Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	Oncotatorv0393GAF20hg19Feb2011dbSNPbuild132UniProtRelease2011_6	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	context_orig	context65	gene_name	categ	categ_ignoring_null_categ
PNLIPRP3	119548	broad.mit.edu	37	10	118228809	118228810	+	Missense_Mutation	DNP	GG	CT	CT			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:118228809_118228810GG>CT	uc001lcl.3	+	c.1040_1041GG>CT	c.(1039-1041)GGG>GCT	p.G347A		NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3 precursor	347					lipid catabolic process	extracellular region	triglyceride lipase activity			ovary(1)	1				all cancers(201;0.0131)										0.24	18.937189	20.479624	6	19	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	118228809	118228810	12578	10	GG	CT	CT	CT	559	43	PNLIPRP3	3	3
PRLHR	2834	broad.mit.edu	37	10	120354273	120354273	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:120354273C>G	uc001ldp.1	-	c.484G>C	c.(484-486)GTG>CTG	p.V162L		NM_004248	NP_004239	P49683	PRLHR_HUMAN	G protein-coupled receptor 10	162	Cytoplasmic (Potential).				female pregnancy	integral to plasma membrane	neuropeptide Y receptor activity				0		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)										0.163265	17.171331	22.451314	8	41	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	120354273	120354273	12973	10	C	G	G	G	247	19	PRLHR	3	3
IKZF5	64376	broad.mit.edu	37	10	124753980	124753980	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:124753980G>T	uc001lha.2	-	c.576C>A	c.(574-576)AGC>AGA	p.S192R	IKZF5_uc001lgz.2_Missense_Mutation_p.S30R	NM_022466	NP_071911	Q9H5V7	IKZF5_HUMAN	zinc finger protein, subfamily 1A, 5	192					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_neural(114;0.169)|Colorectal(57;0.178)|Glioma(114;0.222)		Colorectal(40;0.0701)|COAD - Colon adenocarcinoma(40;0.0754)										0.184987	143.947179	178.694771	69	304	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	124753980	124753980	7919	10	G	T	T	T	594	46	IKZF5	2	2
C10orf90	118611	broad.mit.edu	37	10	128118366	128118366	+	Nonsense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:128118366G>A	uc010qum.1	-	c.2242C>T	c.(2242-2244)CGA>TGA	p.R748*	C10orf90_uc001ljp.2_Nonsense_Mutation_p.R507*|C10orf90_uc001ljq.2_Nonsense_Mutation_p.R651*|C10orf90_uc001ljo.2_Non-coding_Transcript	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611	651											0		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)										0.166667	30.637486	40.752813	16	80	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	128118366	128118366	1660	10	G	A	A	A	493	38	C10orf90	5	1
DOCK1	1793	broad.mit.edu	37	10	129152931	129152931	+	Splice_Site_SNP	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:129152931A>G	uc010qun.1	+	c.3225_splice	c.e32-2	p.K1075_splice	DOCK1_uc001ljt.2_Splice_Site_SNP_p.K1054_splice|DOCK1_uc009yaq.2_Splice_Site_SNP_p.K49_splice	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)										0.191406	115.127398	137.903428	49	207	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	129152931	129152931	4868	10	A	G	G	G	91	7	DOCK1	5	4
MKI67	4288	broad.mit.edu	37	10	129902310	129902310	+	Silent	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:129902310C>A	uc001lke.2	-	c.7794G>T	c.(7792-7794)ACG>ACT	p.T2598T	MKI67_uc001lkf.2_Silent_p.T2238T|MKI67_uc009yav.1_Silent_p.T2173T|MKI67_uc009yaw.1_Silent_p.T1748T	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	2598	14.|16 X 122 AA approximate repeats.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(1)	5		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)												0.324232	265.89995	273.947412	95	198	KEEP	---	---	---	---	capture		Silent	SNP	129902310	129902310	9988	10	C	A	A	A	392	31	MKI67	1	1
ZEB1	6935	broad.mit.edu	37	10	31809098	31809098	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:31809098C>T	uc001ivu.3	+	c.838C>T	c.(838-840)CAT>TAT	p.H280Y	ZEB1_uc001ivr.3_Missense_Mutation_p.H61Y|ZEB1_uc010qee.1_Missense_Mutation_p.H61Y|ZEB1_uc010qef.1_Missense_Mutation_p.H61Y|ZEB1_uc009xlj.1_Missense_Mutation_p.H205Y|ZEB1_uc010qeg.1_Missense_Mutation_p.H138Y|ZEB1_uc009xlk.1_Missense_Mutation_p.H61Y|ZEB1_uc001ivs.3_Missense_Mutation_p.H279Y|ZEB1_uc001ivt.3_Missense_Mutation_p.H61Y|ZEB1_uc001ivv.3_Missense_Mutation_p.H259Y|ZEB1_uc010qeh.1_Missense_Mutation_p.H212Y|ZEB1_uc009xlo.1_Missense_Mutation_p.H262Y|ZEB1_uc009xlp.2_Missense_Mutation_p.H263Y	NM_030751	NP_001121600	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b	279	C2H2-type 4; atypical.				cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter	cytoplasm	sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|transcription repressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)				Ovarian(40;423 959 14296 36701 49589)								0.358974	41.738349	42.421704	14	25	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	31809098	31809098	18211	10	C	T	T	T	273	21	ZEB1	2	2
RBP3	5949	broad.mit.edu	37	10	48387854	48387854	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:48387854C>A	uc001jez.2	-	c.3024G>T	c.(3022-3024)AAG>AAT	p.K1008N		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	1008	4 X approximate tandem repeats.|4.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)									0.390323	336.371748	339.648095	121	189	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	48387854	48387854	13626	10	C	A	A	A	311	24	RBP3	2	2
PCDH15	65217	broad.mit.edu	37	10	56128953	56128953	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:56128953C>T	uc010qhy.1	-	c.416G>A	c.(415-417)CGA>CAA	p.R139Q	PCDH15_uc010qhq.1_Missense_Mutation_p.R139Q|PCDH15_uc010qhr.1_Missense_Mutation_p.R134Q|PCDH15_uc010qhs.1_Missense_Mutation_p.R139Q|PCDH15_uc010qht.1_Missense_Mutation_p.R134Q|PCDH15_uc010qhu.1_Missense_Mutation_p.R134Q|PCDH15_uc001jjv.1_Missense_Mutation_p.R112Q|PCDH15_uc010qhv.1_Missense_Mutation_p.R134Q|PCDH15_uc010qhw.1_Missense_Mutation_p.R134Q|PCDH15_uc010qhx.1_Missense_Mutation_p.R134Q|PCDH15_uc010qhz.1_Missense_Mutation_p.R134Q|PCDH15_uc010qia.1_Missense_Mutation_p.R112Q|PCDH15_uc001jju.1_Missense_Mutation_p.R134Q|PCDH15_uc010qib.1_Missense_Mutation_p.R112Q|PCDH15_uc001jjw.2_Missense_Mutation_p.R134Q	NM_001142763	NP_001136235	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-1 precursor	134	Cadherin 1.|Extracellular (Potential).		R -> G (in DFNB23).		equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)	9		Melanoma(3;0.117)|Lung SC(717;0.238)								1612				0.25	7.518888	8.20087	3	9	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	56128953	56128953	11931	10	C	T	T	T	403	31	PCDH15	1	1
PIK3AP1	118788	broad.mit.edu	37	10	98363772	98363772	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:98363772G>A	uc001kmq.2	-	c.2205C>T	c.(2203-2205)CTC>CTT	p.L735L	PIK3AP1_uc001kmo.2_Silent_p.L334L|PIK3AP1_uc001kmp.2_Silent_p.L557L	NM_152309	NP_689522	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	735						cytoplasm|plasma membrane				ovary(1)	1		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)										0.148148	6.881072	10.090697	4	23	KEEP	---	---	---	---	capture		Silent	SNP	98363772	98363772	12332	10	G	A	A	A	522	41	PIK3AP1	2	2
MMP13	4322	broad.mit.edu	37	11	102816471	102816471	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:102816471C>T	uc001phl.2	-	c.1219G>A	c.(1219-1221)GAT>AAT	p.D407N		NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein	407	Hemopexin-like 3.				collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)	2		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)										0.137255	8.285049	14.7862	7	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	102816471	102816471	10042	11	C	T	T	T	377	29	MMP13	2	2
MUC2	4583	broad.mit.edu	37	11	1102476	1102476	+	Silent	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:1102476C>A	uc001lsx.1	+	c.14946C>A	c.(14944-14946)GCC>GCA	p.A4982A		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4982	VWFC 2.					inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)									0.25	15.216683	16.806102	7	21	KEEP	---	---	---	---	capture		Silent	SNP	1102476	1102476	10369	11	C	A	A	A	275	22	MUC2	2	2
ZNF202	7753	broad.mit.edu	37	11	123597574	123597574	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:123597574C>T	uc001pzd.1	-	c.1078G>A	c.(1078-1080)GAC>AAC	p.D360N	ZNF202_uc001pzc.1_Missense_Mutation_p.D136N|ZNF202_uc001pze.1_Missense_Mutation_p.D360N|ZNF202_uc001pzf.1_Missense_Mutation_p.D360N	NM_003455	NP_003446	O95125	ZN202_HUMAN	zinc finger protein 202	360					lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|specific RNA polymerase II transcription factor activity|zinc ion binding			ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)										0.595745	713.641637	716.648681	224	152	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	123597574	123597574	18354	11	C	T	T	T	390	30	ZNF202	2	2
NAV2	89797	broad.mit.edu	37	11	20070465	20070465	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:20070465C>T	uc001mpr.3	+	c.4094C>T	c.(4093-4095)TCT>TTT	p.S1365F	NAV2_uc001mpp.2_Missense_Mutation_p.S1301F|NAV2_uc010rdm.1_Missense_Mutation_p.S1388F|NAV2_uc001mpt.2_Missense_Mutation_p.S451F|NAV2_uc009yhx.2_Missense_Mutation_p.S451F|NAV2_uc009yhy.1_Missense_Mutation_p.S364F|NAV2_uc009yhz.2_Missense_Mutation_p.S47F	NM_182964	NP_892009	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 1	1388	Ser-rich.					nucleus	ATP binding|helicase activity			ovary(1)|pancreas(1)	2														0.257143	67.571169	73.188395	27	78	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20070465	20070465	10580	11	C	T	T	T	416	32	NAV2	2	2
ELP4	26610	broad.mit.edu	37	11	31531495	31531495	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:31531495C>T	uc001mtb.2	+	c.164C>T	c.(163-165)TCG>TTG	p.S55L	IMMP1L_uc001msy.1_5'Flank|IMMP1L_uc001msz.1_5'Flank|ELP4_uc001mta.1_Non-coding_Transcript|ELP4_uc001mtc.2_Missense_Mutation_p.S55L|ELP4_uc010rdz.1_Missense_Mutation_p.S55L|IMMP1L_uc009yjo.2_5'Flank|IMMP1L_uc009yjp.2_5'Flank	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN	elongation protein 4 homolog	55					histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			ovary(1)	1	Lung SC(675;0.225)													0.137931	29.208548	47.588815	20	125	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	31531495	31531495	5274	11	C	T	T	T	403	31	ELP4	1	1
C11orf41	25758	broad.mit.edu	37	11	33640201	33640201	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:33640201G>T	uc001mup.3	+	c.4529G>T	c.(4528-4530)GGA>GTA	p.G1510V		NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	1504						integral to membrane				ovary(2)	2														0.538462	19.623718	19.640256	7	6	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	33640201	33640201	1679	11	G	T	T	T	533	41	C11orf41	2	2
ZNF195	7748	broad.mit.edu	37	11	3380968	3380968	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:3380968C>A	uc001lxt.2	-	c.1270G>T	c.(1270-1272)GAC>TAC	p.D424Y	ZNF195_uc001lxv.2_Missense_Mutation_p.D401Y|ZNF195_uc001lxs.2_Missense_Mutation_p.D352Y|ZNF195_uc010qxr.1_Missense_Mutation_p.D405Y|ZNF195_uc009ydz.2_Missense_Mutation_p.D379Y|ZNF195_uc001lxu.2_Missense_Mutation_p.D356Y	NM_001130520	NP_001123992	O14628	ZN195_HUMAN	zinc finger protein 195 isoform 1	424	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)										0.21118	68.558178	80.984724	34	127	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	3380968	3380968	18349	11	C	A	A	A	416	32	ZNF195	2	2
MYBPC3	4607	broad.mit.edu	37	11	47364216	47364216	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:47364216T>C	uc001nfa.3	-	c.1537A>G	c.(1537-1539)ATC>GTC	p.I513V	MYBPC3_uc010rhl.1_Non-coding_Transcript	NM_000256	NP_000247	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	512	Ig-like C2-type 3.				cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding			ovary(2)|central_nervous_system(1)	3				Lung(87;0.176)										0.604255	506.900087	509.140228	142	93	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	47364216	47364216	10408	11	T	C	C	C	650	50	MYBPC3	4	4
OR51Q1	390061	broad.mit.edu	37	11	5443760	5443760	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:5443760C>T	uc010qzd.1	+	c.330C>T	c.(328-330)TCC>TCT	p.S110S	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004757	NP_001004757	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q,	110	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)										0.594828	469.786729	471.608071	138	94	KEEP	---	---	---	---	capture		Silent	SNP	5443760	5443760	11514	11	C	T	T	T	301	24	OR51Q1	2	2
OR4C11	219429	broad.mit.edu	37	11	55371295	55371295	+	Silent	SNP	A	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:55371295A>T	uc010rii.1	-	c.555T>A	c.(553-555)CTT>CTA	p.L185L		NM_001004700	NP_001004700	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C,	185	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1														0.676471	75.735085	76.67463	23	11	KEEP	---	---	---	---	capture		Silent	SNP	55371295	55371295	11451	11	A	T	T	T	54	5	OR4C11	3	3
OR5L2	26338	broad.mit.edu	37	11	55595263	55595263	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:55595263C>A	uc001nhy.1	+	c.569C>A	c.(568-570)TCT>TAT	p.S190Y		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	190	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)												0.565789	256.449031	257.01925	86	66	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55595263	55595263	11581	11	C	A	A	A	416	32	OR5L2	2	2
OR5M10	390167	broad.mit.edu	37	11	56344619	56344619	+	Silent	SNP	A	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:56344619A>T	uc001niz.1	-	c.579T>A	c.(577-579)CGT>CGA	p.R193R		NM_001004741	NP_001004741	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M,	193	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.591837	96.983999	97.345244	29	20	KEEP	---	---	---	---	capture		Silent	SNP	56344619	56344619	11583	11	A	T	T	T	67	6	OR5M10	3	3
SLC43A1	8501	broad.mit.edu	37	11	57258837	57258837	+	Splice_Site_SNP	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:57258837T>A	uc001nkk.2	-	c.1055_splice	c.e11-1	p.V352_splice	SLC43A1_uc001nkl.2_Splice_Site_SNP_p.V352_splice	NM_003627	NP_003618			solute carrier family 43, member 1						cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	neutral amino acid transmembrane transporter activity				0												OREG0020651	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.126761	13.027723	22.67487	9	62	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	57258837	57258837	15129	11	T	A	A	A	715	55	SLC43A1	5	3
GPR44	11251	broad.mit.edu	37	11	60620811	60620811	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:60620811G>A	uc001nqc.2	-	c.385C>T	c.(385-387)CGC>TGC	p.R129C		NM_004778	NP_004769	Q9Y5Y4	GPR44_HUMAN	G protein-coupled receptor 44	129	Cytoplasmic (Potential).				immune response	integral to plasma membrane	N-formyl peptide receptor activity			ovary(1)	1						NSCLC(93;935 1515 23268 23864 24549)								0.35	19.128886	19.521318	7	13	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	60620811	60620811	6970	11	G	A	A	A	507	39	GPR44	1	1
UBXN1	51035	broad.mit.edu	37	11	62444254	62444254	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:62444254C>G	uc001nuj.2	-	c.875G>C	c.(874-876)AGA>ACA	p.R292T	UBXN1_uc001num.1_Intron|UBXN1_uc001nul.1_Intron|UBXN1_uc001nuk.2_3'UTR	NM_015853	NP_056937	Q04323	UBXN1_HUMAN	UBX domain protein 1	110	Potential.|Interaction with BRCA1.				negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process	cytoplasm	ATPase binding|polyubiquitin binding				0														0.240157	185.044915	200.696775	61	193	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	62444254	62444254	17469	11	C	G	G	G	416	32	UBXN1	3	3
CLEC12A	160364	broad.mit.edu	37	12	10132026	10132026	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:10132026G>T	uc001qwq.2	+	c.312G>T	c.(310-312)ATG>ATT	p.M104I	CLEC12A_uc001qwr.3_Missense_Mutation_p.M94I|CLEC12A_uc001qws.3_Missense_Mutation_p.M61I|CLEC12A_uc001qwt.2_Missense_Mutation_p.M23I	NM_138337	NP_612210	Q5QGZ9	CL12A_HUMAN	myeloid inhibitory C-type lectin-like receptor	94	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity|sugar binding				0						Melanoma(197;1487 2125 16611 22221 34855)								0.666667	19.853019	20.074631	6	3	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	10132026	10132026	3634	12	G	T	T	T	585	45	CLEC12A	2	2
UTP20	27340	broad.mit.edu	37	12	101728221	101728221	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:101728221G>C	uc001tia.1	+	c.3580G>C	c.(3580-3582)GAG>CAG	p.E1194Q		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	1194					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4														0.166667	10.184014	12.712507	4	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	101728221	101728221	17664	12	G	C	C	C	585	45	UTP20	3	3
NT5DC3	51559	broad.mit.edu	37	12	104181259	104181259	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:104181259C>A	uc010swe.1	-	c.1148G>T	c.(1147-1149)AGA>ATA	p.R383I		NM_001031701	NP_001026871	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	383							hydrolase activity|metal ion binding			ovary(2)|skin(1)	3														0.153846	5.880975	8.862478	4	22	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	104181259	104181259	11097	12	C	A	A	A	416	32	NT5DC3	2	2
RIC8B	55188	broad.mit.edu	37	12	107209055	107209055	+	Silent	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:107209055G>C	uc001tlw.2	+	c.714G>C	c.(712-714)ACG>ACC	p.T238T	RIC8B_uc001tlx.2_Silent_p.T238T|RIC8B_uc001tly.2_Silent_p.T198T|RIC8B_uc001tlz.2_Non-coding_Transcript	NM_018157	NP_060627	Q9NVN3	RIC8B_HUMAN	resistance to inhibitors of cholinesterase 8	238					regulation of G-protein coupled receptor protein signaling pathway	cell cortex|cytosol|plasma membrane	G-protein alpha-subunit binding|guanyl-nucleotide exchange factor activity			ovary(1)	1														0.404762	111.233908	111.899962	34	50	KEEP	---	---	---	---	capture		Silent	SNP	107209055	107209055	13831	12	G	C	C	C	496	39	RIC8B	3	3
WSCD2	9671	broad.mit.edu	37	12	108604018	108604018	+	Silent	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:108604018G>C	uc001tms.2	+	c.618G>C	c.(616-618)GTG>GTC	p.V206V	WSCD2_uc001tmt.2_Silent_p.V206V	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	206	WSC 1.					integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3														0.24	18.037489	19.579748	6	19	KEEP	---	---	---	---	capture		Silent	SNP	108604018	108604018	17981	12	G	C	C	C	613	48	WSCD2	3	3
TBX5	6910	broad.mit.edu	37	12	114837405	114837405	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:114837405G>T	uc001tvo.2	-	c.275C>A	c.(274-276)ACG>AAG	p.T92K	TBX5_uc001tvp.2_Missense_Mutation_p.T92K|TBX5_uc001tvq.2_Missense_Mutation_p.T42K|TBX5_uc010syv.1_Missense_Mutation_p.T92K	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	92	T-box.				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of gene-specific transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|RNA polymerase II transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)	7	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		NSCLC(152;1358 1980 4050 23898 40356)								0.202658	141.602293	166.322991	61	240	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	114837405	114837405	16187	12	G	T	T	T	520	40	TBX5	1	1
TBX3	6926	broad.mit.edu	37	12	115112623	115112623	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:115112623C>T	uc001tvt.1	-	c.1117G>A	c.(1117-1119)GGT>AGT	p.G373S	TBX3_uc001tvu.1_Missense_Mutation_p.G353S	NM_016569	NP_057653	O15119	TBX3_HUMAN	T-box 3 protein isoform 2	373					anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	general transcriptional repressor activity|RNA polymerase II transcription factor activity|sequence-specific DNA binding			ovary(2)	2	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)										0.380952	22.995254	23.256171	8	13	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	115112623	115112623	16185	12	C	T	T	T	286	22	TBX3	2	2
NCOR2	9612	broad.mit.edu	37	12	124885199	124885199	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:124885199G>A	uc010tay.1	-	c.1661C>T	c.(1660-1662)TCA>TTA	p.S554L	NCOR2_uc010taz.1_Missense_Mutation_p.S554L|NCOR2_uc010tba.1_Missense_Mutation_p.S554L|NCOR2_uc010tbb.1_Missense_Mutation_p.S554L|NCOR2_uc010tbc.1_Missense_Mutation_p.S553L|NCOR2_uc001ugj.1_Missense_Mutation_p.S554L	NM_006312	NP_006303	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 1	554	Potential.				cellular lipid metabolic process|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity|transcription repressor activity			ovary(1)|skin(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)										0.210674	159.65352	187.328533	75	281	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	124885199	124885199	10635	12	G	A	A	A	585	45	NCOR2	2	2
LST-3TM12	338821	broad.mit.edu	37	12	21196342	21196342	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:21196342G>A	uc010sim.1	+	c.802G>A	c.(802-804)GTA>ATA	p.V268I	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sin.1_Missense_Mutation_p.V221I	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	221						membrane	transporter activity				0														0.688312	167.11546	169.567193	53	24	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	21196342	21196342	9442	12	G	A	A	A	468	36	LST-3TM12	2	2
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:25398285C>A	uc001rgp.1	-	c.34G>T	c.(34-36)GGT>TGT	p.G12C	KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_Non-coding_Transcript	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	12	GTP.		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.G12C(2374)|p.G12S(1078)|p.G12R(674)|p.G12?(50)|p.G12F(33)|p.G12D(15)|p.G12N(6)|p.G12V(6)|p.G12L(5)|p.G12I(3)|p.G12W(3)|p.G12A(2)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12_G13insG(1)		large_intestine(11742)|pancreas(3256)|lung(2694)|biliary_tract(514)|ovary(437)|endometrium(339)|haematopoietic_and_lymphoid_tissue(303)|stomach(179)|thyroid(145)|prostate(85)|soft_tissue(75)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|breast(27)|liver(21)|testis(17)|oesophagus(15)|central_nervous_system(8)|peritoneum(5)|kidney(5)|salivary_gland(5)|thymus(5)|eye(4)|gastrointestinal_tract_(site_indeterminate)(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	20148	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119	p.G12R(PSN1-Tumor)|p.G12C(NCIH1373-Tumor)|p.G12C(NCIH1792-Tumor)|p.G12S(KMS20-Tumor)|p.G12C(HCC44-Tumor)|p.G12C(HCC1171-Tumor)|p.G12C(SW837-Tumor)|p.G12C(LU65-Tumor)|p.G12R(HUPT3-Tumor)|p.G12S(A549-Tumor)|p.G12C(NCIH2122-Tumor)|p.G12R(KP2-Tumor)|p.G12C(OV56-Tumor)|p.G12C(IALM-Tumor)|p.G12C(SW1463-Tumor)|p.G12C(SW1573-Tumor)|p.G12R(NCIH1339-Tumor)|p.G12C(NCIH23-Tumor)|p.G12C(MIAPACA2-Tumor)|p.G12C(CALU1-Tumor)|p.G12C(NCIH2030-Tumor)|p.G12S(LS123-Tumor)|p.G12C(KYSE410-Tumor)|p.G12C(UMUC3-Tumor)|p.G12C(NCIH2291-Tumor)|p.G12R(TCCPAN2-Tumor)|p.G12C(KHM1B-Tumor)|p.G12C(LU99-Tumor)|p.G12C(NCIH358-Tumor)|p.G12C(NCIH1385-Tumor)|p.G12R(CAL62-Tumor)	262	TSP Lung(1;<1E-8)|Multiple Myeloma(2;<1E-6)			0.535714	47.926113	47.957084	15	13	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	25398285	25398285	8753	12	C	A	A	A	273	21	KRAS	2	2
TMTC1	83857	broad.mit.edu	37	12	29659837	29659837	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:29659837G>T	uc001rjb.2	-	c.2267C>A	c.(2266-2268)GCC>GAC	p.A756D	TMTC1_uc001riz.2_Missense_Mutation_p.A513D|TMTC1_uc001rja.2_Missense_Mutation_p.A600D|TMTC1_uc001riy.2_Missense_Mutation_p.A209D	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	756						integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)													0.369048	87.901051	89.167876	31	53	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	29659837	29659837	16801	12	G	T	T	T	546	42	TMTC1	2	2
NDUFA9	4704	broad.mit.edu	37	12	4791405	4791405	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:4791405T>C	uc001qnc.2	+	c.835T>C	c.(835-837)TAC>CAC	p.Y279H	NDUFA9_uc010ses.1_Missense_Mutation_p.Y60H	NM_005002	NP_004993	Q16795	NDUA9_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	279					mitochondrial electron transport, NADH to ubiquinone|sodium ion transport	mitochondrial matrix|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	Colon(75;996 1244 23946 25294 29232)								0.233645	73.417999	80.371831	25	82	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	4791405	4791405	10671	12	T	C	C	C	741	57	NDUFA9	4	4
KRT5	3852	broad.mit.edu	37	12	52910540	52910540	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:52910540C>T	uc001san.2	-	c.1320G>A	c.(1318-1320)CAG>CAA	p.Q440Q	KRT5_uc009zmh.2_Silent_p.Q440Q	NM_000424	NP_000415	P13647	K2C5_HUMAN	keratin 5	440	Rod.|Coil 2.				epidermis development|hemidesmosome assembly	cytosol|keratin filament	protein binding|structural constituent of cytoskeleton				0				BRCA - Breast invasive adenocarcinoma(357;0.189)										0.146853	72.544909	106.829792	42	244	KEEP	---	---	---	---	capture		Silent	SNP	52910540	52910540	8794	12	C	T	T	T	415	32	KRT5	2	2
SP7	121340	broad.mit.edu	37	12	53722569	53722569	+	Silent	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:53722569C>G	uc001sct.2	-	c.657G>C	c.(655-657)GGG>GGC	p.G219G	SP7_uc001scu.2_Silent_p.G201G|SP7_uc001scv.2_Silent_p.G219G	NM_152860	NP_690599	Q8TDD2	SP7_HUMAN	osterix	219					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0														0.162338	61.737906	78.379919	25	129	KEEP	---	---	---	---	capture		Silent	SNP	53722569	53722569	15469	12	C	G	G	G	327	26	SP7	3	3
NXPH4	11247	broad.mit.edu	37	12	57619152	57619152	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:57619152G>T	uc010srf.1	+	c.549G>T	c.(547-549)GAG>GAT	p.E183D	NXPH4_uc009zpj.2_De_novo_Start_OutOfFrame	NM_007224	NP_009155	O95158	NXPH4_HUMAN	neurexophilin 4 precursor	183	IV (linker domain).				neuropeptide signaling pathway	extracellular region					0														0.376289	195.470946	198.095333	73	121	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	57619152	57619152	11198	12	G	T	T	T	451	35	NXPH4	2	2
ARHGAP9	64333	broad.mit.edu	37	12	57871282	57871282	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:57871282C>A	uc001sod.2	-	c.929G>T	c.(928-930)TGC>TTC	p.C310F	ARHGAP9_uc001sny.2_5'Flank|ARHGAP9_uc001snz.2_Missense_Mutation_p.C55F|ARHGAP9_uc001soa.2_5'UTR|ARHGAP9_uc001sob.2_Missense_Mutation_p.C239F|ARHGAP9_uc001soc.2_Missense_Mutation_p.C239F|ARHGAP9_uc001soe.1_Missense_Mutation_p.C318F|ARHGAP9_uc010sro.1_Missense_Mutation_p.C239F	NM_032496	NP_115885	Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9 isoform 1	239	WW.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			lung(1)	1			GBM - Glioblastoma multiforme(3;3.37e-34)											0.351064	180.982242	184.665855	66	122	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	57871282	57871282	903	12	C	A	A	A	325	25	ARHGAP9	2	2
B4GALNT1	2583	broad.mit.edu	37	12	58020640	58020640	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:58020640C>T	uc001spg.1	-	c.1489G>A	c.(1489-1491)GGA>AGA	p.G497R	B4GALNT1_uc010sru.1_Missense_Mutation_p.G442R	NM_001478	NP_001469	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	497	Lumenal (Potential).				lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity				0	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)											0.262295	120.85083	130.184165	48	135	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	58020640	58020640	1287	12	C	T	T	T	299	23	B4GALNT1	1	1
SRGAP1	57522	broad.mit.edu	37	12	64485100	64485100	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:64485100G>T	uc010ssp.1	+	c.1481G>T	c.(1480-1482)AGG>ATG	p.R494M	SRGAP1_uc001srv.2_Intron	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	494					axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)										0.194444	15.102011	18.239053	7	29	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	64485100	64485100	15659	12	G	T	T	T	455	35	SRGAP1	2	2
BBS10	79738	broad.mit.edu	37	12	76739847	76739847	+	Missense_Mutation	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:76739847T>A	uc001syd.1	-	c.1918A>T	c.(1918-1920)ATT>TTT	p.I640F		NM_024685	NP_078961	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	640					cellular protein metabolic process|photoreceptor cell maintenance|response to stimulus|retina homeostasis|sensory cilium assembly	cilium	ATP binding			ovary(1)	1														0.140845	16.504423	25.340671	10	61	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	76739847	76739847	1357	12	T	A	A	A	663	51	BBS10	3	3
SLC6A15	55117	broad.mit.edu	37	12	85255532	85255532	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:85255532C>G	uc001szv.2	-	c.2072G>C	c.(2071-2073)GGT>GCT	p.G691A	SLC6A15_uc010sul.1_Missense_Mutation_p.G584A|SLC6A15_uc001szw.1_3'UTR	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN	solute carrier family 6, member 15 isoform 1	691	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			pancreas(2)|ovary(1)	3														0.194805	40.978303	47.668117	15	62	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	85255532	85255532	15175	12	C	G	G	G	234	18	SLC6A15	3	3
MGAT4C	25834	broad.mit.edu	37	12	86373286	86373286	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:86373286C>A	uc010sum.1	-	c.1290G>T	c.(1288-1290)TTG>TTT	p.L430F	MGAT4C_uc001tal.3_Missense_Mutation_p.L406F|MGAT4C_uc001taj.3_Missense_Mutation_p.L406F|MGAT4C_uc001tak.3_Missense_Mutation_p.L406F|MGAT4C_uc001tai.3_Missense_Mutation_p.L406F|MGAT4C_uc001tah.3_Missense_Mutation_p.L406F	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	406	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3														0.28	15.811052	16.981945	7	18	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	86373286	86373286	9937	12	C	A	A	A	324	25	MGAT4C	2	2
VEZT	55591	broad.mit.edu	37	12	95645844	95645844	+	Silent	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:95645844A>G	uc001tdz.2	+	c.165A>G	c.(163-165)CCA>CCG	p.P55P	VEZT_uc009zsy.1_5'UTR|VEZT_uc001tdr.2_5'UTR|VEZT_uc001tds.2_5'UTR|VEZT_uc001tdt.2_5'UTR|VEZT_uc009zsz.1_Silent_p.P55P|VEZT_uc001tdv.2_Missense_Mutation_p.K26E|VEZT_uc001tdw.1_5'UTR|VEZT_uc009zta.1_5'UTR	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	55						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1														0.245614	42.025232	45.381522	14	43	KEEP	---	---	---	---	capture		Silent	SNP	95645844	95645844	17723	12	A	G	G	G	54	5	VEZT	4	4
ANKS1B	56899	broad.mit.edu	37	12	99898388	99898388	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:99898388A>G	uc001tge.1	-	c.1304T>C	c.(1303-1305)ATG>ACG	p.M435T	ANKS1B_uc001tgf.1_Missense_Mutation_p.M15T|ANKS1B_uc009ztt.1_Missense_Mutation_p.M401T	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	435						Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)										0.333333	6.348385	6.495796	2	4	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	99898388	99898388	697	12	A	G	G	G	104	8	ANKS1B	4	4
C13orf16	121793	broad.mit.edu	37	13	111973266	111973266	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:111973266C>A	uc001vsa.2	+	c.29C>A	c.(28-30)TCT>TAT	p.S10Y		NM_152324	NP_689537	Q8N6K0	CM016_HUMAN	hypothetical protein LOC121793	10	Extracellular (Potential).					integral to membrane					0	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		all cancers(43;0.113)|GBM - Glioblastoma multiforme(44;0.174)|BRCA - Breast invasive adenocarcinoma(86;0.188)											0.207547	88.083939	104.88786	44	168	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	111973266	111973266	1766	13	C	A	A	A	416	32	C13orf16	2	2
ATP11A	23250	broad.mit.edu	37	13	113510353	113510353	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:113510353G>T	uc001vsj.3	+	c.2372G>T	c.(2371-2373)TGC>TTC	p.C791F	ATP11A_uc001vsi.3_Missense_Mutation_p.C791F|ATP11A_uc001vsm.1_Missense_Mutation_p.C667F|ATP11A_uc010ago.2_Non-coding_Transcript	NM_032189	NP_115565	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform b	791	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)								1064				0.435484	233.0199	233.698938	81	105	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	113510353	113510353	1138	13	G	T	T	T	598	46	ATP11A	2	2
FRY	10129	broad.mit.edu	37	13	32698990	32698990	+	Missense_Mutation	SNP	A	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:32698990A>C	uc001utx.2	+	c.694A>C	c.(694-696)ATT>CTT	p.I232L	FRY_uc010tdw.1_Non-coding_Transcript	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	232					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)	6		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)										0.416667	87.870524	88.232761	25	35	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32698990	32698990	6313	13	A	C	C	C	104	8	FRY	4	4
SOHLH2	54937	broad.mit.edu	37	13	36776079	36776079	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:36776079A>G	uc010tei.1	-	c.431T>C	c.(430-432)ATG>ACG	p.M144T	SOHLH2_uc001uvj.2_Missense_Mutation_p.M67T	NM_017826	NP_060296	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic	67					cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding|transcription regulator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)										0.457447	141.619576	141.767206	43	51	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	36776079	36776079	15424	13	A	G	G	G	104	8	SOHLH2	4	4
TRPC4	7223	broad.mit.edu	37	13	38266167	38266167	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:38266167G>T	uc010abx.2	-	c.1203C>A	c.(1201-1203)ATC>ATA	p.I401I	TRPC4_uc010abv.2_Intron|TRPC4_uc001uwt.2_Silent_p.I401I|TRPC4_uc001uws.2_Silent_p.I401I|TRPC4_uc010tey.1_Silent_p.I401I|TRPC4_uc010abw.2_Silent_p.I228I|TRPC4_uc010aby.2_Silent_p.I401I	NM_003306	NP_003297	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,	401	Cytoplasmic (Potential).				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|breast(1)	4				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)										0.54902	93.70481	93.811433	28	23	KEEP	---	---	---	---	capture		Silent	SNP	38266167	38266167	17131	13	G	T	T	T	473	37	TRPC4	1	1
OLFM4	10562	broad.mit.edu	37	13	53624885	53624885	+	Silent	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:53624885T>A	uc001vhl.2	+	c.1512T>A	c.(1510-1512)TCT>TCA	p.S504S	OLFM4_uc001vhk.1_3'UTR	NM_006418	NP_006409	Q6UX06	OLFM4_HUMAN	olfactomedin 4 precursor	504	Olfactomedin-like.				cell adhesion	extracellular space					0		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)						717				0.564103	148.609341	148.888633	44	34	KEEP	---	---	---	---	capture		Silent	SNP	53624885	53624885	11260	13	T	A	A	A	704	55	OLFM4	3	3
DACH1	1602	broad.mit.edu	37	13	72440100	72440100	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:72440100A>G	uc010thn.1	-	c.802T>C	c.(802-804)TCC>CCC	p.S268P	DACH1_uc010tho.1_Missense_Mutation_p.S268P|DACH1_uc010thp.1_Missense_Mutation_p.S268P	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN	dachshund homolog 1 isoform a	268	Interaction with SIX6 and HDAC3 (By similarity).|DACHbox-N.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)						202				0.254237	91.712275	98.167581	30	88	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72440100	72440100	4386	13	A	G	G	G	143	11	DACH1	4	4
DNAJC3	5611	broad.mit.edu	37	13	96438214	96438214	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:96438214C>T	uc001vmq.2	+	c.1097C>T	c.(1096-1098)GCT>GTT	p.A366V	DNAJC3_uc001vmr.2_Missense_Mutation_p.A315V	NM_006260	NP_006251	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3	366	TPR 9.				protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding				0	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)											0.294118	26.73481	28.025635	10	24	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	96438214	96438214	4830	13	C	T	T	T	364	28	DNAJC3	2	2
BRF1	2972	broad.mit.edu	37	14	105685542	105685542	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:105685542C>A	uc001yqp.2	-	c.1405G>T	c.(1405-1407)GTG>TTG	p.V469L	BRF1_uc010tyo.1_Missense_Mutation_p.V354L|BRF1_uc010typ.1_Missense_Mutation_p.V376L|BRF1_uc001yqk.2_5'UTR|BRF1_uc001yql.2_Missense_Mutation_p.V265L|BRF1_uc001yqo.2_Missense_Mutation_p.V231L|BRF1_uc010axg.1_Missense_Mutation_p.V442L|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron|BRF1_uc010axi.1_5'UTR	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1	469					regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	RNA polymerase III transcription factor activity|transcription activator activity|translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)										0.198864	80.776863	95.591919	35	141	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	105685542	105685542	1541	14	C	A	A	A	247	19	BRF1	1	1
TEP1	7011	broad.mit.edu	37	14	20850850	20850850	+	Nonsense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:20850850C>A	uc001vxe.2	-	c.4072G>T	c.(4072-4074)GAA>TAA	p.E1358*	TEP1_uc010ahk.2_Nonsense_Mutation_p.E701*|TEP1_uc010tlf.1_Non-coding_Transcript|TEP1_uc010tlg.1_Nonsense_Mutation_p.E1250*|TEP1_uc010tlh.1_5'Flank	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1358	NACHT.				telomere maintenance via recombination|telomere maintenance via telomerase	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)										0.20979	55.382978	66.529842	30	113	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	20850850	20850850	16286	14	C	A	A	A	390	30	TEP1	5	2
ARHGAP5	394	broad.mit.edu	37	14	32563253	32563253	+	Silent	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:32563253A>G	uc001wrl.2	+	c.3378A>G	c.(3376-3378)GTA>GTG	p.V1126V	ARHGAP5_uc001wrm.2_Silent_p.V1126V|ARHGAP5_uc001wrn.2_Silent_p.V1126V|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	1126					cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(3)|central_nervous_system(1)	4	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		NSCLC(9;77 350 3443 29227 41353)								0.183673	25.048476	29.646457	9	40	KEEP	---	---	---	---	capture		Silent	SNP	32563253	32563253	900	14	A	G	G	G	158	13	ARHGAP5	4	4
EGLN3	112399	broad.mit.edu	37	14	34419700	34419701	+	Missense_Mutation	DNP	CC	AA	AA			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:34419700_34419701CC>AA	uc001wsa.3	-	c.258_259GG>TT	c.(256-261)GAGGGC>GATTGC	p.86_87EG>DC	EGLN3_uc001wry.2_Intron|EGLN3_uc001wrz.2_Missense_Mutation_p.86_87EG>DC|EGLN3_uc001wsb.1_Missense_Mutation_p.86_87EG>DC	NM_022073	NP_071356	Q9H6Z9	EGLN3_HUMAN	egl nine homolog 3	86_87					apoptosis|oxidation-reduction process	cytoplasm|nucleus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding				0	Breast(36;0.0303)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.000246)|Lung(238;0.000959)|Epithelial(34;0.155)	GBM - Glioblastoma multiforme(112;0.0118)	Vitamin C(DB00126)	Esophageal Squamous(161;245 1904 13895 22565 30076)								0.252874	52.04204	56.846226	22	65	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	34419700	34419701	5159	14	CC	AA	AA	AA	286	22	EGLN3	2	2
KCNH5	27133	broad.mit.edu	37	14	63416870	63416870	+	Silent	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:63416870C>G	uc001xfx.2	-	c.1350G>C	c.(1348-1350)GTG>GTC	p.V450V	KCNH5_uc001xfy.2_Silent_p.V450V|KCNH5_uc001xfz.1_Silent_p.V392V|KCNH5_uc001xga.2_Silent_p.V392V	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	450	Helical; Name=Segment S6; (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)										0.432836	91.464054	91.727831	29	38	KEEP	---	---	---	---	capture		Silent	SNP	63416870	63416870	8340	14	C	G	G	G	262	21	KCNH5	3	3
SLC8A3	6547	broad.mit.edu	37	14	70634945	70634945	+	Silent	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:70634945C>A	uc001xly.2	-	c.195G>T	c.(193-195)CCG>CCT	p.P65P	SLC8A3_uc001xlw.2_Silent_p.P65P|SLC8A3_uc001xlx.2_Silent_p.P65P|SLC8A3_uc001xlz.2_Silent_p.P65P|SLC8A3_uc010ara.2_Non-coding_Transcript	NM_183002	NP_892114	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium	65	Extracellular (Potential).				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			ovary(2)|breast(2)	4				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)										0.215385	32.41269	37.273979	14	51	KEEP	---	---	---	---	capture		Silent	SNP	70634945	70634945	15205	14	C	A	A	A	288	23	SLC8A3	1	1
PCNX	22990	broad.mit.edu	37	14	71542904	71542904	+	Splice_Site_SNP	SNP	A	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:71542904A>T	uc001xmo.2	+	c.5107_splice	c.e28-2	p.G1703_splice	PCNX_uc010are.1_Splice_Site_SNP_p.G1592_splice|PCNX_uc010arf.1_Splice_Site_SNP_p.G491_splice	NM_014982	NP_055797			pecanex-like 1							integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)										0.35	77.496355	79.075037	28	52	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	71542904	71542904	12011	14	A	T	T	T	195	15	PCNX	5	3
YLPM1	56252	broad.mit.edu	37	14	75248655	75248655	+	Nonsense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:75248655G>T	uc001xqj.3	+	c.1909G>T	c.(1909-1911)GGA>TGA	p.G637*	YLPM1_uc001xql.3_Non-coding_Transcript	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	442					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)										0.217949	36.858279	42.564955	17	61	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	75248655	75248655	18069	14	G	T	T	T	611	47	YLPM1	5	2
MLH3	27030	broad.mit.edu	37	14	75515150	75515150	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:75515150C>A	uc001xrd.1	-	c.1209G>T	c.(1207-1209)ATG>ATT	p.M403I	MLH3_uc001xre.1_Missense_Mutation_p.M403I|MLH3_uc010tuy.1_Non-coding_Transcript	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN	mutL homolog 3 isoform 1	403					mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)										0.2	12.160756	14.253193	5	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	75515150	75515150	10008	14	C	A	A	A	221	17	MLH3	2	2
KCNK10	54207	broad.mit.edu	37	14	88658611	88658611	+	Silent	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:88658611C>A	uc001xwm.2	-	c.825G>T	c.(823-825)GTG>GTT	p.V275V	KCNK10_uc001xwn.2_Silent_p.V275V|KCNK10_uc001xwo.2_Silent_p.V270V	NM_138318	NP_612191	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	270					signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|pancreas(1)	3														0.447368	201.170286	201.538532	68	84	KEEP	---	---	---	---	capture		Silent	SNP	88658611	88658611	8364	14	C	A	A	A	262	21	KCNK10	2	2
SLC24A4	123041	broad.mit.edu	37	14	92922951	92922951	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:92922951G>A	uc001yak.2	+	c.1203G>A	c.(1201-1203)CCG>CCA	p.P401P	SLC24A4_uc001yai.2_Silent_p.P354P|SLC24A4_uc010twm.1_Silent_p.P399P|SLC24A4_uc001yaj.2_Silent_p.P382P|SLC24A4_uc010auj.2_Silent_p.P290P|SLC24A4_uc010twn.1_Silent_p.P174P|SLC24A4_uc001yan.2_Silent_p.P112P	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1	401	Extracellular (Potential).					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		NSCLC(10;315 435 10383 28450 38798)						OREG0022876	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.2	39.248993	46.347389	17	68	KEEP	---	---	---	---	capture		Silent	SNP	92922951	92922951	14965	14	G	A	A	A	496	39	SLC24A4	1	1
SLC24A4	123041	broad.mit.edu	37	14	92959832	92959832	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:92959832C>G	uc001yak.2	+	c.1678C>G	c.(1678-1680)CAC>GAC	p.H560D	SLC24A4_uc001yai.2_Missense_Mutation_p.H513D|SLC24A4_uc010twm.1_Missense_Mutation_p.H558D|SLC24A4_uc001yaj.2_Missense_Mutation_p.H541D|SLC24A4_uc010auj.2_3'UTR|SLC24A4_uc010twn.1_Missense_Mutation_p.H333D|SLC24A4_uc001yan.2_Missense_Mutation_p.H271D	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1	560	Helical; (Potential).					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		NSCLC(10;315 435 10383 28450 38798)								0.253731	46.151514	49.834187	17	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	92959832	92959832	14965	14	C	G	G	G	273	21	SLC24A4	3	3
KIAA1409	57578	broad.mit.edu	37	14	93962756	93962756	+	Splice_Site_SNP	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:93962756G>A	uc001ybv.1	+	c.182_splice	c.e3-1	p.V61_splice	KIAA1409_uc001ybs.1_Splice_Site_SNP_p.V61_splice|KIAA1409_uc001ybu.1_Intron	NM_020818	NP_065869			hypothetical protein LOC57578							integral to membrane				ovary(10)|large_intestine(3)	13		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)						1186				0.208333	12.660624	14.551946	5	19	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	93962756	93962756	8539	14	G	A	A	A	468	36	KIAA1409	5	2
HERC2	8924	broad.mit.edu	37	15	28457617	28457617	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:28457617T>C	uc001zbj.2	-	c.6899A>G	c.(6898-6900)AAG>AGG	p.K2300R		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	2300					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of mitotic metaphase/anaphase transition	anaphase-promoting complex	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(2)|central_nervous_system(1)	11		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)						1580				0.39781	391.237719	393.734998	109	165	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	28457617	28457617	7341	15	T	C	C	C	728	56	HERC2	4	4
MTMR15	22909	broad.mit.edu	37	15	31222754	31222754	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:31222754C>T	uc001zff.2	+	c.2796C>T	c.(2794-2796)GTC>GTT	p.V932V	MTMR15_uc001zfe.2_Silent_p.V537V	NM_014967	NP_055782	Q9Y2M0	FAN1_HUMAN	myotubularin related protein 15 isoform a	932	VRR-NUC.				double-strand break repair via homologous recombination|nucleotide-excision repair, DNA incision	nucleus	5'-3' exonuclease activity|5'-flap endonuclease activity|DNA binding|magnesium ion binding|phosphodiesterase I activity|ubiquitin binding				0		all_lung(180;2.23e-09)		all cancers(64;4.72e-15)|Epithelial(43;5.4e-11)|GBM - Glioblastoma multiforme(186;0.000136)|BRCA - Breast invasive adenocarcinoma(123;0.00402)|Lung(196;0.168)										0.181159	50.289443	63.478515	25	113	KEEP	---	---	---	---	capture		Silent	SNP	31222754	31222754	10336	15	C	T	T	T	405	32	MTMR15	2	2
RYR3	6263	broad.mit.edu	37	15	34102736	34102736	+	Silent	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:34102736C>G	uc001zhi.2	+	c.10083C>G	c.(10081-10083)TCC>TCG	p.S3361S	RYR3_uc010bar.2_Silent_p.S3356S	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3361					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)										0.410714	74.714593	75.104527	23	33	KEEP	---	---	---	---	capture		Silent	SNP	34102736	34102736	14250	15	C	G	G	G	262	21	RYR3	3	3
C15orf55	256646	broad.mit.edu	37	15	34648156	34648156	+	Silent	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:34648156C>A	uc010ucc.1	+	c.1947C>A	c.(1945-1947)CCC>CCA	p.P649P	C15orf55_uc010ucd.1_Silent_p.P639P|C15orf55_uc001zif.2_Silent_p.P621P	NM_175741	NP_786883	Q86Y26	NUT_HUMAN	nuclear protein in testis	621						cytoplasm|nucleus			BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	midline_organs(25)|ovary(2)|lung(2)|skin(1)	30		all_lung(180;2.78e-08)		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)						408				0.343284	59.295102	60.753129	23	44	KEEP	---	---	---	---	capture		Silent	SNP	34648156	34648156	1853	15	C	A	A	A	275	22	C15orf55	2	2
ATPBD4	89978	broad.mit.edu	37	15	35746951	35746951	+	Missense_Mutation	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:35746951T>A	uc001zja.2	-	c.383A>T	c.(382-384)AAT>ATT	p.N128I	ATPBD4_uc001ziz.2_Missense_Mutation_p.N112I	NM_080650	NP_542381	Q7L8W6	ATBD4_HUMAN	ATP binding domain 4 isoform 1	128											0		all_epithelial(112;2.11e-09)|Lung NSC(122;2.38e-08)|all_lung(180;3.65e-07)		all cancers(64;9.9e-19)|GBM - Glioblastoma multiforme(113;2.01e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)										0.216216	18.779903	21.529301	8	29	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	35746951	35746951	1221	15	T	A	A	A	676	52	ATPBD4	3	3
ZFP106	64397	broad.mit.edu	37	15	42729559	42729559	+	Silent	SNP	T	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:42729559T>G	uc001zpw.2	-	c.4548A>C	c.(4546-4548)CCA>CCC	p.P1516P	ZFP106_uc001zpu.2_Silent_p.P614P|ZFP106_uc001zpv.2_Silent_p.P701P|ZFP106_uc001zpx.2_Silent_p.P744P	NM_022473	NP_071918	Q9H2Y7	ZF106_HUMAN	zinc finger protein 106 homolog	1516						nucleolus	zinc ion binding			central_nervous_system(2)|ovary(1)	3		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.6e-07)										0.337838	164.795954	168.241958	50	98	KEEP	---	---	---	---	capture		Silent	SNP	42729559	42729559	18225	15	T	G	G	G	704	55	ZFP106	4	4
SLC28A2	9153	broad.mit.edu	37	15	45545435	45545435	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:45545435C>A	uc001zva.2	+	c.22C>A	c.(22-24)CAG>AAG	p.Q8K		NM_004212	NP_004203	O43868	S28A2_HUMAN	solute carrier family 28 (sodium-coupled	8					nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)		NSCLC(92;493 1501 26361 28917 47116)								0.416667	44.315897	44.534781	15	21	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	45545435	45545435	15029	15	C	A	A	A	221	17	SLC28A2	2	2
SCG3	29106	broad.mit.edu	37	15	52011673	52011673	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:52011673C>A	uc002abh.2	+	c.1357C>A	c.(1357-1359)CTT>ATT	p.L453I	SCG3_uc010ufz.1_Missense_Mutation_p.L221I	NM_013243	NP_037375	Q8WXD2	SCG3_HUMAN	secretogranin III isoform 1 precursor	453					platelet activation|platelet degranulation	extracellular region|stored secretory granule				ovary(1)	1				all cancers(107;0.00488)										0.403509	65.008836	65.473942	23	34	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	52011673	52011673	14373	15	C	A	A	A	312	24	SCG3	2	2
UNC13C	440279	broad.mit.edu	37	15	54786899	54786899	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:54786899C>T	uc002ack.2	+	c.5027C>T	c.(5026-5028)CCT>CTT	p.P1676L		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1676	MHD1.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)						2691				0.127273	11.384317	18.836808	7	48	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	54786899	54786899	17544	15	C	T	T	T	312	24	UNC13C	2	2
SCAPER	49855	broad.mit.edu	37	15	76994155	76994155	+	Nonsense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:76994155G>A	uc002bby.2	-	c.2452C>T	c.(2452-2454)CAA>TAA	p.Q818*	SCAPER_uc010bkr.2_Nonsense_Mutation_p.Q126*|SCAPER_uc002bbx.2_Nonsense_Mutation_p.Q572*|SCAPER_uc002bbz.1_Nonsense_Mutation_p.Q689*|SCAPER_uc002bca.1_Nonsense_Mutation_p.Q683*	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	817						endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3														0.448276	71.77541	71.9181	26	32	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	76994155	76994155	14359	15	G	A	A	A	598	46	SCAPER	5	2
CRABP1	1381	broad.mit.edu	37	15	78635905	78635905	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:78635905G>T	uc002bdp.2	+	c.314G>T	c.(313-315)GGC>GTC	p.G105V		NM_004378	NP_004369	P29762	RABP1_HUMAN	cellular retinoic acid binding protein 1	105					multicellular organismal development|signal transduction	cytoplasm	retinal binding|retinol binding|transporter activity				0					Alitretinoin(DB00523)|Etretinate(DB00926)	Ovarian(146;578 3231 38536)								0.416667	113.875574	114.458979	40	56	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	78635905	78635905	3982	15	G	T	T	T	546	42	CRABP1	2	2
CHRNB4	1143	broad.mit.edu	37	15	78921765	78921765	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:78921765G>A	uc002bed.1	-	c.882C>T	c.(880-882)CTC>CTT	p.L294L	CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_Silent_p.L112L	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	294	Extracellular (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0										152				0.18125	49.958977	65.264628	29	131	KEEP	---	---	---	---	capture		Silent	SNP	78921765	78921765	3527	15	G	A	A	A	574	45	CHRNB4	2	2
CHRNB4	1143	broad.mit.edu	37	15	78921903	78921903	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:78921903C>A	uc002bed.1	-	c.744G>T	c.(742-744)TTG>TTT	p.L248F	CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_Missense_Mutation_p.L66F	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	248	Helical; (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0										152				0.164122	74.237578	102.358856	43	219	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	78921903	78921903	3527	15	C	A	A	A	324	25	CHRNB4	2	2
EFTUD1	79631	broad.mit.edu	37	15	82512058	82512058	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:82512058C>A	uc002bgt.1	-	c.1546G>T	c.(1546-1548)GCT>TCT	p.A516S	EFTUD1_uc002bgu.1_Missense_Mutation_p.A465S	NM_024580	NP_078856	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain	516							GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1														0.302326	31.707839	33.241584	13	30	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	82512058	82512058	5149	15	C	A	A	A	338	26	EFTUD1	2	2
ALPK3	57538	broad.mit.edu	37	15	85400144	85400144	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:85400144G>T	uc002ble.2	+	c.2781G>T	c.(2779-2781)GAG>GAT	p.E927D		NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	927					heart development|protein phosphorylation	nucleus	ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	8			BRCA - Breast invasive adenocarcinoma(143;0.0587)							343				0.209091	95.760143	112.976457	46	174	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	85400144	85400144	549	15	G	T	T	T	438	34	ALPK3	2	2
NTRK3	4916	broad.mit.edu	37	15	88678594	88678594	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:88678594C>A	uc002bme.1	-	c.942G>T	c.(940-942)GAG>GAT	p.E314D	NTRK3_uc002bmh.2_Missense_Mutation_p.E314D|NTRK3_uc002bmf.1_Missense_Mutation_p.E314D|NTRK3_uc010upl.1_Missense_Mutation_p.E216D|NTRK3_uc010bnh.1_Missense_Mutation_p.E314D|NTRK3_uc002bmg.2_Missense_Mutation_p.E314D	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	314	Ig-like C2-type 2.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(13)|ovary(5)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|skin(1)|pancreas(1)	259			BRCA - Breast invasive adenocarcinoma(143;0.211)							506	TSP Lung(13;0.10)			0.232877	37.932491	42.705798	17	56	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	88678594	88678594	11113	15	C	A	A	A	363	28	NTRK3	2	2
DNAH3	55567	broad.mit.edu	37	16	20944578	20944578	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:20944578G>A	uc010vbe.1	-	c.12249C>T	c.(12247-12249)GGC>GGT	p.G4083G	DNAH3_uc010vbd.1_Silent_p.G1518G	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	4083					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(10)|large_intestine(2)|central_nervous_system(2)	14				GBM - Glioblastoma multiforme(48;0.207)										0.416918	381.461938	383.462178	138	193	KEEP	---	---	---	---	capture		Silent	SNP	20944578	20944578	4786	16	G	A	A	A	535	42	DNAH3	2	2
SETD1A	9739	broad.mit.edu	37	16	30974843	30974843	+	Nonsense_Mutation	SNP	A	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:30974843A>T	uc002ead.1	+	c.607A>T	c.(607-609)AAG>TAG	p.K203*	SETD1A_uc002eae.1_Nonsense_Mutation_p.K203*	NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	203					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)	2														0.432203	130.185114	130.661058	51	67	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	30974843	30974843	14618	16	A	T	T	T	117	9	SETD1A	5	3
SETD1A	9739	broad.mit.edu	37	16	30974845	30974845	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:30974845G>T	uc002ead.1	+	c.609G>T	c.(607-609)AAG>AAT	p.K203N	SETD1A_uc002eae.1_Missense_Mutation_p.K203N	NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	203					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)	2														0.458716	153.345827	153.506298	50	59	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	30974845	30974845	14618	16	G	T	T	T	464	36	SETD1A	2	2
ITGAM	3684	broad.mit.edu	37	16	31336931	31336931	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:31336931G>T	uc002ebr.2	+	c.2619G>T	c.(2617-2619)CCG>CCT	p.P873P	ITGAM_uc002ebq.2_Silent_p.P872P|ITGAM_uc010can.2_Silent_p.P278P|ITGAM_uc002ebs.1_Silent_p.P278P	NM_001145808	NP_001139280	P11215	ITAM_HUMAN	integrin alpha M isoform 1 precursor	872	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1														0.3125	83.306855	86.316332	30	66	KEEP	---	---	---	---	capture		Silent	SNP	31336931	31336931	8191	16	G	T	T	T	496	39	ITGAM	1	1
ITGAX	3687	broad.mit.edu	37	16	31391695	31391695	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:31391695C>A	uc002ebt.2	+	c.3169C>A	c.(3169-3171)CGC>AGC	p.R1057S	ITGAX_uc002ebu.1_Missense_Mutation_p.R1057S	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	1057	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.460317	91.071267	91.157245	29	34	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	31391695	31391695	8193	16	C	A	A	A	299	23	ITGAX	1	1
ZNF434	54925	broad.mit.edu	37	16	3434572	3434572	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:3434572G>T	uc002cux.3	-	c.1118C>A	c.(1117-1119)ACG>AAG	p.T373K	ZNF434_uc010uwx.1_Missense_Mutation_p.T85K|ZNF434_uc002cuy.3_Missense_Mutation_p.T85K|ZNF434_uc002cuz.2_Missense_Mutation_p.T162K|ZNF434_uc010uwy.1_Missense_Mutation_p.T85K|ZNF434_uc010uwz.1_Missense_Mutation_p.T373K|ZNF434_uc010uxa.1_Missense_Mutation_p.T162K	NM_017810	NP_060280	Q9NX65	ZN434_HUMAN	zinc finger protein 434	162					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2														0.194093	106.415841	127.10545	46	191	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	3434572	3434572	18501	16	G	T	T	T	520	40	ZNF434	1	1
CREBBP	1387	broad.mit.edu	37	16	3900576	3900576	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:3900576C>G	uc002cvv.2	-	c.520G>C	c.(520-522)GGT>CGT	p.G174R	CREBBP_uc002cvw.2_Missense_Mutation_p.G174R	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	174					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			ovary(6)|skin(2)|pancreas(1)|lung(1)	10		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)						748				0.349057	112.33844	114.471627	37	69	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	3900576	3900576	4000	16	C	G	G	G	273	21	CREBBP	3	3
PLEKHG4	25894	broad.mit.edu	37	16	67319226	67319226	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:67319226G>T	uc002eso.3	+	c.2229G>T	c.(2227-2229)ACG>ACT	p.T743T	PLEKHG4_uc002esp.3_Silent_p.T550T|PLEKHG4_uc002esq.3_Silent_p.T743T|PLEKHG4_uc010cef.2_Silent_p.T743T|PLEKHG4_uc002ess.3_Silent_p.T743T|PLEKHG4_uc010ceg.2_Silent_p.T662T	NM_015432	NP_056247	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G	743	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)										0.321212	140.705791	145.397041	53	112	KEEP	---	---	---	---	capture		Silent	SNP	67319226	67319226	12497	16	G	T	T	T	496	39	PLEKHG4	1	1
PKD1L2	114780	broad.mit.edu	37	16	81187865	81187865	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:81187865G>T	uc002fgh.1	-	c.4204C>A	c.(4204-4206)CGA>AGA	p.R1402R	PKD1L2_uc002fgg.1_Non-coding_Transcript	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	1402	Cytoplasmic (Potential).|PLAT.				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3														0.188679	19.663124	24.443094	10	43	KEEP	---	---	---	---	capture		Silent	SNP	81187865	81187865	12389	16	G	T	T	T	519	40	PKD1L2	1	1
PKD1L2	114780	broad.mit.edu	37	16	81219212	81219212	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:81219212G>T	uc002fgh.1	-	c.1882C>A	c.(1882-1884)CCG>ACG	p.P628T	PKD1L2_uc002fgj.2_Missense_Mutation_p.P628T	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	628	REJ.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3														0.376623	79.150016	80.180823	29	48	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	81219212	81219212	12389	16	G	T	T	T	546	42	PKD1L2	2	2
DDX52	11056	broad.mit.edu	37	17	35993383	35993383	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:35993383C>G	uc002hoi.1	-	c.352G>C	c.(352-354)GAC>CAC	p.D118H	DDX52_uc002hoh.1_Missense_Mutation_p.D10H|DDX52_uc002hoj.1_Missense_Mutation_p.D26H	NM_007010	NP_008941	Q9Y2R4	DDX52_HUMAN	ATP-dependent RNA helicase ROK1 isoform a	118						nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Breast(25;0.00637)|Ovarian(249;0.15)												0.122222	41.014728	66.171975	22	158	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	35993383	35993383	4541	17	C	G	G	G	416	32	DDX52	3	3
TOP2A	7153	broad.mit.edu	37	17	38564376	38564376	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:38564376C>A	uc002huq.2	-	c.1343G>T	c.(1342-1344)GGG>GTG	p.G448V	TOP2A_uc002hur.1_Missense_Mutation_p.G89V	NM_001067	NP_001058	P11388	TOP2A_HUMAN	DNA topoisomerase II, alpha isozyme	448					apoptotic chromosome condensation|DNA ligation|DNA repair|DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|phosphatidylinositol-mediated signaling|positive regulation of apoptosis|positive regulation of retroviral genome replication|resolution of meiotic recombination intermediates|sister chromatid segregation	cytoplasm|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|drug binding|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity|ubiquitin binding			ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Gatifloxacin(DB01044)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)					636				0.259259	32.921096	35.758822	14	40	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	38564376	38564376	16907	17	C	A	A	A	286	22	TOP2A	2	2
KRT33B	3884	broad.mit.edu	37	17	39521771	39521771	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:39521771C>T	uc002hwl.2	-	c.623G>A	c.(622-624)CGC>CAC	p.R208H		NM_002279	NP_002270	Q14525	KT33B_HUMAN	type I hair keratin 3B	208	Linker 12.|Rod.					intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)												0.120482	10.790432	22.520088	10	73	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	39521771	39521771	8785	17	C	T	T	T	351	27	KRT33B	1	1
ZZEF1	23140	broad.mit.edu	37	17	3981186	3981186	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:3981186T>C	uc002fxe.2	-	c.2980A>G	c.(2980-2982)ATT>GTT	p.I994V	ZZEF1_uc002fxk.1_Missense_Mutation_p.I995V	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	994					regulation of mitotic metaphase/anaphase transition	anaphase-promoting complex	calcium ion binding|zinc ion binding			ovary(1)|pancreas(1)	2														0.178161	79.129048	96.086888	31	143	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	3981186	3981186	18861	17	T	C	C	C	637	49	ZZEF1	4	4
ALOX15	246	broad.mit.edu	37	17	4539076	4539076	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:4539076G>A	uc010vse.1	-	c.1205C>T	c.(1204-1206)CCG>CTG	p.P402L	ALOX15_uc002fyh.2_Missense_Mutation_p.P380L|ALOX15_uc010vsd.1_Missense_Mutation_p.P341L	NM_001140	NP_001131	P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	380	Lipoxygenase.				inflammatory response|leukotriene biosynthetic process|oxidation-reduction process	nucleus	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			ovary(1)|lung(1)|skin(1)	3				READ - Rectum adenocarcinoma(115;0.0327)	Ciclopirox(DB01188)|Masoprocol(DB00179)|Zileuton(DB00744)									0.335404	148.673305	152.546084	54	107	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	4539076	4539076	541	17	G	A	A	A	507	39	ALOX15	1	1
TEX14	56155	broad.mit.edu	37	17	56679776	56679776	+	Silent	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:56679776C>G	uc010dcz.1	-	c.1530G>C	c.(1528-1530)CTG>CTC	p.L510L	TEX14_uc002iwr.1_Silent_p.L504L|TEX14_uc002iws.1_Silent_p.L504L|TEX14_uc010dda.1_Silent_p.L284L	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a	510	Protein kinase.				protein phosphorylation	cytoplasm	ATP binding|protein kinase activity			stomach(4)|ovary(3)|large_intestine(1)|lung(1)|skin(1)|pancreas(1)	11	Medulloblastoma(34;0.127)|all_neural(34;0.237)									598				0.134387	73.965526	106.764135	34	219	KEEP	---	---	---	---	capture		Silent	SNP	56679776	56679776	16305	17	C	G	G	G	366	29	TEX14	3	3
MED13	9969	broad.mit.edu	37	17	60060325	60060325	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:60060325C>G	uc002izo.2	-	c.3039G>C	c.(3037-3039)AGG>AGC	p.R1013S		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1013					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription mediator activity|thyroid hormone receptor binding|transcription activator activity|vitamin D receptor binding			large_intestine(1)|ovary(1)	2														0.483051	206.376691	206.405868	57	61	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	60060325	60060325	9819	17	C	G	G	G	389	30	MED13	3	3
ABCA8	10351	broad.mit.edu	37	17	66918397	66918397	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:66918397A>G	uc002jhq.2	-	c.1487T>C	c.(1486-1488)ATA>ACA	p.I496T	ABCA8_uc002jhp.2_Missense_Mutation_p.I496T|ABCA8_uc010wqq.1_Missense_Mutation_p.I496T|ABCA8_uc010wqr.1_Missense_Mutation_p.I435T|ABCA8_uc002jhr.2_Missense_Mutation_p.I496T	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8	496	ABC transporter 1.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)	2	Breast(10;4.56e-13)													0.227273	16.001213	17.476407	5	17	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	66918397	66918397	39	17	A	G	G	G	208	16	ABCA8	4	4
KIF19	124602	broad.mit.edu	37	17	72345451	72345452	+	Missense_Mutation	DNP	GG	TT	TT			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:72345451_72345452GG>TT	uc002jkm.3	+	c.1176_1177GG>TT	c.(1174-1179)CGGGGC>CGTTGC	p.G393C	KIF19_uc002jkj.2_Missense_Mutation_p.G393C|KIF19_uc002jkk.2_Missense_Mutation_p.G351C|KIF19_uc002jkl.2_Missense_Mutation_p.G351C	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	393					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0														0.56701	166.725974	167.104917	55	42	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	72345451	72345452	8593	17	GG	TT	TT	TT	548	43	KIF19	2	2
CD300LB	124599	broad.mit.edu	37	17	72522108	72522108	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:72522108C>T	uc002jkx.2	-	c.260G>A	c.(259-261)TGC>TAC	p.C87Y	CD300LB_uc010wqz.1_Missense_Mutation_p.C87Y	NM_174892	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	50	Ig-like V-type.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(1)	1														0.492147	789.408933	789.441712	282	291	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72522108	72522108	3127	17	C	T	T	T	325	25	CD300LB	2	2
USH1G	124590	broad.mit.edu	37	17	72915586	72915586	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:72915586C>A	uc002jme.1	-	c.1345G>T	c.(1345-1347)GCG>TCG	p.A449S	USH1G_uc010wro.1_Missense_Mutation_p.A346S	NM_173477	NP_775748	Q495M9	USH1G_HUMAN	Usher syndrome 1G protein	449					equilibrioception|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	actin cytoskeleton				skin(1)	1	all_lung(278;0.172)|Lung NSC(278;0.207)													0.466667	134.670355	134.758695	49	56	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72915586	72915586	17597	17	C	A	A	A	338	26	USH1G	2	2
CASKIN2	57513	broad.mit.edu	37	17	73498744	73498744	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:73498744G>A	uc002joc.2	-	c.2411C>T	c.(2410-2412)CCT>CTT	p.P804L	CASKIN2_uc010wsc.1_Missense_Mutation_p.P722L	NM_020753	NP_065804	Q8WXE0	CSKI2_HUMAN	cask-interacting protein 2 isoform a	804	Pro-rich.					cytoplasm				pancreas(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)											0.25	22.18414	24.002256	8	24	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	73498744	73498744	2786	17	G	A	A	A	455	35	CASKIN2	2	2
CARD14	79092	broad.mit.edu	37	17	78162253	78162253	+	Silent	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:78162253G>C	uc002jxw.1	+	c.753G>C	c.(751-753)CTG>CTC	p.L251L	CARD14_uc002jxt.1_Non-coding_Transcript|CARD14_uc002jxv.2_Silent_p.L251L|CARD14_uc010wud.1_Non-coding_Transcript|CARD14_uc002jxx.2_Silent_p.L14L|CARD14_uc010dhu.1_Silent_p.L49L	NM_024110	NP_077015	Q9BXL6	CAR14_HUMAN	caspase recruitment domain protein 14 isoform 1	251	Potential.				activation of NF-kappaB-inducing kinase activity|positive regulation of protein phosphorylation|regulation of apoptosis	aggresome|cytoplasm|plasma membrane	CARD domain binding			ovary(4)|skin(1)	5	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)							565				0.121622	48.458171	79.602413	27	195	KEEP	---	---	---	---	capture		Silent	SNP	78162253	78162253	2765	17	G	C	C	C	574	45	CARD14	3	3
PER1	5187	broad.mit.edu	37	17	8048275	8048275	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:8048275G>C	uc002gkd.2	-	c.2255C>G	c.(2254-2256)CCA>CGA	p.P752R	PER1_uc010cns.2_5'Flank|PER1_uc010vuq.1_Non-coding_Transcript|PER1_uc010vur.1_Missense_Mutation_p.P736R	NM_002616	NP_002607	O15534	PER1_HUMAN	period 1	752	CSNK1E binding domain (By similarity).				circadian rhythm|entrainment of circadian clock|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			breast(2)|ovary(1)|large_intestine(1)|kidney(1)|skin(1)	6										239				0.5	53.402231	53.402231	16	16	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	8048275	8048275	12150	17	G	C	C	C	611	47	PER1	3	3
GLP2R	9340	broad.mit.edu	37	17	9760757	9760757	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:9760757G>T	uc002gmd.1	+	c.629G>T	c.(628-630)CGC>CTC	p.R210L		NM_004246	NP_004237	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor precursor	210	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane				ovary(1)	1					Glucagon recombinant(DB00040)									0.402985	84.312534	84.863679	27	40	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	9760757	9760757	6721	17	G	T	T	T	494	38	GLP2R	1	1
MC5R	4161	broad.mit.edu	37	18	13825793	13825793	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:13825793T>C	uc010xaf.1	+	c.29T>C	c.(28-30)TTG>TCG	p.L10S		NM_005913	NP_005904	P33032	MC5R_HUMAN	melanocortin 5 receptor	10	Extracellular (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding			ovary(3)	3														0.460784	314.828129	315.101034	94	110	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	13825793	13825793	9756	18	T	C	C	C	819	63	MC5R	4	4
CTAGE1	64693	broad.mit.edu	37	18	19997171	19997171	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:19997171A>G	uc002ktv.1	-	c.604T>C	c.(604-606)TGG>CGG	p.W202R		NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1	202	Potential.					integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)													0.409639	111.140882	111.731054	34	49	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	19997171	19997171	4151	18	A	G	G	G	104	8	CTAGE1	4	4
C18orf34	374864	broad.mit.edu	37	18	30806766	30806766	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:30806766C>A	uc010xbr.1	-	c.1647G>T	c.(1645-1647)ATG>ATT	p.M549I	C18orf34_uc010dme.1_Missense_Mutation_p.M63I|C18orf34_uc002kxn.2_Missense_Mutation_p.M549I|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Missense_Mutation_p.M549I|C18orf34_uc002kxp.2_Missense_Mutation_p.M549I	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	549										ovary(1)	1														0.444444	49.595823	49.692563	16	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	30806766	30806766	1963	18	C	A	A	A	273	21	C18orf34	2	2
ASXL3	80816	broad.mit.edu	37	18	31323007	31323007	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:31323007G>T	uc010dmg.1	+	c.3195G>T	c.(3193-3195)CGG>CGT	p.R1065R	ASXL3_uc002kxq.2_Silent_p.R772R	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1065	Ala-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3														0.588235	29.138323	29.251929	10	7	KEEP	---	---	---	---	capture		Silent	SNP	31323007	31323007	1087	18	G	T	T	T	548	43	ASXL3	2	2
RNF165	494470	broad.mit.edu	37	18	44036010	44036010	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:44036010G>T	uc002lcb.1	+	c.890G>T	c.(889-891)TGT>TTT	p.C297F	RNF165_uc002lby.1_Missense_Mutation_p.C230F|RNF165_uc010dnn.1_Missense_Mutation_p.C93F	NM_152470	NP_689683	Q6ZSG1	RN165_HUMAN	ring finger protein 165	297	RING-type; atypical.						zinc ion binding				0				READ - Rectum adenocarcinoma(1;0.0873)										0.68	58.383548	59.103009	17	8	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	44036010	44036010	13933	18	G	T	T	T	624	48	RNF165	2	2
SERPINB3	6317	broad.mit.edu	37	18	61323207	61323207	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:61323207C>G	uc002lji.2	-	c.857G>C	c.(856-858)CGG>CCG	p.R286P	SERPINB4_uc002ljg.2_Intron|SERPINB3_uc010dqa.2_Missense_Mutation_p.R234P	NM_006919	NP_008850	P29508	SPB3_HUMAN	serine (or cysteine) proteinase inhibitor, clade	286					regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)|central_nervous_system(1)	2														0.415385	93.719369	94.124226	27	38	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	61323207	61323207	14590	18	C	G	G	G	299	23	SERPINB3	3	3
ADNP2	22850	broad.mit.edu	37	18	77894782	77894782	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:77894782C>T	uc002lnw.2	+	c.1486C>T	c.(1486-1488)CGG>TGG	p.R496W		NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	496					cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth|regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|breast(3)|central_nervous_system(1)	7		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)										0.286822	88.387166	93.672061	37	92	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	77894782	77894782	325	18	C	T	T	T	243	19	ADNP2	1	1
EMR2	30817	broad.mit.edu	37	19	14866492	14866492	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:14866492G>A	uc002mzp.1	-	c.1390C>T	c.(1390-1392)CCA>TCA	p.P464S	EMR2_uc010dzs.1_Intron|EMR2_uc010xnw.1_Missense_Mutation_p.P464S|EMR2_uc002mzo.1_Missense_Mutation_p.P453S|EMR2_uc002mzq.1_Missense_Mutation_p.P404S|EMR2_uc002mzr.1_Missense_Mutation_p.P415S|EMR2_uc002mzs.1_Missense_Mutation_p.P322S|EMR2_uc002mzt.1_Missense_Mutation_p.P360S|EMR2_uc002mzu.1_Missense_Mutation_p.P371S|EMR2_uc010xnx.1_Intron|EMR2_uc010xny.1_Intron	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone	464	Extracellular (Potential).				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)	1														0.192453	111.967072	135.378931	51	214	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	14866492	14866492	5298	19	G	A	A	A	559	43	EMR2	2	2
OR10H2	26538	broad.mit.edu	37	19	15839102	15839102	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:15839102C>T	uc002nbm.2	+	c.249C>T	c.(247-249)GCC>GCT	p.A83A		NM_013939	NP_039227	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H,	83	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)													0.151786	30.310247	43.306959	17	95	KEEP	---	---	---	---	capture		Silent	SNP	15839102	15839102	11312	19	C	T	T	T	288	23	OR10H2	1	1
OR10H1	26539	broad.mit.edu	37	19	15918599	15918599	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:15918599G>A	uc002nbq.2	-	c.249C>T	c.(247-249)GCC>GCT	p.A83A		NM_013940	NP_039228	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H,	83	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.235294	30.075677	33.342777	12	39	KEEP	---	---	---	---	capture		Silent	SNP	15918599	15918599	11311	19	G	A	A	A	496	39	OR10H1	1	1
NCAN	1463	broad.mit.edu	37	19	19338712	19338712	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:19338712C>T	uc002nlz.2	+	c.2283C>T	c.(2281-2283)TTC>TTT	p.F761F	NCAN_uc010ecc.1_Silent_p.F325F	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	761					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)											0.46798	284.892093	285.074281	95	108	KEEP	---	---	---	---	capture		Silent	SNP	19338712	19338712	10603	19	C	T	T	T	402	31	NCAN	1	1
ZNF536	9745	broad.mit.edu	37	19	30935348	30935348	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:30935348C>T	uc002nsu.1	+	c.879C>T	c.(877-879)ATC>ATT	p.I293I	ZNF536_uc010edd.1_Silent_p.I293I	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	293	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)	9	Esophageal squamous(110;0.0834)													0.491379	510.098828	510.121504	171	177	KEEP	---	---	---	---	capture		Silent	SNP	30935348	30935348	18568	19	C	T	T	T	382	30	ZNF536	2	2
FXYD5	53827	broad.mit.edu	37	19	35660493	35660493	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:35660493G>T	uc002nyg.1	+	c.512G>T	c.(511-513)CGG>CTG	p.R171L	FXYD5_uc002nyh.1_Missense_Mutation_p.R171L|FXYD5_uc002nyi.1_Missense_Mutation_p.R108L|FXYD5_uc002nyj.1_Non-coding_Transcript	NM_014164	NP_054883	Q96DB9	FXYD5_HUMAN	FXYD domain-containing ion transport regulator 5	171	Cytoplasmic (Potential).				microvillus assembly|negative regulation of calcium-dependent cell-cell adhesion	integral to membrane	actin binding|cadherin binding|ion channel activity				0	all_lung(56;9.4e-09)|Lung NSC(56;1.4e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.75e-22)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;7.07e-19)|LUSC - Lung squamous cell carcinoma(66;0.0221)											0.531532	178.932994	179.030691	59	52	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	35660493	35660493	6372	19	G	T	T	T	507	39	FXYD5	1	1
MLL4	9757	broad.mit.edu	37	19	36228979	36228979	+	Nonsense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:36228979C>T	uc010eei.2	+	c.7759C>T	c.(7759-7761)CGA>TGA	p.R2587*		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	2587	SET.	S-adenosyl-L-methionine (By similarity).			chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)											0.118421	17.934613	39.688206	18	134	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	36228979	36228979	10013	19	C	T	T	T	347	27	MLL4	5	1
PLEKHG2	64857	broad.mit.edu	37	19	39915830	39915830	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:39915830A>G	uc010xuz.1	+	c.4057A>G	c.(4057-4059)AAG>GAG	p.K1353E	PLEKHG2_uc010xuy.1_Intron|PLEKHG2_uc002olj.2_Intron|PLEKHG2_uc010xva.1_Missense_Mutation_p.K1131E	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide	1353					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			pancreas(1)|breast(1)|skin(1)	3	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)											0.1875	20.158866	24.539577	9	39	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	39915830	39915830	12495	19	A	G	G	G	65	5	PLEKHG2	4	4
SPTBN4	57731	broad.mit.edu	37	19	41019339	41019339	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:41019339C>T	uc002ony.2	+	c.2643C>T	c.(2641-2643)CTC>CTT	p.L881L	SPTBN4_uc002onx.2_Silent_p.L881L|SPTBN4_uc002onz.2_Silent_p.L881L|SPTBN4_uc010egx.2_5'UTR	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	881	Spectrin 7.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)	4			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)											0.645161	61.505085	62.082381	20	11	KEEP	---	---	---	---	capture		Silent	SNP	41019339	41019339	15635	19	C	T	T	T	392	31	SPTBN4	1	1
LIPE	3991	broad.mit.edu	37	19	42930740	42930740	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:42930740T>C	uc002otr.2	-	c.562A>G	c.(562-564)ACA>GCA	p.T188A	LIPE_uc002ots.1_5'Flank	NM_005357	NP_005348	Q05469	LIPS_HUMAN	hormone-sensitive lipase	188					cholesterol metabolic process|protein phosphorylation|triglyceride catabolic process	caveola|cytosol	hormone-sensitive lipase activity|protein binding			ovary(1)|breast(1)	2		Prostate(69;0.00682)												0.586698	939.641041	942.418962	247	174	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	42930740	42930740	9148	19	T	C	C	C	780	60	LIPE	4	4
CEACAM1	634	broad.mit.edu	37	19	43026327	43026327	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:43026327C>A	uc002otv.2	-	c.452G>T	c.(451-453)AGC>ATC	p.S151I	CEACAM1_uc010eii.2_5'Flank|CEACAM1_uc002otw.2_Missense_Mutation_p.S151I|CEACAM1_uc010eij.2_Missense_Mutation_p.S151I|CEACAM1_uc002otx.2_Missense_Mutation_p.S151I|CEACAM1_uc002oty.2_Missense_Mutation_p.S151I|CEACAM1_uc002otz.2_Missense_Mutation_p.S151I|CEACAM1_uc010eik.2_Intron|CEACAM1_uc002oua.2_Missense_Mutation_p.S151I|CEACAM1_uc002oub.2_Missense_Mutation_p.S151I|CEACAM1_uc002ouc.2_Missense_Mutation_p.S151I	NM_001712	NP_001703	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion	151	Ig-like C2-type 1.|Extracellular (Potential).				angiogenesis|cell migration|homophilic cell adhesion|integrin-mediated signaling pathway	extracellular region|integral to plasma membrane|membrane fraction				ovary(1)|central_nervous_system(1)	2		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)									0.133663	66.417155	119.141337	54	350	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43026327	43026327	3320	19	C	A	A	A	364	28	CEACAM1	2	2
PSG7	5676	broad.mit.edu	37	19	43430163	43430163	+	Silent	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:43430163G>C	uc002ovl.3	-	c.1005C>G	c.(1003-1005)CCC>CCG	p.P335P	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Silent_p.P248P|PSG7_uc002ous.1_Non-coding_Transcript|PSG7_uc002out.1_Silent_p.P61P|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Silent_p.P248P|PSG7_uc010xwl.1_Silent_p.P213P	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7	335	Ig-like C2-type 3.				female pregnancy	extracellular region					0		Prostate(69;0.00682)												0.536765	496.858212	497.176825	146	126	KEEP	---	---	---	---	capture		Silent	SNP	43430163	43430163	13113	19	G	C	C	C	600	47	PSG7	3	3
PSG5	5673	broad.mit.edu	37	19	43679379	43679379	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:43679379C>A	uc002ovv.2	-	c.1231G>T	c.(1231-1233)GTC>TTC	p.V411F	PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_Missense_Mutation_p.V193F|PSG5_uc002ovu.2_Missense_Mutation_p.V318F|PSG5_uc002ovx.2_Missense_Mutation_p.V318F|PSG5_uc002ovw.2_Intron	NM_002781	NP_002772	Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	318					female pregnancy	extracellular region					0		Prostate(69;0.00899)												0.553153	982.047211	983.407485	307	248	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43679379	43679379	13111	19	C	A	A	A	260	20	PSG5	2	2
ZNF225	7768	broad.mit.edu	37	19	44636444	44636444	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:44636444G>C	uc002oyj.1	+	c.1677G>C	c.(1675-1677)CAG>CAC	p.Q559H	ZNF225_uc010eje.1_Missense_Mutation_p.Q476H|ZNF225_uc010ejf.1_Missense_Mutation_p.Q559H	NM_013362	NP_037494	Q9UK10	ZN225_HUMAN	zinc finger protein 225	559	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)|all_neural(266;0.202)												0.092857	14.560978	37.91141	13	127	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	44636444	44636444	18370	19	G	C	C	C	425	33	ZNF225	3	3
PRR12	57479	broad.mit.edu	37	19	50102993	50102993	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:50102993C>T	uc002poo.3	+	c.4143C>T	c.(4141-4143)TCC>TCT	p.S1381S		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	560	Pro-rich.						DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)										0.244275	82.131629	89.939731	32	99	KEEP	---	---	---	---	capture		Silent	SNP	50102993	50102993	13027	19	C	T	T	T	301	24	PRR12	2	2
KLK14	43847	broad.mit.edu	37	19	51582093	51582093	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:51582093C>A	uc002pvs.1	-	c.630G>T	c.(628-630)CAG>CAT	p.Q210H		NM_022046	NP_071329	Q9P0G3	KLK14_HUMAN	kallikrein 14 preproprotein	210	Peptidase S1.				epidermis morphogenesis|fertilization|negative regulation of G-protein coupled receptor protein signaling pathway|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis|seminal clot liquefaction	extracellular space	serine-type endopeptidase activity			skin(1)	1		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00422)		GBM(117;2161 2172 2448 22911)								0.167421	195.079733	264.619802	111	552	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	51582093	51582093	8716	19	C	A	A	A	311	24	KLK14	2	2
ZNF610	162963	broad.mit.edu	37	19	52856949	52856949	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:52856949C>T	uc002pyx.3	+	c.78C>T	c.(76-78)TTC>TTT	p.F26F	ZNF610_uc002pyy.3_Silent_p.F26F|ZNF610_uc002pyz.3_Silent_p.F26F|ZNF610_uc002pza.2_Silent_p.F26F	NM_001161426	NP_001154898	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610 isoform a	26	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)										0.220779	35.122349	40.661371	17	60	KEEP	---	---	---	---	capture		Silent	SNP	52856949	52856949	18631	19	C	T	T	T	376	29	ZNF610	2	2
BIRC8	112401	broad.mit.edu	37	19	53792981	53792981	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:53792981G>T	uc002qbk.2	-	c.647C>A	c.(646-648)GCA>GAA	p.A216E		NM_033341	NP_203127	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat-containing 8	216	RING-type.				apoptosis		zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(134;0.00304)										0.224	134.557178	152.069382	56	194	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	53792981	53792981	1465	19	G	T	T	T	598	46	BIRC8	2	2
ZNRF4	148066	broad.mit.edu	37	19	5456195	5456195	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:5456195G>T	uc002mca.3	+	c.693G>T	c.(691-693)TCG>TCT	p.S231S		NM_181710	NP_859061	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4 precursor	231	Extracellular (Potential).					integral to membrane	zinc ion binding			large_intestine(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)										0.530303	213.383141	213.492304	70	62	KEEP	---	---	---	---	capture		Silent	SNP	5456195	5456195	18818	19	G	T	T	T	496	39	ZNRF4	1	1
NLRP5	126206	broad.mit.edu	37	19	56539809	56539809	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:56539809G>T	uc002qmj.2	+	c.2210G>T	c.(2209-2211)CGG>CTG	p.R737L	NLRP5_uc002qmi.2_Missense_Mutation_p.R718L	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	737	LRR 2.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)	6		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)										0.242574	247.851186	272.261307	98	306	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	56539809	56539809	10883	19	G	T	T	T	507	39	NLRP5	1	1
NLRP5	126206	broad.mit.edu	37	19	56565064	56565064	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:56565064G>A	uc002qmj.2	+	c.3189G>A	c.(3187-3189)AGG>AGA	p.R1063R	NLRP5_uc002qmi.2_Silent_p.R1044R	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	1063						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)	6		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)										0.25	52.039964	56.808869	21	63	KEEP	---	---	---	---	capture		Silent	SNP	56565064	56565064	10883	19	G	A	A	A	529	41	NLRP5	2	2
ZIM3	114026	broad.mit.edu	37	19	57647096	57647096	+	Silent	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:57647096T>C	uc002qnz.1	-	c.609A>G	c.(607-609)GCA>GCG	p.A203A		NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	203	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)										0.22381	125.939745	140.64548	47	163	KEEP	---	---	---	---	capture		Silent	SNP	57647096	57647096	18276	19	T	C	C	C	652	51	ZIM3	4	4
ZNF211	10520	broad.mit.edu	37	19	58153284	58153284	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:58153284G>T	uc002qps.2	+	c.1625G>T	c.(1624-1626)GGA>GTA	p.G542V	ZNF211_uc010yhb.1_Missense_Mutation_p.G481V|ZNF211_uc002qpp.2_Missense_Mutation_p.G490V|ZNF211_uc002qpq.2_Missense_Mutation_p.G477V|ZNF211_uc002qpr.2_Missense_Mutation_p.G541V|ZNF211_uc002qpt.2_Missense_Mutation_p.G489V|ZNF211_uc010yhc.1_Missense_Mutation_p.G489V|ZNF211_uc010yhd.1_Missense_Mutation_p.G416V|ZNF211_uc010yhe.1_Missense_Mutation_p.G468V	NM_006385	NP_006376	Q13398	ZN211_HUMAN	zinc finger protein 211 isoform 1	477					regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)										0.202247	34.491086	41.831666	18	71	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	58153284	58153284	18358	19	G	T	T	T	533	41	ZNF211	2	2
ZNF324B	388569	broad.mit.edu	37	19	58967524	58967524	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:58967524G>C	uc002qsv.1	+	c.1213G>C	c.(1213-1215)GCC>CCC	p.A405P	ZNF324B_uc002qsu.1_Missense_Mutation_p.A395P|ZNF324B_uc010euq.1_Missense_Mutation_p.A405P	NM_207395	NP_997278	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	405	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)										0.218487	74.984007	83.674549	26	93	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	58967524	58967524	18437	19	G	C	C	C	598	46	ZNF324B	3	3
C3	718	broad.mit.edu	37	19	6692982	6692982	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:6692982C>G	uc002mfm.2	-	c.3343G>C	c.(3343-3345)GAC>CAC	p.D1115H	C3_uc002mfl.2_5'UTR	NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	1115			D -> N (in AHUS5; leads to impaired binding to the regulator CD46/MCP and resistance to cleavage by factor I).		complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)										0.522989	664.099423	664.263381	182	166	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	6692982	6692982	2296	19	C	G	G	G	403	31	C3	3	3
ACTL9	284382	broad.mit.edu	37	19	8808680	8808680	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:8808680G>T	uc002mkl.2	-	c.372C>A	c.(370-372)GCC>GCA	p.A124A		NM_178525	NP_848620	Q8TC94	ACTL9_HUMAN	actin-like 9	124						cytoplasm|cytoskeleton				large_intestine(2)|pancreas(1)	3														0.492958	106.02065	106.023755	35	36	KEEP	---	---	---	---	capture		Silent	SNP	8808680	8808680	204	19	G	T	T	T	496	39	ACTL9	1	1
MUC16	94025	broad.mit.edu	37	19	9056608	9056608	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:9056608G>C	uc002mkp.2	-	c.30838C>G	c.(30838-30840)CCT>GCT	p.P10280A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10282	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			ovary(15)|large_intestine(1)|pancreas(1)|breast(1)|skin(1)	19														0.481928	137.423692	137.450194	40	43	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	9056608	9056608	10367	19	G	C	C	C	546	42	MUC16	3	3
VCAM1	7412	broad.mit.edu	37	1	101198093	101198093	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:101198093C>A	uc001dti.2	+	c.1645C>A	c.(1645-1647)CAG>AAG	p.Q549K	VCAM1_uc001dtj.2_Missense_Mutation_p.Q457K|VCAM1_uc010ouj.1_Missense_Mutation_p.Q487K	NM_001078	NP_001069	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1 isoform a	549	Ig-like C2-type 6.|Extracellular (Potential).				B cell differentiation|heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding			central_nervous_system(1)	1		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)									0.375	35.191099	35.63046	12	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	101198093	101198093	17702	1	C	A	A	A	325	25	VCAM1	2	2
UBIAD1	29914	broad.mit.edu	37	1	11345877	11345877	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:11345877G>A	uc001asg.2	+	c.706G>A	c.(706-708)GAC>AAC	p.D236N		NM_013319	NP_037451	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	236			D -> E (in SCCD).		menaquinone biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrion|nucleus	prenyltransferase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)										0.246914	96.456778	105.87838	40	122	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	11345877	11345877	17443	1	G	A	A	A	533	41	UBIAD1	2	2
PTGFRN	5738	broad.mit.edu	37	1	117504037	117504037	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:117504037G>T	uc001egv.1	+	c.1386G>T	c.(1384-1386)GAG>GAT	p.E462D		NM_020440	NP_065173	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor negative regulator	462	Extracellular (Potential).|Ig-like C2-type 4.					endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	protein binding			liver(1)	1	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)										0.265625	82.484848	88.844194	34	94	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	117504037	117504037	13205	1	G	T	T	T	438	34	PTGFRN	2	2
FMO5	2330	broad.mit.edu	37	1	146672938	146672938	+	Missense_Mutation	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:146672938T>A	uc001epi.2	-	c.979A>T	c.(979-981)ATC>TTC	p.I327F	FMO5_uc001eph.3_Missense_Mutation_p.I327F|FMO5_uc001epj.2_Intron	NM_001461	NP_001452	P49326	FMO5_HUMAN	flavin containing monooxygenase 5 isoform 1	327					oxidation-reduction process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			ovary(3)	3	all_hematologic(923;0.0487)													0.516854	143.64621	143.668069	46	43	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	146672938	146672938	6200	1	T	A	A	A	637	49	FMO5	3	3
TARS2	80222	broad.mit.edu	37	1	150477145	150477145	+	Nonsense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:150477145C>T	uc001euq.2	+	c.1756C>T	c.(1756-1758)CGA>TGA	p.R586*	TARS2_uc001eur.2_Nonsense_Mutation_p.R504*|TARS2_uc009wlt.2_Nonsense_Mutation_p.R212*|TARS2_uc009wls.2_Nonsense_Mutation_p.R456*	NM_025150	NP_079426	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial	586					threonyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|threonine-tRNA ligase activity			ovary(1)	1	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)									0.155844	121.442997	173.671781	72	390	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	150477145	150477145	16082	1	C	T	T	T	295	23	TARS2	5	1
OAZ3	51686	broad.mit.edu	37	1	151743591	151743591	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:151743591G>A	uc010pdm.1	+	c.602G>A	c.(601-603)GGT>GAT	p.G201D	OAZ3_uc010pdl.1_Missense_Mutation_p.G157D|TDRKH_uc001eyy.2_Intron	NM_016178	NP_057262	Q9UMX2	OAZ3_HUMAN	ornithine decarboxylase antizyme 3 isoform 1	Error:Variant_position_missing_in_Q9UMX2_after_alignment					cellular nitrogen compound metabolic process|regulation of cellular amino acid metabolic process|spermatogenesis	cytosol|nucleus	ornithine decarboxylase inhibitor activity				0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)		L-Ornithine(DB00129)									0.329268	290.357574	298.799292	108	220	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	151743591	151743591	11211	1	G	A	A	A	572	44	OAZ3	2	2
HRNR	388697	broad.mit.edu	37	1	152192787	152192787	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:152192787C>A	uc001ezt.1	-	c.1318G>T	c.(1318-1320)GGC>TGC	p.G440C		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	440	4.				keratinization		calcium ion binding|protein binding			ovary(1)	1	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.319018	146.146915	150.889288	52	111	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	152192787	152192787	7653	1	C	A	A	A	299	23	HRNR	1	1
CRNN	49860	broad.mit.edu	37	1	152382438	152382438	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:152382438G>T	uc001ezx.2	-	c.1120C>A	c.(1120-1122)CAG>AAG	p.Q374K		NM_016190	NP_057274	Q9UBG3	CRNN_HUMAN	cornulin	374	Gln-rich.				cell-cell adhesion|response to heat	cytoplasm|membrane	calcium ion binding			ovary(2)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.142061	78.160933	122.547867	51	308	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	152382438	152382438	4031	1	G	T	T	T	624	48	CRNN	2	2
CRCT1	54544	broad.mit.edu	37	1	152487955	152487955	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:152487955G>T	uc001ezz.2	+	c.96G>T	c.(94-96)GCG>GCT	p.A32A		NM_019060	NP_061933	Q9UGL9	CRCT1_HUMAN	cysteine-rich C-terminal 1	32											0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.518519	40.741451	40.749196	14	13	KEEP	---	---	---	---	capture		Silent	SNP	152487955	152487955	3992	1	G	T	T	T	483	38	CRCT1	1	1
GATAD2B	57459	broad.mit.edu	37	1	153789863	153789863	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:153789863G>A	uc001fdb.3	-	c.885C>T	c.(883-885)GCC>GCT	p.A295A		NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	295					regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)											0.184211	57.111051	71.34171	28	124	KEEP	---	---	---	---	capture		Silent	SNP	153789863	153789863	6525	1	G	A	A	A	600	47	GATAD2B	2	2
FCRL3	115352	broad.mit.edu	37	1	157660199	157660199	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:157660199G>C	uc001fqz.3	-	c.1536C>G	c.(1534-1536)CAC>CAG	p.H512Q	FCRL3_uc001fqx.3_Non-coding_Transcript|FCRL3_uc001fqy.3_Non-coding_Transcript|FCRL3_uc009wsn.2_Non-coding_Transcript|FCRL3_uc009wso.2_Non-coding_Transcript|FCRL3_uc001fra.2_Missense_Mutation_p.H238Q|FCRL3_uc001frb.2_Missense_Mutation_p.H512Q|FCRL3_uc001frc.1_Missense_Mutation_p.H512Q	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	512	Ig-like C2-type 6.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)													0.423077	221.107552	221.91559	66	90	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	157660199	157660199	6033	1	G	C	C	C	516	40	FCRL3	3	3
SPTA1	6708	broad.mit.edu	37	1	158596791	158596791	+	Nonsense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:158596791G>A	uc001fst.1	-	c.5671C>T	c.(5671-5673)CAG>TAG	p.Q1891*		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1891	Spectrin 18.			Q -> H (in Ref. 1; AAA60577/AAA60994).	actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|breast(1)	5	all_hematologic(112;0.0378)													0.2625	48.928875	53.018956	21	59	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	158596791	158596791	15630	1	G	A	A	A	598	46	SPTA1	5	2
KLHDC9	126823	broad.mit.edu	37	1	161069916	161069916	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:161069916C>T	uc001fxr.2	+	c.952C>T	c.(952-954)CGC>TGC	p.R318C	KLHDC9_uc001fxq.2_Missense_Mutation_p.R80C|KLHDC9_uc001fxs.2_3'UTR	NM_152366	NP_689579	Q8NEP7	KLDC9_HUMAN	kelch/ankyrin repeat containing cyclin A1	318											0	all_cancers(52;1.28e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)											0.169604	141.557682	188.415445	77	377	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	161069916	161069916	8676	1	C	T	T	T	403	31	KLHDC9	1	1
SH2D1B	117157	broad.mit.edu	37	1	162372583	162372583	+	Silent	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:162372583A>G	uc001gbz.1	-	c.144T>C	c.(142-144)AAT>AAC	p.N48N	SH2D1B_uc001gca.1_Silent_p.N48N	NM_053282	NP_444512	O14796	SH21B_HUMAN	SH2 domain containing 1B	48	SH2.									pancreas(1)	1	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)											0.154286	63.52923	83.503233	27	148	KEEP	---	---	---	---	capture		Silent	SNP	162372583	162372583	14722	1	A	G	G	G	206	16	SH2D1B	4	4
ADCY10	55811	broad.mit.edu	37	1	167815391	167815391	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:167815391G>A	uc001ger.2	-	c.2548C>T	c.(2548-2550)CCC>TCC	p.P850S	ADCY10_uc009wvk.2_Missense_Mutation_p.P758S|ADCY10_uc010plj.1_Missense_Mutation_p.P697S|ADCY10_uc009wvl.2_Missense_Mutation_p.P849S	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10	850					intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3														0.148368	89.480507	129.44235	50	287	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	167815391	167815391	294	1	G	A	A	A	559	43	ADCY10	2	2
FMO1	2326	broad.mit.edu	37	1	171250010	171250010	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:171250010G>C	uc009wvz.2	+	c.713G>C	c.(712-714)CGC>CCC	p.R238P	FMO1_uc010pme.1_Missense_Mutation_p.R175P|FMO1_uc001ghl.2_Missense_Mutation_p.R238P|FMO1_uc001ghm.2_Missense_Mutation_p.R238P|FMO1_uc001ghn.2_Missense_Mutation_p.R238P	NM_002021	NP_002012	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	238					NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum lumen|integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding				0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)													0.443038	124.31693	124.539942	35	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	171250010	171250010	6196	1	G	C	C	C	494	38	FMO1	3	3
FAM5B	57795	broad.mit.edu	37	1	177250489	177250490	+	Missense_Mutation	DNP	GG	TT	TT			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:177250489_177250490GG>TT	uc001glf.2	+	c.2177_2178GG>TT	c.(2176-2178)CGG>CTT	p.R726L	FAM5B_uc001glg.2_Missense_Mutation_p.R621L	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	726						extracellular region				ovary(2)	2														0.146245	66.906411	97.341087	37	216	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	177250489	177250490	5816	1	GG	TT	TT	TT	507	39	FAM5B	1	1
KLHDC7A	127707	broad.mit.edu	37	1	18809215	18809215	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:18809215G>T	uc001bax.2	+	c.1740G>T	c.(1738-1740)CCG>CCT	p.P580P	KLHDC7A_uc009vpg.2_Silent_p.P362P	NM_152375	NP_689588	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	580	Kelch 3.					integral to membrane				ovary(2)	2		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)										0.266667	10.192653	10.930733	4	11	KEEP	---	---	---	---	capture		Silent	SNP	18809215	18809215	8672	1	G	T	T	T	483	38	KLHDC7A	1	1
FAM5C	339479	broad.mit.edu	37	1	190067753	190067754	+	Nonsense_Mutation	DNP	CC	AA	AA			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:190067753_190067754CC>AA	uc001gse.1	-	c.1695_1696GG>TT	c.(1693-1698)TTGGAG>TTTTAG	p.565_566LE>F*	FAM5C_uc010pot.1_Nonsense_Mutation_p.463_464LE>F*	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	565_566						extracellular region				lung(2)|ovary(1)|kidney(1)	4	Prostate(682;0.198)													0.202247	73.487765	88.160161	36	142	KEEP	---	---	---	---	capture		Nonsense_Mutation	DNP	190067753	190067754	5817	1	CC	AA	AA	AA	390	30	FAM5C	5	2
UBR4	23352	broad.mit.edu	37	1	19505708	19505708	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:19505708G>C	uc001bbi.2	-	c.2191C>G	c.(2191-2193)CTG>GTG	p.L731V	UBR4_uc001bbm.1_5'UTR	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	731					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)	23		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)										0.261905	35.706311	37.859949	11	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	19505708	19505708	17462	1	G	C	C	C	464	36	UBR4	3	3
LGR6	59352	broad.mit.edu	37	1	202287785	202287785	+	Missense_Mutation	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:202287785T>A	uc001gxu.2	+	c.2354T>A	c.(2353-2355)CTC>CAC	p.L785H	LGR6_uc001gxv.2_Missense_Mutation_p.L733H|LGR6_uc009xab.2_Non-coding_Transcript|LGR6_uc001gxw.2_Missense_Mutation_p.L646H	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled	785	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|pancreas(1)	8														0.561983	406.008806	406.818725	136	106	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	202287785	202287785	9084	1	T	A	A	A	702	54	LGR6	3	3
CNTN2	6900	broad.mit.edu	37	1	205033534	205033534	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:205033534C>A	uc001hbr.2	+	c.1325C>A	c.(1324-1326)CCC>CAC	p.P442H	CNTN2_uc001hbq.1_Missense_Mutation_p.P333H|CNTN2_uc001hbs.2_Missense_Mutation_p.P230H	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	442	Ig-like C2-type 5.				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			Melanoma(183;2548 2817 37099 41192)								0.340866	473.430272	485.306872	181	350	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	205033534	205033534	3779	1	C	A	A	A	286	22	CNTN2	2	2
C4BPA	722	broad.mit.edu	37	1	207287595	207287595	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:207287595C>A	uc001hfo.2	+	c.293C>A	c.(292-294)TCT>TAT	p.S98Y		NM_000715	NP_000706	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	98	Sushi 1.				complement activation, classical pathway|innate immune response	extracellular region	protein binding			large_intestine(1)|ovary(1)	2														0.212121	45.213842	52.803945	21	78	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	207287595	207287595	2344	1	C	A	A	A	416	32	C4BPA	2	2
HHAT	55733	broad.mit.edu	37	1	210637891	210637891	+	Missense_Mutation	SNP	A	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:210637891A>T	uc010psr.1	+	c.902A>T	c.(901-903)TAC>TTC	p.Y301F	HHAT_uc009xcx.2_Missense_Mutation_p.Y300F|HHAT_uc010psq.1_Missense_Mutation_p.Y163F|HHAT_uc001hhz.3_Missense_Mutation_p.Y300F|HHAT_uc010pss.1_Missense_Mutation_p.Y255F|HHAT_uc009xcy.2_Missense_Mutation_p.Y235F|HHAT_uc010pst.1_Missense_Mutation_p.Y237F|HHAT_uc010psu.1_Missense_Mutation_p.Y235F|HHAT_uc001hia.3_5'UTR	NM_018194	NP_060664	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	300	Helical; (Potential).				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)										0.115385	55.315311	123.581925	54	414	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	210637891	210637891	7373	1	A	T	T	T	182	14	HHAT	3	3
USH2A	7399	broad.mit.edu	37	1	215847654	215847654	+	Silent	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:215847654T>C	uc001hku.1	-	c.13599A>G	c.(13597-13599)TCA>TCG	p.S4533S		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4533	Fibronectin type-III 31.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|kidney(1)|central_nervous_system(1)	22				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)										0.131429	39.408845	62.51113	23	152	KEEP	---	---	---	---	capture		Silent	SNP	215847654	215847654	17598	1	T	C	C	C	704	55	USH2A	4	4
USH2A	7399	broad.mit.edu	37	1	216420112	216420112	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:216420112G>T	uc001hku.1	-	c.2624C>A	c.(2623-2625)ACA>AAA	p.T875K	USH2A_uc001hkv.2_Missense_Mutation_p.T875K	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	875	Laminin EGF-like 7.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|kidney(1)|central_nervous_system(1)	22				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)										0.259615	70.57198	76.017742	27	77	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	216420112	216420112	17598	1	G	T	T	T	624	48	USH2A	2	2
HSPG2	3339	broad.mit.edu	37	1	22159808	22159808	+	Missense_Mutation	SNP	T	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:22159808T>G	uc009vqd.2	-	c.11051A>C	c.(11050-11052)TAC>TCC	p.Y3684S	HSPG2_uc001bfi.2_5'Flank|HSPG2_uc001bfj.2_Missense_Mutation_p.Y3683S	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	3683	Laminin G-like 1.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)	8		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)									0.224299	65.339312	72.824828	24	83	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	22159808	22159808	7730	1	T	G	G	G	741	57	HSPG2	4	4
SUSD4	55061	broad.mit.edu	37	1	223396808	223396808	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:223396808C>G	uc001hnx.2	-	c.1227G>C	c.(1225-1227)CAG>CAC	p.Q409H	SUSD4_uc001hny.3_Missense_Mutation_p.Q409H|SUSD4_uc010puw.1_Missense_Mutation_p.Q249H	NM_017982	NP_060452	Q5VX71	SUSD4_HUMAN	sushi domain containing 4 isoform a	409	Cytoplasmic (Potential).					integral to membrane					0				GBM - Glioblastoma multiforme(131;0.0611)										0.285714	55.722841	58.319351	18	45	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	223396808	223396808	15930	1	C	G	G	G	415	32	SUSD4	3	3
OBSCN	84033	broad.mit.edu	37	1	228462074	228462074	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:228462074G>A	uc009xez.1	+	c.5612G>A	c.(5611-5613)CGC>CAC	p.R1871H	OBSCN_uc001hsn.2_Missense_Mutation_p.R1871H	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	1871	Ig-like 18.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			large_intestine(7)|breast(5)|ovary(4)|skin(2)|stomach(1)|central_nervous_system(1)|pancreas(1)	21		Prostate(94;0.0405)								4006				0.122807	21.545001	45.37972	21	150	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	228462074	228462074	11217	1	G	A	A	A	494	38	OBSCN	1	1
TAF5L	27097	broad.mit.edu	37	1	229738448	229738448	+	Nonsense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:229738448G>A	uc001htq.2	-	c.466C>T	c.(466-468)CGA>TGA	p.R156*	TAF5L_uc001htr.2_Nonsense_Mutation_p.R156*	NM_014409	NP_055224	O75529	TAF5L_HUMAN	PCAF associated factor 65 beta isoform a	156					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	STAGA complex|transcription factor TFTC complex	sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulator activity			ovary(1)	1	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)												0.308642	196.0015	203.95185	75	168	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	229738448	229738448	16050	1	G	A	A	A	480	37	TAF5L	5	1
PCNXL2	80003	broad.mit.edu	37	1	233136185	233136185	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:233136185C>A	uc001hvl.2	-	c.5194G>T	c.(5194-5196)GAC>TAC	p.D1732Y	PCNXL2_uc001hvk.1_Missense_Mutation_p.D384Y|PCNXL2_uc001hvm.1_Non-coding_Transcript	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	1732						integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)												0.449153	169.690587	169.950986	53	65	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	233136185	233136185	12012	1	C	A	A	A	403	31	PCNXL2	1	1
NID1	4811	broad.mit.edu	37	1	236176844	236176844	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:236176844G>T	uc001hxo.2	-	c.2271C>A	c.(2269-2271)CGC>CGA	p.R757R	NID1_uc009xgd.2_Intron|NID1_uc009xgc.2_5'Flank	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor	757					bioluminescence|cell-matrix adhesion|protein-chromophore linkage	basement membrane|membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)									0.354839	90.140768	91.871003	33	60	KEEP	---	---	---	---	capture		Silent	SNP	236176844	236176844	10815	1	G	T	T	T	535	42	NID1	2	2
HEATR1	55127	broad.mit.edu	37	1	236746143	236746143	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:236746143T>C	uc001hyd.1	-	c.2455A>G	c.(2455-2457)AAA>GAA	p.K819E	HEATR1_uc009xgh.1_Missense_Mutation_p.K62E	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	819					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)	2	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)											0.5	203.934008	203.934008	55	55	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	236746143	236746143	7310	1	T	C	C	C	806	62	HEATR1	4	4
ACTN2	88	broad.mit.edu	37	1	236925911	236925911	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:236925911G>T	uc001hyf.2	+	c.2677G>T	c.(2677-2679)GAT>TAT	p.D893Y	ACTN2_uc001hyg.2_Missense_Mutation_p.D685Y|ACTN2_uc009xgi.1_Missense_Mutation_p.D893Y|ACTN2_uc010pxu.1_Missense_Mutation_p.D582Y|ACTN2_uc001hyh.2_Missense_Mutation_p.D581Y	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	893					focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)	4	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)											0.471698	68.854496	68.892459	25	28	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	236925911	236925911	206	1	G	T	T	T	481	37	ACTN2	1	1
GREM2	64388	broad.mit.edu	37	1	240656560	240656560	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:240656560C>G	uc001hys.2	-	c.216G>C	c.(214-216)TGG>TGC	p.W72C		NM_022469	NP_071914	Q9H772	GREM2_HUMAN	gremlin 2 precursor	72					BMP signaling pathway	extracellular space	cytokine activity				0		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)											0.147368	29.09376	40.43296	14	81	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	240656560	240656560	7040	1	C	G	G	G	234	18	GREM2	3	3
RGS7	6000	broad.mit.edu	37	1	241262063	241262063	+	Splice_Site_SNP	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:241262063C>T	uc001hyv.2	-	c.79_splice	c.e3-1	p.M27_splice	RGS7_uc010pyh.1_Splice_Site_SNP_p.M1_splice|RGS7_uc010pyj.1_Splice_Site_SNP|RGS7_uc001hyu.2_Splice_Site_SNP_p.M27_splice|RGS7_uc009xgn.1_Splice_Site_SNP_p.M27_splice|RGS7_uc001hyw.2_Splice_Site_SNP_p.M27_splice	NM_002924	NP_002915			regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|kidney(1)	5		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)											0.304348	58.541011	60.902607	21	48	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	241262063	241262063	13784	1	C	T	T	T	416	32	RGS7	5	2
AHCTF1	25909	broad.mit.edu	37	1	247063503	247063503	+	Silent	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:247063503T>A	uc001ibv.1	-	c.1323A>T	c.(1321-1323)TCA>TCT	p.S441S	AHCTF1_uc001ibu.1_Silent_p.S432S|AHCTF1_uc009xgs.1_5'Flank	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	432	Necessary for cytoplasmic localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)	5	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			Colon(145;197 1800 4745 15099 26333)								0.296296	136.535727	142.548816	48	114	KEEP	---	---	---	---	capture		Silent	SNP	247063503	247063503	411	1	T	A	A	A	652	51	AHCTF1	3	3
OR2G3	81469	broad.mit.edu	37	1	247769603	247769603	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:247769603G>T	uc010pyz.1	+	c.716G>T	c.(715-717)AGC>ATC	p.S239I		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	239	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)											0.571429	85.201116	85.41824	28	21	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	247769603	247769603	11405	1	G	T	T	T	442	34	OR2G3	2	2
OR6F1	343169	broad.mit.edu	37	1	247875300	247875301	+	Missense_Mutation	DNP	CC	AA	AA	rs112992531		TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:247875300_247875301CC>AA	uc001idj.1	-	c.757_758GG>TT	c.(757-759)GGG>TTG	p.G253L		NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F,	253	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)											0.273171	143.311232	152.81631	56	149	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	247875300	247875301	11611	1	CC	AA	AA	AA	286	22	OR6F1	2	2
OR2L3	391192	broad.mit.edu	37	1	248224140	248224140	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:248224140C>A	uc001idx.1	+	c.157C>A	c.(157-159)CAT>AAT	p.H53N	OR2L13_uc001ids.2_Intron	NM_001004687	NP_001004687	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L,	53	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)											0.369444	376.531663	381.94212	133	227	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	248224140	248224140	11414	1	C	A	A	A	273	21	OR2L3	2	2
OR2M3	127062	broad.mit.edu	37	1	248366751	248366751	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:248366751C>G	uc010pzg.1	+	c.382C>G	c.(382-384)CAC>GAC	p.H128D		NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M,	128	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)											0.1625	86.250829	112.271784	39	201	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	248366751	248366751	11417	1	C	G	G	G	273	21	OR2M3	3	3
AIM1L	55057	broad.mit.edu	37	1	26663852	26663852	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:26663852C>A	uc001bmd.3	-	c.528G>T	c.(526-528)AAG>AAT	p.K176N	AIM1L_uc001bmf.3_Missense_Mutation_p.K67N	NM_001039775	NP_001034864	Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	176	Beta/gamma crystallin 'Greek key' 4.						sugar binding			pancreas(1)	1		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)										0.233766	79.559374	89.526284	36	118	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	26663852	26663852	434	1	C	A	A	A	311	24	AIM1L	2	2
COL16A1	1307	broad.mit.edu	37	1	32163665	32163665	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:32163665G>T	uc001btk.1	-	c.499C>A	c.(499-501)CGT>AGT	p.R167S	COL16A1_uc001btj.1_5'UTR|COL16A1_uc001btl.3_Missense_Mutation_p.R167S	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	167	TSP N-terminal.				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		Colon(143;498 1786 21362 25193 36625)								0.305263	77.636312	80.852076	29	66	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32163665	32163665	3811	1	G	T	T	T	494	38	COL16A1	1	1
GJA4	2701	broad.mit.edu	37	1	35260118	35260118	+	Silent	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:35260118C>A	uc009vul.2	+	c.532C>A	c.(532-534)CGA>AGA	p.R178R	GJA4_uc001bya.2_Silent_p.R102R|GJA4_uc009vum.1_Silent_p.R102R	NM_002060	NP_002051	P35212	CXA4_HUMAN	connexin 37	102	Cytoplasmic (Potential).				cell-cell junction assembly	integral to plasma membrane				central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)												0.352941	70.7173	71.997366	24	44	KEEP	---	---	---	---	capture		Silent	SNP	35260118	35260118	6671	1	C	A	A	A	347	27	GJA4	1	1
KIAA0467	23334	broad.mit.edu	37	1	43908192	43908192	+	Missense_Mutation	SNP	A	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:43908192A>T	uc001cjk.1	+	c.5357A>T	c.(5356-5358)CAG>CTG	p.Q1786L		NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	2685						peroxisome				breast(6)|ovary(4)|pancreas(1)	11	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)												0.207207	53.263341	62.081851	23	88	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43908192	43908192	8485	1	A	T	T	T	91	7	KIAA0467	3	3
HECTD3	79654	broad.mit.edu	37	1	45476310	45476310	+	Silent	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:45476310C>A	uc009vxk.2	-	c.438G>T	c.(436-438)GCG>GCT	p.A146A	HECTD3_uc001cmy.3_5'Flank|HECTD3_uc010olh.1_Intron|UROD_uc010oli.1_5'Flank|UROD_uc001cna.1_5'Flank|UROD_uc001cnb.1_5'Flank|UROD_uc010olj.1_5'Flank|UROD_uc001cnc.1_5'Flank	NM_024602	NP_078878	Q5T447	HECD3_HUMAN	HECT domain containing 3	146					proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of mitotic metaphase/anaphase transition	anaphase-promoting complex|perinuclear region of cytoplasm	ubiquitin-protein ligase activity				0	Acute lymphoblastic leukemia(166;0.155)													0.384615	11.965153	12.118925	5	8	KEEP	---	---	---	---	capture		Silent	SNP	45476310	45476310	7324	1	C	A	A	A	288	23	HECTD3	1	1
ZYG11B	79699	broad.mit.edu	37	1	53245579	53245579	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:53245579G>C	uc001cuj.2	+	c.1006G>C	c.(1006-1008)GAA>CAA	p.E336Q	ZYG11B_uc009vzg.2_Non-coding_Transcript|ZYG11B_uc010onj.1_Missense_Mutation_p.E327Q	NM_024646	NP_078922	Q9C0D3	ZY11B_HUMAN	zyg-11 homolog B	336							protein binding			ovary(1)|pancreas(1)	2														0.259804	171.686197	182.338924	53	151	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	53245579	53245579	18859	1	G	C	C	C	585	45	ZYG11B	3	3
USP24	23358	broad.mit.edu	37	1	55598341	55598341	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:55598341G>A	uc001cyg.3	-	c.2934C>T	c.(2932-2934)TCC>TCT	p.S978S		NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24	1138	Ser-rich.				ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13														0.333333	15.669957	16.038988	5	10	KEEP	---	---	---	---	capture		Silent	SNP	55598341	55598341	17618	1	G	A	A	A	444	35	USP24	2	2
IL12RB2	3595	broad.mit.edu	37	1	67795269	67795269	+	Splice_Site_SNP	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:67795269G>T	uc001ddu.2	+	c.665_splice	c.e6-1	p.V222_splice	IL12RB2_uc010oqi.1_Splice_Site_SNP_p.V222_splice|IL12RB2_uc010oqj.1_Splice_Site_SNP_p.V222_splice|IL12RB2_uc010oqk.1_Splice_Site_SNP|IL12RB2_uc010oql.1_Splice_Site_SNP_p.V222_splice|IL12RB2_uc010oqm.1_Splice_Site_SNP_p.V222_splice|IL12RB2_uc010oqn.1_Splice_Site_SNP	NM_001559	NP_001550			interleukin 12 receptor, beta 2 precursor						positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3														0.191176	28.637506	34.696338	13	55	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	67795269	67795269	7928	1	G	T	T	T	468	36	IL12RB2	5	2
IL12RB2	3595	broad.mit.edu	37	1	67861719	67861719	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:67861719G>C	uc001ddu.2	+	c.2536G>C	c.(2536-2538)GAT>CAT	p.D846H	IL12RB2_uc010oqi.1_3'UTR|IL12RB2_uc010oqj.1_3'UTR|IL12RB2_uc010oqk.1_Non-coding_Transcript|IL12RB2_uc010oql.1_Missense_Mutation_p.D760H|IL12RB2_uc010oqm.1_3'UTR|IL12RB2_uc010oqn.1_Non-coding_Transcript	NM_001559	NP_001550	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2 precursor	846	Cytoplasmic (Potential).				positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3														0.246518	566.622385	608.610819	177	541	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	67861719	67861719	7928	1	G	C	C	C	585	45	IL12RB2	3	3
CTH	1491	broad.mit.edu	37	1	70899568	70899568	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:70899568G>T	uc001dfd.2	+	c.935G>T	c.(934-936)GGG>GTG	p.G312V	CTH_uc001dfe.2_Missense_Mutation_p.G268V|CTH_uc010oqq.1_Missense_Mutation_p.G280V	NM_001902	NP_001893	P32929	CGL_HUMAN	cystathionase isoform 1	312					cysteine biosynthetic process|hydrogen sulfide biosynthetic process|protein homotetramerization|protein-pyridoxal-5-phosphate linkage via peptidyl-N6-pyridoxal phosphate-L-lysine	cytoplasm|nucleus	cystathionine gamma-lyase activity|L-cysteine desulfhydrase activity|pyridoxal phosphate binding			lung(1)	1					L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)									0.177419	21.294456	27.366173	11	51	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	70899568	70899568	4168	1	G	T	T	T	559	43	CTH	2	2
ELTD1	64123	broad.mit.edu	37	1	79358799	79358799	+	Missense_Mutation	SNP	A	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:79358799A>C	uc001diq.3	-	c.1825T>G	c.(1825-1827)TGC>GGC	p.C609G		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	609	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)	1				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)										0.166667	5.242574	6.506344	2	10	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	79358799	79358799	5276	1	A	C	C	C	65	5	ELTD1	4	4
PRKACB	5567	broad.mit.edu	37	1	84610229	84610229	+	Nonsense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:84610229C>G	uc001djl.2	+	c.185C>G	c.(184-186)TCA>TGA	p.S62*	PRKACB_uc001djj.2_Intron|PRKACB_uc001dji.2_Intron|PRKACB_uc001djk.2_Nonsense_Mutation_p.S62*	NM_182948	NP_891993	P22694	KAPCB_HUMAN	cAMP-dependent protein kinase catalytic subunit	15					activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|cytosol|nucleoplasm	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding			lung(2)|ovary(1)	3				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)						144				0.132353	18.526474	27.453094	9	59	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	84610229	84610229	12941	1	C	G	G	G	377	29	PRKACB	5	3
AGRN	375790	broad.mit.edu	37	1	957682	957682	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:957682C>T	uc001ack.1	+	c.303C>T	c.(301-303)CTC>CTT	p.L101L		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	101	NtA.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)										0.235294	183.589633	206.49732	84	273	KEEP	---	---	---	---	capture		Silent	SNP	957682	957682	400	1	C	T	T	T	366	29	AGRN	2	2
SLC24A3	57419	broad.mit.edu	37	20	19665960	19665960	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:19665960G>A	uc002wrl.2	+	c.1279G>A	c.(1279-1281)GAC>AAC	p.D427N		NM_020689	NP_065740	Q9HC58	NCKX3_HUMAN	solute carrier family 24	427	Cytoplasmic (Potential).|Poly-Glu.					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1														0.604651	329.116231	330.763051	104	68	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	19665960	19665960	14964	20	G	A	A	A	533	41	SLC24A3	2	2
CST9	128822	broad.mit.edu	37	20	23584184	23584184	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:23584184G>T	uc002wtl.2	-	c.443C>A	c.(442-444)GCA>GAA	p.A148E		NM_001008693	NP_001008693	Q5W186	CST9_HUMAN	cystatin 9 precursor	148						extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1	Colorectal(13;0.0993)													0.681818	287.57673	291.448582	90	42	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	23584184	23584184	4120	20	G	T	T	T	598	46	CST9	2	2
C20orf96	140680	broad.mit.edu	37	20	257517	257517	+	Missense_Mutation	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:257517T>A	uc002wde.1	-	c.829A>T	c.(829-831)ACC>TCC	p.T277S	C20orf96_uc002wdc.2_Missense_Mutation_p.T224S|C20orf96_uc002wdd.2_Missense_Mutation_p.T242S|C20orf96_uc010zpi.1_Missense_Mutation_p.T224S|C20orf96_uc010zpj.1_Missense_Mutation_p.T242S|C20orf96_uc010zpk.1_Missense_Mutation_p.T215S	NM_153269	NP_695001	Q9NUD7	CT096_HUMAN	hypothetical protein LOC140680	277	Potential.										0		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)											0.569231	113.383536	113.656255	37	28	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	257517	257517	2202	20	T	A	A	A	780	60	C20orf96	3	3
E2F1	1869	broad.mit.edu	37	20	32265061	32265061	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:32265061T>C	uc002wzu.3	-	c.916A>G	c.(916-918)ATC>GTC	p.I306V	NECAB3_uc002wzm.3_5'Flank|NECAB3_uc002wzn.3_5'Flank|NECAB3_uc002wzo.3_5'Flank|NECAB3_uc002wzp.3_5'Flank|NECAB3_uc002wzq.3_5'Flank|NECAB3_uc002wzr.3_5'Flank|NECAB3_uc010geo.2_5'Flank	NM_005225	NP_005216	Q01094	E2F1_HUMAN	E2F transcription factor 1	306	Required for interaction with TRIM28.				apoptosis|cell proliferation|G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|mRNA stabilization|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of transcription involved in G1/S phase of mitotic cell cycle|positive regulation of fibroblast proliferation|positive regulation of gene-specific transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle	mitochondrion|Rb-E2F complex	sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription corepressor activity|transcription factor binding				0										66				0.128342	37.036913	62.171258	24	163	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32265061	32265061	5052	20	T	C	C	C	650	50	E2F1	4	4
KIAA0406	9675	broad.mit.edu	37	20	36611948	36611948	+	Silent	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:36611948G>C	uc002xhl.2	-	c.3180C>G	c.(3178-3180)CCC>CCG	p.P1060P	KIAA0406_uc002xhm.2_Silent_p.P1060P	NM_014657	NP_055472	O43156	TTI1_HUMAN	hypothetical protein LOC9675	1060							binding				0		Myeloproliferative disorder(115;0.00874)												0.425926	132.713305	133.23375	46	62	KEEP	---	---	---	---	capture		Silent	SNP	36611948	36611948	8480	20	G	C	C	C	600	47	KIAA0406	3	3
BPI	671	broad.mit.edu	37	20	36937430	36937430	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:36937430G>T	uc002xib.2	+	c.356G>T	c.(355-357)AGC>ATC	p.S119I		NM_001725	NP_001716	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	119					defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)												0.649746	404.230861	408.120617	128	69	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	36937430	36937430	1518	20	G	T	T	T	442	34	BPI	2	2
SULF2	55959	broad.mit.edu	37	20	46318884	46318884	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:46318884G>T	uc002xto.2	-	c.723C>A	c.(721-723)AAC>AAA	p.N241K	SULF2_uc002xtr.2_Missense_Mutation_p.N241K|SULF2_uc002xtq.2_Missense_Mutation_p.N241K|SULF2_uc010ghv.1_Missense_Mutation_p.N241K	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	241					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)	5									p.N241N(U138MG-Tumor)	709				0.592233	208.694589	209.460423	61	42	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	46318884	46318884	15891	20	G	T	T	T	516	40	SULF2	1	1
DOK5	55816	broad.mit.edu	37	20	53205280	53205280	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:53205280G>T	uc002xwy.2	+	c.344G>T	c.(343-345)CGG>CTG	p.R115L	DOK5_uc010gin.2_Missense_Mutation_p.R7L|DOK5_uc002xwz.2_5'UTR	NM_018431	NP_060901	Q9P104	DOK5_HUMAN	docking protein 5	115							insulin receptor binding			ovary(1)	1			Colorectal(105;0.202)											0.440559	188.508364	188.947612	63	80	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	53205280	53205280	4884	20	G	T	T	T	507	39	DOK5	1	1
PCK1	5105	broad.mit.edu	37	20	56138620	56138620	+	Splice_Site_SNP	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:56138620G>T	uc002xyn.3	+	c.799_splice	c.e6-1	p.I267_splice	PCK1_uc010zzm.1_Intron	NM_002591	NP_002582			cytosolic phosphoenolpyruvate carboxykinase 1						gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity				0	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)											0.331492	157.231956	161.789272	60	121	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	56138620	56138620	12001	20	G	T	T	T	429	33	PCK1	5	2
HRH3	11255	broad.mit.edu	37	20	60791983	60791983	+	Splice_Site_SNP	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:60791983C>A	uc002yci.2	-	c.418_splice	c.e3-1	p.V140_splice	HRH3_uc002ycf.2_Intron|HRH3_uc002ycg.2_Splice_Site_SNP_p.V140_splice|HRH3_uc002ych.2_Splice_Site_SNP_p.V140_splice	NM_007232	NP_009163			histamine receptor H3						G-protein signaling, coupled to cyclic nucleotide second messenger|neurotransmitter secretion	integral to plasma membrane	histamine receptor activity				0	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Histamine Phosphate(DB00667)									0.652174	179.212474	181.089352	60	32	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	60791983	60791983	7649	20	C	A	A	A	312	24	HRH3	5	2
LAMA5	3911	broad.mit.edu	37	20	60906119	60906119	+	Missense_Mutation	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:60906119T>A	uc002ycq.2	-	c.3619A>T	c.(3619-3621)ATC>TTC	p.I1207F		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	1207	Domain IV 1 (domain IV B).				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding|receptor activity|structural molecule activity			pancreas(1)	1	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)									0.538462	44.75089	44.784521	14	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	60906119	60906119	8932	20	T	A	A	A	663	51	LAMA5	3	3
SRMS	6725	broad.mit.edu	37	20	62174736	62174736	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:62174736C>T	uc002yfi.1	-	c.576G>A	c.(574-576)GAG>GAA	p.E192E		NM_080823	NP_543013	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory	192	SH2.				protein phosphorylation		ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(1)	1	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)							557				0.30853	450.851936	468.852302	170	381	KEEP	---	---	---	---	capture		Silent	SNP	62174736	62174736	15666	20	C	T	T	T	363	28	SRMS	2	2
KRTAP13-3	337960	broad.mit.edu	37	21	31797799	31797799	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:31797799G>T	uc002yob.1	-	c.432C>A	c.(430-432)TCC>TCA	p.S144S		NM_181622	NP_853653	Q3SY46	KR133_HUMAN	keratin associated protein 13-3	144						intermediate filament				ovary(1)|lung(1)	2														0.129032	8.529995	16.906603	8	54	KEEP	---	---	---	---	capture		Silent	SNP	31797799	31797799	8839	21	G	T	T	T	600	47	KRTAP13-3	2	2
COL6A1	1291	broad.mit.edu	37	21	47412102	47412102	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:47412102C>T	uc002zhu.1	+	c.1207C>T	c.(1207-1209)CCC>TCC	p.P403S		NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor	403	Triple-helical region.				axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)									0.565217	163.884804	164.223725	52	40	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	47412102	47412102	3837	21	C	T	T	T	286	22	COL6A1	2	2
PRAME	23532	broad.mit.edu	37	22	22890696	22890696	+	Silent	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:22890696A>G	uc002zwf.2	-	c.1323T>C	c.(1321-1323)TAT>TAC	p.Y441Y	LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Silent_p.Y425Y|PRAME_uc010gtr.2_Silent_p.Y441Y|PRAME_uc002zwg.2_Silent_p.Y441Y|PRAME_uc002zwh.2_Silent_p.Y441Y|PRAME_uc002zwi.2_Silent_p.Y441Y|PRAME_uc002zwj.2_Silent_p.Y441Y|PRAME_uc002zwk.2_Silent_p.Y441Y	NM_206956	NP_996839	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	441	Mediates interaction with RARA.				apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|positive regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding|transcription repressor activity			central_nervous_system(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		Melanoma(73;1707 1838 15168 27201)				1184				0.490066	259.853562	259.866165	74	77	KEEP	---	---	---	---	capture		Silent	SNP	22890696	22890696	12860	22	A	G	G	G	154	12	PRAME	4	4
SMARCB1	6598	broad.mit.edu	37	22	24129426	24129426	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:24129426G>C	uc002zyd.2	+	c.70G>C	c.(70-72)GAG>CAG	p.E24Q	SMARCB1_uc002zyg.2_Missense_Mutation_p.E24Q|SMARCB1_uc011ajb.1_Missense_Mutation_p.E24Q|SMARCB1_uc002zya.2_Missense_Mutation_p.E24Q|SMARCB1_uc002zyb.2_Missense_Mutation_p.E24Q|SMARCB1_uc002zyc.2_Missense_Mutation_p.E24Q	NM_001007468	NP_001007469	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin	24					cell cycle|chromatin remodeling|DNA integration|interspecies interaction between organisms|nervous system development|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|retroviral genome replication|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleolus|nucleoplasm|SWI/SNF complex	p53 binding	p.?(2)		soft_tissue(192)|central_nervous_system(172)|haematopoietic_and_lymphoid_tissue(23)|meninges(5)|bone(4)|ovary(2)|endometrium(1)|skin(1)|pancreas(1)	401		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)								150				0.220779	53.547662	59.062779	17	60	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	24129426	24129426	15272	22	G	C	C	C	481	37	SMARCB1	3	3
LRP5L	91355	broad.mit.edu	37	22	25755958	25755958	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:25755958G>A	uc003abs.2	-	c.102C>T	c.(100-102)AAC>AAT	p.N34N	LRP5L_uc011ajz.1_Silent_p.N34N|LRP5L_uc010guw.1_Silent_p.N34N	NM_182492	NP_872298	A4QPB2	LRP5L_HUMAN	low density lipoprotein receptor-related protein	34	LDL-receptor class B 1.					membrane					0														0.175926	34.130899	44.770253	19	89	KEEP	---	---	---	---	capture		Silent	SNP	25755958	25755958	9334	22	G	A	A	A	516	40	LRP5L	1	1
PES1	23481	broad.mit.edu	37	22	30977532	30977532	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:30977532G>A	uc003aij.1	-	c.730C>T	c.(730-732)CTC>TTC	p.L244F	PES1_uc003aik.1_Missense_Mutation_p.L244F|PES1_uc003ail.1_Missense_Mutation_p.L227F|PES1_uc003aim.1_Missense_Mutation_p.L244F|PES1_uc003ain.1_Missense_Mutation_p.L105F|PES1_uc003aio.1_Missense_Mutation_p.L105F	NM_014303	NP_055118	O00541	PESC_HUMAN	pescadillo homolog 1, containing BRCT domain	244	Sufficient for nucleolar localization.				cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	chromosome|nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0														0.561224	183.232772	183.552169	55	43	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	30977532	30977532	12154	22	G	A	A	A	455	35	PES1	2	2
TOM1	10043	broad.mit.edu	37	22	35743195	35743195	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:35743195C>T	uc003anp.2	+	c.1475C>T	c.(1474-1476)GCC>GTC	p.A492V	TOM1_uc011ami.1_Missense_Mutation_p.A459V|TOM1_uc011amj.1_Missense_Mutation_p.A334V|TOM1_uc003ans.2_Missense_Mutation_p.A334V|TOM1_uc011amk.1_Missense_Mutation_p.A453V|TOM1_uc003ann.2_Missense_Mutation_p.A491V|TOM1_uc011aml.1_Missense_Mutation_p.A446V|TOM1_uc003ano.2_Non-coding_Transcript|TOM1_uc003anq.2_Missense_Mutation_p.A485V|TOM1_uc003anr.2_Missense_Mutation_p.A334V	NM_001135732	NP_001129204	O60784	TOM1_HUMAN	target of myb1 isoform 2	491					endocytosis|endosome transport|intracellular protein transport	cytosol|early endosome|membrane	protein binding			ovary(1)	1														0.477612	189.184747	189.243199	64	70	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	35743195	35743195	16892	22	C	T	T	T	338	26	TOM1	2	2
RPL3	6122	broad.mit.edu	37	22	39710735	39710735	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:39710735C>A	uc003axi.2	-	c.805G>T	c.(805-807)GCT>TCT	p.A269S	RPL3_uc003axh.2_Missense_Mutation_p.A220S|RPL3_uc003axj.2_Missense_Mutation_p.A117S|RPL3_uc010gxx.2_Missense_Mutation_p.A217S|RPL3_uc003axg.2_Missense_Mutation_p.A217S|RPL3_uc003axk.1_Missense_Mutation_p.A117S	NM_000967	NP_000958	P39023	RL3_HUMAN	ribosomal protein L3 isoform a	269					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome			breast(1)|kidney(1)	2	Melanoma(58;0.04)													0.457831	114.439254	114.567939	38	45	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	39710735	39710735	14058	22	C	A	A	A	351	27	RPL3	1	1
RAD51AP2	729475	broad.mit.edu	37	2	17696555	17696555	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:17696555C>A	uc002rcl.1	-	c.3128G>T	c.(3127-3129)AGT>ATT	p.S1043I	RAD51AP2_uc010exn.1_Missense_Mutation_p.S1034I	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	1043										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)													0.74	124.492927	127.098216	37	13	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	17696555	17696555	13447	2	C	A	A	A	260	20	RAD51AP2	2	2
ABCB6	10058	broad.mit.edu	37	2	220077768	220077768	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:220077768C>G	uc002vkc.1	-	c.1825G>C	c.(1825-1827)GTG>CTG	p.V609L	ABCB6_uc010fwe.1_Missense_Mutation_p.V563L	NM_005689	NP_005680	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B, member 6	609	ABC transporter.				cellular iron ion homeostasis|detoxification of cadmium ion|porphyrin biosynthetic process	ATP-binding cassette (ABC) transporter complex|Golgi apparatus|integral to mitochondrial outer membrane|plasma membrane|vacuolar membrane	ATP binding|cadmium ion transmembrane transporter activity|efflux transmembrane transporter activity|heme binding|heme-transporting ATPase activity			breast(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.468085	72.930632	72.973196	22	25	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	220077768	220077768	46	2	C	G	G	G	247	19	ABCB6	3	3
DNAJB3	414061	broad.mit.edu	37	2	234652186	234652186	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:234652186G>A	uc002vuz.2	-	c.377C>T	c.(376-378)TCA>TTA	p.S126L	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron	NM_001001394	NP_001001394	Q8WWF6	DNJB3_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 3	126					protein folding		heat shock protein binding|unfolded protein binding				0														0.166667	32.417614	45.070843	20	100	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	234652186	234652186	4804	2	G	A	A	A	585	45	DNAJB3	2	2
KIF1A	547	broad.mit.edu	37	2	241661247	241661247	+	Missense_Mutation	SNP	A	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:241661247A>T	uc010fzk.2	-	c.4720T>A	c.(4720-4722)TGC>AGC	p.C1574S	KIF1A_uc002vzy.2_Missense_Mutation_p.C1473S|KIF1A_uc002vzw.2_Missense_Mutation_p.C134S|KIF1A_uc002vzx.2_Missense_Mutation_p.C200S	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles	1473					anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)										0.807692	70.187633	72.486467	21	5	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	241661247	241661247	8594	2	A	T	T	T	91	7	KIF1A	3	3
OTOF	9381	broad.mit.edu	37	2	26707430	26707430	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:26707430C>A	uc002rhk.2	-	c.1117G>T	c.(1117-1119)GTG>TTG	p.V373L		NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	373	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GBM(102;732 1451 20652 24062 31372)								0.604938	165.390519	166.170754	49	32	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	26707430	26707430	11715	2	C	A	A	A	247	19	OTOF	1	1
CAD	790	broad.mit.edu	37	2	27440873	27440873	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:27440873G>C	uc002rji.2	+	c.211G>C	c.(211-213)GGT>CGT	p.G71R	CAD_uc010eyw.2_Missense_Mutation_p.G71R	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	71	GATase (Glutamine amidotransferase).				'de novo' pyrimidine base biosynthetic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|nuclear matrix	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)					653				0.277778	77.535073	82.323136	30	78	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	27440873	27440873	2681	2	G	C	C	C	507	39	CAD	3	3
ZNF512	84450	broad.mit.edu	37	2	27822533	27822533	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:27822533C>A	uc002rla.2	+	c.361C>A	c.(361-363)CAT>AAT	p.H121N	ZNF512_uc010ylv.1_Missense_Mutation_p.H42N|ZNF512_uc010ylw.1_Missense_Mutation_p.H120N|ZNF512_uc002rlb.2_Missense_Mutation_p.H42N|ZNF512_uc010ylx.1_Missense_Mutation_p.H42N|ZNF512_uc002rlc.2_Missense_Mutation_p.H42N|ZNF512_uc010yly.1_Non-coding_Transcript|ZNF512_uc010ylz.1_Missense_Mutation_p.H42N	NM_032434	NP_115810	Q96ME7	ZN512_HUMAN	zinc finger protein 512	121					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)													0.627451	206.819572	208.272777	64	38	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	27822533	27822533	18550	2	C	A	A	A	325	25	ZNF512	2	2
ATL2	64225	broad.mit.edu	37	2	38542443	38542443	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:38542443C>T	uc002rqq.2	-	c.637G>A	c.(637-639)GAT>AAT	p.D213N	ATL2_uc010ynm.1_Missense_Mutation_p.D195N|ATL2_uc010ynn.1_Missense_Mutation_p.D195N|ATL2_uc010yno.1_Missense_Mutation_p.D42N|ATL2_uc002rqs.2_Missense_Mutation_p.D213N|ATL2_uc002rqr.2_Missense_Mutation_p.D42N	NM_001135673	NP_001129145	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2 isoform 2	213	Cytoplasmic.				endoplasmic reticulum organization|Golgi organization|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	GTP binding|GTPase activity|identical protein binding			ovary(1)|kidney(1)	2														0.256757	47.086025	51.058534	19	55	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	38542443	38542443	1126	2	C	T	T	T	377	29	ATL2	2	2
CTNNA2	1496	broad.mit.edu	37	2	80782968	80782968	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:80782968G>T	uc010ysh.1	+	c.1691G>T	c.(1690-1692)GGG>GTG	p.G564V	CTNNA2_uc010yse.1_Missense_Mutation_p.G564V|CTNNA2_uc010ysf.1_Missense_Mutation_p.G564V|CTNNA2_uc010ysg.1_Missense_Mutation_p.G564V|CTNNA2_uc010ysi.1_Missense_Mutation_p.G196V	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	564					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)	8										489				0.621212	380.733148	383.277307	123	75	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	80782968	80782968	4172	2	G	T	T	T	559	43	CTNNA2	2	2
CD8B	926	broad.mit.edu	37	2	87073827	87073827	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:87073827C>A	uc002ssa.2	-	c.563G>T	c.(562-564)GGA>GTA	p.G188V	RMND5A_uc002srs.3_Intron|CD8B_uc002srw.2_Missense_Mutation_p.G188V|CD8B_uc002srx.2_Missense_Mutation_p.G188V|CD8B_uc002sry.2_Intron|CD8B_uc010fgt.2_Intron|CD8B_uc002srz.2_Missense_Mutation_p.G188V|CD8B_uc010yto.1_Missense_Mutation_p.G188V	NM_172099	NP_742097	P10966	CD8B_HUMAN	CD8b antigen isoform 1 precursor	188	Helical; (Potential).				immune response|regulation of defense response to virus by virus|regulation of immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway|viral reproduction	early endosome|extracellular region|integral to plasma membrane|T cell receptor complex	coreceptor activity|MHC class I protein binding				0														0.727273	47.203861	48.228484	16	6	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	87073827	87073827	3173	2	C	A	A	A	390	30	CD8B	2	2
SMYD1	150572	broad.mit.edu	37	2	88387418	88387418	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:88387418G>T	uc002ssr.2	+	c.352G>T	c.(352-354)GGC>TGC	p.G118C	SMYD1_uc002ssq.1_Intron	NM_198274	NP_938015	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	118					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3														0.642857	53.55409	54.056851	18	10	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	88387418	88387418	15321	2	G	T	T	T	455	35	SMYD1	2	2
ADAM17	6868	broad.mit.edu	37	2	9666321	9666321	+	Silent	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:9666321C>A	uc002qzu.2	-	c.672G>T	c.(670-672)ACG>ACT	p.T224T	ADAM17_uc010ewy.2_Silent_p.T224T|ADAM17_uc010ewz.2_Intron|ADAM17_uc010exa.2_5'Flank|ADAM17_uc010exb.1_3'UTR	NM_003183	NP_003174	P78536	ADA17_HUMAN	a disintegrin and metalloprotease domain 17	224	Peptidase M12B.|Extracellular (Potential).				B cell differentiation|cell adhesion mediated by integrin|epidermal growth factor receptor signaling pathway|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|germinal center formation|membrane protein intracellular domain proteolysis|negative regulation of interleukin-8 production|nerve growth factor receptor signaling pathway|neutrophil mediated immunity|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of chemokine production|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of protein phosphorylation|positive regulation of T cell chemotaxis|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of mast cell apoptosis|response to drug|response to high density lipoprotein particle stimulus|response to hypoxia|response to lipopolysaccharide|spleen development|T cell differentiation in thymus|wound healing, spreading of epidermal cells	actin cytoskeleton|apical plasma membrane|cell surface|cytoplasm|integral to plasma membrane|membrane raft	integrin binding|interleukin-6 receptor binding|metalloendopeptidase activity|PDZ domain binding|SH3 domain binding|zinc ion binding			kidney(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)						267				0.639216	561.310914	565.643309	163	92	KEEP	---	---	---	---	capture		Silent	SNP	9666321	9666321	239	2	C	A	A	A	236	19	ADAM17	1	1
PVRL3	25945	broad.mit.edu	37	3	110852594	110852594	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:110852594G>A	uc003dxt.1	+	c.1182G>A	c.(1180-1182)TTG>TTA	p.L394L	PVRL3_uc003dxu.1_Intron	NM_015480	NP_056295	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3 precursor	394	Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane	cell adhesion molecule binding|protein homodimerization activity				0														0.235294	17.780146	19.961157	8	26	KEEP	---	---	---	---	capture		Silent	SNP	110852594	110852594	13299	3	G	A	A	A	607	47	PVRL3	2	2
SLC35A5	55032	broad.mit.edu	37	3	112299982	112299982	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:112299982A>G	uc003dze.2	+	c.1018A>G	c.(1018-1020)ACT>GCT	p.T340A		NM_017945	NP_060415	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	340	Helical; (Potential).					Golgi membrane|integral to membrane	nucleotide-sugar transmembrane transporter activity|sugar:hydrogen symporter activity			ovary(1)	1														0.1875	23.315368	29.245473	12	52	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	112299982	112299982	15071	3	A	G	G	G	78	6	SLC35A5	4	4
ROPN1B	152015	broad.mit.edu	37	3	125694456	125694456	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:125694456C>A	uc003eih.2	+	c.167C>A	c.(166-168)TCT>TAT	p.S56Y	ROPN1B_uc010hsb.2_Missense_Mutation_p.S56Y|ROPN1B_uc010hsc.2_De_novo_Start_OutOfFrame|ROPN1B_uc011bkg.1_Missense_Mutation_p.S56Y	NM_001012337	NP_001012337	Q9BZX4	ROP1B_HUMAN	ropporin, rhophilin associated protein 1B	56					acrosome reaction|cell-cell adhesion|cytokinesis|fusion of sperm to egg plasma membrane|Rho protein signal transduction|sperm motility|spermatogenesis	cytoplasm|flagellum	cAMP-dependent protein kinase regulator activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling complex scaffold activity				0				GBM - Glioblastoma multiforme(114;0.151)										0.146497	32.90923	51.779743	23	134	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	125694456	125694456	14003	3	C	A	A	A	416	32	ROPN1B	2	2
PLXNA1	5361	broad.mit.edu	37	3	126751397	126751397	+	Missense_Mutation	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:126751397T>A	uc003ejg.2	+	c.5330T>A	c.(5329-5331)CTG>CAG	p.L1777Q	PLXNA1_uc003ejh.2_Missense_Mutation_p.L445Q	NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	1800	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(114;0.155)										0.415789	247.103676	248.276112	79	111	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	126751397	126751397	12545	3	T	A	A	A	715	55	PLXNA1	3	3
GATA2	2624	broad.mit.edu	37	3	128200779	128200779	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:128200779G>A	uc003ekm.3	-	c.1026C>T	c.(1024-1026)GCC>GCT	p.A342A	GATA2_uc003ekn.3_Intron|GATA2_uc003eko.2_Silent_p.A342A	NM_001145661	NP_001139133	P23769	GATA2_HUMAN	GATA binding protein 2 isoform 1	342					blood coagulation|phagocytosis|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of phagocytosis	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulator activity|zinc ion binding	p.A341_G346del(1)		haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15				GBM - Glioblastoma multiforme(114;0.173)						134				0.155738	34.949507	48.754866	19	103	KEEP	---	---	---	---	capture		Silent	SNP	128200779	128200779	6518	3	G	A	A	A	600	47	GATA2	2	2
NMNAT3	349565	broad.mit.edu	37	3	139280150	139280150	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:139280150T>C	uc003etj.2	-	c.461A>G	c.(460-462)CAG>CGG	p.Q154R	NMNAT3_uc003etk.2_Missense_Mutation_p.Q117R|NMNAT3_uc003etl.2_Non-coding_Transcript|NMNAT3_uc010hul.2_Missense_Mutation_p.Q65R	NM_178177	NP_835471	Q96T66	NMNA3_HUMAN	nicotinamide mononucleotide adenylyltransferase	154					NAD biosynthetic process	cytosol|mitochondrion	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity				0														0.152542	17.936399	24.752544	9	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	139280150	139280150	10903	3	T	C	C	C	715	55	NMNAT3	4	4
ZIC1	7545	broad.mit.edu	37	3	147128524	147128524	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:147128524G>T	uc003ewe.2	+	c.625G>T	c.(625-627)GGC>TGC	p.G209C		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	209					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|regulation of smoothened signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription activator activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2														0.117647	8.928069	23.629032	12	90	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	147128524	147128524	18269	3	G	T	T	T	507	39	ZIC1	1	1
GPR149	344758	broad.mit.edu	37	3	154145355	154145355	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:154145355A>G	uc003faa.2	-	c.1124T>C	c.(1123-1125)ATC>ACC	p.I375T		NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	375	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)											0.625	155.294069	156.286183	45	27	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	154145355	154145355	6929	3	A	G	G	G	156	12	GPR149	4	4
CHRD	8646	broad.mit.edu	37	3	184104849	184104849	+	Silent	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:184104849T>C	uc003fov.2	+	c.2301T>C	c.(2299-2301)GAT>GAC	p.D767D	CHRD_uc003fow.2_Silent_p.D397D|CHRD_uc003fox.2_Silent_p.D767D|CHRD_uc003foy.2_Silent_p.D397D|CHRD_uc010hyc.2_Silent_p.D357D|CHRD_uc011brr.1_Silent_p.D309D	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor	767					BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			ovary(1)	1	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)											0.166667	54.758757	71.810912	27	135	KEEP	---	---	---	---	capture		Silent	SNP	184104849	184104849	3506	3	T	C	C	C	660	51	CHRD	4	4
WDR53	348793	broad.mit.edu	37	3	196281560	196281560	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:196281560G>T	uc003fwt.2	-	c.599C>A	c.(598-600)GCC>GAC	p.A200D		NM_182627	NP_872433	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53	200	WD 4.									breast(1)	1	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)										0.335878	359.790463	369.150375	132	261	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	196281560	196281560	17878	3	G	T	T	T	546	42	WDR53	2	2
SENP5	205564	broad.mit.edu	37	3	196612172	196612172	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:196612172G>T	uc003fwz.3	+	c.120G>T	c.(118-120)CTG>CTT	p.L40L	SENP5_uc011bty.1_Silent_p.L40L	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	40					cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			lung(1)	1	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		Ovarian(47;891 1095 11174 13858 51271)								0.266129	79.210256	85.344249	33	91	KEEP	---	---	---	---	capture		Silent	SNP	196612172	196612172	14535	3	G	T	T	T	574	45	SENP5	2	2
FYCO1	79443	broad.mit.edu	37	3	46008032	46008032	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:46008032C>G	uc011bal.1	-	c.2794G>C	c.(2794-2796)GAG>CAG	p.E932Q	FYCO1_uc003cpb.3_Missense_Mutation_p.E932Q	NM_024513	NP_078789	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	932	Potential.				transport	integral to membrane	protein binding|zinc ion binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)										0.161491	52.575458	70.107186	26	135	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	46008032	46008032	6376	3	C	G	G	G	390	30	FYCO1	3	3
CDC25A	993	broad.mit.edu	37	3	48215895	48215895	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:48215895C>G	uc003csh.1	-	c.809G>C	c.(808-810)CGG>CCG	p.R270P	CDC25A_uc003csi.1_Missense_Mutation_p.R230P	NM_001789	NP_001780	P30304	MPIP1_HUMAN	cell division cycle 25A isoform a	270					cell cycle checkpoint|cell division|cell proliferation|cellular response to UV|DNA replication|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitosis|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle	cytosol|nucleoplasm	protein binding|protein tyrosine phosphatase activity			lung(2)|kidney(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(193;0.000685)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)					p.R270P(CMLT1-Tumor)	123				0.326733	103.543768	106.231525	33	68	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	48215895	48215895	3190	3	C	G	G	G	299	23	CDC25A	3	3
CELSR3	1951	broad.mit.edu	37	3	48699962	48699962	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:48699962C>T	uc003cuf.1	-	c.316G>A	c.(316-318)GGC>AGC	p.G106S	CELSR3_uc003cul.2_Missense_Mutation_p.G36S	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	36	Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)										0.155172	13.948158	20.530319	9	49	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	48699962	48699962	3356	3	C	T	T	T	286	22	CELSR3	2	2
LAMB2	3913	broad.mit.edu	37	3	49160160	49160160	+	Missense_Mutation	SNP	T	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:49160160T>G	uc003cwe.2	-	c.4550A>C	c.(4549-4551)CAG>CCG	p.Q1517P	USP19_uc003cvz.3_5'Flank|USP19_uc011bcg.1_5'Flank|USP19_uc003cwb.2_5'Flank|USP19_uc003cwd.1_5'Flank|USP19_uc011bch.1_5'Flank|USP19_uc011bci.1_5'Flank	NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1517	Potential.|Domain I.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)										0.222222	165.206226	185.006003	62	217	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	49160160	49160160	8934	3	T	G	G	G	715	55	LAMB2	4	4
LAMB2	3913	broad.mit.edu	37	3	49161963	49161963	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:49161963C>A	uc003cwe.2	-	c.3192G>T	c.(3190-3192)CAG>CAT	p.Q1064H	LAMB2_uc003cwf.1_Missense_Mutation_p.Q1064H	NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1064	Laminin EGF-like 11.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)										0.268293	51.799296	55.786373	22	60	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	49161963	49161963	8934	3	C	A	A	A	259	20	LAMB2	2	2
C3orf63	23272	broad.mit.edu	37	3	56680580	56680580	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:56680580T>C	uc003did.3	-	c.2185A>G	c.(2185-2187)AAT>GAT	p.N729D	C3orf63_uc003dic.3_Missense_Mutation_p.N333D|C3orf63_uc003die.3_Missense_Mutation_p.N729D	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b	729										ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)										0.369863	186.917495	189.088329	54	92	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	56680580	56680580	2332	3	T	C	C	C	793	61	C3orf63	4	4
CADM2	253559	broad.mit.edu	37	3	86114787	86114787	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:86114787G>C	uc003dql.2	+	c.1102G>C	c.(1102-1104)GAC>CAC	p.D368H	CADM2_uc003dqj.2_Missense_Mutation_p.D366H|CADM2_uc003dqk.2_Missense_Mutation_p.D335H	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D	366	Extracellular (Potential).				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)	3		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)										0.243243	27.257123	29.479854	9	28	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	86114787	86114787	2683	3	G	C	C	C	585	45	CADM2	3	3
GPR15	2838	broad.mit.edu	37	3	98251438	98251438	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:98251438G>T	uc011bgy.1	+	c.561G>T	c.(559-561)AAG>AAT	p.K187N		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	187	Extracellular (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)										0.237705	66.707296	74.381221	29	93	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	98251438	98251438	6930	3	G	T	T	T	451	35	GPR15	2	2
DKK2	27123	broad.mit.edu	37	4	107956632	107956632	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:107956632C>A	uc003hyi.2	-	c.117G>T	c.(115-117)AAG>AAT	p.K39N	DKK2_uc010ilw.1_Intron|DKK2_uc003hyj.1_Missense_Mutation_p.K39N	NM_014421	NP_055236	Q9UBU2	DKK2_HUMAN	dickkopf homolog 2 precursor	39					multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space				ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)										0.295699	144.074696	151.007641	55	131	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	107956632	107956632	4725	4	C	A	A	A	259	20	DKK2	2	2
SEC24D	9871	broad.mit.edu	37	4	119666152	119666152	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:119666152C>A	uc003icj.3	-	c.1774G>T	c.(1774-1776)GGG>TGG	p.G592W	SEC24D_uc003ich.3_Non-coding_Transcript|SEC24D_uc003ici.3_Missense_Mutation_p.G591W|SEC24D_uc003icl.2_Non-coding_Transcript	NM_014822	NP_055637	O94855	SC24D_HUMAN	Sec24-related protein D	591					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0														0.170543	41.861539	55.11255	22	107	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	119666152	119666152	14483	4	C	A	A	A	312	24	SEC24D	2	2
SMARCA5	8467	broad.mit.edu	37	4	144469215	144469215	+	Silent	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:144469215T>C	uc003ijg.2	+	c.2907T>C	c.(2905-2907)GTT>GTC	p.V969V		NM_003601	NP_003592	O60264	SMCA5_HUMAN	SWI/SNF-related matrix-associated	969	SANT 2.				CenH3-containing nucleosome assembly at centromere|nucleosome positioning|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	condensed chromosome|nucleolus|nucleoplasm|NURF complex|RSF complex	ATP binding|ATPase activity|DNA binding|helicase activity|nucleosome binding|protein binding|RNA polymerase II transcription factor activity			skin(1)	1	all_hematologic(180;0.158)													0.157895	8.112644	10.232577	3	16	KEEP	---	---	---	---	capture		Silent	SNP	144469215	144469215	15269	4	T	C	C	C	821	64	SMARCA5	4	4
C4orf51	646603	broad.mit.edu	37	4	146617753	146617753	+	Nonsense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:146617753G>A	uc003ikk.2	+	c.276G>A	c.(274-276)TGG>TGA	p.W92*		NM_001080531	NP_001074000	C9J302	CD051_HUMAN	chromosome 4 open reading frame 51	92											0														0.373134	152.935022	154.821712	50	84	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	146617753	146617753	2374	4	G	A	A	A	559	43	C4orf51	5	2
RXFP1	59350	broad.mit.edu	37	4	159567946	159567946	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:159567946C>A	uc011cje.1	+	c.1430C>A	c.(1429-1431)GCC>GAC	p.A477D	RXFP1_uc003ipz.2_Missense_Mutation_p.A450D|RXFP1_uc011cja.1_Missense_Mutation_p.A345D|RXFP1_uc010iqo.2_Missense_Mutation_p.A402D|RXFP1_uc011cjb.1_Missense_Mutation_p.A348D|RXFP1_uc010iqk.2_Missense_Mutation_p.A318D|RXFP1_uc011cjc.1_Missense_Mutation_p.A369D|RXFP1_uc011cjd.1_Missense_Mutation_p.A369D|RXFP1_uc010iql.2_Missense_Mutation_p.A294D|RXFP1_uc010iqm.2_Missense_Mutation_p.A417D|RXFP1_uc011cjf.1_Missense_Mutation_p.A319D|RXFP1_uc010iqn.2_Missense_Mutation_p.A395D	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	450	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)										0.185185	50.150413	62.656061	25	110	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	159567946	159567946	14239	4	C	A	A	A	338	26	RXFP1	2	2
PALLD	23022	broad.mit.edu	37	4	169433085	169433085	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:169433085G>C	uc011cjx.1	+	c.430G>C	c.(430-432)GGT>CGT	p.G144R	PALLD_uc003iru.2_Missense_Mutation_p.G144R	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2	144					cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		Esophageal Squamous(109;1482 1532 18347 40239 51172)								0.4	170.46837	171.634257	54	81	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	169433085	169433085	11823	4	G	C	C	C	611	47	PALLD	3	3
PALLD	23022	broad.mit.edu	37	4	169589482	169589482	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:169589482C>G	uc011cjx.1	+	c.1050C>G	c.(1048-1050)AGC>AGG	p.S350R	PALLD_uc003iru.2_Missense_Mutation_p.S350R|PALLD_uc003irv.2_5'UTR	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2	350	Ig-like C2-type 1.				cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		Esophageal Squamous(109;1482 1532 18347 40239 51172)								0.12931	27.745052	43.266312	15	101	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	169589482	169589482	11823	4	C	G	G	G	350	27	PALLD	3	3
TACC3	10460	broad.mit.edu	37	4	1737014	1737014	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:1737014G>A	uc003gdo.2	+	c.1606G>A	c.(1606-1608)GCG>ACG	p.A536T	TACC3_uc010ibz.2_Missense_Mutation_p.A536T|TACC3_uc003gdp.2_Missense_Mutation_p.A176T|TACC3_uc010ica.2_5'UTR	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing	536						centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			Ovarian(120;482 2294 11894 35824)				480				0.130612	37.246842	69.763137	32	213	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	1737014	1737014	16024	4	G	A	A	A	494	38	TACC3	1	1
VEGFC	7424	broad.mit.edu	37	4	177609075	177609075	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:177609075C>A	uc003ius.1	-	c.711G>T	c.(709-711)CAG>CAT	p.Q237H		NM_005429	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	237					angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(2)	2		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)						148				0.329114	67.118778	69.166168	26	53	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	177609075	177609075	17719	4	C	A	A	A	311	24	VEGFC	2	2
ODZ3	55714	broad.mit.edu	37	4	183594202	183594202	+	Nonsense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:183594202G>T	uc003ivd.1	+	c.1156G>T	c.(1156-1158)GGA>TGA	p.G386*		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	386	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)										0.4	18.847236	18.978356	6	9	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	183594202	183594202	11241	4	G	T	T	T	507	39	ODZ3	5	1
ACSL1	2180	broad.mit.edu	37	4	185705088	185705088	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:185705088T>C	uc003iww.2	-	c.368A>G	c.(367-369)TAT>TGT	p.Y123C	ACSL1_uc011ckm.1_De_novo_Start_OutOfFrame|ACSL1_uc003iwt.1_Missense_Mutation_p.Y123C|ACSL1_uc003iwu.1_Missense_Mutation_p.Y123C|ACSL1_uc011ckn.1_Missense_Mutation_p.Y123C|ACSL1_uc003iwv.1_Missense_Mutation_p.Y123C	NM_001995	NP_001986	P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	123	Cytoplasmic (Potential).				digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			ovary(2)	2		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)									0.398256	491.642008	494.745827	137	207	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	185705088	185705088	178	4	T	C	C	C	637	49	ACSL1	4	4
ZCCHC4	29063	broad.mit.edu	37	4	25334902	25334902	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:25334902C>A	uc003grl.3	+	c.427C>A	c.(427-429)CAT>AAT	p.H143N	ZCCHC4_uc003grm.1_Non-coding_Transcript|ZCCHC4_uc003grn.3_5'UTR	NM_024936	NP_079212	Q9H5U6	ZCHC4_HUMAN	zinc finger, CCHC domain containing 4	143							methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(2)	2		Breast(46;0.0503)												0.362069	59.756735	60.728847	21	37	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	25334902	25334902	18178	4	C	A	A	A	325	25	ZCCHC4	2	2
MFSD10	10227	broad.mit.edu	37	4	2934882	2934882	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:2934882C>A	uc003gfw.2	-	c.323G>T	c.(322-324)GGG>GTG	p.G108V	MFSD10_uc003gfv.2_5'Flank|MFSD10_uc003gfx.2_5'UTR|MFSD10_uc003gfz.2_Missense_Mutation_p.G108V|MFSD10_uc003gfy.2_Non-coding_Transcript|MFSD10_uc003gga.2_Missense_Mutation_p.G108V|MFSD10_uc003ggb.1_Missense_Mutation_p.G108V|MFSD10_uc003ggc.2_Missense_Mutation_p.G108V|C4orf10_uc003ggd.1_5'Flank|C4orf10_uc003gge.1_5'Flank|C4orf10_uc003ggg.1_5'Flank|C4orf10_uc003ggh.2_5'Flank	NM_001120	NP_001111	Q14728	MFS10_HUMAN	major facilitator superfamily domain containing	108					apoptosis	integral to membrane	tetracycline transporter activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)										0.210526	41.643003	49.01253	20	75	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	2934882	2934882	9918	4	C	A	A	A	286	22	MFSD10	2	2
N4BP2	55728	broad.mit.edu	37	4	40127837	40127837	+	Missense_Mutation	SNP	T	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:40127837T>G	uc003guy.3	+	c.4414T>G	c.(4414-4416)TTA>GTA	p.L1472V	N4BP2_uc010ifq.2_Missense_Mutation_p.L1392V|N4BP2_uc010ifr.2_Missense_Mutation_p.L1392V	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2	1472						cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8										693				0.142857	49.454063	70.977369	25	150	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	40127837	40127837	10505	4	T	G	G	G	829	64	N4BP2	4	4
PIGG	54872	broad.mit.edu	37	4	527726	527726	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:527726G>T	uc003gak.3	+	c.2691G>T	c.(2689-2691)CTG>CTT	p.L897L	PIGG_uc003gaj.3_Silent_p.L889L|PIGG_uc011bux.1_Non-coding_Transcript|PIGG_uc010ibf.2_Silent_p.L764L|PIGG_uc003gal.3_Silent_p.L808L	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	897	Helical; (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity			ovary(1)|central_nervous_system(1)	2														0.372727	117.542625	119.10925	41	69	KEEP	---	---	---	---	capture		Silent	SNP	527726	527726	12312	4	G	T	T	T	613	48	PIGG	2	2
JAKMIP1	152789	broad.mit.edu	37	4	6042384	6042384	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:6042384G>A	uc010idb.1	-	c.2157C>T	c.(2155-2157)GCC>GCT	p.A719A	JAKMIP1_uc010idc.1_Silent_p.A534A|JAKMIP1_uc010idd.1_Intron	NM_001099433	NP_001092903	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	490	Mediates interaction with TYK2 and GABBR1.|Potential.				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|ovary(1)|pancreas(1)	3														0.324324	30.167118	31.19169	12	25	KEEP	---	---	---	---	capture		Silent	SNP	6042384	6042384	8244	4	G	A	A	A	548	43	JAKMIP1	2	2
UBA6	55236	broad.mit.edu	37	4	68527971	68527971	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:68527971C>A	uc003hdg.3	-	c.1040G>T	c.(1039-1041)TGC>TTC	p.C347F	UBA6_uc003hdi.2_Missense_Mutation_p.C347F	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2	347					protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0														0.16	21.158222	29.409974	12	63	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	68527971	68527971	17389	4	C	A	A	A	325	25	UBA6	2	2
AFM	173	broad.mit.edu	37	4	74349697	74349697	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:74349697T>C	uc003hhb.2	+	c.128T>C	c.(127-129)ATT>ACT	p.I43T		NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor	43	Albumin 1.				transport					ovary(2)	2	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)											0.588235	38.753594	38.869234	10	7	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	74349697	74349697	362	4	T	C	C	C	676	52	AFM	4	4
SNCA	6622	broad.mit.edu	37	4	90743427	90743427	+	Silent	SNP	A	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:90743427A>T	uc003hsq.2	-	c.276T>A	c.(274-276)ACT>ACA	p.T92T	SNCA_uc010ikt.2_Silent_p.T78T|SNCA_uc003hso.2_Silent_p.T92T|SNCA_uc003hsp.2_Silent_p.T92T|SNCA_uc003hsr.2_Silent_p.T92T	NM_001146054	NP_001139526	P37840	SYUA_HUMAN	alpha-synuclein isoform NACP140	92				Missing: Reduces polymerization into amyloid fibrils.	activation of caspase activity|anti-apoptosis|negative regulation of caspase activity|negative regulation of dopamine uptake|negative regulation of exocytosis|negative regulation of histone acetylation|negative regulation of microtubule polymerization|negative regulation of monooxygenase activity|negative regulation of norepinephrine uptake|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of serotonin uptake|negative regulation of thrombin receptor signaling pathway|negative regulation of transporter activity|positive regulation of endocytosis|positive regulation of inositol phosphate biosynthetic process|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein serine/threonine kinase activity|positive regulation of receptor recycling|positive regulation of release of sequestered calcium ion into cytosol|receptor internalization|regulation of phospholipase activity|response to interferon-gamma|response to interleukin-1|response to iron(II) ion|response to lipopolysaccharide|response to magnesium ion|synaptic vesicle endocytosis	actin cytoskeleton|axon|cell cortex|cell junction|cytosol|fibril|growth cone|nucleus|synapse	alpha-tubulin binding|calcium ion binding|caspase inhibitor activity|dynein binding|ferrous iron binding|histone binding|Hsp70 protein binding|kinesin binding|magnesium ion binding|phosphoprotein binding|tau protein binding|zinc ion binding				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.42e-05)	Melatonin(DB01065)									0.213333	37.258337	42.953004	16	59	KEEP	---	---	---	---	capture		Silent	SNP	90743427	90743427	15340	4	A	T	T	T	80	7	SNCA	3	3
PPIP5K2	23262	broad.mit.edu	37	5	102537262	102537262	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:102537262C>T	uc003kod.3	+	c.3659C>T	c.(3658-3660)TCA>TTA	p.S1220L	PPIP5K2_uc011cva.1_Non-coding_Transcript|PPIP5K2_uc003koe.2_Missense_Mutation_p.S1199L|PPIP5K2_uc003kof.2_Missense_Mutation_p.S402L	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1	1220					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)	1														0.294118	12.166732	12.812613	5	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	102537262	102537262	12768	5	C	T	T	T	377	29	PPIP5K2	2	2
YTHDC2	64848	broad.mit.edu	37	5	112878169	112878169	+	Silent	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:112878169C>G	uc003kqn.2	+	c.1464C>G	c.(1462-1464)GTC>GTG	p.V488V	YTHDC2_uc010jce.1_Silent_p.V488V|YTHDC2_uc010jcf.1_Silent_p.V188V	NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	488							ATP binding|ATP-dependent helicase activity|nucleic acid binding			central_nervous_system(1)	1		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)										0.166667	39.336613	49.450345	16	80	KEEP	---	---	---	---	capture		Silent	SNP	112878169	112878169	18080	5	C	G	G	G	405	32	YTHDC2	3	3
P4HA2	8974	broad.mit.edu	37	5	131545977	131545977	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:131545977C>A	uc003kwh.2	-	c.709G>T	c.(709-711)GAC>TAC	p.D237Y	P4HA2_uc003kwg.2_Missense_Mutation_p.D237Y|P4HA2_uc003kwi.2_Missense_Mutation_p.D237Y|P4HA2_uc003kwk.2_Missense_Mutation_p.D237Y|P4HA2_uc003kwl.2_Missense_Mutation_p.D237Y|P4HA2_uc003kwj.2_Missense_Mutation_p.D237Y	NM_004199	NP_004190	O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha II subunit isoform 1	237	TPR.				oxidation-reduction process	endoplasmic reticulum lumen	electron carrier activity|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity|protein binding				0		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	Esophageal Squamous(68;117 1135 17362 19256 34242)								0.392713	273.71313	276.203433	97	150	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	131545977	131545977	11770	5	C	A	A	A	273	21	P4HA2	2	2
TXNDC15	79770	broad.mit.edu	37	5	134223691	134223691	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:134223691G>A	uc003lac.1	+	c.410G>A	c.(409-411)GGA>GAA	p.G137E	TXNDC15_uc010jdy.1_Intron|TXNDC15_uc011cxv.1_Non-coding_Transcript	NM_024715	NP_078991	Q96J42	TXD15_HUMAN	disulfide isomerase precursor	137	Extracellular (Potential).				cell redox homeostasis	integral to membrane				ovary(1)|breast(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)											0.244681	53.779541	59.361993	23	71	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	134223691	134223691	17350	5	G	A	A	A	533	41	TXNDC15	2	2
PCDHA2	56146	broad.mit.edu	37	5	140175812	140175812	+	Silent	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140175812T>C	uc003lhd.2	+	c.1263T>C	c.(1261-1263)TAT>TAC	p.Y421Y	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Silent_p.Y421Y|PCDHA2_uc011czy.1_Silent_p.Y421Y	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	421	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.174074	99.09272	126.135393	47	223	KEEP	---	---	---	---	capture		Silent	SNP	140175812	140175812	11944	5	T	C	C	C	660	51	PCDHA2	4	4
PCDHB9	56127	broad.mit.edu	37	5	140567311	140567311	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140567311T>C	uc003liw.1	+	c.419T>C	c.(418-420)TTA>TCA	p.L140S		NM_019119	NP_061992	Q9Y5E1	PCDB9_HUMAN	protocadherin beta 9 precursor	140	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)											0.238318	150.631876	164.005629	51	163	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140567311	140567311	11969	5	T	C	C	C	793	61	PCDHB9	4	4
PCDHGA5	56110	broad.mit.edu	37	5	140744565	140744565	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140744565C>A	uc003lju.1	+	c.668C>A	c.(667-669)TCC>TAC	p.S223Y	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Missense_Mutation_p.S223Y	NM_018918	NP_061741	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5 isoform 1	223	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.192308	32.597125	41.870528	20	84	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140744565	140744565	11977	5	C	A	A	A	390	30	PCDHGA5	2	2
PCDHGC4	56098	broad.mit.edu	37	5	140865302	140865302	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140865302G>A	uc003lky.1	+	c.562G>A	c.(562-564)GGC>AGC	p.G188S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc011dbb.1_Missense_Mutation_p.G188S	NM_018928	NP_061751	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4 isoform 1	188	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.234043	51.998991	58.086703	22	72	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140865302	140865302	11990	5	G	A	A	A	507	39	PCDHGC4	1	1
ARHGAP26	23092	broad.mit.edu	37	5	142437235	142437235	+	Silent	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:142437235T>A	uc011dbj.1	+	c.1461T>A	c.(1459-1461)TCT>TCA	p.S487S	ARHGAP26_uc003lmt.2_Silent_p.S487S|ARHGAP26_uc003lmw.2_Silent_p.S487S	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal	487	Rho-GAP.				actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)							831				0.367347	108.875525	110.391094	36	62	KEEP	---	---	---	---	capture		Silent	SNP	142437235	142437235	887	5	T	A	A	A	704	55	ARHGAP26	3	3
SH3TC2	79628	broad.mit.edu	37	5	148406292	148406292	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:148406292G>A	uc003lpu.2	-	c.2896C>T	c.(2896-2898)CTC>TTC	p.L966F	SH3TC2_uc003lpp.1_Non-coding_Transcript|SH3TC2_uc010jgw.2_Missense_Mutation_p.L610F|SH3TC2_uc003lps.2_Non-coding_Transcript|SH3TC2_uc003lpt.2_Missense_Mutation_p.L513F|SH3TC2_uc010jgx.2_Missense_Mutation_p.L959F|SH3TC2_uc003lpv.1_Silent_p.P548P|SH3TC2_uc011dbz.1_Silent_p.P886P	NM_024577	NP_078853	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	966							binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.408854	492.427363	495.207089	157	227	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	148406292	148406292	14754	5	G	A	A	A	455	35	SH3TC2	2	2
PPARGC1B	133522	broad.mit.edu	37	5	149216513	149216513	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:149216513C>G	uc003lrc.2	+	c.2495C>G	c.(2494-2496)TCT>TGT	p.S832C	PPARGC1B_uc003lrb.1_Missense_Mutation_p.S832C|PPARGC1B_uc003lrd.2_Missense_Mutation_p.S793C|PPARGC1B_uc003lrf.2_Missense_Mutation_p.S811C|PPARGC1B_uc003lre.1_Missense_Mutation_p.S811C	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor	832					estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription mediator activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)											0.35814	261.821548	265.628996	77	138	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	149216513	149216513	12731	5	C	G	G	G	416	32	PPARGC1B	3	3
CSF1R	1436	broad.mit.edu	37	5	149449494	149449494	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:149449494C>T	uc003lrl.2	-	c.1452G>A	c.(1450-1452)GAG>GAA	p.E484E	CSF1R_uc011dcd.1_Silent_p.E336E|CSF1R_uc010jhc.2_Non-coding_Transcript|CSF1R_uc003lrm.2_Silent_p.E484E	NM_005211	NP_005202	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor precursor	484	Ig-like C2-type 5.|Extracellular (Potential).				cell proliferation|multicellular organismal development|protein phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity			haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)					592				0.315315	94.280908	97.651172	35	76	KEEP	---	---	---	---	capture		Silent	SNP	149449494	149449494	4073	5	C	T	T	T	259	20	CSF1R	2	2
LARP1	23367	broad.mit.edu	37	5	154191175	154191175	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:154191175G>A	uc003lvp.2	+	c.3056G>A	c.(3055-3057)CGA>CAA	p.R1019Q	LARP1_uc003lvo.2_Missense_Mutation_p.R942Q	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2	1019							protein binding|RNA binding			ovary(2)|pancreas(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)											0.195122	86.174478	103.950115	40	165	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	154191175	154191175	8951	5	G	A	A	A	481	37	LARP1	1	1
SGCD	6444	broad.mit.edu	37	5	156186311	156186311	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:156186311C>G	uc003lwc.3	+	c.783C>G	c.(781-783)TTC>TTG	p.F261L	SGCD_uc003lwd.3_Missense_Mutation_p.F260L	NM_000337	NP_000328	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 1	260	Extracellular (Potential).				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)											0.342105	134.89393	137.403531	39	75	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	156186311	156186311	14692	5	C	G	G	G	402	31	SGCD	3	3
FAM153B	202134	broad.mit.edu	37	5	175530279	175530280	+	Nonsense_Mutation	DNP	GG	AT	AT			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:175530279_175530280GG>AT	uc003mdk.2	+	c.714_715GG>AT	c.(712-717)GAGGAG>GAATAG	p.E239*		NM_001079529	NP_001072997	P0C7A2	F153B_HUMAN	hypothetical protein LOC202134	239										ovary(1)	1	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)										0.085511	6.830982	80.12174	36	385	KEEP	---	---	---	---	capture		Nonsense_Mutation	DNP	175530279	175530280	5659	5	GG	AT	AT	AT	451	35	FAM153B	5	2
ADAMTS12	81792	broad.mit.edu	37	5	33546268	33546268	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:33546268C>A	uc003jia.1	-	c.4342G>T	c.(4342-4344)GTG>TTG	p.V1448L	ADAMTS12_uc010iuq.1_Missense_Mutation_p.V1363L	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1448	TSP type-1 7.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|lung(1)|kidney(1)|skin(1)	7														0.488889	65.949387	65.954143	22	23	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	33546268	33546268	258	5	C	A	A	A	260	20	ADAMTS12	2	2
IL7R	3575	broad.mit.edu	37	5	35876564	35876564	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:35876564G>T	uc003jjs.2	+	c.1356G>T	c.(1354-1356)ATG>ATT	p.M452I	IL7R_uc011cop.1_Non-coding_Transcript	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor	452	Cytoplasmic (Potential).				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)	4	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)											0.44	69.242786	69.399779	22	28	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	35876564	35876564	8006	5	G	T	T	T	624	48	IL7R	2	2
CDC20B	166979	broad.mit.edu	37	5	54429307	54429307	+	Silent	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:54429307A>G	uc003jpo.1	-	c.630T>C	c.(628-630)GGT>GGC	p.G210G	CDC20B_uc003jpn.1_Silent_p.G210G|CDC20B_uc010ivu.1_Silent_p.G210G|CDC20B_uc010ivv.1_Silent_p.G210G	NM_152623	NP_689836	Q86Y33	CD20B_HUMAN	CDC20 cell division cycle 20 homolog B isoform	210											0		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)											0.338235	135.810532	138.956438	46	90	KEEP	---	---	---	---	capture		Silent	SNP	54429307	54429307	3188	5	A	G	G	G	67	6	CDC20B	4	4
KIAA0947	23379	broad.mit.edu	37	5	5463461	5463461	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:5463461G>A	uc003jdm.3	+	c.4014G>A	c.(4012-4014)CAG>CAA	p.Q1338Q		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1338										ovary(1)|central_nervous_system(1)	2														0.302326	35.557176	37.058059	13	30	KEEP	---	---	---	---	capture		Silent	SNP	5463461	5463461	8509	5	G	A	A	A	425	33	KIAA0947	2	2
MAP3K1	4214	broad.mit.edu	37	5	56177585	56177585	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:56177585G>T	uc003jqw.3	+	c.2558G>T	c.(2557-2559)CGT>CTT	p.R853L		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	853					cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)						201				0.155556	27.596853	37.79151	14	76	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	56177585	56177585	9626	5	G	T	T	T	520	40	MAP3K1	1	1
BDP1	55814	broad.mit.edu	37	5	70759928	70759928	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:70759928C>G	uc003kbp.1	+	c.643C>G	c.(643-645)CCA>GCA	p.P215A	BDP1_uc003kbn.1_Missense_Mutation_p.P215A|BDP1_uc003kbo.2_Missense_Mutation_p.P215A	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	215	Interaction with ZBTB43.				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding				0		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)										0.266667	26.486282	27.961526	8	22	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	70759928	70759928	1417	5	C	G	G	G	390	30	BDP1	3	3
MCCC2	64087	broad.mit.edu	37	5	70931014	70931014	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:70931014G>T	uc003kbs.3	+	c.940G>T	c.(940-942)GCT>TCT	p.A314S	MCCC2_uc010iyv.1_Missense_Mutation_p.A314S|MCCC2_uc003kbt.3_Non-coding_Transcript|MCCC2_uc003kbu.1_Missense_Mutation_p.A183S	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)	314	Carboxyltransferase.				leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)									0.157143	20.283685	28.130844	11	59	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	70931014	70931014	9764	5	G	T	T	T	598	46	MCCC2	2	2
C5orf36	285600	broad.mit.edu	37	5	93856111	93856111	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:93856111A>G	uc011cuk.1	-	c.812T>C	c.(811-813)ATG>ACG	p.M271T	C5orf36_uc003kkp.2_Missense_Mutation_p.M271T	NM_001145678	NP_001139150	Q8IV33	K0825_HUMAN	hypothetical protein LOC285600 isoform 1	271											0		all_cancers(142;2.12e-08)|all_epithelial(76;5.95e-11)|all_lung(232;0.000996)|Lung NSC(167;0.0108)|Ovarian(174;0.0218)|Colorectal(57;0.0329)|Breast(839;0.214)|Lung SC(612;0.236)		all cancers(79;3.96e-19)										0.571429	29.002745	29.065181	8	6	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	93856111	93856111	2393	5	A	G	G	G	104	8	C5orf36	4	4
ZDHHC14	79683	broad.mit.edu	37	6	158014043	158014043	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:158014043G>T	uc003qqt.2	+	c.430G>T	c.(430-432)GGG>TGG	p.G144W	ZDHHC14_uc003qqs.2_Missense_Mutation_p.G144W|ZDHHC14_uc010kjm.1_Missense_Mutation_p.G39W	NM_024630	NP_078906	Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14 isoform 1	144						integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)										0.323529	113.837458	117.605332	44	92	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	158014043	158014043	18192	6	G	T	T	T	455	35	ZDHHC14	2	2
MBOAT1	154141	broad.mit.edu	37	6	20113163	20113163	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:20113163G>A	uc003ncx.1	-	c.1153C>T	c.(1153-1155)CCT>TCT	p.P385S	MBOAT1_uc011dji.1_Missense_Mutation_p.P236S	NM_001080480	NP_001073949	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain	385	Helical; (Potential).				phospholipid biosynthetic process	integral to membrane	acyltransferase activity				0	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)											0.122807	9.783531	17.721784	7	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20113163	20113163	9744	6	G	A	A	A	559	43	MBOAT1	2	2
HIST1H2AG	8969	broad.mit.edu	37	6	27100922	27100922	+	Silent	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:27100922C>G	uc003niw.2	+	c.72C>G	c.(70-72)CTC>CTG	p.L24L	HIST1H2BJ_uc003niu.1_5'Flank|HIST1H2BJ_uc003niv.2_5'Flank	NM_021064	NP_066408	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	24					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding				0														0.339806	112.257717	114.611586	35	68	KEEP	---	---	---	---	capture		Silent	SNP	27100922	27100922	7418	6	C	G	G	G	379	30	HIST1H2AG	3	3
TRIM31	11074	broad.mit.edu	37	6	30072985	30072985	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:30072985G>C	uc003npg.1	-	c.918C>G	c.(916-918)AAC>AAG	p.N306K	TRIM31_uc003npi.3_Non-coding_Transcript	NM_007028	NP_008959	Q9BZY9	TRI31_HUMAN	tripartite motif protein 31	306	Potential.					mitochondrion	ligase activity|zinc ion binding			lung(1)	1														0.1875	102.382274	119.938979	36	156	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	30072985	30072985	17049	6	G	C	C	C	620	48	TRIM31	3	3
DDR1	780	broad.mit.edu	37	6	30860208	30860208	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:30860208A>G	uc003nrv.2	+	c.988A>G	c.(988-990)AGA>GGA	p.R330G	DDR1_uc010jse.2_Missense_Mutation_p.R330G|DDR1_uc003nrq.2_Missense_Mutation_p.R330G|DDR1_uc003nrs.2_Missense_Mutation_p.R330G|DDR1_uc003nrt.2_Missense_Mutation_p.R330G|DDR1_uc003nrr.2_Missense_Mutation_p.R330G|DDR1_uc011dms.1_Missense_Mutation_p.R348G|DDR1_uc003nru.2_Missense_Mutation_p.R330G|DDR1_uc003nrw.1_Missense_Mutation_p.R129G|DDR1_uc003nry.1_5'Flank|DDR1_uc003nrx.1_5'Flank	NM_013994	NP_054700	Q08345	DDR1_HUMAN	discoidin domain receptor family, member 1	330	Extracellular (Potential).				cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane	ATP binding|protein binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|central_nervous_system(3)|large_intestine(1)|ovary(1)	9					Imatinib(DB00619)					411				0.318966	102.839888	106.216352	37	79	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	30860208	30860208	4507	6	A	G	G	G	88	7	DDR1	4	4
TNXB	7148	broad.mit.edu	37	6	32018012	32018012	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:32018012C>A	uc003nzl.2	-	c.9196G>T	c.(9196-9198)GTG>TTG	p.V3066L		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	3113	Fibronectin type-III 23.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0														0.165	64.682077	85.960097	33	167	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32018012	32018012	16887	6	C	A	A	A	247	19	TNXB	1	1
NOTCH4	4855	broad.mit.edu	37	6	32178643	32178643	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:32178643G>T	uc003obb.2	-	c.2751C>A	c.(2749-2751)CAC>CAA	p.H917Q	NOTCH4_uc011dpu.1_Non-coding_Transcript|NOTCH4_uc011dpv.1_Non-coding_Transcript	NM_004557	NP_004548	Q99466	NOTC4_HUMAN	notch4 preproprotein	917	EGF-like 23.|Extracellular (Potential).				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			ovary(5)|lung(5)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	14										693				0.126437	15.162176	27.012921	11	76	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32178643	32178643	10954	6	G	T	T	T	464	36	NOTCH4	2	2
NOTCH4	4855	broad.mit.edu	37	6	32188208	32188208	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:32188208G>C	uc003obb.2	-	c.1133C>G	c.(1132-1134)TCC>TGC	p.S378C	NOTCH4_uc011dpu.1_Non-coding_Transcript|NOTCH4_uc011dpv.1_Non-coding_Transcript|NOTCH4_uc003obc.2_Missense_Mutation_p.S378C	NM_004557	NP_004548	Q99466	NOTC4_HUMAN	notch4 preproprotein	378	EGF-like 9; calcium-binding (Potential).|Extracellular (Potential).				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			ovary(5)|lung(5)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	14										693				0.23219	240.890011	265.911993	88	291	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32188208	32188208	10954	6	G	C	C	C	533	41	NOTCH4	3	3
LHFPL5	222662	broad.mit.edu	37	6	35773816	35773816	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:35773816G>T	uc003olg.1	+	c.369G>T	c.(367-369)ACG>ACT	p.T123T		NM_182548	NP_872354	Q8TAF8	TMHS_HUMAN	lipoma HMGIC fusion partner-like 5	123						integral to membrane					0														0.411392	184.979241	186.052257	65	93	KEEP	---	---	---	---	capture		Silent	SNP	35773816	35773816	9094	6	G	T	T	T	496	39	LHFPL5	1	1
TREML2	79865	broad.mit.edu	37	6	41162312	41162312	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:41162312G>T	uc010jxm.1	-	c.636C>A	c.(634-636)ACC>ACA	p.T212T		NM_024807	NP_079083	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid	212	Extracellular (Potential).				T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)													0.130952	15.971531	27.09179	11	73	KEEP	---	---	---	---	capture		Silent	SNP	41162312	41162312	17017	6	G	T	T	T	496	39	TREML2	1	1
TRERF1	55809	broad.mit.edu	37	6	42211039	42211039	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:42211039G>A	uc003ose.2	-	c.2866C>T	c.(2866-2868)CGG>TGG	p.R956W	TRERF1_uc011duq.1_Missense_Mutation_p.R853W|TRERF1_uc003osb.2_Missense_Mutation_p.R692W|TRERF1_uc003osc.2_Missense_Mutation_p.R692W|TRERF1_uc003osd.2_Missense_Mutation_p.R936W	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	936	SANT.|Interacts with CREBBP.				cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription mediator activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)											0.169811	83.007849	110.357083	45	220	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	42211039	42211039	17019	6	G	A	A	A	493	38	TRERF1	1	1
CAPN11	11131	broad.mit.edu	37	6	44141031	44141031	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:44141031C>A	uc003owt.1	+	c.739C>A	c.(739-741)CAG>AAG	p.Q247K		NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11	247	Calpain catalytic.				proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)									OREG0017466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.436464	229.671705	230.312766	79	102	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	44141031	44141031	2741	6	C	A	A	A	273	21	CAPN11	2	2
ZNF451	26036	broad.mit.edu	37	6	57015521	57015521	+	Missense_Mutation	SNP	A	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:57015521A>T	uc003pdm.1	+	c.2613A>T	c.(2611-2613)GAA>GAT	p.E871D	ZNF451_uc003pdl.2_Missense_Mutation_p.E871D|ZNF451_uc003pdn.1_Intron|ZNF451_uc003pdk.1_Missense_Mutation_p.E871D	NM_001031623	NP_001026794	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451 isoform 1	871					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)											0.398148	122.699627	123.680611	43	65	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	57015521	57015521	18515	6	A	T	T	T	37	3	ZNF451	3	3
MANEA	79694	broad.mit.edu	37	6	96034364	96034364	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:96034364C>A	uc003poo.1	+	c.49C>A	c.(49-51)CTA>ATA	p.L17I	MANEA_uc003pon.2_Missense_Mutation_p.L17I	NM_024641	NP_078917	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	17	Helical; Signal-anchor for type II membrane protein; (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	glycoprotein endo-alpha-1,2-mannosidase activity			ovary(2)|breast(1)	3		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)										0.473684	79.917592	79.952205	27	30	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	96034364	96034364	9604	6	C	A	A	A	415	32	MANEA	2	2
MLL5	55904	broad.mit.edu	37	7	104702637	104702637	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:104702637T>C	uc003vcm.2	+	c.98T>C	c.(97-99)GTG>GCG	p.V33A	MLL5_uc010lja.1_5'UTR|MLL5_uc010ljb.1_Missense_Mutation_p.V33A|MLL5_uc003vcl.2_Missense_Mutation_p.V33A|MLL5_uc010ljc.2_Missense_Mutation_p.V33A	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5	33					cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3														0.396694	164.096193	165.219174	48	73	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	104702637	104702637	10014	7	T	C	C	C	767	59	MLL5	4	4
TMEM168	64418	broad.mit.edu	37	7	112407532	112407532	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:112407532C>A	uc003vgn.2	-	c.1814G>T	c.(1813-1815)TGG>TTG	p.W605L	TMEM168_uc010lju.2_Missense_Mutation_p.W605L|TMEM168_uc011kmr.1_Missense_Mutation_p.W221L	NM_022484	NP_071929	Q9H0V1	TM168_HUMAN	transmembrane protein 168	605						integral to membrane|transport vesicle				ovary(1)|central_nervous_system(1)	2														0.24	28.372241	31.459494	12	38	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	112407532	112407532	16617	7	C	A	A	A	273	21	TMEM168	2	2
PAX4	5078	broad.mit.edu	37	7	127251682	127251682	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:127251682G>A	uc010lld.1	-	c.796C>T	c.(796-798)CTG>TTG	p.L266L	PAX4_uc003vmf.2_Silent_p.L264L|PAX4_uc003vmg.1_Silent_p.L266L	NM_006193	NP_006184	O43316	PAX4_HUMAN	paired box 4	274					cell differentiation|endocrine pancreas development|organ morphogenesis|regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity			ovary(1)	1						Ovarian(113;737 1605 7858 27720 34092)								0.282946	190.237466	201.176605	73	185	KEEP	---	---	---	---	capture		Silent	SNP	127251682	127251682	11901	7	G	A	A	A	464	36	PAX4	2	2
TBXAS1	6916	broad.mit.edu	37	7	139611091	139611091	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:139611091G>A	uc011kqv.1	+	c.307G>A	c.(307-309)GAG>AAG	p.E103K	TBXAS1_uc003vvh.2_Missense_Mutation_p.E103K|TBXAS1_uc010lne.2_Missense_Mutation_p.E35K|TBXAS1_uc011kqu.1_Missense_Mutation_p.E54K|TBXAS1_uc003vvi.2_Missense_Mutation_p.E103K|TBXAS1_uc003vvj.2_Missense_Mutation_p.E103K|TBXAS1_uc011kqw.1_Missense_Mutation_p.E83K|TBXAS1_uc011kqx.1_Missense_Mutation_p.E103K	NM_001130966	NP_001124438	P24557	THAS_HUMAN	thromboxane A synthase 1, platelet isoform	102	Cytoplasmic (Potential).			E -> Q (in Ref. 7; AAA36742).	hormone biosynthetic process|oxidation-reduction process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)													0.141479	63.565032	102.158697	44	267	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	139611091	139611091	16190	7	G	A	A	A	585	45	TBXAS1	2	2
KEL	3792	broad.mit.edu	37	7	142651458	142651458	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:142651458A>G	uc003wcb.2	-	c.737T>C	c.(736-738)ATC>ACC	p.I246T		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	246	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)													0.155556	65.693004	86.07662	28	152	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	142651458	142651458	8448	7	A	G	G	G	156	12	KEL	4	4
OR2A25	392138	broad.mit.edu	37	7	143771552	143771552	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:143771552G>A	uc011ktx.1	+	c.240G>A	c.(238-240)ATG>ATA	p.M80I		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	80	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)													0.294118	80.704603	85.205514	35	84	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	143771552	143771552	11384	7	G	A	A	A	598	46	OR2A25	2	2
OR2A12	346525	broad.mit.edu	37	7	143792957	143792957	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:143792957A>G	uc011kty.1	+	c.757A>G	c.(757-759)AGC>GGC	p.S253G		NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,	253	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)													0.100287	22.22758	78.106773	35	314	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	143792957	143792957	11381	7	A	G	G	G	91	7	OR2A12	4	4
CUL1	8454	broad.mit.edu	37	7	148481087	148481087	+	Missense_Mutation	SNP	A	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:148481087A>C	uc010lpg.2	+	c.1216A>C	c.(1216-1218)AAC>CAC	p.N406H	CUL1_uc003wey.2_Missense_Mutation_p.N406H|CUL1_uc003wez.2_Missense_Mutation_p.N296H|CUL1_uc003wfa.2_Missense_Mutation_p.N67H	NM_003592	NP_003583	Q13616	CUL1_HUMAN	cullin 1	406					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)											0.344828	137.557664	140.027569	40	76	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	148481087	148481087	4214	7	A	C	C	C	65	5	CUL1	4	4
ABP1	26	broad.mit.edu	37	7	150553664	150553664	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:150553664C>A	uc003wia.1	+	c.106C>A	c.(106-108)CTA>ATA	p.L36I	ABP1_uc003why.1_Missense_Mutation_p.L36I|ABP1_uc003whz.1_Missense_Mutation_p.L36I	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	36					amine metabolic process|oxidation-reduction process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)	4	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	Pancreas(195;1227 3054 24912 28503)								0.255435	114.190287	124.144977	47	137	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	150553664	150553664	99	7	C	A	A	A	311	24	ABP1	2	2
RHEB	6009	broad.mit.edu	37	7	151164231	151164231	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:151164231C>A	uc003wkh.1	-	c.529G>T	c.(529-531)GGC>TGC	p.G177C		NM_005614	NP_005605	Q15382	RHEB_HUMAN	Ras homolog enriched in brain precursor	177					cell cycle arrest|insulin receptor signaling pathway|positive regulation of TOR signaling cascade|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|metal ion binding|protein binding			large_intestine(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00306)	UCEC - Uterine corpus endometrioid carcinoma (81;0.174)		Pancreas(98;671 892 8111 15140 36556 39178 39939 44184)				115				0.141176	15.845435	26.41263	12	73	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	151164231	151164231	13803	7	C	A	A	A	312	24	RHEB	2	2
NOM1	64434	broad.mit.edu	37	7	156742967	156742967	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:156742967A>G	uc003wmy.2	+	c.536A>G	c.(535-537)AAC>AGC	p.N179S		NM_138400	NP_612409	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	179	Necessary for nucleolar localization and for targeting PPP1CA to the nucleolus.				RNA metabolic process	nucleolus	protein binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)										0.247191	196.754882	212.25883	66	201	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	156742967	156742967	10933	7	A	G	G	G	26	2	NOM1	4	4
WDR60	55112	broad.mit.edu	37	7	158695181	158695181	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:158695181G>A	uc003woe.3	+	c.1252G>A	c.(1252-1254)GAA>AAA	p.E418K	WDR60_uc010lqv.2_Non-coding_Transcript|WDR60_uc010lqw.2_5'UTR	NM_018051	NP_060521	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	418	Potential.									ovary(2)|breast(1)	3	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)										0.320611	122.800454	126.547153	42	89	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	158695181	158695181	17884	7	G	A	A	A	429	33	WDR60	2	2
HDAC9	9734	broad.mit.edu	37	7	18869084	18869085	+	Missense_Mutation	DNP	GG	TT	TT			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:18869084_18869085GG>TT	uc003sui.2	+	c.2379_2380GG>TT	c.(2377-2382)ATGGGG>ATTTGG	p.793_794MG>IW	HDAC9_uc003sue.2_Missense_Mutation_p.790_791MG>IW|HDAC9_uc011jyd.1_Missense_Mutation_p.790_791MG>IW|HDAC9_uc003suh.2_Missense_Mutation_p.790_791MG>IW|HDAC9_uc003suj.2_Missense_Mutation_p.749_750MG>IW|HDAC9_uc003suk.2_Missense_Mutation_p.38_39MG>IW	NM_178425	NP_848512	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 5	790_791	Histone deacetylase.				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|specific transcriptional repressor activity|transcription corepressor activity|transcription repressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)									0.27907	60.558744	64.337041	24	62	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	18869084	18869085	7297	7	GG	TT	TT	TT	559	43	HDAC9	2	2
ABCB5	340273	broad.mit.edu	37	7	20782645	20782645	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:20782645G>C	uc010kuh.2	+	c.3170G>C	c.(3169-3171)AGC>ACC	p.S1057T	ABCB5_uc003suw.3_Missense_Mutation_p.S612T	NM_001163941	NP_001157413	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	612	ATP (Potential).|Cytoplasmic (Potential).|ABC transporter 2.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			large_intestine(1)|ovary(1)|pancreas(1)	3														0.333333	80.476181	82.247336	24	48	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20782645	20782645	45	7	G	C	C	C	442	34	ABCB5	3	3
CARD11	84433	broad.mit.edu	37	7	2959040	2959040	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:2959040C>A	uc003smv.2	-	c.2476G>T	c.(2476-2478)GAC>TAC	p.D826Y		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	826					positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|central_nervous_system(1)	48		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)						1492				0.333333	93.552738	96.215256	36	72	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	2959040	2959040	2764	7	C	A	A	A	377	29	CARD11	2	2
C7orf10	79783	broad.mit.edu	37	7	40900032	40900032	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:40900032G>T	uc003thn.1	+	c.1271G>T	c.(1270-1272)GGG>GTG	p.G424V	C7orf10_uc003thm.1_Missense_Mutation_p.G420V|C7orf10_uc003tho.1_Missense_Mutation_p.G376V|C7orf10_uc003thp.1_Non-coding_Transcript	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13	431							transferase activity			ovary(2)	2														0.286996	167.931534	176.993802	64	159	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	40900032	40900032	2483	7	G	T	T	T	559	43	C7orf10	2	2
GLI3	2737	broad.mit.edu	37	7	42006017	42006017	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:42006017C>A	uc011kbh.1	-	c.2654G>T	c.(2653-2655)CGG>CTG	p.R885L	GLI3_uc011kbg.1_Missense_Mutation_p.R826L	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	885					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of gene-specific transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|transcription activator activity|transcription repressor activity|zinc ion binding			large_intestine(2)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)|pancreas(1)	8										806				0.384615	57.793659	58.39821	20	32	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	42006017	42006017	6707	7	C	A	A	A	299	23	GLI3	1	1
CAMK2B	816	broad.mit.edu	37	7	44323760	44323760	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:44323760T>C	uc003tkq.2	-	c.130A>G	c.(130-132)ATC>GTC	p.I44V	CAMK2B_uc003tkp.2_Missense_Mutation_p.I44V|CAMK2B_uc003tkx.2_Missense_Mutation_p.I44V|CAMK2B_uc010kyd.2_Non-coding_Transcript|CAMK2B_uc003tkr.2_Missense_Mutation_p.I44V|CAMK2B_uc003tks.2_Missense_Mutation_p.I44V|CAMK2B_uc003tku.2_Missense_Mutation_p.I44V|CAMK2B_uc003tkv.2_Missense_Mutation_p.I44V|CAMK2B_uc003tkt.2_Missense_Mutation_p.I44V|CAMK2B_uc003tkw.2_Missense_Mutation_p.I44V|CAMK2B_uc010kyc.2_Missense_Mutation_p.I44V	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II	44	Protein kinase.				interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2										200				0.142857	27.619333	38.797491	13	78	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	44323760	44323760	2717	7	T	C	C	C	650	50	CAMK2B	4	4
NPC1L1	29881	broad.mit.edu	37	7	44560615	44560615	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:44560615C>A	uc003tlb.2	-	c.3056G>T	c.(3055-3057)CGG>CTG	p.R1019L	NPC1L1_uc003tlc.2_Missense_Mutation_p.R1019L|NPC1L1_uc011kbw.1_Missense_Mutation_p.R973L|NPC1L1_uc003tla.2_Missense_Mutation_p.R22L	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN	Niemann-Pick C1-like protein 1 isoform 1	1019	Cytoplasmic (Potential).				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)	4					Ezetimibe(DB00973)									0.348529	697.499972	711.254775	237	443	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	44560615	44560615	10975	7	C	A	A	A	299	23	NPC1L1	1	1
ZNF804B	219578	broad.mit.edu	37	7	88956742	88956742	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:88956742C>G	uc011khi.1	+	c.334C>G	c.(334-336)CTT>GTT	p.L112V		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	112						intracellular	zinc ion binding			ovary(5)|pancreas(2)	7	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)											0.184211	20.10488	23.657096	7	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	88956742	88956742	18769	7	C	G	G	G	260	20	ZNF804B	3	3
SAMD9L	219285	broad.mit.edu	37	7	92763290	92763290	+	Silent	SNP	T	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:92763290T>C	uc003umh.1	-	c.1995A>G	c.(1993-1995)ACA>ACG	p.T665T	SAMD9L_uc003umj.1_Silent_p.T665T|SAMD9L_uc003umi.1_Silent_p.T665T|SAMD9L_uc010lfb.1_Silent_p.T665T|SAMD9L_uc003umk.1_Silent_p.T665T|SAMD9L_uc010lfc.1_Silent_p.T665T|SAMD9L_uc010lfd.1_Silent_p.T665T|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	665										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)											0.37037	66.286492	67.083724	20	34	KEEP	---	---	---	---	capture		Silent	SNP	92763290	92763290	14307	7	T	C	C	C	704	55	SAMD9L	4	4
CASD1	64921	broad.mit.edu	37	7	94181710	94181710	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:94181710G>A	uc003uni.3	+	c.2005G>A	c.(2005-2007)GAA>AAA	p.E669K	CASD1_uc003unj.3_Missense_Mutation_p.E669K	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor	669						integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)											0.179775	30.739867	39.330106	16	73	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	94181710	94181710	2783	7	G	A	A	A	585	45	CASD1	2	2
TECPR1	25851	broad.mit.edu	37	7	97870217	97870217	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:97870217G>T	uc003upg.2	-	c.879C>A	c.(877-879)GTC>GTA	p.V293V	TECPR1_uc003uph.1_Silent_p.V223V	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	293						integral to membrane	protein binding			pancreas(1)	1														0.2	14.068578	17.428457	8	32	KEEP	---	---	---	---	capture		Silent	SNP	97870217	97870217	16270	7	G	T	T	T	574	45	TECPR1	2	2
TRIM4	89122	broad.mit.edu	37	7	99490024	99490024	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:99490024C>A	uc003usd.2	-	c.1265G>T	c.(1264-1266)AGT>ATT	p.S422I	TRIM4_uc003use.2_Missense_Mutation_p.S396I|TRIM4_uc011kjc.1_Missense_Mutation_p.S252I	NM_033017	NP_148977	Q9C037	TRIM4_HUMAN	tripartite motif protein TRIM4 isoform alpha	422	B30.2/SPRY.				protein trimerization	cytoplasm|plasma membrane	zinc ion binding			ovary(1)|kidney(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)												0.246377	344.190244	376.556141	136	416	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	99490024	99490024	17058	7	C	A	A	A	260	20	TRIM4	2	2
RP1L1	94137	broad.mit.edu	37	8	10468624	10468624	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:10468624C>A	uc003wtc.2	-	c.2984G>T	c.(2983-2985)GGG>GTG	p.G995V		NM_178857	NP_849188	A6NKC6	A6NKC6_HUMAN	retinitis pigmentosa 1-like 1	995					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)										0.236434	140.231966	156.55918	61	197	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	10468624	10468624	14012	8	C	A	A	A	286	22	RP1L1	2	2
DPYS	1807	broad.mit.edu	37	8	105405183	105405183	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:105405183G>A	uc003yly.3	-	c.1272C>T	c.(1270-1272)AAC>AAT	p.N424N	DPYS_uc010mcf.1_5'UTR	NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	424					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)											0.137931	21.815211	36.53113	16	100	KEEP	---	---	---	---	capture		Silent	SNP	105405183	105405183	4930	8	G	A	A	A	464	36	DPYS	2	2
DPYS	1807	broad.mit.edu	37	8	105463529	105463529	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:105463529G>T	uc003yly.3	-	c.368C>A	c.(367-369)CCC>CAC	p.P123H		NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	123					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)											0.266055	69.228918	74.617935	29	80	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	105463529	105463529	4930	8	G	T	T	T	559	43	DPYS	2	2
EXT1	2131	broad.mit.edu	37	8	119123195	119123195	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:119123195A>G	uc003yok.1	-	c.91T>C	c.(91-93)TCG>CCG	p.S31P		NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1	31	Lumenal (Potential).				glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(1)	3	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)							297				0.147541	14.346359	21.619272	9	52	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	119123195	119123195	5517	8	A	G	G	G	156	12	EXT1	4	4
HAS2	3037	broad.mit.edu	37	8	122641407	122641407	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:122641407G>C	uc003yph.2	-	c.174C>G	c.(172-174)ATC>ATG	p.I58M		NM_005328	NP_005319	Q92819	HAS2_HUMAN	hyaluronan synthase 2	58	Helical; Name=2; (Potential).					integral to plasma membrane	hyaluronan synthase activity			ovary(5)	5	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)											0.309013	247.31504	254.887013	72	161	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	122641407	122641407	7244	8	G	C	C	C	577	45	HAS2	3	3
ARHGEF10	9639	broad.mit.edu	37	8	1808322	1808322	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:1808322C>T	uc003wpr.2	+	c.453C>T	c.(451-453)ATC>ATT	p.I151I	ARHGEF10_uc003wpq.1_Silent_p.I175I|ARHGEF10_uc003wps.2_Silent_p.I151I|ARHGEF10_uc003wpt.2_Silent_p.I65I|ARHGEF10_uc010lrd.1_Silent_p.I65I|ARHGEF10_uc003wpu.2_Silent_p.I65I	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	175					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)						2844				0.125	17.768572	39.793348	20	140	KEEP	---	---	---	---	capture		Silent	SNP	1808322	1808322	908	8	C	T	T	T	369	29	ARHGEF10	2	2
NAT2	10	broad.mit.edu	37	8	18257533	18257533	+	Missense_Mutation	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:18257533T>A	uc003wyw.1	+	c.20T>A	c.(19-21)TTT>TAT	p.F7Y		NM_000015	NP_000006	P11245	ARY2_HUMAN	N-acetyltransferase 2	7					xenobiotic metabolic process	cytosol	arylamine N-acetyltransferase activity			ovary(1)|skin(1)	2				Colorectal(111;0.0531)|COAD - Colon adenocarcinoma(73;0.21)										0.290598	84.598527	89.198115	34	83	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	18257533	18257533	10573	8	T	A	A	A	832	64	NAT2	3	3
SLC25A37	51312	broad.mit.edu	37	8	23423746	23423746	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:23423746G>A	uc003xdo.2	+	c.336G>A	c.(334-336)ATG>ATA	p.M112I	SLC25A37_uc003xdn.1_Missense_Mutation_p.M112I|SLC25A37_uc003xdp.2_Non-coding_Transcript|SLC25A37_uc010ltz.2_Non-coding_Transcript|SLC25A37_uc003xdq.2_5'Flank	NM_016612	NP_057696	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25, member 37	112	Solcar 1.|Helical; Name=2; (Potential).				ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)										0.291667	73.154348	76.890879	28	68	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	23423746	23423746	14998	8	G	A	A	A	611	47	SLC25A37	2	2
CSMD1	64478	broad.mit.edu	37	8	2830668	2830668	+	Nonsense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:2830668G>T	uc011kwk.1	-	c.8897C>A	c.(8896-8898)TCA>TAA	p.S2966*	CSMD1_uc011kwj.1_Nonsense_Mutation_p.S2295*|CSMD1_uc010lrg.2_Nonsense_Mutation_p.S976*	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2966	Extracellular (Potential).|Sushi 22.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)										0.370968	63.513486	64.418471	23	39	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	2830668	2830668	4085	8	G	T	T	T	585	45	CSMD1	5	2
UNC5D	137970	broad.mit.edu	37	8	35406908	35406908	+	Missense_Mutation	SNP	A	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:35406908A>T	uc003xjr.1	+	c.202A>T	c.(202-204)AGC>TGC	p.S68C	UNC5D_uc003xjs.1_Missense_Mutation_p.S63C	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	68	Extracellular (Potential).|Ig-like.				apoptosis|axon guidance	integral to membrane	receptor activity			ovary(2)|pancreas(1)	3				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)										0.4	48.537644	48.931898	18	27	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	35406908	35406908	17553	8	A	T	T	T	143	11	UNC5D	3	3
ADAM2	2515	broad.mit.edu	37	8	39666959	39666959	+	Silent	SNP	T	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:39666959T>G	uc003xnj.2	-	c.540A>C	c.(538-540)ATA>ATC	p.I180I	ADAM2_uc003xnk.2_Intron|ADAM2_uc011lck.1_Silent_p.I180I|ADAM2_uc003xnl.2_Intron	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein	180	Extracellular (Potential).|Peptidase M12B.				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)										0.3125	15.069632	15.57012	5	11	KEEP	---	---	---	---	capture		Silent	SNP	39666959	39666959	242	8	T	G	G	G	680	53	ADAM2	4	4
PRKDC	5591	broad.mit.edu	37	8	48777168	48777168	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:48777168G>A	uc003xqi.2	-	c.5520C>T	c.(5518-5520)TTC>TTT	p.F1840F	PRKDC_uc003xqj.2_Silent_p.F1840F|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	1840					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of gene-specific transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				Esophageal Squamous(79;1091 1253 12329 31680 40677)				1566				0.241379	16.909109	18.679584	7	22	KEEP	---	---	---	---	capture		Silent	SNP	48777168	48777168	12964	8	G	A	A	A	581	45	PRKDC	2	2
PRKDC	5591	broad.mit.edu	37	8	48826536	48826536	+	Missense_Mutation	SNP	T	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:48826536T>A	uc003xqi.2	-	c.2706A>T	c.(2704-2706)AAA>AAT	p.K902N	PRKDC_uc003xqj.2_Missense_Mutation_p.K902N|PRKDC_uc011ldh.1_Missense_Mutation_p.K902N	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	902					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of gene-specific transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				Esophageal Squamous(79;1091 1253 12329 31680 40677)				1566				0.322314	100.000803	103.383778	39	82	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	48826536	48826536	12964	8	T	A	A	A	777	60	PRKDC	3	3
ST18	9705	broad.mit.edu	37	8	53045646	53045646	+	Silent	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:53045646G>T	uc003xqz.2	-	c.2415C>A	c.(2413-2415)ACC>ACA	p.T805T	ST18_uc011ldq.1_Silent_p.T452T|ST18_uc011ldr.1_Silent_p.T770T|ST18_uc011lds.1_Silent_p.T710T|ST18_uc003xra.2_Silent_p.T805T	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	805						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)												0.338308	180.788969	185.459639	68	133	KEEP	---	---	---	---	capture		Silent	SNP	53045646	53045646	15730	8	G	T	T	T	600	47	ST18	2	2
ANGPT2	285	broad.mit.edu	37	8	6389879	6389879	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:6389879G>A	uc003wqj.3	-	c.418C>T	c.(418-420)CGG>TGG	p.R140W	MCPH1_uc003wqi.2_Intron|ANGPT2_uc003wqk.3_Missense_Mutation_p.R140W|ANGPT2_uc010lri.2_Intron|ANGPT2_uc003wql.3_Missense_Mutation_p.R140W	NM_001147	NP_001138	O15123	ANGP2_HUMAN	angiopoietin 2 isoform a precursor	140					angiogenesis|blood coagulation|leukocyte migration|negative regulation of blood vessel endothelial cell migration|negative regulation of positive chemotaxis|Tie receptor signaling pathway	extracellular space	metal ion binding|receptor tyrosine kinase binding				0		Hepatocellular(245;0.0663)		Colorectal(4;0.0142)|READ - Rectum adenocarcinoma(4;0.19)|COAD - Colon adenocarcinoma(4;0.226)										0.154206	55.129674	79.604108	33	181	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	6389879	6389879	614	8	G	A	A	A	493	38	ANGPT2	1	1
KCNB2	9312	broad.mit.edu	37	8	73849959	73849959	+	Missense_Mutation	SNP	A	C	C			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:73849959A>C	uc003xzb.2	+	c.2369A>C	c.(2368-2370)AAG>ACG	p.K790T		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	790	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4	Breast(64;0.137)		Epithelial(68;0.105)											0.191489	62.042505	74.580843	27	114	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	73849959	73849959	8318	8	A	C	C	C	39	3	KCNB2	4	4
ZFHX4	79776	broad.mit.edu	37	8	77618058	77618058	+	Silent	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:77618058C>A	uc003yav.2	+	c.1735C>A	c.(1735-1737)CGG>AGG	p.R579R	ZFHX4_uc003yat.1_Silent_p.R579R|ZFHX4_uc003yau.1_Silent_p.R579R|ZFHX4_uc003yaw.1_Silent_p.R579R	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	579					regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)											0.252747	54.275843	59.333523	23	68	KEEP	---	---	---	---	capture		Silent	SNP	77618058	77618058	18223	8	C	A	A	A	295	23	ZFHX4	1	1
SLC7A13	157724	broad.mit.edu	37	8	87242442	87242442	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:87242442A>G	uc003ydq.1	-	c.65T>C	c.(64-66)TTG>TCG	p.L22S	SLC7A13_uc003ydr.1_Missense_Mutation_p.L22S	NM_138817	NP_620172	Q8TCU3	S7A13_HUMAN	solute carrier family 7, (cationic amino acid	22	Helical; Name=1; (Potential).					integral to membrane	amino acid transmembrane transporter activity			central_nervous_system(1)	1														0.240741	69.501196	76.122068	26	82	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	87242442	87242442	15192	8	A	G	G	G	65	5	SLC7A13	4	4
SVEP1	79987	broad.mit.edu	37	9	113169628	113169628	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:113169628C>A	uc010mtz.2	-	c.8252G>T	c.(8251-8253)GGC>GTC	p.G2751V	SVEP1_uc010mty.2_Missense_Mutation_p.G677V	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	2751	Sushi 22.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7														0.48062	182.547746	182.588933	62	67	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	113169628	113169628	15940	9	C	A	A	A	338	26	SVEP1	2	2
TLR4	7099	broad.mit.edu	37	9	120476467	120476467	+	Nonsense_Mutation	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:120476467G>A	uc004bjz.2	+	c.2061G>A	c.(2059-2061)TGG>TGA	p.W687*	TLR4_uc004bka.2_Nonsense_Mutation_p.W647*|TLR4_uc004bkb.2_Nonsense_Mutation_p.W487*	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	687	Cytoplasmic (Potential).|TIR.				activation of MAPK activity|cellular response to mechanical stimulus|defense response to Gram-negative bacterium|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of inflammatory response|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			ovary(4)	4										157				0.45	83.417375	83.54808	27	33	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	120476467	120476467	16483	9	G	A	A	A	559	43	TLR4	5	2
SET	6418	broad.mit.edu	37	9	131454184	131454184	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:131454184A>G	uc004bvt.3	+	c.218A>G	c.(217-219)TAT>TGT	p.Y73C	SET_uc004bvu.3_Missense_Mutation_p.Y60C|SET_uc010myg.2_Non-coding_Transcript|SET_uc011mbj.1_Missense_Mutation_p.Y49C	NM_001122821	NP_001116293	Q01105	SET_HUMAN	SET translocation (myeloid leukemia-associated)	73					DNA replication|mRNA metabolic process|negative regulation of histone acetylation|negative regulation of neuron apoptosis|nucleocytoplasmic transport|nucleosome assembly|nucleosome disassembly	cytosol|endoplasmic reticulum|nucleoplasm|perinuclear region of cytoplasm|protein complex	histone binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity|transcription repressor activity				0		Myeloproliferative disorder(178;0.204)		GBM - Glioblastoma multiforme(294;3.1e-09)						335				0.489796	91.768458	91.773464	24	25	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	131454184	131454184	14616	9	A	G	G	G	208	16	SET	4	4
JAK2	3717	broad.mit.edu	37	9	5081748	5081748	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:5081748G>T	uc010mhm.2	+	c.2458G>T	c.(2458-2460)GAC>TAC	p.D820Y	JAK2_uc003ziw.2_Missense_Mutation_p.D820Y	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2	820					actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28274)|lung(5)|breast(4)|ovary(1)|liver(1)	28285	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)				1		432				0.508475	89.645171	89.648737	30	29	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	5081748	5081748	8242	9	G	T	T	T	585	45	JAK2	2	2
NFIL3	4783	broad.mit.edu	37	9	94171718	94171718	+	Silent	SNP	C	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:94171718C>T	uc004arh.2	-	c.1299G>A	c.(1297-1299)TTG>TTA	p.L433L		NM_005384	NP_005375	Q16649	NFIL3_HUMAN	nuclear factor, interleukin 3 regulated	433					circadian rhythm|immune response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulator activity				0						Esophageal Squamous(152;732 1832 10053 26981 51762)								0.317073	103.172213	106.836727	39	84	KEEP	---	---	---	---	capture		Silent	SNP	94171718	94171718	10773	9	C	T	T	T	376	29	NFIL3	2	2
GPR112	139378	broad.mit.edu	37	X	135439865	135439865	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:135439865G>T	uc004ezu.1	+	c.6930G>T	c.(6928-6930)TTG>TTT	p.L2310F	GPR112_uc010nsb.1_Missense_Mutation_p.L2105F|GPR112_uc010nsc.1_Intron	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2310	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	11	Acute lymphoblastic leukemia(192;0.000127)									487				0.421053	94.686196	95.099737	32	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	135439865	135439865	6903	23	G	T	T	T	607	47	GPR112	2	2
CDR1	1038	broad.mit.edu	37	X	139866270	139866270	+	Silent	SNP	G	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:139866270G>A	uc004fbg.1	-	c.262C>T	c.(262-264)CTG>TTG	p.L88L		NM_004065	NP_004056	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1,	88	23 X 6 AA approximate repeats.|15.										0	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)												0.353846	65.104174	66.328984	23	42	KEEP	---	---	---	---	capture		Silent	SNP	139866270	139866270	3300	23	G	A	A	A	425	33	CDR1	2	2
SLITRK2	84631	broad.mit.edu	37	X	144905579	144905579	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:144905579C>A	uc004fcd.2	+	c.1636C>A	c.(1636-1638)CAT>AAT	p.H546N	SLITRK2_uc010nsp.2_Missense_Mutation_p.H546N|SLITRK2_uc010nso.2_Missense_Mutation_p.H546N|SLITRK2_uc011mwq.1_Missense_Mutation_p.H546N|SLITRK2_uc011mwr.1_Missense_Mutation_p.H546N|SLITRK2_uc011mws.1_Missense_Mutation_p.H546N|SLITRK2_uc004fcg.2_Missense_Mutation_p.H546N|SLITRK2_uc011mwt.1_Missense_Mutation_p.H546N	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	546	Extracellular (Potential).|LRRCT 2.					integral to membrane				ovary(4)|pancreas(1)	5	Acute lymphoblastic leukemia(192;6.56e-05)													0.428571	139.657558	140.125096	45	60	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	144905579	144905579	15241	23	C	A	A	A	221	17	SLITRK2	2	2
GPR50	9248	broad.mit.edu	37	X	150348572	150348572	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:150348572C>A	uc010ntg.1	+	c.517C>A	c.(517-519)CCT>ACT	p.P173T	GPR50_uc011myc.1_Missense_Mutation_p.P173T	NM_004224	NP_004215	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	173	Extracellular (Potential).				cell-cell signaling	integral to plasma membrane	melatonin receptor activity			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)													0.506993	405.043738	405.055526	145	141	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	150348572	150348572	6972	23	C	A	A	A	390	30	GPR50	2	2
MAGEA4	4103	broad.mit.edu	37	X	151092768	151092768	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:151092768C>A	uc004fez.2	+	c.632C>A	c.(631-633)GCA>GAA	p.A211E	MAGEA4_uc004ffa.2_Missense_Mutation_p.A211E|MAGEA4_uc004ffb.2_Missense_Mutation_p.A211E|MAGEA4_uc004ffc.2_Missense_Mutation_p.A211E|MAGEA4_uc004ffd.2_Missense_Mutation_p.A211E	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	211	MAGE.						protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)													0.46281	334.257191	334.55028	112	130	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	151092768	151092768	9547	23	C	A	A	A	325	25	MAGEA4	2	2
PCDH11X	27328	broad.mit.edu	37	X	91873723	91873723	+	Silent	SNP	C	A	A			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:91873723C>A	uc004efk.1	+	c.3828C>A	c.(3826-3828)GTC>GTA	p.V1276V	PCDH11X_uc004efl.1_Silent_p.V1266V|PCDH11X_uc004efo.1_Silent_p.V1239V|PCDH11X_uc010nmv.1_3'UTR|PCDH11X_uc004efm.1_Silent_p.V1268V|PCDH11X_uc004efn.1_Silent_p.V1258V	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	1276	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						NSCLC(38;925 1092 2571 38200 45895)								0.453074	391.424461	392.021117	140	169	KEEP	---	---	---	---	capture		Silent	SNP	91873723	91873723	11928	23	C	A	A	A	366	29	PCDH11X	2	2
OR5AP2	338675	broad.mit.edu	37	11	56409724	56409724	+	Frame_Shift_Del	DEL	G	-	-			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:56409724_56409724delG	uc001njb.1	-	c.192_192delC	c.(190-192)CCCfs	p.P64fs		NM_001002925	NP_001002925	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP,	64	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)	3														0.38			43	69		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	56409724	56409724	11554	11	G	-	-	-	600	47	OR5AP2	5	5
ZNF181	339318	broad.mit.edu	37	19	35231824	35231824	+	Frame_Shift_Del	DEL	G	-	-			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:35231824_35231824delG	uc002nvu.3	+	c.538_538delG	c.(538-540)GGGfs	p.G180fs	ZNF181_uc010xsa.1_Frame_Shift_Del_p.G179fs|ZNF181_uc010xsb.1_Frame_Shift_Del_p.G179fs|ZNF181_uc010xsc.1_Frame_Shift_Del_p.G115fs	NM_001029997	NP_001025168	Q2M3W8	ZN181_HUMAN	zinc finger protein 181 isoform 1	180					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)											0.68			39	18		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	35231824	35231824	18340	19	G	-	-	-	455	35	ZNF181	5	5
STK39	27347	broad.mit.edu	37	2	169103872	169103892	+	In_Frame_Del	DEL	GCCGCCGCCGCTGTCACCGGG	-	-			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:169103872_169103892delGCCGCCGCCGCTGTCACCGGG	uc002uea.2	-	c.54_74delCCCGGTGACAGCGGCGGCGGC	c.(52-75)GCCCCGGTGACAGCGGCGGCGGCG>GCG	p.18_25APVTAAAA>A		NM_013233	NP_037365	Q9UEW8	STK39_HUMAN	serine threonine kinase 39 (STE20/SPS1 homolog,	18_25	Ala/Pro-rich.				protein phosphorylation|response to stress	cytoplasm|nucleus	ATP binding|receptor signaling protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2										264				0.67			8	4		---	---	---	---	capture_indel		In_Frame_Del	DEL	169103872	169103892	15825	2	GCCGCCGCCGCTGTCACCGGG	-	-	-	494	38	STK39	5	5
PRR21	643905	broad.mit.edu	37	2	240982117	240982144	+	Frame_Shift_Del	DEL	GTGGGTGAAGAGGCATGGATGAAGGACT	-	-	rs112308001;rs79839275;rs74754936;rs79314166		TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:240982117_240982144delGTGGGTGAAGAGGCATGGATGAAGGACT	uc010zod.1	-	c.256_283delAGTCCTTCATCCATGCCTCTTCACCCAC	c.(256-285)AGTCCTTCATCCATGCCTCTTCACCCACGGfs	p.S86fs		NM_001080835	NP_001074304	Q8WXC7	PRR21_HUMAN	proline rich 21	86_95	Pro-rich.									ovary(1)	1														0.31			36	80		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	240982117	240982144	13040	2	GTGGGTGAAGAGGCATGGATGAAGGACT	-	-	-	519	40	PRR21	5	5
PCDHAC1	56135	broad.mit.edu	37	5	140308810	140308810	+	Frame_Shift_Del	DEL	C	-	-			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140308810_140308810delC	uc003lih.2	+	c.2333_2333delC	c.(2332-2334)GCCfs	p.A778fs	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lig.1_Frame_Shift_Del_p.A778fs	NM_018898	NP_061721	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1 isoform 1	778	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.30			45	103		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	140308810	140308810	11952	5	C	-	-	-	338	26	PCDHAC1	5	5
GRM3	2913	broad.mit.edu	37	7	86468581	86468581	+	Frame_Shift_Del	DEL	C	-	-			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:86468581_86468581delC	uc003uid.2	+	c.1751_1751delC	c.(1750-1752)GCCfs	p.A584fs	GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Frame_Shift_Del_p.A456fs|GRM3_uc010leh.2_Frame_Shift_Del_p.A176fs	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	584	Helical; Name=1; (Potential).				synaptic transmission	integral to plasma membrane				ovary(3)|central_nervous_system(2)	5	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	GBM(52;969 1098 3139 52280)								0.30			44	102		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	86468581	86468581	7077	7	C	-	-	-	338	26	GRM3	5	5
GARNL3	84253	broad.mit.edu	37	9	130119519	130119519	+	Frame_Shift_Del	DEL	C	-	-			TCGA-05-4250-01	TCGA-05-4250-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:130119519_130119519delC	uc011mae.1	+	c.1957_1957delC	c.(1957-1959)CCCfs	p.P653fs	GARNL3_uc011mad.1_Frame_Shift_Del_p.P631fs|GARNL3_uc010mxi.2_5'UTR	NM_032293	NP_115669	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	653	CNH.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity|small GTPase regulator activity			central_nervous_system(1)|skin(1)	2														0.42			50	68		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	130119519	130119519	6505	9	C	-	-	-	390	30	GARNL3	5	5
