Flank|DBP_uc010elz.1_5'Flank	NM_001217	NP_001208	O75493	CAH11_HUMAN	carbonic anhydrase XI precursor	150						extracellular region					0		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)		AGCCCTGGTGGTTGATCTGAT	0.587													10	87	---	---	---	---	PASS
IZUMO1	284359	broad.mit.edu	37	19	49246789	49246789	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49246789G>C	uc002pkj.2	-						RASIP1_uc002pki.2_5'Flank|IZUMO1_uc010eme.2_Intron|IZUMO1_uc010emf.2_Intron	NM_182575	NP_872381	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1 precursor						fusion of sperm to egg plasma membrane	integral to membrane				ovary(1)	1		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		ACACCTGGAGGGGCAGGGTCA	0.527													14	46	---	---	---	---	PASS
CGB7	94027	broad.mit.edu	37	19	49557573	49557573	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49557573G>C	uc002pmd.2	-	3	838	c.473C>G	c.(472-474)TCA>TGA	p.S158*	CGB_uc010yad.1_Intron|CGB8_uc002pmc.2_Intron|CGB7_uc002pme.2_Nonsense_Mutation_p.S158*	NM_033142	NP_149133	P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 7	158					apoptosis|cell-cell signaling|cellular nitrogen compound metabolic process|female gamete generation|hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Choriogonadotropin alfa(DB00097)	CGGGGTGTCTGAGGGCCCCGG	0.627													3	125	---	---	---	---	PASS
TRPM4	54795	broad.mit.edu	37	19	49675295	49675295	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49675295C>T	uc002pmw.2	+	9	1152	c.1080C>T	c.(1078-1080)CTC>CTT	p.L360L	TRPM4_uc010emu.2_Silent_p.L360L|TRPM4_uc010yak.1_5'UTR|TRPM4_uc002pmx.2_Silent_p.L186L|TRPM4_uc010emv.2_Silent_p.L245L|TRPM4_uc010yal.1_Intron	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,	360	Cytoplasmic (Potential).				dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		GGAAGGAGCTCCTGACAGTCT	0.537													17	71	---	---	---	---	PASS
TRPM4	54795	broad.mit.edu	37	19	49675296	49675296	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49675296C>T	uc002pmw.2	+	9	1153	c.1081C>T	c.(1081-1083)CTG>TTG	p.L361L	TRPM4_uc010emu.2_Silent_p.L361L|TRPM4_uc010yak.1_5'UTR|TRPM4_uc002pmx.2_Silent_p.L187L|TRPM4_uc010emv.2_Silent_p.L246L|TRPM4_uc010yal.1_Intron	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,	361	Cytoplasmic (Potential).				dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		GAAGGAGCTCCTGACAGTCTA	0.537													18	72	---	---	---	---	PASS
TBC1D17	79735	broad.mit.edu	37	19	50387614	50387614	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50387614C>T	uc002pqo.2	+	11	1383	c.1231C>T	c.(1231-1233)CAC>TAC	p.H411Y	TBC1D17_uc010ybg.1_Missense_Mutation_p.H378Y|TBC1D17_uc002pqp.2_Missense_Mutation_p.H62Y|TBC1D17_uc002pqq.1_RNA|TBC1D17_uc002pqr.2_Missense_Mutation_p.H62Y|TBC1D17_uc002pqs.2_RNA	NM_024682	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	411	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		CTGCATGTATCACTTCGACCT	0.662													7	344	---	---	---	---	PASS
SIGLEC8	27181	broad.mit.edu	37	19	51955867	51955867	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51955867C>A	uc002pwt.2	-	7	1333	c.1266G>T	c.(1264-1266)TGG>TGT	p.W422C	SIGLEC8_uc010yda.1_Missense_Mutation_p.W313C|SIGLEC8_uc002pwu.2_Intron|SIGLEC8_uc010eox.2_Missense_Mutation_p.W329C	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	422	Cytoplasmic (Potential).				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		TGCCATCTTTCCAGGATTCAG	0.587													12	54	---	---	---	---	PASS
ZNF615	284370	broad.mit.edu	37	19	52496580	52496580	+	Silent	SNP	G	A	A	rs147050024		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52496580G>A	uc002pye.1	-	6	2041	c.1749C>T	c.(1747-1749)CTC>CTT	p.L583L	ZNF615_uc002pyf.1_Silent_p.L594L|ZNF615_uc002pyg.1_Silent_p.L475L|ZNF615_uc002pyh.1_Silent_p.L594L|ZNF615_uc010epi.1_Silent_p.L590L|ZNF615_uc010ydg.1_Silent_p.L588L	NM_198480	NP_940882	Q8N8J6	ZN615_HUMAN	zinc finger protein 615	583	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		GATGTGCAATGAGCATGCTTT	0.438													5	273	---	---	---	---	PASS
PPP2R1A	5518	broad.mit.edu	37	19	52725424	52725424	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52725424G>C	uc002pyp.2	+	13	1750	c.1591G>C	c.(1591-1593)GAC>CAC	p.D531H	PPP2R1A_uc010ydk.1_Missense_Mutation_p.D476H|PPP2R1A_uc002pyq.2_Missense_Mutation_p.D352H	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein	531	PP2A subunit C binding.|HEAT 14.				ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CATGGCTGGGGACCCGGTTGC	0.607			Mis		clear cell ovarian carcinoma								5	37	---	---	---	---	PASS
ZNF665	79788	broad.mit.edu	37	19	53667918	53667918	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53667918G>T	uc010eqm.1	-	4	1925	c.1825C>A	c.(1825-1827)CAA>AAA	p.Q609K		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	544	C2H2-type 16.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)		TGTGAATTTTGAGTGAAGACC	0.398													36	141	---	---	---	---	PASS
CNOT3	4849	broad.mit.edu	37	19	54659157	54659157	+	3'UTR	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54659157C>T	uc002qdj.1	+	18					CNOT3_uc002qdi.2_3'UTR|CNOT3_uc002qdk.1_3'UTR|CNOT3_uc010ere.1_RNA	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					ACCGGCCCCTCCCTCTACCCA	0.657													3	9	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55147045	55147045	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55147045G>A	uc002qgj.2	+	14	1975	c.1635G>A	c.(1633-1635)GTG>GTA	p.V545V	LILRB1_uc010erp.1_Silent_p.V160V|LILRB1_uc002qgl.2_Silent_p.V545V|LILRB1_uc002qgk.2_Silent_p.V546V|LILRB1_uc002qgm.2_Silent_p.V546V|LILRB1_uc010erq.2_Silent_p.V529V|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	545	Cytoplasmic (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		AGGATGGGGTGGAGATGGACA	0.612										HNSCC(37;0.09)			35	122	---	---	---	---	PASS
FCAR	2204	broad.mit.edu	37	19	55396759	55396759	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55396759G>A	uc002qhr.1	+	3	380	c.183G>A	c.(181-183)ATG>ATA	p.M61I	FCAR_uc002qhq.2_Missense_Mutation_p.M61I|FCAR_uc002qhs.1_RNA|FCAR_uc002qht.1_Missense_Mutation_p.M34I|FCAR_uc010esi.1_Missense_Mutation_p.M34I|FCAR_uc002qhu.1_Missense_Mutation_p.M61I|FCAR_uc002qhv.1_Missense_Mutation_p.M61I|FCAR_uc002qhw.1_Missense_Mutation_p.M49I|FCAR_uc002qhx.1_Missense_Mutation_p.M49I|FCAR_uc002qhy.1_Missense_Mutation_p.M49I|FCAR_uc002qhz.1_Missense_Mutation_p.M49I|FCAR_uc002qia.1_Intron	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor	61	Extracellular (Potential).|Ig-like C2-type 1.				immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		CCCAGCTGATGATCATAAAAA	0.468													12	71	---	---	---	---	PASS
TNNI3	7137	broad.mit.edu	37	19	55666173	55666173	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55666173C>A	uc002qjg.3	-	6	308	c.308G>T	c.(307-309)CGT>CTT	p.R103L	TNNI3_uc010yft.1_Missense_Mutation_p.R95L	NM_000363	NP_000354	P19429	TNNI3_HUMAN	troponin I, cardiac	103					cardiac muscle contraction|cellular calcium ion homeostasis|muscle filament sliding|negative regulation of ATPase activity|regulation of systemic arterial blood pressure by ischemic conditions|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|calcium channel inhibitor activity|calcium-dependent protein binding|protein domain specific binding|protein kinase binding|troponin C binding|troponin T binding			lung(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CTTGTCCACACGGGCGTGGAG	0.478													9	33	---	---	---	---	PASS
C19orf51	352909	broad.mit.edu	37	19	55671358	55671358	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55671358T>C	uc002qji.1	-	10	1106	c.1072A>G	c.(1072-1074)ACC>GCC	p.T358A	TNNI3_uc002qjg.3_5'Flank|TNNI3_uc010yft.1_5'Flank|C19orf51_uc002qjh.1_Missense_Mutation_p.T173A|C19orf51_uc002qjj.1_Missense_Mutation_p.T405A|C19orf51_uc002qjk.1_Missense_Mutation_p.T304A|C19orf51_uc002qjl.1_Missense_Mutation_p.T425A			Q8N9W5	CS051_HUMAN	RecName: Full=UPF0470 protein C19orf51;	358											0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		AAGTGGACGGTGAAAGATTCC	0.597													5	53	---	---	---	---	PASS
C19orf51	352909	broad.mit.edu	37	19	55671359	55671359	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55671359G>T	uc002qji.1	-	10	1105	c.1071C>A	c.(1069-1071)TTC>TTA	p.F357L	TNNI3_uc002qjg.3_5'Flank|TNNI3_uc010yft.1_5'Flank|C19orf51_uc002qjh.1_Missense_Mutation_p.F172L|C19orf51_uc002qjj.1_Missense_Mutation_p.F404L|C19orf51_uc002qjk.1_Missense_Mutation_p.F303L|C19orf51_uc002qjl.1_Missense_Mutation_p.F424L			Q8N9W5	CS051_HUMAN	RecName: Full=UPF0470 protein C19orf51;	357											0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		AGTGGACGGTGAAAGATTCCG	0.597													5	54	---	---	---	---	PASS
PTPRH	5794	broad.mit.edu	37	19	55703022	55703022	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55703022G>C	uc002qjq.2	-						PTPRH_uc010esv.2_Intron|uc002qjr.2_Missense_Mutation_p.E36Q	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H						apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		GCCCTGTGCTGAGTCTCACCT	0.602													21	100	---	---	---	---	PASS
ZNF71	58491	broad.mit.edu	37	19	57133271	57133271	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57133271C>T	uc002qnm.3	+	3	854	c.616C>T	c.(616-618)CGC>TGC	p.R206C		NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	206	C2H2-type 3.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		TGTGCACCAGCGCACGCACAC	0.652													11	37	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57325348	57325348	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57325348C>T	uc002qnu.2	-	7	4813	c.4462G>A	c.(4462-4464)GAA>AAA	p.E1488K	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.E1459K|PEG3_uc002qnv.2_Missense_Mutation_p.E1488K|PEG3_uc002qnw.2_Missense_Mutation_p.E1364K|PEG3_uc002qnx.2_Missense_Mutation_p.E1362K|PEG3_uc010etr.2_Missense_Mutation_p.E1488K	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	1488	Glu-rich.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TCTGGGTCTTCAATTCCCACA	0.493													13	239	---	---	---	---	PASS
ZIK1	284307	broad.mit.edu	37	19	58101644	58101644	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58101644G>A	uc002qpg.2	+	4	562	c.465G>A	c.(463-465)GTG>GTA	p.V155V	ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Silent_p.V100V|ZIK1_uc002qpi.2_Silent_p.V142V|ZIK1_uc002qpj.2_Silent_p.V52V	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein	155					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CCTCATATGTGAAGTGCTGCC	0.483													18	79	---	---	---	---	PASS
ZNF776	284309	broad.mit.edu	37	19	58265642	58265642	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58265642G>A	uc002qpx.2	+	3	1367	c.1144G>A	c.(1144-1146)GGG>AGG	p.G382R	ZNF587_uc002qqb.2_Intron|ZNF776_uc002qqa.2_Missense_Mutation_p.G382R	NM_173632	NP_775903	Q68DI1	ZN776_HUMAN	zinc finger protein 776	382	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		TACGGCATGTGGGAAGTTATT	0.433													34	117	---	---	---	---	PASS
SIRPA	140885	broad.mit.edu	37	20	1903162	1903162	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1903162G>C	uc002wfq.2	+	5	1318	c.958G>C	c.(958-960)GTA>CTA	p.V320L	SIRPA_uc010zps.1_Missense_Mutation_p.V300L|SIRPA_uc002wfr.2_Missense_Mutation_p.V320L|SIRPA_uc002wfs.2_Missense_Mutation_p.V320L|SIRPA_uc002wft.2_Missense_Mutation_p.V320L	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	320	Ig-like C1-type 2.|Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CCTGGTGAATGTATCTGCCCA	0.562													11	79	---	---	---	---	PASS
HAO1	54363	broad.mit.edu	37	20	7886891	7886891	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7886891T>C	uc002wmw.1	-	4	655	c.631A>G	c.(631-633)AAA>GAA	p.K211E	HAO1_uc010gbu.2_Missense_Mutation_p.K211E	NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1	211	FMN hydroxy acid dehydrogenase.				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3						TCTATTGCTTTAGCCACATAT	0.378													38	196	---	---	---	---	PASS
PLCB1	23236	broad.mit.edu	37	20	8632075	8632075	+	Intron	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8632075G>A	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wmz.1_Missense_Mutation_p.E204K|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						AAAAGCTAATGAGGCTGCGAA	0.388													4	6	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16362393	16362393	+	Splice_Site	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16362393C>G	uc002wpg.1	-	18	1943	c.1785_splice	c.e18-1	p.G595_splice	KIF16B_uc002wpe.1_5'Flank|KIF16B_uc002wpf.1_5'Flank|KIF16B_uc010gch.1_Splice_Site_p.G595_splice|KIF16B_uc010gci.1_Splice_Site_p.G595_splice|KIF16B_uc010gcj.1_Splice_Site_p.R606_splice	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23						cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						AAATTCAAGTCTAATAAAATC	0.348													6	48	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20269276	20269276	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20269276G>C	uc002wru.2	+	23	2896	c.2820G>C	c.(2818-2820)AAG>AAC	p.K940N	C20orf26_uc002wrw.2_Intron	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	940										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		TCTGTGAGAAGAATGTGGATT	0.398													9	347	---	---	---	---	PASS
GGTLC1	92086	broad.mit.edu	37	20	23966001	23966001	+	Intron	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23966001T>A	uc002wts.2	-						GGTLC1_uc002wtu.2_Intron	NM_178312	NP_842564	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1								gamma-glutamyltransferase activity			ovary(1)	1						AGTCACTTCCTGGGGGTGGGA	0.632													18	111	---	---	---	---	PASS
ACSS1	84532	broad.mit.edu	37	20	25011462	25011462	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25011462G>A	uc002wub.2	-	3	1442	c.564C>T	c.(562-564)ATC>ATT	p.I188I	ACSS1_uc002wuc.2_Silent_p.I188I|ACSS1_uc010gdc.2_Silent_p.I188I|ACSS1_uc002wua.2_Silent_p.I105I	NM_032501	NP_115890	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	188					acetyl-CoA biosynthetic process|ethanol oxidation|xenobiotic metabolic process	mitochondrial matrix	acetate-CoA ligase activity|AMP binding|ATP binding|protein binding			ovary(1)|skin(1)	2					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GGACAGCTCCGATCCTGGCAC	0.597													12	29	---	---	---	---	PASS
MYLK2	85366	broad.mit.edu	37	20	30408352	30408352	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30408352G>C	uc002wwq.2	+							NM_033118	NP_149109	Q9H1R3	MYLK2_HUMAN	skeletal myosin light chain kinase						cardiac muscle tissue morphogenesis|regulation of muscle filament sliding		ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			ATCTCCAGGTGAATATCCCCT	0.587													7	56	---	---	---	---	PASS
C20orf186	149954	broad.mit.edu	37	20	31695567	31695567	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31695567G>A	uc010zue.1	+	15	1777	c.1762G>A	c.(1762-1764)GTC>ATC	p.V588I		NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor	588						cytoplasm|extracellular region	lipid binding				0						GGGTTCTGGCGTCCCTCTCCC	0.488													61	73	---	---	---	---	PASS
E2F1	1869	broad.mit.edu	37	20	32266052	32266052	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32266052C>A	uc002wzu.3	-	4	820	c.680G>T	c.(679-681)TGT>TTT	p.C227F		NM_005225	NP_005216	Q01094	E2F1_HUMAN	E2F transcription factor 1	227	Dimerization (Potential).|Required for interaction with TRIM28.				apoptosis|cell proliferation|G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|mRNA stabilization|negative regulation of transcription involved in G1/S phase of mitotic cell cycle|positive regulation of fibroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle	mitochondrion|Rb-E2F complex	sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription factor binding				0						CTGCGTAGTACAGATATTCAT	0.627													25	40	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33345597	33345597	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33345597C>G	uc002xav.2	-	8	3525	c.954G>C	c.(952-954)TGG>TGC	p.W318C	NCOA6_uc002xaw.2_Missense_Mutation_p.W318C|NCOA6_uc010gew.1_Missense_Mutation_p.W275C	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	318	TBP/GTF2A-binding region.|NCOA1-binding region.|Gln-rich.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						GCAGCTGGTTCCAGCCTGGAG	0.592													14	119	---	---	---	---	PASS
MMP24	10893	broad.mit.edu	37	20	33839711	33839711	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33839711G>C	uc002xbu.2	+	3	402	c.399G>C	c.(397-399)TGG>TGC	p.W133C	EDEM2_uc010zuv.1_Intron	NM_006690	NP_006681	Q9Y5R2	MMP24_HUMAN	matrix metalloproteinase 24 preproprotein	133	Extracellular (Potential).				proteolysis	integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00252)			TGCCCAGGTGGATGAAGAAAC	0.542													24	129	---	---	---	---	PASS
RBM12	10137	broad.mit.edu	37	20	34240637	34240637	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34240637C>G	uc002xdq.2	-	3	2840	c.2608G>C	c.(2608-2610)GAT>CAT	p.D870H	CPNE1_uc010zvj.1_Intron|CPNE1_uc002xde.2_Intron|CPNE1_uc002xdf.2_Intron|CPNE1_uc002xdg.2_Intron|CPNE1_uc010gfi.2_Intron|CPNE1_uc010gfj.2_Intron|CPNE1_uc002xdh.2_Intron|CPNE1_uc002xdi.2_Intron|CPNE1_uc002xdj.2_Intron|CPNE1_uc002xdk.2_Intron|CPNE1_uc002xdl.2_Intron|CPNE1_uc002xdm.2_Intron|CPNE1_uc010gfk.1_Intron|CPNE1_uc002xdn.1_Intron|CPNE1_uc002xdo.1_Intron|CPNE1_uc002xdp.1_Intron|RBM12_uc002xdr.2_Missense_Mutation_p.D870H|RBM12_uc002xds.2_Missense_Mutation_p.D870H	NM_152838	NP_690051	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	870	RRM 3.					nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			AAAATCTCATCAATAGACACA	0.408													25	154	---	---	---	---	PASS
RBM39	9584	broad.mit.edu	37	20	34302155	34302155	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34302155C>G	uc002xeb.2	-	11	1392	c.1048G>C	c.(1048-1050)GAT>CAT	p.D350H	RBM39_uc002xdz.2_Missense_Mutation_p.D326H|RBM39_uc002xea.2_Missense_Mutation_p.D193H|RBM39_uc010gfn.2_Missense_Mutation_p.D193H|RBM39_uc010zvm.1_Missense_Mutation_p.D328H|RBM39_uc002xeg.2_Missense_Mutation_p.D328H|RBM39_uc002xec.2_Missense_Mutation_p.D350H|RBM39_uc002xed.2_Missense_Mutation_p.D68H|RBM39_uc002xee.2_Missense_Mutation_p.D193H|RBM39_uc002xef.2_Missense_Mutation_p.D193H|RBM39_uc010zvn.1_Missense_Mutation_p.D193H	NM_184234	NP_909122	Q14498	RBM39_HUMAN	RNA binding motif protein 39 isoform a	350	Activating domain (By similarity).|Interaction with JUN (By similarity).				mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	centrosome|nuclear speck	nucleotide binding|protein binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					GTTCCCAAATCAATTCCAGTC	0.413													22	197	---	---	---	---	PASS
RBL1	5933	broad.mit.edu	37	20	35661184	35661184	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35661184G>T	uc002xgi.2	-	16	2345	c.2266C>A	c.(2266-2268)CAT>AAT	p.H756N	RBL1_uc010zvt.1_RNA|RBL1_uc002xgj.1_Missense_Mutation_p.H756N	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a	756	Pocket; binds T and E1A.|Spacer.				cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)				ATTAATGAATGAGCAGTAAGT	0.423													71	439	---	---	---	---	PASS
SNHG11	128439	broad.mit.edu	37	20	37078005	37078005	+	Intron	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37078005T>C	uc002xiq.1	+						SNHG11_uc002xir.1_Intron|SNHG11_uc002xis.1_Intron|SNHG11_uc002xit.1_Intron|SNHG11_uc002xiu.1_Intron|SNORA39_uc002xip.2_RNA	NR_003239				Homo sapiens hypothetical protein mRNA, complete cds.												0						CTCTCTGCCCTTGTATACACC	0.512													122	662	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40944533	40944533	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40944533T>A	uc002xkg.2	-	12	2153	c.1969A>T	c.(1969-1971)AGC>TGC	p.S657C	PTPRT_uc010ggj.2_Missense_Mutation_p.S657C	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	657	Extracellular (Potential).|Fibronectin type-III 4.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GAATCGAGGCTGGAGGCATTC	0.507													32	169	---	---	---	---	PASS
PABPC1L	80336	broad.mit.edu	37	20	43566779	43566779	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43566779G>C	uc010ggv.1	+	13	1805	c.1723G>C	c.(1723-1725)GAC>CAC	p.D575H	PABPC1L_uc010zwq.1_RNA|PABPC1L_uc002xmv.2_RNA|PABPC1L_uc002xmw.2_Missense_Mutation_p.D129H|PABPC1L_uc002xmx.2_Missense_Mutation_p.D129H	NM_001124756	NP_001118228	Q4VXU2	PAP1L_HUMAN	poly(A)-binding protein, cytoplasmic 1-like	575	PABC.						nucleotide binding|RNA binding			ovary(1)	1						GCTGGAGATTGACAACTCAGA	0.587													20	48	---	---	---	---	PASS
NEURL2	140825	broad.mit.edu	37	20	44517426	44517426	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44517426C>A	uc002xqg.1	-	2	1100	c.829G>T	c.(829-831)GAA>TAA	p.E277*	C20orf165_uc002xqf.2_5'Flank|CTSA_uc002xqh.2_5'Flank|CTSA_uc002xqj.3_5'Flank|CTSA_uc002xqi.2_5'Flank|CTSA_uc010zxi.1_5'Flank|CTSA_uc002xqk.3_5'Flank	NM_080749	NP_542787	Q9BR09	NEUL2_HUMAN	neuralized-like protein 2	277	SOCS box.				intracellular signal transduction						0		Myeloproliferative disorder(115;0.0122)				TCCTTAAGTTCTTTGGGCAGG	0.567													8	100	---	---	---	---	PASS
MMP9	4318	broad.mit.edu	37	20	44640944	44640944	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44640944C>T	uc002xqz.2	+	7	1185	c.1166C>T	c.(1165-1167)CCG>CTG	p.P389L		NM_004994	NP_004985	P14780	MMP9_HUMAN	matrix metalloproteinase 9 preproprotein	389	Fibronectin type-II 3.				collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)			Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)	GGCTTCTGCCCGGACCAAGGT	0.697													10	121	---	---	---	---	PASS
CDH22	64405	broad.mit.edu	37	20	44815456	44815456	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44815456C>G	uc002xrm.2	-						CDH22_uc010ghk.1_Intron	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN	cadherin 22 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				CCCACCCCCTCAGGGGTACCT	0.612													23	155	---	---	---	---	PASS
ZNF334	55713	broad.mit.edu	37	20	45131354	45131354	+	Silent	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45131354C>A	uc002xsc.2	-	5	808	c.624G>T	c.(622-624)CCG>CCT	p.P208P	ZNF334_uc002xsa.2_Silent_p.P231P|ZNF334_uc002xsb.2_Silent_p.P170P|ZNF334_uc002xsd.2_Silent_p.P170P|ZNF334_uc010ghl.2_Silent_p.P207P	NM_018102	NP_060572	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334 isoform a	208					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)				TATAGTCAAACGGTTGTTTCA	0.348													33	258	---	---	---	---	PASS
SULF2	55959	broad.mit.edu	37	20	46365469	46365469	+	Silent	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46365469G>C	uc002xto.2	-	3	723	c.393C>G	c.(391-393)CTC>CTG	p.L131L	SULF2_uc002xtr.2_Silent_p.L131L|SULF2_uc002xtq.2_Silent_p.L131L|SULF2_uc010ghv.1_Silent_p.L131L	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	131					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						CAGTGCTATTGAGGTACACGG	0.542													7	60	---	---	---	---	PASS
ARFGEF2	10564	broad.mit.edu	37	20	47626853	47626853	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47626853G>C	uc002xtx.3	+	27	3821	c.3669G>C	c.(3667-3669)AAG>AAC	p.K1223N	ARFGEF2_uc010zyf.1_Missense_Mutation_p.K516N	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	1223					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			CAGGTTGGAAGAACATCTTTG	0.562													5	179	---	---	---	---	PASS
ADNP	23394	broad.mit.edu	37	20	49509542	49509542	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49509542T>C	uc002xvt.1	-	5	2054	c.1709A>G	c.(1708-1710)AAT>AGT	p.N570S	ADNP_uc002xvu.1_Missense_Mutation_p.N570S	NM_015339	NP_056154	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector	570						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						ATCCCTCAGATTGTATGTAGT	0.443													10	355	---	---	---	---	PASS
NFATC2	4773	broad.mit.edu	37	20	50048903	50048903	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50048903G>A	uc002xwd.2	-	9	2643	c.2423C>T	c.(2422-2424)TCG>TTG	p.S808L	NFATC2_uc002xwc.2_Missense_Mutation_p.S808L|NFATC2_uc010zyv.1_Missense_Mutation_p.S589L|NFATC2_uc010zyw.1_Missense_Mutation_p.S589L|NFATC2_uc010zyx.1_Missense_Mutation_p.S788L|NFATC2_uc010zyy.1_Missense_Mutation_p.S589L|NFATC2_uc010zyz.1_Missense_Mutation_p.S589L|NFATC2_uc002xwe.2_Missense_Mutation_p.S788L	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,	808					B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					GATCACAGGCGAGGCCTGCTG	0.647													41	108	---	---	---	---	PASS
CYP24A1	1591	broad.mit.edu	37	20	52774666	52774666	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52774666C>T	uc002xwv.2	-	9	1593	c.1195G>A	c.(1195-1197)GAC>AAC	p.D399N	CYP24A1_uc002xwu.1_Missense_Mutation_p.D257N|CYP24A1_uc002xww.2_Missense_Mutation_p.D399N	NM_000782	NP_000773	Q07973	CP24A_HUMAN	cytochrome P450 family 24 subfamily A	399					hormone biosynthetic process|osteoblast differentiation|vitamin D catabolic process|vitamin D receptor signaling pathway|xenobiotic metabolic process	mitochondrial inner membrane	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity|electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcitriol(DB00136)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	GTTGCCTTGTCAAGAGTCCGA	0.378													17	154	---	---	---	---	PASS
NPEPL1	79716	broad.mit.edu	37	20	57269496	57269496	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57269496G>A	uc010zzs.1	+	3	450	c.355G>A	c.(355-357)GAG>AAG	p.E119K	NPEPL1_uc010zzr.1_Missense_Mutation_p.E71K|NPEPL1_uc002xzn.2_RNA|NPEPL1_uc010gjo.1_Missense_Mutation_p.E91K|NPEPL1_uc002xzp.2_Missense_Mutation_p.E7K	NM_024663	NP_078939	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1	119					proteolysis	cytoplasm	aminopeptidase activity|manganese ion binding|metalloexopeptidase activity				0	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			CGAGCAGCCGGAGGTCTTTGC	0.667													5	152	---	---	---	---	PASS
TH1L	51497	broad.mit.edu	37	20	57565961	57565961	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57565961C>T	uc002yag.2	+						TH1L_uc002yaf.1_Intron|TH1L_uc002yah.2_Intron	NM_198976	NP_945327	Q8IXH7	NELFD_HUMAN	TH1-like protein						negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	all_lung(29;0.00711)		Colorectal(105;0.109)			TTTTTCTCATCAAGAGGTCAT	0.488													32	283	---	---	---	---	PASS
CDH4	1002	broad.mit.edu	37	20	60509210	60509210	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60509210G>A	uc002ybn.1	+	15	2490	c.2476G>A	c.(2476-2478)GCT>ACT	p.A826T	CDH4_uc002ybp.1_Missense_Mutation_p.A752T	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	826	Cytoplasmic (Potential).			A -> P (in Ref. 1; AAA35627 and 4; no nucleotide entry).	adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GCCGGTGGGCGCTGAGCCCCA	0.687													13	49	---	---	---	---	PASS
TAF4	6874	broad.mit.edu	37	20	60587993	60587993	+	Intron	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60587993G>T	uc002ybs.2	-							NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4						interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CCAGGTGCCTGAAAAATAAGC	0.473													22	125	---	---	---	---	PASS
C20orf200	253868	broad.mit.edu	37	20	61143691	61143691	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61143691G>A	uc002ycz.1	-	3	648	c.157C>T	c.(157-159)CTG>TTG	p.L53L	C20orf200_uc002ycy.2_RNA	NM_152757	NP_689970			hypothetical protein LOC253868												0	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;7.17e-06)			CCCCTCCGCAGACCGGATGGT	0.677													56	70	---	---	---	---	PASS
DIDO1	11083	broad.mit.edu	37	20	61512756	61512756	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61512756C>T	uc002ydr.1	-	16	4816	c.4552G>A	c.(4552-4554)GAC>AAC	p.D1518N	DIDO1_uc002yds.1_Missense_Mutation_p.D1518N	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	1518					apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					ATCAAGGCGTCCGACACCGAG	0.622													29	233	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	10862811	10862811	+	IGR	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10862811C>T								None (None upstream) : TPTE (43932 downstream)																							CCTGGGGCCTCAGTGAAGGTC	0.562													15	350	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19647652	19647652	+	Silent	SNP	A	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19647652A>C	uc002ykw.2	-	24	2797	c.2766T>G	c.(2764-2766)GGT>GGG	p.G922G		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	922	Extracellular (Potential).|Peptidase S1.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						TTGCAGTAGTACCTGCTCAAA	0.388													17	101	---	---	---	---	PASS
ADAMTS5	11096	broad.mit.edu	37	21	28306991	28306991	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28306991G>T	uc002ymg.2	-	4	2212	c.1483C>A	c.(1483-1485)CAG>AAG	p.Q495K		NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1	495	Disintegrin.				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						TTGCACTGCTGGGTGGCATCG	0.567													15	77	---	---	---	---	PASS
SFRS15	57466	broad.mit.edu	37	21	33065631	33065631	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33065631G>C	uc002ypd.2	-	12	1915	c.1489C>G	c.(1489-1491)CAA>GAA	p.Q497E	SFRS15_uc002ype.2_Missense_Mutation_p.Q497E|SFRS15_uc010glu.2_Missense_Mutation_p.Q482E|SFRS15_uc002ypf.1_Missense_Mutation_p.Q171E	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	497						nucleus	nucleotide binding|RNA binding				0						GGTTTCACTTGAGGGAGGCCT	0.428													4	181	---	---	---	---	PASS
HUNK	30811	broad.mit.edu	37	21	33346872	33346872	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33346872C>T	uc002yph.2	+	7	1376	c.1016C>T	c.(1015-1017)TCT>TTT	p.S339F		NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase	339					multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						CGCAGGATTTCTCTGGAAGAT	0.552													33	192	---	---	---	---	PASS
IFNAR1	3454	broad.mit.edu	37	21	34721847	34721847	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34721847G>C	uc002yrn.2	+	8	1288	c.1141G>C	c.(1141-1143)GAG>CAG	p.E381Q	IFNAR1_uc011adv.1_Missense_Mutation_p.E312Q	NM_000629	NP_000620	P17181	INAR1_HUMAN	interferon-alpha receptor 1 precursor	381	Fibronectin type-III 3.|Extracellular (Potential).				JAK-STAT cascade|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	integral to plasma membrane	type I interferon receptor activity			central_nervous_system(1)|skin(1)	2					Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)	TTCAAATGCTGAGGTAAAAAG	0.308													7	31	---	---	---	---	PASS
IGSF5	150084	broad.mit.edu	37	21	41173288	41173288	+	3'UTR	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41173288A>T	uc002yyo.2	+	9						NM_001080444	NP_001073913	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily 5 like							integral to membrane|tight junction					0		Prostate(19;5.35e-06)				AGTATAGCAAAGCCTTCCCCA	0.512													12	41	---	---	---	---	PASS
UMODL1	89766	broad.mit.edu	37	21	43541194	43541194	+	Intron	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43541194C>A	uc002zaf.1	+						UMODL1_uc002zad.1_Intron|UMODL1_uc002zae.1_Intron|UMODL1_uc002zag.1_Intron|UMODL1_uc002zal.1_Intron	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor							cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						AAATGTTGTGCAGATTACGAT	0.532													32	139	---	---	---	---	PASS
KRTAP10-2	386679	broad.mit.edu	37	21	45971181	45971181	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45971181G>A	uc002zfi.1	-	1	208	c.161C>T	c.(160-162)TCC>TTC	p.S54F	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198693	NP_941966	P60368	KR102_HUMAN	keratin associated protein 10-2	54	22 X 5 AA repeats of C-C-X(3).					keratin filament				large_intestine(1)	1						GCAGGGGCTGGACACACAGCT	0.701													16	49	---	---	---	---	PASS
KRTAP10-7	386675	broad.mit.edu	37	21	46021108	46021108	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46021108G>C	uc002zfn.3	+	2	597	c.572G>C	c.(571-573)TGT>TCT	p.C191S	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198689	NP_941962	P60409	KR107_HUMAN	keratin associated protein 10-7	196	30 X 5 AA repeats of C-C-X(3).					keratin filament					0						CAGGCGGTCTGTGAGCCCAGC	0.647													6	50	---	---	---	---	PASS
UBE2G2	7327	broad.mit.edu	37	21	46191303	46191303	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46191303G>C	uc002zfy.2	-	6	562	c.487C>G	c.(487-489)CTG>GTG	p.L163V	UBE2G2_uc002zfx.2_Missense_Mutation_p.L135V	NM_003343	NP_003334	P60604	UB2G2_HUMAN	ubiquitin-conjugating enzyme E2G 2 isoform 1	163					protein K48-linked ubiquitination	cytosol	ATP binding|protein binding|ubiquitin-protein ligase activity			breast(3)|central_nervous_system(1)	4				Colorectal(79;0.0638)		CACAGTCCCAGAGACTTCTGG	0.572													29	108	---	---	---	---	PASS
CECR2	27443	broad.mit.edu	37	22	18022049	18022049	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18022049G>A	uc010gqw.1	+	15	2277	c.2151G>A	c.(2149-2151)GGG>GGA	p.G717G	CECR2_uc010gqv.1_Silent_p.G576G|CECR2_uc002zml.2_Silent_p.G576G	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	759					chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		CCCGGCATGGGGGGGCTCCAG	0.552													12	30	---	---	---	---	PASS
ZNF280B	140883	broad.mit.edu	37	22	22842929	22842929	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22842929C>G	uc002zwc.1	-	4	1571	c.795G>C	c.(793-795)TTG>TTC	p.L265F	LOC96610_uc011aim.1_Intron	NM_080764	NP_542942	Q86YH2	Z280B_HUMAN	zinc finger protein 280B	265					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TTGTTAGACTCAAAATGTCTG	0.373													31	96	---	---	---	---	PASS
ZNF70	7621	broad.mit.edu	37	22	24086611	24086611	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24086611G>A	uc002zxs.2	-	2	1178	c.717C>T	c.(715-717)CTC>CTT	p.L239L	ZNF70_uc002zxr.1_5'Flank	NM_021916	NP_068735	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	239	C2H2-type 4.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						CGTGTTTTCTGAGGCTGGAGC	0.532													8	145	---	---	---	---	PASS
CABIN1	23523	broad.mit.edu	37	22	24432570	24432570	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24432570A>G	uc002zzi.1	+	3	164	c.37A>G	c.(37-39)ATT>GTT	p.I13V	CABIN1_uc002zzj.1_Missense_Mutation_p.I13V|CABIN1_uc002zzl.1_Missense_Mutation_p.I13V|CABIN1_uc010guk.1_Missense_Mutation_p.I13V|CABIN1_uc002zzk.1_Missense_Mutation_p.I13V	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	13					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CAGCTCCACCATTGAGGATGA	0.448													125	394	---	---	---	---	PASS
CYTSA	23384	broad.mit.edu	37	22	24718054	24718054	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24718054C>G	uc002zzw.2	+	5	1413	c.1106C>G	c.(1105-1107)TCA>TGA	p.S369*	CYTSA_uc002zzv.3_Nonsense_Mutation_p.S369*|CYTSA_uc011ajq.1_Nonsense_Mutation_p.S369*	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A	369					cell cycle|cell division						0						CCATCCTCCTCAGAGTCGGAA	0.572													13	95	---	---	---	---	PASS
PIWIL3	440822	broad.mit.edu	37	22	25115858	25115858	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25115858C>T	uc003abd.1	-	20	2806	c.2389G>A	c.(2389-2391)GAC>AAC	p.D797N	PIWIL3_uc011ajx.1_Missense_Mutation_p.D679N|PIWIL3_uc011ajy.1_Missense_Mutation_p.D679N|PIWIL3_uc010gut.1_Missense_Mutation_p.D788N	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3	797	Piwi.				cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						ATAAAAAAGTCATACCTGGAA	0.368													17	107	---	---	---	---	PASS
RHBDD3	25807	broad.mit.edu	37	22	29656762	29656762	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29656762G>C	uc003aeq.1	-	5	996	c.624C>G	c.(622-624)TGC>TGG	p.C208W	RHBDD3_uc003aer.1_RNA	NM_012265	NP_036397	Q9Y3P4	RHBD3_HUMAN	rhomboid domain containing 3	208						integral to membrane	serine-type endopeptidase activity			ovary(1)	1						TCAGGGGCCAGCACCCCGCCA	0.687													5	9	---	---	---	---	PASS
AP1B1	162	broad.mit.edu	37	22	29754886	29754886	+	Silent	SNP	G	A	A	rs139994318		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29754886G>A	uc003afj.2	-	5	538	c.354C>T	c.(352-354)ATC>ATT	p.I118I	AP1B1_uc003afi.2_Silent_p.I118I|AP1B1_uc003afk.2_Silent_p.I118I|AP1B1_uc003afl.2_Silent_p.I118I	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit	118					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						GGTACTCTGTGATCTTGTCAA	0.622													4	33	---	---	---	---	PASS
MTMR3	8897	broad.mit.edu	37	22	30416605	30416605	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30416605C>G	uc003agv.3	+	17	3285	c.2957C>G	c.(2956-2958)TCA>TGA	p.S986*	MTMR3_uc003agu.3_Nonsense_Mutation_p.S986*|MTMR3_uc003agw.3_Nonsense_Mutation_p.S986*	NM_021090	NP_066576	Q13615	MTMR3_HUMAN	myotubularin-related protein 3 isoform c	986					phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CACTTACACTCAAGGAACTTG	0.597													15	98	---	---	---	---	PASS
OSBP2	23762	broad.mit.edu	37	22	31091221	31091221	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31091221G>C	uc003aiy.1	+	1	429	c.325G>C	c.(325-327)GAG>CAG	p.E109Q	OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc003aix.1_Missense_Mutation_p.E109Q|OSBP2_uc011alb.1_Missense_Mutation_p.E109Q|OSBP2_uc003aiz.1_Missense_Mutation_p.E109Q	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a	109					lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						GCCGGGGTCAGAGTCAAGCTC	0.682													14	61	---	---	---	---	PASS
RNF185	91445	broad.mit.edu	37	22	31600551	31600551	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31600551G>T	uc003akb.2	+	7	758	c.558G>T	c.(556-558)ATG>ATT	p.M186I	RNF185_uc010gwh.2_RNA|RNF185_uc011alm.1_Missense_Mutation_p.M124I|RNF185_uc003akc.2_Missense_Mutation_p.M124I|RNF185_uc003ake.2_Missense_Mutation_p.M130I	NM_152267	NP_689480	Q96GF1	RN185_HUMAN	ring finger protein 185 isoform 1	186	Helical; (Potential).					integral to membrane	zinc ion binding				0						TGGTGATCATGTTCTGGCTCC	0.572													68	170	---	---	---	---	PASS
DRG1	4733	broad.mit.edu	37	22	31829895	31829895	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31829895C>G	uc003aku.2	+	9	1173	c.1042C>G	c.(1042-1044)CAG>GAG	p.Q348E	uc003akv.1_5'Flank	NM_004147	NP_004138	Q9Y295	DRG1_HUMAN	developmentally regulated GTP binding protein 1	348					multicellular organismal development|transcription, DNA-dependent	cytoplasm|intermediate filament cytoskeleton|nucleus	GTP binding|transcription factor binding			central_nervous_system(1)	1						ACACAATCCTCAGAAAGTGGG	0.453													23	102	---	---	---	---	PASS
DEPDC5	9681	broad.mit.edu	37	22	32289687	32289687	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32289687G>C	uc003als.2	+	38	4202	c.4060G>C	c.(4060-4062)GAG>CAG	p.E1354Q	DEPDC5_uc011als.1_Missense_Mutation_p.E1285Q|DEPDC5_uc011alu.1_Missense_Mutation_p.E1385Q|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.E1376Q|DEPDC5_uc003alu.2_Missense_Mutation_p.E803Q|DEPDC5_uc003alv.2_RNA|DEPDC5_uc003alw.2_Missense_Mutation_p.E652Q|DEPDC5_uc011alx.1_Missense_Mutation_p.E202Q|DEPDC5_uc010gwk.2_Missense_Mutation_p.E380Q|DEPDC5_uc011aly.1_Missense_Mutation_p.E202Q	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	1354					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						TGCAGCCTTTGAGATCAAGCT	0.537													7	112	---	---	---	---	PASS
BPIL2	254240	broad.mit.edu	37	22	32813092	32813092	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32813092C>G	uc003amn.2	-	13	1304	c.1304G>C	c.(1303-1305)GGA>GCA	p.G435A	BPIL2_uc010gwo.2_Missense_Mutation_p.G192A|BPIL2_uc011amb.1_Missense_Mutation_p.G159A	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing	435						extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						TGGGAGGACTCCAAAGTGAAG	0.378													16	399	---	---	---	---	PASS
SYN3	8224	broad.mit.edu	37	22	32929781	32929781	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32929781C>G	uc003amx.2	-	9	1252	c.1093G>C	c.(1093-1095)GAG>CAG	p.E365Q	SYN3_uc003amy.2_Missense_Mutation_p.E365Q|SYN3_uc003amz.2_Missense_Mutation_p.E364Q	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa	365	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						TCCCTCACCTCGATGATGTAA	0.597													8	54	---	---	---	---	PASS
KCNJ4	3761	broad.mit.edu	37	22	38823708	38823708	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38823708C>G	uc003avs.1	-	2	527	c.430G>C	c.(430-432)GAG>CAG	p.E144Q	KCNJ4_uc003avt.1_Missense_Mutation_p.E144Q	NM_004981	NP_004972	P48050	IRK4_HUMAN	potassium inwardly-rectifying channel J4	144	Extracellular (By similarity).				synaptic transmission	basolateral plasma membrane|voltage-gated potassium channel complex	inward rectifier potassium channel activity|PDZ domain binding				0	Melanoma(58;0.0286)					GGGCACTCCTCTGTCACGCAC	0.617													12	103	---	---	---	---	PASS
APOBEC3F	200316	broad.mit.edu	37	22	39440184	39440184	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39440184C>T	uc003aww.2	+						APOBEC3F_uc003awv.2_Missense_Mutation_p.P90S|APOBEC3F_uc011aog.1_Intron	NM_145298	NP_660341	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic						base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding				0	Melanoma(58;0.04)					CCAGTGGCCTCCCCAGCTGAC	0.363													3	23	---	---	---	---	PASS
MKL1	57591	broad.mit.edu	37	22	40819692	40819692	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40819692G>C	uc003ayv.1	-						MKL1_uc003ayw.1_Intron|MKL1_uc010gye.1_Intron|MKL1_uc010gyf.1_Intron	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein						positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						GACACAACCTGAGAGGGAAAA	0.602			T	RBM15	acute megakaryocytic leukemia								4	55	---	---	---	---	PASS
WBP2NL	164684	broad.mit.edu	37	22	42423026	42423026	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42423026C>T	uc011ape.1	+	7	787	c.771C>T	c.(769-771)CTC>CTT	p.L257L	WBP2NL_uc003bbt.2_Silent_p.L257L|WBP2NL_uc011apk.1_Silent_p.L129L|WBP2NL_uc003bbu.2_RNA|WBP2NL_uc003bbv.1_RNA	NM_152613	NP_689826	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like	257	10 X 7 AA tandem repeat of Y-G-X-P-P-X-G.|9.|Gly-rich.				egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding			ovary(2)	2						CCCCACCTCTCGGATATGGAG	0.612													66	402	---	---	---	---	PASS
SERHL2	253190	broad.mit.edu	37	22	42956238	42956238	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42956238C>G	uc003bcr.2	+	8	682	c.580C>G	c.(580-582)CTC>GTC	p.L194V	SERHL_uc011apm.1_Intron|SERHL2_uc011apn.1_Missense_Mutation_p.L180V|SERHL2_uc010gyz.2_Missense_Mutation_p.L130V|SERHL2_uc010gyy.2_RNA|SERHL2_uc011apo.1_RNA|RRP7B_uc003bcs.2_Intron	NM_014509	NP_055324	Q9H4I8	SEHL2_HUMAN	serine hydrolase-like 2	194						perinuclear region of cytoplasm|peroxisome	hydrolase activity				0						CGGGGAGCTTCTCCTGCAAAG	0.488													11	126	---	---	---	---	PASS
PARVG	64098	broad.mit.edu	37	22	44586423	44586423	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44586423C>G	uc011aqe.1	+						PARVG_uc003bep.2_Intron|PARVG_uc011aqf.1_Intron|PARVG_uc003beq.2_Intron|PARVG_uc003ber.2_Intron	NM_001137605	NP_001131077	Q9HBI0	PARVG_HUMAN	parvin, gamma						cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)				TCTCCACTCTCTTCCCAGGCA	0.592													14	78	---	---	---	---	PASS
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45210543	45210543	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45210543C>T	uc003bfd.2	+						PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|ARHGAP8_uc003bfi.2_Intron|ARHGAP8_uc010gzv.2_Intron|ARHGAP8_uc003bfj.2_Intron|ARHGAP8_uc003bfk.2_Intron|ARHGAP8_uc003bfl.2_Intron	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2						CCCCCGTTTCCCTCCTCAGGT	0.552													42	99	---	---	---	---	PASS
C22orf9	23313	broad.mit.edu	37	22	45598926	45598926	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45598926G>T	uc003bfx.1	-	7	863	c.797C>A	c.(796-798)ACA>AAA	p.T266K	C22orf9_uc010gzw.1_Missense_Mutation_p.T118K|C22orf9_uc003bfv.1_Missense_Mutation_p.T275K|C22orf9_uc003bfw.1_Missense_Mutation_p.T271K|C22orf9_uc010gzx.2_Missense_Mutation_p.T248K|MIR1249_hsa-mir-1249|MI0006384_5'Flank	NM_001009880	NP_001009880	Q6ICG6	K0930_HUMAN	hypothetical protein LOC23313 isoform b	266							protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|READ - Rectum adenocarcinoma(1;0.000617)|Colorectal(1;0.0024)		ACAGGGGGATGTGTCACCTGT	0.632													45	140	---	---	---	---	PASS
C22orf9	23313	broad.mit.edu	37	22	45601129	45601129	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45601129T>A	uc003bfx.1	-	5	551	c.485A>T	c.(484-486)AAC>ATC	p.N162I	C22orf9_uc010gzw.1_Missense_Mutation_p.N14I|C22orf9_uc003bfv.1_Missense_Mutation_p.N171I|C22orf9_uc003bfw.1_Missense_Mutation_p.N167I|C22orf9_uc010gzx.2_Missense_Mutation_p.N144I	NM_001009880	NP_001009880	Q6ICG6	K0930_HUMAN	hypothetical protein LOC23313 isoform b	162							protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|READ - Rectum adenocarcinoma(1;0.000617)|Colorectal(1;0.0024)		GAAGAAGATGTTGGGGTAGCT	0.547													30	125	---	---	---	---	PASS
ZBED4	9889	broad.mit.edu	37	22	50279761	50279761	+	Silent	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50279761G>A	uc003bix.2	+	2	2921	c.2451G>A	c.(2449-2451)CTG>CTA	p.L817L		NM_014838	NP_055653	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	817						cytoplasm|nucleus	DNA binding|metal ion binding|protein dimerization activity			ovary(2)	2		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		GGAAGACGCTGAACGAGGGGG	0.612													6	26	---	---	---	---	PASS
HDAC10	83933	broad.mit.edu	37	22	50686732	50686732	+	Intron	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50686732G>C	uc003bkg.2	-						HDAC10_uc003bke.2_Intron|HDAC10_uc003bkf.2_Intron|HDAC10_uc010hav.2_Intron|HDAC10_uc003bkh.2_Intron|HDAC10_uc003bki.2_Intron|HDAC10_uc003bkj.2_Intron|HDAC10_uc003bkk.1_5'UTR	NM_032019	NP_114408	Q969S8	HDA10_HUMAN	histone deacetylase 10 isoform 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|nucleus	histone deacetylase activity|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CTGTGAGGGAGACACAACAGT	0.672													17	97	---	---	---	---	PASS
SAPS2	9701	broad.mit.edu	37	22	50845188	50845188	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50845188G>A	uc003blb.1	+	5	720	c.298G>A	c.(298-300)GAG>AAG	p.E100K	SAPS2_uc003bky.1_Missense_Mutation_p.E100K|SAPS2_uc003bkz.1_Missense_Mutation_p.E100K|SAPS2_uc003blc.2_Missense_Mutation_p.E100K|SAPS2_uc003bla.1_Missense_Mutation_p.E100K	NM_014678	NP_055493	O75170	PP6R2_HUMAN	SAPS domain family, member 2	100						cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)		CGGTGGGGACGAGAGCCTGCT	0.547													64	399	---	---	---	---	PASS
ARSF	416	broad.mit.edu	37	X	3021944	3021944	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3021944G>A	uc004cre.1	+	9	1465	c.1244G>A	c.(1243-1245)GGA>GAA	p.G415E	ARSF_uc004crf.1_Missense_Mutation_p.G415E	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor	415						extracellular region	arylsulfatase activity|metal ion binding			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCAGTGTCAGGAGGAAGTCTC	0.443													53	44	---	---	---	---	PASS
OFD1	8481	broad.mit.edu	37	X	13771553	13771553	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13771553G>C	uc004cvp.3	+	11	1481	c.1122G>C	c.(1120-1122)AAG>AAC	p.K374N	OFD1_uc004cvr.3_5'UTR|OFD1_uc011mil.1_5'UTR|OFD1_uc004cvq.3_Missense_Mutation_p.K234N|OFD1_uc010nen.2_Missense_Mutation_p.K373N|OFD1_uc004cvs.3_RNA|OFD1_uc004cvu.3_Missense_Mutation_p.K333N|OFD1_uc004cvv.3_Missense_Mutation_p.K333N|OFD1_uc010neo.1_Missense_Mutation_p.K120N	NM_003611	NP_003602	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	374	Potential.				cilium movement involved in determination of left/right asymmetry|G2/M transition of mitotic cell cycle	centriole|cilium|cytosol|microtubule basal body|nuclear membrane	alpha-tubulin binding|gamma-tubulin binding				0						ATGAAAGGAAGAATAAAGGTG	0.353													4	118	---	---	---	---	PASS
PDHA1	5160	broad.mit.edu	37	X	19369418	19369418	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19369418T>C	uc004czg.3	+	4	456	c.311T>C	c.(310-312)CTG>CCG	p.L104P	PDHA1_uc004czh.3_Missense_Mutation_p.L139P|PDHA1_uc011mjc.1_Missense_Mutation_p.L108P|PDHA1_uc011mjd.1_Missense_Mutation_p.L101P|PDHA1_uc010nfk.2_Missense_Mutation_p.L101P	NM_000284	NP_000275	P08559	ODPA_HUMAN	pyruvate dehydrogenase E1 alpha 1 precursor	104					glycolysis|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	protein binding|pyruvate dehydrogenase (acetyl-transferring) activity			ovary(1)	1	Hepatocellular(33;0.183)				NADH(DB00157)	TGTGTGGGCCTGGAGGCCGGC	0.498													33	103	---	---	---	---	PASS
ZNF645	158506	broad.mit.edu	37	X	22292313	22292313	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22292313C>A	uc004dai.1	+	1	1254	c.1205C>A	c.(1204-1206)ACG>AAG	p.T402K		NM_152577	NP_689790	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	402						intracellular	zinc ion binding			lung(1)|pancreas(1)	2						TGTCCACCAACGCGGAGTCCA	0.458													42	98	---	---	---	---	PASS
EIF2S3	1968	broad.mit.edu	37	X	24078262	24078262	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24078262C>T	uc004dbc.2	+	5	462	c.441C>T	c.(439-441)AAC>AAT	p.N147N		NM_001415	NP_001406	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2,	147						cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			lung(1)	1						CTATGCTGAACGGTGCAGCAG	0.373													11	54	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	31496327	31496327	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31496327C>T	uc004dda.1	-	59	9077	c.8833G>A	c.(8833-8835)GAG>AAG	p.E2945K	DMD_uc004dcq.1_Missense_Mutation_p.E216K|DMD_uc004dcr.1_Missense_Mutation_p.E485K|DMD_uc004dcs.1_Missense_Mutation_p.E485K|DMD_uc004dct.1_Missense_Mutation_p.E485K|DMD_uc004dcu.1_Missense_Mutation_p.E485K|DMD_uc004dcv.1_Missense_Mutation_p.E485K|DMD_uc004dcw.2_Missense_Mutation_p.E1601K|DMD_uc004dcx.2_Missense_Mutation_p.E1604K|DMD_uc004dcz.2_Missense_Mutation_p.E2822K|DMD_uc004dcy.1_Missense_Mutation_p.E2941K|DMD_uc004ddb.1_Missense_Mutation_p.E2937K	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2945	Spectrin 22.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AGGTCCAGCTCATCCGTGGCC	0.527													18	14	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32305648	32305648	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32305648T>C	uc004dda.1	-	43	6532	c.6288A>G	c.(6286-6288)CAA>CAG	p.Q2096Q	DMD_uc004dcw.2_Silent_p.Q752Q|DMD_uc004dcx.2_Silent_p.Q755Q|DMD_uc004dcz.2_Silent_p.Q1973Q|DMD_uc004dcy.1_Silent_p.Q2092Q|DMD_uc004ddb.1_Silent_p.Q2088Q|DMD_uc010ngo.1_Intron|DMD_uc010ngn.1_RNA	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2096	Spectrin 14.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTACCTACCCTTGTCGGTCCT	0.403													47	57	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37027712	37027712	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37027712G>T	uc004ddl.1	+	1	1243	c.1229G>T	c.(1228-1230)CGC>CTC	p.R410L		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	410										ovary(3)	3						CCCAAGACTCGCATATCTAAT	0.607													40	32	---	---	---	---	PASS
RPGR	6103	broad.mit.edu	37	X	38163977	38163977	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38163977T>C	uc004ded.1	-	8	1013	c.845A>G	c.(844-846)GAA>GGA	p.E282G	RPGR_uc004deb.2_Missense_Mutation_p.E282G|RPGR_uc004dea.2_RNA|RPGR_uc004dec.2_RNA|RPGR_uc004dee.1_5'UTR	NM_001034853	NP_001030025	Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator isoform C	282	RCC1 5.				intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						TTCTGAAGTTTCAAAAAGAAA	0.383													29	22	---	---	---	---	PASS
KDM6A	7403	broad.mit.edu	37	X	44833908	44833908	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44833908C>T	uc004dge.3	+						KDM6A_uc010nhk.2_Intron|KDM6A_uc011mkz.1_Intron|KDM6A_uc011mla.1_Intron|KDM6A_uc011mlb.1_Intron|KDM6A_uc011mlc.1_Intron	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide						histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						ATTTTCCTTTCAGCATTATCT	0.378			D|N|F|S		renal|oesophageal SCC|MM								6	100	---	---	---	---	PASS
ZNF673	55634	broad.mit.edu	37	X	46332325	46332325	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46332325C>T	uc004dgn.3	+	6	693	c.394C>T	c.(394-396)CTG>TTG	p.L132L	ZNF673_uc004dgp.3_3'UTR|ZNF673_uc010nhl.2_3'UTR|ZNF673_uc004dgm.3_Silent_p.L127L	NM_001129898	NP_001123370	Q5JUW0	ZN673_HUMAN	zinc finger family member 673 isoform 1	132					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding				0						AAGCATTTATCTGAGCACAGA	0.378													30	74	---	---	---	---	PASS
ERAS	3266	broad.mit.edu	37	X	48688086	48688086	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48688086C>T	uc004dky.1	+	1	804	c.553C>T	c.(553-555)CGG>TGG	p.R185W		NM_181532	NP_853510	Q7Z444	RASE_HUMAN	ES cell expressed Ras precursor	185					small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|GTPase activity			lung(4)|urinary_tract(1)	5						GGCCAAAACACGGCAAGGCGT	0.622													12	6	---	---	---	---	PASS
GRIPAP1	56850	broad.mit.edu	37	X	48858606	48858606	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48858606C>T	uc004dly.1	-	1	70	c.35G>A	c.(34-36)CGG>CAG	p.R12Q	GRIPAP1_uc004dma.2_Missense_Mutation_p.R12Q	NM_020137	NP_064522	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1 isoform 1	12	Potential.					early endosome				breast(2)|kidney(1)	3						CACCTGCATCCGCTGAAACTC	0.652													6	28	---	---	---	---	PASS
FOXP3	50943	broad.mit.edu	37	X	49107902	49107902	+	Missense_Mutation	SNP	G	A	A	rs28935477		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49107902G>A	uc004dnf.3	-	12	1377	c.1189C>T	c.(1189-1191)CGG>TGG	p.R397W	FOXP3_uc011mnb.1_Missense_Mutation_p.R420W|FOXP3_uc011mnc.1_Missense_Mutation_p.R370W|FOXP3_uc004dne.3_Missense_Mutation_p.R362W|FOXP3_uc010niq.1_Missense_Mutation_p.R422W	NM_014009	NP_054728	Q9BZS1	FOXP3_HUMAN	forkhead box P3 isoform a	397	Fork-head.				B cell homeostasis|cerebellum development|chromatin remodeling|embryo development|myeloid cell homeostasis|negative regulation of activated T cell proliferation|negative regulation of chronic inflammatory response|negative regulation of CREB transcription factor activity|negative regulation of cytokine secretion|negative regulation of histone acetylation|negative regulation of histone deacetylation|negative regulation of interferon-gamma biosynthetic process|negative regulation of interferon-gamma production|negative regulation of interleukin-10 production|negative regulation of interleukin-2 biosynthetic process|negative regulation of interleukin-2 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of interleukin-6 production|negative regulation of isotype switching to IgE isotypes|negative regulation of NF-kappaB transcription factor activity|negative regulation of T cell cytokine production|negative regulation of tumor necrosis factor production|pattern specification process|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation|positive regulation of histone acetylation|positive regulation of immature T cell proliferation in thymus|positive regulation of peripheral T cell tolerance induction|positive regulation of T cell anergy|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transforming growth factor-beta1 production|post-embryonic development|regulation of isotype switching to IgG isotypes|response to virus|T cell homeostasis|T cell receptor signaling pathway|tolerance induction to self antigen	cytoplasm|cytoplasm|nucleus|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|histone acetyltransferase binding|histone deacetylase binding|NF-kappaB binding|NFAT protein binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription corepressor activity|zinc ion binding				0	Ovarian(276;0.236)					CTCTCCACCCGCACAAAGCAC	0.632													3	39	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50052096	50052096	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50052096C>T	uc004dox.3	+	6	1225	c.927C>T	c.(925-927)ATC>ATT	p.I309I	CCNB3_uc004doy.2_Silent_p.I309I|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	309					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					AGACAACCATCTGTGGAGCAA	0.423													35	121	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50054316	50054316	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50054316G>C	uc004dox.3	+	6	3445	c.3147G>C	c.(3145-3147)TTG>TTC	p.L1049F	CCNB3_uc004doy.2_Missense_Mutation_p.L1049F|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	1049					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					AAACATTCTTGATCCCCCAAA	0.502													37	129	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54275803	54275803	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54275803C>A	uc004dtd.1	-	17	3417	c.2978G>T	c.(2977-2979)GGA>GTA	p.G993V	WNK3_uc004dtc.1_Missense_Mutation_p.G993V	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	993					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						TTTGGTGAGTCCCTCACATTC	0.448													39	50	---	---	---	---	PASS
TRO	7216	broad.mit.edu	37	X	54955416	54955416	+	Silent	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54955416T>C	uc004dtq.2	+	12	2366	c.2259T>C	c.(2257-2259)GGT>GGC	p.G753G	TRO_uc004dts.2_Intron|TRO_uc004dtr.2_Intron|TRO_uc004dtt.2_Intron|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Silent_p.G284G|TRO_uc004dtw.2_Silent_p.G356G|TRO_uc004dtx.2_Silent_p.G136G	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	753	1.|62 X 10 AA approximate tandem repeats.				embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						GCTTCAGTGGTGGACCTGGCA	0.542													8	25	---	---	---	---	PASS
MTMR8	55613	broad.mit.edu	37	X	63615252	63615252	+	5'UTR	SNP	T	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63615252T>C	uc004dvs.2	-	1					MTMR8_uc011mou.1_5'UTR|MTMR8_uc004dvt.1_5'UTR	NM_017677	NP_060147	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8							nuclear envelope	protein tyrosine phosphatase activity			ovary(2)|breast(2)	4						ATGACTGCAGTTCCCGCCACC	0.617													11	46	---	---	---	---	PASS
TAF1	6872	broad.mit.edu	37	X	70601652	70601652	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70601652G>A	uc004dzu.3	+	9	1468	c.1417G>A	c.(1417-1419)GAG>AAG	p.E473K	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.E494K	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	473					G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				CATTGACAATGAGGATCTGGT	0.453													7	185	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73071858	73071858	+	RNA	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73071858C>T	uc004ebm.1	-	1		c.731G>A				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						AAAAAAAAATCAAAGCAGGTA	0.408													5	15	---	---	---	---	PASS
ABCB7	22	broad.mit.edu	37	X	74284974	74284974	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74284974G>A	uc004eca.2	-	13	1787	c.1762C>T	c.(1762-1764)CAT>TAT	p.H588Y	ABCB7_uc004ebz.2_Missense_Mutation_p.H589Y|ABCB7_uc011mqn.1_Missense_Mutation_p.H562Y|ABCB7_uc010nls.2_Missense_Mutation_p.H549Y|ABCB7_uc010nlt.2_Missense_Mutation_p.H548Y	NM_004299	NP_004290	O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B, member 7	588	ABC transporter.				cellular iron ion homeostasis	integral to membrane|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|heme transporter activity			ovary(1)	1						ATTGCATCATGAAGTCCAGCT	0.433													12	57	---	---	---	---	PASS
MAGEE1	57692	broad.mit.edu	37	X	75650539	75650539	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75650539C>T	uc004ecm.1	+	1	2423	c.2216C>T	c.(2215-2217)TCA>TTA	p.S739L		NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	739						dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane				breast(3)|ovary(1)|pancreas(1)|skin(1)	6						GCCCCACATTCATGGCCTGAG	0.468													20	57	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76890178	76890178	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76890178C>T	uc004ecp.3	-	17	4948	c.4716G>A	c.(4714-4716)TGG>TGA	p.W1572*	ATRX_uc004ecq.3_Nonsense_Mutation_p.W1534*|ATRX_uc004eco.3_Nonsense_Mutation_p.W1357*	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1572					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	AGCAGCAATCCCACATAAACT	0.358			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						48	151	---	---	---	---	PASS
ATP7A	538	broad.mit.edu	37	X	77301851	77301851	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77301851G>C	uc004ecx.3	+	23	4447	c.4287G>C	c.(4285-4287)AAG>AAC	p.K1429N		NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1429	Cytoplasmic (Potential).				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						TAGGACAGAAGAGTCCTTCAG	0.423													163	151	---	---	---	---	PASS
LPAR4	2846	broad.mit.edu	37	X	78010547	78010547	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78010547C>G	uc010nme.2	+	2	586	c.181C>G	c.(181-183)CTG>GTG	p.L61V		NM_005296	NP_005287	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	61	Helical; Name=1; (Potential).					integral to plasma membrane	lipid binding|purinergic nucleotide receptor activity, G-protein coupled			ovary(3)	3						CAGTGTCTCTCTGTTTGTCTT	0.373													99	264	---	---	---	---	PASS
TBX22	50945	broad.mit.edu	37	X	79279607	79279607	+	Silent	SNP	A	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79279607A>T	uc010nmg.1	+	4	536	c.402A>T	c.(400-402)CCA>CCT	p.P134P	TBX22_uc004edi.1_Silent_p.P14P|TBX22_uc004edj.1_Silent_p.P134P	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN	T-box 22 isoform 1	134	T-box.				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						GGTTGGATCCAGGGAAGCAGT	0.507													30	38	---	---	---	---	PASS
MORC4	79710	broad.mit.edu	37	X	106228351	106228351	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106228351G>A	uc004emu.3	-	5	892	c.649C>T	c.(649-651)CGT>TGT	p.R217C	MORC4_uc004emp.3_Intron|MORC4_uc004emv.3_Missense_Mutation_p.R217C|MORC4_uc004emw.3_Intron	NM_024657	NP_078933	Q8TE76	MORC4_HUMAN	zinc finger, CW type with coiled-coil domain 2	217							ATP binding|zinc ion binding			ovary(1)	1						ATGAGAACACGAGTGCCTTTT	0.388													43	115	---	---	---	---	PASS
CXorf41	139212	broad.mit.edu	37	X	106466060	106466060	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106466060A>G	uc004enc.2	+	5	480	c.418A>G	c.(418-420)AGT>GGT	p.S140G	CXorf41_uc004end.2_Missense_Mutation_p.S140G	NM_173494	NP_775765	Q9NQM4	CX041_HUMAN	hypothetical protein LOC139212	140											0						AGGTTGTTGCAGTGAACTAGT	0.358													37	89	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107403859	107403859	+	Silent	SNP	G	A	A	rs139555294	byFrequency	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107403859G>A	uc004enw.3	-	43	4465	c.4362C>T	c.(4360-4362)TTC>TTT	p.F1454F	COL4A6_uc004env.3_Silent_p.F1453F|COL4A6_uc011msn.1_Silent_p.F1429F|COL4A6_uc010npk.2_Silent_p.F1396F|COL4A6_uc011msm.1_5'Flank|COL4A6_uc010npj.2_Intron	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	1454	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						CAGGCATCCCGAAGGGGCCTT	0.522									Alport_syndrome_with_Diffuse_Leiomyomatosis				6	117	---	---	---	---	PASS
ALG13	79868	broad.mit.edu	37	X	110925357	110925357	+	Intron	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110925357C>T	uc011msy.1	+						ALG13_uc004epi.1_Intron|ALG13_uc011msw.1_Intron|ALG13_uc011msx.1_Intron|ALG13_uc011msz.1_Intron|ALG13_uc011mta.1_Intron|ALG13_uc011mtb.1_Intron			Q9NP73	ALG13_HUMAN	SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);						dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity			lung(1)	1						TTTCCTCTTTCAGAAAATCGA	0.453													24	215	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111195371	111195371	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111195371C>G	uc004epl.1	-	2	1197	c.278G>C	c.(277-279)AGC>ACC	p.S93T	TRPC5_uc004epm.1_Missense_Mutation_p.S93T	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	93	ANK 2.|Cytoplasmic (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						CACATACACGCTGTGGTTCAG	0.557													81	93	---	---	---	---	PASS
LONRF3	79836	broad.mit.edu	37	X	118143099	118143099	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118143099C>G	uc004eqw.2	+	7	1572	c.1541C>G	c.(1540-1542)TCA>TGA	p.S514*	LONRF3_uc004eqx.2_Nonsense_Mutation_p.S473*|LONRF3_uc004eqy.2_RNA|LONRF3_uc004eqz.2_Nonsense_Mutation_p.S258*	NM_001031855	NP_001027026	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger	514					proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)	2						TGCTTGGCATCAAGAAAATAC	0.383													26	85	---	---	---	---	PASS
SEPT6	23157	broad.mit.edu	37	X	118769069	118769069	+	Intron	SNP	G	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118769069G>T	uc004erv.2	-						SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Intron|SEPT6_uc004ert.2_Intron|SEPT6_uc004eru.2_Intron|SEPT6_uc004erw.2_Intron|SEPT6_uc011mtv.1_Intron|SEPT6_uc011mtw.1_Intron	NM_015129	NP_055944	Q14141	SEPT6_HUMAN	septin 6 isoform B						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4						AAGGGAAGCAGAACTCCCAGG	0.199													3	6	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	124029949	124029949	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:124029949G>C	uc004euj.2	-	2	423	c.359C>G	c.(358-360)GCA>GGA	p.A120G	ODZ1_uc011muj.1_Missense_Mutation_p.A120G|ODZ1_uc010nqy.2_Missense_Mutation_p.A120G	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	120	Teneurin N-terminal.|Cytoplasmic (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						CATTCTTAGTGCATGGTCAGG	0.498													82	243	---	---	---	---	PASS
OCRL	4952	broad.mit.edu	37	X	128692883	128692883	+	Silent	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128692883C>G	uc004euq.2	+	8	792	c.627C>G	c.(625-627)CTC>CTG	p.L209L	OCRL_uc004eur.2_Silent_p.L209L	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase	209					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						TGCGGAAGCTCTTTGTACCAA	0.428													10	120	---	---	---	---	PASS
MAGEC2	51438	broad.mit.edu	37	X	141291553	141291553	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:141291553C>A	uc004fbu.1	-	3	569	c.221G>T	c.(220-222)GGT>GTT	p.G74V		NM_016249	NP_057333	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	74						cytoplasm|nucleus				breast(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TGGTATCACACCAGAGGGCAC	0.393										HNSCC(46;0.14)			51	25	---	---	---	---	PASS
FMR1	2332	broad.mit.edu	37	X	147018994	147018994	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147018994C>T	uc010nst.2	+	11	1189	c.1000C>T	c.(1000-1002)CCA>TCA	p.P334S	FMR1_uc004fcj.2_Missense_Mutation_p.P332S|FMR1_uc004fck.3_Missense_Mutation_p.P334S|FMR1_uc004fcl.3_Missense_Mutation_p.P195S|FMR1_uc011mxa.1_Missense_Mutation_p.P2S	NM_002024	NP_002015	Q06787	FMR1_HUMAN	fragile X mental retardation 1	334					mRNA transport|negative regulation of translational initiation	cytoplasm|mRNA cap binding complex|nucleolus|nucleoplasm|soluble fraction	mRNA binding|protein binding			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GGAAATTATGCCACCAAATTC	0.264									Fragile_X_syndrome				4	141	---	---	---	---	PASS
AFF2	2334	broad.mit.edu	37	X	148069098	148069098	+	Intron	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148069098C>G	uc004fcp.2	+						AFF2_uc004fcq.2_Intron|AFF2_uc004fcr.2_Intron|AFF2_uc011mxb.1_Intron|AFF2_uc004fcs.2_Intron|AFF2_uc011mxc.1_Intron	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2						brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					GTATGCTCATCTGTTCTACCC	0.443													27	59	---	---	---	---	PASS
OPN1LW	5956	broad.mit.edu	37	X	153416362	153416362	+	Missense_Mutation	SNP	C	G	G	rs1065422		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153416362C>G	uc004fjz.3	+	2	380	c.347C>G	c.(346-348)TCT>TGT	p.S116C		NM_020061	NP_064445	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	116	Extracellular.				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AACCAGGTCTCTGGCTACTTC	0.617													30	107	---	---	---	---	PASS
OPN1LW	5956	broad.mit.edu	37	X	153416372	153416372	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153416372C>G	uc004fjz.3	+	2	390	c.357C>G	c.(355-357)TTC>TTG	p.F119L		NM_020061	NP_064445	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	119	Extracellular.				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGGCTACTTCGTGCTGGGCC	0.607													27	104	---	---	---	---	PASS
F8	2157	broad.mit.edu	37	X	154159454	154159454	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154159454C>G	uc004fmt.2	-	14	2782	c.2611G>C	c.(2611-2613)GAG>CAG	p.E871Q		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	871	B.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	AGGCCTGACTCAGGGGTAAAT	0.423													35	76	---	---	---	---	PASS
MTCP1	4515	broad.mit.edu	37	X	154294059	154294059	+	Silent	SNP	C	T	T			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154294059C>T	uc004fmz.2	-	3	737	c.111G>A	c.(109-111)ACG>ACA	p.T37T	MTCP1NB_uc004fmy.2_Intron	NM_001018025	NP_001018025	P56278	MTCP1_HUMAN	mature T-cell proliferation 1	37					cell proliferation					lung(1)	1	all_cancers(53;3.51e-17)|all_epithelial(53;5.13e-11)|all_lung(58;3.84e-07)|Lung NSC(58;1.2e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TTAGGAAACTCGTCTCCTAAT	0.423			T	TRA@	T cell prolymphocytic leukemia								62	47	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37271562	37271563	+	Intron	DEL	AG	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37271562_37271563delAG	uc001caz.2	-						GRIK3_uc001cba.1_Intron	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3						negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	aaaaaaaaaaagaaaagaacag	0.243													4	2	---	---	---	---	
PPT1	5538	broad.mit.edu	37	1	40558364	40558367	+	Intron	DEL	ACTT	-	-	rs72144657		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40558364_40558367delACTT	uc001cfb.2	-						PPT1_uc010ojf.1_5'Flank|PPT1_uc010ojg.1_Intron|PPT1_uc009vwa.2_Intron	NM_000310	NP_000301	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1 isoform 1						brain development|cofactor metabolic process|cofactor transport|DNA fragmentation involved in apoptotic nuclear change|lysosomal lumen acidification|membrane raft organization|negative regulation of cell growth|negative regulation of neuron apoptosis|neuron development|pinocytosis|positive regulation of pinocytosis|positive regulation of receptor-mediated endocytosis|protein depalmitoylation|protein transport|receptor-mediated endocytosis|regulation of synapse structure and activity|sphingolipid catabolic process|visual perception	axon|cytosol|Golgi apparatus|lysosome|membrane fraction|membrane raft|nucleus|synaptic vesicle	palmitoyl-(protein) hydrolase activity|palmitoyl-CoA hydrolase activity			ovary(1)	1	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			tctataactcacttacaactcaac	0.000													10	16	---	---	---	---	
PCNXL2	80003	broad.mit.edu	37	1	233424551	233424551	+	Intron	DEL	T	-	-	rs10558976		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233424551delT	uc001hvl.2	-							NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				AAAGATGCCCttttttttttt	0.358													4	2	---	---	---	---	
MTA3	57504	broad.mit.edu	37	2	42760223	42760223	+	Intron	DEL	C	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42760223delC	uc002rso.1	+							NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						GTGGGGCAttctttttttttt	0.239													13	7	---	---	---	---	
NCAPH	23397	broad.mit.edu	37	2	97017424	97017424	+	Intron	DEL	C	-	-	rs772153		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97017424delC	uc002svz.1	+						NCAPH_uc010fhu.1_Intron|NCAPH_uc010fhv.1_Intron|NCAPH_uc010yum.1_Intron|NCAPH_uc010fhw.1_Intron|NCAPH_uc010yun.1_Intron|NCAPH_uc002swa.1_Intron	NM_015341	NP_056156	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|microtubule cytoskeleton|nucleus				urinary_tract(1)|skin(1)	2		Ovarian(717;0.0221)				aaaaaaaaaacaaaaacaaaC	0.189													4	2	---	---	---	---	
IL1B	3553	broad.mit.edu	37	2	113596301	113596304	+	5'Flank	DEL	TTTC	-	-	rs10560590		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113596301_113596304delTTTC	uc002tii.1	-							NM_000576	NP_000567	P01584	IL1B_HUMAN	interleukin 1, beta proprotein						activation of MAPK activity|anti-apoptosis|apoptosis|cell-cell signaling|cellular response to drug|cellular response to mechanical stimulus|cytokine-mediated signaling pathway|embryo implantation|fever generation|negative regulation of adiponectin secretion|negative regulation of cell proliferation|negative regulation of glucose transport|negative regulation of insulin receptor signaling pathway|negative regulation of lipid catabolic process|negative regulation of MAP kinase activity|positive regulation of angiogenesis|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of cell adhesion molecule production|positive regulation of cell division|positive regulation of fever generation|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of heterotypic cell-cell adhesion|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of interferon-gamma production|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of lipid catabolic process|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mitosis|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myosin light chain kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|positive regulation of protein export from nucleus|positive regulation of T cell proliferation|positive regulation vascular endothelial growth factor production|regulation of insulin secretion|sequestering of triglyceride|smooth muscle adaptation	cytosol|extracellular space	cytokine activity|growth factor activity|interleukin-1 receptor binding|protein domain specific binding			lung(3)|breast(1)	4					Anakinra(DB00026)|Minocycline(DB01017)|Procaterol(DB01366)	tttcttttcttttctttctttctt	0.103													4	2	---	---	---	---	
BAZ2B	29994	broad.mit.edu	37	2	160206201	160206202	+	Intron	DEL	AC	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160206201_160206202delAC	uc002uao.2	-						BAZ2B_uc002uap.2_Intron	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						AAAATGAGTTACAGTTAGCAGT	0.401													33	35	---	---	---	---	
ZFAND2B	130617	broad.mit.edu	37	2	220071843	220071843	+	Intron	DEL	C	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220071843delC	uc002vka.2	+						ZFAND2B_uc010zkt.1_Intron|ZFAND2B_uc010fwd.1_Intron|ZFAND2B_uc002vjy.1_Intron|ZFAND2B_uc002vjz.1_Intron|ZFAND2B_uc002vkb.1_5'Flank	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B							endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGGTGGGCTCCCAGGCTGGC	0.597													4	3	---	---	---	---	
SLC4A7	9497	broad.mit.edu	37	3	27424683	27424683	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27424683delC	uc003cdv.2	-	24	3595	c.3524delG	c.(3523-3525)GGAfs	p.G1175fs	SLC4A7_uc011awu.1_RNA|SLC4A7_uc011awv.1_RNA|SLC4A7_uc003cdu.3_Frame_Shift_Del_p.G1056fs|SLC4A7_uc011aww.1_Frame_Shift_Del_p.G1184fs|SLC4A7_uc011awx.1_Frame_Shift_Del_p.G1171fs|SLC4A7_uc011awy.1_Frame_Shift_Del_p.G1167fs|SLC4A7_uc011awz.1_RNA|SLC4A7_uc011axa.1_Frame_Shift_Del_p.G1056fs|SLC4A7_uc011axb.1_Frame_Shift_Del_p.G1171fs|SLC4A7_uc010hfl.2_Frame_Shift_Del_p.G725fs|SLC4A7_uc003cdw.2_Frame_Shift_Del_p.G1051fs	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate	1175	Cytoplasmic (Potential).					apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)|skin(1)	5						CAAGAGACTTCCCCCTTCAAA	0.363													128	68	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48596037	48596037	+	Intron	DEL	A	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48596037delA	uc003gyh.1	-						FRYL_uc003gyk.2_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						AGCGTTCCTTAAAAAAAAAAA	0.169													3	4	---	---	---	---	
F11	2160	broad.mit.edu	37	4	187195492	187195492	+	Intron	DEL	C	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187195492delC	uc003iza.1	+						F11_uc003iyz.2_3'UTR	NM_000128	NP_000119	P03951	FA11_HUMAN	coagulation factor XI precursor						blood coagulation, intrinsic pathway|plasminogen activation|positive regulation of fibrinolysis	extracellular space|plasma membrane	heparin binding|serine-type endopeptidase activity				0		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	TACTAAAAAGCTTTTGCCATC	0.398													36	19	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37349352	37349355	+	Intron	DEL	AAGT	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37349352_37349355delAAGT	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TAGGATCTAAAAGTAAGACAAAAA	0.260													4	2	---	---	---	---	
DSP	1832	broad.mit.edu	37	6	7565382	7565382	+	Intron	DEL	A	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7565382delA	uc003mxp.1	+						DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		agtccgtctcaaaaaaaaaaa	0.189													5	3	---	---	---	---	
KIF13A	63971	broad.mit.edu	37	6	17940280	17940280	+	Intron	DEL	A	-	-	rs138274227		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17940280delA	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			ctcataaattaaaaaaaaaaa	0.005													4	2	---	---	---	---	
RARS2	57038	broad.mit.edu	37	6	88272604	88272605	+	Intron	INS	-	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88272604_88272605insA	uc003pme.2	-						RARS2_uc003pmb.2_Intron|RARS2_uc003pmc.2_Intron|RARS2_uc003pmd.2_Intron|RARS2_uc003pmf.2_Intron	NM_020320	NP_064716	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial						arginyl-tRNA aminoacylation	mitochondrial matrix	arginine-tRNA ligase activity|ATP binding|protein binding			ovary(2)|central_nervous_system(1)	3		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		ACAAGTAAGTCATCTTTCATGG	0.342													26	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	94495532	94495533	+	IGR	DEL	TG	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:94495532_94495533delTG								TSG1 (9333 upstream) : None (None downstream)																							TATGTACCGCtgtgtgtgtgtg	0.238													4	2	---	---	---	---	
AIM1	202	broad.mit.edu	37	6	106978407	106978408	+	Intron	INS	-	G	G	rs149729831	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106978407_106978408insG	uc003prh.2	+							NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1								sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TTATAGGAAATGGGGGGGGATT	0.322													4	3	---	---	---	---	
RSPH10B2	728194	broad.mit.edu	37	7	6804340	6804341	+	Intron	DEL	TG	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6804340_6804341delTG	uc003sqw.1	+						RSPH10B2_uc010ktk.1_Intron|RSPH10B2_uc011jxc.1_Intron|RSPH10B2_uc010ktl.1_Intron	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B											ovary(1)|pancreas(1)|skin(1)	3						TTGTTGTTGTtgtgtgtgtgtg	0.243													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57886274	57886275	+	IGR	INS	-	CCCA	CCCA	rs145944938	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57886274_57886275insCCCA								ZNF716 (353009 upstream) : None (None downstream)																							ACCACCTGCAGCCCAGGGCTCC	0.599													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	72832789	72832792	+	IGR	DEL	CTTC	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72832789_72832792delCTTC								FKBP6 (60148 upstream) : FZD9 (15317 downstream)																							GCTctttcttcttccttccttcct	0.314													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98408891	98408893	+	IGR	DEL	TAG	-	-	rs140739561	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98408891_98408893delTAG								NPTX2 (149710 upstream) : TMEM130 (35219 downstream)																							gtggtggtgatagtggtggtggt	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128762518	128762529	+	IGR	DEL	TCCTTCCTTCCA	-	-	rs11784480	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128762518_128762529delTCCTTCCTTCCA								MYC (8840 upstream) : PVT1 (44250 downstream)																							cttccttccttccttccttccatccttccttc	0.000													4	2	---	---	---	---	
CBWD1	55871	broad.mit.edu	37	9	162478	162479	+	Intron	INS	-	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:162478_162479insA	uc003zga.3	-						CBWD1_uc010mgs.2_Intron|CBWD1_uc003zgb.3_Intron|CBWD1_uc003zgc.3_Intron|CBWD1_uc011llr.1_Intron	NM_018491	NP_060961	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1 isoform 1								ATP binding|protein binding			ovary(1)	1	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		ACCTACAAAGGAAAAAACATTT	0.272													9	6	---	---	---	---	
KIAA0649	9858	broad.mit.edu	37	9	138376850	138376850	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138376850delC	uc004cfr.1	+	4	1043	c.494delC	c.(493-495)GCCfs	p.A165fs		NM_014811	NP_055626	Q5T8A7	K0649_HUMAN	1A6/DRIM (down-regulated in metastasis)	165						nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;6.91e-08)|Epithelial(140;4.69e-07)|all cancers(34;9.33e-06)		CCTTCCAGGGCCGCAGGCGGA	0.672													37	35	---	---	---	---	
POLR2L	5441	broad.mit.edu	37	11	840579	840579	+	Intron	DEL	C	-	-	rs34627090		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:840579delC	uc001lsc.2	-						TSPAN4_uc001lsd.1_5'Flank|TSPAN4_uc001lse.1_5'Flank|TSPAN4_uc001lsf.1_5'Flank|TSPAN4_uc001lsg.1_5'Flank|TSPAN4_uc001lsh.1_5'Flank	NM_021128	NP_066951	P62875	RPAB5_HUMAN	DNA directed RNA polymerase II polypeptide L						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;4.1e-25)|Epithelial(43;3.15e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTGGCCTCACCCCCCCCGCC	0.607													1	9	---	---	---	---	
MUC5B	727897	broad.mit.edu	37	11	1265952	1265952	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1265952delG	uc009ycr.1	+	48	9882	c.9756delG	c.(9754-9756)ACGfs	p.T3252fs	MUC5B_uc001ltb.2_Frame_Shift_Del_p.T2617fs	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	2614	7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCACAACCACGGGCTTCACAG	0.647													59	39	---	---	---	---	
OR51A4	401666	broad.mit.edu	37	11	4967535	4967535	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4967535delC	uc010qys.1	-	1	796	c.796delG	c.(796-798)GCCfs	p.A266fs		NM_001005329	NP_001005329	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A,	266	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACATGCCGGGCAAAGCGGTGG	0.453													91	48	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	61711676	61711681	+	IGR	DEL	TCCTTC	-	-	rs148785004	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61711676_61711681delTCCTTC								RAB3IL1 (23935 upstream) : BEST1 (5675 downstream)																							ttccttcctttccttcccttccttcc	0.010													4	2	---	---	---	---	
XRRA1	143570	broad.mit.edu	37	11	74645032	74645033	+	Intron	INS	-	TTCA	TTCA	rs140602440	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74645032_74645033insTTCA	uc009yub.2	-						XRRA1_uc001ovm.2_Intron|XRRA1_uc001ovo.2_Intron|XRRA1_uc001ovq.3_Intron|XRRA1_uc001ovp.3_Intron|XRRA1_uc001ovr.2_Intron	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1						response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1						TTGTTTGCTTGttcattcattc	0.193													4	2	---	---	---	---	
OR8B8	26493	broad.mit.edu	37	11	124310156	124310156	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124310156delG	uc010sal.1	-	1	826	c.826delC	c.(826-828)CTAfs	p.L276fs		NM_012378	NP_036510	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B,	276	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		GTATAGAATAGGGAAGACACC	0.418													100	58	---	---	---	---	
IFFO1	25900	broad.mit.edu	37	12	6656906	6656907	+	Intron	DEL	AG	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6656906_6656907delAG	uc001qpd.1	-						IFFO1_uc001qoy.2_Intron|IFFO1_uc001qpa.1_Intron|IFFO1_uc001qpb.1_Intron|IFFO1_uc001qpe.1_Intron|IFFO1_uc010sfe.1_Intron|IFFO1_uc001qpf.1_Intron|IFFO1_uc001qoz.1_Intron|IFFO1_uc001qpc.1_Intron|IFFO1_uc001qpg.2_Intron	NM_080730	NP_542768	Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan isoform 2							intermediate filament					0						ggggaggggaagagagagagag	0.010													6	4	---	---	---	---	
SLC11A2	4891	broad.mit.edu	37	12	51402086	51402087	+	Intron	DEL	GT	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51402086_51402087delGT	uc001rxe.3	-						SLC11A2_uc001rxd.3_Intron|SLC11A2_uc001rxc.3_Intron|SLC11A2_uc001rxf.2_Intron|SLC11A2_uc010smx.1_Intron|SLC11A2_uc001rxh.1_Intron|SLC11A2_uc001rxj.1_Intron|SLC11A2_uc001rxi.2_Intron|SLC11A2_uc001rxk.1_Intron|SLC11A2_uc010smy.1_Intron	NM_000617	NP_000608	P49281	NRAM2_HUMAN	solute carrier family 11 (proton-coupled						activation of caspase activity|cellular iron ion homeostasis|cellular response to oxidative stress|detection of oxygen|ferrous iron import|multicellular organismal iron ion homeostasis|response to hypoxia|response to iron ion	apical plasma membrane|basal part of cell|cell surface|cytoplasmic vesicle|early endosome|late endosome|late endosome membrane|lysosomal membrane|lysosome|nucleus|paraferritin complex|perinuclear region of cytoplasm|perinuclear region of cytoplasm|plasma membrane|recycling endosome|trans-Golgi network	cadmium ion transmembrane transporter activity|cadmium ion transmembrane transporter activity|cobalt ion transmembrane transporter activity|copper ion transmembrane transporter activity|ferrous iron transmembrane transporter activity|ferrous iron transmembrane transporter activity|lead ion transmembrane transporter activity|lead ion transmembrane transporter activity|manganese ion transmembrane transporter activity|manganese ion transmembrane transporter activity|nickel ion transmembrane transporter activity|protein binding|solute:hydrogen symporter activity|vanadium ion transmembrane transporter activity|zinc ion transmembrane transporter activity			large_intestine(1)	1						taTAGATGGGgtgtgtgtgtgt	0.144													4	2	---	---	---	---	
KIF5A	3798	broad.mit.edu	37	12	57975862	57975862	+	Intron	DEL	A	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57975862delA	uc001sor.1	+						KIF5A_uc010srr.1_Intron|uc001sos.2_5'Flank	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A						blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						GGCTTCAAATAAAAAaaaaaa	0.224													4	3	---	---	---	---	
GNS	2799	broad.mit.edu	37	12	65130629	65130629	+	Intron	DEL	A	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65130629delA	uc001ssg.3	-						GNS_uc001ssf.2_Intron|GNS_uc010ssq.1_Intron|GNS_uc010ssr.1_Intron	NM_002076	NP_002067	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase precursor							lysosome	metal ion binding|N-acetylglucosamine-6-sulfatase activity|protein binding			central_nervous_system(1)	1	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		GAAGTTAAGGAAAAAAAAAAG	0.383													4	2	---	---	---	---	
CEP290	80184	broad.mit.edu	37	12	88514121	88514121	+	Intron	DEL	T	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88514121delT	uc001tar.2	-						CEP290_uc001tat.2_Intron|CEP290_uc009zsl.1_Intron	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						AAGTTCATGATTTTTTTTTTA	0.244													4	2	---	---	---	---	
LOC284232	284232	broad.mit.edu	37	13	19420047	19420053	+	RNA	DEL	TTCGTAT	-	-	rs117180361	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19420047_19420053delTTCGTAT	uc010tcj.1	-	1		c.26057_26063delATACGAA				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						ATAACATTTCTTCGTATTTTATATTTT	0.246													4	2	---	---	---	---	
DZIP1	22873	broad.mit.edu	37	13	96237022	96237022	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96237022delC	uc001vmk.2	-	22	3344	c.2492delG	c.(2491-2493)GGCfs	p.G831fs	DZIP1_uc001vmi.2_Frame_Shift_Del_p.G79fs|DZIP1_uc001vmj.2_Frame_Shift_Del_p.G307fs|DZIP1_uc001vml.2_Frame_Shift_Del_p.G812fs|DZIP1_uc001vmm.2_5'Flank	NM_198968	NP_945319	Q86YF9	DZIP1_HUMAN	DAZ interacting protein 1 isoform 2	831					germ cell development|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			ATTAAATGCGCCCCAGGCATT	0.413													156	103	---	---	---	---	
TRPM7	54822	broad.mit.edu	37	15	50882045	50882046	+	Intron	INS	-	TTTTTTG	TTTTTTG	rs148695282	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50882045_50882046insTTTTTTG	uc001zyt.3	-						TRPM7_uc010bew.1_Intron	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,						cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		AGGTTACAGttttttttgtttt	0.178													4	2	---	---	---	---	
CES1	1066	broad.mit.edu	37	16	55845084	55845085	+	Intron	INS	-	G	G	rs138015167	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55845084_55845085insG	uc002eim.2	-						CES1_uc010ccf.2_Intron|CES1_uc002eil.2_Intron|CES1_uc002ein.2_Intron	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor						response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	ATGAATCAAATGGGCTTATATC	0.347													4	2	---	---	---	---	
GGNBP2	79893	broad.mit.edu	37	17	34923771	34923771	+	Intron	DEL	T	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34923771delT	uc002hnb.2	+						GGNBP2_uc002hna.2_Intron	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		AGGCAGTTCCttttttttttt	0.219													4	2	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59482169	59482169	+	Intron	DEL	C	-	-	rs35619711		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59482169delC	uc010wox.1	+						TBX2_uc002ize.2_Frame_Shift_Del_p.R354fs|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						GAGGTGGCGGCGGGGGGTCCT	0.706													3	5	---	---	---	---	
ACE	1636	broad.mit.edu	37	17	61574285	61574287	+	In_Frame_Del	DEL	GGA	-	-	rs138240046		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61574285_61574287delGGA	uc002jau.1	+	24	3652_3654	c.3630_3632delGGA	c.(3628-3633)ACGGAG>ACG	p.E1211del	ACE_uc002jav.1_In_Frame_Del_p.E637del|ACE_uc010ddv.1_In_Frame_Del_p.E438del|ACE_uc010wpj.1_In_Frame_Del_p.E596del|ACE_uc002jaw.1_RNA|ACE_uc010wpk.1_In_Frame_Del_p.E416del	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	1211	Extracellular (Potential).|Peptidase M2 2.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GGCTCCGCACGGAGAACGAGCTG	0.655													32	18	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	9006152	9006153	+	Intron	INS	-	AA	AA			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9006152_9006153insAA	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GATGGACTCTGGAATCTCTCAG	0.505													3	8	---	---	---	---	
ZSCAN5A	79149	broad.mit.edu	37	19	56755967	56755971	+	Intron	DEL	CAAGG	-	-	rs57532903		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56755967_56755971delCAAGG	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						tttgttgtcacaagggggaggacag	0.117													4	2	---	---	---	---	
TCN2	6948	broad.mit.edu	37	22	31019235	31019236	+	Intron	INS	-	C	C	rs148568974	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31019235_31019236insC	uc003aip.1	+						TCN2_uc003aiq.1_Intron|TCN2_uc003air.1_Intron	NM_000355	NP_000346	P20062	TCO2_HUMAN	transcobalamin II precursor						cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAAGCCTTAGAATTTTTATGCA	0.361													3	3	---	---	---	---	
C22orf23	84645	broad.mit.edu	37	22	38347218	38347219	+	Intron	INS	-	A	A			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38347218_38347219insA	uc003auj.1	-						C22orf23_uc003auk.1_Intron|POLR2F_uc010gxi.2_5'Flank|POLR2F_uc003aul.2_5'Flank|POLR2F_uc003aum.2_5'Flank	NM_032561	NP_115950	Q9BZE7	EVG1_HUMAN	hypothetical protein LOC84645												0	Melanoma(58;0.045)					gactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SAPS2	9701	broad.mit.edu	37	22	50836289	50836290	+	Intron	INS	-	CC	CC	rs139970798	by1000genomes	TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50836289_50836290insCC	uc003blb.1	+						SAPS2_uc003bky.1_Intron|SAPS2_uc003bkz.1_Intron|SAPS2_uc003blc.2_Intron|SAPS2_uc003bla.1_Intron	NM_014678	NP_055493	O75170	PP6R2_HUMAN	SAPS domain family, member 2							cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)		AGCCTTGTCATCTCTGAGCTTT	0.589													5	3	---	---	---	---	
CXorf23	256643	broad.mit.edu	37	X	19953721	19953721	+	Intron	DEL	A	-	-			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19953721delA	uc004czp.2	-						CXorf23_uc010nfn.2_Intron|CXorf23_uc011mjg.1_Intron|CXorf23_uc004czo.2_Intron	NM_198279	NP_938020	A2AJT9	CX023_HUMAN	hypothetical protein LOC256643							mitochondrion				lung(1)|skin(1)	2						atctactggtaaaaaaaaaaa	0.209													4	2	---	---	---	---	
FAAH2	158584	broad.mit.edu	37	X	57458220	57458220	+	Intron	DEL	G	-	-	rs6521622		TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57458220delG	uc004dvc.2	+							NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2							integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3						ttgtttttttgttttttttgg	0.060										HNSCC(52;0.14)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	M	493	494	+	5'Flank	INS	-	C	C			TCGA-66-2785-01	TCGA-66-2785-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:493_494insC	uc004coq.3	-						uc004cor.1_5'Flank|uc004cos.3_5'Flank					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		CTCATCAATACAACCCCCGCCC	0.480													6	4	---	---	---	---	
