Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
HSPA12A	259217	broad.mit.edu	36	10	118429014	118429014	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:118429014G>A	uc001lct.1	-	c.1276C>T	c.(1276-1278)CGG>TGG	p.R426W	HSPA12A_uc001lcu.1_Missense_Mutation_p.R343W	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	426							ATP binding			ovary(1)	1														0.123457	10.191558	21.430672	10	71	GG		KEEP	---	---	---	---	capture		all cancers(201;0.0158)	Missense_Mutation	SNP	118429014	118429014	7703	10	G	A	A	38	38	HSPA12A	A	1	1
KCNQ1	3784	broad.mit.edu	36	11	2423200	2423200	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:2423200C>T	uc001lwn.1	+	c.296C>T	c.(295-297)CCG>CTG	p.P99L	KCNQ1_uc009ydo.1_Missense_Mutation_p.P99L	NM_000218	NP_000209	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like	99				TRRPVLARTHV -> METRGSRLTGG (in Ref. 6; AAC51781).	blood circulation|membrane depolarization|muscle contraction|regulation of heart contraction|sensory perception of sound	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			ovary(1)	1		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)			Bepridil(DB01244)|Indapamide(DB00808)									0.485714	50.079685	50.085507	17	18	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Missense_Mutation	SNP	2423200	2423200	8387	11	C	T	T	23	23	KCNQ1	T	1	1
PKP3	11187	broad.mit.edu	36	11	387331	387331	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:387331G>C	uc001lpc.1	+	c.830G>C	c.(829-831)CGA>CCA	p.R277P		NM_007183	NP_009114	Q9Y446	PKP3_HUMAN	plakophilin 3	277					cell adhesion	desmosome|nucleus	binding			skin(1)	1		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)												0.4	10.196521	10.284337	4	6	GG		KEEP	---	---	---	---	capture		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Missense_Mutation	SNP	387331	387331	12411	11	G	C	C	37	37	PKP3	C	3	3
TMEM132A	54972	broad.mit.edu	36	11	60460088	60460088	+	Silent	SNP	G	C	C			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:60460088G>C	uc001nqi.1	+	c.2208G>C	c.(2206-2208)GGG>GGC	p.G736G	TMEM132A_uc001nqj.1_Silent_p.G735G|TMEM132A_uc001nqm.1_5'UTR	NM_017870	NP_060340	Q24JP5	T132A_HUMAN	transmembrane protein 132A isoform a	735	Binds to HSPA5/GRP78 (By similarity).|Confers cellular localization similar to full-length form (By similarity).|Extracellular (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane					0														0.25	11.835173	13.201928	6	18	GG		KEEP	---	---	---	---	capture			Silent	SNP	60460088	60460088	16576	11	G	C	C	42	42	TMEM132A	C	3	3
TRPV4	59341	broad.mit.edu	36	12	108720815	108720815	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:108720815G>A	uc001tpj.1	-	c.1139C>T	c.(1138-1140)ACG>ATG	p.T380M	TRPV4_uc001tpg.1_Missense_Mutation_p.T346M|TRPV4_uc001tph.1_Missense_Mutation_p.T333M|TRPV4_uc001tpi.1_Missense_Mutation_p.T333M|TRPV4_uc001tpk.1_Missense_Mutation_p.T380M|TRPV4_uc001tpl.1_Missense_Mutation_p.T380M	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,	380	Cytoplasmic (Potential).|ANK 3.				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)	2														0.435294	102.150253	102.461996	37	48	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	108720815	108720815	17149	12	G	A	A	40	40	TRPV4	A	1	1
TAS2R13	50838	broad.mit.edu	36	12	10952754	10952754	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:10952754G>A	uc001qzg.1	-	c.411C>T	c.(409-411)ACC>ACT	p.T137T	PRR4_uc009zhp.1_Intron|PRH1_uc001qzb.2_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qze.2_Intron|PRB4_uc001qzf.1_Intron	NM_023920	NP_076409	Q9NYV9	T2R13_HUMAN	taste receptor, type 2, member 13	137	Helical; Name=4; (Potential).				sensory perception of taste	integral to membrane	taste receptor activity			breast(1)	1														0.428571	161.904102	162.43414	51	68	GG		KEEP	---	---	---	---	capture			Silent	SNP	10952754	10952754	16089	12	G	A	A	35	35	TAS2R13	A	2	2
HPD	3242	broad.mit.edu	36	12	120777064	120777064	+	Silent	SNP	G	A	A	rs61742674	unknown	TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:120777064G>A	uc001ubj.1	-	c.342C>T	c.(340-342)GGC>GGT	p.G114G	HPD_uc001ubk.1_Silent_p.G75G	NM_002150	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase	114					L-phenylalanine catabolic process|oxidation-reduction process|tyrosine catabolic process	cytosol	4-hydroxyphenylpyruvate dioxygenase activity|metal ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)				Nitisinone(DB00348)									0.412587	149.259345	150.221933	59	84	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Silent	SNP	120777064	120777064	7624	12	G	A	A	38	38	HPD	A	1	1
VWF	7450	broad.mit.edu	36	12	5993018	5993018	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:5993018C>T	uc001qnn.1	-	c.5510G>A	c.(5509-5511)CGG>CAG	p.R1837Q		NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1837	VWFA 3; main binding site for collagens type I and III.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			ovary(3)|pancreas(2)|breast(1)|central_nervous_system(1)	7					Antihemophilic Factor(DB00025)									0.359649	119.347855	121.323031	41	73	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5993018	5993018	17818	12	C	T	T	23	23	VWF	T	1	1
COL4A1	1282	broad.mit.edu	36	13	109693032	109693032	+	Silent	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:109693032C>T	uc001vqw.2	-	c.135G>A	c.(133-135)AAG>AAA	p.K45K	COL4A1_uc010agl.1_Silent_p.K45K	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	45					angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)												0.363043	509.13449	516.712168	167	293	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)		Silent	SNP	109693032	109693032	3827	13	C	T	T	24	24	COL4A1	T	2	2
KCNH5	27133	broad.mit.edu	36	14	62386218	62386218	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0157-01	TCGA-06-0157-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:62386218A>T	uc001xfx.1	-	c.1475T>A	c.(1474-1476)CTA>CAA	p.L492Q	KCNH5_uc001xfy.1_Missense_Mutation_p.L492Q|KCNH5_uc001xfz.1_Missense_Mutation_p.L434Q	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	492	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|central_nervous_system(1)	5														0.255682	108.992708	118.52201	45	131	AA		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)	Missense_Mutation	SNP	62386218	62386218	8340	14	A	T	T	15	15	KCNH5	T	4	4
WDR90	197335	broad.mit.edu	36	16	641987	641987	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:641987G>A	uc002cii.1	+	c.1000G>A	c.(1000-1002)GTG>ATG	p.V334M	WDR90_uc002cij.1_Non-coding_Transcript|WDR90_uc002cig.1_Missense_Mutation_p.V334M|WDR90_uc002cih.1_Missense_Mutation_p.V335M	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	334										ovary(1)	1		Hepatocellular(780;0.0218)												0.235294	8.991486	10.080964	4	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	641987	641987	17911	16	G	A	A	40	40	WDR90	A	1	1
SLC12A4	6560	broad.mit.edu	36	16	66541725	66541725	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:66541725G>A	uc002euz.1	-	c.1627C>T	c.(1627-1629)CGG>TGG	p.R543W	SLC12A4_uc002eva.1_Missense_Mutation_p.R543W|SLC12A4_uc010cev.1_5'Flank|SLC12A4_uc002evb.1_Non-coding_Transcript	NM_005072	NP_005063	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride	543					cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)			Bumetanide(DB00887)|Potassium Chloride(DB00761)									0.352941	86.453765	88.0617	30	55	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Missense_Mutation	SNP	66541725	66541725	14880	16	G	A	A	39	39	SLC12A4	A	1	1
RHBDL1	9028	broad.mit.edu	36	16	667081	667081	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:667081G>A	uc002cis.1	+	c.731G>A	c.(730-732)CGC>CAC	p.R244H	RHBDL1_uc002cir.1_Missense_Mutation_p.R179H	NM_003961	NP_003952	O75783	RHBL1_HUMAN	rhomboid, veinlet-like 1	244					signal transduction	integral to plasma membrane|membrane fraction	calcium ion binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.0218)												0.362745	96.438709	98.132763	37	65	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	667081	667081	13796	16	G	A	A	38	38	RHBDL1	A	1	1
CDH15	1013	broad.mit.edu	36	16	87788812	87788812	+	Silent	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:87788812C>T	uc002fmt.1	+	c.2193C>T	c.(2191-2193)TAC>TAT	p.Y731Y		NM_004933	NP_004924	P55291	CAD15_HUMAN	cadherin 15 preproprotein	731	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	calcium ion binding				0														0.5	40.139798	40.139798	14	14	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(80;0.0261)	Silent	SNP	87788812	87788812	3229	16	C	T	T	19	19	CDH15	T	1	1
DNAH9	1770	broad.mit.edu	36	17	11588860	11588860	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:11588860C>T	uc002gne.1	+	c.6133C>T	c.(6133-6135)CGG>TGG	p.R2045W	DNAH9_uc010coo.1_Missense_Mutation_p.R1339W	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2045	AAA 1 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	10		Breast(5;0.0122)|all_epithelial(5;0.131)												0.327103	88.882979	91.722825	35	72	CC		KEEP	---	---	---	---	capture		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	Missense_Mutation	SNP	11588860	11588860	4791	17	C	T	T	19	19	DNAH9	T	1	1
MNT	4335	broad.mit.edu	36	17	2237248	2237248	+	Silent	SNP	C	G	G			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:2237248C>G	uc002fur.1	-	c.1446G>C	c.(1444-1446)GCG>GCC	p.A482A		NM_020310	NP_064706	Q99583	MNT_HUMAN	MAX binding protein	482					multicellular organismal development|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|transcription regulator activity				0														0.266667	6.692207	7.432395	4	11	CC		KEEP	---	---	---	---	capture		Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)	Silent	SNP	2237248	2237248	10069	17	C	G	G	27	27	MNT	G	3	3
SNX11	29916	broad.mit.edu	36	17	43553837	43553837	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:43553837C>A	uc002inf.1	+	c.781C>A	c.(781-783)CCT>ACT	p.P261T	SNX11_uc002ing.1_Missense_Mutation_p.P261T|SNX11_uc002inh.1_Missense_Mutation_p.P261T	NM_152244	NP_689450	Q9Y5W9	SNX11_HUMAN	sorting nexin 11	261					cell communication|protein transport	membrane	phosphatidylinositol binding				0														0.348432	264.327081	270.139218	100	187	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43553837	43553837	15382	17	C	A	A	22	22	SNX11	A	3	3
UTS2R	2837	broad.mit.edu	36	17	77925505	77925505	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:77925505G>A	uc002ker.1	+	c.16G>A	c.(16-18)GAG>AAG	p.E6K		NM_018949	NP_061822	Q9UKP6	UR2R_HUMAN	urotensin 2 receptor	6	Extracellular (Potential).					integral to membrane|plasma membrane				breast(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)													0.333333	10.997733	11.292074	4	8	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)		Missense_Mutation	SNP	77925505	77925505	17671	17	G	A	A	37	37	UTS2R	A	1	1
LAMA1	284217	broad.mit.edu	36	18	7013335	7013335	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:7013335G>A	uc002knm.1	-	c.2529C>T	c.(2527-2529)GGC>GGT	p.G843G		NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	843	Laminin EGF-like 7.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|breast(2)|pancreas(2)|central_nervous_system(1)	17		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)					1597				0.5	141.194083	141.194083	48	48	GG		KEEP	---	---	---	---	capture			Silent	SNP	7013335	7013335	8928	18	G	A	A	38	38	LAMA1	A	1	1
PIP5K1C	23396	broad.mit.edu	36	19	3612952	3612952	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:3612952G>T	uc002lyj.1	-	c.267C>A	c.(265-267)TAC>TAA	p.Y89*		NM_012398	NP_036530	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	89	PIPK.				axon guidance	cytosol|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding				0		Hepatocellular(1079;0.137)				Esophageal Squamous(135;99 1744 12852 27186 39851)				246				0.333333	7.550356	7.929548	5	10	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)	Nonsense_Mutation	SNP	3612952	3612952	12365	19	G	T	T	48	48	PIP5K1C	T	5	3
ZFP82	284406	broad.mit.edu	36	19	41576289	41576289	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:41576289C>T	uc002ody.1	-	c.793G>A	c.(793-795)GTA>ATA	p.V265I		NM_133466	NP_597723	Q8N141	ZFP82_HUMAN	zinc finger protein 82 homolog	265	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1														0.442308	610.350012	611.709159	207	261	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41576289	41576289	18242	19	C	T	T	18	18	ZFP82	T	2	2
MYH14	79784	broad.mit.edu	36	19	55420672	55420672	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:55420672C>G	uc010enu.1	+	c.736C>G	c.(736-738)CTG>GTG	p.L246V	MYH14_uc002prq.1_Missense_Mutation_p.L246V|MYH14_uc002prr.1_Missense_Mutation_p.L238V	NM_001077186	NP_001070654	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 1	238	Myosin head-like.				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)												0.444444	9.597598	9.621778	4	5	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)	Missense_Mutation	SNP	55420672	55420672	10428	19	C	G	G	28	28	MYH14	G	3	3
ZNF419	79744	broad.mit.edu	36	19	62696796	62696796	+	Silent	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:62696796C>T	uc010ety.1	+	c.1062C>T	c.(1060-1062)AGC>AGT	p.S354S	ZNF419_uc002qov.2_Silent_p.S353S|ZNF419_uc010etz.1_Silent_p.S341S|ZNF419_uc010eua.1_Silent_p.S340S|ZNF419_uc002qow.2_Silent_p.S321S|ZNF419_uc010eub.1_Silent_p.S308S|ZNF419_uc010euc.1_Silent_p.S307S	NM_001098491	NP_001091961	Q96HQ0	ZN419_HUMAN	zinc finger protein 419 isoform 1	353	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)												0.281915	134.789193	142.827682	53	135	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)	Silent	SNP	62696796	62696796	18489	19	C	T	T	26	26	ZNF419	T	2	2
MUC16	94025	broad.mit.edu	36	19	8924659	8924659	+	Silent	SNP	A	T	T			TCGA-06-0157-01	TCGA-06-0157-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:8924659A>T	uc002mkp.1	-	c.23787T>A	c.(23785-23787)TCT>TCA	p.S7929S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	7931	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			ovary(15)|large_intestine(1)|pancreas(1)|breast(1)|skin(1)	19														0.41358	190.293293	191.349981	67	95	AA		KEEP	---	---	---	---	capture			Silent	SNP	8924659	8924659	10367	19	A	T	T	3	3	MUC16	T	4	4
FCRL3	115352	broad.mit.edu	36	1	155932708	155932708	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:155932708C>T	uc001fqz.2	-	c.878G>A	c.(877-879)CGG>CAG	p.R293Q	FCRL3_uc001fqx.2_Non-coding_Transcript|FCRL3_uc001fqy.2_Non-coding_Transcript|FCRL3_uc009wsn.1_Non-coding_Transcript|FCRL3_uc009wso.1_Non-coding_Transcript|FCRL3_uc001fra.1_Missense_Mutation_p.R19Q|FCRL3_uc001frb.1_Missense_Mutation_p.R293Q|FCRL3_uc001frc.1_Missense_Mutation_p.R293Q	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	293	Ig-like C2-type 4.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)													0.389744	217.752448	219.829546	76	119	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	155932708	155932708	6033	1	C	T	T	23	23	FCRL3	T	1	1
SPTA1	6708	broad.mit.edu	36	1	156851795	156851795	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:156851795G>A	uc001fst.1	-	c.6623C>T	c.(6622-6624)GCG>GTG	p.A2208V		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2208	Spectrin 21.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|breast(1)	5	all_hematologic(112;0.0378)													0.370213	226.143645	229.629493	87	148	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	156851795	156851795	15630	1	G	A	A	38	38	SPTA1	A	1	1
SERPINC1	462	broad.mit.edu	36	1	172145347	172145347	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:172145347G>A	uc001gjt.1	-	c.1119C>T	c.(1117-1119)GTC>GTT	p.V373V		NM_000488	NP_000479	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C, member 1	373					blood coagulation|regulation of proteolysis	extracellular space|plasma membrane	heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(1)	1					Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)									0.418182	194.94487	195.908649	69	96	GG		KEEP	---	---	---	---	capture			Silent	SNP	172145347	172145347	14597	1	G	A	A	37	37	SERPINC1	A	1	1
SYT2	127833	broad.mit.edu	36	1	200832695	200832695	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:200832695G>A	uc001gyd.1	-	c.1073C>T	c.(1072-1074)ACC>ATC	p.T358I	SYT2_uc009xaf.1_Missense_Mutation_p.T188I|SYT2_uc001gye.1_Missense_Mutation_p.T358I	NM_177402	NP_796376	Q8N9I0	SYT2_HUMAN	synaptotagmin II	358	Phospholipid binding (By similarity).|C2 2.|Cytoplasmic (Potential).				neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)	2					Botulinum Toxin Type B(DB00042)									0.436364	135.072333	135.462302	48	62	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(75;0.169)		Missense_Mutation	SNP	200832695	200832695	15995	1	G	A	A	44	44	SYT2	A	2	2
HSD11B1	3290	broad.mit.edu	36	1	207974364	207974364	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:207974364C>T	uc001hhj.1	+	c.754C>T	c.(754-756)CGC>TGC	p.R252C	HSD11B1_uc001hhk.1_Missense_Mutation_p.R252C	NM_181755	NP_861420	P28845	DHI1_HUMAN	11-beta-hydroxysteroid dehydrogenase 1	252	Lumenal (Potential).				glucocorticoid biosynthetic process|oxidation-reduction process	endoplasmic reticulum membrane|integral to membrane	11-beta-hydroxysteroid dehydrogenase (NADP+) activity|binding			breast(1)	1					NADH(DB00157)									0.407407	118.770781	119.581768	44	64	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(81;1.04e-55)|Epithelial(68;1.57e-52)|all cancers(67;1.83e-46)|Colorectal(1306;0.115)	Missense_Mutation	SNP	207974364	207974364	7670	1	C	T	T	27	27	HSD11B1	T	1	1
RYR2	6262	broad.mit.edu	36	1	235844249	235844249	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:235844249C>T	uc001hyl.1	+	c.5198C>T	c.(5197-5199)ACG>ATG	p.T1733M		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1733	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)												0.357143	54.182145	55.189699	20	36	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		Missense_Mutation	SNP	235844249	235844249	14249	1	C	T	T	19	19	RYR2	T	1	1
AHDC1	27245	broad.mit.edu	36	1	27746690	27746690	+	Silent	SNP	T	G	G			TCGA-06-0157-01	TCGA-06-0157-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:27746690T>G	uc009vsy.1	-	c.4524A>C	c.(4522-4524)CCA>CCC	p.P1508P	AHDC1_uc009vsz.1_Silent_p.P1508P|AHDC1_uc009vta.1_Silent_p.P1508P	NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1508							DNA binding			central_nervous_system(1)	1		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)												0.307692	6.383098	6.819262	4	9	TT		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)	Silent	SNP	27746690	27746690	415	1	T	G	G	59	59	AHDC1	G	4	4
SERINC2	347735	broad.mit.edu	36	1	31678427	31678427	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0157-01	TCGA-06-0157-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:31678427T>G	uc001bst.1	+	c.1040T>G	c.(1039-1041)GTG>GGG	p.V347G	SERINC2_uc001bsu.1_Missense_Mutation_p.V292G|SERINC2_uc001bsv.1_Missense_Mutation_p.V292G	NM_178865	NP_849196	Q96SA4	SERC2_HUMAN	tumor differentially expressed 2-like	347						integral to membrane					0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)												0.30303	7.231194	8.578742	10	23	TT		KEEP	---	---	---	---	capture		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)	Missense_Mutation	SNP	31678427	31678427	14568	1	T	G	G	59	59	SERINC2	G	4	4
TMEM90B	79953	broad.mit.edu	36	20	24513630	24513630	+	Splice_Site_SNP	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:24513630G>A	uc002wtw.1	+	c.618_splice	c.e3+1	p.E206_splice		NM_024893	NP_079169			hypothetical protein LOC79953						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane				lung(1)	1														0.473251	340.702457	340.853928	115	128	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	24513630	24513630	16759	20	G	A	A	44	44	TMEM90B	A	5	2
C20orf27	54976	broad.mit.edu	36	20	3683070	3683070	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:3683070C>T	uc002wjh.1	-	c.473G>A	c.(472-474)CGC>CAC	p.R158H	C20orf27_uc002wjf.1_3'UTR|C20orf27_uc002wji.1_Missense_Mutation_p.R133H	NM_001039140	NP_001034229	Q9GZN8	CT027_HUMAN	hypothetical protein LOC54976	133											0														0.438053	277.395905	278.15012	99	127	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3683070	3683070	2187	20	C	T	T	27	27	C20orf27	T	1	1
PTK6	5753	broad.mit.edu	36	20	61639088	61639088	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:61639088G>T	uc002yfg.1	-	c.24C>A	c.(22-24)CAC>CAA	p.H8Q		NM_005975	NP_005966	Q13882	PTK6_HUMAN	PTK6 protein tyrosine kinase 6	8					protein phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			kidney(1)	1	all_cancers(38;2.51e-11)									575				0.363636	23.894231	24.254075	8	14	GG		KEEP	---	---	---	---	capture	Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)		Missense_Mutation	SNP	61639088	61639088	13219	20	G	T	T	44	44	PTK6	T	3	3
HAO1	54363	broad.mit.edu	36	20	7812254	7812254	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:7812254C>T	uc002wmw.1	-	c.1099G>A	c.(1099-1101)GTT>ATT	p.V367I		NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1	367					cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3														0.329032	134.906144	138.905803	51	104	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7812254	7812254	7233	20	C	T	T	19	19	HAO1	T	1	1
KRTAP13-2	337959	broad.mit.edu	36	21	30666160	30666160	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:30666160G>A	uc002ynz.2	-	c.243C>T	c.(241-243)TAC>TAT	p.Y81Y		NM_181621	NP_853652	Q52LG2	KR132_HUMAN	keratin associated protein 13-2	81	4.|5 X 10 AA approximate repeats.					intermediate filament					0														0.344828	109.561232	112.029547	40	76	GG		KEEP	---	---	---	---	capture			Silent	SNP	30666160	30666160	8838	21	G	A	A	44	44	KRTAP13-2	A	2	2
TBR1	10716	broad.mit.edu	36	2	161988250	161988250	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0157-01	TCGA-06-0157-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:161988250A>G	uc002ubw.1	+	c.1315A>G	c.(1315-1317)AAC>GAC	p.N439D	TBR1_uc010foy.1_Missense_Mutation_p.N152D	NM_006593	NP_006584	Q16650	TBR1_HUMAN	T-box, brain, 1	439						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1														0.3125	28.451656	29.445997	10	22	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	161988250	161988250	16173	2	A	G	G	5	5	TBR1	G	4	4
TTN	7273	broad.mit.edu	36	2	179250878	179250878	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179250878G>A	uc002umr.1	-	c.30274C>T	c.(30274-30276)CGT>TGT	p.R10092C	TTN_uc002ums.1_Intron|TTN_uc010frc.1_Intron|TTN_uc010frd.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R6753C|TTN_uc010fre.1_Intron|TTN_uc002una.1_Non-coding_Transcript|TTN_uc010frf.1_Non-coding_Transcript	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11019										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153										8722				0.121951	15.631886	32.859603	15	108	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		Missense_Mutation	SNP	179250878	179250878	17290	2	G	A	A	40	40	TTN	A	1	1
PDE1A	5136	broad.mit.edu	36	2	182762011	182762011	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:182762011C>T	uc002uoq.1	-	c.1195G>A	c.(1195-1197)GGG>AGG	p.G399R	PDE1A_uc002uor.1_Missense_Mutation_p.G383R|PDE1A_uc002uos.1_Missense_Mutation_p.G399R	NM_005019	NP_005010	P54750	PDE1A_HUMAN	phosphodiesterase 1A, calmodulin-dependent	399	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(1)	1														0.424028	383.250147	384.67639	120	163	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.061)		Missense_Mutation	SNP	182762011	182762011	12054	2	C	T	T	24	24	PDE1A	T	2	2
FRZB	2487	broad.mit.edu	36	2	183439434	183439434	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:183439434C>G	uc002upa.1	-	c.92G>C	c.(91-93)CGG>CCG	p.R31P		NM_001463	NP_001454	Q92765	SFRP3_HUMAN	frizzled-related protein	31					brain development|cochlea morphogenesis|gonad development|mammary gland involution|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cartilage development|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of hepatocyte differentiation|positive regulation of apoptosis|positive regulation of fat cell differentiation|regulation of gene-specific transcription from RNA polymerase II promoter|skeletal system development|vasculature development|Wnt receptor signaling pathway	cytoplasm|extracellular space|membrane	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|central_nervous_system(1)	3														0.363636	7.473987	7.662538	4	7	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)		Missense_Mutation	SNP	183439434	183439434	6315	2	C	G	G	23	23	FRZB	G	3	3
SNRNP200	23020	broad.mit.edu	36	2	96327865	96327865	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:96327865C>T	uc002svu.1	-	c.1003G>A	c.(1003-1005)GCC>ACC	p.A335T		NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	335					cis assembly of pre-catalytic spliceosome|response to stimulus|visual perception	catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|large_intestine(1)|skin(1)	7														0.367816	90.47489	91.812018	32	55	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	96327865	96327865	15352	2	C	T	T	26	26	SNRNP200	T	2	2
ABCE1	6059	broad.mit.edu	36	4	146250724	146250724	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0157-01	TCGA-06-0157-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:146250724A>G	uc003ijx.1	+	c.425A>G	c.(424-426)GAG>GGG	p.E142G	ABCE1_uc003ijy.1_Missense_Mutation_p.E142G|ABCE1_uc010iot.1_Non-coding_Transcript	NM_001040876	NP_002931	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E, member 1	142	ABC transporter 1.				interspecies interaction between organisms|response to virus|RNA catabolic process	mitochondrion	ATP binding|ATPase activity|electron carrier activity|iron-sulfur cluster binding|ribonuclease inhibitor activity				0	all_hematologic(180;0.151)													0.206897	6.491247	11.50357	12	46	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	146250724	146250724	65	4	A	G	G	11	11	ABCE1	G	4	4
UGT2B4	7363	broad.mit.edu	36	4	70395692	70395692	+	Silent	SNP	C	G	G			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:70395692C>G	uc003hek.2	-	c.477G>C	c.(475-477)CTG>CTC	p.L159L	UGT2B4_uc003hel.2_Silent_p.L159L	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family,	159					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity				0														0.357143	67.984734	68.991317	20	36	CC		KEEP	---	---	---	---	capture			Silent	SNP	70395692	70395692	17519	4	C	G	G	25	25	UGT2B4	G	3	3
BMP3	651	broad.mit.edu	36	4	82171501	82171501	+	Silent	SNP	C	G	G			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:82171501C>G	uc003hmg.2	+	c.39C>G	c.(37-39)GGC>GGG	p.G13G		NM_001201	NP_001192	P12645	BMP3_HUMAN	bone morphogenetic protein 3 preproprotein	13					cartilage development|cell differentiation|cell-cell signaling|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(4)|central_nervous_system(1)	5														0.222222	8.02288	9.278431	4	14	CC		KEEP	---	---	---	---	capture			Silent	SNP	82171501	82171501	1486	4	C	G	G	28	28	BMP3	G	3	3
TARS	6897	broad.mit.edu	36	5	33497133	33497133	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:33497133C>G	uc003jhy.1	+	c.1527C>G	c.(1525-1527)ATC>ATG	p.I509M	TARS_uc010iup.1_Missense_Mutation_p.I450M|TARS_uc003jhz.1_Missense_Mutation_p.I405M	NM_152295	NP_689508	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	509					threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity			ovary(2)	2					L-Threonine(DB00156)									0.463277	301.543012	301.750102	82	95	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33497133	33497133	16081	5	C	G	G	31	31	TARS	G	3	3
IRX1	79192	broad.mit.edu	36	5	3654124	3654124	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:3654124G>A	uc003jde.1	+	c.1413G>A	c.(1411-1413)CCG>CCA	p.P471P		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	471					regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity			ovary(1)|pancreas(1)	2														0.384615	109.969916	111.185481	40	64	GG		KEEP	---	---	---	---	capture			Silent	SNP	3654124	3654124	8147	5	G	A	A	38	38	IRX1	A	1	1
RPS12	6206	broad.mit.edu	36	6	133179396	133179396	+	Splice_Site_SNP	SNP	G	T	T			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:133179396G>T	uc003qdx.1	+	c.234_splice	c.e4+1	p.K78_splice	RPS12_uc003qdy.1_3'UTR	NM_001016	NP_001007			ribosomal protein S12						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	structural constituent of ribosome				0	Breast(56;0.214)													0.424242	129.836243	130.331317	42	57	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(155;0.00284)|GBM - Glioblastoma multiforme(226;0.0256)	Splice_Site_SNP	SNP	133179396	133179396	14101	6	G	T	T	44	44	RPS12	T	5	3
CAMK2B	816	broad.mit.edu	36	7	44234969	44234969	+	Silent	SNP	C	G	G			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:44234969C>G	uc003tkq.1	-	c.1419G>C	c.(1417-1419)GGG>GGC	p.G473G	CAMK2B_uc010kyc.1_Intron|CAMK2B_uc003tkp.1_Intron|CAMK2B_uc003tkx.1_Intron|CAMK2B_uc010kyd.1_Intron|CAMK2B_uc003tkr.1_Intron|CAMK2B_uc003tks.1_Intron|CAMK2B_uc003tkt.1_Intron|CAMK2B_uc003tku.1_Intron|CAMK2B_uc003tkv.1_Intron|CAMK2B_uc003tkw.1_Intron	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II	473					interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2										200				0.416667	7.138036	7.214554	5	7	CC		KEEP	---	---	---	---	capture			Silent	SNP	44234969	44234969	2717	7	C	G	G	26	26	CAMK2B	G	3	3
RADIL	55698	broad.mit.edu	36	7	4828640	4828640	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:4828640C>T	uc003snj.1	-	c.1526G>A	c.(1525-1527)TGG>TAG	p.W509*	RADIL_uc003sng.1_Non-coding_Transcript|RADIL_uc003sni.1_Nonsense_Mutation_p.W14*	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor	509	Dilute.				cell adhesion|multicellular organismal development|signal transduction		protein binding	p.W509*(1)		central_nervous_system(2)|pancreas(2)|breast(1)	5		Ovarian(82;0.0175)												0.267241	85.46934	91.147062	31	85	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)	Nonsense_Mutation	SNP	4828640	4828640	13457	7	C	T	T	21	21	RADIL	T	5	2
EGFR	1956	broad.mit.edu	36	7	55189316	55189316	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:55189316C>T	uc003tqk.1	+	c.866C>T	c.(865-867)GCC>GTC	p.A289V	EGFR_uc003tqh.1_Missense_Mutation_p.A289V|EGFR_uc003tqi.1_Missense_Mutation_p.A289V|EGFR_uc003tqj.1_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(10)|p.A289D(3)		lung(8200)|central_nervous_system(103)|upper_aerodigestive_tract(37)|prostate(32)|ovary(31)|thyroid(23)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|stomach(6)|urinary_tract(6)|skin(5)|adrenal_gland(5)|kidney(4)|soft_tissue(4)|bone(3)|NS(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)|pancreas(1)	8515	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)				Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)			8	p.A289V(HEC6-Tumor)|p.A289D(HS683-Tumor)|p.A289V(RL952-Tumor)	608	TCGA GBM(3;<1E-8)|TSP Lung(4;<1E-8)			0.917098	2896.508584	3067.233794	885	80	CC		KEEP	---	---	---	---	capture	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Missense_Mutation	SNP	55189316	55189316	5156	7	C	T	T	26	26	EGFR	T	2	2
PCLO	27445	broad.mit.edu	36	7	82622709	82622709	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:82622709G>A	uc003uhx.2	-	c.1184C>T	c.(1183-1185)CCT>CTT	p.P395L	PCLO_uc003uhv.2_Missense_Mutation_p.P395L	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	346	Gln-rich.|Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity|zinc ion binding			ovary(7)	7														0.264	174.376557	187.017945	66	184	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	82622709	82622709	12003	7	G	A	A	35	35	PCLO	A	2	2
GATA4	2626	broad.mit.edu	36	8	11645041	11645041	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:11645041C>T	uc003wuc.2	+	c.796C>T	c.(796-798)CGA>TGA	p.R266*	GATA4_uc003wub.1_Nonsense_Mutation_p.R60*	NM_002052	NP_002043	P43694	GATA4_HUMAN	GATA binding protein 4	266					atrial septum primum morphogenesis|blood coagulation|cardiac right ventricle morphogenesis|cell-cell signaling|embryonic foregut morphogenesis|embryonic heart tube anterior/posterior pattern formation|endocardial cushion development|heart looping|intestinal epithelial cell differentiation|male gonad development|positive regulation of angiogenesis|positive regulation of cardioblast differentiation|positive regulation of gene-specific transcription|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|transcription from RNA polymerase II promoter|ventricular septum development	nucleoplasm	activating transcription factor binding|promoter binding|specific RNA polymerase II transcription factor activity|zinc ion binding			central_nervous_system(1)	1	all_epithelial(15;0.0839)													0.382353	80.334909	81.159949	26	42	CC		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)	Nonsense_Mutation	SNP	11645041	11645041	6520	8	C	T	T	23	23	GATA4	T	5	1
SLC18A1	6570	broad.mit.edu	36	8	20066744	20066744	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0157-01	TCGA-06-0157-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr8:20066744A>T	uc003wzm.1	-	c.931T>A	c.(931-933)TTT>ATT	p.F311I	SLC18A1_uc003wzl.1_Missense_Mutation_p.F98I|SLC18A1_uc010ltf.1_Non-coding_Transcript|SLC18A1_uc003wzn.1_Intron|SLC18A1_uc003wzo.1_Intron	NM_003053	NP_003044	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine),	311	Helical; (Potential).				neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2														0.453704	135.242681	135.44601	49	59	AA		KEEP	---	---	---	---	capture		Colorectal(74;0.0747)	Missense_Mutation	SNP	20066744	20066744	14921	8	A	T	T	3	3	SLC18A1	T	4	4
AQP7	364	broad.mit.edu	36	9	33375701	33375701	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0157-01	TCGA-06-0157-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:33375701T>C	uc003zst.1	-	c.689A>G	c.(688-690)GAC>GGC	p.D230G	SUGT1P1_uc010mjq.1_Intron|AQP7_uc010mjs.1_Missense_Mutation_p.D138G|AQP7_uc010mjt.1_Missense_Mutation_p.D138G|AQP7_uc003zss.2_Missense_Mutation_p.D138G|AQP7_uc003zsu.1_Missense_Mutation_p.D173G	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7	230	Extracellular (Potential).				excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0														0.409574	240.818349	242.164711	77	111	TT		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)	Missense_Mutation	SNP	33375701	33375701	842	9	T	C	C	58	58	AQP7	C	4	4
EGFL6	25975	broad.mit.edu	36	X	13547258	13547258	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:13547258G>A	uc004cvj.1	+	c.1158G>A	c.(1156-1158)GCG>GCA	p.A386A	EGFL6_uc004cvi.1_Silent_p.A386A	NM_015507	NP_056322	Q8IUX8	EGFL6_HUMAN	epidermal growth factor-like protein 6	386					cell adhesion|cell cycle|cell differentiation|multicellular organismal development	basement membrane|extracellular space|membrane	calcium ion binding|integrin binding			breast(2)	2														0.475309	224.659087	224.745243	77	85	GG		KEEP	---	---	---	---	capture			Silent	SNP	13547258	13547258	5152	23	G	A	A	38	38	EGFL6	A	1	1
GPR101	83550	broad.mit.edu	36	X	135941061	135941061	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:135941061G>A	uc004faj.1	-	c.439C>T	c.(439-441)CGC>TGC	p.R147C		NM_054021	NP_473362	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	147	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|lung(1)	4	Acute lymphoblastic leukemia(192;0.000127)													0.361111	74.33126	75.553271	26	46	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	135941061	135941061	6896	23	G	A	A	39	39	GPR101	A	1	1
TMEM185A	84548	broad.mit.edu	36	X	148489869	148489869	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:148489869G>A	uc004fdn.1	-	c.579C>T	c.(577-579)TCC>TCT	p.S193S	HSFX1_uc004fdl.1_Intron|HSFX1_uc004fdm.1_Intron|TMEM185A_uc004fdo.1_Silent_p.S15S	NM_032508	NP_115897	Q8NFB2	T185A_HUMAN	transmembrane protein 185A	193	Helical; (Potential).					integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)													0.423529	109.587246	110.020556	36	49	GG		KEEP	---	---	---	---	capture			Silent	SNP	148489869	148489869	16641	23	G	A	A	39	39	TMEM185A	A	1	1
RPS6KA3	6197	broad.mit.edu	36	X	20103288	20103288	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0157-01	TCGA-06-0157-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:20103288A>T	uc004czu.1	-	c.1142T>A	c.(1141-1143)CTT>CAT	p.L381H	RPS6KA3_uc004czv.1_Missense_Mutation_p.L369H	NM_004586	NP_004577	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	381	AGC-kinase C-terminal.				axon guidance|central nervous system development|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of caspase activity|nerve growth factor receptor signaling pathway|protein phosphorylation|skeletal system development|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein serine/threonine kinase activity	p.L381H(1)		central_nervous_system(4)|ovary(1)|stomach(1)|breast(1)	7										144				0.458647	174.339206	174.539325	61	72	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20103288	20103288	14132	23	A	T	T	3	3	RPS6KA3	T	4	4
XK	7504	broad.mit.edu	36	X	37438569	37438569	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0157-01	TCGA-06-0157-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:37438569G>T	uc004ddq.1	+	c.337G>T	c.(337-339)GGC>TGC	p.G113C		NM_021083	NP_066569	P51811	XK_HUMAN	membrane transport protein XK	113	Extracellular (Potential).				amino acid transport	integral to membrane	protein binding|transporter activity				0		all_lung(315;0.175)												0.366197	70.225137	71.345222	26	45	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37438569	37438569	18012	23	G	T	T	47	47	XK	T	3	3
SYP	6855	broad.mit.edu	36	X	48935116	48935116	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:48935116C>T	uc004dmz.1	-	c.664G>A	c.(664-666)GTG>ATG	p.V222M	SYP_uc004dna.1_Missense_Mutation_p.V222M	NM_003179	NP_003170	P08247	SYPH_HUMAN	synaptophysin	222	Helical; (Potential).|MARVEL.				regulation of long-term neuronal synaptic plasticity|regulation of short-term neuronal synaptic plasticity|synaptic vesicle maturation|synaptic vesicle membrane organization	cell junction|integral to synaptic vesicle membrane|synaptosome	calcium ion binding|cholesterol binding|transporter activity	p.V222M(1)		ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(315;0.00016)												0.384615	54.98613	55.59352	20	32	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48935116	48935116	15982	23	C	T	T	19	19	SYP	T	1	1
AWAT1	158833	broad.mit.edu	36	X	69372708	69372708	+	Silent	SNP	C	A	A			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:69372708C>A	uc004dxy.1	+	c.249C>A	c.(247-249)CCC>CCA	p.P83P		NM_001013579	NP_001013597	Q58HT5	AWAT1_HUMAN	acyl-CoA wax alcohol acyltransferase 1	83					lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	long-chain-alcohol O-fatty-acyltransferase activity			ovary(3)	3														0.375	99.369326	100.688702	36	60	CC		KEEP	---	---	---	---	capture			Silent	SNP	69372708	69372708	1255	23	C	A	A	21	21	AWAT1	A	3	3
NONO	4841	broad.mit.edu	36	X	70433430	70433430	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:70433430C>T	uc004dzn.1	+	c.751C>T	c.(751-753)CGA>TGA	p.R251*	NONO_uc004dzo.1_Nonsense_Mutation_p.R251*|NONO_uc004dzp.1_Nonsense_Mutation_p.R251*|NONO_uc004dzq.1_Nonsense_Mutation_p.R120*	NM_007363	NP_031389	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	251	DBHS.				DNA recombination|DNA repair|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|identical protein binding|nucleotide binding|RNA binding		NONO/TFE3(2)	ovary(2)|kidney(2)	4	Renal(35;0.156)									130				0.415385	75.710274	76.117264	27	38	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	70433430	70433430	10937	23	C	T	T	19	19	NONO	T	5	1
JAKMIP3	282973	broad.mit.edu	36	10	133799472	133799472	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0157-01	TCGA-06-0157-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:133799472_133799472delA	uc009yaz.1	+	c.1018_1018delA	c.(1018-1020)AAAfs	p.K340fs		NM_001105521	NP_001098991			janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)										0.81			13	3				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	133799472	133799472	8246	10	A	-	-	13	13	JAKMIP3	-	5	5
PTEN	5728	broad.mit.edu	36	10	89680799	89680800	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-06-0157-01	TCGA-06-0157-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:89680799_89680800delTA	uc001kfb.1	+	c.226_227delTA	c.(226-228)TATfs	p.Y76fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	76	Phosphatase tensin-type.				apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.Y76fs*1(12)|p.L70fs*7(4)|p.C71fs*6(2)|p.Y27_N212>Y(2)|p.Y76del(1)|p.H75_T78del(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)				31	p.Y76fs(HEC151-Tumor)	264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.50			25	25				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	89680799	89680800	13192	10	TA	-	-	61	61	PTEN	-	5	5
KRTAP5-5	439915	broad.mit.edu	36	11	1608162	1608191	+	In_Frame_Del	DEL	CTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	-	-			TCGA-06-0157-01	TCGA-06-0157-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:1608162_1608191delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	uc001lty.1	+	c.516_545delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	c.(514-546)TCCTGCTGCCAGTCCAGCTGCTGTAAGCCTTAC>TCC	p.CCQSSCCKPY183del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	183_192	8 X 4 AA repeats of C-C-X-P.					keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)										0.33			55	114				---	---	---	---	capture_indel			In_Frame_Del	DEL	1608162	1608191	8886	11	CTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	-	-	24	24	KRTAP5-5	-	5	5
DNAJB11	51726	broad.mit.edu	36	3	187785061	187785061	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0157-01	TCGA-06-0157-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:187785061_187785061delA	uc003fqi.1	+	c.1001_1001delA	c.(1000-1002)GAAfs	p.E334fs		NM_016306	NP_057390	Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	334					protein folding	endoplasmic reticulum lumen	heat shock protein binding			ovary(1)|lung(1)	2	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)										0.41			34	49				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	187785061	187785061	4799	3	A	-	-	9	9	DNAJB11	-	5	5
