Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
FAM196A	642938	broad.mit.edu	36	10	128863681	128863681	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:128863681C>T	uc001lju.1	-	c.969G>A	c.(967-969)TCG>TCA	p.S323S	DOCK1_uc001ljt.1_Intron|FAM196A_uc009yap.1_Silent_p.S323S|FAM196A_uc001ljv.1_Silent_p.S323S	NM_001039762	NP_001034851	Q6ZSG2	F196A_HUMAN	hypothetical protein LOC642938	323										ovary(2)	2														0.754545	276.977742	283.474006	83	27	CC		KEEP	---	---	---	---	capture			Silent	SNP	128863681	128863681	5740	10	C	T	T	27	27	FAM196A	T	1	1
SLC39A12	221074	broad.mit.edu	36	10	18310264	18310264	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:18310264G>A	uc001ipo.1	+	c.942G>A	c.(940-942)AGG>AGA	p.R314R	SLC39A12_uc001ipn.1_Silent_p.R314R|SLC39A12_uc001ipp.1_Silent_p.R314R	NM_152725	NP_689938	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	314	Cytoplasmic (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2														0.826667	210.393637	217.947725	62	13	GG		KEEP	---	---	---	---	capture			Silent	SNP	18310264	18310264	15112	10	G	A	A	42	42	SLC39A12	A	2	2
ADAMTS8	11095	broad.mit.edu	36	11	129786702	129786702	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:129786702C>T	uc001qgg.2	-	c.1570G>A	c.(1570-1572)GTG>ATG	p.V524M	ADAMTS8_uc001qgf.1_Missense_Mutation_p.V5M	NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1	524	Disintegrin.				negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)												0.455556	126.360175	126.515375	41	49	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)	Missense_Mutation	SNP	129786702	129786702	273	11	C	T	T	19	19	ADAMTS8	T	1	1
MRPL23	6150	broad.mit.edu	36	11	1930015	1930015	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:1930015G>C	uc001lux.1	+	c.223G>C	c.(223-225)GGC>CGC	p.G75R		NM_021134	NP_066957	Q16540	RM23_HUMAN	mitochondrial ribosomal protein L23	75					translation	mitochondrial large ribosomal subunit	nucleotide binding|RNA binding|structural constituent of ribosome			large_intestine(2)|ovary(1)	3		all_epithelial(84;6.24e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)												0.470588	92.488864	92.540485	32	36	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(625;0.0026)|Lung(200;0.0171)|LUSC - Lung squamous cell carcinoma(625;0.0842)	Missense_Mutation	SNP	1930015	1930015	10182	11	G	C	C	47	47	MRPL23	C	3	3
ANO5	203859	broad.mit.edu	36	11	22196389	22196389	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0648-01	TCGA-06-0648-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:22196389T>G	uc001mqi.1	+	c.160T>G	c.(160-162)TTC>GTC	p.F54V	ANO5_uc001mqj.1_Missense_Mutation_p.F53V	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	54	Cytoplasmic (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4														0.390977	167.860298	169.247289	52	81	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22196389	22196389	708	11	T	G	G	60	60	ANO5	G	4	4
OR5D16	390144	broad.mit.edu	36	11	55363465	55363465	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55363465C>A	uc001nhz.1	+	c.662C>A	c.(661-663)GCA>GAA	p.A221E		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	221	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3		all_epithelial(135;0.208)												0.412322	264.081492	265.499616	87	124	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55363465	55363465	11566	11	C	A	A	25	25	OR5D16	A	3	3
OR5M3	219482	broad.mit.edu	36	11	55994503	55994503	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55994503G>A	uc001niw.1	-	c.47C>T	c.(46-48)ACG>ATG	p.T16M		NM_001004742	NP_001004742	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M,	16	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)													0.456311	142.016031	142.18573	47	56	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55994503	55994503	11585	11	G	A	A	40	40	OR5M3	A	1	1
ANO1	55107	broad.mit.edu	36	11	69626875	69626875	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:69626875G>A	uc001opj.1	+	c.497G>A	c.(496-498)TGC>TAC	p.C166Y	ANO1_uc001opi.1_Missense_Mutation_p.C166Y|ANO1_uc001opk.1_Missense_Mutation_p.C138Y|ANO1_uc001opl.1_Non-coding_Transcript	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	transmembrane protein 16A	166	Cytoplasmic (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2														0.321429	23.269866	24.060468	9	19	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69626875	69626875	703	11	G	A	A	46	46	ANO1	A	2	2
PAAF1	80227	broad.mit.edu	36	11	73305262	73305262	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:73305262G>A	uc001ouk.1	+	c.844G>A	c.(844-846)GCT>ACT	p.A282T	PAAF1_uc001oul.1_Missense_Mutation_p.A265T|PAAF1_uc009ytx.1_Non-coding_Transcript|PAAF1_uc001oum.1_Missense_Mutation_p.A265T|PAAF1_uc001oun.1_5'Flank	NM_025155	NP_079431	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	282	WD 4.				interspecies interaction between organisms	proteasome complex	protein binding			ovary(1)	1	Breast(11;7.42e-05)													0.450549	126.164247	126.358	41	50	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73305262	73305262	11775	11	G	A	A	38	38	PAAF1	A	1	1
XRRA1	143570	broad.mit.edu	36	11	74237067	74237067	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:74237067A>G	uc009yub.1	-	c.1445T>C	c.(1444-1446)ATG>ACG	p.M482T	XRRA1_uc001ovm.2_Non-coding_Transcript|XRRA1_uc001ovo.1_Missense_Mutation_p.M90T|XRRA1_uc001ovq.2_Missense_Mutation_p.M395T|XRRA1_uc001ovp.2_Missense_Mutation_p.M207T|XRRA1_uc001ovr.2_Missense_Mutation_p.M105T|XRRA1_uc001ovn.1_Missense_Mutation_p.M105T|XRRA1_uc001ovs.1_Missense_Mutation_p.M84T	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1	482					response to X-ray	cytoplasm|nucleus					0														0.507463	103.441672	103.444827	34	33	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74237067	74237067	18044	11	A	G	G	8	8	XRRA1	G	4	4
KSR2	283455	broad.mit.edu	36	12	116501335	116501335	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:116501335G>A	uc001two.2	-	c.1210C>T	c.(1210-1212)CTT>TTT	p.L404F		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	433	Phorbol-ester/DAG-type.				intracellular signal transduction|protein phosphorylation	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity	p.L465F(1)		lung(7)|central_nervous_system(2)|large_intestine(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)									623				0.392857	34.419139	34.700526	11	17	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116501335	116501335	8905	12	G	A	A	34	34	KSR2	A	2	2
CCDC60	160777	broad.mit.edu	36	12	118350950	118350950	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:118350950G>A	uc001txe.1	+	c.170G>A	c.(169-171)CGC>CAC	p.R57H		NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	57										ovary(2)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)													0.37037	32.243383	32.641959	10	17	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(302;0.207)	Missense_Mutation	SNP	118350950	118350950	2954	12	G	A	A	39	39	CCDC60	A	1	1
GPR133	283383	broad.mit.edu	36	12	130053769	130053769	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:130053769G>T	uc001uit.2	+	c.1113G>T	c.(1111-1113)CAG>CAT	p.Q371H		NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	371	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)													0.439759	217.145208	217.67113	73	93	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)	Missense_Mutation	SNP	130053769	130053769	6917	12	G	T	T	35	35	GPR133	T	3	3
NR4A1	3164	broad.mit.edu	36	12	50738769	50738769	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0648-01	TCGA-06-0648-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:50738769T>G	uc001rzq.1	+	c.1733T>G	c.(1732-1734)GTG>GGG	p.V578G	NR4A1_uc001rzs.1_Missense_Mutation_p.V524G|NR4A1_uc001rzt.1_Missense_Mutation_p.V524G|NR4A1_uc009zmc.1_Missense_Mutation_p.W138G	NM_173157	NP_775180	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	524					nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0														0.6	8.093052	8.152727	6	4	TT		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(357;0.0967)	Missense_Mutation	SNP	50738769	50738769	11037	12	T	G	G	59	59	NR4A1	G	4	4
KRT4	3851	broad.mit.edu	36	12	51494296	51494296	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51494296G>A	uc001saz.1	-	c.36C>T	c.(34-36)AAC>AAT	p.N12N		NM_002272	NP_002263	P19013	K2C4_HUMAN	keratin 4	Error:Variant_position_missing_in_P19013_after_alignment					cytoskeleton organization|epithelial cell differentiation|negative regulation of epithelial cell proliferation	keratin filament	structural molecule activity			ovary(4)	4						Pancreas(190;284 2995 41444 45903)								0.425926	141.134337	141.650874	46	62	GG		KEEP	---	---	---	---	capture			Silent	SNP	51494296	51494296	8792	12	G	A	A	40	40	KRT4	A	1	1
C12orf66	144577	broad.mit.edu	36	12	62874666	62874666	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:62874666G>A	uc001srw.2	-	c.561C>T	c.(559-561)TTC>TTT	p.F187F	C12orf66_uc009zql.1_Silent_p.F134F	NM_152440	NP_689653	Q96MD2	CL066_HUMAN	hypothetical protein LOC144577	187										ovary(1)	1														0.433333	118.710545	119.059452	39	51	GG		KEEP	---	---	---	---	capture			Silent	SNP	62874666	62874666	1753	12	G	A	A	41	41	C12orf66	A	2	2
GRK1	6011	broad.mit.edu	36	13	113369753	113369753	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:113369753C>T	uc001vua.1	+	c.51C>T	c.(49-51)GCC>GCT	p.A17A		NM_002929	NP_002920	Q15835	RK_HUMAN	rhodopsin kinase	17	N-terminal.				regulation of G-protein coupled receptor protein signaling pathway|rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|rhodopsin kinase activity|signal transducer activity			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)								178				0.4	24.896149	25.07103	8	12	CC		KEEP	---	---	---	---	capture	all cancers(43;0.234)		Silent	SNP	113369753	113369753	7069	13	C	T	T	23	23	GRK1	T	1	1
AHNAK2	113146	broad.mit.edu	36	14	104481891	104481891	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:104481891A>G	uc010axc.1	-	c.10942T>C	c.(10942-10944)TTC>CTC	p.F3648L	AHNAK2_uc001ypx.2_Missense_Mutation_p.F3548L	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3648						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)												0.386167	455.689092	459.623677	134	213	AA		KEEP	---	---	---	---	capture	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		Missense_Mutation	SNP	104481891	104481891	418	14	A	G	G	4	4	AHNAK2	G	4	4
SERPINA6	866	broad.mit.edu	36	14	93850153	93850153	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:93850153C>T	uc001ycv.1	-	c.586G>A	c.(586-588)GTC>ATC	p.V196I	SERPINA6_uc010auv.1_Non-coding_Transcript	NM_001756	NP_001747	P08185	CBG_HUMAN	corticosteroid binding globulin precursor	196					regulation of proteolysis|transport	extracellular space	serine-type endopeptidase inhibitor activity|steroid binding			skin(2)|ovary(1)|central_nervous_system(1)	4		all_cancers(154;0.0482)|all_epithelial(191;0.166)			Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)									0.428571	166.749501	167.3405	57	76	CC		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(157;0.211)	Missense_Mutation	SNP	93850153	93850153	14581	14	C	T	T	19	19	SERPINA6	T	1	1
C15orf41	84529	broad.mit.edu	36	15	34737354	34737354	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:34737354G>C	uc001zjd.1	+	c.302G>C	c.(301-303)CGG>CCG	p.R101P	C15orf41_uc001zje.2_Missense_Mutation_p.R101P|C15orf41_uc010bbb.1_Missense_Mutation_p.R3P|C15orf41_uc001zjf.1_Missense_Mutation_p.R3P	NM_032499	NP_115888	Q9Y2V0	CO041_HUMAN	hypothetical protein LOC84529 isoform 2	101							protein binding			pancreas(1)	1		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)												0.333333	6.608525	6.897615	4	8	GG		KEEP	---	---	---	---	capture		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)	Missense_Mutation	SNP	34737354	34737354	1845	15	G	C	C	39	39	C15orf41	C	3	3
DUOX2	50506	broad.mit.edu	36	15	43179562	43179562	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:43179562G>A	uc010bea.1	-	c.3162C>T	c.(3160-3162)GGC>GGT	p.G1054G	DUOX2_uc001zun.1_Silent_p.G1054G	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	1054	Interaction with TXNDC11 (By similarity).|Helical; (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|oxidation-reduction process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|pancreas(1)	3		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)												0.765625	154.99716	159.127413	49	15	GG		KEEP	---	---	---	---	capture		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)	Silent	SNP	43179562	43179562	4986	15	G	A	A	38	38	DUOX2	A	1	1
SYNM	23336	broad.mit.edu	36	15	97487602	97487602	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:97487602C>T	uc002bup.1	+	c.1514C>T	c.(1513-1515)ACG>ATG	p.T505M	SYNM_uc002buo.1_Missense_Mutation_p.T505M|SYNM_uc002buq.1_Intron	NM_145728	NP_663780	O15061	SYNEM_HUMAN	desmuslin isoform A	505	Tail.				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding			ovary(3)|central_nervous_system(1)	4						Pancreas(125;1071 1762 21750 40003 40381)								0.238095	10.352818	11.68143	5	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	97487602	97487602	15976	15	C	T	T	19	19	SYNM	T	1	1
LRRK1	79705	broad.mit.edu	36	15	99403721	99403721	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:99403721C>T	uc002bwr.1	+	c.2976C>T	c.(2974-2976)CCC>CCT	p.P992P		NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	992					protein phosphorylation|small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)								p.P992P(VMRCLCD-Tumor)	1100				0.536585	225.859594	226.002772	66	57	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		Silent	SNP	99403721	99403721	9408	15	C	T	T	22	22	LRRK1	T	2	2
PCSK6	5046	broad.mit.edu	36	15	99787783	99787783	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:99787783G>A	uc002bxa.1	-	c.666C>T	c.(664-666)TAC>TAT	p.Y222Y	PCSK6_uc010bpd.1_Silent_p.Y92Y|PCSK6_uc002bwy.1_Silent_p.Y222Y|PCSK6_uc010bpe.1_Silent_p.Y222Y|PCSK6_uc002bxb.1_Silent_p.Y222Y|PCSK6_uc002bxc.1_Silent_p.Y222Y|PCSK6_uc002bxd.1_Silent_p.Y222Y|PCSK6_uc002bxe.1_Silent_p.Y222Y|PCSK6_uc002bxg.1_Silent_p.Y222Y	NM_138320	NP_612193	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	222	Catalytic.				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)													0.275	29.322576	31.137054	11	29	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		Silent	SNP	99787783	99787783	12025	15	G	A	A	40	40	PCSK6	A	1	1
AMDHD2	51005	broad.mit.edu	36	16	2517934	2517934	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:2517934G>T	uc002cqp.1	+	c.575G>T	c.(574-576)CGT>CTT	p.R192L	AMDHD2_uc002cqq.1_Missense_Mutation_p.R192L	NM_015944	NP_057028	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2	192					N-acetylglucosamine metabolic process		N-acetylglucosamine-6-phosphate deacetylase activity			large_intestine(1)|breast(1)	2														0.166667	6.586641	9.114427	4	20	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2517934	2517934	571	16	G	T	T	40	40	AMDHD2	T	3	3
OR3A2	4995	broad.mit.edu	36	17	3128488	3128488	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:3128488G>A	uc002fvg.1	-	c.492C>T	c.(490-492)AAC>AAT	p.N164N		NM_002551	NP_002542	P47893	OR3A2_HUMAN	olfactory receptor, family 3, subfamily A,	164	Helical; Name=4; (Potential).				sensory perception of smell	integral to plasma membrane	olfactory receptor activity			ovary(1)	1						GBM(166;478 2018 3875 5042 31983)|Esophageal Squamous(77;407 1232 1405 14297 15272)								0.434783	235.583766	236.262696	80	104	GG		KEEP	---	---	---	---	capture			Silent	SNP	3128488	3128488	11444	17	G	A	A	40	40	OR3A2	A	1	1
MLLT6	4302	broad.mit.edu	36	17	34126692	34126692	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:34126692C>T	uc002hqi.2	+	c.1583C>T	c.(1582-1584)TCC>TTC	p.S528F	MLLT6_uc002hqj.2_Intron|MLLT6_uc002hqk.2_5'Flank	NM_005937	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	528					regulation of transcription, DNA-dependent	nucleus	protein binding|zinc ion binding			skin(1)	1	Breast(7;4.43e-21)									439				0.327869	55.680128	57.282363	20	41	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	34126692	34126692	10020	17	C	T	T	30	30	MLLT6	T	2	2
OR4D2	124538	broad.mit.edu	36	17	53602706	53602706	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:53602706G>A	uc002ivo.1	+	c.691G>A	c.(691-693)GAG>AAG	p.E231K		NM_001004707	NP_001004707	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D,	231	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2														0.451852	188.465616	188.737075	61	74	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53602706	53602706	11463	17	G	A	A	41	41	OR4D2	A	2	2
GRIN2C	2905	broad.mit.edu	36	17	70358413	70358413	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:70358413C>A	uc002jlt.1	-	c.1202G>T	c.(1201-1203)CGG>CTG	p.R401L	GRIN2C_uc002jlu.1_Missense_Mutation_p.R401L|GRIN2C_uc002jlv.1_3'UTR	NM_000835	NP_000826	Q14957	NMDE3_HUMAN	N-methyl-D-aspartate receptor subunit 2C	401	Extracellular (Potential).				glutamate signaling pathway	cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|N-methyl-D-aspartate selective glutamate receptor activity			ovary(2)|breast(2)	4	all_lung(278;0.172)|Lung NSC(278;0.207)				Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)									0.410256	99.39074	99.937885	32	46	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70358413	70358413	7060	17	C	A	A	23	23	GRIN2C	A	3	3
DNAH2	146754	broad.mit.edu	36	17	7677232	7677232	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7677232G>A	uc002giu.1	+	c.13097G>A	c.(13096-13098)CGG>CAG	p.R4366Q		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	4366					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|central_nervous_system(1)	7		all_cancers(10;4.66e-07)|Prostate(122;0.081)												0.11828	14.680083	27.974614	11	82	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7677232	7677232	4785	17	G	A	A	39	39	DNAH2	A	1	1
C18orf45	85019	broad.mit.edu	36	18	19233529	19233529	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0648-01	TCGA-06-0648-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr18:19233529A>T	uc002kuf.1	-	c.278T>A	c.(277-279)CTG>CAG	p.L93Q	C18orf45_uc002kug.1_Non-coding_Transcript|C18orf45_uc002kuh.1_Non-coding_Transcript	NM_032933	NP_116322	Q24JQ0	CR045_HUMAN	hypothetical protein LOC85019	93	Helical; (Potential).					integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)													0.126984	10.751807	19.310147	8	55	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19233529	19233529	1964	18	A	T	T	7	7	C18orf45	T	4	4
LGALS13	29124	broad.mit.edu	36	19	44787728	44787728	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:44787728C>T	uc002omb.1	+	c.163C>T	c.(163-165)CGA>TGA	p.R55*		NM_013268	NP_037400	Q9UHV8	PP13_HUMAN	galectin-13	55	Galectin.				lipid catabolic process|phospholipid metabolic process		lysophospholipase activity|sugar binding			ovary(1)	1	all_cancers(60;1.77e-05)|all_lung(34;5.38e-08)|Lung NSC(34;6.37e-08)|Ovarian(47;0.116)													0.235294	50.755811	56.203579	20	65	CC		KEEP	---	---	---	---	capture	Epithelial(26;3.28e-26)|OV - Ovarian serous cystadenocarcinoma(5;7.31e-25)|all cancers(26;1.15e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)		Nonsense_Mutation	SNP	44787728	44787728	9065	19	C	T	T	23	23	LGALS13	T	5	1
CEACAM7	1087	broad.mit.edu	36	19	46879586	46879586	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:46879586G>A	uc002ori.1	-	c.676C>T	c.(676-678)CGC>TGC	p.R226C	CEACAM7_uc010ehx.1_Missense_Mutation_p.R226C|CEACAM7_uc010ehy.1_Intron	NM_006890	NP_008821	Q14002	CEAM7_HUMAN	carcinoembryonic antigen-related cell adhesion	226	Ig-like C2-type.					anchored to membrane|integral to membrane|plasma membrane				ovary(2)	2														0.361991	243.355663	247.053006	80	141	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)	Missense_Mutation	SNP	46879586	46879586	3330	19	G	A	A	39	39	CEACAM7	A	1	1
BCAM	4059	broad.mit.edu	36	19	50014807	50014807	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:50014807C>T	uc002ozu.1	+	c.1747C>T	c.(1747-1749)CGG>TGG	p.R583W	BCAM_uc002ozt.1_Missense_Mutation_p.R583W	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1	583	Cytoplasmic (Potential).				cell-matrix adhesion	external side of plasma membrane|integral to plasma membrane	laminin binding|laminin receptor activity				0	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)												0.592593	97.376922	97.776693	32	22	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	50014807	50014807	1365	19	C	T	T	27	27	BCAM	T	1	1
EML2	24139	broad.mit.edu	36	19	50829560	50829560	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:50829560G>T	uc002pcq.1	-	c.792C>A	c.(790-792)TAC>TAA	p.Y264*	EML2_uc002pcn.1_Nonsense_Mutation_p.Y63*|EML2_uc002pco.1_Non-coding_Transcript|EML2_uc002pcp.1_Intron|EML2_uc010ekj.1_Nonsense_Mutation_p.Y63*|EML2_uc010ekk.1_5'Flank	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like	63					sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)												0.307692	7.60714	8.030575	4	9	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)	Nonsense_Mutation	SNP	50829560	50829560	5289	19	G	T	T	44	44	EML2	T	5	3
FPR2	2358	broad.mit.edu	36	19	56963884	56963884	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:56963884G>A	uc002pxr.1	+	c.161G>A	c.(160-162)CGG>CAG	p.R54Q	FPR2_uc002pxs.2_Missense_Mutation_p.R54Q|FPR2_uc010epf.1_Missense_Mutation_p.R54Q|FPR2_uc010epg.1_Missense_Mutation_p.R54Q	NM_001005738	NP_001453	P25090	FPR2_HUMAN	formyl peptide receptor-like 1	54	Cytoplasmic (Potential).				cell adhesion|cellular component movement|chemotaxis|inflammatory response	integral to membrane|plasma membrane	N-formyl peptide receptor activity			ovary(1)	1														0.382653	233.512924	235.86679	75	121	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	56963884	56963884	6285	19	G	A	A	39	39	FPR2	A	1	1
ZNF835	90485	broad.mit.edu	36	19	61867880	61867880	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:61867880C>G	uc002qno.1	-	c.565G>C	c.(565-567)GCC>CCC	p.A189P		NM_001005850	NP_001005850	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	189	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(3)|skin(1)	4														0.375	6.705315	6.973207	6	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61867880	61867880	18785	19	C	G	G	27	27	ZNF835	G	3	3
DBT	1629	broad.mit.edu	36	1	100479018	100479018	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:100479018C>T	uc001dta.1	-	c.62G>A	c.(61-63)CGC>CAC	p.R21H		NM_001918	NP_001909	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase	21					branched chain family amino acid catabolic process|fatty-acyl-CoA biosynthetic process	microtubule cytoskeleton|mitochondrial alpha-ketoglutarate dehydrogenase complex|mitochondrial nucleoid	acyltransferase activity|cofactor binding|dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity|protein binding			pancreas(1)	1		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)												0.370861	161.758716	163.972099	56	95	CC		KEEP	---	---	---	---	capture		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)	Missense_Mutation	SNP	100479018	100479018	4429	1	C	T	T	27	27	DBT	T	1	1
C1orf187	374946	broad.mit.edu	36	1	11688912	11688912	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:11688912C>G	uc001asr.1	+	c.10C>G	c.(10-12)CCT>GCT	p.P4A		NM_198545	NP_940947	Q8NBI3	DRAXI_HUMAN	chromosome 1 open reading frame 187	4					axon guidance|commissural neuron differentiation in spinal cord|dorsal spinal cord development|forebrain development|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular region					0	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)												0.294118	10.111967	10.732275	5	12	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.48e-06)|COAD - Colon adenocarcinoma(227;0.000283)|BRCA - Breast invasive adenocarcinoma(304;0.000316)|Kidney(185;0.000841)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|STAD - Stomach adenocarcinoma(313;0.00754)|READ - Rectum adenocarcinoma(331;0.0651)	Missense_Mutation	SNP	11688912	11688912	2089	1	C	G	G	26	26	C1orf187	G	3	3
ANP32E	81611	broad.mit.edu	36	1	148469558	148469558	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:148469558A>G	uc001etw.1	-	c.299T>C	c.(298-300)ATA>ACA	p.I100T	ANP32E_uc001etv.2_Missense_Mutation_p.I100T	NM_030920	NP_112182	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32	100	LRR 4.					cytoplasmic membrane-bounded vesicle|nucleus	phosphatase inhibitor activity				0	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)													0.446667	234.910367	235.281207	67	83	AA		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(543;0.171)		Missense_Mutation	SNP	148469558	148469558	717	1	A	G	G	16	16	ANP32E	G	4	4
PLA2G2A	5320	broad.mit.edu	36	1	20177511	20177511	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:20177511C>G	uc001bcu.1	-	c.134G>C	c.(133-135)GGC>GCC	p.G45A	PLA2G2A_uc001bcv.1_Missense_Mutation_p.G45A	NM_000300	NP_000291	P14555	PA2GA_HUMAN	phospholipase A2, group IIA	45					defense response to Gram-positive bacterium|lipid catabolic process|low-density lipoprotein particle remodeling|phosphatidic acid metabolic process|positive regulation of inflammatory response|positive regulation of macrophage derived foam cell differentiation	endoplasmic reticulum|extracellular space|membrane	calcium ion binding|calcium-dependent phospholipase A2 activity|phospholipid binding				0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)												0.333333	12.188016	12.71988	7	14	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000138)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.00032)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Missense_Mutation	SNP	20177511	20177511	12421	1	C	G	G	26	26	PLA2G2A	G	3	3
SMYD2	56950	broad.mit.edu	36	1	212572078	212572078	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:212572078C>A	uc009xdk.1	+	c.1032C>A	c.(1030-1032)TAC>TAA	p.Y344*	SMYD2_uc009xdl.1_Intron	NM_020197	NP_064582	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2	344					negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	cytosol|nucleus	histone methyltransferase activity (H3-K36 specific)|p53 binding|RNA polymerase II core binding|zinc ion binding			ovary(1)	1												OREG0012979	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.340659	91.79587	93.838608	31	60	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)	Nonsense_Mutation	SNP	212572078	212572078	15322	1	C	A	A	18	18	SMYD2	A	5	3
PLCG1	5335	broad.mit.edu	36	20	39221774	39221774	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr20:39221774A>G	uc002xjo.1	+	c.332A>G	c.(331-333)TAT>TGT	p.Y111C	PLCG1_uc002xjp.1_Missense_Mutation_p.Y111C	NM_002660	NP_002651	P19174	PLCG1_HUMAN	phospholipase C gamma 1 isoform a	111	PH 1.				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			breast(3)|lung(2)|skin(1)	6		Myeloproliferative disorder(115;0.00878)								429				0.463576	247.859126	248.030727	70	81	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39221774	39221774	12461	20	A	G	G	16	16	PLCG1	G	4	4
RRP1B	23076	broad.mit.edu	36	21	43931869	43931869	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:43931869C>T	uc002zdk.1	+	c.1186C>T	c.(1186-1188)CTT>TTT	p.L396F	RRP1B_uc002zdl.1_5'UTR	NM_015056	NP_055871	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1 homolog B	396					rRNA processing	cytosol|nucleolus|preribosome, small subunit precursor	protein binding				0														0.426752	215.998179	216.733457	67	90	CC		KEEP	---	---	---	---	capture		STAD - Stomach adenocarcinoma(101;0.178)	Missense_Mutation	SNP	43931869	43931869	14168	21	C	T	T	32	32	RRP1B	T	2	2
CABIN1	23523	broad.mit.edu	36	22	22817684	22817684	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:22817684G>A	uc002zzi.1	+	c.3673G>A	c.(3673-3675)GTT>ATT	p.V1225I	CABIN1_uc002zzj.1_Missense_Mutation_p.V1175I|CABIN1_uc002zzl.1_Missense_Mutation_p.V1225I	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1225					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.5	204.368039	204.368039	71	71	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22817684	22817684	2644	22	G	A	A	40	40	CABIN1	A	1	1
TTN	7273	broad.mit.edu	36	2	179265059	179265059	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179265059G>T	uc002umr.1	-	c.27959C>A	c.(27958-27960)CCC>CAC	p.P9320H	TTN_uc002ums.1_Intron|TTN_uc010frc.1_Intron|TTN_uc010frd.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.P5981H|TTN_uc010fre.1_Missense_Mutation_p.P431H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10247										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153										8722				0.402439	101.959895	102.642019	33	49	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		Missense_Mutation	SNP	179265059	179265059	17290	2	G	T	T	43	43	TTN	T	3	3
TTN	7273	broad.mit.edu	36	2	179278207	179278207	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179278207C>T	uc002umr.1	-	c.25811G>A	c.(25810-25812)CGA>CAA	p.R8604Q	TTN_uc002ums.1_Intron|TTN_uc010frc.1_Intron|TTN_uc010frd.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R5265Q|TTN_uc010fre.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9531										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153										8722				0.411765	196.502084	197.541147	63	90	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		Missense_Mutation	SNP	179278207	179278207	17290	2	C	T	T	31	31	TTN	T	1	1
RMND5A	64795	broad.mit.edu	36	2	86846506	86846506	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:86846506G>A	uc002srr.1	+	c.702G>A	c.(700-702)TTG>TTA	p.L234L	RMND5A_uc002srs.2_Intron	NM_022780	NP_073617	Q9H871	RMD5A_HUMAN	required for meiotic nuclear division 5 homolog	234										ovary(1)	1														0.529412	137.074312	137.137847	45	40	GG		KEEP	---	---	---	---	capture			Silent	SNP	86846506	86846506	13874	2	G	A	A	45	45	RMND5A	A	2	2
GCET2	257144	broad.mit.edu	36	3	113325127	113325127	+	Silent	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:113325127A>G	uc003dys.1	-	c.402T>C	c.(400-402)CCT>CCC	p.P134P	C3orf52_uc003dyr.1_Intron|GCET2_uc003dyt.1_Silent_p.P68P	NM_152785	NP_001008756	Q8N6F7	GCET2_HUMAN	germinal center expressed transcript 2 isoform	134						mitochondrion					0														0.093923	34.783011	94.756648	34	328	AA		KEEP	---	---	---	---	capture			Silent	SNP	113325127	113325127	6554	3	A	G	G	3	3	GCET2	G	4	4
FGD5	152273	broad.mit.edu	36	3	14837439	14837439	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:14837439C>T	uc003bzc.1	+	c.1134C>T	c.(1132-1134)TTC>TTT	p.F378F		NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	619					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5														0.512397	192.554281	192.570805	62	59	CC		KEEP	---	---	---	---	capture			Silent	SNP	14837439	14837439	6073	3	C	T	T	31	31	FGD5	T	1	1
ABCF3	55324	broad.mit.edu	36	3	185390045	185390045	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:185390045C>A	uc003fmz.2	+	c.1120C>A	c.(1120-1122)CCC>ACC	p.P374T	ABCF3_uc003fna.2_Missense_Mutation_p.P368T|ABCF3_uc003fnb.2_Missense_Mutation_p.P55T	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	374	ABC transporter 1.						ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)													0.58	259.688071	260.518097	87	63	CC		KEEP	---	---	---	---	capture	Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Missense_Mutation	SNP	185390045	185390045	68	3	C	A	A	26	26	ABCF3	A	3	3
TLL1	7092	broad.mit.edu	36	4	167180015	167180015	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:167180015C>T	uc003irh.1	+	c.1233C>T	c.(1231-1233)GAC>GAT	p.D411D		NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1	411	CUB 1.				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)|breast(1)|central_nervous_system(1)	4	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)												0.364583	103.204457	104.750733	35	61	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(119;0.103)	Silent	SNP	167180015	167180015	16475	4	C	T	T	19	19	TLL1	T	1	1
ODZ3	55714	broad.mit.edu	36	4	183831214	183831214	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:183831214C>T	uc003ivd.1	+	c.1174C>T	c.(1174-1176)CGA>TGA	p.R392*		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	392	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)												0.392857	35.019691	35.300889	11	17	CC		KEEP	---	---	---	---	capture		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)	Nonsense_Mutation	SNP	183831214	183831214	11241	4	C	T	T	23	23	ODZ3	T	5	1
ODZ3	55714	broad.mit.edu	36	4	183831337	183831337	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:183831337C>T	uc003ivd.1	+	c.1297C>T	c.(1297-1299)CGG>TGG	p.R433W		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	433	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)												0.347826	73.483123	74.89163	24	45	CC		KEEP	---	---	---	---	capture		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)	Missense_Mutation	SNP	183831337	183831337	11241	4	C	T	T	23	23	ODZ3	T	1	1
FAT1	2195	broad.mit.edu	36	4	187794874	187794874	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:187794874G>A	uc003izf.1	-	c.3831C>T	c.(3829-3831)ACC>ACT	p.T1277T		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	1277	Extracellular (Potential).|Cadherin 11.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						Colon(197;1040 2055 4143 4984 49344)								0.403774	685.85509	690.14309	214	316	GG		KEEP	---	---	---	---	capture			Silent	SNP	187794874	187794874	5925	4	G	A	A	39	39	FAT1	A	1	1
PCDH7	5099	broad.mit.edu	36	4	30333365	30333365	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:30333365A>G	uc010iez.1	+	c.1082A>G	c.(1081-1083)GAG>GGG	p.E361G	PCDH7_uc003gsj.1_Missense_Mutation_p.E408G|PCDH7_uc003gsk.1_Missense_Mutation_p.E408G	NM_032457	NP_115833	O60245	PCDH7_HUMAN	protocadherin 7 isoform c precursor	408	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4														0.452055	107.969022	108.114807	33	40	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30333365	30333365	11936	4	A	G	G	11	11	PCDH7	G	4	4
EVC2	132884	broad.mit.edu	36	4	5681251	5681251	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:5681251G>A	uc003gij.1	-	c.1822C>T	c.(1822-1824)CGT>TGT	p.R608C	EVC2_uc003gik.1_Missense_Mutation_p.R528C	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin	608						integral to membrane				large_intestine(3)|ovary(2)	5														0.455782	215.117719	215.366781	67	80	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5681251	5681251	5479	4	G	A	A	39	39	EVC2	A	1	1
CXCL6	6372	broad.mit.edu	36	4	74921655	74921655	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:74921655C>A	uc003hhf.1	+	c.220C>A	c.(220-222)CAG>AAG	p.Q74K		NM_002993	NP_002984	P80162	CXCL6_HUMAN	chemokine (C-X-C motif) ligand 6 (granulocyte	74					cell-cell signaling|chemotaxis|immune response|inflammatory response|signal transduction	extracellular space	chemokine activity|heparin binding				0	Breast(15;0.00102)													0.137931	25.772401	40.436406	16	100	CC		KEEP	---	---	---	---	capture	all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)		Missense_Mutation	SNP	74921655	74921655	4248	4	C	A	A	25	25	CXCL6	A	3	3
SLC2A9	56606	broad.mit.edu	36	4	9498359	9498359	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:9498359G>A	uc003gmc.1	-	c.1221C>T	c.(1219-1221)CAC>CAT	p.H407H	SLC2A9_uc003gmd.1_Silent_p.H378H	NM_020041	NP_064425	Q9NRM0	GTR9_HUMAN	solute carrier family 2, member 9 protein	407	Extracellular (Potential).				glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3														0.375	17.446223	17.66563	6	10	GG		KEEP	---	---	---	---	capture			Silent	SNP	9498359	9498359	15049	4	G	A	A	40	40	SLC2A9	A	1	1
DMXL1	1657	broad.mit.edu	36	5	118531433	118531433	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:118531433A>G	uc010jcl.1	+	c.5373A>G	c.(5371-5373)ATA>ATG	p.I1791M	DMXL1_uc003ksd.2_Missense_Mutation_p.I1791M	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1791										ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)												0.091743	10.767892	29.0619	10	99	AA		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)	Missense_Mutation	SNP	118531433	118531433	4776	5	A	G	G	13	13	DMXL1	G	4	4
SLIT3	6586	broad.mit.edu	36	5	168045305	168045305	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:168045305C>T	uc010jjg.1	-	c.3541G>A	c.(3541-3543)GCC>ACC	p.A1181T	SLIT3_uc003mab.1_Missense_Mutation_p.A1174T	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3	1174	Laminin G-like.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding	p.A1174T(1)		ovary(3)	3	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)				Ovarian(29;311 847 10864 17279 24903)								0.409091	182.475072	183.591046	63	91	CC		KEEP	---	---	---	---	capture	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Missense_Mutation	SNP	168045305	168045305	15239	5	C	T	T	27	27	SLIT3	T	1	1
STK10	6793	broad.mit.edu	36	5	171412571	171412571	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:171412571C>T	uc003mbo.1	-	c.2733G>A	c.(2731-2733)AAG>AAA	p.K911K		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	911	Potential.				protein phosphorylation		ATP binding|protein serine/threonine kinase activity			ovary(3)|testis(1)|lung(1)|pancreas(1)	6	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)								570				0.345865	144.108913	146.899347	46	87	CC		KEEP	---	---	---	---	capture	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		Silent	SNP	171412571	171412571	15806	5	C	T	T	24	24	STK10	T	2	2
LMAN2	10960	broad.mit.edu	36	5	176698147	176698147	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:176698147G>A	uc003mge.1	-	c.381C>T	c.(379-381)AAC>AAT	p.N127N	LMAN2_uc003mgd.1_Silent_p.N127N	NM_006816	NP_006807	Q12907	LMAN2_HUMAN	lectin, mannose-binding 2 precursor	127	Lumenal (Potential).|L-type lectin-like.				protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	sugar binding				0	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)												0.401515	310.39284	312.630539	106	158	GG		KEEP	---	---	---	---	capture	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Silent	SNP	176698147	176698147	9167	5	G	A	A	44	44	LMAN2	A	2	2
CANX	821	broad.mit.edu	36	5	179065346	179065346	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:179065346G>A	uc003mkk.1	+	c.58G>A	c.(58-60)GCT>ACT	p.A20T	CANX_uc010jlb.1_Missense_Mutation_p.A20T|CANX_uc003mkl.1_Missense_Mutation_p.A20T	NM_001746	NP_001737	P27824	CALX_HUMAN	calnexin precursor	20					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein secretion	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane|melanosome	calcium ion binding|sugar binding|unfolded protein binding				0	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)			Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)									0.418182	617.03321	619.926898	207	288	GG		KEEP	---	---	---	---	capture	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Missense_Mutation	SNP	179065346	179065346	2735	5	G	A	A	42	42	CANX	A	2	2
UTRN	7402	broad.mit.edu	36	6	144851572	144851572	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0648-01	TCGA-06-0648-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:144851572T>A	uc003qkt.1	+	c.4043T>A	c.(4042-4044)GTC>GAC	p.V1348D		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1348	Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(3)|pancreas(1)	4		Ovarian(120;0.218)												0.161765	18.988223	26.383667	11	57	TT		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)	Missense_Mutation	SNP	144851572	144851572	17668	6	T	A	A	58	58	UTRN	A	4	4
LRFN2	57497	broad.mit.edu	36	6	40467834	40467834	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:40467834C>T	uc003oph.1	-	c.2196G>A	c.(2194-2196)GCG>GCA	p.A732A		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	732	Cytoplasmic (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)													0.545455	76.604342	76.683639	24	20	CC		KEEP	---	---	---	---	capture			Silent	SNP	40467834	40467834	9311	6	C	T	T	23	23	LRFN2	T	1	1
UNC5CL	222643	broad.mit.edu	36	6	41104116	41104116	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:41104116C>T	uc003opi.1	-	c.1531G>A	c.(1531-1533)GGC>AGC	p.G511S		NM_173561	NP_775832	Q8IV45	UN5CL_HUMAN	unc-5 homolog C-like	511	Cytoplasmic (Potential).				signal transduction	cytoplasm|integral to membrane				ovary(2)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)											OREG0017423	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.35	20.918268	21.315623	7	13	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41104116	41104116	17552	6	C	T	T	22	22	UNC5CL	T	2	2
SLC29A4	222962	broad.mit.edu	36	7	5297006	5297006	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:5297006A>G	uc003sod.1	+	c.287A>G	c.(286-288)CAT>CGT	p.H96R	SLC29A4_uc003soc.1_Missense_Mutation_p.H96R|SLC29A4_uc003soe.1_Missense_Mutation_p.H96R	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN	solute carrier family 29 (nucleoside	96	Cytoplasmic (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity			liver(1)	1		Ovarian(82;0.0175)												0.2	58.345513	69.650029	27	108	AA		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Missense_Mutation	SNP	5297006	5297006	15034	7	A	G	G	8	8	SLC29A4	G	4	4
MCM4	4173	broad.mit.edu	36	8	49051802	49051802	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr8:49051802A>G	uc003xqk.1	+	c.2503A>G	c.(2503-2505)ATT>GTT	p.I835V	MCM4_uc003xql.1_Missense_Mutation_p.I835V	NM_182746	NP_877423	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	835					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(2)|skin(2)	4		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)								376				0.459459	183.718541	183.876979	51	60	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49051802	49051802	9778	8	A	G	G	4	4	MCM4	G	4	4
C9orf125	84302	broad.mit.edu	36	9	103278503	103278503	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:103278503G>A	uc004bbm.1	-	c.693C>T	c.(691-693)CGC>CGT	p.R231R	C9orf125_uc010mte.1_Silent_p.R231R	NM_032342	NP_115718	Q9BRR3	CI125_HUMAN	hypothetical protein LOC84302	231						integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)												0.378151	129.239893	130.792446	45	74	GG		KEEP	---	---	---	---	capture			Silent	SNP	103278503	103278503	2567	9	G	A	A	34	34	C9orf125	A	2	2
SMC2	10592	broad.mit.edu	36	9	105925222	105925222	+	Silent	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:105925222A>G	uc004bbv.1	+	c.2145A>G	c.(2143-2145)CTA>CTG	p.L715L	SMC2_uc004bbu.1_Silent_p.L715L|SMC2_uc004bbw.1_Silent_p.L715L|SMC2_uc004bbx.1_Silent_p.L715L	NM_001042551	NP_006435	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	715	Potential.				cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity			ovary(4)|skin(2)|lung(1)|breast(1)	8										1437				0.44	123.072049	123.306121	33	42	AA		KEEP	---	---	---	---	capture			Silent	SNP	105925222	105925222	15281	9	A	G	G	13	13	SMC2	G	4	4
COL27A1	85301	broad.mit.edu	36	9	116111379	116111379	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:116111379C>T	uc004bih.1	+	c.5236C>T	c.(5236-5238)CGG>TGG	p.R1746W	COL27A1_uc004bii.1_Non-coding_Transcript|COL27A1_uc004bij.1_Missense_Mutation_p.R61W	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1746	Fibrillar collagen NC1.				cell adhesion		extracellular matrix structural constituent			ovary(3)	3														0.396923	411.752447	414.759157	129	196	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116111379	116111379	3823	9	C	T	T	23	23	COL27A1	T	1	1
ATP6V1G1	9550	broad.mit.edu	36	9	116399807	116399807	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:116399807G>A	uc004bjc.1	+	c.320G>A	c.(319-321)CGG>CAG	p.R107Q		NM_004888	NP_004879	O75348	VATG1_HUMAN	vacuolar H+ ATPase G1	107					cellular iron ion homeostasis|insulin receptor signaling pathway|proton transport|transferrin transport	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase complex	ATPase binding|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances				0														0.424242	136.635956	137.131289	42	57	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116399807	116399807	1205	9	G	A	A	39	39	ATP6V1G1	A	1	1
FOXR2	139628	broad.mit.edu	36	X	55667651	55667651	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0648-01	TCGA-06-0648-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:55667651A>C	uc004duo.1	+	c.782A>C	c.(781-783)GAT>GCT	p.D261A		NM_198451	NP_940853	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	261	Fork-head.				embryo development|negative regulation of gene-specific transcription from RNA polymerase II promoter|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			lung(2)|central_nervous_system(1)	3														0.904762	298.471188	312.288645	76	8	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55667651	55667651	6278	23	A	C	C	12	12	FOXR2	C	4	4
KRTAP5-5	439915	broad.mit.edu	36	11	1608162	1608191	+	In_Frame_Del	DEL	CTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	-	-			TCGA-06-0648-01	TCGA-06-0648-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:1608162_1608191delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	uc001lty.1	+	c.516_545delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	c.(514-546)TCCTGCTGCCAGTCCAGCTGCTGTAAGCCTTAC>TCC	p.CCQSSCCKPY183del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	183_192	8 X 4 AA repeats of C-C-X-P.					keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)										0.33			51	105				---	---	---	---	capture_indel			In_Frame_Del	DEL	1608162	1608191	8886	11	CTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	-	-	24	24	KRTAP5-5	-	5	5
SPIRE2	84501	broad.mit.edu	36	16	88444467	88444467	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0648-01	TCGA-06-0648-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:88444467_88444467delC	uc002foz.1	+	c.543_543delC	c.(541-543)GACfs	p.D181fs	SPIRE2_uc010civ.1_Frame_Shift_Del_p.D96fs|SPIRE2_uc010ciw.1_Frame_Shift_Del_p.D181fs|SPIRE2_uc002fpa.1_Frame_Shift_Del_p.D133fs|SPIRE2_uc010cix.1_Frame_Shift_Del_p.D50fs	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2	181	KIND.				transport	cytoplasm|cytoskeleton	actin binding|zinc ion binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	88444467	88444467	15585	16	C	-	-	18	18	SPIRE2	-	5	5
ZNF784	147808	broad.mit.edu	36	19	60825600	60825601	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-0648-01	TCGA-06-0648-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:60825600_60825601insC	uc002qll.1	-	c.300_301insG	c.(298-303)CCGAGCfs	p.P100fs	ZNF784_uc010etb.1_Frame_Shift_Ins_p.R16fs	NM_203374	NP_976308	Q8NCA9	ZN784_HUMAN	zinc finger protein 784	100_101	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)										0.35			7	13				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	60825600	60825601	18754	19	-	C	C	54	54	ZNF784	C	5	5
ABCF1	23	broad.mit.edu	36	6	30660048	30660048	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0648-01	TCGA-06-0648-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:30660048_30660048delG	uc003nql.1	+	c.1203_1203delG	c.(1201-1203)CTGfs	p.L401fs	ABCF1_uc003nqk.2_Frame_Shift_Del_p.L402fs|ABCF1_uc003nqm.1_Frame_Shift_Del_p.L363fs|ABCF1_uc010jsb.1_Intron	NM_001025091	NP_001020262	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F, member 1	401	ABC transporter 1.				inflammatory response|translational initiation	nuclear envelope|nuclear envelope|nucleoplasm|nucleoplasm|polysomal ribosome	ATP binding|ATP binding|ATPase activity|protein binding|ribosome binding|translation activator activity|translation factor activity, nucleic acid binding			ovary(2)	2														0.36			42	74				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	30660048	30660048	66	6	G	-	-	47	47	ABCF1	-	5	5
RRAGA	10670	broad.mit.edu	36	9	19040524	19040525	+	In_Frame_Ins	INS	-	TTG	TTG			TCGA-06-0648-01	TCGA-06-0648-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:19040524_19040525insTTG	uc003znj.1	+	c.867_868insTTG	c.(865-870)insTTG	p.289_290insL		NM_006570	NP_006561	Q7L523	RRAGA_HUMAN	Ras-related GTP binding A	289_290					apoptosis|cellular protein localization|cellular response to amino acid stimulus|positive regulation of cytolysis|positive regulation of TOR signaling cascade|virus-host interaction	Golgi apparatus|lysosome|nucleus	GTP binding|phosphoprotein binding|protein heterodimerization activity|protein homodimerization activity				0														0.34			100	193				---	---	---	---	capture_indel			In_Frame_Ins	INS	19040524	19040525	14152	9	-	TTG	TTG	17	17	RRAGA	TTG	5	5
