Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	Oncotatorv0393GAF20hg19Feb2011dbSNPbuild132UniProtRelease2011_6	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	context_orig	context65	gene_name	categ	categ_ignoring_null_categ
IDI1	3422	broad.mit.edu	37	10	1089975	1089975	+	Nonsense_Mutation	SNP	T	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:1089975T>A	uc001iga.2	-	c.277A>T	c.(277-279)AAG>TAG	p.K93*	C10orf110_uc010qaf.1_Non-coding_Transcript|C10orf110_uc001ifx.3_Non-coding_Transcript|C10orf110_uc001ifw.3_3'UTR|C10orf110_uc001ify.3_Non-coding_Transcript|IDI1_uc001ifz.2_Nonsense_Mutation_p.K37*|IDI1_uc001igb.2_Intron|IDI1_uc001igc.2_Nonsense_Mutation_p.K37*	NM_004508	NP_004499	Q13907	IDI1_HUMAN	isopentenyl-diphosphate delta isomerase	36		Substrate.			carotenoid biosynthetic process|cholesterol biosynthetic process	cytosol|peroxisome	hydrolase activity|isopentenyl-diphosphate delta-isomerase activity|metal ion binding				0		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)										0.057143	-17.978122	25.265736	12	198	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	1089975	1089975	7799	10	T	A	A	A	819	63	IDI1	5	3
TET1	80312	broad.mit.edu	37	10	70450634	70450634	+	Nonsense_Mutation	SNP	C	G	G			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:70450634C>G	uc001jok.3	+	c.5474C>G	c.(5473-5475)TCA>TGA	p.S1825*		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	1825					DNA demethylation|inner cell mass cell differentiation|oxidation-reduction process|stem cell maintenance	nucleus	iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)	5										280				0.039301	-30.820191	21.619743	9	220	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	70450634	70450634	16296	10	C	G	G	G	377	29	TET1	5	3
MYOF	26509	broad.mit.edu	37	10	95113621	95113621	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:95113621C>G	uc001kin.2	-	c.3428G>C	c.(3427-3429)TGC>TCC	p.C1143S	MYOF_uc001kio.2_Missense_Mutation_p.C1130S|MYOF_uc009xue.2_Non-coding_Transcript	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	1143	Cytoplasmic (Potential).|C2 4.				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4														0.405172	167.204155	168.115733	47	69	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	95113621	95113621	10484	10	C	G	G	G	325	25	MYOF	3	3
SLC22A25	387601	broad.mit.edu	37	11	62997041	62997041	+	Silent	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:62997041G>A	uc001nwr.1	-	c.84C>T	c.(82-84)AAC>AAT	p.N28N	SLC22A10_uc010rmo.1_Intron|SLC22A25_uc009yoq.1_Non-coding_Transcript|SLC22A25_uc001nws.1_Non-coding_Transcript|SLC22A25_uc001nwt.1_Silent_p.N28N	NM_199352	NP_955384	Q6T423	S22AP_HUMAN	putative UST1-like organic anion transporter	28	Helical; Name=1; (Potential).				transmembrane transport	integral to membrane				ovary(3)	3														0.271845	73.654822	78.488748	28	75	KEEP	---	---	---	---	capture		Silent	SNP	62997041	62997041	14951	11	G	A	A	A	516	40	SLC22A25	1	1
SF1	7536	broad.mit.edu	37	11	64535055	64535055	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:64535055G>A	uc001oaz.1	-	c.1705C>T	c.(1705-1707)CCT>TCT	p.P569S	SF1_uc010rnm.1_Missense_Mutation_p.P136S|SF1_uc010rnn.1_Missense_Mutation_p.P418S|SF1_uc001oba.1_Missense_Mutation_p.P444S|SF1_uc001obb.1_Missense_Mutation_p.P444S|SF1_uc001obc.1_Missense_Mutation_p.P444S|SF1_uc001obd.1_Missense_Mutation_p.P444S|SF1_uc001obe.1_Missense_Mutation_p.P329S|SF1_uc010rno.1_Missense_Mutation_p.P329S	NM_201998	NP_973727	Q15637	SF01_HUMAN	splicing factor 1 isoform 3	444	Pro-rich.				nuclear mRNA 3'-splice site recognition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ribosome|spliceosomal complex	protein binding|RNA binding|RNA polymerase II transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|breast(1)|skin(1)	3												OREG0021062	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.367232	187.901615	190.654456	65	112	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	64535055	64535055	14634	11	G	A	A	A	559	43	SF1	2	2
USP15	9958	broad.mit.edu	37	12	62785065	62785065	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:62785065G>A	uc001src.1	+	c.2089G>A	c.(2089-2091)GAG>AAG	p.E697K	USP15_uc001srb.1_Missense_Mutation_p.E668K	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	697					protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)	2			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		Melanoma(181;615 2041 39364 49691 50001)								0.322034	102.700519	106.023744	38	80	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	62785065	62785065	17608	12	G	A	A	A	585	45	USP15	2	2
PLD4	122618	broad.mit.edu	37	14	105395177	105395177	+	Missense_Mutation	SNP	C	G	G			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:105395177C>G	uc010tyl.1	+	c.397C>G	c.(397-399)CTG>GTG	p.L133V	PLD4_uc001ypu.1_Missense_Mutation_p.L126V	NM_138790	NP_620145	Q96BZ4	PLD4_HUMAN	phospholipase D4	126					lipid catabolic process	integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity			central_nervous_system(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)		Choline(DB00122)									0.195652	22.755215	26.721728	9	37	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	105395177	105395177	12474	14	C	G	G	G	363	28	PLD4	3	3
ADCY4	196883	broad.mit.edu	37	14	24798609	24798609	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:24798609G>A	uc001wov.2	-	c.1348C>T	c.(1348-1350)CGG>TGG	p.R450W	ADCY4_uc001wow.2_Missense_Mutation_p.R450W|ADCY4_uc010toh.1_Missense_Mutation_p.R136W|ADCY4_uc001wox.2_Missense_Mutation_p.R450W|ADCY4_uc001woy.2_Missense_Mutation_p.R450W	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	450	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)						1				0.287879	50.009108	52.665902	19	47	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	24798609	24798609	297	14	G	A	A	A	519	40	ADCY4	1	1
SPTB	6710	broad.mit.edu	37	14	65264536	65264536	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:65264536G>C	uc001xhr.2	-	c.1093C>G	c.(1093-1095)CTA>GTA	p.L365V	SPTB_uc001xhs.2_Missense_Mutation_p.L365V|SPTB_uc001xht.2_Missense_Mutation_p.L365V|SPTB_uc001xhu.2_Missense_Mutation_p.L365V	NM_001024858	NP_001020029	P11277	SPTB1_HUMAN	spectrin beta isoform a	365	Spectrin 1.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|lung(1)|central_nervous_system(1)	9		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)										0.263158	150.971754	160.60533	50	140	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	65264536	65264536	15632	14	G	C	C	C	425	33	SPTB	3	3
CHRNA7	1139	broad.mit.edu	37	15	32460235	32460235	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:32460235G>A	uc001zft.2	+	c.1085G>A	c.(1084-1086)CGG>CAG	p.R362Q	CHRNA7_uc010baf.2_Missense_Mutation_p.R181Q|CHRNA7_uc010bak.2_Missense_Mutation_p.R277Q	NM_000746	NP_000737	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7	362	Cytoplasmic (Potential).				activation of MAPK activity|calcium ion transport|cellular calcium ion homeostasis|memory|negative regulation of tumor necrosis factor production|positive regulation of angiogenesis|positive regulation of cell proliferation|response to hypoxia|response to nicotine	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|beta-amyloid binding|chloride channel regulator activity|nicotinic acetylcholine-activated cation-selective channel activity|protein homodimerization activity|toxin binding			ovary(1)	1		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Nicotine(DB00184)|Varenicline(DB01273)	Esophageal Squamous(193;529 2900 40232 43193)								0.116279	3.976415	10.187893	5	38	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32460235	32460235	3522	15	G	A	A	A	507	39	CHRNA7	1	1
VPS18	57617	broad.mit.edu	37	15	41194859	41194859	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:41194859G>T	uc001zne.2	+	c.2242G>T	c.(2242-2244)GAT>TAT	p.D748Y		NM_020857	NP_065908	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18	748	Clathrin.				endosome organization|lysosome organization|protein transport	HOPS complex|late endosome membrane|lysosomal membrane	metal ion binding|protein binding			ovary(2)|large_intestine(1)	3		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)										0.278689	36.522333	39.230663	17	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	41194859	41194859	17761	15	G	T	T	T	533	41	VPS18	2	2
SLCO3A1	28232	broad.mit.edu	37	15	92459366	92459366	+	Silent	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:92459366G>A	uc002bqx.2	+	c.324G>A	c.(322-324)CTG>CTA	p.L108L	SLCO3A1_uc002bqy.2_Silent_p.L108L|SLCO3A1_uc010boc.1_Non-coding_Transcript|SLCO3A1_uc002bqz.1_Silent_p.L50L	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,	108	Helical; Name=3; (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity				0	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)											0.2	6.815978	8.071882	3	12	KEEP	---	---	---	---	capture		Silent	SNP	92459366	92459366	15225	15	G	A	A	A	574	45	SLCO3A1	2	2
SCNN1G	6340	broad.mit.edu	37	16	23200956	23200956	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:23200956G>C	uc002dlm.1	+	c.582G>C	c.(580-582)ATG>ATC	p.M194I		NM_001039	NP_001030	P51170	SCNNG_HUMAN	sodium channel, nonvoltage-gated 1, gamma	194	Extracellular (By similarity).				excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|large_intestine(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)									0.216495	182.960191	204.537277	63	228	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	23200956	23200956	14412	16	G	C	C	C	598	46	SCNN1G	3	3
C16orf93	90835	broad.mit.edu	37	16	30768826	30768826	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:30768826G>A	uc002dzn.2	-	c.1162C>T	c.(1162-1164)CCG>TCG	p.P388S	C16orf93_uc002dzm.2_Missense_Mutation_p.P323S|C16orf93_uc002dzo.2_Missense_Mutation_p.P286S	NM_001014979	NP_001014979	A1A4V9	CP093_HUMAN	hypothetical protein LOC90835	323											0														0.250597	262.375237	286.068294	105	314	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	30768826	30768826	1899	16	G	A	A	A	533	41	C16orf93	2	2
HYDIN	54768	broad.mit.edu	37	16	71025246	71025246	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:71025246G>T	uc002ezr.2	-	c.3839C>A	c.(3838-3840)ACG>AAG	p.T1280K		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	1280										ovary(1)	1		Ovarian(137;0.0654)												0.308511	87.445354	90.514129	29	65	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	71025246	71025246	7767	16	G	T	T	T	520	40	HYDIN	1	1
DNAH9	1770	broad.mit.edu	37	17	11696840	11696840	+	Silent	SNP	G	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:11696840G>T	uc002gne.2	+	c.8082G>T	c.(8080-8082)GTG>GTT	p.V2694V	DNAH9_uc010coo.2_Silent_p.V1988V	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2694					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	10		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)										0.28125	121.502858	128.386251	45	115	KEEP	---	---	---	---	capture		Silent	SNP	11696840	11696840	4791	17	G	T	T	T	600	47	DNAH9	2	2
STK11	6794	broad.mit.edu	37	19	1221229	1221229	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:1221229G>T	uc002lrl.1	+	c.752G>T	c.(751-753)GGT>GTT	p.G251V		NM_000455	NP_000446	Q15831	STK11_HUMAN	serine/threonine protein kinase 11	251	Protein kinase.				anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|protein phosphorylation|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	p.0?(19)|p.Y246fs*3(1)		lung(162)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|ovary(4)|stomach(3)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|breast(1)|oesophagus(1)|prostate(1)|kidney(1)	252		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)				14		1341	TSP Lung(3;<1E-8)			0.434783	31.446572	31.531878	10	13	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	1221229	1221229	15807	19	G	T	T	T	572	44	STK11	2	2
ZNF536	9745	broad.mit.edu	37	19	30936284	30936284	+	Silent	SNP	G	C	C			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:30936284G>C	uc002nsu.1	+	c.1815G>C	c.(1813-1815)CGG>CGC	p.R605R	ZNF536_uc010edd.1_Silent_p.R605R	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	605					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)	9	Esophageal squamous(110;0.0834)													0.300578	157.328267	163.476991	52	121	KEEP	---	---	---	---	capture		Silent	SNP	30936284	30936284	18568	19	G	C	C	C	548	43	ZNF536	3	3
THEG	51298	broad.mit.edu	37	19	362332	362332	+	Silent	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:362332G>A	uc002lol.2	-	c.1008C>T	c.(1006-1008)ATC>ATT	p.I336I	THEG_uc002lom.2_Silent_p.I312I	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1	336	THEG 6.				cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.397959	106.276742	107.176913	39	59	KEEP	---	---	---	---	capture		Silent	SNP	362332	362332	16385	19	G	A	A	A	577	45	THEG	2	2
ADAMTSL4	54507	broad.mit.edu	37	1	150529665	150529665	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:150529665G>A	uc009wlw.2	+	c.1970G>A	c.(1969-1971)CGC>CAC	p.R657H	ADAMTSL4_uc001euw.2_Missense_Mutation_p.R634H|ADAMTSL4_uc001eux.2_Missense_Mutation_p.R634H|ADAMTSL4_uc010pcg.1_Intron|ADAMTSL4_uc009wlx.2_5'Flank	NM_019032	NP_061905	Q6UY14	ATL4_HUMAN	thrombospondin repeat containing 1 isoform 1	634	Pro-rich.				apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding			ovary(1)	1	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)											0.192308	17.317891	21.920267	10	42	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	150529665	150529665	278	1	G	A	A	A	494	38	ADAMTSL4	1	1
LAMC1	3915	broad.mit.edu	37	1	183104244	183104244	+	Missense_Mutation	SNP	G	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:183104244G>T	uc001gpy.3	+	c.4067G>T	c.(4066-4068)GGA>GTA	p.G1356V		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	1356	Potential.|Domain II and I.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)									0.347826	40.744253	41.658328	16	30	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	183104244	183104244	8937	1	G	T	T	T	533	41	LAMC1	2	2
RYR2	6262	broad.mit.edu	37	1	237791246	237791246	+	Silent	SNP	G	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:237791246G>T	uc001hyl.1	+	c.6306G>T	c.(6304-6306)CTG>CTT	p.L2102L		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2102	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)											0.241379	33.840952	37.366491	14	44	KEEP	---	---	---	---	capture		Silent	SNP	237791246	237791246	14249	1	G	T	T	T	587	46	RYR2	2	2
KANK4	163782	broad.mit.edu	37	1	62739326	62739326	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:62739326C>T	uc001dah.3	-	c.1450G>A	c.(1450-1452)GAG>AAG	p.E484K	KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	484										ovary(3)|lung(1)	4														0.470588	147.297037	147.373217	48	54	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	62739326	62739326	8283	1	C	T	T	T	403	31	KANK4	1	1
GGTLC1	92086	broad.mit.edu	37	20	23967157	23967157	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:23967157A>G	uc002wts.2	-	c.92T>C	c.(91-93)ATG>ACG	p.M31T	GGTLC1_uc002wtu.2_Missense_Mutation_p.M31T	NM_178312	NP_842564	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	31							gamma-glutamyltransferase activity			ovary(1)	1														0.088235	0.500356	6.328002	3	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	23967157	23967157	6633	20	A	G	G	G	104	8	GGTLC1	4	4
CDH26	60437	broad.mit.edu	37	20	58547105	58547105	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:58547105C>T	uc002ybe.2	+	c.320C>T	c.(319-321)TCT>TTT	p.S107F	CDH26_uc010zzy.1_Non-coding_Transcript	NM_177980	NP_817089	Q8IXH8	CAD26_HUMAN	cadherin-like 26 isoform a	107	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|central_nervous_system(1)	4	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)											0.266187	103.708936	110.575744	37	102	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	58547105	58547105	3239	20	C	T	T	T	416	32	CDH26	2	2
SON	6651	broad.mit.edu	37	21	34927023	34927023	+	Missense_Mutation	SNP	C	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:34927023C>A	uc002yse.1	+	c.5486C>A	c.(5485-5487)TCC>TAC	p.S1829Y	SON_uc002ysb.1_Missense_Mutation_p.S1829Y|SON_uc002ysc.2_Missense_Mutation_p.S1829Y|SON_uc002ysd.2_Missense_Mutation_p.S820Y|SON_uc002ysf.1_Intron|SON_uc002ysg.2_Missense_Mutation_p.S820Y	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	1829					anti-apoptosis	nuclear speck	DNA binding|double-stranded RNA binding			ovary(3)	3														0.404494	101.877191	102.58824	36	53	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	34927023	34927023	15426	21	C	A	A	A	390	30	SON	2	2
MYO18B	84700	broad.mit.edu	37	22	26351204	26351204	+	Silent	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:26351204G>A	uc003abz.1	+	c.6030G>A	c.(6028-6030)GCG>GCA	p.A2010A	MYO18B_uc003aca.1_Silent_p.A1891A|MYO18B_uc010guy.1_Silent_p.A1892A|MYO18B_uc010guz.1_Silent_p.A1890A|MYO18B_uc011aka.1_Silent_p.A1164A|MYO18B_uc011akb.1_Silent_p.A1523A|MYO18B_uc010gva.1_Silent_p.A8A	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2010	Tail.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12									p.A2010A(2313287-Tumor)	968				0.3125	13.876903	14.373453	5	11	KEEP	---	---	---	---	capture		Silent	SNP	26351204	26351204	10461	22	G	A	A	A	496	39	MYO18B	1	1
SCO2	9997	broad.mit.edu	37	22	50962600	50962600	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:50962600C>T	uc003bma.2	-	c.241G>A	c.(241-243)GAG>AAG	p.E81K	SCO2_uc003blz.3_Missense_Mutation_p.E81K	NM_005138	NP_005129	O43819	SCO2_HUMAN	cytochrome oxidase deficient homolog 2	81					cell redox homeostasis|cellular copper ion homeostasis|copper ion transport|oxidation-reduction process|respiratory chain complex IV assembly	mitochondrial inner membrane	copper ion binding				0		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)										0.367347	48.80688	49.576048	18	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	50962600	50962600	14414	22	C	T	T	T	377	29	SCO2	2	2
AAMP	14	broad.mit.edu	37	2	219132260	219132260	+	Silent	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:219132260G>A	uc002vhl.2	-	c.354C>T	c.(352-354)TTC>TTT	p.F118F	PNKD_uc002vhn.2_5'Flank|AAMP_uc002vhj.2_Silent_p.F98F|AAMP_uc002vhk.2_Silent_p.F117F|AAMP_uc010fvo.2_Silent_p.F117F|PNKD_uc002vhm.1_5'Flank	NM_001087	NP_001078	Q13685	AAMP_HUMAN	angio-associated, migratory cell protein	117	WD 1.				angiogenesis|cell differentiation|positive regulation of endothelial cell migration|smooth muscle cell migration	cell surface|cytoplasm|plasma membrane	heparin binding			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.27551	68.687129	73.131853	27	71	KEEP	---	---	---	---	capture		Silent	SNP	219132260	219132260	18	2	G	A	A	A	477	37	AAMP	1	1
NRXN1	9378	broad.mit.edu	37	2	50282123	50282123	+	Nonsense_Mutation	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:50282123G>A	uc010fbq.2	-	c.3898C>T	c.(3898-3900)CGA>TGA	p.R1300*	NRXN1_uc010fbp.2_Intron|NRXN1_uc002rxb.3_Nonsense_Mutation_p.R932*|NRXN1_uc002rxe.3_Intron	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	205	Extracellular (Potential).|Laminin G-like.				neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)											0.5	28.774899	28.774899	9	9	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	50282123	50282123	11070	2	G	A	A	A	480	37	NRXN1	5	1
HTR3C	170572	broad.mit.edu	37	3	183773963	183773963	+	Splice_Site_SNP	SNP	A	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:183773963A>T	uc003fmk.2	+	c.280_splice	c.e4-2	p.V94_splice		NM_130770	NP_570126			5-hydroxytryptamine receptor 3 subunit C							integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)											0.45679	124.670684	124.801891	37	44	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	183773963	183773963	7746	3	A	T	T	T	91	7	HTR3C	5	3
TRIM71	131405	broad.mit.edu	37	3	32932170	32932170	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:32932170G>A	uc003cff.2	+	c.1474G>A	c.(1474-1476)GAT>AAT	p.D492N		NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71	492	Filamin.				multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3														0.3375	70.401283	72.26915	27	53	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32932170	32932170	17093	3	G	A	A	A	481	37	TRIM71	1	1
CTNNB1	1499	broad.mit.edu	37	3	41266113	41266113	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:41266113C>T	uc010hia.1	+	c.110C>T	c.(109-111)TCT>TTT	p.S37F	CTNNB1_uc003ckp.2_Missense_Mutation_p.S37F|CTNNB1_uc003ckq.2_Missense_Mutation_p.S37F|CTNNB1_uc003ckr.2_Missense_Mutation_p.S37F|CTNNB1_uc011azf.1_Missense_Mutation_p.S30F|CTNNB1_uc011azg.1_Intron	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	37			S -> C (in PTR, hepatoblastoma and ovarian cancer).|SG -> W (in hepatocellular carcinoma).|S -> F (in PTR).|S -> A (in MDB and hepatocellular carcinoma; enhances transactivation of target genes).|S -> Y (in hepatocellular carcinoma).		adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|patterning of blood vessels|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|promoter binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription repressor activity	p.S37F(145)|p.S37C(122)|p.A5_A80del(74)|p.S37Y(23)|p.H24_S47del(18)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.W25_I140del(5)|p.V22_L139>V(4)|p.V22_G38del(3)|p.A5_Q72del(2)|p.A20_Q143del(2)|p.T3_A126del(2)|p.A5_R90del(2)|p.E9_S47del(2)|p.M8_G50del(2)|p.A5fs*7(2)|p.D6_A43del(2)|p.A5_D144>D(2)|p.V22_G80>NNNNN(2)|p.A5_T42del(2)|p.D6_K133del(2)|p.M5_N141>D(2)|p.W25_A80del(2)|p.?(2)|p.D17_P128del(2)|p.A20_R151del(2)|p.E9_A80del(2)|p.K19_Y142>V(2)|p.D17_A126del(2)|p.W25_H36del(2)|p.A20_L148del(2)|p.V22_A80del(2)|p.L7_I140del(2)|p.E9_I140del(2)|p.A20_Q72del(2)|p.D6_I140del(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Q28_I140del(2)|p.M1_T42del(2)|p.S23_I140del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.D32_S47del(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.S37P(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S23_S33del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.G34_S37del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.S37_G38>W(1)|p.Y30_A80del(1)		liver(787)|soft_tissue(609)|large_intestine(228)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(127)|ovary(101)|skin(97)|pancreas(91)|pituitary(81)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|adrenal_gland(49)|biliary_tract(41)|lung(33)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|salivary_gland(2)|eye(1)	3016				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	Colon(6;3 56 14213 18255)	S37F(HUTU80_SMALL_INTESTINE)|S37C(SNU398_LIVER)|S37C(JHUEM2_ENDOMETRIUM)	15	p.S37C(SNU398-Tumor)|p.S37C(JHUEM2-Tumor)	237				0.326087	46.309515	47.543602	15	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	41266113	41266113	4175	3	C	T	T	T	416	32	CTNNB1	2	2
SEMA3F	6405	broad.mit.edu	37	3	50211518	50211518	+	Nonsense_Mutation	SNP	G	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:50211518G>T	uc003cyj.2	+	c.307G>T	c.(307-309)GAA>TAA	p.E103*	SEMA3F_uc003cyk.2_Nonsense_Mutation_p.E103*	NM_004186	NP_004177	Q13275	SEM3F_HUMAN	semaphorin 3F precursor	103	Sema.				axon guidance	extracellular space|membrane	chemorepellent activity|receptor activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)										0.283582	44.065199	46.843647	19	48	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	50211518	50211518	14515	3	G	T	T	T	533	41	SEMA3F	5	2
TLR3	7098	broad.mit.edu	37	4	187003653	187003653	+	Silent	SNP	A	G	G			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:187003653A>G	uc003iyq.2	+	c.813A>G	c.(811-813)CTA>CTG	p.L271L	TLR3_uc011ckz.1_5'UTR|TLR3_uc003iyr.2_5'UTR	NM_003265	NP_003256	O15455	TLR3_HUMAN	toll-like receptor 3 precursor	271	Lumenal (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|defense response to bacterium|defense response to virus|detection of virus|hyperosmotic response|I-kappaB phosphorylation|inflammatory response|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of osteoclast differentiation|positive regulation of chemokine production|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of inflammatory response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of toll-like receptor signaling pathway|positive regulation of tumor necrosis factor production|toll-like receptor 3 signaling pathway	endoplasmic reticulum membrane|endosome membrane|integral to plasma membrane	double-stranded RNA binding|transmembrane receptor activity			ovary(2)	2		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)						155				0.362319	178.420746	180.719436	50	88	KEEP	---	---	---	---	capture		Silent	SNP	187003653	187003653	16482	4	A	G	G	G	158	13	TLR3	4	4
PDGFRB	5159	broad.mit.edu	37	5	149511607	149511607	+	Missense_Mutation	SNP	T	G	G			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:149511607T>G	uc003lro.2	-	c.1178A>C	c.(1177-1179)CAC>CCC	p.H393P	PDGFRB_uc010jhd.2_Missense_Mutation_p.H232P	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	393	Ig-like C2-type 4.|Extracellular (Potential).				cardiac myofibril assembly|cell chemotaxis|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(3)|large_intestine(1)|stomach(1)|breast(1)|ovary(1)	11		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)					880				0.285714	22.99639	24.145464	8	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	149511607	149511607	12083	5	T	G	G	G	767	59	PDGFRB	4	4
KIF4B	285643	broad.mit.edu	37	5	154396899	154396899	+	Silent	SNP	C	G	G			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:154396899C>G	uc010jih.1	+	c.3480C>G	c.(3478-3480)GTC>GTG	p.V1160V		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1160	Interaction with PRC1 (By similarity).|Globular (By similarity).				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)											0.314607	96.567754	99.289295	28	61	KEEP	---	---	---	---	capture		Silent	SNP	154396899	154396899	8615	5	C	G	G	G	405	32	KIF4B	3	3
RFPL4B	442247	broad.mit.edu	37	6	112671585	112671585	+	Missense_Mutation	SNP	T	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:112671585T>A	uc003pvx.1	+	c.675T>A	c.(673-675)AAT>AAA	p.N225K		NM_001013734	NP_001013756	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B	225	B30.2/SPRY.						zinc ion binding				0		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)										0.229358	63.221435	70.540091	25	84	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	112671585	112671585	13728	6	T	A	A	A	634	49	RFPL4B	3	3
AASS	10157	broad.mit.edu	37	7	121717989	121717989	+	Silent	SNP	C	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:121717989C>T	uc003vka.2	-	c.2565G>A	c.(2563-2565)ACG>ACA	p.T855T	AASS_uc011knu.1_Non-coding_Transcript|AASS_uc011knv.1_Non-coding_Transcript|AASS_uc003vkb.2_Silent_p.T855T|AASS_uc011knw.1_Silent_p.T343T	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor	855	Saccharopine dehydrogenase.				oxidation-reduction process|protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			ovary(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)									0.28022	410.324776	434.047984	153	393	KEEP	---	---	---	---	capture		Silent	SNP	121717989	121717989	25	7	C	T	T	T	392	31	AASS	1	1
HGF	3082	broad.mit.edu	37	7	81332027	81332027	+	Missense_Mutation	SNP	A	G	G			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:81332027A>G	uc003uhl.2	-	c.2057T>C	c.(2056-2058)ATG>ACG	p.M686T	HGF_uc003uhm.2_Missense_Mutation_p.M681T	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	686	Peptidase S1.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4										800				0.288462	87.916788	92.083708	30	74	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	81332027	81332027	7369	7	A	G	G	G	104	8	HGF	4	4
TRMT12	55039	broad.mit.edu	37	8	125464156	125464156	+	Nonsense_Mutation	SNP	G	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:125464156G>T	uc003yra.3	+	c.988G>T	c.(988-990)GGA>TGA	p.G330*		NM_017956	NP_060426	Q53H54	TYW2_HUMAN	homolog of yeast tRNA methyltransferase 12	330					tRNA processing		methyltransferase activity			upper_aerodigestive_tract(1)	1	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)											0.11	21.427143	51.513948	22	178	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	125464156	125464156	17114	8	G	T	T	T	611	47	TRMT12	5	2
TRMT12	55039	broad.mit.edu	37	8	125464490	125464490	+	Missense_Mutation	SNP	G	C	C			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:125464490G>C	uc003yra.3	+	c.1322G>C	c.(1321-1323)TGC>TCC	p.C441S		NM_017956	NP_060426	Q53H54	TYW2_HUMAN	homolog of yeast tRNA methyltransferase 12	441					tRNA processing		methyltransferase activity			upper_aerodigestive_tract(1)	1	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)											0.116279	24.026101	42.725994	15	114	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	125464490	125464490	17114	8	G	C	C	C	598	46	TRMT12	3	3
OC90	729330	broad.mit.edu	37	8	133051064	133051064	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:133051064C>T	uc003ytg.2	-	c.553G>A	c.(553-555)GAA>AAA	p.E185K	OC90_uc011lix.1_Missense_Mutation_p.E201K	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90	201					lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)											0.283333	136.245667	143.83713	51	129	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	133051064	133051064	11219	8	C	T	T	T	390	30	OC90	2	2
OC90	729330	broad.mit.edu	37	8	133051249	133051249	+	Silent	SNP	C	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:133051249C>T	uc003ytg.2	-	c.531G>A	c.(529-531)CAG>CAA	p.Q177Q	OC90_uc011lix.1_Silent_p.Q193Q	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90	193					lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)											0.222656	140.939009	159.049927	57	199	KEEP	---	---	---	---	capture		Silent	SNP	133051249	133051249	11219	8	C	T	T	T	415	32	OC90	2	2
OC90	729330	broad.mit.edu	37	8	133051317	133051317	+	Missense_Mutation	SNP	C	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:133051317C>T	uc003ytg.2	-	c.463G>A	c.(463-465)GAG>AAG	p.E155K	OC90_uc011lix.1_Missense_Mutation_p.E171K	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90	171	Phospholipase A2-like 1.				lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)											0.277457	137.520818	145.233476	48	125	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	133051317	133051317	11219	8	C	T	T	T	416	32	OC90	2	2
FLJ43860	389690	broad.mit.edu	37	8	142487879	142487879	+	Silent	SNP	C	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:142487879C>T	uc003ywi.2	-	c.1362G>A	c.(1360-1362)CTG>CTA	p.L454L	FLJ43860_uc011ljs.1_Non-coding_Transcript|FLJ43860_uc010meu.1_Non-coding_Transcript	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690	454							binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)											0.333333	43.381644	44.563652	16	32	KEEP	---	---	---	---	capture		Silent	SNP	142487879	142487879	6170	8	C	T	T	T	366	29	FLJ43860	2	2
CA8	767	broad.mit.edu	37	8	61178489	61178489	+	Missense_Mutation	SNP	T	C	C			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:61178489T>C	uc003xtz.1	-	c.412A>G	c.(412-414)ATG>GTG	p.M138V	CA8_uc003xua.1_Missense_Mutation_p.M138V|CA8_uc003xub.2_Missense_Mutation_p.M138V	NM_004056	NP_004047	P35219	CAH8_HUMAN	carbonic anhydrase VIII	138					one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)												0.257576	51.446731	54.959985	17	49	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	61178489	61178489	2639	8	T	C	C	C	663	51	CA8	4	4
FAM108B1	51104	broad.mit.edu	37	9	74481838	74481838	+	Silent	SNP	G	C	C			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:74481838G>C	uc004ail.2	-	c.732C>G	c.(730-732)CTC>CTG	p.L244L	FAM108B1_uc004aim.1_Silent_p.L244L	NM_016014	NP_057098	Q5VST6	F108B_HUMAN	family with sequence similarity 108, member B1	244					proteolysis	extracellular region	serine-type peptidase activity				0														0.304348	95.769796	98.909233	28	64	KEEP	---	---	---	---	capture		Silent	SNP	74481838	74481838	5589	9	G	C	C	C	470	37	FAM108B1	3	3
NRK	203447	broad.mit.edu	37	X	105190394	105190394	+	Missense_Mutation	SNP	G	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:105190394G>A	uc004emd.2	+	c.4291G>A	c.(4291-4293)GAT>AAT	p.D1431N	NRK_uc011msi.1_5'Flank	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1431	CNH.				protein phosphorylation		ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14										430				0.055556	-6.865092	8.116908	4	68	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	105190394	105190394	11060	23	G	A	A	A	429	33	NRK	2	2
ARHGEF6	9459	broad.mit.edu	37	X	135827450	135827450	+	Missense_Mutation	SNP	A	T	T			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:135827450A>T	uc004fab.2	-	c.391T>A	c.(391-393)TCT>ACT	p.S131T	ARHGEF6_uc011mwd.1_5'UTR|ARHGEF6_uc011mwe.1_5'UTR	NM_004840	NP_004831	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor 6	131					apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)													0.566929	431.604531	432.593067	144	110	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	135827450	135827450	925	23	A	T	T	T	117	9	ARHGEF6	3	3
SLITRK2	84631	broad.mit.edu	37	X	144904729	144904729	+	Silent	SNP	C	A	A			TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:144904729C>A	uc004fcd.2	+	c.786C>A	c.(784-786)CTC>CTA	p.L262L	SLITRK2_uc010nsp.2_Silent_p.L262L|SLITRK2_uc010nso.2_Silent_p.L262L|SLITRK2_uc011mwq.1_Silent_p.L262L|SLITRK2_uc011mwr.1_Silent_p.L262L|SLITRK2_uc011mws.1_Silent_p.L262L|SLITRK2_uc004fcg.2_Silent_p.L262L|SLITRK2_uc011mwt.1_Silent_p.L262L	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	262	Extracellular (Potential).|LRRCT 1.					integral to membrane				ovary(4)|pancreas(1)	5	Acute lymphoblastic leukemia(192;6.56e-05)													0.584906	186.850787	187.514866	62	44	KEEP	---	---	---	---	capture		Silent	SNP	144904729	144904729	15241	23	C	A	A	A	405	32	SLITRK2	2	2
KRT1	3848	broad.mit.edu	37	12	53069236	53069256	+	In_Frame_Del	DEL	TAGCTGCTACCTCCGGAGCCA	-	-	rs77846840;rs61226348		TCGA-05-4422-01	TCGA-05-4422-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:53069236_53069256delTAGCTGCTACCTCCGGAGCCA	uc001sau.1	-	c.1656_1676delTGGCTCCGGAGGTAGCAGCTA	c.(1654-1677)TATGGCTCCGGAGGTAGCAGCTAC>TAC	p.552_559YGSGGSSY>Y	KRT1_uc001sav.1_Splice_Site_Del_p.G556_splice	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	552_559	Gly/Ser-rich.|Tail.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)	1														0.36			4	7		---	---	---	---	capture_indel		In_Frame_Del	DEL	53069236	53069256	8762	12	TAGCTGCTACCTCCGGAGCCA	-	-	-	741	57	KRT1	5	5
