Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
FAM178A	55719	broad.mit.edu	36	10	102666930	102666931	+	Missense_Mutation	DNP	TT	CA	CA			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:102666930_102666931TT>CA	uc001krs.2	+	c.798_799TT>CA	c.(796-801)TCTTTC>TCCATC	p.F267I	FAM178A_uc001krr.1_Missense_Mutation_p.F267I|FAM178A_uc001krt.2_Missense_Mutation_p.F267I|FAM178A_uc001kru.1_Missense_Mutation_p.F203I	NM_018121	NP_060591	Q8IX21	F178A_HUMAN	hypothetical protein LOC55719 isoform 1	267											0														0.285714	6.380447	6.967789	4	10	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	102666930	102666931	5709	10	TT	CA	CA	56	56	FAM178A	CA	4	4
FGFR2	2263	broad.mit.edu	36	10	123253348	123253348	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:123253348C>A	uc009xzo.1	-	c.1388G>T	c.(1387-1389)GGG>GTG	p.G463V	FGFR2_uc009xzp.1_Missense_Mutation_p.G462V|FGFR2_uc009xzq.1_Missense_Mutation_p.G365V|FGFR2_uc001lfj.2_Missense_Mutation_p.G364V|FGFR2_uc001lfm.1_Missense_Mutation_p.G391V|FGFR2_uc001lfg.2_Missense_Mutation_p.G70V|FGFR2_uc001lfl.2_Missense_Mutation_p.G25V	NM_022970	NP_075259	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 2	462	Cytoplasmic (Potential).				angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of gene-specific transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of mesenchymal cell proliferation|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|protein phosphorylation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(39)|skin(28)|lung(7)|ovary(4)|cervix(2)|stomach(2)|breast(2)|soft_tissue(1)|central_nervous_system(1)	86		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)			5		350				0.5	8.894453	8.894453	4	4	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	123253348	123253348	6103	10	C	A	A	22	22	FGFR2	A	3	3
NRP1	8829	broad.mit.edu	36	10	33659676	33659676	+	Missense_Mutation	SNP	T	A	A			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:33659676T>A	uc001iwx.2	-	c.214A>T	c.(214-216)AAC>TAC	p.N72Y	NRP1_uc001iww.2_5'UTR|NRP1_uc001iwv.2_Missense_Mutation_p.N72Y|NRP1_uc009xlz.1_Missense_Mutation_p.N72Y|NRP1_uc001iwy.2_Missense_Mutation_p.N72Y|NRP1_uc001iwz.2_Missense_Mutation_p.N72Y|NRP1_uc001ixa.2_Missense_Mutation_p.N72Y|NRP1_uc001ixb.1_Missense_Mutation_p.N72Y|NRP1_uc001ixc.1_Missense_Mutation_p.N72Y	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a	72	CUB 1.|Extracellular (Potential).				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)	3					Palifermin(DB00039)|Pegaptanib(DB04895)	Melanoma(104;886 1489 44640 45944 51153)								0.714286	10.464732	10.749236	5	2	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33659676	33659676	11065	10	T	A	A	63	63	NRP1	A	4	4
PLAU	5328	broad.mit.edu	36	10	75345150	75345150	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:75345150C>G	uc001jwa.1	+	c.1106C>G	c.(1105-1107)ACA>AGA	p.T369R	C10orf55_uc001jvz.1_Intron|PLAU_uc001jwb.1_Non-coding_Transcript|PLAU_uc001jwc.1_Missense_Mutation_p.T369R|PLAU_uc009xrq.1_Missense_Mutation_p.T333R	NM_002658	NP_002649	P00749	UROK_HUMAN	urokinase plasminogen activator isoform 1	369	Peptidase S1.				blood coagulation|chemotaxis|fibrinolysis|proteolysis|regulation of cell adhesion mediated by integrin|regulation of receptor activity|regulation of smooth muscle cell migration|regulation of smooth muscle cell-matrix adhesion|signal transduction	cell surface|extracellular space|plasma membrane	serine-type endopeptidase activity			ovary(2)|kidney(1)	3	Prostate(51;0.0112)				Amiloride(DB00594)|Urokinase(DB00013)									0.694915	133.282851	135.278664	41	18	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75345150	75345150	12448	10	C	G	G	17	17	PLAU	G	3	3
TAF3	83860	broad.mit.edu	36	10	8091118	8091118	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:8091118C>A	uc009xis.1	+	c.2387C>A	c.(2386-2388)CCG>CAG	p.P796Q		NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140	796	Pro-rich.				maintenance of protein location in nucleus|regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1														0.75	7.45774	7.652535	3	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8091118	8091118	16046	10	C	A	A	23	23	TAF3	A	3	3
PTEN	5728	broad.mit.edu	36	10	89710721	89710721	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:89710721C>T	uc001kfb.1	+	c.892C>T	c.(892-894)CAA>TAA	p.Q298*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	298	C2 tensin-type.				apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.Q298*(2)|p.G165_K342del(1)|p.G165_*404del(1)|p.W274_F341del(1)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)				31	p.Q298*(CAL148-Tumor)	264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.75	29.077542	29.758124	9	3	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	89710721	89710721	13192	10	C	T	T	29	29	PTEN	T	5	2
IFIT3	3437	broad.mit.edu	36	10	91089659	91089659	+	Missense_Mutation	SNP	T	A	A			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:91089659T>A	uc001kgf.1	+	c.1267T>A	c.(1267-1269)TTA>ATA	p.L423I	LIPA_uc001kgb.2_Intron|LIPA_uc001kgc.2_Intron|IFIT3_uc001kgg.1_Missense_Mutation_p.L423I	NM_001549	NP_001540	O14879	IFIT3_HUMAN	interferon-induced protein with	423	TPR 7.				type I interferon-mediated signaling pathway		protein binding			central_nervous_system(1)	1														0.45	17.45397	17.499602	9	11	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	91089659	91089659	7825	10	T	A	A	52	52	IFIT3	A	4	4
CYP26C1	340665	broad.mit.edu	36	10	94818138	94818138	+	Nonsense_Mutation	SNP	C	G	G			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:94818138C>G	uc001kij.1	+	c.1263C>G	c.(1261-1263)TAC>TAG	p.Y421*	CYP26C1_uc009xud.1_Non-coding_Transcript	NM_183374	NP_899230	Q6V0L0	CP26C_HUMAN	cytochrome P450, family 26, subfamily C,	421					anterior/posterior pattern formation|central nervous system development|negative regulation of retinoic acid receptor signaling pathway|neural crest cell development|organelle fusion|oxidation-reduction process|retinoic acid catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			central_nervous_system(1)	1		Colorectal(252;0.122)												0.666667	8.594942	8.741781	4	2	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	94818138	94818138	4322	10	C	G	G	18	18	CYP26C1	G	5	3
OAF	220323	broad.mit.edu	36	11	119601602	119601602	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:119601602T>C	uc001pxb.1	+	c.254T>C	c.(253-255)CTG>CCG	p.L85P		NM_178507	NP_848602	Q86UD1	OAF_HUMAN	OAF homolog	85											0		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)										0.333333	6.348089	6.495648	2	4	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	119601602	119601602	11203	11	T	C	C	55	55	OAF	C	4	4
OR5W2	390148	broad.mit.edu	36	11	55437791	55437791	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55437791C>T	uc001nib.1	-	c.844G>A	c.(844-846)GTT>ATT	p.V282I		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	282	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						Melanoma(48;171 1190 15239 43886 49348)								0.4	36.798777	37.059515	12	18	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55437791	55437791	11595	11	C	T	T	18	18	OR5W2	T	2	2
TNKS1BP1	85456	broad.mit.edu	36	11	56834388	56834388	+	Silent	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:56834388G>A	uc001njr.1	-	c.2373C>T	c.(2371-2373)GCC>GCT	p.A791A	TNKS1BP1_uc001njs.1_Silent_p.A791A|TNKS1BP1_uc009ymd.1_Silent_p.A242A	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	791	Acidic.				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)												0.294118	7.952715	8.608607	5	12	GG		KEEP	---	---	---	---	capture			Silent	SNP	56834388	56834388	16861	11	G	A	A	47	47	TNKS1BP1	A	2	2
OR4D10	390197	broad.mit.edu	36	11	59001950	59001950	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:59001950G>A	uc001nnz.1	+	c.472G>A	c.(472-474)GTG>ATG	p.V158M		NM_001004705	NP_001004705	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D,	158	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2														0.823529	43.454557	45.130322	14	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	59001950	59001950	11461	11	G	A	A	40	40	OR4D10	A	1	1
ATG2A	23130	broad.mit.edu	36	11	64436259	64436259	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:64436259G>T	uc001obx.1	-	c.961C>A	c.(961-963)CCG>ACG	p.P321T		NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	ATG2 autophagy related 2 homolog A	321							protein binding			ovary(1)|central_nervous_system(1)	2														0.217391	6.75999	8.39733	5	18	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64436259	64436259	1112	11	G	T	T	43	43	ATG2A	T	3	3
FXC1	26515	broad.mit.edu	36	11	6459888	6459889	+	Missense_Mutation	DNP	AT	CC	CC			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:6459888_6459889AT>CC	uc001mdn.2	+	c.173_174AT>CC	c.(172-174)CAT>CCC	p.H58P	ARFIP2_uc001mdk.1_5'Flank|ARFIP2_uc001mdl.1_5'Flank|ARFIP2_uc001mdm.1_5'Flank|ARFIP2_uc009yfe.1_5'Flank|FXC1_uc001mdo.2_Non-coding_Transcript	NM_012192	NP_036324	Q9Y5J6	TIM9B_HUMAN	fractured callus expressed transcript 1	58					cell-matrix adhesion|protein import into mitochondrial inner membrane|transmembrane transport	mitochondrial inner membrane|mitochondrial intermembrane space protein transporter complex	metal ion binding				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.26e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)										0.210526	6.588263	8.063538	4	15	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	6459888	6459889	6364	11	AT	CC	CC	8	8	FXC1	CC	4	4
RPLP2	6181	broad.mit.edu	36	11	800267	800267	+	Silent	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:800267C>A	uc001lrq.1	+	c.33C>A	c.(31-33)GCC>GCA	p.A11A	RPLP2_uc001lrr.1_Silent_p.A11A|SNORA52_uc001lrs.1_5'Flank	NM_001004	NP_000995	P05387	RLA2_HUMAN	ribosomal protein P2	11					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	RNA binding|structural constituent of ribosome				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)										0.666667	15.578102	15.875581	8	4	CC		KEEP	---	---	---	---	capture			Silent	SNP	800267	800267	14085	11	C	A	A	22	22	RPLP2	A	3	3
CRY1	1407	broad.mit.edu	36	12	105919268	105919268	+	Missense_Mutation	SNP	T	A	A			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:105919268T>A	uc001tmi.2	-	c.604A>T	c.(604-606)ACA>TCA	p.T202S		NM_004075	NP_004066	Q16526	CRY1_HUMAN	cryptochrome 1 (photolyase-like)	202					circadian rhythm|DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	DNA binding|DNA photolyase activity|G-protein coupled photoreceptor activity|nucleotide binding|protein binding			ovary(3)	3														0.207547	15.188541	19.402898	11	42	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	105919268	105919268	4042	12	T	A	A	57	57	CRY1	A	4	4
TMEM132D	121256	broad.mit.edu	36	12	128750645	128750645	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:128750645C>A	uc009zyl.1	-	c.631G>T	c.(631-633)GGG>TGG	p.G211W		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D	211	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)	12	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)										0.75	7.043486	7.249181	3	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128750645	128750645	16579	12	C	A	A	23	23	TMEM132D	A	3	3
P2RX2	22953	broad.mit.edu	36	12	131706925	131706925	+	Splice_Site_SNP	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:131706925G>A	uc001ukk.1	+	c.e6_splice_site			P2RX2_uc001uki.1_Splice_Site_SNP|P2RX2_uc001ukj.1_Splice_Site_SNP|P2RX2_uc001ukl.1_Splice_Site_SNP|P2RX2_uc001ukm.1_Splice_Site_SNP|P2RX2_uc001ukn.1_Splice_Site_SNP|P2RX2_uc009zyt.1_Splice_Site_SNP|P2RX2_uc001uko.1_Splice_Site_SNP	NM_170683	NP_733783			purinergic receptor P2X2 isoform D						positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|protein homooligomerization	integral to membrane	ATP binding|extracellular ATP-gated cation channel activity|identical protein binding|purinergic nucleotide receptor activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)										0.363636	6.78719	6.970847	4	7	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	131706925	131706925	11753	12	G	A	A	34	34	P2RX2	A	5	2
TUBA1C	84790	broad.mit.edu	36	12	47952834	47952834	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:47952834G>A	uc001rtt.1	+	c.907G>A	c.(907-909)GTG>ATG	p.V303M	TUBA1C_uc001rts.1_Missense_Mutation_p.V268M	NM_032704	NP_116093	Q9BQE3	TBA1C_HUMAN	tubulin alpha 6	303					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0														0.638889	100.692454	101.905538	46	26	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47952834	47952834	17300	12	G	A	A	44	44	TUBA1C	A	2	2
VWF	7450	broad.mit.edu	36	12	5929291	5929291	+	Silent	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:5929291G>A	uc001qnn.1	-	c.8175C>T	c.(8173-8175)AAC>AAT	p.N2725N		NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	2725	CTCK.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	p.N2725N(1)		ovary(3)|pancreas(2)|breast(1)|central_nervous_system(1)	7					Antihemophilic Factor(DB00025)									0.15	9.123185	13.8255	6	34	GG		KEEP	---	---	---	---	capture			Silent	SNP	5929291	5929291	17818	12	G	A	A	40	40	VWF	A	1	1
TBK1	29110	broad.mit.edu	36	12	63161917	63161917	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:63161917C>A	uc001ssc.1	+	c.841C>A	c.(841-843)CTT>ATT	p.L281I		NM_013254	NP_037386	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1	281	Protein kinase.				I-kappaB kinase/NF-kappaB cascade|innate immune response|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|protein phosphorylation|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|large_intestine(1)|breast(1)	5				GBM - Glioblastoma multiforme(28;0.0386)						569				0.272727	8.720705	9.232434	3	8	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	63161917	63161917	16163	12	C	A	A	32	32	TBK1	A	3	3
ATP12A	479	broad.mit.edu	36	13	24160659	24160659	+	Missense_Mutation	SNP	A	G	G			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:24160659A>G	uc010aaa.1	+	c.431A>G	c.(430-432)AAC>AGC	p.N144S	ATP12A_uc001upp.1_Missense_Mutation_p.N144S	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A	144	Lumenal (Potential).				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	Pancreas(156;1582 1935 18898 22665 26498)								0.278689	47.559802	50.240607	17	44	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	24160659	24160659	1141	13	A	G	G	2	2	ATP12A	G	4	4
ARL11	115761	broad.mit.edu	36	13	49102675	49102675	+	Missense_Mutation	SNP	A	C	C			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:49102675A>C	uc001vdf.1	+	c.91A>C	c.(91-93)AAG>CAG	p.K31Q	ARL11_uc010adi.1_Missense_Mutation_p.K31Q	NM_138450	NP_612459	Q969Q4	ARL11_HUMAN	ADP-ribosylation factor-like 11	31					small GTPase mediated signal transduction	intracellular	GTP binding|protein binding				0		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.119)|Kidney(9;0.169)	GBM - Glioblastoma multiforme(99;1.67e-09)										0.8	8.945111	9.31021	4	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49102675	49102675	942	13	A	C	C	5	5	ARL11	C	4	4
NUMB	8650	broad.mit.edu	36	14	72823724	72823724	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:72823724G>A	uc001xny.1	-	c.502C>T	c.(502-504)CGC>TGC	p.R168C	NUMB_uc010aro.1_Missense_Mutation_p.R168C|NUMB_uc010arp.1_Missense_Mutation_p.R157C|NUMB_uc010arq.1_Missense_Mutation_p.R168C|NUMB_uc010arr.1_Missense_Mutation_p.R157C|NUMB_uc001xoa.1_Missense_Mutation_p.R168C|NUMB_uc001xnz.1_Missense_Mutation_p.R157C|NUMB_uc001xob.1_Missense_Mutation_p.R157C|NUMB_uc001xod.1_Missense_Mutation_p.R168C|NUMB_uc001xoc.1_Missense_Mutation_p.R168C|NUMB_uc010ars.1_Missense_Mutation_p.R157C|NUMB_uc001xof.1_Missense_Mutation_p.R132C|NUMB_uc001xog.1_Missense_Mutation_p.R157C|NUMB_uc001xoh.1_Missense_Mutation_p.R157C	NM_001005743	NP_001005743	P49757	NUMB_HUMAN	numb homolog isoform 1	168	PID.				axon guidance|lateral ventricle development|neuroblast division in subventricular zone|positive regulation of neurogenesis	integral to plasma membrane				ovary(2)|central_nervous_system(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)										0.893617	379.220612	400.882368	126	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	72823724	72823724	11156	14	G	A	A	38	38	NUMB	A	1	1
FBLN5	10516	broad.mit.edu	36	14	91413767	91413767	+	Silent	SNP	A	G	G			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:91413767A>G	uc010aue.1	-	c.1125T>C	c.(1123-1125)TGT>TGC	p.C375C	FBLN5_uc001xzw.1_5'Flank|FBLN5_uc010aud.1_Silent_p.C339C|FBLN5_uc001xzx.2_Silent_p.C334C	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor	334					cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|lung(1)|skin(1)	5		all_cancers(154;0.0722)								478				0.210375	155.545829	182.551587	73	274	AA		KEEP	---	---	---	---	capture			Silent	SNP	91413767	91413767	5936	14	A	G	G	10	10	FBLN5	G	4	4
SERPINA1	5265	broad.mit.edu	36	14	93918921	93918921	+	Missense_Mutation	SNP	A	T	T			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:93918921A>T	uc001ycx.2	-	c.407T>A	c.(406-408)CTG>CAG	p.L136Q	SERPINA1_uc001ycw.2_Non-coding_Transcript|SERPINA1_uc010auw.1_Missense_Mutation_p.L136Q|SERPINA1_uc010aux.1_Missense_Mutation_p.L136Q|SERPINA1_uc001ycy.2_Missense_Mutation_p.L136Q|SERPINA1_uc010auy.1_Missense_Mutation_p.L136Q|SERPINA1_uc001ycz.2_Missense_Mutation_p.L136Q|SERPINA1_uc010auz.1_Missense_Mutation_p.L136Q|SERPINA1_uc010ava.1_Missense_Mutation_p.L136Q|SERPINA1_uc001ydb.2_Missense_Mutation_p.L136Q|SERPINA1_uc010avb.1_Missense_Mutation_p.L136Q|SERPINA1_uc001ydc.2_Missense_Mutation_p.L136Q|SERPINA1_uc001yda.1_Missense_Mutation_p.L136Q	NM_000295	NP_001121179	P01009	A1AT_HUMAN	serine proteinase inhibitor, clade A, member 1	136					acute-phase response|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen|proteinaceous extracellular matrix	protease binding|serine-type endopeptidase inhibitor activity			skin(1)	1		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)	Alpha-1-proteinase inhibitor(DB00058)									0.4	7.490395	7.579735	4	6	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	93918921	93918921	14574	14	A	T	T	7	7	SERPINA1	T	4	4
CHAC1	79094	broad.mit.edu	36	15	39035144	39035144	+	Silent	SNP	A	C	C			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr15:39035144A>C	uc001znh.1	+	c.549A>C	c.(547-549)GCA>GCC	p.A183A		NM_024111	NP_077016	Q9BUX1	CHAC1_HUMAN	ChaC, cation transport regulator-like 1 isoform	225					apoptosis in response to endoplasmic reticulum stress|response to unfolded protein	cytosol	protein binding				0		all_cancers(109;1.42e-13)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.66e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.163)										0.294118	8.862953	9.511785	5	12	AA		KEEP	---	---	---	---	capture			Silent	SNP	39035144	39035144	3441	15	A	C	C	7	7	CHAC1	C	4	4
RPAP1	26015	broad.mit.edu	36	15	39607418	39607418	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr15:39607418T>C	uc001zod.1	-	c.1360A>G	c.(1360-1362)AGA>GGA	p.R454G		NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	454						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)										0.266667	6.991429	7.731236	4	11	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39607418	39607418	14020	15	T	C	C	55	55	RPAP1	C	4	4
PPIP5K1	9677	broad.mit.edu	36	15	41618990	41618990	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:41618990G>A	uc001zrw.1	-	c.3469C>T	c.(3469-3471)CTC>TTC	p.L1157F	PPIP5K1_uc001zru.1_Missense_Mutation_p.L1132F|PPIP5K1_uc001zrv.1_Intron|PPIP5K1_uc001zrx.1_Missense_Mutation_p.L1090F|PPIP5K1_uc001zry.2_Missense_Mutation_p.L1132F	NM_014659	NP_055474	Q6PFW1	VIP1_HUMAN	histidine acid phosphatase domain containing 2A	1157					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0														0.333333	7.489349	7.787886	4	8	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41618990	41618990	12767	15	G	A	A	36	36	PPIP5K1	A	2	2
STRC	161497	broad.mit.edu	36	15	41682881	41682881	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:41682881C>G	uc001zsf.1	-	c.4396G>C	c.(4396-4398)GAT>CAT	p.D1466H	PPIP5K1_uc001zsa.2_Intron|STRC_uc010bdk.1_Intron|STRC_uc001zse.1_5'UTR|STRC_uc010bdl.1_Missense_Mutation_p.D693H	NM_153700	NP_714544	Q7RTU9	STRC_HUMAN	stereocilin	1466					sensory perception of sound	cell surface					0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)										0.481203	207.744883	207.787676	64	69	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41682881	41682881	15848	15	C	G	G	32	32	STRC	G	3	3
CD276	80381	broad.mit.edu	36	15	71781924	71781925	+	Missense_Mutation	DNP	AG	GT	GT			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:71781924_71781925AG>GT	uc002avv.1	+	c.355_356AG>GT	c.(355-357)AGC>GTC	p.S119V	CD276_uc010bjd.1_5'UTR|CD276_uc002avu.1_Missense_Mutation_p.S119V|CD276_uc002avw.1_Missense_Mutation_p.S119V|CD276_uc002avx.2_5'Flank	NM_001024736	NP_001019907	Q5ZPR3	CD276_HUMAN	CD276 antigen isoform a	119	Ig-like V-type 1.|Extracellular (Potential).				cell proliferation|immune response|positive regulation of interferon-gamma biosynthetic process|positive regulation of T cell proliferation|regulation of immune response|T cell activation	external side of plasma membrane|integral to membrane	receptor binding				0														0.714286	11.268543	11.554098	5	2	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	71781924	71781925	3120	15	AG	GT	GT	7	7	CD276	GT	4	4
AKAP13	11214	broad.mit.edu	36	15	83999892	83999892	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:83999892G>A	uc002blu.1	+	c.4615G>A	c.(4615-4617)GAC>AAC	p.D1539N	AKAP13_uc002blt.1_Missense_Mutation_p.D1539N|AKAP13_uc002blv.1_Missense_Mutation_p.D1539N|AKAP13_uc010bne.1_Missense_Mutation_p.D192N|AKAP13_uc010bnf.1_Missense_Mutation_p.D179N|AKAP13_uc002blw.1_Missense_Mutation_p.D24N	NM_006738	NP_006729	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 1	1539					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|ovary(1)|liver(1)	8						Melanoma(94;603 1453 3280 32295 32951)								0.295139	220.541226	231.371108	85	203	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	83999892	83999892	452	15	G	A	A	41	41	AKAP13	A	2	2
ABCC1	4363	broad.mit.edu	36	16	16011185	16011185	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:16011185T>C	uc010bvi.1	+	c.277T>C	c.(277-279)TTC>CTC	p.F93L	ABCC1_uc010bvj.1_Missense_Mutation_p.F93L|ABCC1_uc010bvk.1_Missense_Mutation_p.F93L|ABCC1_uc010bvl.1_Missense_Mutation_p.F93L|ABCC1_uc010bvm.1_Missense_Mutation_p.F93L|ABCC1_uc002del.2_5'UTR	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	93	Helical; Name=2.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)									0.204545	20.349011	23.915626	9	35	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16011185	16011185	50	16	T	C	C	64	64	ABCC1	C	4	4
ZP2	7783	broad.mit.edu	36	16	21123191	21123191	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:21123191C>G	uc010bwn.1	-	c.846G>C	c.(844-846)AAG>AAC	p.K282N	ZP2_uc002dii.2_Missense_Mutation_p.K243N|ZP2_uc010bwo.1_Missense_Mutation_p.K282N	NM_003460	NP_003451	Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 preproprotein	243	Extracellular (Potential).				binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0573)										0.227273	8.960538	10.466499	5	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	21123191	21123191	18820	16	C	G	G	28	28	ZP2	G	3	3
PDIA2	64714	broad.mit.edu	36	16	276440	276440	+	Silent	SNP	T	C	C			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:276440T>C	uc002cgn.1	+	c.1206T>C	c.(1204-1206)GCT>GCC	p.A402A	PDIA2_uc010bqt.1_Silent_p.A247A|PDIA2_uc002cgo.1_Silent_p.A402A	NM_006849	NP_006840	Q13087	PDIA2_HUMAN	protein disulfide isomerase-associated 2	402	Thioredoxin 2.				apoptosis|cell redox homeostasis|glycerol ether metabolic process|protein folding|protein retention in ER lumen|response to hypoxia	endoplasmic reticulum lumen	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity|steroid binding			central_nervous_system(1)	1		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)												1	12.160875	12.099858	4	0	TT		KEEP	---	---	---	---	capture			Silent	SNP	276440	276440	12089	16	T	C	C	56	56	PDIA2	C	4	4
XPO6	23214	broad.mit.edu	36	16	28025208	28025208	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:28025208G>T	uc002dpa.1	-	c.2609C>A	c.(2608-2610)ACC>AAC	p.T870N	XPO6_uc002dpb.1_Missense_Mutation_p.T856N	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN	exportin 6	870					protein export from nucleus	cytoplasm|nucleus	protein binding|protein transporter activity			ovary(1)|skin(1)	2														0.25	8.227828	9.602905	6	18	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	28025208	28025208	18031	16	G	T	T	44	44	XPO6	T	3	3
ARMC5	79798	broad.mit.edu	36	16	31381147	31381147	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:31381147C>T	uc002ecc.1	+	c.778C>T	c.(778-780)CGT>TGT	p.R260C	ARMC5_uc002ecb.1_Missense_Mutation_p.R260C|ARMC5_uc002eca.2_Missense_Mutation_p.R260C	NM_001105247	NP_001098717	Q96C12	ARMC5_HUMAN	armadillo repeat containing 5 isoform a	260	ARM 3.						binding			pancreas(1)	1														0.461538	11.235975	11.253661	6	7	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31381147	31381147	972	16	C	T	T	23	23	ARMC5	T	1	1
CLUAP1	23059	broad.mit.edu	36	16	3513172	3513172	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:3513172G>T	uc002cvl.1	+	c.727G>T	c.(727-729)GAT>TAT	p.D243Y	CLUAP1_uc002cvk.1_Missense_Mutation_p.D243Y|CLUAP1_uc002cvj.1_Missense_Mutation_p.D243Y|CLUAP1_uc002cvm.1_Missense_Mutation_p.D77Y	NM_015041	NP_055856	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1 isoform 1	243	Potential.					nucleus	protein binding			ovary(1)|breast(1)|pancreas(1)	3														0.411765	13.411925	13.529389	7	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3513172	3513172	3707	16	G	T	T	41	41	CLUAP1	T	3	3
RPGRIP1L	23322	broad.mit.edu	36	16	52244161	52244161	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:52244161C>T	uc002ehp.1	-	c.1939G>A	c.(1939-1941)GTA>ATA	p.V647I	RPGRIP1L_uc002ehn.1_Missense_Mutation_p.V62I|RPGRIP1L_uc002eho.2_Missense_Mutation_p.V647I|RPGRIP1L_uc010cbx.1_Missense_Mutation_p.V647I	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	647	C2 1.				negative regulation of G-protein coupled receptor protein signaling pathway	centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)												0.436364	73.691184	73.885148	24	31	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52244161	52244161	14029	16	C	T	T	19	19	RPGRIP1L	T	1	1
SLC6A2	6530	broad.mit.edu	36	16	54289948	54289948	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:54289948C>A	uc002eif.1	+	c.1456C>A	c.(1456-1458)CTC>ATC	p.L486I	SLC6A2_uc010ccd.1_Missense_Mutation_p.L486I|SLC6A2_uc002eig.1_Missense_Mutation_p.L486I|SLC6A2_uc002eih.1_Missense_Mutation_p.L486I|SLC6A2_uc002eii.1_Missense_Mutation_p.L381I|SLC6A2_uc002eij.1_Missense_Mutation_p.L200I	NM_001043	NP_001034	P23975	SC6A2_HUMAN	solute carrier family 6 member 2	486	Helical; Name=10; (Potential).				synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity			ovary(2)|pancreas(2)	4				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)									0.177778	7.142922	11.596235	8	37	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54289948	54289948	15180	16	C	A	A	24	24	SLC6A2	A	3	3
PLCG2	5336	broad.mit.edu	36	16	80377222	80377222	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:80377222G>A	uc002fgt.1	+	c.127G>A	c.(127-129)GTC>ATC	p.V43I	PLCG2_uc010chg.1_Missense_Mutation_p.V43I	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	43	PH.				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8										1880				0.315068	57.895436	60.118589	23	50	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	80377222	80377222	12462	16	G	A	A	40	40	PLCG2	A	1	1
RAI1	10743	broad.mit.edu	36	17	17642210	17642211	+	Missense_Mutation	DNP	AG	CT	CT			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:17642210_17642211AG>CT	uc002grm.1	+	c.5223_5224AG>CT	c.(5221-5226)AAAGGT>AACTGT	p.1741_1742KG>NC	RAI1_uc002grn.1_Missense_Mutation_p.1741_1742KG>NC	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1741_1742						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(1115;0.0276)										1	10.053306	9.991927	4	0	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	17642210	17642211	13467	17	AG	CT	CT	3	3	RAI1	CT	4	4
SMCR8	140775	broad.mit.edu	36	17	18160198	18160198	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:18160198G>A	uc002gsy.2	+	c.370G>A	c.(370-372)GTG>ATG	p.V124M	TOP3A_uc002gsx.1_5'Flank|TOP3A_uc010cqa.1_5'Flank	NM_144775	NP_658988	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region,	124										central_nervous_system(1)	1														0.162272	140.52334	193.913212	80	413	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18160198	18160198	15290	17	G	A	A	44	44	SMCR8	A	2	2
SSH2	85464	broad.mit.edu	36	17	24983391	24983391	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:24983391C>A	uc002heo.1	-	c.2866G>T	c.(2866-2868)GCT>TCT	p.A956S		NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	956					actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0														0.153846	23.301764	33.722447	14	77	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	24983391	24983391	15701	17	C	A	A	28	28	SSH2	A	3	3
CTNS	1497	broad.mit.edu	36	17	3505039	3505039	+	Splice_Site_SNP	SNP	A	G	G			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:3505039A>G	uc002fwa.1	+	c.e6_splice_site			CTNS_uc002fwb.1_Splice_Site_SNP|CTNS_uc010ckj.1_Splice_Site_SNP	NM_001031681	NP_001026851			cystinosis, nephropathic isoform 1						ATP metabolic process|brain development|cognition|glutathione metabolic process	integral to membrane|late endosome|lysosomal membrane	L-cystine transmembrane transporter activity				0				COAD - Colon adenocarcinoma(5;0.0829)	L-Cystine(DB00138)									0.333333	6.992712	7.28957	4	8	AA		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	3505039	3505039	4180	17	A	G	G	7	7	CTNS	G	5	4
ZZEF1	23140	broad.mit.edu	36	17	3867624	3867624	+	Missense_Mutation	SNP	G	C	C			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:3867624G>C	uc002fxe.1	-	c.7791C>G	c.(7789-7791)TGC>TGG	p.C2597W	ZZEF1_uc002fxg.1_Splice_Site_SNP	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	2597					regulation of mitotic metaphase/anaphase transition	anaphase-promoting complex	calcium ion binding|zinc ion binding			ovary(1)|pancreas(1)	2														0.189189	7.997827	11.355888	7	30	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3867624	3867624	18861	17	G	C	C	46	46	ZZEF1	C	3	3
CHD3	1107	broad.mit.edu	36	17	7734771	7734771	+	Missense_Mutation	SNP	A	C	C			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7734771A>C	uc002gjd.2	+	c.506A>C	c.(505-507)GAT>GCT	p.D169A	CHD3_uc002gje.2_Missense_Mutation_p.D124A|CHD3_uc002gjf.2_Missense_Mutation_p.D124A|CHD3_uc002gjg.1_5'Flank	NM_001005271	NP_001005271	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	124				GEGDGG -> PHFQQK (in Ref. 4; AAC50228).	chromatin assembly or disassembly|chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	chromatin|microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|chromatin binding|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)												0.428571	6.322765	6.353903	3	4	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7734771	7734771	3460	17	A	C	C	12	12	CHD3	C	4	4
EPB41L3	23136	broad.mit.edu	36	18	5386243	5386243	+	Missense_Mutation	SNP	A	T	T			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr18:5386243A>T	uc002kmt.1	-	c.2930T>A	c.(2929-2931)GTA>GAA	p.V977E	EPB41L3_uc002kmu.1_Missense_Mutation_p.V755E|EPB41L3_uc010dkq.1_Missense_Mutation_p.V646E|EPB41L3_uc002kms.1_Missense_Mutation_p.V212E|EPB41L3_uc010dkr.1_Missense_Mutation_p.V369E	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	977	Carboxyl-terminal (CTD).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5														0.333333	8.864037	9.236036	5	10	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5386243	5386243	5347	18	A	T	T	14	14	EPB41L3	T	4	4
SERPINB7	8710	broad.mit.edu	36	18	59614538	59614538	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:59614538C>T	uc002ljl.1	+	c.395C>T	c.(394-396)ACG>ATG	p.T132M	SERPINB7_uc002ljm.1_Missense_Mutation_p.T132M|SERPINB7_uc010dqg.1_Missense_Mutation_p.T132M	NM_001040147	NP_003775	O75635	SPB7_HUMAN	serine (or cysteine) proteinase inhibitor, clade	132					regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			lung(2)|central_nervous_system(1)	3		Esophageal squamous(42;0.129)												0.327869	55.78168	57.383159	20	41	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	59614538	59614538	14594	18	C	T	T	19	19	SERPINB7	T	1	1
C19orf57	79173	broad.mit.edu	36	19	13861934	13861934	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:13861934C>A	uc002mxl.1	-	c.735G>T	c.(733-735)GAG>GAT	p.E245D	C19orf57_uc002mxk.1_Missense_Mutation_p.E127D|C19orf57_uc002mxm.1_Intron	NM_024323	NP_077299	Q0VDD7	CS057_HUMAN	hypothetical protein LOC79173	245					multicellular organismal development		protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(19;2e-21)											0.25	6.922127	7.602122	3	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	13861934	13861934	2003	19	C	A	A	32	32	C19orf57	A	3	3
GMIP	51291	broad.mit.edu	36	19	19610091	19610091	+	Silent	SNP	T	C	C			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:19610091T>C	uc002nnd.1	-	c.666A>G	c.(664-666)CAA>CAG	p.Q222Q		NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein	222					negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1														0.4	7.59817	7.684985	4	6	TT		KEEP	---	---	---	---	capture			Silent	SNP	19610091	19610091	6760	19	T	C	C	60	60	GMIP	C	4	4
ZNF208	7757	broad.mit.edu	36	19	21948823	21948823	+	Missense_Mutation	SNP	T	A	A	rs61742421	unknown	TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:21948823T>A	uc002nqp.1	-	c.853A>T	c.(853-855)AAC>TAC	p.N285Y	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)	5		all_lung(12;0.0961)|Lung NSC(12;0.103)												0.235294	8.790883	9.881339	4	13	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	21948823	21948823	18357	19	T	A	A	63	63	ZNF208	A	4	4
THOP1	7064	broad.mit.edu	36	19	2745846	2745846	+	Missense_Mutation	SNP	T	A	A			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:2745846T>A	uc002lwj.1	+	c.314T>A	c.(313-315)CTC>CAC	p.L105H		NM_003249	NP_003240	P52888	THOP1_HUMAN	thimet oligopeptidase 1	105					proteolysis	cytoplasm	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.5	6.519049	6.519049	3	3	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2745846	2745846	16399	19	T	A	A	54	54	THOP1	A	4	4
GAPDHS	26330	broad.mit.edu	36	19	40726431	40726431	+	Silent	SNP	G	C	C			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:40726431G>C	uc002oaf.1	+	c.918G>C	c.(916-918)CGG>CGC	p.R306R	TMEM147_uc002oai.1_5'Flank|TMEM147_uc002oaj.1_5'Flank|TMEM147_uc002oak.1_5'Flank|TMEM147_uc010eed.1_5'Flank	NM_014364	NP_055179	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase,	306		Glyceraldehyde 3-phosphate (By similarity).			gluconeogenesis|glycolysis|oxidation-reduction process|positive regulation of glycolysis|sperm motility	cytosol	glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity|NAD binding|protein binding				0	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		NADH(DB00157)									0.184211	6.697244	10.270821	7	31	GG		KEEP	---	---	---	---	capture			Silent	SNP	40726431	40726431	6501	19	G	C	C	43	43	GAPDHS	C	3	3
ZNF582	147948	broad.mit.edu	36	19	61588306	61588306	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:61588306C>T	uc002qmy.1	-	c.385G>A	c.(385-387)GAA>AAA	p.E129K	ZNF582_uc002qmz.1_Missense_Mutation_p.E98K	NM_144690	NP_653291	Q96NG8	ZN582_HUMAN	zinc finger protein 582	98					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|large_intestine(1)	4		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		Ovarian(183;1887 2032 4349 30507 51343)								0.164706	10.777863	19.901821	14	71	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61588306	61588306	18609	19	C	T	T	31	31	ZNF582	T	1	1
PTBP1	5725	broad.mit.edu	36	19	759674	759674	+	Missense_Mutation	SNP	T	A	A			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:759674T>A	uc002lpp.1	+	c.1375T>A	c.(1375-1377)TCA>ACA	p.S459T	PTBP1_uc002lpq.1_Missense_Mutation_p.S452T|PTBP1_uc002lpr.1_Missense_Mutation_p.S433T|PTBP1_uc002lps.1_Missense_Mutation_p.S99T|PTBP1_uc002lpt.1_Non-coding_Transcript|PTBP1_uc002lpu.1_Missense_Mutation_p.S429T	NM_002819	NP_002810	P26599	PTBP1_HUMAN	polypyrimidine tract-binding protein 1 isoform	433					nuclear mRNA splicing, via spliceosome	heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|poly-pyrimidine tract binding|protein binding			kidney(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.666667	12.437317	12.654718	6	3	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	759674	759674	13179	19	T	A	A	54	54	PTBP1	A	4	4
MTOR	2475	broad.mit.edu	36	1	11132871	11132872	+	Splice_Site_DNP	DNP	CT	TG	TG			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:11132871_11132872CT>TG	uc001asd.1	-	c.e31_splice_site				NM_004958	NP_004949			FK506 binding protein 12-rapamycin associated						cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|ovary(4)|kidney(3)|large_intestine(2)|skin(2)|lung(1)	19										1389				0.333333	8.462154	8.835096	5	10	CC		KEEP	---	---	---	---	capture			Splice_Site_DNP	DNP	11132871	11132872	10347	1	CT	TG	TG	24	24	MTOR	TG	5	2
HAO2	51179	broad.mit.edu	36	1	119730844	119730844	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:119730844G>T	uc001ehq.1	+	c.638G>T	c.(637-639)AGC>ATC	p.S213I	HAO2_uc001ehr.1_Missense_Mutation_p.S213I	NM_001005783	NP_057611	Q9NYQ3	HAOX2_HUMAN	hydroxyacid oxidase 2	213	FMN hydroxy acid dehydrogenase.				fatty acid alpha-oxidation	peroxisome	(S)-2-hydroxy-acid oxidase activity			ovary(1)	1	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.0155)|LUSC - Lung squamous cell carcinoma(189;0.0856)										0.20197	179.018557	212.537243	82	324	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	119730844	119730844	7234	1	G	T	T	34	34	HAO2	T	3	3
OR10R2	343406	broad.mit.edu	36	1	156716439	156716439	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:156716439G>T	uc001fsp.1	+	c.148G>T	c.(148-150)GTT>TTT	p.V50F		NM_001004472	NP_001004472	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R,	50	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(2)	2	all_hematologic(112;0.0378)													0.6875	618.783231	627.787895	198	90	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	156716439	156716439	11323	1	G	T	T	36	36	OR10R2	T	3	3
XCL2	6846	broad.mit.edu	36	1	166777915	166777915	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:166777915C>T	uc001gfn.2	-	c.116G>A	c.(115-117)CGA>CAA	p.R39Q		NM_003175	NP_003166	Q9UBD3	XCL2_HUMAN	chemokine (C motif) ligand 2	39					blood circulation|chemotaxis|immune response|signal transduction	extracellular space	chemokine activity			ovary(1)	1	all_hematologic(923;0.215)													0.106383	10.296438	24.744125	10	84	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	166777915	166777915	18005	1	C	T	T	31	31	XCL2	T	1	1
QSOX1	5768	broad.mit.edu	36	1	178432198	178432198	+	Silent	SNP	A	G	G			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:178432198A>G	uc001gnz.1	+	c.1647A>G	c.(1645-1647)TCA>TCG	p.S549S	QSOX1_uc001gny.1_Silent_p.S549S|QSOX1_uc001goa.1_Silent_p.S549S|QSOX1_uc001goc.1_Silent_p.S91S|FLJ23867_uc001god.2_5'Flank	NM_002826	NP_002817	O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1 isoform a	549					cell redox homeostasis|oxidation-reduction process|protein thiol-disulfide exchange	extracellular space|integral to Golgi membrane	flavin-linked sulfhydryl oxidase activity			ovary(1)|central_nervous_system(1)	2														0.318182	13.006928	13.659288	7	15	AA		KEEP	---	---	---	---	capture			Silent	SNP	178432198	178432198	13341	1	A	G	G	7	7	QSOX1	G	4	4
NAV1	89796	broad.mit.edu	36	1	200044991	200044991	+	Silent	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:200044991C>T	uc001gwu.2	+	c.4275C>T	c.(4273-4275)CCC>CCT	p.P1425P	NAV1_uc001gwx.2_Silent_p.P1034P	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1428					cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(2)|ovary(1)	3														0.294118	7.480071	8.119633	5	12	CC		KEEP	---	---	---	---	capture			Silent	SNP	200044991	200044991	10579	1	C	T	T	22	22	NAV1	T	2	2
KCNH1	3756	broad.mit.edu	36	1	209043935	209043935	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:209043935C>A	uc001hib.1	-	c.1659G>T	c.(1657-1659)GAG>GAT	p.E553D	KCNH1_uc001hic.1_Missense_Mutation_p.E526D	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	553	Cytoplasmic (Potential).				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)										0.259259	17.011798	18.42983	7	20	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	209043935	209043935	8336	1	C	A	A	32	32	KCNH1	A	3	3
USH2A	7399	broad.mit.edu	36	1	213920320	213920320	+	Silent	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:213920320G>A	uc001hku.1	-	c.12088C>T	c.(12088-12090)CTG>TTG	p.L4030L		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4030	Fibronectin type-III 25.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|kidney(1)|central_nervous_system(1)	22				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)										0.316279	405.631787	418.494722	136	294	GG		KEEP	---	---	---	---	capture			Silent	SNP	213920320	213920320	17598	1	G	A	A	35	35	USH2A	A	2	2
C1QA	712	broad.mit.edu	36	1	22838070	22838070	+	Silent	SNP	A	G	G			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:22838070A>G	uc001bfy.1	+	c.321A>G	c.(319-321)GGA>GGG	p.G107G	C1QA_uc001bfz.1_Silent_p.G107G	NM_015991	NP_057075	P02745	C1QA_HUMAN	complement component 1, q subcomponent, A chain	107	Collagen-like.				cell-cell signaling|complement activation, classical pathway|innate immune response	collagen|complement component C1 complex					0		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.41e-27)|Colorectal(126;1.52e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.63e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000541)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)									0.454545	10.565334	10.58593	5	6	AA		KEEP	---	---	---	---	capture			Silent	SNP	22838070	22838070	2021	1	A	G	G	9	9	C1QA	G	4	4
NID1	4811	broad.mit.edu	36	1	234278846	234278846	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:234278846G>A	uc001hxo.1	-	c.292C>T	c.(292-294)CCA>TCA	p.P98S	NID1_uc009xgd.1_Missense_Mutation_p.P98S	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor	98					bioluminescence|cell-matrix adhesion|protein-chromophore linkage	basement membrane|membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)									0.25	6.486356	7.401161	4	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	234278846	234278846	10815	1	G	A	A	43	43	NID1	A	2	2
AHCTF1	25909	broad.mit.edu	36	1	245125771	245125771	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:245125771C>A	uc001ibv.1	-	c.1730G>T	c.(1729-1731)TGG>TTG	p.W577L	AHCTF1_uc009xgs.1_5'UTR|AHCTF1_uc001ibu.1_Missense_Mutation_p.W568L	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	568	Necessary for cytoplasmic localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)	5	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			Colon(145;197 1800 4745 15099 26333)								0.277778	7.154245	7.964403	5	13	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	245125771	245125771	411	1	C	A	A	21	21	AHCTF1	A	3	3
OR2G6	391211	broad.mit.edu	36	1	246751897	246751897	+	Silent	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:246751897G>A	uc001ien.1	+	c.327G>A	c.(325-327)TCG>TCA	p.S109S		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	109	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)											0.169811	33.510551	44.430414	18	88	GG		KEEP	---	---	---	---	capture			Silent	SNP	246751897	246751897	11406	1	G	A	A	40	40	OR2G6	A	1	1
CCDC27	148870	broad.mit.edu	36	1	3669852	3669852	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:3669852C>G	uc001akv.1	+	c.1275C>G	c.(1273-1275)TTC>TTG	p.F425L		NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	425											0	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)										0.152174	11.193303	16.525447	7	39	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3669852	3669852	2923	1	C	G	G	30	30	CCDC27	G	3	3
KDM4A	9682	broad.mit.edu	36	1	43936185	43936185	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:43936185G>A	uc001cjx.1	+	c.2755G>A	c.(2755-2757)GTG>ATG	p.V919M		NM_014663	NP_055478	O75164	KDM4A_HUMAN	jumonji domain containing 2A	919	Tudor 1.				interspecies interaction between organisms|oxidation-reduction process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|transcription repressor activity|zinc ion binding				0														0.255474	86.477981	93.898214	35	102	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43936185	43936185	8434	1	G	A	A	36	36	KDM4A	A	2	2
MAST2	23139	broad.mit.edu	36	1	46249199	46249199	+	Splice_Site_SNP	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:46249199G>A	uc001cov.1	+	c.e10_splice_site			MAST2_uc001cow.1_Splice_Site_SNP|MAST2_uc001coy.1_Splice_Site_SNP|MAST2_uc001coz.1_Splice_Site_SNP|MAST2_uc001cpa.2_Intron|MAST2_uc009vya.1_Splice_Site_SNP	NM_015112	NP_055927			microtubule associated serine/threonine kinase						protein phosphorylation|regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|breast(1)	9	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)									975				0.233333	14.609488	16.563486	7	23	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	46249199	46249199	9709	1	G	A	A	48	48	MAST2	A	5	2
BRDT	676	broad.mit.edu	36	1	92202846	92202846	+	Silent	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:92202846G>A	uc001dok.2	+	c.267G>A	c.(265-267)GCG>GCA	p.A89A	BRDT_uc001dol.2_Silent_p.A89A|BRDT_uc009wdf.1_Silent_p.A16A|BRDT_uc001dom.2_Silent_p.A89A	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein	89	Bromo 1.		A -> V (in a gastric adenocarcinoma sample; somatic mutation).		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(1)|ovary(1)|lung(1)	3		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)					p.A89A(JHUEM7-Tumor)	576				0.571429	51.502597	51.627577	16	12	GG		KEEP	---	---	---	---	capture			Silent	SNP	92202846	92202846	1539	1	G	A	A	37	37	BRDT	A	1	1
TGM3	7053	broad.mit.edu	36	20	2268617	2268617	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:2268617G>A	uc002wfx.2	+	c.1918G>A	c.(1918-1920)GGT>AGT	p.G640S		NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor	640					cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)	8					L-Glutamine(DB00130)									0.363636	6.988372	7.171553	4	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2268617	2268617	16359	20	G	A	A	43	43	TGM3	A	2	2
SLC4A11	83959	broad.mit.edu	36	20	3158357	3158358	+	Missense_Mutation	DNP	CA	GG	GG			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:3158357_3158358CA>GG	uc002wig.1	-	c.1602_1603TG>CC	c.(1600-1605)CTTGTC>CTCCTC	p.V535L	SLC4A11_uc002wih.1_Intron	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	535	Extracellular (Potential).|Membrane (bicarbonate transporter).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1						NSCLC(190;922 2139 10266 10292 38692)								0.571429	8.293178	8.323663	4	3	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	3158357	3158358	15149	20	CA	GG	GG	17	17	SLC4A11	GG	3	3
TOMM34	10953	broad.mit.edu	36	20	43005215	43005215	+	Silent	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:43005215C>T	uc002xmy.1	-	c.879G>A	c.(877-879)AGG>AGA	p.R293R	PABPC1L_uc002xmx.2_Intron|TOMM34_uc002xmz.1_Non-coding_Transcript	NM_006809	NP_006800	Q15785	TOM34_HUMAN	translocase of outer mitochondrial membrane 34	293	TPR 6.				protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane	heat shock protein binding|signal sequence binding				0		Myeloproliferative disorder(115;0.0122)												0.25	11.234506	12.601814	6	18	CC		KEEP	---	---	---	---	capture			Silent	SNP	43005215	43005215	16898	20	C	T	T	30	30	TOMM34	T	2	2
USP25	29761	broad.mit.edu	36	21	16158484	16158484	+	Silent	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:16158484G>A	uc002yjz.1	+	c.2460G>A	c.(2458-2460)TTG>TTA	p.L820L	USP25_uc002yjy.1_Silent_p.L788L|USP25_uc010gla.1_Intron	NM_013396	NP_037528	Q9UHP3	UBP25_HUMAN	ubiquitin specific protease 25	788					protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)|liver(2)	5				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)										0.5	6.318899	6.318899	3	3	GG		KEEP	---	---	---	---	capture			Silent	SNP	16158484	16158484	17619	21	G	A	A	47	47	USP25	A	2	2
CBR3	874	broad.mit.edu	36	21	36432093	36432093	+	Silent	SNP	A	G	G			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr21:36432093A>G	uc002yve.1	+	c.390A>G	c.(388-390)AAA>AAG	p.K130K		NM_001236	NP_001227	O75828	CBR3_HUMAN	carbonyl reductase 3	130					oxidation-reduction process	cytosol|nucleus	carbonyl reductase (NADPH) activity|NADPH binding				0														0.52381	35.327096	35.337622	11	10	AA		KEEP	---	---	---	---	capture			Silent	SNP	36432093	36432093	2828	21	A	G	G	2	2	CBR3	G	4	4
TRAPPC10	7109	broad.mit.edu	36	21	44342738	44342738	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr21:44342738T>C	uc002zea.1	+	c.3241T>C	c.(3241-3243)TCC>CCC	p.S1081P	TRAPPC10_uc010gpo.1_Missense_Mutation_p.S792P	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	1081					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2														0.266667	10.866437	12.359921	8	22	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44342738	44342738	17001	21	T	C	C	54	54	TRAPPC10	C	4	4
KRTAP10-8	386681	broad.mit.edu	36	21	44856629	44856629	+	Missense_Mutation	SNP	A	G	G			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr21:44856629A>G	uc002zfo.1	+	c.184A>G	c.(184-186)ACC>GCC	p.T62A	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198695	NP_941968	P60410	KR108_HUMAN	keratin associated protein 10-8	62	2.|19 X 5 AA repeats of C-C-X(3).					keratin filament				large_intestine(1)|breast(1)	2														0.225806	8.512366	10.658732	7	24	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44856629	44856629	8830	21	A	G	G	14	14	KRTAP10-8	G	4	4
COL6A2	1292	broad.mit.edu	36	21	46369916	46369916	+	Silent	SNP	C	G	G			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:46369916C>G	uc002zia.1	+	c.1926C>G	c.(1924-1926)GTC>GTG	p.V642V	COL6A2_uc002zhy.1_Silent_p.V642V|COL6A2_uc002zhz.1_Silent_p.V642V|COL6A2_uc002zib.1_Silent_p.V48V|COL6A2_uc002zic.1_5'Flank	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	642	VWFA 2.|Nonhelical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)										0.352941	9.727264	10.058808	6	11	CC		KEEP	---	---	---	---	capture			Silent	SNP	46369916	46369916	3838	21	C	G	G	29	29	COL6A2	G	3	3
ADRBK2	157	broad.mit.edu	36	22	24389598	24389598	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:24389598C>T	uc003abx.2	+	c.368C>T	c.(367-369)CCT>CTT	p.P123L	ADRBK2_uc010gux.1_Missense_Mutation_p.P123L|ADRBK2_uc003abw.2_Missense_Mutation_p.P10L|ADRBK2_uc003aby.2_Non-coding_Transcript	NM_005160	NP_005151	P35626	ARBK2_HUMAN	beta-adrenergic receptor kinase 2	123	N-terminal.|RGS.				protein phosphorylation		ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)	5					Adenosine triphosphate(DB00171)					345				0.25	6.690503	7.602076	4	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	24389598	24389598	345	22	C	T	T	24	24	ADRBK2	T	2	2
CARD10	29775	broad.mit.edu	36	22	36223053	36223053	+	Silent	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:36223053C>T	uc003asx.1	-	c.1866G>A	c.(1864-1866)TCG>TCA	p.S622S	CARD10_uc003ast.1_Non-coding_Transcript|CARD10_uc003asv.1_5'Flank|CARD10_uc003asw.1_Silent_p.S336S|CARD10_uc003asy.1_Silent_p.S622S	NM_014550	NP_055365	Q9BWT7	CAR10_HUMAN	caspase recruitment domain protein 10	622					activation of NF-kappaB-inducing kinase activity|protein complex assembly|regulation of apoptosis	CBM complex	receptor signaling complex scaffold activity			ovary(1)|kidney(1)	2	Melanoma(58;0.0574)									672				0.708333	51.978191	52.912182	17	7	CC		KEEP	---	---	---	---	capture			Silent	SNP	36223053	36223053	2763	22	C	T	T	19	19	CARD10	T	1	1
PARVG	64098	broad.mit.edu	36	22	42933599	42933600	+	Missense_Mutation	DNP	AG	CT	CT			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:42933599_42933600AG>CT	uc003bep.1	+	c.956_957AG>CT	c.(955-957)AAG>ACT	p.K319T	PARVG_uc003beq.1_Non-coding_Transcript|PARVG_uc003ber.1_Non-coding_Transcript	NM_022141	NP_071424	Q9HBI0	PARVG_HUMAN	parvin, gamma	319					cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)												0.307692	6.690553	7.122179	4	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	42933599	42933600	11887	22	AG	CT	CT	3	3	PARVG	CT	4	4
DPP10	57628	broad.mit.edu	36	2	116288982	116288982	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:116288982T>C	uc002tla.1	+	c.1844T>C	c.(1843-1845)ATT>ACT	p.I615T	DPP10_uc002tlb.1_Missense_Mutation_p.I565T|DPP10_uc002tlc.1_Missense_Mutation_p.I611T|DPP10_uc002tle.1_Missense_Mutation_p.I565T|DPP10_uc002tlf.1_Missense_Mutation_p.I608T	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	615	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|breast(1)|skin(1)	9														0.626667	308.602782	310.70362	94	56	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116288982	116288982	4911	2	T	C	C	52	52	DPP10	C	4	4
LRP2	4036	broad.mit.edu	36	2	169730763	169730763	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:169730763G>A	uc002ues.1	-	c.11683C>T	c.(11683-11685)CGC>TGC	p.R3895C		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3895	LDL-receptor class A 35.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	23				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)					2055				0.111111	13.591514	32.411819	14	112	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	169730763	169730763	9329	2	G	A	A	37	37	LRP2	A	1	1
ZSWIM2	151112	broad.mit.edu	36	2	187422100	187422100	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:187422100C>T	uc002upu.1	-	c.3G>A	c.(1-3)ATG>ATA	p.M1I		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	1					apoptosis		zinc ion binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)											0.6	6.521057	6.564116	3	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	187422100	187422100	18845	2	C	T	T	25	25	ZSWIM2	T	2	2
SDPR	8436	broad.mit.edu	36	2	192419790	192419791	+	Missense_Mutation	DNP	GG	AT	AT			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:192419790_192419791GG>AT	uc002utb.1	-	c.106_107CC>AT	c.(106-108)CCC>ATC	p.P36I		NM_004657	NP_004648	O95810	SDPR_HUMAN	serum deprivation response protein	36						caveola|cytosol	phosphatidylserine binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0647)		Phosphatidylserine(DB00144)									0.196078	9.799355	14.226088	10	41	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	192419790	192419791	14456	2	GG	AT	AT	43	43	SDPR	AT	2	2
WDR35	57539	broad.mit.edu	36	2	20001634	20001634	+	Missense_Mutation	SNP	G	C	C			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:20001634G>C	uc002rdi.1	-	c.1969C>G	c.(1969-1971)CAT>GAT	p.H657D	WDR35_uc002rdh.1_Missense_Mutation_p.H222D|WDR35_uc002rdj.1_Missense_Mutation_p.H646D|WDR35_uc010ext.1_Non-coding_Transcript|WDR35_uc002rdk.2_Missense_Mutation_p.H222D	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	657										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)													0.5	8.797238	8.797238	4	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20001634	20001634	17862	2	G	C	C	48	48	WDR35	C	3	3
CXCR7	57007	broad.mit.edu	36	2	237154129	237154129	+	Silent	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:237154129C>A	uc010fyq.1	+	c.282C>A	c.(280-282)GTC>GTA	p.V94V	CXCR7_uc002vwd.1_Silent_p.V94V|CXCR7_uc010fyr.1_Silent_p.V94V	NM_020311	NP_064707	P25106	CXCR7_HUMAN	chemokine orphan receptor 1	94	Helical; Name=2; (Potential).				interspecies interaction between organisms	integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			large_intestine(1)|central_nervous_system(1)|skin(1)	3		Breast(86;0.000182)|Renal(207;0.00339)|all_hematologic(139;0.0048)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|all_lung(227;0.147)|all_neural(83;0.223)		Epithelial(121;8.35e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.09e-11)|Kidney(56;1.11e-07)|KIRC - Kidney renal clear cell carcinoma(57;3.03e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000176)|Lung(119;0.00468)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.118)						49				0.183673	8.230469	12.863055	9	40	CC		KEEP	---	---	---	---	capture			Silent	SNP	237154129	237154129	4256	2	C	A	A	30	30	CXCR7	A	3	3
SIDT1	54847	broad.mit.edu	36	3	114808583	114808583	+	Silent	SNP	A	G	G			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:114808583A>G	uc003eak.1	+	c.1410A>G	c.(1408-1410)GTA>GTG	p.V470V	SIDT1_uc003eaj.1_Silent_p.V470V	NM_017699	NP_060169	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	470	Extracellular (Potential).					integral to membrane				ovary(3)|pancreas(1)|skin(1)	5														0.565789	279.435463	280.006647	86	66	AA		KEEP	---	---	---	---	capture			Silent	SNP	114808583	114808583	14797	3	A	G	G	13	13	SIDT1	G	4	4
ZNF148	7707	broad.mit.edu	36	3	126435076	126435077	+	Missense_Mutation	DNP	AT	TG	TG			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:126435076_126435077AT>TG	uc003ehx.2	-	c.1183_1184AT>CA	c.(1183-1185)ATT>CAT	p.I395H	SLC12A8_uc003ehw.2_Intron|ZNF148_uc003ehz.2_Missense_Mutation_p.I395H|ZNF148_uc010hsa.1_Missense_Mutation_p.I395H|ZNF148_uc003eia.2_Missense_Mutation_p.I395H|ZNF148_uc003ehy.2_Intron	NM_021964	NP_068799	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	395					cellular defense response|negative regulation of transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|specific RNA polymerase II transcription factor activity|transcription repressor activity|zinc ion binding			ovary(1)|pancreas(1)	2														0.363636	6.89127	7.073204	4	7	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	126435076	126435077	18325	3	AT	TG	TG	4	4	ZNF148	TG	4	4
RFTN1	23180	broad.mit.edu	36	3	16333388	16333388	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr3:16333388T>C	uc003cay.1	-	c.1688A>G	c.(1687-1689)GAC>GGC	p.D563G	RFTN1_uc010hes.1_Missense_Mutation_p.D527G|OXNAD1_uc003cax.2_Intron	NM_015150	NP_055965	Q14699	RFTN1_HUMAN	raft-linking protein	563						plasma membrane				ovary(3)|central_nervous_system(1)	4														0.238095	7.861038	9.181898	5	16	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16333388	16333388	13730	3	T	C	C	58	58	RFTN1	C	4	4
SLC7A14	57709	broad.mit.edu	36	3	171681357	171681357	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:171681357C>T	uc003fgz.2	-	c.1408G>A	c.(1408-1410)GGG>AGG	p.G470R		NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	470						integral to membrane	amino acid transmembrane transporter activity			ovary(2)|liver(1)|central_nervous_system(1)	4	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)											0.25448	173.920286	189.10622	71	208	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	171681357	171681357	15193	3	C	T	T	22	22	SLC7A14	T	2	2
TNK2	10188	broad.mit.edu	36	3	197099755	197099755	+	Silent	SNP	G	C	C			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:197099755G>C	uc003fvt.1	-	c.291C>G	c.(289-291)CGC>CGG	p.R97R	TNK2_uc003fvs.1_Silent_p.R66R|TNK2_uc003fvu.1_Silent_p.R34R|TNK2_uc010hzw.1_Non-coding_Transcript|TNK2_uc003fvv.1_5'Flank|TNK2_uc010hzx.1_Silent_p.R48R	NM_001010938	NP_001010938	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2 isoform 2	34	SAM-like domain.		R -> L (in a lung adenocarcinoma sample; somatic mutation).		positive regulation of peptidyl-tyrosine phosphorylation|protein phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)					288				0.3125	16.32031	17.332843	10	22	GG		KEEP	---	---	---	---	capture			Silent	SNP	197099755	197099755	16859	3	G	C	C	42	42	TNK2	C	3	3
KBTBD5	131377	broad.mit.edu	36	3	42702334	42702334	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:42702334C>A	uc003clv.1	+	c.220C>A	c.(220-222)CTG>ATG	p.L74M		NM_152393	NP_689606	Q2TBA0	KBTB5_HUMAN	kelch repeat and BTB (POZ) domain containing 5	74	BTB.									ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.214)										0.454545	8.125994	8.150723	5	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42702334	42702334	8301	3	C	A	A	24	24	KBTBD5	A	3	3
SETD2	29072	broad.mit.edu	36	3	47136966	47136966	+	Missense_Mutation	SNP	A	T	T			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:47136966A>T	uc003cqs.1	-	c.2655T>A	c.(2653-2655)GAT>GAA	p.D885E	SETD2_uc003cqu.1_Missense_Mutation_p.D1344E|SETD2_uc003cqv.1_Missense_Mutation_p.D1377E	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1388					oxidation-reduction process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)										0.357143	9.764837	10.018929	5	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47136966	47136966	14620	3	A	T	T	4	4	SETD2	T	4	4
PGRMC2	10424	broad.mit.edu	36	4	129428122	129428123	+	Missense_Mutation	DNP	CG	GA	GA			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:129428122_129428123CG>GA	uc003igg.1	-	c.273_274CG>TC	c.(271-276)CCCGCC>CCTCCC	p.A92P		NM_006320	NP_006311			progesterone receptor membrane component 2												0						Colon(78;371 1268 8296 41305 53030)								0.8	9.329025	9.71308	4	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	129428122	129428123	12230	4	CG	GA	GA	27	27	PGRMC2	GA	3	3
KLHL2	11275	broad.mit.edu	36	4	166438221	166438221	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:166438221C>A	uc003irb.1	+	c.665C>A	c.(664-666)GCA>GAA	p.A222E	KLHL2_uc003irc.1_Missense_Mutation_p.A134E|KLHL2_uc010ira.1_5'UTR	NM_007246	NP_009177	O95198	KLHL2_HUMAN	kelch-like 2, Mayven	222					intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)										0.193548	47.527346	58.407099	24	100	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	166438221	166438221	8686	4	C	A	A	25	25	KLHL2	A	3	3
UFSP2	55325	broad.mit.edu	36	4	186571894	186571894	+	Missense_Mutation	SNP	G	C	C			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:186571894G>C	uc003ixo.1	-	c.811C>G	c.(811-813)CCT>GCT	p.P271A	UFSP2_uc003ixn.1_Missense_Mutation_p.P161A|UFSP2_uc003ixp.1_Non-coding_Transcript|UFSP2_uc003ixq.1_Missense_Mutation_p.P161A	NM_018359	NP_060829	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	271						endoplasmic reticulum|nucleus	small conjugating protein-specific protease activity				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)										0.172414	12.011389	17.904873	10	48	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	186571894	186571894	17496	4	G	C	C	44	44	UFSP2	C	3	3
ZFP42	132625	broad.mit.edu	36	4	189161687	189161687	+	Silent	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:189161687G>A	uc003izg.1	+	c.732G>A	c.(730-732)CCG>CCA	p.P244P	ZFP42_uc003izh.1_Silent_p.P244P|ZFP42_uc003izi.1_Silent_p.P244P|ZFP42_uc010isp.1_Silent_p.P244P	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	244					female gonad development|male gonad development|meiosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)										0.676692	280.511366	284.183002	90	43	GG		KEEP	---	---	---	---	capture			Silent	SNP	189161687	189161687	18238	4	G	A	A	40	40	ZFP42	A	1	1
TRIML1	339976	broad.mit.edu	36	4	189297719	189297719	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:189297719G>T	uc003izm.1	+	c.13G>T	c.(13-15)GAT>TAT	p.D5Y		NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	5					multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|breast(1)|pancreas(1)	3		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		Melanoma(31;213 1036 16579 23968 32372)								0.367089	82.952543	84.179729	29	50	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	189297719	189297719	17100	4	G	T	T	33	33	TRIML1	T	3	3
TLR6	10333	broad.mit.edu	36	4	38507050	38507050	+	Missense_Mutation	SNP	T	A	A			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:38507050T>A	uc003gtm.2	-	c.440A>T	c.(439-441)CAA>CTA	p.Q147L	TLR6_uc010ifg.1_Missense_Mutation_p.Q147L|TLR6_uc010ifh.1_Missense_Mutation_p.Q147L	NM_006068	NP_006059	Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	147	Extracellular (Potential).|LRR 5.				activation of NF-kappaB-inducing kinase activity|cellular response to diacyl bacterial lipopeptide|defense response to bacterium|detection of diacyl bacterial lipopeptide|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-6 biosynthetic process|positive regulation of JUN kinase activity|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	integral to plasma membrane|phagocytic vesicle membrane	lipopeptide binding|transmembrane receptor activity			ovary(2)	2														0.206897	7.424252	9.747317	6	23	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38507050	38507050	16485	4	T	A	A	63	63	TLR6	A	4	4
CHIC2	26511	broad.mit.edu	36	4	54610230	54610230	+	Splice_Site_SNP	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:54610230C>A	uc003haj.1	-	c.e2_splice_site			PDGFRA_uc003haa.1_Intron	NM_012110	NP_036242			cysteine-rich hydrophobic domain 2							plasma membrane	protein binding			central_nervous_system(1)	1	all_cancers(7;0.0193)|all_neural(26;0.0209)|Lung NSC(11;0.0281)|Glioma(25;0.08)		LUSC - Lung squamous cell carcinoma(32;0.00216)							9				0.25	6.755531	7.902404	5	15	CC		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	54610230	54610230	3478	4	C	A	A	32	32	CHIC2	A	5	3
EVC2	132884	broad.mit.edu	36	4	5621185	5621185	+	Silent	SNP	G	T	T			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:5621185G>T	uc003gij.1	-	c.3444C>A	c.(3442-3444)CCC>CCA	p.P1148P	EVC2_uc003gik.1_Silent_p.P1068P	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin	1148						integral to membrane				large_intestine(3)|ovary(2)	5														0.571429	7.488762	7.518675	4	3	GG		KEEP	---	---	---	---	capture			Silent	SNP	5621185	5621185	5479	4	G	T	T	47	47	EVC2	T	3	3
DRD5	1816	broad.mit.edu	36	4	9393586	9393586	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:9393586G>A	uc003gmb.2	+	c.835G>A	c.(835-837)GCG>ACG	p.A279T		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	279	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane					0					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)									0.588235	26.844397	26.959104	10	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9393586	9393586	4944	4	G	A	A	38	38	DRD5	A	1	1
CXCL14	9547	broad.mit.edu	36	5	134938181	134938181	+	Silent	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:134938181G>A	uc003lay.1	-	c.300C>T	c.(298-300)AAC>AAT	p.N100N		NM_004887	NP_004878	O95715	CXL14_HUMAN	small inducible cytokine B14 precursor	100					cell-cell signaling|chemotaxis|immune response|signal transduction	extracellular space|Golgi apparatus	chemokine activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)											0.255319	26.729455	29.250562	12	35	GG		KEEP	---	---	---	---	capture			Silent	SNP	134938181	134938181	4242	5	G	A	A	40	40	CXCL14	A	1	1
PCDHA1	56147	broad.mit.edu	36	5	140147341	140147341	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140147341C>T	uc003lhb.1	+	c.1282C>T	c.(1282-1284)CGG>TGG	p.R428W	PCDHA1_uc003lha.1_Missense_Mutation_p.R428W|PCDHA1_uc003lgz.1_Missense_Mutation_p.R428W	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	428	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.5	32.731059	32.731059	13	13	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140147341	140147341	11939	5	C	T	T	27	27	PCDHA1	T	1	1
PCDHB5	26167	broad.mit.edu	36	5	140496488	140496488	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140496488C>A	uc003liq.1	+	c.1288C>A	c.(1288-1290)CTG>ATG	p.L430M		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	430	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)											0.084746	7.762152	59.366319	25	270	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140496488	140496488	11965	5	C	A	A	28	28	PCDHB5	A	3	3
STK10	6793	broad.mit.edu	36	5	171456156	171456156	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:171456156C>A	uc003mbo.1	-	c.884G>T	c.(883-885)AGC>ATC	p.S295I		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	295					protein phosphorylation		ATP binding|protein serine/threonine kinase activity			ovary(3)|testis(1)|lung(1)|pancreas(1)	6	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)							570				0.307692	8.792577	9.222727	4	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	171456156	171456156	15806	5	C	A	A	28	28	STK10	A	3	3
EGFLAM	133584	broad.mit.edu	36	5	38373417	38373417	+	Missense_Mutation	SNP	T	A	A			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:38373417T>A	uc003jlc.1	+	c.136T>A	c.(136-138)TTG>ATG	p.L46M	EGFLAM_uc003jlb.1_Missense_Mutation_p.L46M	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	46	Fibronectin type-III 1.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|ovary(1)	4	all_lung(31;0.000385)					Colon(62;485 1295 3347 17454)								0.277778	10.859313	11.665431	5	13	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38373417	38373417	5155	5	T	A	A	52	52	EGFLAM	A	4	4
MSH3	4437	broad.mit.edu	36	5	80006604	80006604	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:80006604G>T	uc003kgz.1	+	c.1074G>T	c.(1072-1074)GAG>GAT	p.E358D		NM_002439	NP_002430	P20585	MSH3_HUMAN	mutS homolog 3	358					maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			ovary(1)	1		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		Melanoma(88;1010 1399 13793 26548 36275)				1101				0.225806	8.897141	11.053251	7	24	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	80006604	80006604	10264	5	G	T	T	33	33	MSH3	T	3	3
HIVEP1	3096	broad.mit.edu	36	6	12231815	12231816	+	Missense_Mutation	DNP	AA	TC	TC			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:12231815_12231816AA>TC	uc003nac.1	+	c.3801_3802AA>TC	c.(3799-3804)GAAACC>GATCCC	p.1267_1268ET>DP		NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	1267_1268					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)	5	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)												0.227273	6.756582	8.267571	5	17	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	12231815	12231816	7477	6	AA	TC	TC	1	1	HIVEP1	TC	4	4
HEBP2	23593	broad.mit.edu	36	6	138768981	138768981	+	Missense_Mutation	SNP	G	C	C	rs3734303	by-cluster,by-frequency,by-hapmap	TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:138768981G>C	uc003qhw.1	+	c.419G>C	c.(418-420)CGG>CCG	p.R140P		NM_014320	NP_055135	Q9Y5Z4	HEBP2_HUMAN	heme binding protein 2	140						mitochondrion					0	Breast(32;0.0933)			GBM - Glioblastoma multiforme(68;0.000732)|OV - Ovarian serous cystadenocarcinoma(155;0.00171)										0.612903	295.474026	297.19081	95	60	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	138768981	138768981	7320	6	G	C	C	39	39	HEBP2	C	3	3
HIST1H1T	3010	broad.mit.edu	36	6	26216163	26216163	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:26216163C>G	uc003ngj.1	-	c.138G>C	c.(136-138)AAG>AAC	p.K46N		NM_005323	NP_005314	P22492	H1T_HUMAN	histone cluster 1, H1t	46	H15.				cell differentiation|multicellular organismal development|nucleosome assembly|spermatogenesis	nucleosome	DNA binding			ovary(2)	2														0.4	25.697725	25.872096	8	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26216163	26216163	7412	6	C	G	G	20	20	HIST1H1T	G	3	3
COL11A2	1302	broad.mit.edu	36	6	33242480	33242480	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:33242480C>T	uc003ocx.1	-	c.4333G>A	c.(4333-4335)GAG>AAG	p.E1445K	COL11A2_uc010jul.1_Intron|COL11A2_uc003ocy.1_Missense_Mutation_p.E1359K|COL11A2_uc003ocz.1_Missense_Mutation_p.E1338K	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	1445	Triple-helical region.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(1)	4						Melanoma(1;90 116 3946 5341 17093)								0.168831	23.724388	31.727966	13	64	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33242480	33242480	3806	6	C	T	T	29	29	COL11A2	T	2	2
KIFC1	3833	broad.mit.edu	36	6	33482415	33482415	+	Silent	SNP	T	G	G			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:33482415T>G	uc003oef.2	+	c.1896T>G	c.(1894-1896)GCT>GCG	p.A632A		NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN	kinesin family member C1	632					blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity				0														0.240741	17.450481	20.868125	13	41	TT		KEEP	---	---	---	---	capture			Silent	SNP	33482415	33482415	8623	6	T	G	G	53	53	KIFC1	G	4	4
DNAH8	1769	broad.mit.edu	36	6	39013842	39013842	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:39013842C>T	uc003ooe.1	+	c.11027C>T	c.(11026-11028)GCG>GTG	p.A3676V	DNAH8_uc003oog.1_Missense_Mutation_p.A125V	NM_001371	NP_001362	Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy polypeptide 8	3676					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(5)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	17										2979				0.5	49.878635	49.878635	17	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39013842	39013842	4790	6	C	T	T	27	27	DNAH8	T	1	1
ZNF318	24149	broad.mit.edu	36	6	43414711	43414711	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:43414711C>T	uc003oux.1	-	c.5003G>A	c.(5002-5004)GGC>GAC	p.G1668D	ZNF318_uc003ouw.2_Intron	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1668					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(2)|breast(2)|central_nervous_system(1)	5			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)											0.186047	8.366714	12.358657	8	35	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43414711	43414711	18428	6	C	T	T	26	26	ZNF318	T	2	2
TDRD6	221400	broad.mit.edu	36	6	46769663	46769663	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:46769663G>A	uc003oyj.1	+	c.5839G>A	c.(5839-5841)GAA>AAA	p.E1947K	TDRD6_uc010jze.1_Missense_Mutation_p.E1941K	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	1947					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)	5			Lung(136;0.192)											0.225806	8.085164	10.254195	7	24	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46769663	46769663	16261	6	G	A	A	33	33	TDRD6	A	2	2
GFRAL	389400	broad.mit.edu	36	6	55324154	55324154	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:55324154G>A	uc003pcm.1	+	c.515G>A	c.(514-516)CGG>CAG	p.R172Q		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	172	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)											0.218543	68.231298	79.241372	33	118	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55324154	55324154	6619	6	G	A	A	39	39	GFRAL	A	1	1
MUC17	140453	broad.mit.edu	36	7	100469992	100469992	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100469992G>A	uc003uxp.1	+	c.8575G>A	c.(8575-8577)GTG>ATG	p.V2859M	MUC17_uc010lho.1_Non-coding_Transcript	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17	2859	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|46.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	p.V2859M(1)		ovary(14)|breast(3)|lung(2)	19	Lung NSC(181;0.136)|all_lung(186;0.182)													0.318182	56.754273	58.692381	21	45	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100469992	100469992	10368	7	G	A	A	40	40	MUC17	A	1	1
FAM71F1	84691	broad.mit.edu	36	7	128142791	128142791	+	Silent	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:128142791C>T	uc003vno.1	+	c.60C>T	c.(58-60)GTC>GTT	p.V20V	FAM71F1_uc010llo.1_Intron|FAM71F1_uc003vnm.1_Intron|FAM71F1_uc003vnn.1_Intron|FAM71F1_uc010llp.1_Non-coding_Transcript|FAM71F1_uc003vnp.1_Silent_p.V20V	NM_032599	NP_115988	Q96KD3	F71F1_HUMAN	testes development-related NYD-SP18	20											0														0.304348	12.103634	12.897317	7	16	CC		KEEP	---	---	---	---	capture			Silent	SNP	128142791	128142791	5836	7	C	T	T	29	29	FAM71F1	T	2	2
ATP6V1F	9296	broad.mit.edu	36	7	128290266	128290266	+	Silent	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:128290266C>T	uc003voc.1	+	c.72C>T	c.(70-72)GGC>GGT	p.G24G	KCP_uc003vob.1_Non-coding_Transcript	NM_004231	NP_004222	Q16864	VATF_HUMAN	ATPase, H+ transporting, lysosomal 14kD, V1	24					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|membrane fraction|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATPase activity, uncoupled|hydrogen ion transporting ATP synthase activity, rotational mechanism|protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)	1												OREG0018299	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.22449	13.794277	17.227808	11	38	CC		KEEP	---	---	---	---	capture			Silent	SNP	128290266	128290266	1204	7	C	T	T	25	25	ATP6V1F	T	2	2
OR2A25	392138	broad.mit.edu	36	7	143402611	143402611	+	Silent	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:143402611C>T	uc003wdv.1	+	c.366C>T	c.(364-366)TAC>TAT	p.Y122Y		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)													0.476821	209.725541	209.792199	72	79	CC		KEEP	---	---	---	---	capture			Silent	SNP	143402611	143402611	11384	7	C	T	T	19	19	OR2A25	T	1	1
FAM188B	84182	broad.mit.edu	36	7	30881698	30881698	+	Silent	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:30881698C>T	uc003tbt.1	+	c.1873C>T	c.(1873-1875)CTG>TTG	p.L625L	FAM188B_uc010kwe.1_Silent_p.L596L|FAM188B_uc003tbu.1_Silent_p.L145L	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	625											0														0.15942	8.367203	16.031192	11	58	CC		KEEP	---	---	---	---	capture			Silent	SNP	30881698	30881698	5725	7	C	T	T	28	28	FAM188B	T	2	2
TNS3	64759	broad.mit.edu	36	7	47374571	47374572	+	Missense_Mutation	DNP	GA	TG	TG			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:47374571_47374572GA>TG	uc003tnv.1	-	c.2196_2197TC>CA	c.(2194-2199)TCTCCA>TCCACA	p.P733T	TNS3_uc003tnw.1_Missense_Mutation_p.P733T	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3	733						focal adhesion	protein binding			ovary(4)	4														0.571429	7.991742	8.021883	4	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	47374571	47374572	16885	7	GA	TG	TG	41	41	TNS3	TG	3	3
ACTB	60	broad.mit.edu	36	7	5534000	5534000	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:5534000T>C	uc003sos.2	-	c.1033A>G	c.(1033-1035)ATC>GTC	p.I345V	ACTB_uc003sor.2_Missense_Mutation_p.I223V|ACTB_uc003sot.2_Missense_Mutation_p.I345V|ACTB_uc003soq.2_Missense_Mutation_p.I223V|ACTB_uc010ksy.1_Missense_Mutation_p.I223V	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin	345					'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)										0.159574	15.140081	25.475111	15	79	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5534000	5534000	194	7	T	C	C	51	51	ACTB	C	4	4
WBSCR17	64409	broad.mit.edu	36	7	70518904	70518904	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:70518904G>A	uc003tvy.1	+	c.683G>A	c.(682-684)CGC>CAC	p.R228H	WBSCR17_uc003tvz.1_5'UTR	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	228	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)												0.41573	103.571892	104.118131	37	52	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70518904	70518904	17836	7	G	A	A	38	38	WBSCR17	A	1	1
PTPN12	5782	broad.mit.edu	36	7	77004813	77004813	+	Missense_Mutation	SNP	A	G	G			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:77004813A>G	uc003ugh.1	+	c.14A>G	c.(13-15)GAG>GGG	p.E5G		NM_002835	NP_002826	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type	5						soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding			ovary(1)|breast(1)|pancreas(1)	3														0.266667	6.589794	7.330938	4	11	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	77004813	77004813	13236	7	A	G	G	11	11	PTPN12	G	4	4
WISP1	8840	broad.mit.edu	36	8	134294438	134294438	+	Missense_Mutation	SNP	T	G	G			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr8:134294438T>G	uc003yub.1	+	c.219T>G	c.(217-219)TGT>TGG	p.C73W	WISP1_uc003yuc.1_Missense_Mutation_p.C73W|WISP1_uc010meb.1_Intron|WISP1_uc010mec.1_Missense_Mutation_p.C73W|WISP1_uc010med.1_Intron|WISP1_uc003yud.1_5'Flank	NM_003882	NP_003873	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	73	IGFBP N-terminal.				cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding			central_nervous_system(1)|kidney(1)	2	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)											0.2	12.776544	17.812295	12	48	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	134294438	134294438	17946	8	T	G	G	59	59	WISP1	G	4	4
GSDMD	79792	broad.mit.edu	36	8	144712777	144712777	+	Silent	SNP	G	A	A			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:144712777G>A	uc003yyf.1	+	c.273G>A	c.(271-273)AAG>AAA	p.K91K	GSDMD_uc010mfe.1_Silent_p.K43K|GSDMD_uc003yyg.1_Silent_p.K43K|GSDMD_uc003yyh.1_Silent_p.K43K|GSDMD_uc003yyi.1_Silent_p.K43K	NM_024736	NP_079012	P57764	GSDMD_HUMAN	gasdermin D	43											0														0.233333	9.194374	11.16481	7	23	GG		KEEP	---	---	---	---	capture			Silent	SNP	144712777	144712777	7099	8	G	A	A	34	34	GSDMD	A	2	2
NAPRT1	93100	broad.mit.edu	36	8	144731204	144731204	+	Missense_Mutation	SNP	G	C	C			TCGA-06-1801-01	TCGA-06-1801-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:144731204G>C	uc003yyo.2	-	c.279C>G	c.(277-279)TTC>TTG	p.F93L	NAPRT1_uc003yyl.1_Missense_Mutation_p.F69L|NAPRT1_uc003yym.2_Missense_Mutation_p.F93L|NAPRT1_uc003yyn.2_Missense_Mutation_p.F93L	NM_145201	NP_660202	Q6XQN6	PNCB_HUMAN	nicotinate phosphoribosyltransferase domain	93					nicotinamide metabolic process|nicotinate nucleotide salvage|response to oxidative stress	cytosol|Golgi apparatus|nucleus	nicotinate phosphoribosyltransferase activity|nicotinate-nucleotide diphosphorylase (carboxylating) activity			ovary(1)	1	all_cancers(97;6.49e-11)|all_epithelial(106;4.73e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.014)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.146)							3				0.444444	7.69191	7.716858	4	5	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	144731204	144731204	10561	8	G	C	C	37	37	NAPRT1	C	3	3
LZTS1	11178	broad.mit.edu	36	8	20154776	20154776	+	Missense_Mutation	SNP	T	G	G			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr8:20154776T>G	uc003wzr.1	-	c.946A>C	c.(946-948)AAG>CAG	p.K316Q	LZTS1_uc010ltg.1_Missense_Mutation_p.K316Q	NM_021020	NP_066300	Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	316	Potential.				cell cycle|regulation of transcription, DNA-dependent|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)										0.6	6.319335	6.361929	3	2	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20154776	20154776	9515	8	T	G	G	63	63	LZTS1	G	4	4
ARMC1	55156	broad.mit.edu	36	8	66680287	66680288	+	Missense_Mutation	DNP	TT	AA	AA			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:66680287_66680288TT>AA	uc003xvl.1	-	c.505_506AA>TT	c.(505-507)AAA>TTA	p.K169L		NM_018120	NP_060590	Q9NVT9	ARMC1_HUMAN	armadillo repeat-containing protein	169					metal ion transport		metal ion binding				0			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)											0.208333	7.262219	9.155986	5	19	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	66680287	66680288	967	8	TT	AA	AA	64	64	ARMC1	AA	4	4
RBM12B	389677	broad.mit.edu	36	8	94815683	94815684	+	Missense_Mutation	DNP	GG	CC	CC			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:94815683_94815684GG>CC	uc003yfz.1	-	c.2131_2132CC>GG	c.(2131-2133)CCT>GGT	p.P711G	RBM12B_uc010mas.1_Missense_Mutation_p.P711G	NM_203390	NP_976324	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	711							nucleotide binding|RNA binding				0	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)											0.454545	9.86472	9.885395	5	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	94815683	94815684	13575	8	GG	CC	CC	35	35	RBM12B	CC	3	3
FAM129B	64855	broad.mit.edu	36	9	129310582	129310582	+	Silent	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:129310582C>T	uc004brh.1	-	c.1374G>A	c.(1372-1374)AAG>AAA	p.K458K	FAM129B_uc004bri.1_Silent_p.K445K|FAM129B_uc004brj.2_Silent_p.K458K	NM_022833	NP_073744	Q96TA1	NIBL1_HUMAN	hypothetical protein LOC64855 isoform 1	445							protein binding				0														0.333333	9.629063	10.079356	6	12	CC		KEEP	---	---	---	---	capture			Silent	SNP	129310582	129310582	5634	9	C	T	T	24	24	FAM129B	T	2	2
RALGDS	5900	broad.mit.edu	36	9	134975531	134975531	+	Missense_Mutation	SNP	T	G	G			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:134975531T>G	uc004cco.1	-	c.461A>C	c.(460-462)CAA>CCA	p.Q154P	RALGDS_uc004ccs.1_Missense_Mutation_p.Q99P|RALGDS_uc004ccp.1_Non-coding_Transcript|RALGDS_uc004ccq.1_Missense_Mutation_p.Q154P|RALGDS_uc004ccr.1_Missense_Mutation_p.Q153P|RALGDS_uc004ccu.1_5'Flank|RALGDS_uc004ccv.1_5'Flank	NM_006266	NP_006257	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	154	N-terminal Ras-GEF.				nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	Ral guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		Melanoma(189;762 2088 15384 21931 52515)				815				0.4	9.194929	9.283113	4	6	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	134975531	134975531	13476	9	T	G	G	63	63	RALGDS	G	4	4
C9orf71	169693	broad.mit.edu	36	9	70345481	70345481	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:70345481C>T	uc004agt.1	-	c.70G>A	c.(70-72)GGG>AGG	p.G24R		NM_153237	NP_694969	Q8N6L7	CI071_HUMAN	hypothetical protein LOC169693	24	Helical; (Potential).					integral to membrane					0														0.238095	6.958722	8.282387	5	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70345481	70345481	2610	9	C	T	T	22	22	C9orf71	T	2	2
GPR112	139378	broad.mit.edu	36	X	135315566	135315566	+	Missense_Mutation	SNP	T	A	A			TCGA-06-1801-01	TCGA-06-1801-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:135315566T>A	uc004ezu.1	+	c.8704T>A	c.(8704-8706)TTT>ATT	p.F2902I	GPR112_uc010nsb.1_Missense_Mutation_p.F2697I	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2902	Helical; Name=5; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	11	Acute lymphoblastic leukemia(192;0.000127)									487				0.129032	9.829391	22.320091	12	81	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	135315566	135315566	6903	23	T	A	A	64	64	GPR112	A	4	4
AFF2	2334	broad.mit.edu	36	X	147851941	147851941	+	Missense_Mutation	SNP	A	C	C			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:147851941A>C	uc004fcp.1	+	c.2691A>C	c.(2689-2691)GAA>GAC	p.E897D	AFF2_uc004fcq.1_Missense_Mutation_p.E887D|AFF2_uc004fcr.1_Missense_Mutation_p.E858D|AFF2_uc004fcs.1_Missense_Mutation_p.E864D	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	897					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)													0.75	7.824908	8.04865	3	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	147851941	147851941	358	23	A	C	C	9	9	AFF2	C	4	4
MAGEB4	4115	broad.mit.edu	36	X	30170511	30170512	+	Missense_Mutation	DNP	CG	GA	GA			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:30170511_30170512CG>GA	uc004dcb.1	+	c.338_339CG>GA	c.(337-339)ACG>AGA	p.T113R	MAGEB1_uc004dcc.1_5'Flank|MAGEB1_uc004dcd.1_5'Flank	NM_002367	NP_002358	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	113	MAGE.									ovary(1)	1														0.4	7.389736	7.479247	4	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	30170511	30170512	9559	23	CG	GA	GA	19	19	MAGEB4	GA	3	3
CXorf59	286464	broad.mit.edu	36	X	36027835	36027835	+	Missense_Mutation	SNP	A	T	T			TCGA-06-1801-01	TCGA-06-1801-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:36027835A>T	uc004ddk.1	+	c.770A>T	c.(769-771)AAA>ATA	p.K257I		NM_173695	NP_775966	Q8N9S7	CX059_HUMAN	hypothetical protein LOC286464	257						integral to membrane				central_nervous_system(1)	1														0.275	57.503833	61.163165	22	58	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36027835	36027835	4279	23	A	T	T	1	1	CXorf59	T	4	4
KDM6A	7403	broad.mit.edu	36	X	44807958	44807958	+	Silent	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:44807958C>T	uc004dge.2	+	c.1875C>T	c.(1873-1875)ACC>ACT	p.T625T	KDM6A_uc004dgf.1_Silent_p.T240T|KDM6A_uc010nhk.1_Silent_p.T257T	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	625					histone H3-K4 methylation|oxidation-reduction process		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						Colon(129;1273 1667 15230 27352 52914)				372				0.555556	14.673844	14.697933	5	4	CC		KEEP	---	---	---	---	capture			Silent	SNP	44807958	44807958	8443	23	C	T	T	21	21	KDM6A	T	2	2
SMC1A	8243	broad.mit.edu	36	X	53447470	53447470	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:53447470C>A	uc004dsg.1	-	c.2277G>T	c.(2275-2277)GAG>GAT	p.E759D	SMC1A_uc004dsh.1_Missense_Mutation_p.E737D	NM_006306	NP_006297	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	759	Potential.				cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity			ovary(5)	5														0.212121	9.701546	12.239716	7	26	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53447470	53447470	15279	23	C	A	A	32	32	SMC1A	A	3	3
OTUD6A	139562	broad.mit.edu	36	X	69199920	69199921	+	Missense_Mutation	DNP	CG	AT	AT			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:69199920_69199921CG>AT	uc004dxu.1	+	c.821_822CG>AT	c.(820-822)CCG>CAT	p.P274H		NM_207320	NP_997203	Q7L8S5	OTU6A_HUMAN	OTU domain containing 6A	274	OTU.										0														0.21875	16.808193	21.497882	14	50	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	69199920	69199921	11729	23	CG	AT	AT	23	23	OTUD6A	AT	3	3
MED12	9968	broad.mit.edu	36	X	70261673	70261673	+	Silent	SNP	C	T	T			TCGA-06-1801-01	TCGA-06-1801-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:70261673C>T	uc004dyy.1	+	c.2178C>T	c.(2176-2178)TAC>TAT	p.Y726Y	MED12_uc004dyz.1_Silent_p.Y726Y|MED12_uc004dza.1_Silent_p.Y573Y	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	726					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription mediator activity|thyroid hormone receptor binding|transcription activator activity|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)													0.218045	127.018952	146.442141	58	208	CC		KEEP	---	---	---	---	capture			Silent	SNP	70261673	70261673	9817	23	C	T	T	19	19	MED12	T	1	1
EIF4B	1975	broad.mit.edu	36	12	51699058	51699059	+	Splice_Site_Ins	INS	-	T	T			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:51699058_51699059insT	uc001sbh.2	+	c.e3_splice_site			EIF4B_uc009zmp.1_Splice_Site_Ins|EIF4B_uc001sbi.1_Splice_Site_Ins	NM_001417	NP_001408			eukaryotic translation initiation factor 4B						insulin receptor signaling pathway|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	nucleotide binding|translation initiation factor activity			breast(1)|kidney(1)	2										304				0.38			5	8				---	---	---	---	capture_indel			Splice_Site_Ins	INS	51699058	51699059	5218	12	-	T	T	48	48	EIF4B	T	5	5
IPO4	79711	broad.mit.edu	36	14	23725923	23725926	+	Splice_Site_Del	DEL	CCTC	-	-			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:23725923_23725926delCCTC	uc001wmv.1	-	c.e8_splice_site			IPO4_uc001wmu.1_Splice_Site_Del|IPO4_uc001wmw.1_Splice_Site_Del|IPO4_uc001wmx.1_Splice_Site_Del|IPO4_uc001wmy.1_Splice_Site_Del|IPO4_uc001wmz.1_Splice_Site_Del	NM_024658	NP_078934			importin 4						intracellular protein transport	cytoplasm|nucleus	protein binding|protein transporter activity			kidney(1)	1				GBM - Glioblastoma multiforme(265;0.0087)										0.45			40	48				---	---	---	---	capture_indel			Splice_Site_Del	DEL	23725923	23725926	8096	14	CCTC	-	-	18	18	IPO4	-	5	5
MLH3	27030	broad.mit.edu	36	14	74583838	74583839	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:74583838_74583839insA	uc001xrd.1	-	c.2273_2274insT	c.(2272-2274)AAGfs	p.K758fs	MLH3_uc001xre.1_Frame_Shift_Ins_p.K758fs	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN	mutL homolog 3 isoform 1	758					mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)										0.34			29	57				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	74583838	74583839	10008	14	-	A	A	32	32	MLH3	A	5	5
KCNH4	23415	broad.mit.edu	36	17	37575077	37575078	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:37575077_37575078insC	uc002hzb.1	-	c.1533_1534insG	c.(1531-1536)CGCATGfs	p.R511fs		NM_012285	NP_036417	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H,	511_512	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	two-component sensor activity|voltage-gated potassium channel activity			large_intestine(1)	1		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		NSCLC(117;707 1703 2300 21308 31858)								0.35			43	79				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	37575077	37575078	8339	17	-	C	C	51	51	KCNH4	C	5	5
RIT2	6014	broad.mit.edu	36	18	38577598	38577602	+	Frame_Shift_Del	DEL	TCAAT	-	-			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:38577598_38577602delTCAAT	uc002lav.1	-	c.508_512delATTGA	c.(508-513)ATTGATfs	p.I170fs	RIT2_uc010dnf.1_3'UTR	NM_002930	NP_002921	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	170_171					nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			ovary(1)	1														0.66			47	24				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	38577598	38577602	13864	18	TCAAT	-	-	50	50	RIT2	-	5	5
HOMER3	9454	broad.mit.edu	36	19	18910259	18910260	+	Frame_Shift_Ins	INS	-	GC	GC			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:18910259_18910260insGC	uc002nku.1	-	c.205_206insGC	c.(205-207)ACCfs	p.T69fs	HOMER3_uc010eby.1_Frame_Shift_Ins_p.T69fs|HOMER3_uc010ebz.1_Frame_Shift_Ins_p.T69fs|HOMER3_uc002nkv.1_Frame_Shift_Ins_p.T69fs|HOMER3_uc002nkw.1_Frame_Shift_Ins_p.T69fs	NM_004838	NP_004829	Q9NSC5	HOME3_HUMAN	Homer, neuronal immediate early gene, 3	69	WH1.				metabotropic glutamate receptor signaling pathway|protein targeting	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	protein binding				0			Epithelial(12;0.0107)											0.39			32	51				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	18910259	18910260	7572	19	-	GC	GC	44	44	HOMER3	GC	5	5
MOSC1	64757	broad.mit.edu	36	1	219037904	219037923	+	Frame_Shift_Del	DEL	CAGGCTAGAGAAGAAAGTTA	-	-			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:219037904_219037923delCAGGCTAGAGAAGAAAGTTA	uc001hmt.1	+	c.678_697delCAGGCTAGAGAAGAAAGTTA	c.(676-699)TCCAGGCTAGAGAAGAAAGTTAAAfs	p.S226fs	MOSC1_uc001hms.1_Frame_Shift_Del_p.S226fs	NM_022746	NP_073583	Q5VT66	MOSC1_HUMAN	MOCO sulphurase C-terminal domain containing 1	226_233	MOSC.				oxidation-reduction process		molybdenum ion binding|oxidoreductase activity|pyridoxal phosphate binding				0				GBM - Glioblastoma multiforme(131;0.0358)										0.31			48	108				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	219037904	219037923	10105	1	CAGGCTAGAGAAGAAAGTTA	-	-	21	21	MOSC1	-	5	5
SLC12A5	57468	broad.mit.edu	36	20	44107106	44107109	+	Frame_Shift_Del	DEL	GGGG	-	-			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:44107106_44107109delGGGG	uc002xrb.1	+	c.1489_1492delGGGG	c.(1489-1494)GGGGCTfs	p.G497fs		NM_020708	NP_065759	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	520_521					potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)									0.33			54	108				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	44107106	44107109	14881	20	GGGG	-	-	47	47	SLC12A5	-	5	5
YTHDF1	54915	broad.mit.edu	36	20	61304698	61304702	+	Frame_Shift_Del	DEL	CGCTG	-	-			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:61304698_61304702delCGCTG	uc002yeh.1	-	c.1035_1039delCAGCG	c.(1033-1041)GGCAGCGATfs	p.G345fs		NM_017798	NP_060268	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	345_347										ovary(2)	2														0.51			56	53				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	61304698	61304702	18081	20	CGCTG	-	-	31	31	YTHDF1	-	5	5
SEC14L2	23541	broad.mit.edu	36	22	29135271	29135272	+	Splice_Site_Ins	INS	-	TCT	TCT			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:29135271_29135272insTCT	uc003ahr.1	+	c.e6_splice_site			SEC14L2_uc003ahq.2_Splice_Site_Ins|SEC14L2_uc003ahs.1_Splice_Site_Ins|SEC14L2_uc003aht.1_Splice_Site_Ins|SEC14L2_uc010gvv.1_Splice_Site_Ins|SEC14L2_uc003ahu.2_Splice_Site_Ins|SEC14L2_uc010gvw.1_Splice_Site_Ins|MTFP1_uc010gvx.1_Splice_Site_Ins|MTFP1_uc003ahv.1_Splice_Site_Ins|MTFP1_uc010gvy.1_5'Flank	NM_012429	NP_036561			SEC14-like 2 isoform 1						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	phospholipid binding|transcription activator activity|transporter activity|vitamin E binding				0					Vitamin E(DB00163)									0.42			10	14				---	---	---	---	capture_indel			Splice_Site_Ins	INS	29135271	29135272	14468	22	-	TCT	TCT	35	35	SEC14L2	TCT	5	5
FBXO11	80204	broad.mit.edu	36	2	47902936	47902936	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:47902936_47902936delT	uc010fbl.1	-	c.1375_1375delA	c.(1375-1377)ATAfs	p.I459fs	FBXO11_uc002rwe.1_Frame_Shift_Del_p.I459fs|FBXO11_uc002rwf.1_Frame_Shift_Del_p.I459fs|FBXO11_uc002rwg.1_Frame_Shift_Del_p.I459fs|FBXO11_uc010fbk.1_5'UTR	NM_025133	NP_079409	Q86XK2	FBX11_HUMAN	F-box only protein 11 isoform 1	543	PbH1 7.				ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|ubiquitin ligase complex	protein binding|protein-arginine N-methyltransferase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)							2				0.41			54	79				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	47902936	47902936	5964	2	T	-	-	49	49	FBXO11	-	5	5
MST1	4485	broad.mit.edu	36	3	49698326	49698331	+	In_Frame_Del	DEL	GCGCTG	-	-			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:49698326_49698331delGCGCTG	uc003cxg.1	-	c.1174_1179delCAGCGC	c.(1174-1179)CAGCGCdel	p.QR392del		NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	392_393	Kringle 4.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GBM(110;181 1524 8005 22865 46297)								0.33			2	4				---	---	---	---	capture_indel			In_Frame_Del	DEL	49698326	49698331	10283	3	GCGCTG	-	-	34	34	MST1	-	5	5
CRHBP	1393	broad.mit.edu	36	5	76294954	76294954	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:76294954_76294954delG	uc003ker.1	+	c.724_724delG	c.(724-726)GACfs	p.D242fs		NM_001882	NP_001873	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	242					female pregnancy|learning or memory|signal transduction	soluble fraction					0		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)										0.49			18	19				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	76294954	76294954	4009	5	G	-	-	33	33	CRHBP	-	5	5
TTBK1	84630	broad.mit.edu	36	6	43330351	43330356	+	In_Frame_Del	DEL	CGGGGG	-	-			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:43330351_43330356delCGGGGG	uc003ouq.1	+	c.560_565delCGGGGG	c.(559-567)ACGGGGGAT>AAT	p.187_189TGD>N		NM_032538	NP_115927	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	187_189	Protein kinase.				protein phosphorylation	cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)							85				0.40			19	28				---	---	---	---	capture_indel			In_Frame_Del	DEL	43330351	43330356	17230	6	CGGGGG	-	-	19	19	TTBK1	-	5	5
PPP1R9A	55607	broad.mit.edu	36	7	94377651	94377653	+	In_Frame_Del	DEL	AGA	-	-			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:94377651_94377653delAGA	uc010lfj.1	+	c.290_292delAGA	c.(289-294)CAGAGA>CGA	p.Q97del	PPP1R9A_uc003unp.1_In_Frame_Del_p.Q97del|PPP1R9A_uc003unq.1_In_Frame_Del_p.Q97del	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	97	Actin-binding.					cell junction|synapse|synaptosome	actin binding			ovary(2)|skin(1)	3	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)											0.30			10	23				---	---	---	---	capture_indel			In_Frame_Del	DEL	94377651	94377653	12814	7	AGA	-	-	7	7	PPP1R9A	-	5	5
CDK5RAP2	55755	broad.mit.edu	36	9	122255864	122255865	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-06-1801-01	TCGA-06-1801-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:122255864_122255865delCT	uc004bkf.1	-	c.2483_2484delAG	c.(2482-2484)AAGfs	p.K828fs	CDK5RAP2_uc004bkg.1_Frame_Shift_Del_p.K828fs|CDK5RAP2_uc004bkh.1_Intron|CDK5RAP2_uc004bki.1_Frame_Shift_Del_p.K595fs|CDK5RAP2_uc004bke.1_Frame_Shift_Del_p.K113fs	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	828					brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|promoter binding			ovary(2)|lung(1)|skin(1)	4														0.42			101	137				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	122255864	122255865	3275	9	CT	-	-	28	28	CDK5RAP2	-	5	5
