Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
C11orf92	399948	broad.mit.edu	36	11	110672048	110672048	+	Silent	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:110672048A>G	uc001pld.1	-	c.366T>C	c.(364-366)GCT>GCC	p.A122A	C11orf92_uc001ple.1_Non-coding_Transcript|C11orf92_uc009yyc.1_Silent_p.A122A	NM_207429	NP_997312			hypothetical protein LOC399948											lung(1)	1														0.505882	310.357537	310.362784	86	84	AA		KEEP	---	---	---	---	capture			Silent	SNP	110672048	110672048	1714	11	A	G	G	11	11	C11orf92	G	4	4
BUD13	84811	broad.mit.edu	36	11	116133145	116133145	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:116133145G>A	uc001ppn.1	-	c.1693C>T	c.(1693-1695)CGC>TGC	p.R565C	BUD13_uc001ppo.1_Missense_Mutation_p.R431C	NM_032725	NP_116114	Q9BRD0	BUD13_HUMAN	BUD13 homolog	565										large_intestine(1)|pancreas(1)	2	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)												0.442857	93.514891	93.714133	31	39	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)	Missense_Mutation	SNP	116133145	116133145	1607	11	G	A	A	37	37	BUD13	A	1	1
PHF21A	51317	broad.mit.edu	36	11	45943463	45943463	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:45943463G>T	uc001ncc.2	-	c.972C>A	c.(970-972)AGC>AGA	p.S324R	PHF21A_uc001ncb.2_Missense_Mutation_p.S325R|PHF21A_uc009ykx.1_Missense_Mutation_p.S325R|PHF21A_uc001nce.2_Missense_Mutation_p.S325R|PHF21A_uc001nca.1_Missense_Mutation_p.S60R	NM_001101802	NP_001095272	Q96BD5	PF21A_HUMAN	BRAF35/HDAC2 complex isoform a	324					blood coagulation|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex	DNA binding|zinc ion binding			central_nervous_system(1)	1												OREG0020936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.6	6.917528	6.959821	3	2	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45943463	45943463	12256	11	G	T	T	46	46	PHF21A	T	3	3
OR4S1	256148	broad.mit.edu	36	11	48285050	48285050	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:48285050G>T	uc001ngu.1	+	c.700G>T	c.(700-702)GCT>TCT	p.A234S		NM_001004725	NP_001004725	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S,	234	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1														0.480769	370.501582	370.574937	125	135	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48285050	48285050	11492	11	G	T	T	42	42	OR4S1	T	3	3
TUT1	64852	broad.mit.edu	36	11	62100155	62100155	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:62100155G>A	uc001nto.1	-	c.1612C>T	c.(1612-1614)CCC>TCC	p.P538S	EEF1G_uc001ntm.1_5'Flank|TUT1_uc001ntp.1_Missense_Mutation_p.P72S	NM_022830	NP_073741	Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6	538	PAP-associated.				mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2														0.353846	67.552484	68.756082	23	42	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	62100155	62100155	17336	11	G	A	A	43	43	TUT1	A	2	2
FXC1	26515	broad.mit.edu	36	11	6460024	6460024	+	Silent	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:6460024C>T	uc001mdn.2	+	c.309C>T	c.(307-309)AGC>AGT	p.S103S	ARFIP2_uc001mdk.1_5'Flank|ARFIP2_uc001mdl.1_5'Flank|ARFIP2_uc001mdm.1_5'Flank|ARFIP2_uc009yfe.1_5'Flank|FXC1_uc001mdo.2_Non-coding_Transcript	NM_012192	NP_036324	Q9Y5J6	TIM9B_HUMAN	fractured callus expressed transcript 1	103					cell-matrix adhesion|protein import into mitochondrial inner membrane|transmembrane transport	mitochondrial inner membrane|mitochondrial intermembrane space protein transporter complex	metal ion binding				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)												0.285714	9.793126	10.370757	4	10	CC		KEEP	---	---	---	---	capture		Epithelial(150;3.26e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Silent	SNP	6460024	6460024	6364	11	C	T	T	28	28	FXC1	T	2	2
PLEKHG6	55200	broad.mit.edu	36	12	6294538	6294538	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:6294538G>A	uc001qnr.1	+	c.401G>A	c.(400-402)GGT>GAT	p.G134D	PLEKHG6_uc001qns.2_Missense_Mutation_p.G134D	NM_018173	NP_060643	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain-containing family G	134					regulation of Rho protein signal transduction	cleavage furrow|cytoplasm|spindle pole	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1														0.784615	151.932433	156.787293	51	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6294538	6294538	12500	12	G	A	A	44	44	PLEKHG6	A	2	2
LRRIQ1	84125	broad.mit.edu	36	12	83974652	83974652	+	Silent	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:83974652T>C	uc001tac.1	+	c.1950T>C	c.(1948-1950)GCT>GCC	p.A650A	LRRIQ1_uc001tab.1_Silent_p.A650A|LRRIQ1_uc001taa.1_Silent_p.A625A	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	650										ovary(4)|central_nervous_system(1)	5														0.296296	76.668732	79.67432	24	57	TT		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(134;0.212)	Silent	SNP	83974652	83974652	9405	12	T	C	C	56	56	LRRIQ1	C	4	4
NR2C1	7181	broad.mit.edu	36	12	93967055	93967055	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:93967055G>T	uc001tdm.2	-	c.1051C>A	c.(1051-1053)CAC>AAC	p.H351N	NR2C1_uc001tdn.2_Missense_Mutation_p.H351N|NR2C1_uc001tdo.2_Missense_Mutation_p.H351N	NM_003297	NP_003288	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	351					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1														0.365079	134.818521	136.834936	46	80	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	93967055	93967055	11027	12	G	T	T	48	48	NR2C1	T	3	3
ELK3	2004	broad.mit.edu	36	12	95164995	95164995	+	Silent	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:95164995C>T	uc001teo.1	+	c.354C>T	c.(352-354)GGC>GGT	p.G118G		NM_005230	NP_005221	P41970	ELK3_HUMAN	ELK3 protein	118					negative regulation of transcription, DNA-dependent|signal transduction	mitochondrion|nucleus	protein binding|purine-rich negative regulatory element binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	all_cancers(2;0.00173)													0.516129	44.694826	44.701668	16	15	CC		KEEP	---	---	---	---	capture			Silent	SNP	95164995	95164995	5252	12	C	T	T	26	26	ELK3	T	2	2
GZMB	3002	broad.mit.edu	36	14	24171996	24171996	+	Silent	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:24171996G>A	uc001wps.1	-	c.168C>T	c.(166-168)GAC>GAT	p.D56D	GZMB_uc010ama.1_Silent_p.D44D|GZMB_uc010amb.1_Non-coding_Transcript	NM_004131	NP_004122	P10144	GRAB_HUMAN	granzyme B precursor	56	Peptidase S1.				activation of pro-apoptotic gene products|cleavage of lamin|cytolysis|induction of apoptosis by intracellular signals	cytosol|immunological synapse|nucleus	protein binding|serine-type endopeptidase activity				0														0.474138	162.13507	162.200622	55	61	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(265;0.028)	Silent	SNP	24171996	24171996	7196	14	G	A	A	40	40	GZMB	A	1	1
SIP1	8487	broad.mit.edu	36	14	38661458	38661458	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:38661458G>C	uc001wuq.1	+	c.479G>C	c.(478-480)GGA>GCA	p.G160A	SIP1_uc001wur.1_Missense_Mutation_p.G160A|SIP1_uc001wus.1_Missense_Mutation_p.G160A|SIP1_uc010amx.1_Non-coding_Transcript	NM_003616	NP_003607	O14893	GEMI2_HUMAN	SMN-interacting protein 1 isoform alpha	160					ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	Cajal body|cytosol|spliceosomal complex	protein binding				0	Hepatocellular(127;0.213)													0.178571	7.451287	10.187608	5	23	GG		KEEP	---	---	---	---	capture	Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0121)	Missense_Mutation	SNP	38661458	38661458	14822	14	G	C	C	41	41	SIP1	C	3	3
RYR3	6263	broad.mit.edu	36	15	31924491	31924491	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:31924491G>T	uc001zhi.1	+	c.13433G>T	c.(13432-13434)CGT>CTT	p.R4478L	RYR3_uc010bar.1_Missense_Mutation_p.R4473L	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	4478					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)												0.468571	266.868811	267.015439	82	93	GG		KEEP	---	---	---	---	capture		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	Missense_Mutation	SNP	31924491	31924491	14250	15	G	T	T	40	40	RYR3	T	3	3
LACTB	114294	broad.mit.edu	36	15	61220816	61220816	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr15:61220816A>G	uc002alw.1	+	c.1403A>G	c.(1402-1404)GAA>GGA	p.E468G		NM_032857	NP_116246	P83111	LACTB_HUMAN	lactamase, beta isoform a	468						mitochondrion	hydrolase activity				0						Melanoma(85;443 1381 6215 27308 35583)								0.46789	176.559801	176.661127	51	58	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61220816	61220816	8920	15	A	G	G	9	9	LACTB	G	4	4
BAIAP3	8938	broad.mit.edu	36	16	1332021	1332021	+	Silent	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:1332021G>A	uc002clk.1	+	c.915G>A	c.(913-915)GCG>GCA	p.A305A	BAIAP3_uc002clj.1_Silent_p.A287A	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	305	C2 1.				G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)												0.574074	94.72666	94.984244	31	23	GG		KEEP	---	---	---	---	capture			Silent	SNP	1332021	1332021	1325	16	G	A	A	40	40	BAIAP3	A	1	1
PPL	5493	broad.mit.edu	36	16	4892436	4892436	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:4892436T>C	uc002cyd.1	-	c.410A>G	c.(409-411)AAC>AGC	p.N137S		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	137					keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)	4														0.638298	210.302777	211.880349	60	34	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4892436	4892436	12769	16	T	C	C	60	60	PPL	C	4	4
POLDIP2	26073	broad.mit.edu	36	17	23699336	23699336	+	Silent	SNP	C	A	A			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:23699336C>A	uc002haz.1	-	c.1041G>T	c.(1039-1041)CGG>CGT	p.R347R		NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2	347	ApaG.					mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)													0.40625	72.035824	72.527742	26	38	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Silent	SNP	23699336	23699336	12622	17	C	A	A	30	30	POLDIP2	A	3	3
TP53	7157	broad.mit.edu	36	17	7518242	7518242	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5417-01	TCGA-06-5417-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7518242A>C	uc002gim.2	-	c.764T>G	c.(763-765)ATC>AGC	p.I255S	TP53_uc002gig.1_Missense_Mutation_p.I255S|TP53_uc002gih.1_Missense_Mutation_p.I255S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.I123S|TP53_uc010cng.1_Missense_Mutation_p.I123S|TP53_uc002gii.1_Missense_Mutation_p.I123S|TP53_uc010cnh.1_Missense_Mutation_p.I255S|TP53_uc010cni.1_Missense_Mutation_p.I255S|TP53_uc002gij.2_Missense_Mutation_p.I255S|TP53_uc010cnj.1_Non-coding_Transcript|TP53_uc002gin.2_Missense_Mutation_p.I162S|TP53_uc002gio.2_Missense_Mutation_p.I123S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	255	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		I -> T (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> M (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> F (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.I255del(7)|p.I255S(7)|p.0?(6)|p.I255T(6)|p.I255N(6)|p.I255fs*8(1)|p.?(1)|p.I254fs*7(1)|p.I254_T256del(1)|p.R249_T256delRPILTIIT(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)				Pancreas(47;798 1329 9957 10801)		111	p.I255S(SW579-Tumor)|p.I255S(CGTHW1-Tumor)|p.I255N(PANC10.05-Tumor)|p.I255T(HUPT4-Tumor)	690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.577465	144.666274	145.036688	41	30	AA		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Missense_Mutation	SNP	7518242	7518242	16923	17	A	C	C	12	12	TP53	C	4	4
TP53	7157	broad.mit.edu	36	17	7518988	7518988	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7518988G>A	uc002gim.2	-	c.586C>T	c.(586-588)CGA>TGA	p.R196*	TP53_uc002gig.1_Nonsense_Mutation_p.R196*|TP53_uc002gih.1_Nonsense_Mutation_p.R196*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R64*|TP53_uc010cng.1_Nonsense_Mutation_p.R64*|TP53_uc002gii.1_Nonsense_Mutation_p.R64*|TP53_uc010cnh.1_Nonsense_Mutation_p.R196*|TP53_uc010cni.1_Nonsense_Mutation_p.R196*|TP53_uc002gij.2_Nonsense_Mutation_p.R196*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.R103*|TP53_uc002gio.2_Nonsense_Mutation_p.R64*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	196	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.R196*(121)|p.0?(6)|p.R196fs*51(4)|p.A189_V197delAPPQHLIRV(4)|p.I195fs*50(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.I195fs*12(1)|p.R196R(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)				Pancreas(47;798 1329 9957 10801)		111	p.R196*(P31FUJ-Tumor)|p.R196*(CALU6-Tumor)|p.R196*(HUT78-Tumor)|p.H193fs(59M-Tumor)	690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.55	141.906756	142.080855	44	36	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Nonsense_Mutation	SNP	7518988	7518988	16923	17	G	A	A	39	39	TP53	A	5	1
PFAS	5198	broad.mit.edu	36	17	8109949	8109949	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:8109949G>C	uc002gkr.1	+	c.2590G>C	c.(2590-2592)GGG>CGG	p.G864R	PFAS_uc002gks.2_5'UTR	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	864					'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)									0.346939	26.554546	27.662556	17	32	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8109949	8109949	12176	17	G	C	C	39	39	PFAS	C	3	3
EMR2	30817	broad.mit.edu	36	19	14738847	14738847	+	Missense_Mutation	SNP	T	G	G			TCGA-06-5417-01	TCGA-06-5417-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:14738847T>G	uc002mzp.1	-	c.430A>C	c.(430-432)ACG>CCG	p.T144P	EMR2_uc010dzs.1_5'Flank|EMR2_uc002mzo.1_Missense_Mutation_p.T144P|EMR2_uc002mzq.1_Missense_Mutation_p.T144P|EMR2_uc002mzr.1_Missense_Mutation_p.T144P|EMR2_uc002mzs.1_Intron|EMR2_uc002mzt.1_Intron|EMR2_uc002mzu.1_Intron	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone	144	Extracellular (Potential).|EGF-like 3; calcium-binding.				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)	1														0.538462	19.623012	19.639603	7	6	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14738847	14738847	5298	19	T	G	G	59	59	EMR2	G	4	4
ZNF544	27300	broad.mit.edu	36	19	63464457	63464457	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5417-01	TCGA-06-5417-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:63464457A>C	uc010euo.1	+	c.673A>C	c.(673-675)AGT>CGT	p.S225R	ZNF544_uc002qrt.2_Missense_Mutation_p.S83R|ZNF544_uc002qru.2_Missense_Mutation_p.S83R	NM_014480	NP_055295	Q6NX49	ZN544_HUMAN	zinc finger protein 544	225					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)												0.918182	363.870725	383.429177	101	9	AA		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)	Missense_Mutation	SNP	63464457	63464457	18572	19	A	C	C	11	11	ZNF544	C	4	4
HBXIP	10542	broad.mit.edu	36	1	110751805	110751805	+	Silent	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:110751805G>A	uc001dzr.1	-	c.207C>T	c.(205-207)GCC>GCT	p.A69A		NM_006402	NP_006393	O43504	HBXIP_HUMAN	hepatitis B virus x-interacting protein	Error:Variant_position_missing_in_O43504_after_alignment					anti-apoptosis|negative regulation of caspase activity|response to virus|viral genome replication	cytosol	protein binding			large_intestine(1)|ovary(1)|pancreas(1)	3		all_cancers(81;4.08e-06)|all_epithelial(167;4.38e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)												0.451327	149.308692	149.541601	51	62	GG		KEEP	---	---	---	---	capture		Lung(183;0.0237)|all cancers(265;0.0675)|Epithelial(280;0.0732)|Colorectal(144;0.102)|LUSC - Lung squamous cell carcinoma(189;0.134)	Silent	SNP	110751805	110751805	7270	1	G	A	A	39	39	HBXIP	A	1	1
KCNA10	3744	broad.mit.edu	36	1	110862053	110862053	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:110862053G>A	uc001dzt.1	-	c.880C>T	c.(880-882)CCC>TCC	p.P294S		NM_005549	NP_005540	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related	294						voltage-gated potassium channel complex	intracellular cyclic nucleotide activated cation channel activity|voltage-gated potassium channel activity			ovary(3)|large_intestine(1)	4		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)												0.536082	335.779261	335.996374	104	90	GG		KEEP	---	---	---	---	capture		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Missense_Mutation	SNP	110862053	110862053	8307	1	G	A	A	43	43	KCNA10	A	2	2
FLG2	388698	broad.mit.edu	36	1	150592725	150592725	+	Silent	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150592725T>C	uc001ezw.2	-	c.4161A>G	c.(4159-4161)AGA>AGG	p.R1387R		NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1387							calcium ion binding|structural molecule activity			ovary(9)|breast(1)	10	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)													0.314815	475.470695	490.316302	153	333	TT		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(543;0.206)		Silent	SNP	150592725	150592725	6161	1	T	C	C	58	58	FLG2	C	4	4
RNPEP	6051	broad.mit.edu	36	1	200233255	200233255	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5417-01	TCGA-06-5417-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:200233255A>T	uc001gxd.1	+	c.1040A>T	c.(1039-1041)AAT>ATT	p.N347I	RNPEP_uc001gxe.1_Missense_Mutation_p.N48I|RNPEP_uc001gxf.1_Missense_Mutation_p.N216I	NM_020216	NP_064601	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	347					leukotriene biosynthetic process|proteolysis		epoxide hydrolase activity|zinc ion binding				0						GBM(19;39 479 7473 13131 19462)								0.395973	181.498439	182.907948	59	90	AA		KEEP	---	---	---	---	capture		KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)	Missense_Mutation	SNP	200233255	200233255	13988	1	A	T	T	4	4	RNPEP	T	4	4
RPS6KC1	26750	broad.mit.edu	36	1	211481160	211481160	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:211481160T>C	uc001hkc.1	+	c.1718T>C	c.(1717-1719)TTC>TCC	p.F573S	RPS6KC1_uc001hkd.1_Missense_Mutation_p.F561S|RPS6KC1_uc001hke.1_Missense_Mutation_p.F392S	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	573					cell communication|protein phosphorylation|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8										410				0.419048	142.932111	143.542684	44	61	TT		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)	Missense_Mutation	SNP	211481160	211481160	14138	1	T	C	C	62	62	RPS6KC1	C	4	4
HSPG2	3339	broad.mit.edu	36	1	22027488	22027488	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:22027488G>A	uc009vqd.1	-	c.12259C>T	c.(12259-12261)CGG>TGG	p.R4087W	HSPG2_uc001bfi.1_Missense_Mutation_p.R103W|HSPG2_uc001bfj.1_Missense_Mutation_p.R4086W	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	4086	Laminin G-like 2.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)	8		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)			Becaplermin(DB00102)|Palifermin(DB00039)									0.464789	96.166489	96.243248	33	38	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Missense_Mutation	SNP	22027488	22027488	7730	1	G	A	A	40	40	HSPG2	A	1	1
FAM73A	374986	broad.mit.edu	36	1	78111369	78111369	+	Silent	SNP	G	C	C			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:78111369G>C	uc001dhx.1	+	c.1656G>C	c.(1654-1656)CTG>CTC	p.L552L		NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN	hypothetical protein LOC374986	552						integral to membrane				ovary(1)	1														0.386973	349.217173	352.138925	101	160	GG		KEEP	---	---	---	---	capture		Colorectal(170;0.226)	Silent	SNP	78111369	78111369	5841	1	G	C	C	48	48	FAM73A	C	3	3
TTLL7	79739	broad.mit.edu	36	1	84180944	84180944	+	Silent	SNP	A	T	T			TCGA-06-5417-01	TCGA-06-5417-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:84180944A>T	uc001djc.1	-	c.513T>A	c.(511-513)TCT>TCA	p.S171S	TTLL7_uc001djb.1_Non-coding_Transcript|TTLL7_uc001djd.1_Non-coding_Transcript|TTLL7_uc001dje.1_Intron|TTLL7_uc001djf.1_Intron|TTLL7_uc001djg.1_Non-coding_Transcript	NM_024686	NP_078962	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	171	TTL.				cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity			ovary(1)	1														0.408451	84.15797	84.678747	29	42	AA		KEEP	---	---	---	---	capture		all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)	Silent	SNP	84180944	84180944	17287	1	A	T	T	3	3	TTLL7	T	4	4
ZNRF3	84133	broad.mit.edu	36	22	27775795	27775795	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:27775795C>A	uc003aeg.2	+	c.1326C>A	c.(1324-1326)TAC>TAA	p.Y442*	ZNRF3_uc003aeh.1_Nonsense_Mutation_p.Y442*	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	542	Cytoplasmic (Potential).					integral to membrane	zinc ion binding			ovary(1)	1														0.363636	8.662578	8.855649	4	7	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	27775795	27775795	18817	22	C	A	A	18	18	ZNRF3	A	5	3
PANX2	56666	broad.mit.edu	36	22	48958006	48958006	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:48958006C>A	uc003bjn.2	+	c.738C>A	c.(736-738)TGC>TGA	p.C246*	PANX2_uc003bjo.2_Nonsense_Mutation_p.C236*|PANX2_uc003bjp.2_Nonsense_Mutation_p.C112*	NM_052839	NP_443071	Q96RD6	PANX2_HUMAN	pannexin 2	246	Helical; (Potential).				protein hexamerization|synaptic transmission	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity			breast(1)	1		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)												0.333333	8.121557	8.343184	3	6	CC		KEEP	---	---	---	---	capture		LUAD - Lung adenocarcinoma(64;0.105)	Nonsense_Mutation	SNP	48958006	48958006	11838	22	C	A	A	25	25	PANX2	A	5	3
MDH1B	130752	broad.mit.edu	36	2	207324034	207324034	+	Silent	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:207324034G>A	uc002vbs.1	-	c.921C>T	c.(919-921)GAC>GAT	p.D307D	MDH1B_uc010fui.1_Silent_p.D307D|MDH1B_uc010fuj.1_Silent_p.D209D|MDH1B_uc002vbt.1_Intron	NM_001039845	NP_001034934	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	307					carbohydrate metabolic process|malate metabolic process|tricarboxylic acid cycle		binding|malate dehydrogenase activity			ovary(3)|kidney(1)	4						Pancreas(76;29 1355 28675 37177 51207)								0.383721	185.901036	187.94289	66	106	GG		KEEP	---	---	---	---	capture		LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)	Silent	SNP	207324034	207324034	9798	2	G	A	A	40	40	MDH1B	A	1	1
IDH1	3417	broad.mit.edu	36	2	208821357	208821357	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:208821357C>T	uc002vcs.1	-	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.1_Missense_Mutation_p.R132H|IDH1_uc002vcu.1_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(1725)|p.R132?(210)|p.R132C(92)|p.R132L(48)|p.R132G(26)|p.R132S(11)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(1848)|haematopoietic_and_lymphoid_tissue(593)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2451						Pancreas(158;264 1958 3300 35450 36047)				134				0.409524	123.406281	124.156692	43	62	CC		KEEP	---	---	---	---	capture		Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)	Missense_Mutation	SNP	208821357	208821357	7794	2	C	T	T	19	19	IDH1	T	1	1
SPTBN1	6711	broad.mit.edu	36	2	54709663	54709663	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:54709663C>T	uc002rxu.1	+	c.1888C>T	c.(1888-1890)CGC>TGC	p.R630C	SPTBN1_uc002rxv.1_Missense_Mutation_p.R630C|SPTBN1_uc002rxx.1_Missense_Mutation_p.R617C	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	630	Spectrin 4.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(2)|breast(2)|central_nervous_system(2)	6														0.441026	221.490952	222.063642	86	109	CC		KEEP	---	---	---	---	capture	Lung(47;0.24)		Missense_Mutation	SNP	54709663	54709663	15633	2	C	T	T	27	27	SPTBN1	T	1	1
ADRA2B	151	broad.mit.edu	36	2	96144377	96144377	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:96144377G>T	uc002svi.1	-	c.1248C>A	c.(1246-1248)TAC>TAA	p.Y416*		NM_000682	NP_000673	P18089	ADA2B_HUMAN	alpha-2B-adrenergic receptor	416	Helical; Name=7; (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation	integral to plasma membrane	alpha2-adrenergic receptor activity|epinephrine binding|protein binding			ovary(2)|lung(1)	3					Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)									0.16	7.092555	9.83802	4	21	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	96144377	96144377	339	2	G	T	T	36	36	ADRA2B	T	5	3
POLQ	10721	broad.mit.edu	36	3	122713434	122713434	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:122713434G>C	uc003eee.2	-	c.1601C>G	c.(1600-1602)GCT>GGT	p.A534G		NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	534	Helicase C-terminal.				DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity			ovary(4)|skin(1)	5						Pancreas(152;907 1925 26081 31236 36904)								0.09434	16.526184	51.587549	20	192	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(114;0.0915)	Missense_Mutation	SNP	122713434	122713434	12636	3	G	C	C	34	34	POLQ	C	3	3
PIK3CA	5290	broad.mit.edu	36	3	180418785	180418785	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:180418785G>A	uc003fjk.1	+	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545			E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(713)|p.E545?(19)|p.E545Q(11)|p.E545D(1)|p.E545G(1)|p.E545A(1)		breast(1506)|large_intestine(749)|endometrium(244)|urinary_tract(195)|ovary(136)|skin(112)|stomach(89)|thyroid(77)|central_nervous_system(69)|lung(61)|upper_aerodigestive_tract(48)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|kidney(2)|prostate(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3437	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)					Colon(199;1504 1750 3362 26421 31210 32040)	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	p.E545K(NCIH508-Tumor)|p.E545K(L363-Tumor)|p.E545K(KYSE510-Tumor)|p.E545K(MKN1-Tumor)|p.E545K(BFTC909-Tumor)|p.E545K(NCIH460-Tumor)|p.E545K(HCC202-Tumor)|p.E545K(KPL1-Tumor)|p.E545K(NCIH596-Tumor)|p.E545K(HUH28-Tumor)|p.E545K(MDAMB361-Tumor)|p.E545K(ESS1-Tumor)|p.E545K(TE5-Tumor)|p.E545K(HSC4-Tumor)|p.E545K(RERFLCSQ1-Tumor)	621	TCGA GBM(8;5.49e-07)			0.488095	124.668032	124.678524	41	43	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Missense_Mutation	SNP	180418785	180418785	12337	3	G	A	A	45	45	PIK3CA	A	2	2
EIF4G1	1981	broad.mit.edu	36	3	185535345	185535345	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:185535345C>G	uc010hxx.1	+	c.4776C>G	c.(4774-4776)TTC>TTG	p.F1592L	EIF4G1_uc003fnp.1_Missense_Mutation_p.F1585L|EIF4G1_uc003fnt.1_Missense_Mutation_p.F1296L|EIF4G1_uc003fnq.1_Missense_Mutation_p.F1498L|EIF4G1_uc003fnr.1_Missense_Mutation_p.F1421L|EIF4G1_uc003fns.1_Missense_Mutation_p.F1545L|EIF4G1_uc010hxy.1_Missense_Mutation_p.F1592L|EIF4G1_uc003fnu.2_Missense_Mutation_p.F1585L|EIF4G1_uc003fnv.2_Missense_Mutation_p.F1586L|EIF4G1_uc003fnw.1_Missense_Mutation_p.F1592L|EIF4G1_uc003fny.2_Missense_Mutation_p.F1389L|EIF4G1_uc003foa.1_Missense_Mutation_p.F257L|FAM131A_uc003fob.1_5'Flank|FAM131A_uc003foc.1_5'Flank|FAM131A_uc003fod.1_5'Flank	NM_004953	NP_004944	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	1585	W2.|Necessary but not sufficient for MKNK1- binding.|EIF4A-binding.				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|large_intestine(1)|central_nervous_system(1)	6	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)									439				0.436893	153.864703	154.221549	45	58	CC		KEEP	---	---	---	---	capture	Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Missense_Mutation	SNP	185535345	185535345	5227	3	C	G	G	32	32	EIF4G1	G	3	3
SEL1L3	23231	broad.mit.edu	36	4	25428877	25428877	+	Silent	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:25428877C>T	uc003gru.2	-	c.1545G>A	c.(1543-1545)CTG>CTA	p.L515L		NM_015187	NP_056002	Q68CR1	SE1L3_HUMAN	hypothetical protein LOC23231	515						integral to membrane	binding				0														0.354839	32.715146	33.291279	11	20	CC		KEEP	---	---	---	---	capture			Silent	SNP	25428877	25428877	14498	4	C	T	T	21	21	SEL1L3	T	2	2
WDR19	57728	broad.mit.edu	36	4	38895159	38895159	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5417-01	TCGA-06-5417-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:38895159A>T	uc003gtv.1	+	c.1260A>T	c.(1258-1260)AAA>AAT	p.K420N	WDR19_uc003gtw.1_Missense_Mutation_p.K17N|WDR19_uc003gtu.1_Missense_Mutation_p.K420N	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	420					cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1														0.45	25.77342	25.816766	9	11	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38895159	38895159	17852	4	A	T	T	4	4	WDR19	T	4	4
GUF1	60558	broad.mit.edu	36	4	44375448	44375448	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:44375448C>G	uc003gww.2	+	c.52C>G	c.(52-54)CGA>GGA	p.R18G	GUF1_uc010ifz.1_Non-coding_Transcript	NM_021927	NP_068746	Q8N442	GUF1_HUMAN	GUF1 GTPase homolog	18					translation	mitochondrial inner membrane	GTP binding|GTPase activity				0														0.230769	6.417775	7.281845	3	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44375448	44375448	7179	4	C	G	G	19	19	GUF1	G	3	3
POLR2B	5431	broad.mit.edu	36	4	57584995	57584995	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:57584995G>A	uc003hcl.1	+	c.2924G>A	c.(2923-2925)CGT>CAT	p.R975H	POLR2B_uc003hcm.1_Missense_Mutation_p.R468H	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B	975					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)													0.613139	529.556743	532.634754	168	106	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57584995	57584995	12643	4	G	A	A	40	40	POLR2B	A	1	1
STARD4	134429	broad.mit.edu	36	5	110869932	110869932	+	Silent	SNP	T	G	G			TCGA-06-5417-01	TCGA-06-5417-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:110869932T>G	uc003kph.1	-	c.150A>C	c.(148-150)GGA>GGC	p.G50G	STARD4_uc010jbw.1_5'UTR|STARD4_uc010jbx.1_5'UTR|STARD4_uc003kpi.1_Non-coding_Transcript|STARD4_uc003kpj.2_Silent_p.G50G	NM_139164	NP_631903	Q96DR4	STAR4_HUMAN	StAR-related lipid transfer (START) domain	50	START.				lipid transport		lipid binding			ovary(1)	1		all_cancers(142;0.00259)|all_epithelial(76;8.32e-05)|Prostate(80;0.0115)|Colorectal(10;0.0959)|Ovarian(225;0.156)|all_lung(232;0.18)|Lung NSC(167;0.248)												0.396552	84.217099	84.759026	23	35	TT		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(64;4.91e-09)|Epithelial(69;1.39e-08)|all cancers(49;2.34e-06)|COAD - Colon adenocarcinoma(37;0.049)|Colorectal(14;0.138)	Silent	SNP	110869932	110869932	15778	5	T	G	G	50	50	STARD4	G	4	4
ACOT12	134526	broad.mit.edu	36	5	80679371	80679371	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:80679371T>C	uc003khl.2	-	c.631A>G	c.(631-633)ACA>GCA	p.T211A		NM_130767	NP_570123	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	211	Acyl coenzyme A hydrolase 2.				acyl-CoA metabolic process|fatty acid metabolic process	cytosol	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(1)|kidney(1)	2		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)												0.483146	879.104742	879.236639	258	276	TT		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)	Missense_Mutation	SNP	80679371	80679371	151	5	T	C	C	58	58	ACOT12	C	4	4
SYNE1	23345	broad.mit.edu	36	6	152779262	152779262	+	Silent	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:152779262A>G	uc010kiw.1	-	c.6003T>C	c.(6001-6003)ACT>ACC	p.T2001T	SYNE1_uc003qot.2_Silent_p.T2008T|SYNE1_uc003qou.2_Silent_p.T2001T|SYNE1_uc010kjb.1_Silent_p.T1984T	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2001	Cytoplasmic (Potential).|Potential.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|ovary(8)|large_intestine(5)|pancreas(2)	30		Ovarian(120;0.0955)												0.440613	694.798076	696.410558	230	292	AA		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	Silent	SNP	152779262	152779262	15966	6	A	G	G	7	7	SYNE1	G	4	4
SOX4	6659	broad.mit.edu	36	6	21703064	21703064	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:21703064C>T	uc003ndi.1	+	c.320C>T	c.(319-321)CCT>CTT	p.P107L		NM_003107	NP_003098	Q06945	SOX4_HUMAN	SRY (sex determining region Y)-box 4	107	HMG box.				canonical Wnt receptor signaling pathway|heart development|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|pro-B cell differentiation|protein stabilization|T cell differentiation	mitochondrion|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(93;0.163)													0.608696	44.850469	45.087566	14	9	CC		KEEP	---	---	---	---	capture	all cancers(50;0.0751)|Epithelial(50;0.155)		Missense_Mutation	SNP	21703064	21703064	15453	6	C	T	T	24	24	SOX4	T	2	2
VARS2	57176	broad.mit.edu	36	6	31001462	31001462	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:31001462A>G	uc003nsc.1	+	c.2948A>G	c.(2947-2949)TAC>TGC	p.Y983C	VARS2_uc010jsg.1_Missense_Mutation_p.Y355C|VARS2_uc010jsh.1_Missense_Mutation_p.Y127C	NM_020442	NP_065175	Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	983					valyl-tRNA aminoacylation	mitochondrion	ATP binding|valine-tRNA ligase activity			ovary(3)|central_nervous_system(1)	4														0.475	67.931535	67.952487	19	21	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31001462	31001462	17689	6	A	G	G	14	14	VARS2	G	4	4
LMBRD1	55788	broad.mit.edu	36	6	70468561	70468561	+	Silent	SNP	G	C	C			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:70468561G>C	uc003pfa.1	-	c.921C>G	c.(919-921)GTC>GTG	p.V307V	LMBRD1_uc003pez.1_Silent_p.V234V|LMBRD1_uc010kal.1_Silent_p.V234V|LMBRD1_uc003pfb.1_Non-coding_Transcript|LMBRD1_uc003pey.1_Silent_p.V103V	NM_018368	NP_060838	Q9NUN5	LMBD1_HUMAN	liver regeneration p-53 related protein	307	Helical; Name=6; (Potential).				interspecies interaction between organisms|transport	integral to membrane|lysosomal membrane	cobalamin binding			ovary(1)	1														0.454545	165.167129	165.345063	45	54	GG		KEEP	---	---	---	---	capture			Silent	SNP	70468561	70468561	9171	6	G	C	C	33	33	LMBRD1	C	3	3
FBXO24	26261	broad.mit.edu	36	7	100025786	100025786	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100025786G>C	uc003uvm.1	+	c.192G>C	c.(190-192)CAG>CAC	p.Q64H	FBXO24_uc010lha.1_Non-coding_Transcript|FBXO24_uc003uvl.1_Missense_Mutation_p.Q64H|FBXO24_uc003uvn.1_Intron	NM_033506	NP_277041	O75426	FBX24_HUMAN	F-box only protein 24 isoform 1	64	F-box.					ubiquitin ligase complex	ubiquitin-protein ligase activity			ovary(3)|skin(1)	4	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)													0.139535	8.517171	13.920191	6	37	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100025786	100025786	5972	7	G	C	C	33	33	FBXO24	C	3	3
EMID2	136227	broad.mit.edu	36	7	100850035	100850035	+	Silent	SNP	G	C	C			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100850035G>C	uc010lhy.1	+	c.216G>C	c.(214-216)TCG>TCC	p.S72S	EMID2_uc003uyo.1_Silent_p.S72S	NM_133457	NP_597714	Q96A83	EMID2_HUMAN	EMI domain containing 2	72	EMI.					collagen				ovary(1)	1	Lung NSC(181;0.215)													0.333333	8.288832	8.759757	6	12	GG		KEEP	---	---	---	---	capture			Silent	SNP	100850035	100850035	5284	7	G	C	C	39	39	EMID2	C	3	3
CTTNBP2	83992	broad.mit.edu	36	7	117218454	117218454	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:117218454G>A	uc003vjf.1	-	c.2032C>T	c.(2032-2034)CCA>TCA	p.P678S		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	678										ovary(4)	4	Lung NSC(10;0.0018)|all_lung(10;0.002)													0.580381	667.612783	669.679188	213	154	GG		KEEP	---	---	---	---	capture		LUSC - Lung squamous cell carcinoma(290;0.133)	Missense_Mutation	SNP	117218454	117218454	4204	7	G	A	A	44	44	CTTNBP2	A	2	2
EFR3A	23167	broad.mit.edu	36	8	133035290	133035290	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr8:133035290A>G	uc003yte.1	+	c.532A>G	c.(532-534)AAA>GAA	p.K178E		NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A	178						plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)													0.277778	13.267736	14.067325	5	13	AA		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)		Missense_Mutation	SNP	133035290	133035290	5146	8	A	G	G	5	5	EFR3A	G	4	4
XKR9	389668	broad.mit.edu	36	8	71755908	71755908	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:71755908G>T	uc003xyq.1	+	c.61G>T	c.(61-63)GAT>TAT	p.D21Y	XKR9_uc010lzd.1_5'UTR|XKR9_uc010lze.1_Missense_Mutation_p.D21Y	NM_001011720	NP_001011720	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related	21	Helical; (Potential).					integral to membrane				ovary(1)	1	Breast(64;0.0716)													0.437333	488.437916	489.722918	164	211	GG		KEEP	---	---	---	---	capture	Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)		Missense_Mutation	SNP	71755908	71755908	18019	8	G	T	T	45	45	XKR9	T	3	3
OR13C8	138802	broad.mit.edu	36	9	106372117	106372117	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:106372117T>C	uc004bcc.1	+	c.848T>C	c.(847-849)TTC>TCC	p.F283S		NM_001004483	NP_001004483	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1														0.085427	13.52049	48.195419	17	182	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	106372117	106372117	11344	9	T	C	C	62	62	OR13C8	C	4	4
FBXO10	26267	broad.mit.edu	36	9	37512884	37512884	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:37512884T>C	uc004aac.1	-	c.1916A>G	c.(1915-1917)TAT>TGT	p.Y639C	FBXO10_uc004aab.1_Missense_Mutation_p.Y623C|FBXO10_uc004aad.1_Missense_Mutation_p.Y173C	NM_012166	NP_036298	Q9UK96	FBX10_HUMAN	F-box protein 10	623	PbH1 10.					ubiquitin ligase complex	ubiquitin-protein ligase activity				0														0.5	21.350548	21.350548	6	6	TT		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(29;0.0107)	Missense_Mutation	SNP	37512884	37512884	5963	9	T	C	C	49	49	FBXO10	C	4	4
COL4A5	1287	broad.mit.edu	36	X	107727448	107727448	+	Silent	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:107727448A>G	uc004enz.1	+	c.1773A>G	c.(1771-1773)GGA>GGG	p.G591G	COL4A5_uc010npl.1_Silent_p.G591G|COL4A5_uc010npm.1_Silent_p.G591G|COL4A5_uc010npn.1_Silent_p.G591G|COL4A5_uc004eob.1_Silent_p.G199G	NM_033380	NP_000486	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	591	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4														0.546875	124.134422	124.257389	35	29	AA		KEEP	---	---	---	---	capture			Silent	SNP	107727448	107727448	3832	23	A	G	G	11	11	COL4A5	G	4	4
GUCY2F	2986	broad.mit.edu	36	X	108595140	108595140	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:108595140C>T	uc004eod.2	-	c.919G>A	c.(919-921)GCC>ACC	p.A307T	GUCY2F_uc010npo.1_Missense_Mutation_p.A307T	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F	307	Extracellular (Potential).				intracellular signal transduction|protein phosphorylation|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8										308				0.581967	457.172053	458.599449	142	102	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	108595140	108595140	7178	23	C	T	T	28	28	GUCY2F	T	2	2
CXorf22	170063	broad.mit.edu	36	X	35895761	35895761	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:35895761C>T	uc004ddj.1	+	c.1705C>T	c.(1705-1707)CGC>TGC	p.R569C	CXorf22_uc010ngv.1_Non-coding_Transcript	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	569										large_intestine(1)|lung(1)|ovary(1)	3														0.253731	43.443697	47.13159	17	50	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35895761	35895761	4262	23	C	T	T	19	19	CXorf22	T	1	1
ZNF674	641339	broad.mit.edu	36	X	46273279	46273279	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:46273279T>C	uc004dgr.1	-	c.25A>G	c.(25-27)ACC>GCC	p.T9A	ZNF674_uc010nhm.1_Missense_Mutation_p.T9A	NM_001039891	NP_001034980	Q2M3X9	ZN674_HUMAN	zinc finger family member 674	9	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)	2														0.358696	106.33001	107.955335	33	59	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46273279	46273279	18676	23	T	C	C	58	58	ZNF674	C	4	4
CCDC120	90060	broad.mit.edu	36	X	48806985	48806985	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:48806985G>A	uc010nik.1	+	c.92G>A	c.(91-93)CGT>CAT	p.R31H	CCDC120_uc004dmf.1_Missense_Mutation_p.R31H|CCDC120_uc010nil.1_Missense_Mutation_p.R31H|CCDC120_uc004dmg.1_Silent_p.A109A	NM_033626	NP_296375	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120	31							protein binding			pancreas(1)	1														0.304348	32.729013	34.302588	14	32	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48806985	48806985	2876	23	G	A	A	40	40	CCDC120	A	1	1
LAS1L	81887	broad.mit.edu	36	X	64654666	64654666	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5417-01	TCGA-06-5417-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:64654666G>T	uc004dwa.1	-	c.1853C>A	c.(1852-1854)CCC>CAC	p.P618H	LAS1L_uc004dvy.1_Missense_Mutation_p.P131H|LAS1L_uc004dvz.1_Missense_Mutation_p.P131H|LAS1L_uc004dwc.1_Missense_Mutation_p.P601H|LAS1L_uc004dwd.1_Missense_Mutation_p.P559H	NM_031206	NP_112483	Q9Y4W2	LAS1L_HUMAN	LAS1-like	618						MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4														0.285714	49.56597	52.453852	20	50	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64654666	64654666	8959	23	G	T	T	43	43	LAS1L	T	3	3
ZMYM3	9203	broad.mit.edu	36	X	70386097	70386097	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:70386097A>G	uc004dzh.1	-	c.1409T>C	c.(1408-1410)CTC>CCC	p.L470P	ZMYM3_uc004dzi.1_Missense_Mutation_p.L470P|ZMYM3_uc004dzj.1_Missense_Mutation_p.L470P|ZMYM3_uc004dzk.2_Missense_Mutation_p.L470P|ZMYM3_uc004dzl.2_Missense_Mutation_p.L470P|ZMYM3_uc004dzm.2_Missense_Mutation_p.L470P	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	470					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)													0.571429	42.501483	42.594853	12	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70386097	70386097	18292	23	A	G	G	11	11	ZMYM3	G	4	4
KRTAP5-5	439915	broad.mit.edu	36	11	1608162	1608191	+	In_Frame_Del	DEL	CTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	-	-			TCGA-06-5417-01	TCGA-06-5417-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:1608162_1608191delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	uc001lty.1	+	c.516_545delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	c.(514-546)TCCTGCTGCCAGTCCAGCTGCTGTAAGCCTTAC>TCC	p.CCQSSCCKPY183del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	183_192	8 X 4 AA repeats of C-C-X-P.					keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)										0.60			65	44				---	---	---	---	capture_indel			In_Frame_Del	DEL	1608162	1608191	8886	11	CTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	-	-	24	24	KRTAP5-5	-	5	5
LRP1	4035	broad.mit.edu	36	12	55849356	55849356	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-5417-01	TCGA-06-5417-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:55849356_55849356delG	uc001snd.1	+	c.3162_3162delG	c.(3160-3162)CAGfs	p.Q1054fs	LRP1_uc009zpi.1_Non-coding_Transcript	NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	1054	Extracellular (Potential).				apoptotic cell clearance|multicellular organismal development|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein particle receptor binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(7)|large_intestine(2)|pancreas(2)|skin(1)|central_nervous_system(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)				p.Q1054Q(TEN-Tumor)	1456				0.34			20	39				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	55849356	55849356	9324	12	G	-	-	35	35	LRP1	-	5	5
CDK12	51755	broad.mit.edu	36	17	34872241	34872242	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-5417-01	TCGA-06-5417-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:34872241_34872242insA	uc010cvv.1	+	c.391_392insA	c.(391-393)GAAfs	p.E131fs	CDK12_uc002hrw.2_Frame_Shift_Ins_p.E131fs	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	131					mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity|RNA polymerase II transcription factor activity			ovary(8)|lung(2)|large_intestine(1)	11										277	TCGA Ovarian(9;0.13)			0.46			48	57				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	34872241	34872242	3257	17	-	A	A	33	33	CDK12	A	5	5
ROBO1	6091	broad.mit.edu	36	3	78738757	78738760	+	Frame_Shift_Del	DEL	TCTG	-	-			TCGA-06-5417-01	TCGA-06-5417-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:78738757_78738760delTCTG	uc003dqe.1	-	c.4557_4560delCAGA	c.(4555-4560)GACAGAfs	p.D1519fs	ROBO1_uc010hoh.1_Frame_Shift_Del_p.D711fs|ROBO1_uc003dqb.1_Frame_Shift_Del_p.D1480fs|ROBO1_uc003dqc.1_Frame_Shift_Del_p.D1419fs|ROBO1_uc003dqd.1_Frame_Shift_Del_p.D1474fs	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	1519_1520	Cytoplasmic (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)						693				0.38			215	353				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	78738757	78738760	13992	3	TCTG	-	-	50	50	ROBO1	-	5	5
WWC2	80014	broad.mit.edu	36	4	184447568	184447568	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-5417-01	TCGA-06-5417-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:184447568_184447568delC	uc010irx.1	+	c.3170_3170delC	c.(3169-3171)ACAfs	p.T1057fs	WWC2_uc003ivk.2_Frame_Shift_Del_p.T852fs|WWC2_uc003ivl.2_Non-coding_Transcript|WWC2_uc010iry.1_Frame_Shift_Del_p.T739fs|WWC2_uc003ivn.2_Frame_Shift_Del_p.T572fs|WWC2_uc010irz.1_Frame_Shift_Del_p.T398fs|WWC2_uc003ivo.2_Frame_Shift_Del_p.T185fs	NM_024949	NP_079225	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	1057										ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)										0.37			11	19				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	184447568	184447568	17986	4	C	-	-	17	17	WWC2	-	5	5
HDX	139324	broad.mit.edu	36	X	83610751	83610751	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-5417-01	TCGA-06-5417-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:83610751_83610751delC	uc004eek.1	-	c.636_636delG	c.(634-636)AAGfs	p.K212fs	HDX_uc004eel.1_Frame_Shift_Del_p.K154fs	NM_144657	NP_653258	Q7Z353	HDX_HUMAN	highly divergent homeobox	212					regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						Pancreas(53;231 1169 36156 43751 51139)								0.34			112	213				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	83610751	83610751	7309	23	C	-	-	28	28	HDX	-	5	5
