Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
GDF2	2658	broad.mit.edu	36	10	48033768	48033768	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:48033768G>A	uc001jfa.1	-	c.1106C>T	c.(1105-1107)ACG>ATG	p.T369M		NM_016204	NP_057288	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	369					activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(2)	2														0.768293	200.328552	205.72254	63	19	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48033768	48033768	6582	10	G	A	A	40	40	GDF2	A	1	1
PTEN	5728	broad.mit.edu	36	10	89682972	89682972	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:89682972G>A	uc001kfb.1	+	c.476G>A	c.(475-477)AGG>AAG	p.R159K		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	159	Phosphatase tensin-type.				apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R159K(4)|p.Y27_N212>Y(2)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)						31		264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.8125	188.737952	194.589012	52	12	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)	Missense_Mutation	SNP	89682972	89682972	13192	10	G	A	A	35	35	PTEN	A	2	2
BCL9L	283149	broad.mit.edu	36	11	118278742	118278742	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:118278742G>A	uc001pug.1	-	c.920C>T	c.(919-921)CCG>CTG	p.P307L	BCL9L_uc009zal.1_Missense_Mutation_p.P302L	NM_182557	NP_872363	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	307	Pro-rich.|Necessary for interaction with CTNNB1 (By similarity).				negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of gene-specific transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	transcription coactivator activity			ovary(1)|pancreas(1)	2	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)												0.820896	177.357652	183.854016	55	12	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)	Missense_Mutation	SNP	118278742	118278742	1403	11	G	A	A	39	39	BCL9L	A	1	1
PRDM11	56981	broad.mit.edu	36	11	45074023	45074023	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:45074023G>A	uc001myo.1	+	c.91G>A	c.(91-93)GAG>AAG	p.E31K		NM_020229	NP_064614	Q9NQV5	PRD11_HUMAN	PR domain containing 11	31											0						NSCLC(118;1511 1736 6472 36603 43224)								0.4625	114.465399	114.563602	37	43	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45074023	45074023	12894	11	G	A	A	33	33	PRDM11	A	2	2
ME3	10873	broad.mit.edu	36	11	86060555	86060555	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:86060555G>T	uc001pbz.1	-	c.80C>A	c.(79-81)CCC>CAC	p.P27H	ME3_uc001pca.1_Missense_Mutation_p.P27H|ME3_uc009yvk.1_Missense_Mutation_p.P27H	NM_001014811	NP_006671	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent,	27					aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)									0.238095	11.910201	13.195167	5	16	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	86060555	86060555	9808	11	G	T	T	43	43	ME3	T	3	3
NFYB	4801	broad.mit.edu	36	12	103041147	103041147	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0195-01	TCGA-06-0195-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:103041147T>C	uc001tkl.1	-	c.416A>G	c.(415-417)CAG>CGG	p.Q139R	NFYB_uc001tkk.1_Missense_Mutation_p.Q137R	NM_006166	NP_006157	P25208	NFYB_HUMAN	nuclear transcription factor Y, beta	139	B domain.					CCAAT-binding factor complex	repressing transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0														0.295775	63.636944	66.29282	21	50	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	103041147	103041147	10790	12	T	C	C	55	55	NFYB	C	4	4
SDSL	113675	broad.mit.edu	36	12	112357610	112357610	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:112357610G>A	uc001tvi.1	+	c.537G>A	c.(535-537)CTG>CTA	p.L179L	SDSL_uc009zwh.1_Silent_p.L179L	NM_138432	NP_612441	Q96GA7	SDSL_HUMAN	serine dehydratase-like	179					cellular amino acid metabolic process		L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)									0.338983	46.869578	48.227874	20	39	GG		KEEP	---	---	---	---	capture			Silent	SNP	112357610	112357610	14462	12	G	A	A	47	47	SDSL	A	2	2
SCARB1	949	broad.mit.edu	36	12	123858378	123858378	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:123858378G>A	uc001ugp.2	-	c.891C>T	c.(889-891)CCC>CCT	p.P297P	SCARB1_uc001ugm.2_Silent_p.P297P|SCARB1_uc001ugn.2_Silent_p.P297P|SCARB1_uc001ugo.2_Silent_p.P297P	NM_001082959	NP_001076428	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 2	297	Extracellular (Potential).		P -> S (mutation carriers have increased HDL cholesterol levels and a reduction in cholesterol efflux from macrophages).		adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|regulation of phagocytosis|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)				Phosphatidylserine(DB00144)									0.292683	101.350258	106.084039	36	87	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Silent	SNP	123858378	123858378	14362	12	G	A	A	47	47	SCARB1	A	2	2
LRTM2	654429	broad.mit.edu	36	12	1813766	1813766	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0195-01	TCGA-06-0195-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:1813766T>G	uc001qjt.1	+	c.731T>G	c.(730-732)ATG>AGG	p.M244R	CACNA2D4_uc001qjp.1_Intron|CACNA2D4_uc009zds.1_Intron|CACNA2D4_uc009zdt.1_Intron|CACNA2D4_uc009zdr.1_Intron|LRTM2_uc001qju.1_Missense_Mutation_p.M244R|LRTM2_uc001qjv.1_Missense_Mutation_p.M6R	NM_001039029	NP_001034118	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains	244	LRRCT.|Extracellular (Potential).					integral to membrane				large_intestine(1)	1	Ovarian(42;0.107)													0.568182	86.319283	86.489702	25	19	TT		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(31;0.000834)		Missense_Mutation	SNP	1813766	1813766	9421	12	T	G	G	51	51	LRTM2	G	4	4
OVCH1	341350	broad.mit.edu	36	12	29519302	29519302	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:29519302C>T	uc001rix.1	-	c.1559G>A	c.(1558-1560)CGT>CAT	p.R520H		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1	520	CUB 2.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity	p.R520H(1)		ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)													0.5	6.350121	6.35012	2	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29519302	29519302	11736	12	C	T	T	19	19	OVCH1	T	1	1
KRT79	338785	broad.mit.edu	36	12	51503987	51503987	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51503987G>A	uc001sbb.1	-	c.1097C>T	c.(1096-1098)ACC>ATC	p.T366I	KRT79_uc001sba.1_Missense_Mutation_p.T137I	NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L	366	Rod.|Coil 2.					keratin filament	structural molecule activity			ovary(2)	2														0.480769	72.968915	72.985787	25	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51503987	51503987	8807	12	G	A	A	44	44	KRT79	A	2	2
EIF4B	1975	broad.mit.edu	36	12	51707845	51707845	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51707845G>A	uc001sbh.2	+	c.680G>A	c.(679-681)CGT>CAT	p.R227H	EIF4B_uc009zmp.1_Non-coding_Transcript|EIF4B_uc001sbi.1_5'UTR|EIF4B_uc009zmq.1_5'Flank	NM_001417	NP_001408	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	227	Arg-rich.|Asp-rich.				insulin receptor signaling pathway|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	nucleotide binding|translation initiation factor activity			breast(1)|kidney(1)	2										304				0.29646	176.029663	184.407301	67	159	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51707845	51707845	5218	12	G	A	A	40	40	EIF4B	A	1	1
CPSF6	11052	broad.mit.edu	36	12	67933166	67933166	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0195-01	TCGA-06-0195-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:67933166A>C	uc001suu.2	+	c.339A>C	c.(337-339)AAA>AAC	p.K113N	CPSF6_uc001sut.2_Missense_Mutation_p.K113N	NM_007007	NP_008938	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6,	113	RRM.|Necessary for interaction with NUDT21/CPSF5.				mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)													0.306452	60.60644	62.674811	19	43	AA		KEEP	---	---	---	---	capture	Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)		Missense_Mutation	SNP	67933166	67933166	3968	12	A	C	C	4	4	CPSF6	C	4	4
CD163L1	283316	broad.mit.edu	36	12	7418360	7418360	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:7418360G>A	uc001qsy.1	-	c.3354C>T	c.(3352-3354)CGC>CGT	p.R1118R		NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	1118	SRCR 10.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|central_nervous_system(1)	9														0.517857	85.073182	85.088653	29	27	GG		KEEP	---	---	---	---	capture			Silent	SNP	7418360	7418360	3095	12	G	A	A	38	38	CD163L1	A	1	1
HAL	3034	broad.mit.edu	36	12	94913762	94913762	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:94913762C>T	uc001tem.1	-	c.58G>A	c.(58-60)GCG>ACG	p.A20T	HAL_uc009zti.1_Non-coding_Transcript	NM_002108	NP_002099	P42357	HUTH_HUMAN	histidine ammonia-lyase	20					biosynthetic process|histidine catabolic process	cytosol	histidine ammonia-lyase activity			ovary(2)	2					L-Histidine(DB00117)	NSCLC(169;943 2815 23563 30031)								0.4	38.041088	38.347588	14	21	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	94913762	94913762	7229	12	C	T	T	27	27	HAL	T	1	1
RB1	5925	broad.mit.edu	36	13	47845597	47845597	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:47845597C>T	uc001vcb.1	+	c.1183C>T	c.(1183-1185)CAA>TAA	p.Q395*	RB1_uc010act.1_Nonsense_Mutation_p.Q96*	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	395	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|transcription repressor activity|ubiquitin protein ligase binding	p.Q395*(2)		lung(93)|eye(89)|central_nervous_system(47)|bone(22)|breast(20)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|soft_tissue(8)|prostate(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	355		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)			Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)			6		568	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.647619	214.220692	216.234998	68	37	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Nonsense_Mutation	SNP	47845597	47845597	13559	13	C	T	T	29	29	RB1	T	5	2
OR4K5	79317	broad.mit.edu	36	14	19458991	19458991	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:19458991C>A	uc001vwi.1	+	c.386C>A	c.(385-387)CCC>CAC	p.P129H		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	129	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)													0.414702	861.246942	865.809346	299	422	CC		KEEP	---	---	---	---	capture	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	Missense_Mutation	SNP	19458991	19458991	11483	14	C	A	A	22	22	OR4K5	A	3	3
SALL2	6297	broad.mit.edu	36	14	21061250	21061250	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:21061250C>G	uc001wbe.1	-	c.2452G>C	c.(2452-2454)GCA>CCA	p.A818P	SALL2_uc001wbf.2_Intron|SALL2_uc001wbg.1_Intron	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2	818	Poly-Ala.						DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)													0.35	15.542565	15.928617	7	13	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(265;0.0151)	Missense_Mutation	SNP	21061250	21061250	14291	14	C	G	G	28	28	SALL2	G	3	3
TELO2	9894	broad.mit.edu	36	16	1485446	1485446	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:1485446C>T	uc002cly.1	+	c.434C>T	c.(433-435)ACG>ATG	p.T145M		NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog	145						chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)												0.333333	6.323786	6.544301	3	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1485446	1485446	16284	16	C	T	T	19	19	TELO2	T	1	1
ITGAX	3687	broad.mit.edu	36	16	31299816	31299816	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:31299816C>T	uc002ebt.2	+	c.3374C>T	c.(3373-3375)GCG>GTG	p.A1125V	ITGAX_uc002ebu.1_Missense_Mutation_p.A1125V	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	1125	Helical; (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.505747	132.292163	132.294596	44	43	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31299816	31299816	8193	16	C	T	T	27	27	ITGAX	T	1	1
SLFN5	162394	broad.mit.edu	36	17	30615437	30615437	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0195-01	TCGA-06-0195-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:30615437T>C	uc002hjf.2	+	c.1261T>C	c.(1261-1263)TTT>CTT	p.F421L		NM_144975	NP_659412	Q08AF3	SLFN5_HUMAN	schlafen family member 5	421					cell differentiation		ATP binding			ovary(1)|central_nervous_system(1)	2		Ovarian(249;0.17)												0.406863	295.895679	297.439895	83	121	TT		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)	Missense_Mutation	SNP	30615437	30615437	15235	17	T	C	C	64	64	SLFN5	C	4	4
FAM117A	81558	broad.mit.edu	36	17	45143745	45143745	+	Silent	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:45143745C>T	uc002ipk.1	-	c.1233G>A	c.(1231-1233)CCG>CCA	p.P411P		NM_030802	NP_110429	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	411	Pro-rich.									ovary(1)	1														0.306667	61.596968	64.096698	23	52	CC		KEEP	---	---	---	---	capture			Silent	SNP	45143745	45143745	5606	17	C	T	T	23	23	FAM117A	T	1	1
SLC16A13	201232	broad.mit.edu	36	17	6882374	6882374	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:6882374G>A	uc002geh.1	+	c.523G>A	c.(523-525)GTG>ATG	p.V175M	SLC16A13_uc010clu.1_Missense_Mutation_p.V175M	NM_201566	NP_963860	Q7RTY0	MOT13_HUMAN	monocarboxylate transporter 13	175	Helical; (Potential).					integral to membrane|plasma membrane	symporter activity			ovary(1)	1														0.357664	133.737264	136.181157	49	88	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6882374	6882374	14902	17	G	A	A	44	44	SLC16A13	A	2	2
KCTD2	23510	broad.mit.edu	36	17	70560796	70560796	+	Splice_Site_SNP	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:70560796G>A	uc002jmp.1	+	c.540_splice	c.e3+1	p.Q180_splice	KCTD2_uc010dfz.1_Splice_Site_SNP|KCTD2_uc002jmq.1_Splice_Site_SNP	NM_015353	NP_056168			potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity				0	all_lung(278;0.226)													0.47561	116.116586	116.159231	39	43	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	70560796	70560796	8413	17	G	A	A	36	36	KCTD2	A	5	2
ACADVL	37	broad.mit.edu	36	17	7064033	7064033	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7064033G>T	uc002gev.1	+	c.6G>T	c.(4-6)CAG>CAT	p.Q2H	DLG4_uc010cly.1_5'Flank|DLG4_uc002get.2_5'Flank|DLG4_uc002geu.2_5'Flank|ACADVL_uc002gew.1_Missense_Mutation_p.Q2H|ACADVL_uc002gex.1_De_novo_Start_OutOfFrame	NM_000018	NP_000009	P49748	ACADV_HUMAN	acyl-Coenzyme A dehydrogenase, very long chain	2					energy derivation by oxidation of organic compounds|fatty acid beta-oxidation using acyl-CoA dehydrogenase|negative regulation of fatty acid biosynthetic process|negative regulation of fatty acid oxidation|regulation of cholesterol metabolic process|temperature homeostasis	mitochondrial inner membrane|mitochondrial nucleoid	long-chain-acyl-CoA dehydrogenase activity			ovary(2)	2														0.384615	14.3719	14.523643	5	8	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7064033	7064033	117	17	G	T	T	35	35	ACADVL	T	3	3
CCDC42	146849	broad.mit.edu	36	17	8579224	8579224	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:8579224G>A	uc002gln.1	-	c.788C>T	c.(787-789)ACG>ATG	p.T263M	CCDC42_uc002glo.1_Missense_Mutation_p.T189M	NM_144681	NP_653282	Q96M95	CCD42_HUMAN	coiled-coil domain containing 42	263										ovary(1)	1														0.351351	105.188318	107.35315	39	72	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8579224	8579224	2936	17	G	A	A	40	40	CCDC42	A	1	1
NFIX	4784	broad.mit.edu	36	19	13045252	13045252	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:13045252G>A	uc002mwd.1	+	c.639G>A	c.(637-639)CAG>CAA	p.Q213Q	NFIX_uc002mwe.1_Silent_p.Q205Q|NFIX_uc002mwf.1_Silent_p.Q216Q|NFIX_uc002mwg.1_Silent_p.Q212Q|NFIX_uc002mwh.1_Silent_p.Q166Q	NM_002501	NP_002492	Q14938	NFIX_HUMAN	nuclear factor I/X (CCAAT-binding transcription	213					DNA replication|negative regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of gene-specific transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)	1														0.178571	56.98959	70.602609	25	115	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)		Silent	SNP	13045252	13045252	10774	19	G	A	A	35	35	NFIX	A	2	2
CYP4F3	4051	broad.mit.edu	36	19	15619051	15619051	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:15619051C>T	uc002nbj.1	+	c.442C>T	c.(442-444)CGT>TGT	p.R148C	CYP4F3_uc002nbk.1_Missense_Mutation_p.R148C	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,	148					leukotriene metabolic process|oxidation-reduction process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3														0.255474	89.97137	97.396063	35	102	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15619051	15619051	4355	19	C	T	T	23	23	CYP4F3	T	1	1
MYO9B	4650	broad.mit.edu	36	19	17170077	17170077	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:17170077C>T	uc010eak.1	+	c.4198C>T	c.(4198-4200)CCA>TCA	p.P1400S	MYO9B_uc002nfi.1_Missense_Mutation_p.P1400S|MYO9B_uc002nfj.1_Missense_Mutation_p.P1400S|MYO9B_uc002nfk.1_Missense_Mutation_p.P1400S|MYO9B_uc002nfl.1_5'UTR	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	1400	Tail.				actin filament-based movement|Rho protein signal transduction	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1														0.254237	40.499044	43.731459	15	44	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17170077	17170077	10480	19	C	T	T	22	22	MYO9B	T	2	2
ZNF492	57615	broad.mit.edu	36	19	22639567	22639567	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0195-01	TCGA-06-0195-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:22639567A>C	uc002nqw.2	+	c.1256A>C	c.(1255-1257)AAA>ACA	p.K419T		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	419					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)												0.162963	48.360678	62.939408	22	113	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22639567	22639567	18537	19	A	C	C	1	1	ZNF492	C	4	4
ZNF99	7652	broad.mit.edu	36	19	22733245	22733245	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:22733245G>A	uc002nqx.1	-	c.1033C>T	c.(1033-1035)CGT>TGT	p.R345C		NM_001080409	NP_001073878	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	345	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)												0.265957	63.531454	68.184341	25	69	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22733245	22733245	18808	19	G	A	A	38	38	ZNF99	A	1	1
TEAD2	8463	broad.mit.edu	36	19	54543866	54543866	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:54543866G>A	uc002pnh.1	-	c.653C>T	c.(652-654)TCG>TTG	p.S218L	TEAD2_uc002png.1_Missense_Mutation_p.S217L|TEAD2_uc002pni.1_Missense_Mutation_p.S217L|TEAD2_uc002pnj.1_Missense_Mutation_p.S214L|TEAD2_uc010emw.1_Missense_Mutation_p.S217L	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2	214	Transcriptional activation (Potential).|Pro-rich.				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)												0.163265	14.57324	19.849721	8	41	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)	Missense_Mutation	SNP	54543866	54543866	16266	19	G	A	A	37	37	TEAD2	A	1	1
SHANK1	50944	broad.mit.edu	36	19	55897614	55897614	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:55897614G>A	uc002psx.1	-	c.1669C>T	c.(1669-1671)CGC>TGC	p.R557C		NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	557	SH3.				cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)												0.257143	21.059621	22.930481	9	26	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)	Missense_Mutation	SNP	55897614	55897614	14756	19	G	A	A	40	40	SHANK1	A	1	1
FLG	2312	broad.mit.edu	36	1	150552666	150552666	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150552666G>A	uc001ezu.1	-	c.1320C>T	c.(1318-1320)CAC>CAT	p.H440H		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	440	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)	9	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)													0.492723	698.600317	698.620735	237	244	GG		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(543;0.206)		Silent	SNP	150552666	150552666	6160	1	G	A	A	40	40	FLG	A	1	1
NES	10763	broad.mit.edu	36	1	154907398	154907398	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0195-01	TCGA-06-0195-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:154907398T>A	uc001fpq.1	-	c.3206A>T	c.(3205-3207)GAT>GTT	p.D1069V		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	1069	Tail.				brain development|embryonic camera-type eye development|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)													0.137931	31.017951	49.397577	20	125	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	154907398	154907398	10736	1	T	A	A	50	50	NES	A	4	4
C1orf129	80133	broad.mit.edu	36	1	169228045	169228045	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:169228045C>T	uc001ghg.1	+	c.1145C>T	c.(1144-1146)ACG>ATG	p.T382M	C1orf129_uc009wvy.1_Missense_Mutation_p.T189M	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133	382							binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)													0.380952	136.668919	138.235441	48	78	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	169228045	169228045	2063	1	C	T	T	19	19	C1orf129	T	1	1
LHX9	56956	broad.mit.edu	36	1	196163439	196163439	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:196163439C>A	uc001guk.1	+	c.829C>A	c.(829-831)CAC>AAC	p.H277N	LHX9_uc001gui.1_Missense_Mutation_p.H268N|LHX9_uc001guj.1_Missense_Mutation_p.H283N	NM_020204	NP_064589	Q9NQ69	LHX9_HUMAN	LIM homeobox 9 isoform 1	277	Homeobox.				regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity|zinc ion binding			ovary(1)	1														0.374718	475.78185	481.907297	166	277	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	196163439	196163439	9103	1	C	A	A	29	29	LHX9	A	3	3
IRF6	3664	broad.mit.edu	36	1	208028592	208028592	+	Silent	SNP	C	G	G			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:208028592C>G	uc001hhq.1	-	c.1200G>C	c.(1198-1200)CGG>CGC	p.R400R	IRF6_uc009xct.1_Silent_p.R400R	NM_006147	NP_006138	O14896	IRF6_HUMAN	interferon regulatory factor 6	400					cell cycle arrest|interferon-gamma-mediated signaling pathway|mammary gland epithelial cell differentiation|negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|type I interferon-mediated signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2														0.217391	8.958798	10.656947	5	18	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(81;0.0351)	Silent	SNP	208028592	208028592	8137	1	C	G	G	30	30	IRF6	G	3	3
USH2A	7399	broad.mit.edu	36	1	214053717	214053717	+	Silent	SNP	G	A	A	rs6660707	by-frequency,by-hapmap	TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:214053717G>A	uc001hku.1	-	c.9723C>T	c.(9721-9723)TAC>TAT	p.Y3241Y		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3241	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|kidney(1)|central_nervous_system(1)	22														0.405286	271.25955	273.03807	92	135	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	Silent	SNP	214053717	214053717	17598	1	G	A	A	40	40	USH2A	A	1	1
PCNXL2	80003	broad.mit.edu	36	1	231460731	231460731	+	Silent	SNP	T	C	C			TCGA-06-0195-01	TCGA-06-0195-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:231460731T>C	uc001hvl.2	-	c.1500A>G	c.(1498-1500)ACA>ACG	p.T500T	PCNXL2_uc009xfu.1_Non-coding_Transcript|PCNXL2_uc009xfv.1_Non-coding_Transcript	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	500						integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)												0.386667	166.80441	168.496097	58	92	TT		KEEP	---	---	---	---	capture			Silent	SNP	231460731	231460731	12012	1	T	C	C	55	55	PCNXL2	C	4	4
MYOM3	127294	broad.mit.edu	36	1	24306188	24306188	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:24306188G>C	uc001bin.2	-	c.364C>G	c.(364-366)CTG>GTG	p.L122V	MYOM3_uc001bio.2_Missense_Mutation_p.L122V|MYOM3_uc001bip.1_5'UTR	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	122	Potential.									ovary(1)	1		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)												0.181818	7.285246	9.380011	4	18	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)	Missense_Mutation	SNP	24306188	24306188	10488	1	G	C	C	34	34	MYOM3	C	3	3
GJB5	2709	broad.mit.edu	36	1	34996142	34996142	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:34996142G>A	uc001bxu.1	+	c.624G>A	c.(622-624)CTG>CTA	p.L208L	GJB5_uc009vuk.1_Silent_p.L208L	NM_005268	NP_005259	O95377	CXB5_HUMAN	gap junction protein, beta 5, 31.1kDa	208	Helical; (Potential).				cell communication|epidermis development	connexon complex|integral to membrane				ovary(1)	1		Myeloproliferative disorder(586;0.0393)												0.362637	185.991979	189.017182	66	116	GG		KEEP	---	---	---	---	capture			Silent	SNP	34996142	34996142	6679	1	G	A	A	47	47	GJB5	A	2	2
DMAP1	55929	broad.mit.edu	36	1	44456964	44456964	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:44456964C>T	uc001clq.1	+	c.670C>T	c.(670-672)CGA>TGA	p.R224*	DMAP1_uc001clr.1_Nonsense_Mutation_p.R224*|DMAP1_uc001cls.1_Nonsense_Mutation_p.R224*	NM_001034024	NP_061973	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1	224					DNA methylation|histone H2A acetylation|histone H4 acetylation|negative regulation of transcription, DNA-dependent|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex	DNA binding|protein binding|transcription repressor activity				0	Acute lymphoblastic leukemia(166;0.155)											OREG0013437	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.415205	205.252255	206.309583	71	100	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	44456964	44456964	4756	1	C	T	T	19	19	DMAP1	T	5	1
FOXS1	2307	broad.mit.edu	36	20	29896567	29896567	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:29896567G>A	uc002wwt.1	-	c.440C>T	c.(439-441)ACG>ATG	p.T147M		NM_004118	NP_004109	O43638	FOXS1_HUMAN	forkhead box S1	147					anti-apoptosis|artery morphogenesis|blood vessel remodeling|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|insulin receptor signaling pathway|lymphangiogenesis|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of sequence-specific DNA binding transcription factor activity|neural crest cell fate commitment|neuromuscular process controlling balance|Notch signaling pathway|ossification|paraxial mesodermal cell fate commitment|patterning of blood vessels|positive regulation of multicellular organism growth|positive regulation of transcription from RNA polymerase II promoter|regulation of blood vessel size|regulation of organ growth|somitogenesis|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)	1														0.459459	48.269429	48.322494	17	20	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29896567	29896567	6281	20	G	A	A	40	40	FOXS1	A	1	1
DUSP15	128853	broad.mit.edu	36	20	29918553	29918553	+	Silent	SNP	T	G	G			TCGA-06-0195-01	TCGA-06-0195-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:29918553T>G	uc002wwx.1	-	c.120A>C	c.(118-120)TCA>TCC	p.S40S	DUSP15_uc002wwu.1_Silent_p.S37S|DUSP15_uc002wwv.1_5'UTR|DUSP15_uc002www.1_5'UTR	NM_080611	NP_817130	Q9H1R2	DUS15_HUMAN	dual specificity phosphatase 15 isoform a	37						cytoplasm|plasma membrane	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1														0.444444	9.420126	9.45489	4	5	TT		KEEP	---	---	---	---	capture	Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)		Silent	SNP	29918553	29918553	5000	20	T	G	G	59	59	DUSP15	G	4	4
PLCG1	5335	broad.mit.edu	36	20	39235798	39235798	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:39235798G>A	uc002xjo.1	+	c.3487G>A	c.(3487-3489)GAG>AAG	p.E1163K	PLCG1_uc002xjp.1_Missense_Mutation_p.E1163K	NM_002660	NP_002651	P19174	PLCG1_HUMAN	phospholipase C gamma 1 isoform a	1163	C2.				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			breast(3)|lung(2)|skin(1)	6		Myeloproliferative disorder(115;0.00878)								429		OREG0025953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.385892	264.115252	266.866605	93	148	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39235798	39235798	12461	20	G	A	A	45	45	PLCG1	A	2	2
SEMG1	6406	broad.mit.edu	36	20	43269630	43269630	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:43269630C>T	uc002xni.1	+	c.278C>T	c.(277-279)ACG>ATG	p.T93M	SEMG1_uc002xnh.1_Missense_Mutation_p.T93M|SEMG1_uc002xnj.1_Missense_Mutation_p.T93M|SEMG2_uc010ggz.1_Intron	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I isoform a preproprotein	93					insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity				0		Myeloproliferative disorder(115;0.0122)												0.377907	185.334243	187.583552	65	107	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43269630	43269630	14530	20	C	T	T	19	19	SEMG1	T	1	1
COL6A2	1292	broad.mit.edu	36	21	46363443	46363443	+	Silent	SNP	C	T	T	rs61735827	unknown	TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:46363443C>T	uc002zia.1	+	c.1251C>T	c.(1249-1251)CGC>CGT	p.R417R	COL6A2_uc002zhy.1_Silent_p.R417R|COL6A2_uc002zhz.1_Silent_p.R417R|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	417	Triple-helical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging	p.R417R(1)		central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)													0.6	46.128268	46.346774	15	10	CC		KEEP	---	---	---	---	capture		Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)	Silent	SNP	46363443	46363443	3838	21	C	T	T	27	27	COL6A2	T	1	1
TTN	7273	broad.mit.edu	36	2	179297456	179297456	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179297456G>A	uc002umr.1	-	c.17159C>T	c.(17158-17160)ACG>ATG	p.T5720M	TTN_uc002ums.1_Intron|TTN_uc010frc.1_Intron|TTN_uc010frd.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.T2381M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6647										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153										8722				0.390625	72.162371	72.832298	25	39	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		Missense_Mutation	SNP	179297456	179297456	17290	2	G	A	A	40	40	TTN	A	1	1
TTN	7273	broad.mit.edu	36	2	179346212	179346212	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179346212C>A	uc002umr.1	-	c.7724G>T	c.(7723-7725)AGT>ATT	p.S2575I	TTN_uc002ums.1_Missense_Mutation_p.S2529I|TTN_uc010frc.1_Missense_Mutation_p.S2529I|TTN_uc010frd.1_Missense_Mutation_p.S2529I|TTN_uc002unb.1_Missense_Mutation_p.S2575I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2575										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153										8722				0.318841	62.923147	64.936965	22	47	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		Missense_Mutation	SNP	179346212	179346212	17290	2	C	A	A	20	20	TTN	A	3	3
CCDC141	285025	broad.mit.edu	36	2	179410039	179410039	+	Silent	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179410039C>T	uc002unf.1	-	c.2427G>A	c.(2425-2427)AGG>AGA	p.R809R	CCDC141_uc002une.1_Silent_p.R259R	NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	809							protein binding			ovary(7)|pancreas(2)	9														0.545455	92.950018	93.048393	30	25	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)		Silent	SNP	179410039	179410039	2895	2	C	T	T	26	26	CCDC141	T	2	2
MPP4	58538	broad.mit.edu	36	2	202265931	202265931	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:202265931C>A	uc002uyk.2	-	c.146G>T	c.(145-147)GGA>GTA	p.G49V	MPP4_uc010ftj.1_Missense_Mutation_p.G49V|MPP4_uc002uyj.2_Missense_Mutation_p.G49V|MPP4_uc002uyl.2_Non-coding_Transcript|MPP4_uc010ftk.1_Missense_Mutation_p.G49V|MPP4_uc002uym.1_Missense_Mutation_p.G62V|MPP4_uc002uyn.2_Missense_Mutation_p.G49V	NM_033066	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4	49	L27 1.					cytoplasm	protein binding				0														0.413793	33.692827	33.881479	12	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	202265931	202265931	10128	2	C	A	A	30	30	MPP4	A	3	3
DIS3L2	129563	broad.mit.edu	36	2	232736568	232736568	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:232736568G>T	uc010fxz.1	+	c.1106G>T	c.(1105-1107)AGC>ATC	p.S369I	DIS3L2_uc002vsm.2_Non-coding_Transcript|DIS3L2_uc002vso.2_Non-coding_Transcript	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.	369							exonuclease activity|ribonuclease activity|RNA binding			breast(1)|central_nervous_system(1)	2		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)												0.442623	80.095133	80.273022	27	34	GG		KEEP	---	---	---	---	capture		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)	Missense_Mutation	SNP	232736568	232736568	4716	2	G	T	T	34	34	DIS3L2	T	3	3
NEU2	4759	broad.mit.edu	36	2	233605737	233605737	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:233605737G>A	uc002vtu.1	+	c.112G>A	c.(112-114)GCG>ACG	p.A38T		NM_005383	NP_005374	Q9Y3R4	NEUR2_HUMAN	neuraminidase 2	38							exo-alpha-sialidase activity				0		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)												0.318519	109.375527	113.328514	43	92	GG		KEEP	---	---	---	---	capture		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	Missense_Mutation	SNP	233605737	233605737	10741	2	G	A	A	38	38	NEU2	A	1	1
DGKD	8527	broad.mit.edu	36	2	234023372	234023372	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:234023372G>A	uc002vui.1	+	c.1894G>A	c.(1894-1896)GAT>AAT	p.D632N	DGKD_uc002vuj.1_Missense_Mutation_p.D588N|DGKD_uc010fyh.1_Missense_Mutation_p.D499N|DGKD_uc010fyi.1_Non-coding_Transcript	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	632					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)			Phosphatidylserine(DB00144)									0.229508	31.516328	35.610721	14	47	GG		KEEP	---	---	---	---	capture		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Missense_Mutation	SNP	234023372	234023372	4646	2	G	A	A	37	37	DGKD	A	1	1
TM4SF18	116441	broad.mit.edu	36	3	150533812	150533812	+	Silent	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:150533812C>A	uc003exa.1	-	c.48G>T	c.(46-48)CCG>CCT	p.P16P		NM_138786	NP_620141	Q96CE8	T4S18_HUMAN	transmembrane 4 L six family member 18	16	Helical; (Potential).					integral to membrane				ovary(1)	1														0.183333	23.812364	29.441635	11	49	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)		Silent	SNP	150533812	150533812	16497	3	C	A	A	27	27	TM4SF18	A	3	3
AADAC	13	broad.mit.edu	36	3	153014719	153014719	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:153014719G>A	uc003eze.1	+	c.79G>A	c.(79-81)GTT>ATT	p.V27I		NM_001086	NP_001077	P22760	AAAD_HUMAN	arylacetamide deacetylase	27	Lumenal (Potential).				positive regulation of triglyceride catabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	deacetylase activity|serine hydrolase activity|triglyceride lipase activity				0		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)				Ovarian(30;839 841 2699 32801 46334)								0.533333	234.509616	234.655672	80	70	GG		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Missense_Mutation	SNP	153014719	153014719	11	3	G	A	A	40	40	AADAC	A	1	1
HTR3E	285242	broad.mit.edu	36	3	185305325	185305325	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:185305325G>A	uc010hxr.1	+	c.524G>A	c.(523-525)CGC>CAC	p.R175H	HTR3E_uc010hxq.1_Missense_Mutation_p.R149H|HTR3E_uc003fml.2_Missense_Mutation_p.R134H|HTR3E_uc003fmm.1_Missense_Mutation_p.R164H|HTR3E_uc003fmn.1_Missense_Mutation_p.R149H	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	149	Extracellular (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)	2	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)					Melanoma(7;227 727 6634 44770)								0.463768	181.559243	181.719136	64	74	GG		KEEP	---	---	---	---	capture	Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Missense_Mutation	SNP	185305325	185305325	7748	3	G	A	A	38	38	HTR3E	A	1	1
ATP13A4	84239	broad.mit.edu	36	3	194641066	194641066	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:194641066G>A	uc003ftd.1	-	c.2494C>T	c.(2494-2496)CTG>TTG	p.L832L	ATP13A4_uc010hzi.1_Non-coding_Transcript|ATP13A4_uc003fte.1_Silent_p.L832L	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	832	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)													0.524272	177.251423	177.303881	54	49	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)	Silent	SNP	194641066	194641066	1145	3	G	A	A	33	33	ATP13A4	A	2	2
TRIM71	131405	broad.mit.edu	36	3	32834696	32834696	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:32834696G>A	uc003cff.1	+	c.120G>A	c.(118-120)ACG>ACA	p.T40T		NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71	40	RING-type.|Ser-rich.				multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3														0.285714	24.834212	26.277371	10	25	GG		KEEP	---	---	---	---	capture			Silent	SNP	32834696	32834696	17093	3	G	A	A	40	40	TRIM71	A	1	1
SCAP	22937	broad.mit.edu	36	3	47435320	47435320	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:47435320G>A	uc003crh.1	-	c.1958C>T	c.(1957-1959)CCC>CTC	p.P653L	SCAP_uc003crg.2_Missense_Mutation_p.P261L	NM_012235	NP_036367	Q12770	SCAP_HUMAN	SREBF chaperone protein	653	Lumenal (By similarity).				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding			ovary(1)	1						Pancreas(149;978 1908 29304 37806 46700)								0.434783	32.447229	32.532417	10	13	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)	Missense_Mutation	SNP	47435320	47435320	14358	3	G	A	A	43	43	SCAP	A	2	2
FAM116A	201627	broad.mit.edu	36	3	57602503	57602503	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0195-01	TCGA-06-0195-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:57602503A>G	uc003dja.1	-	c.1049T>C	c.(1048-1050)ATA>ACA	p.I350T		NM_152678	NP_689891	Q8IWF6	F116A_HUMAN	hypothetical protein LOC201627	350										pancreas(1)	1														0.48913	159.477058	159.486371	45	47	AA		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(55;0.000621)|KIRC - Kidney renal clear cell carcinoma(284;0.0485)|Kidney(284;0.0607)	Missense_Mutation	SNP	57602503	57602503	5604	3	A	G	G	16	16	FAM116A	G	4	4
MORF4	10934	broad.mit.edu	36	4	174773870	174773870	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:174773870G>T	uc003itm.1	-	c.500C>A	c.(499-501)TCC>TAC	p.S167Y		NM_006792	NP_006783			mortality factor 4												0		Prostate(90;0.00201)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0765)|all_hematologic(60;0.107)												0.451327	437.022853	437.723289	153	186	GG		KEEP	---	---	---	---	capture		all cancers(43;1.88e-18)|Epithelial(43;1.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)	Missense_Mutation	SNP	174773870	174773870	10096	4	G	T	T	41	41	MORF4	T	3	3
ZFYVE28	57732	broad.mit.edu	36	4	2276374	2276374	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:2276374G>A	uc003gex.1	-	c.1491C>T	c.(1489-1491)GAC>GAT	p.D497D	ZFYVE28_uc003gew.1_Silent_p.D383D	NM_020972	NP_066023	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	497					negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	phosphatidylinositol-3-phosphate binding|protein binding|zinc ion binding			ovary(1)	1														0.435897	146.110244	146.528346	51	66	GG		KEEP	---	---	---	---	capture			Silent	SNP	2276374	2276374	18260	4	G	A	A	40	40	ZFYVE28	A	1	1
RBM47	54502	broad.mit.edu	36	4	40135546	40135546	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:40135546C>T	uc003gvc.2	-	c.122G>A	c.(121-123)CGC>CAC	p.R41H	RBM47_uc003gve.2_Non-coding_Transcript|RBM47_uc003gvd.2_Missense_Mutation_p.R41H|RBM47_uc003gvg.1_Missense_Mutation_p.R41H	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	41						nucleus	nucleotide binding|RNA binding			breast(3)	3														0.5	21.159299	21.159299	7	7	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40135546	40135546	13603	4	C	T	T	27	27	RBM47	T	1	1
CSN3	1448	broad.mit.edu	36	4	71149758	71149758	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:71149758C>T	uc003hfe.2	+	c.542C>T	c.(541-543)ACG>ATG	p.T181M		NM_005212	NP_005203	P07498	CASK_HUMAN	casein kappa	181				TPPT -> PTTS (in Ref. 5; AA sequence and 6; AA sequence).		extracellular region	protein binding			ovary(2)|kidney(1)|central_nervous_system(1)	4														0.406977	103.108722	103.758897	35	51	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71149758	71149758	4090	4	C	T	T	19	19	CSN3	T	1	1
SH3TC1	54436	broad.mit.edu	36	4	8281113	8281113	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:8281113G>A	uc003gkv.2	+	c.2792G>A	c.(2791-2793)CGG>CAG	p.R931Q	SH3TC1_uc003gkw.2_Missense_Mutation_p.R855Q|SH3TC1_uc003gkx.2_Non-coding_Transcript|SH3TC1_uc003gky.1_5'Flank	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	931							binding			large_intestine(2)|pancreas(1)	3						NSCLC(145;2298 2623 35616 37297)								0.409091	84.520481	84.994699	27	39	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8281113	8281113	14753	4	G	A	A	39	39	SH3TC1	A	1	1
TRPC7	57113	broad.mit.edu	36	5	135615287	135615287	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:135615287C>T	uc003lbn.1	-	c.1525G>A	c.(1525-1527)GAC>AAC	p.D509N	TRPC7_uc010jef.1_Missense_Mutation_p.D446N|TRPC7_uc010jeg.1_Non-coding_Transcript|TRPC7_uc010jeh.1_Missense_Mutation_p.D440N|TRPC7_uc010jei.1_Missense_Mutation_p.D385N|TRPC7_uc010jej.1_Missense_Mutation_p.D61N	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	510	Extracellular (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0														0.341463	76.970731	78.794025	28	54	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		Missense_Mutation	SNP	135615287	135615287	17135	5	C	T	T	31	31	TRPC7	T	1	1
KIAA0141	9812	broad.mit.edu	36	5	141297041	141297041	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:141297041C>T	uc003lls.1	+	c.1244C>T	c.(1243-1245)TCA>TTA	p.S415L	KIAA0141_uc003llt.1_Missense_Mutation_p.S415L|KIAA0141_uc003llu.1_Non-coding_Transcript	NM_014773	NP_055588	Q14154	K0141_HUMAN	hypothetical protein LOC9812	415	TPR 6.					mitochondrion	binding				0		all_hematologic(541;0.118)												0.44586	405.93632	406.741191	140	174	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Missense_Mutation	SNP	141297041	141297041	8463	5	C	T	T	29	29	KIAA0141	T	2	2
SOX30	11063	broad.mit.edu	36	5	157010901	157010901	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0195-01	TCGA-06-0195-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:157010901T>G	uc003lxb.1	-	c.764A>C	c.(763-765)CAG>CCG	p.Q255P	SOX30_uc003lxc.1_Missense_Mutation_p.Q255P	NM_178424	NP_848511	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30 isoform a	255					regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|response to corticosteroid stimulus|transcription, DNA-dependent	nucleus|nucleus	sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)|central_nervous_system(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)				Esophageal Squamous(31;525 799 19355 21125 41744)								0.418605	168.227787	168.973554	54	75	TT		KEEP	---	---	---	---	capture	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Missense_Mutation	SNP	157010901	157010901	15452	5	T	G	G	55	55	SOX30	G	4	4
ADAMTS16	170690	broad.mit.edu	36	5	5285628	5285628	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0195-01	TCGA-06-0195-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:5285628A>G	uc003jdl.1	+	c.1849A>G	c.(1849-1851)AAG>GAG	p.K617E	ADAMTS16_uc003jdk.1_Missense_Mutation_p.K617E|ADAMTS16_uc010itk.1_5'Flank	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	617	TSP type-1 1.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8														0.371134	233.655579	236.484127	72	122	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5285628	5285628	262	5	A	G	G	5	5	ADAMTS16	G	4	4
HDAC2	3066	broad.mit.edu	36	6	114373294	114373294	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:114373294C>T	uc003pwd.1	-	c.1298G>A	c.(1297-1299)GGA>GAA	p.G433E	HDAC2_uc003pwc.1_Missense_Mutation_p.G309E|HDAC2_uc003pwe.1_Missense_Mutation_p.G309E	NM_001527	NP_001518	Q92769	HDAC2_HUMAN	histone deacetylase 2	339					blood coagulation|chromatin remodeling|dendrite development|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|maintenance of chromatin silencing|negative regulation of apoptosis|negative regulation of cell cycle|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of MHC class II biosynthetic process|negative regulation of neuron projection development|negative regulation of sequence-specific DNA binding transcription factor activity|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of collagen biosynthetic process|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of proteolysis|positive regulation of receptor biosynthetic process	cytoplasm|ESC/E(Z) complex|NuRD complex|Sin3 complex	chromatin binding|enzyme binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|sequence-specific DNA binding|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|central_nervous_system(1)	3		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)			Vorinostat(DB02546)					302				0.446009	299.820004	300.356941	95	118	CC		KEEP	---	---	---	---	capture		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Missense_Mutation	SNP	114373294	114373294	7290	6	C	T	T	30	30	HDAC2	T	2	2
SYNE1	23345	broad.mit.edu	36	6	152686386	152686386	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:152686386G>A	uc010kiw.1	-	c.15837C>T	c.(15835-15837)CTC>CTT	p.L5279L	SYNE1_uc003qot.2_Silent_p.L5208L|SYNE1_uc003qou.2_Silent_p.L5279L|SYNE1_uc010kiz.1_Silent_p.L1034L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5279	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|ovary(8)|large_intestine(5)|pancreas(2)	30		Ovarian(120;0.0955)												0.474138	161.415226	161.48256	55	61	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	Silent	SNP	152686386	152686386	15966	6	G	A	A	41	41	SYNE1	A	2	2
TIAM2	26230	broad.mit.edu	36	6	155612745	155612745	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:155612745G>A	uc003qqb.1	+	c.3901G>A	c.(3901-3903)GGG>AGG	p.G1301R	TIAM2_uc003qqd.1_Missense_Mutation_p.G1301R|TIAM2_uc003qqe.1_Missense_Mutation_p.G1301R|TIAM2_uc010kjj.1_Missense_Mutation_p.G834R|TIAM2_uc003qqf.1_Missense_Mutation_p.G677R|TIAM2_uc003qqg.1_Missense_Mutation_p.G613R|TIAM2_uc003qqh.1_Missense_Mutation_p.G226R	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1301					apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)												0.518072	127.720054	127.743277	43	40	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)	Missense_Mutation	SNP	155612745	155612745	16419	6	G	A	A	47	47	TIAM2	A	2	2
FILIP1	27145	broad.mit.edu	36	6	76080320	76080320	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:76080320C>T	uc010kbe.1	-	c.1957G>A	c.(1957-1959)GAA>AAA	p.E653K	FILIP1_uc003phy.1_Missense_Mutation_p.E650K|FILIP1_uc003pia.1_Missense_Mutation_p.E650K|FILIP1_uc003phz.1_Missense_Mutation_p.E551K|FILIP1_uc003pib.1_Missense_Mutation_p.E402K	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	650	Potential.										0														0.521452	997.3067	997.548494	316	290	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	76080320	76080320	6132	6	C	T	T	31	31	FILIP1	T	1	1
SSPO	23145	broad.mit.edu	36	7	149138998	149138998	+	Silent	SNP	G	C	C			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:149138998G>C	uc010lpk.1	+	c.9459G>C	c.(9457-9459)CCG>CCC	p.P3153P		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin	3153					cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)													0.189474	38.12178	46.675682	18	77	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		Silent	SNP	149138998	149138998	15705	7	G	C	C	39	39	SSPO	C	3	3
ABCB4	5244	broad.mit.edu	36	7	86898715	86898715	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:86898715C>T	uc003uiv.1	-	c.1834G>A	c.(1834-1836)GGA>AGA	p.G612R	ABCB4_uc003uiw.1_Missense_Mutation_p.G612R|ABCB4_uc003uix.1_Missense_Mutation_p.G612R	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	612	ABC transporter 1.|Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|pancreas(1)	5	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)													0.312757	217.121	224.699733	76	167	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	86898715	86898715	44	7	C	T	T	24	24	ABCB4	T	2	2
NPTX2	4885	broad.mit.edu	36	7	98094474	98094474	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:98094474C>T	uc003upl.1	+	c.950C>T	c.(949-951)ACG>ATG	p.T317M	NPTX2_uc010lfs.1_Non-coding_Transcript	NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II	317	Pentaxin.				synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)	2	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)													0.217391	67.6792	77.839718	30	108	CC		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(171;0.215)		Missense_Mutation	SNP	98094474	98094474	11008	7	C	T	T	19	19	NPTX2	T	1	1
PKHD1L1	93035	broad.mit.edu	36	8	110545941	110545941	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:110545941C>A	uc003yne.1	+	c.7704C>A	c.(7702-7704)AAC>AAA	p.N2568K		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L	2568	Extracellular (Potential).|PbH1 2.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14														0.72	179.083236	182.361054	54	21	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		Missense_Mutation	SNP	110545941	110545941	12397	8	C	A	A	17	17	PKHD1L1	A	3	3
INSL6	11172	broad.mit.edu	36	9	5175586	5175586	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:5175586C>T	uc003zix.1	-	c.17G>A	c.(16-18)CGC>CAC	p.R6H		NM_007179	NP_009110	Q9Y581	INSL6_HUMAN	insulin-like 6 precursor	6						extracellular region	hormone activity				0	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)												0.347826	37.873345	38.818988	16	30	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)	Missense_Mutation	SNP	5175586	5175586	8071	9	C	T	T	27	27	INSL6	T	1	1
FBP1	2203	broad.mit.edu	36	9	96419910	96419910	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:96419910G>A	uc004auw.2	-	c.387C>T	c.(385-387)TGC>TGT	p.C129C	FBP1_uc010mrl.1_Silent_p.C129C	NM_000507	NP_001121100	P09467	F16P1_HUMAN	fructose-1,6-bisphosphatase 1	129					gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding|metal ion binding				0		Acute lymphoblastic leukemia(62;0.136)			Adenosine monophosphate(DB00131)	Ovarian(142;590 2466 25593 44496)								0.368421	104.098226	105.544783	35	60	GG		KEEP	---	---	---	---	capture			Silent	SNP	96419910	96419910	5941	9	G	A	A	42	42	FBP1	A	2	2
GLUD2	2747	broad.mit.edu	36	X	120010769	120010769	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:120010769C>A	uc004eto.1	+	c.1550C>A	c.(1549-1551)TCT>TAT	p.S517Y		NM_012084	NP_036216	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	517					glutamate biosynthetic process|glutamate catabolic process|oxidation-reduction process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding			pancreas(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)									0.383459	138.382682	139.970092	51	82	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	120010769	120010769	6745	23	C	A	A	32	32	GLUD2	A	3	3
BCOR	54880	broad.mit.edu	36	X	39816791	39816791	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:39816791G>A	uc004den.2	-	c.2752C>T	c.(2752-2754)CAA>TAA	p.Q918*	BCOR_uc004dep.2_Nonsense_Mutation_p.Q918*|BCOR_uc004deo.2_Nonsense_Mutation_p.Q918*|BCOR_uc004dem.2_Nonsense_Mutation_p.Q918*|BCOR_uc004deq.2_Nonsense_Mutation_p.Q918*	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	918					chromatin modification|heart development|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|odontogenesis|palate development|protein ubiquitination|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|promoter binding|transcription corepressor activity|transcription factor binding			ovary(2)|kidney(1)|central_nervous_system(1)	4														0.807229	215.851919	223.160399	67	16	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	39816791	39816791	1407	23	G	A	A	47	47	BCOR	A	5	2
KRTAP5-5	439915	broad.mit.edu	36	11	1607775	1607804	+	In_Frame_Del	DEL	AGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	-	-			TCGA-06-0195-01	TCGA-06-0195-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:1607775_1607804delAGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	uc001lty.1	+	c.129_158delAGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	c.(127-159)GGAGGCTGTGGGGGCTGTGGCTCCGGCTGTGCG>GGG	p.GCGGCGSGCA44del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	44_53				A -> G (in Ref. 1; BAD20201 and 2; CAF31639).		keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)										0.91			115	12				---	---	---	---	capture_indel			In_Frame_Del	DEL	1607775	1607804	8886	11	AGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	-	-	11	11	KRTAP5-5	-	5	5
RNF151	146310	broad.mit.edu	36	16	1958614	1958615	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-0195-01	TCGA-06-0195-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:1958614_1958615insC	uc002cnt.1	+	c.425_426insC	c.(424-426)TGCfs	p.C142fs		NM_174903	NP_777563	Q2KHN1	RN151_HUMAN	ring finger protein 151	142	TRAF-type.				cell differentiation|spermatogenesis	cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding				0														0.33			3	6				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	1958614	1958615	13929	16	-	C	C	46	46	RNF151	C	5	5
AMZ1	155185	broad.mit.edu	36	7	2706699	2706700	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-0195-01	TCGA-06-0195-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:2706699_2706700insA	uc003smr.1	+	c.88_89insA	c.(88-90)CAGfs	p.Q30fs	AMZ1_uc003sms.1_Frame_Shift_Ins_p.Q30fs	NM_133463	NP_597720	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	30							metallopeptidase activity|zinc ion binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)										0.32			141	305				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	2706699	2706700	599	7	-	A	A	25	25	AMZ1	A	5	5
