Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
FBXW4	6468	broad.mit.edu	36	10	103362096	103362096	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:103362096C>A	uc001kto.1	-	c.965G>T	c.(964-966)CGC>CTC	p.R322L		NM_022039	NP_071322	P57775	FBXW4_HUMAN	F-box and WD repeat domain containing 4	322	WD 3.				ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	ubiquitin ligase complex				skin(1)	1		Colorectal(252;0.123)		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)										0.333333	11.336126	11.782881	6	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	103362096	103362096	6004	10	C	A	A	27	27	FBXW4	A	3	3
VAX1	11023	broad.mit.edu	36	10	118887473	118887473	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0866-01	TCGA-14-0866-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:118887473T>G	uc009xyx.1	-	c.85A>C	c.(85-87)AGT>CGT	p.S29R	VAX1_uc001ldb.1_Missense_Mutation_p.S29R	NM_001112704	NP_001106175	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1 isoform a	29						nucleus	sequence-specific DNA binding|transcription regulator activity			ovary(2)	2				all cancers(201;0.0108)										0.212121	8.709993	11.244272	7	26	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118887473	118887473	17699	10	T	G	G	54	54	VAX1	G	4	4
BAG3	9531	broad.mit.edu	36	10	121419549	121419549	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:121419549C>A	uc001lem.1	+	c.377C>A	c.(376-378)GCG>GAG	p.A126E	BAG3_uc001lel.2_Missense_Mutation_p.A126E	NM_004281	NP_004272	O95817	BAG3_HUMAN	BCL2-associated athanogene 3	126	WW 2.				anti-apoptosis|apoptosis|protein folding	cytosol				ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)										0.44	23.209865	23.289602	11	14	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	121419549	121419549	1309	10	C	A	A	27	27	BAG3	A	3	3
FGFR2	2263	broad.mit.edu	36	10	123315022	123315022	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:123315022G>C	uc009xzo.1	-	c.296C>G	c.(295-297)CCT>CGT	p.P99R	FGFR2_uc009xzp.1_Missense_Mutation_p.P99R|FGFR2_uc009xzq.1_Missense_Mutation_p.P118R|FGFR2_uc001lfj.2_Intron|FGFR2_uc001lfm.1_Intron|FGFR2_uc009xzr.1_Missense_Mutation_p.P118R|FGFR2_uc009xzs.1_Intron|FGFR2_uc001lfn.2_Intron|FGFR2_uc009xzt.1_Intron|FGFR2_uc001lfo.1_Missense_Mutation_p.P118R	NM_022970	NP_075259	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 2	99	Ig-like C2-type 1.|Extracellular (Potential).				angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of gene-specific transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of mesenchymal cell proliferation|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|protein phosphorylation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(39)|skin(28)|lung(7)|ovary(4)|cervix(2)|stomach(2)|breast(2)|soft_tissue(1)|central_nervous_system(1)	86		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)			5		350				0.259887	133.594221	152.232121	92	262	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	123315022	123315022	6103	10	G	C	C	35	35	FGFR2	C	3	3
ACBD5	91452	broad.mit.edu	36	10	27537363	27537363	+	Silent	SNP	A	G	G			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:27537363A>G	uc001itn.1	-	c.1117T>C	c.(1117-1119)TTG>CTG	p.L373L	ACBD5_uc001ito.1_Silent_p.L373L|ACBD5_uc001itp.1_Silent_p.L299L|ACBD5_uc001itq.1_Silent_p.L299L|ACBD5_uc001itr.1_Silent_p.L197L	NM_145698	NP_663736	Q5T8D3	ACBD5_HUMAN	acyl-Coenzyme A binding domain containing 5	417					transport	integral to membrane	fatty-acyl-CoA binding				0														0.116667	8.181222	16.860951	7	53	AA		KEEP	---	---	---	---	capture			Silent	SNP	27537363	27537363	126	10	A	G	G	3	3	ACBD5	G	4	4
PFKP	5214	broad.mit.edu	36	10	3151045	3151045	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0866-01	TCGA-14-0866-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:3151045T>G	uc001igp.1	+	c.1514T>G	c.(1513-1515)ATC>AGC	p.I505S	PFKP_uc001igq.1_Missense_Mutation_p.I497S|PFKP_uc009xhr.1_Missense_Mutation_p.I467S|PFKP_uc009xhs.1_Missense_Mutation_p.I289S|PFKP_uc009xht.1_Missense_Mutation_p.I243S|PFKP_uc009xhu.1_Missense_Mutation_p.I11S	NM_002627	NP_002618	Q01813	K6PP_HUMAN	phosphofructokinase, platelet	505					glycolysis	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)	2				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)										0.2	16.784258	22.682923	14	56	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3151045	3151045	12188	10	T	G	G	50	50	PFKP	G	4	4
PCDH15	65217	broad.mit.edu	36	10	55270191	55270191	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:55270191C>A	uc001jju.1	-	c.3878G>T	c.(3877-3879)CGG>CTG	p.R1293L	PCDH15_uc001jjv.1_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1293	Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)	9		Melanoma(3;0.117)|Lung SC(717;0.238)								1612				0.173913	7.361773	12.002941	8	38	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55270191	55270191	11931	10	C	A	A	23	23	PCDH15	A	3	3
PTEN	5728	broad.mit.edu	36	10	89643822	89643822	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:89643822G>A	uc001kfb.1	+	c.140G>A	c.(139-141)AGG>AAG	p.R47K		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	47	Phosphatase tensin-type.		R -> G (in CD).		apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.0?(12)|p.Y27_N212>Y(2)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)				31		264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.345395	324.991352	331.403855	105	199	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	89643822	89643822	13192	10	G	A	A	35	35	PTEN	A	2	2
C10orf28	27291	broad.mit.edu	36	10	99959204	99959204	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:99959204G>A	uc001kox.2	+	c.1343G>A	c.(1342-1344)GGT>GAT	p.G448D	C10orf28_uc001kow.2_Missense_Mutation_p.G448D|C10orf28_uc001koy.2_Missense_Mutation_p.G448D|C10orf28_uc009xvx.1_Missense_Mutation_p.G448D|C10orf28_uc009xvy.1_Intron|C10orf28_uc001koz.2_Intron	NM_014472	NP_055287	Q4KMY3	Q4KMY3_HUMAN	growth inhibition and differentiation related	448							nucleotide binding			large_intestine(1)	1		Colorectal(252;0.234)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)										0.363636	160.047201	162.748494	60	105	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99959204	99959204	1638	10	G	A	A	44	44	C10orf28	A	2	2
ANGPTL5	253935	broad.mit.edu	36	11	101280843	101280843	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:101280843G>A	uc001pgl.1	-	c.351C>T	c.(349-351)AAC>AAT	p.N117N		NM_178127	NP_835228	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5	117	Potential.				signal transduction	extracellular space	receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)										0.834783	331.057335	343.294183	96	19	GG		KEEP	---	---	---	---	capture			Silent	SNP	101280843	101280843	620	11	G	A	A	40	40	ANGPTL5	A	1	1
ALG9	79796	broad.mit.edu	36	11	111185591	111185591	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:111185591G>C	uc001pmb.1	-	c.1698C>G	c.(1696-1698)TTC>TTG	p.F566L	ALG9_uc001ply.1_Missense_Mutation_p.F395L|ALG9_uc001plz.1_Missense_Mutation_p.F402L|ALG9_uc009yyg.1_Missense_Mutation_p.F402L	NM_001077690	NP_001071158	Q9H6U8	ALG9_HUMAN	asparagine-linked glycosylation 9 protein	566	Lumenal (Potential).				dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			large_intestine(1)|ovary(1)	2		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)										0.15142	91.236152	128.097793	48	269	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	111185591	111185591	527	11	G	C	C	41	41	ALG9	C	3	3
BACE1	23621	broad.mit.edu	36	11	116666945	116666945	+	Nonsense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:116666945C>A	uc001pqz.1	-	c.973G>T	c.(973-975)GGA>TGA	p.G325*	BACE1_uc001pqv.1_Nonsense_Mutation_p.G91*|BACE1_uc001pqw.1_Nonsense_Mutation_p.G300*|BACE1_uc001pqx.1_Nonsense_Mutation_p.G256*|BACE1_uc001pqy.1_Nonsense_Mutation_p.G281*|BACE1_uc009yzo.1_Intron	NM_012104	NP_036236	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1 isoform A	325	Extracellular (Potential).				beta-amyloid metabolic process|membrane protein ectodomain proteolysis	cell surface|cytoplasmic vesicle membrane|endoplasmic reticulum|endosome|integral to plasma membrane|trans-Golgi network	aspartic-type endopeptidase activity|beta-aspartyl-peptidase activity|protein binding			ovary(1)	1	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)										0.145038	58.255206	90.116614	38	224	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	116666945	116666945	1302	11	C	A	A	24	24	BACE1	A	5	3
TMPRSS13	84000	broad.mit.edu	36	11	117294589	117294589	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:117294589G>T	uc001prs.1	-	c.196C>A	c.(196-198)CCA>ACA	p.P66T	TMPRSS13_uc009yzr.1_5'UTR|TMPRSS13_uc001prt.1_5'UTR|TMPRSS13_uc001pru.1_Missense_Mutation_p.P66T	NM_001077263	NP_001070731	Q1RMF8	Q1RMF8_HUMAN	transmembrane protease, serine 13	66					proteolysis	membrane	scavenger receptor activity|serine-type endopeptidase activity			pancreas(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)										0.178571	6.659186	9.395732	5	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	117294589	117294589	16786	11	G	T	T	41	41	TMPRSS13	T	3	3
PDE3B	5140	broad.mit.edu	36	11	14623129	14623129	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:14623129G>A	uc001mln.1	+	c.932G>A	c.(931-933)TGC>TAC	p.C311Y	PDE3B_uc001mlm.1_Missense_Mutation_p.C311Y|PSMA1_uc001mll.1_5'Flank	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	311					cAMP catabolic process|insulin receptor signaling pathway|negative regulation of cAMP-mediated signaling|negative regulation of cell adhesion mediated by integrin|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0														0.36	366.475201	373.920361	153	272	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14623129	14623129	12059	11	G	A	A	46	46	PDE3B	A	2	2
STIM1	6786	broad.mit.edu	36	11	4001753	4001753	+	Silent	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:4001753C>A	uc001lyv.1	+	c.345C>A	c.(343-345)ATC>ATA	p.I115I	STIM1_uc009yef.1_Silent_p.I115I	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor	115	Extracellular (Potential).				activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)										0.111842	74.545822	165.09443	68	540	CC		KEEP	---	---	---	---	capture			Silent	SNP	4001753	4001753	15803	11	C	A	A	29	29	STIM1	A	3	3
OR52I2	143502	broad.mit.edu	36	11	4565552	4565552	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:4565552G>A	uc001lzd.1	+	c.934G>A	c.(934-936)GTG>ATG	p.V312M		NM_001005170	NP_001005170	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I,	312	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)										0.25641	479.484741	521.454408	200	580	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4565552	4565552	11531	11	G	A	A	40	40	OR52I2	A	1	1
MAPK8IP1	9479	broad.mit.edu	36	11	45881166	45881166	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:45881166G>C	uc001nbr.1	+	c.1272G>C	c.(1270-1272)GAG>GAC	p.E424D		NM_005456	NP_005447	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting	424					vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity			ovary(1)	1				GBM - Glioblastoma multiforme(35;0.231)										0.384615	9.570409	9.721996	5	8	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45881166	45881166	9667	11	G	C	C	36	36	MAPK8IP1	C	3	3
AHNAK	79026	broad.mit.edu	36	11	62052277	62052277	+	Missense_Mutation	SNP	G	C	C	rs1298917	unknown	TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:62052277G>C	uc001ntl.1	-	c.6188C>G	c.(6187-6189)GCA>GGA	p.A2063G	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	2063					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)	14		Melanoma(852;0.155)												0.1	13.825257	44.172717	19	171	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	62052277	62052277	417	11	G	C	C	46	46	AHNAK	C	3	3
SYT9	143425	broad.mit.edu	36	11	7393903	7393903	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:7393903G>T	uc001mfe.1	+	c.1099G>T	c.(1099-1101)GGC>TGC	p.G367C	SYT9_uc001mfd.2_Non-coding_Transcript|SYT9_uc009yfi.1_Non-coding_Transcript	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX	367	Cytoplasmic (Potential).|C2 2.					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)										0.143852	94.067732	146.739827	62	369	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7393903	7393903	16002	11	G	T	T	47	47	SYT9	T	3	3
OLFML1	283298	broad.mit.edu	36	11	7487550	7487550	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:7487550G>T	uc001mfi.1	+	c.764G>T	c.(763-765)GGG>GTG	p.G255V		NM_198474	NP_940876	Q6UWY5	OLFL1_HUMAN	olfactomedin-like 1	255	Olfactomedin-like.					extracellular region				ovary(2)	2				Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)										0.512658	249.736115	249.757229	81	77	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7487550	7487550	11261	11	G	T	T	43	43	OLFML1	T	3	3
OR10A3	26496	broad.mit.edu	36	11	7916767	7916767	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:7916767G>A	uc001mfu.1	-	c.877C>T	c.(877-879)CGA>TGA	p.R293*		NM_001003745	NP_001003745	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A,	293	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)										0.686321	997.856408	1010.971467	291	133	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	7916767	7916767	11297	11	G	A	A	40	40	OR10A3	A	5	1
NAA25	80018	broad.mit.edu	36	12	110976628	110976628	+	Silent	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:110976628C>T	uc001ttm.1	-	c.1575G>A	c.(1573-1575)GTG>GTA	p.V525V	NAA25_uc001ttn.2_Non-coding_Transcript|NAA25_uc009zvz.1_Silent_p.V497V|NAA25_uc009zwa.1_Silent_p.V525V	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20	525						cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3														0.543046	521.59057	522.076302	164	138	CC		KEEP	---	---	---	---	capture			Silent	SNP	110976628	110976628	10516	12	C	T	T	21	21	NAA25	T	2	2
P2RX4	5025	broad.mit.edu	36	12	120155711	120155711	+	Silent	SNP	T	G	G			TCGA-14-0866-01	TCGA-14-0866-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:120155711T>G	uc001tzs.1	+	c.1191T>G	c.(1189-1191)GGT>GGG	p.G397G	P2RX4_uc001tzr.1_Silent_p.G381G|P2RX4_uc009zxb.1_Non-coding_Transcript|P2RX4_uc009zxc.1_Silent_p.G354G	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4	381	Cytoplasmic (Potential).				endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|integral to plasma membrane|perinuclear region of cytoplasm	ATP binding|cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)													0.153846	6.523446	10.999059	6	33	TT		KEEP	---	---	---	---	capture			Silent	SNP	120155711	120155711	11755	12	T	G	G	58	58	P2RX4	G	4	4
PLBD1	79887	broad.mit.edu	36	12	14597543	14597543	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:14597543C>A	uc001rcc.1	-	c.186G>T	c.(184-186)AAG>AAT	p.K62N		NM_024829	NP_079105	Q6P4A8	PLBL1_HUMAN	hypothetical protein LOC79887	62					lipid catabolic process	extracellular region	hydrolase activity				0														0.089552	10.690594	78.99748	36	366	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14597543	14597543	12451	12	C	A	A	32	32	PLBD1	A	3	3
KRT78	196374	broad.mit.edu	36	12	51519420	51519420	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51519420G>A	uc001sbc.1	-	c.1307C>T	c.(1306-1308)TCG>TTG	p.S436L		NM_173352	NP_775487	Q8N1N4	K2C78_HUMAN	keratin 5b	436	Ser-rich.|Tail.					keratin filament	protein binding|structural molecule activity			ovary(2)	2														0.101045	21.608686	67.167988	29	258	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51519420	51519420	8806	12	G	A	A	37	37	KRT78	A	1	1
ATP5B	506	broad.mit.edu	36	12	55319206	55319206	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:55319206C>A	uc001slr.1	-	c.1440G>T	c.(1438-1440)AAG>AAT	p.K480N	BAZ2A_uc001slq.1_5'Flank	NM_001686	NP_001677	P06576	ATPB_HUMAN	mitochondrial ATP synthase beta subunit	480					angiogenesis|ATP hydrolysis coupled proton transport|mitochondrial ATP synthesis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)	1														0.109827	32.886959	85.115151	38	308	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55319206	55319206	1167	12	C	A	A	28	28	ATP5B	A	3	3
VWF	7450	broad.mit.edu	36	12	5997901	5997901	+	Silent	SNP	A	G	G	rs61750591	unknown	TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:5997901A>G	uc001qnn.1	-	c.4944T>C	c.(4942-4944)CCT>CCC	p.P1648P		NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1648	VWFA 2.		P -> S (in VWD2).		blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			ovary(3)|pancreas(2)|breast(1)|central_nervous_system(1)	7					Antihemophilic Factor(DB00025)									0.136364	10.839958	16.456675	6	38	AA		KEEP	---	---	---	---	capture			Silent	SNP	5997901	5997901	17818	12	A	G	G	15	15	VWF	G	4	4
DIO3	1735	broad.mit.edu	36	14	101098000	101098000	+	Silent	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:101098000C>T	uc001yki.2	+	c.336C>T	c.(334-336)TCC>TCT	p.S112S	DIO3-OS_uc001ykd.1_5'Flank	NM_001362	NP_001353	P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III	112	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|oxidation-reduction process	endosome membrane|integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|thyroxine 5-deiodinase activity			ovary(1)|central_nervous_system(1)	2		all_neural(303;0.185)												0.814516	326.213801	337.710789	101	23	CC		KEEP	---	---	---	---	capture			Silent	SNP	101098000	101098000	4705	14	C	T	T	23	23	DIO3	T	1	1
NRXN3	9369	broad.mit.edu	36	14	78251027	78251027	+	Silent	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:78251027C>T	uc001xun.1	+	c.717C>T	c.(715-717)CGC>CGT	p.R239R	NRXN3_uc001xum.1_Non-coding_Transcript|NRXN3_uc010asv.1_Silent_p.R373R	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	612	Extracellular (Potential).|Laminin G-like 3.				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|pancreas(2)|breast(1)|central_nervous_system(1)	7		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)										0.10084	7.935356	26.888038	12	107	CC		KEEP	---	---	---	---	capture			Silent	SNP	78251027	78251027	11072	14	C	T	T	27	27	NRXN3	T	1	1
POTEB	339010	broad.mit.edu	36	15	19335965	19335965	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:19335965G>A	uc001ytu.1	-	c.336C>T	c.(334-336)AGC>AGT	p.S112S	POTEB_uc010axv.1_Non-coding_Transcript	NM_207355	NP_997238	Q6S5H4	POTEB_HUMAN	protein expressed in prostate, ovary, testis,	112											0														0.371429	264.308685	268.338726	104	176	GG		KEEP	---	---	---	---	capture			Silent	SNP	19335965	19335965	12691	15	G	A	A	38	38	POTEB	A	1	1
DUOX2	50506	broad.mit.edu	36	15	43192173	43192173	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:43192173C>T	uc010bea.1	-	c.196G>A	c.(196-198)GCC>ACC	p.A66T	DUOX2_uc001zun.1_Missense_Mutation_p.A66T|DUOXA2_uc001zuo.1_5'Flank|DUOXA2_uc010beb.1_5'Flank	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	66	Extracellular (Potential).|Peroxidase-like; mediates peroxidase activity (By similarity).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|oxidation-reduction process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|pancreas(1)	3		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)										0.197183	27.337844	33.387607	14	57	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43192173	43192173	4986	15	C	T	T	27	27	DUOX2	T	1	1
GALK2	2585	broad.mit.edu	36	15	47249819	47249819	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:47249819C>A	uc001zxj.1	+	c.8C>A	c.(7-9)ACA>AAA	p.T3K	GALK2_uc001zxi.1_Intron|GALK2_uc001zxk.1_Non-coding_Transcript	NM_002044	NP_002035	Q01415	GALK2_HUMAN	galactokinase 2 isoform 1	3					galactose metabolic process	cytoplasm	ATP binding|galactokinase activity|N-acetylgalactosamine kinase activity			breast(1)	1		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)										0.375	6.465684	6.558731	3	5	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47249819	47249819	6468	15	C	A	A	17	17	GALK2	A	3	3
KIF7	374654	broad.mit.edu	36	15	87972835	87972835	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:87972835C>T	uc002bof.1	-	c.2312G>A	c.(2311-2313)GGT>GAT	p.G771D		NM_198525	NP_940927	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1284					microtubule-based movement|negative regulation of smoothened signaling pathway|positive regulation of smoothened signaling pathway	cilium	ATP binding|microtubule motor activity|protein binding			ovary(1)	1	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)											0.166667	7.086328	9.614264	4	20	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	87972835	87972835	8620	15	C	T	T	18	18	KIF7	T	2	2
CP110	9738	broad.mit.edu	36	16	19460717	19460717	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:19460717A>G	uc002dgk.2	+	c.2057A>G	c.(2056-2058)GAA>GGA	p.E686G	CP110_uc002dgl.2_Missense_Mutation_p.E686G	NM_014711	NP_055526	O43303	CP110_HUMAN	CP110 protein	686	Potential.				centriole replication|G2/M transition of mitotic cell cycle|regulation of cytokinesis	centriole|cytosol	protein binding				0														0.144737	9.465917	18.720696	11	65	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19460717	19460717	3926	16	A	G	G	9	9	CP110	G	4	4
IQCK	124152	broad.mit.edu	36	16	19745918	19745918	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:19745918C>T	uc002dgr.1	+	c.760C>T	c.(760-762)CAC>TAC	p.H254Y	IQCK_uc002dgs.1_Non-coding_Transcript|IQCK_uc010bwc.1_Non-coding_Transcript	NM_153208	NP_694940	Q8N0W5	IQCK_HUMAN	IQ motif containing K	254											0														0.344262	117.80411	120.421563	42	80	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19745918	19745918	8116	16	C	T	T	29	29	IQCK	T	2	2
IL21R	50615	broad.mit.edu	36	16	27367498	27367499	+	Missense_Mutation	DNP	CA	TT	TT			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:27367498_27367499CA>TT	uc002doq.1	+	c.1010_1011CA>TT	c.(1009-1011)CCA>CTT	p.P337L	IL21R_uc002dor.1_Missense_Mutation_p.P337L|IL21R_uc002dos.1_Missense_Mutation_p.P337L	NM_181078	NP_851565	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor precursor	337	Cytoplasmic (Potential).				natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)	2										423				0.294118	7.870856	8.515488	5	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	27367498	27367499	7972	16	CA	TT	TT	21	21	IL21R	TT	2	2
ITGAX	3687	broad.mit.edu	36	16	31295732	31295732	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:31295732G>T	uc002ebt.2	+	c.2620G>T	c.(2620-2622)GCC>TCC	p.A874S	ITGAX_uc002ebu.1_Missense_Mutation_p.A874S	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	874	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.125612	73.582453	157.537076	77	536	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31295732	31295732	8193	16	G	T	T	38	38	ITGAX	T	3	3
ZNF213	7760	broad.mit.edu	36	16	3130814	3130814	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:3130814G>T	uc010btg.1	+	c.845G>T	c.(844-846)AGC>ATC	p.S282I	ZNF213_uc002cud.1_Non-coding_Transcript|ZNF213_uc010btf.1_3'UTR|ZNF213_uc010bth.1_Missense_Mutation_p.S282I	NM_004220	NP_004211	O14771	ZN213_HUMAN	zinc finger protein 213	282	KRAB.				regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0														0.697674	63.586317	65.064668	30	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3130814	3130814	18360	16	G	T	T	34	34	ZNF213	T	3	3
PHKB	5257	broad.mit.edu	36	16	46280489	46280489	+	Silent	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:46280489C>A	uc002eev.2	+	c.2667C>A	c.(2665-2667)ATC>ATA	p.I889I	PHKB_uc002eeu.2_Silent_p.I882I|PHKB_uc002eew.2_Silent_p.I130I	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a	889					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)												0.1	7.982614	23.962146	10	90	CC		KEEP	---	---	---	---	capture			Silent	SNP	46280489	46280489	12269	16	C	A	A	30	30	PHKB	A	3	3
GPR97	222487	broad.mit.edu	36	16	56270721	56270721	+	Silent	SNP	C	G	G			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:56270721C>G	uc002emh.1	+	c.624C>G	c.(622-624)CCC>CCG	p.P208P	GPR97_uc010cdd.1_Non-coding_Transcript|GPR97_uc010cde.1_5'Flank	NM_170776	NP_740746	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	208	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1														0.25	9.62745	11.002437	6	18	CC		KEEP	---	---	---	---	capture			Silent	SNP	56270721	56270721	6996	16	C	G	G	22	22	GPR97	G	3	3
PIGQ	9091	broad.mit.edu	36	16	573187	573187	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:573187G>C	uc002cho.1	+	c.1835G>C	c.(1834-1836)GGC>GCC	p.G612A	PIGQ_uc010bqw.1_3'UTR|PIGQ_uc002chn.1_3'UTR|PIGQ_uc002chp.1_Missense_Mutation_p.G182A	NM_148920	NP_683721	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	612					C-terminal protein lipidation|carbohydrate metabolic process|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity			central_nervous_system(1)	1		Hepatocellular(780;0.00335)												0.444444	8.404406	8.427019	4	5	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	573187	573187	12320	16	G	C	C	42	42	PIGQ	C	3	3
KCTD19	146212	broad.mit.edu	36	16	65893213	65893213	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:65893213A>T	uc002esu.2	-	c.757T>A	c.(757-759)TGG>AGG	p.W253R	KCTD19_uc002est.2_5'UTR	NM_001100915	NP_001094385	Q17RG1	KCD19_HUMAN	potassium channel tetramerisation domain	253						voltage-gated potassium channel complex	voltage-gated potassium channel activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)										0.205882	9.802617	12.537994	7	27	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	65893213	65893213	8412	16	A	T	T	6	6	KCTD19	T	4	4
MTSS1L	92154	broad.mit.edu	36	16	69255747	69255747	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:69255747G>A	uc002ezj.1	-	c.1578C>T	c.(1576-1578)AAC>AAT	p.N526N		NM_138383	NP_612392	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	526					filopodium assembly|signal transduction		actin binding|cytoskeletal adaptor activity|SH3 domain binding			central_nervous_system(1)	1														0.75	7.223369	7.448234	3	1	GG		KEEP	---	---	---	---	capture			Silent	SNP	69255747	69255747	10356	16	G	A	A	36	36	MTSS1L	A	2	2
MTSS1L	92154	broad.mit.edu	36	16	69255749	69255749	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0866-01	TCGA-14-0866-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:69255749T>A	uc002ezj.1	-	c.1576A>T	c.(1576-1578)AAC>TAC	p.N526Y		NM_138383	NP_612392	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	526					filopodium assembly|signal transduction		actin binding|cytoskeletal adaptor activity|SH3 domain binding			central_nervous_system(1)	1														0.8	10.199469	10.612992	4	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69255749	69255749	10356	16	T	A	A	62	62	MTSS1L	A	4	4
HYDIN	54768	broad.mit.edu	36	16	69512432	69512432	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:69512432C>T	uc002ezr.1	-	c.7345G>A	c.(7345-7347)GAC>AAC	p.D2449N	HYDIN_uc002ezs.1_Missense_Mutation_p.D54N|HYDIN_uc002ezt.1_Non-coding_Transcript	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	2450										ovary(1)	1		Ovarian(137;0.0654)												0.095304	26.044447	144.975056	69	655	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69512432	69512432	7767	16	C	T	T	31	31	HYDIN	T	1	1
DHODH	1723	broad.mit.edu	36	16	70603568	70603568	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:70603568G>A	uc002fbp.1	+	c.140G>A	c.(139-141)GGG>GAG	p.G47E	DHODH_uc010cgk.1_Non-coding_Transcript	NM_001361	NP_001352	Q02127	PYRD_HUMAN	dihydroorotate dehydrogenase precursor	47	Mitochondrial intermembrane (By similarity).				'de novo' pyrimidine base biosynthetic process|oxidation-reduction process|pyrimidine nucleoside biosynthetic process|UMP biosynthetic process	integral to membrane|mitochondrial inner membrane	dihydroorotate oxidase activity				0		Ovarian(137;0.125)			Atovaquone(DB01117)|Leflunomide(DB01097)									0.144531	111.085911	173.327765	74	438	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70603568	70603568	4663	16	G	A	A	43	43	DHODH	A	2	2
RAPGEFL1	51195	broad.mit.edu	36	17	35603180	35603180	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:35603180C>T	uc010cwu.1	+	c.1231C>T	c.(1231-1233)CGG>TGG	p.R411W		NM_016339	NP_057423	Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor	617	Ras-GEF.				G-protein coupled receptor protein signaling pathway|nervous system development|small GTPase mediated signal transduction	intracellular|membrane fraction	guanyl-nucleotide exchange factor activity			ovary(1)|central_nervous_system(1)	2						Esophageal Squamous(28;274 750 6870 14218 42203)								0.173913	41.134933	52.677537	20	95	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35603180	35603180	13509	17	C	T	T	23	23	RAPGEFL1	T	1	1
PLD2	5338	broad.mit.edu	36	17	4669068	4669068	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0866-01	TCGA-14-0866-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:4669068T>G	uc002fzc.2	+	c.2157T>G	c.(2155-2157)CAT>CAG	p.H719Q	PLD2_uc002fzd.2_Missense_Mutation_p.H719Q	NM_002663	NP_002654	O14939	PLD2_HUMAN	phospholipase D2	719	Catalytic.				cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			breast(2)|ovary(1)|central_nervous_system(1)	4					Choline(DB00122)									0.168831	20.013491	36.111812	26	128	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4669068	4669068	12472	17	T	G	G	50	50	PLD2	G	4	4
EPX	8288	broad.mit.edu	36	17	53629516	53629516	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:53629516G>A	uc002ivq.2	+	c.1019G>A	c.(1018-1020)CGC>CAC	p.R340H		NM_000502	NP_000493	P11678	PERE_HUMAN	eosinophil peroxidase	340					hydrogen peroxide catabolic process|oxidation-reduction process		heme binding|peroxidase activity|protein binding			ovary(2)	2														0.117994	65.159318	162.318877	80	598	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53629516	53629516	5393	17	G	A	A	38	38	EPX	A	1	1
BZRAP1	9256	broad.mit.edu	36	17	53742938	53742938	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:53742938C>A	uc002ivx.2	-	c.3633G>T	c.(3631-3633)CAG>CAT	p.Q1211H	BZRAP1_uc010dcs.1_Missense_Mutation_p.Q1151H	NM_004758	NP_004749	O95153	RIMB1_HUMAN	peripheral benzodiazepine receptor-associated	1211						mitochondrion	benzodiazepine receptor binding				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)													0.170213	7.05643	11.921594	8	39	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53742938	53742938	1611	17	C	A	A	28	28	BZRAP1	A	3	3
NLRP1	22861	broad.mit.edu	36	17	5427885	5427885	+	Silent	SNP	A	T	T			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:5427885A>T	uc002gci.1	-	c.117T>A	c.(115-117)GGT>GGA	p.G39G	NLRP1_uc002gcg.1_Silent_p.G39G|NLRP1_uc002gch.2_Silent_p.G39G|NLRP1_uc002gck.1_Silent_p.G39G|NLRP1_uc002gcj.1_Silent_p.G39G|NLRP1_uc002gcl.1_Silent_p.G39G|NLRP1_uc010clh.1_Silent_p.G39G	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	39	DAPIN.				activation of caspase activity|defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|regulation of inflammatory response|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)								431				0.3	8.792934	9.541788	6	14	AA		KEEP	---	---	---	---	capture			Silent	SNP	5427885	5427885	10874	17	A	T	T	6	6	NLRP1	T	4	4
ACE	1636	broad.mit.edu	36	17	58909095	58909095	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:58909095G>A	uc002jau.1	+	c.321G>A	c.(319-321)CCG>CCA	p.P107P	ACE_uc010ddu.1_5'UTR	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme isoform 1	107	Extracellular (Potential).|Peptidase M2 1.				angiotensin catabolic process in blood|arachidonic acid secretion|blood vessel remodeling|hemopoietic stem cell differentiation|hormone catabolic process|kidney development|mononuclear cell proliferation|peptide catabolic process|regulation of renal output by angiotensin|regulation of smooth muscle cell migration|regulation of vasoconstriction|regulation of vasodilation	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)									0.5	42.374469	42.374469	13	13	GG		KEEP	---	---	---	---	capture			Silent	SNP	58909095	58909095	137	17	G	A	A	37	37	ACE	A	1	1
RGS9	8787	broad.mit.edu	36	17	60653874	60653874	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:60653874G>T	uc002jfe.1	+	c.1912G>T	c.(1912-1914)GAT>TAT	p.D638Y	RGS9_uc002jfd.1_Missense_Mutation_p.D635Y|RGS9_uc002jff.1_Non-coding_Transcript|RGS9_uc002jfg.1_Missense_Mutation_p.D409Y	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1	638					intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)	2														0.13806	55.387668	89.271369	37	231	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60653874	60653874	13787	17	G	T	T	41	41	RGS9	T	3	3
OTOP2	92736	broad.mit.edu	36	17	70438429	70438429	+	Silent	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:70438429C>T	uc002jmg.1	+	c.1104C>T	c.(1102-1104)GAC>GAT	p.D368D		NM_178160	NP_835454	Q7RTS6	OTOP2_HUMAN	otopetrin 2	368						integral to membrane				ovary(3)|large_intestine(1)	4	all_lung(278;0.172)|Lung NSC(278;0.207)													0.568282	804.493976	806.353983	258	196	CC		KEEP	---	---	---	---	capture			Silent	SNP	70438429	70438429	11718	17	C	T	T	19	19	OTOP2	T	1	1
AMAC1L3	643664	broad.mit.edu	36	17	7326373	7326373	+	Nonsense_Mutation	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7326373G>T	uc010cmj.1	+	c.346G>T	c.(346-348)GGA>TGA	p.G116*	POLR2A_uc002ghe.2_5'Flank|POLR2A_uc002ghf.2_5'Flank|ZBTB4_uc002ghc.2_5'Flank|ZBTB4_uc002ghd.2_Intron	NM_001102614	NP_001096084	P0C7Q6	AMCL3_HUMAN	acyl-malonyl condensing enzyme 1-like 3	116	DUF6 1.|Helical; (Potential).					integral to membrane					0		Prostate(122;0.173)												0.113208	19.763492	43.224611	18	141	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	7326373	7326373	564	17	G	T	T	47	47	AMAC1L3	T	5	3
TMC6	11322	broad.mit.edu	36	17	73631853	73631853	+	Silent	SNP	A	C	C			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:73631853A>C	uc002juj.1	-	c.894T>G	c.(892-894)GGT>GGG	p.G298G	TMC6_uc002jui.1_5'Flank|TMC6_uc010dhf.1_Silent_p.G131G|TMC6_uc002juk.2_Silent_p.G298G|TMC6_uc010dhg.1_Silent_p.G298G|TMC6_uc002jul.1_Silent_p.G298G|TMC6_uc002jum.2_Silent_p.G89G|TMC6_uc002jun.2_Silent_p.G298G|TMC6_uc002juo.2_Silent_p.G71G	NM_007267	NP_009198	Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	298	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)											0.714286	7.081176	7.340079	5	2	AA		KEEP	---	---	---	---	capture			Silent	SNP	73631853	73631853	16519	17	A	C	C	2	2	TMC6	C	4	4
STX8	9482	broad.mit.edu	36	17	9349156	9349156	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:9349156C>T	uc002glx.1	-	c.372G>A	c.(370-372)TGG>TGA	p.W124*		NM_004853	NP_004844	Q9UNK0	STX8_HUMAN	syntaxin 8	124	Cytoplasmic (Potential).				transport	endoplasmic reticulum|integral to plasma membrane					0														0.431953	204.623915	205.309569	73	96	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	9349156	9349156	15871	17	C	T	T	26	26	STX8	T	5	2
RNF152	220441	broad.mit.edu	36	18	57634515	57634515	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:57634515G>A	uc002lih.1	-	c.162C>T	c.(160-162)TGC>TGT	p.C54C	RNF152_uc010dpt.1_Silent_p.C54C	NM_173557	NP_775828	Q8N8N0	RN152_HUMAN	ring finger protein 152	54	RING-type.				apoptosis|protein K48-linked ubiquitination	integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			breast(1)	1		Colorectal(73;0.186)												0.25	6.553978	7.701992	5	15	GG		KEEP	---	---	---	---	capture			Silent	SNP	57634515	57634515	13930	18	G	A	A	42	42	RNF152	A	2	2
ZNF136	7695	broad.mit.edu	36	19	12158936	12158936	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:12158936G>A	uc002mti.1	+	c.743G>A	c.(742-744)GGA>GAA	p.G248E		NM_003437	NP_003428	P52737	ZN136_HUMAN	zinc finger protein 136	248					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|protein binding|specific RNA polymerase II transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|pancreas(1)	2														0.119565	46.0023	85.188032	33	243	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12158936	12158936	18317	19	G	A	A	41	41	ZNF136	A	2	2
CYP4F11	57834	broad.mit.edu	36	19	15896659	15896659	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:15896659C>T	uc002nbu.2	-	c.559G>A	c.(559-561)GCC>ACC	p.A187T	CYP4F11_uc010eab.1_Missense_Mutation_p.A187T|CYP4F11_uc002nbt.2_Missense_Mutation_p.A187T	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide	187					inflammatory response|oxidation-reduction process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1														0.122807	19.992414	43.810083	21	150	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15896659	15896659	4351	19	C	T	T	27	27	CYP4F11	T	1	1
TM6SF2	53345	broad.mit.edu	36	19	19242245	19242245	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:19242245G>C	uc002nmd.1	-	c.206C>G	c.(205-207)GCT>GGT	p.A69G	HAPLN4_uc002nmc.1_5'UTR	NM_001001524	NP_001001524	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	69	Helical; (Potential).					integral to membrane					0			Epithelial(12;0.0151)											0.2	6.756162	8.856795	5	20	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19242245	19242245	16503	19	G	C	C	34	34	TM6SF2	C	3	3
U2AF1L4	199746	broad.mit.edu	36	19	40927106	40927106	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:40927106G>A	uc002obf.1	-	c.189C>T	c.(187-189)TGC>TGT	p.C63C	TMEM149_uc002obc.1_5'Flank|TMEM149_uc002obd.2_5'Flank|TMEM149_uc010eej.1_5'UTR|U2AF1L4_uc002obe.1_Silent_p.C63C|U2AF1L4_uc002obg.1_Silent_p.C4C|U2AF1L4_uc002obh.1_5'UTR|PSENEN_uc002obi.1_5'Flank|PSENEN_uc002obj.1_5'Flank|PSENEN_uc002obk.1_5'Flank	NM_144987	NP_659424	Q8WU68	U2AF4_HUMAN	U2 small nuclear RNA auxiliary factor 1-like 4	102	RRM.				mRNA processing|RNA splicing	nuclear speck|spliceosomal complex	nucleotide binding|RNA binding|zinc ion binding				0	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)											0.185714	166.583253	205.419945	78	342	GG		KEEP	---	---	---	---	capture			Silent	SNP	40927106	40927106	17379	19	G	A	A	38	38	U2AF1L4	A	1	1
CNTD2	79935	broad.mit.edu	36	19	45421377	45421377	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:45421377G>A	uc002ond.1	-	c.436C>T	c.(436-438)CGG>TGG	p.R146W		NM_024877	NP_079153	B4DX65	B4DX65_HUMAN	cyclin N-terminal domain containing 2 isoform 2	Error:Variant_position_missing_in_B4DX65_after_alignment											0														0.185185	46.448872	56.476267	20	88	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45421377	45421377	3774	19	G	A	A	39	39	CNTD2	A	1	1
HNRNPUL1	11100	broad.mit.edu	36	19	46469858	46469858	+	Silent	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:46469858C>T	uc002oqb.2	+	c.450C>T	c.(448-450)CCC>CCT	p.P150P	HNRNPUL1_uc002opz.2_Silent_p.P50P|HNRNPUL1_uc002oqa.2_Silent_p.P50P|HNRNPUL1_uc010ehl.1_Silent_p.P50P|HNRNPUL1_uc010ehm.1_Silent_p.P150P|HNRNPUL1_uc002oqc.2_Silent_p.P107P|HNRNPUL1_uc002oqe.2_Intron|HNRNPUL1_uc002oqd.2_Silent_p.P50P|HNRNPUL1_uc010ehn.1_Silent_p.P50P|HNRNPUL1_uc010eho.1_Silent_p.P50P|HNRNPUL1_uc010ehp.1_Silent_p.P6P	NM_007040	NP_653333	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	150					nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding				0														0.120482	20.819534	44.286057	20	146	CC		KEEP	---	---	---	---	capture			Silent	SNP	46469858	46469858	7566	19	C	T	T	21	21	HNRNPUL1	T	2	2
CCDC114	93233	broad.mit.edu	36	19	53492556	53492556	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:53492556C>T	uc002pir.1	-	c.1502G>A	c.(1501-1503)CGC>CAC	p.R501H	CCDC114_uc002pip.1_Missense_Mutation_p.R294H|CCDC114_uc002piq.1_Missense_Mutation_p.R294H|CCDC114_uc002pio.2_Missense_Mutation_p.A562T	NM_144577	NP_653178	Q96M63	CC114_HUMAN	coiled-coil domain containing 114 isoform 2	501										ovary(1)	1		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)										0.355932	50.772325	51.843947	21	38	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53492556	53492556	2871	19	C	T	T	27	27	CCDC114	T	1	1
ZNF578	147660	broad.mit.edu	36	19	57705708	57705708	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:57705708G>A	uc002pzp.2	+	c.262G>A	c.(262-264)GGG>AGG	p.G88R		NM_001099694	NP_001093164	Q96N58	ZN578_HUMAN	zinc finger protein 578	Error:Variant_position_missing_in_Q96N58_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)										0.229535	372.927432	414.706754	143	480	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57705708	57705708	18605	19	G	A	A	35	35	ZNF578	A	2	2
RFX2	5990	broad.mit.edu	36	19	5945881	5945881	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:5945881G>A	uc002meb.1	-	c.2137C>T	c.(2137-2139)CGC>TGC	p.R713C	RFX2_uc002mec.1_Missense_Mutation_p.R688C	NM_000635	NP_000626	P48378	RFX2_HUMAN	regulatory factor X2 isoform a	713					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription regulator activity			breast(4)|ovary(1)	5						Colon(38;171 817 19800 47433 48051)								0.530612	153.108678	153.190944	52	46	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5945881	5945881	13735	19	G	A	A	38	38	RFX2	A	1	1
ZSCAN4	201516	broad.mit.edu	36	19	62879461	62879461	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:62879461G>C	uc002qpu.1	+	c.136G>C	c.(136-138)GTG>CTG	p.V46L		NM_152677	NP_689890	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	46	SCAN box.				regulation of transcription, DNA-dependent|telomere maintenance via telomere lengthening|viral reproduction	nuclear chromosome, telomeric region	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)										0.463415	175.681555	175.831179	57	66	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	62879461	62879461	18841	19	G	C	C	44	44	ZSCAN4	C	3	3
PRSSL1	400668	broad.mit.edu	36	19	645912	645912	+	Silent	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:645912G>T	uc002lpl.1	-	c.138C>A	c.(136-138)CCC>CCA	p.P46P		NM_214710	NP_999875	Q6UWY2	PRS57_HUMAN	protease, serine-like 1	46	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.12766	7.448837	13.777917	6	41	GG		KEEP	---	---	---	---	capture			Silent	SNP	645912	645912	13087	19	G	T	T	35	35	PRSSL1	T	3	3
COL5A3	50509	broad.mit.edu	36	19	9938022	9938022	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0866-01	TCGA-14-0866-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:9938022T>G	uc002mmq.1	-	c.4750A>C	c.(4750-4752)ACC>CCC	p.T1584P		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	1584	Fibrillar collagen NC1.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)	9			Epithelial(33;7.11e-05)											0.619048	13.758867	13.915304	13	8	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9938022	9938022	3836	19	T	G	G	58	58	COL5A3	G	4	4
COL11A1	1301	broad.mit.edu	36	1	103263742	103263742	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:103263742C>A	uc001dum.1	-	c.949G>T	c.(949-951)GAT>TAT	p.D317Y	COL11A1_uc001duk.1_5'UTR|COL11A1_uc001dul.1_Missense_Mutation_p.D305Y|COL11A1_uc001dun.1_Missense_Mutation_p.D266Y|COL11A1_uc009weh.1_Intron	NM_080629	NP_542196	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform B	305	Nonhelical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|central_nervous_system(1)|pancreas(1)	11		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)										0.382979	54.434694	55.000384	18	29	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	103263742	103263742	3805	1	C	A	A	29	29	COL11A1	A	3	3
MAN1A2	10905	broad.mit.edu	36	1	117866991	117866991	+	Silent	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:117866991C>T	uc001ehd.1	+	c.1815C>T	c.(1813-1815)TCC>TCT	p.S605S		NM_006699	NP_006690	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	605	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity				0	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		Ovarian(33;199 881 8228 13687 31538)								0.534884	526.486629	526.80583	161	140	CC		KEEP	---	---	---	---	capture			Silent	SNP	117866991	117866991	9594	1	C	T	T	23	23	MAN1A2	T	1	1
FLG	2312	broad.mit.edu	36	1	150552551	150552551	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150552551C>T	uc001ezu.1	-	c.1435G>A	c.(1435-1437)GAC>AAC	p.D479N		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	479	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)	9	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.088235	9.386188	96.782406	45	465	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	150552551	150552551	6160	1	C	T	T	29	29	FLG	T	2	2
PGLYRP4	57115	broad.mit.edu	36	1	151586982	151586982	+	Splice_Site_SNP	SNP	A	C	C			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:151586982A>C	uc001fbo.1	-	c.e2_splice_site			PGLYRP4_uc001fbp.1_Splice_Site_SNP	NM_020393	NP_065126			peptidoglycan recognition protein-I-beta						defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity			ovary(3)	3	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)											0.218391	21.17429	27.686962	19	68	AA		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	151586982	151586982	12219	1	A	C	C	14	14	PGLYRP4	C	5	4
PBXIP1	57326	broad.mit.edu	36	1	153184811	153184811	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:153184811G>A	uc001ffr.1	-	c.1963C>T	c.(1963-1965)CGC>TGC	p.R655C	PBXIP1_uc001ffs.1_Missense_Mutation_p.R626C	NM_020524	NP_065385	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein	655					cell differentiation|multicellular organismal development|negative regulation of transcription, DNA-dependent	cytosol|microtubule|nucleus	protein binding|transcription corepressor activity			large_intestine(1)	1	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)											0.235294	109.112781	121.09701	44	143	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	153184811	153184811	11916	1	G	A	A	39	39	PBXIP1	A	1	1
DDR2	4921	broad.mit.edu	36	1	161008494	161008495	+	Missense_Mutation	DNP	TA	CC	CC			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:161008494_161008495TA>CC	uc001gcf.1	+	c.1561_1562TA>CC	c.(1561-1563)TAT>CCT	p.Y521P	DDR2_uc001gcg.1_Missense_Mutation_p.Y521P	NM_001014796	NP_006173	Q16832	DDR2_HUMAN	discoidin domain receptor family, member 2	521	Cytoplasmic (Potential).				cell adhesion|protein phosphorylation	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)			NSCLC(161;314 2006 8283 19651 23192)				497				0.2	17.156066	22.197435	12	48	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	161008494	161008495	4508	1	TA	CC	CC	53	53	DDR2	CC	4	4
TMCO4	255104	broad.mit.edu	36	1	19882487	19882487	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:19882487G>C	uc001bcn.1	-	c.1538C>G	c.(1537-1539)GCC>GGC	p.A513G	TMCO4_uc001bcm.1_Missense_Mutation_p.A344G|TMCO4_uc001bco.1_Missense_Mutation_p.A513G|TMCO4_uc001bcp.1_Missense_Mutation_p.A473G	NM_181719	NP_859070	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	513						integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)										0.344828	75.452318	77.334597	30	57	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19882487	19882487	16528	1	G	C	C	42	42	TMCO4	C	3	3
NAV1	89796	broad.mit.edu	36	1	200046366	200046366	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:200046366C>T	uc001gwu.2	+	c.4645C>T	c.(4645-4647)CGG>TGG	p.R1549W	NAV1_uc001gwx.2_Missense_Mutation_p.R1158W	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1552					cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(2)|ovary(1)	3														0.337423	152.349575	156.124373	55	108	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	200046366	200046366	10579	1	C	T	T	23	23	NAV1	T	1	1
JMJD4	65094	broad.mit.edu	36	1	225986989	225986989	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:225986989C>G	uc001hrb.1	-	c.1119G>C	c.(1117-1119)AGG>AGC	p.R373S	LOC100130093_uc001hqx.2_Non-coding_Transcript|LOC100130093_uc001hqy.2_Non-coding_Transcript|SNAP47_uc001hqz.1_Intron|SNAP47_uc001hra.1_Intron|JMJD4_uc001hrc.1_Missense_Mutation_p.R357S|SNAP47_uc001hrd.2_5'Flank|SNAP47_uc001hre.2_5'Flank|SNAP47_uc001hrf.1_5'Flank	NM_023007	NP_075383	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	373											0		Prostate(94;0.0885)												0.30137	35.676513	38.278504	22	51	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	225986989	225986989	8255	1	C	G	G	18	18	JMJD4	G	3	3
MATN1	4146	broad.mit.edu	36	1	30966953	30966953	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:30966953G>A	uc001brz.1	-	c.327C>T	c.(325-327)CGC>CGT	p.R109R	MATN1_uc001bsa.1_5'Flank	NM_002379	NP_002370	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein	109	VWFA 1.				protein complex assembly	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			central_nervous_system(1)	1		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)										0.3	7.122508	7.479242	3	7	GG		KEEP	---	---	---	---	capture			Silent	SNP	30966953	30966953	9717	1	G	A	A	42	42	MATN1	A	2	2
SERINC2	347735	broad.mit.edu	36	1	31670302	31670302	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:31670302G>T	uc001bst.1	+	c.387G>T	c.(385-387)CAG>CAT	p.Q129H	SERINC2_uc009vtw.1_Missense_Mutation_p.Q129H|SERINC2_uc001bsu.1_Missense_Mutation_p.Q74H|SERINC2_uc001bsv.1_Missense_Mutation_p.Q74H	NM_178865	NP_849196	Q96SA4	SERC2_HUMAN	tumor differentially expressed 2-like	129						integral to membrane					0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)										0.150685	16.276552	24.817496	11	62	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31670302	31670302	14568	1	G	T	T	33	33	SERINC2	T	3	3
EPHA10	284656	broad.mit.edu	36	1	37999734	37999734	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:37999734G>A	uc009vvi.1	-	c.780C>T	c.(778-780)GGC>GGT	p.G260G	EPHA10_uc001cbw.2_Silent_p.G260G	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	260	Extracellular (Potential).				protein phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(3)|stomach(1)	4	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)								328				0.709677	66.009782	67.304083	22	9	GG		KEEP	---	---	---	---	capture			Silent	SNP	37999734	37999734	5359	1	G	A	A	38	38	EPHA10	A	1	1
KCNAB2	8514	broad.mit.edu	36	1	6081164	6081164	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:6081164C>A	uc001aly.1	+	c.1191C>A	c.(1189-1191)CAC>CAA	p.H397Q	KCNAB2_uc009vlv.1_Missense_Mutation_p.H349Q|KCNAB2_uc001alu.2_3'UTR|KCNAB2_uc001alv.1_Missense_Mutation_p.H349Q|KCNAB2_uc001alw.1_Missense_Mutation_p.H335Q|KCNAB2_uc001alx.1_Missense_Mutation_p.H349Q|KCNAB2_uc009vlw.1_Missense_Mutation_p.H282Q	NM_172130	NP_742128	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related	349					oxidation-reduction process	cytoplasm|integral to membrane|juxtaparanode region of axon	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity				0	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)										0.109756	21.255341	45.972314	18	146	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6081164	6081164	8315	1	C	A	A	19	19	KCNAB2	A	3	3
GBP5	115362	broad.mit.edu	36	1	89498980	89498980	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:89498980G>T	uc001dnc.1	-	c.1756C>A	c.(1756-1758)CTC>ATC	p.L586I	GBP5_uc001dnd.1_Missense_Mutation_p.L586I	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN	guanylate-binding protein 5	586						plasma membrane	GTP binding|GTPase activity			ovary(1)	1				all cancers(265;0.00784)|Epithelial(280;0.0286)										0.104895	9.42005	31.645987	15	128	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	89498980	89498980	6543	1	G	T	T	36	36	GBP5	T	3	3
ZNF133	7692	broad.mit.edu	36	20	18244943	18244943	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:18244943G>C	uc010gcq.1	+	c.1448G>C	c.(1447-1449)AGA>ACA	p.R483T	ZNF133_uc010gcr.1_Missense_Mutation_p.R483T|ZNF133_uc002wql.2_Missense_Mutation_p.R482T|ZNF133_uc010gcs.1_Missense_Mutation_p.R482T|ZNF133_uc002wqm.1_Missense_Mutation_p.R483T	NM_003434	NP_003425	P52736	ZN133_HUMAN	zinc finger protein 133	483	C2H2-type 10.				regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)	2														0.1875	51.451806	69.079634	36	156	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18244943	18244943	18314	20	G	C	C	33	33	ZNF133	C	3	3
SULF2	55959	broad.mit.edu	36	20	45738675	45738675	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:45738675C>A	uc002xto.1	-	c.1350G>T	c.(1348-1350)GAG>GAT	p.E450D	SULF2_uc002xtp.1_Missense_Mutation_p.E450D|SULF2_uc002xtq.1_Missense_Mutation_p.E450D|SULF2_uc002xtr.1_Missense_Mutation_p.E450D	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	450					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)	5										709				0.204082	42.345693	50.314731	20	78	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45738675	45738675	15891	20	C	A	A	20	20	SULF2	A	3	3
CDH4	1002	broad.mit.edu	36	20	59945195	59945195	+	Silent	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:59945195C>A	uc002ybn.1	+	c.2550C>A	c.(2548-2550)CTC>CTA	p.L850L	CDH4_uc002ybp.1_Silent_p.L776L	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	850	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)	5			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)											0.25	7.858397	9.001775	5	15	CC		KEEP	---	---	---	---	capture			Silent	SNP	59945195	59945195	3241	20	C	A	A	30	30	CDH4	A	3	3
CHRNA4	1137	broad.mit.edu	36	20	61452258	61452258	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:61452258C>T	uc002yes.2	-	c.949G>A	c.(949-951)GTC>ATC	p.V317I	CHRNA4_uc002yet.1_Missense_Mutation_p.V141I|CHRNA4_uc010gke.1_Missense_Mutation_p.V246I|CHRNA4_uc002yev.1_Missense_Mutation_p.V141I|CHRNA4_uc010gkf.1_Missense_Mutation_p.V141I	NM_000744	NP_000735	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 subunit	317	Helical; (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(1)	1	all_cancers(38;1.71e-10)				Nicotine(DB00184)|Varenicline(DB01273)									0.472441	180.036642	180.122815	60	67	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61452258	61452258	3519	20	C	T	T	19	19	CHRNA4	T	1	1
GMEB2	26205	broad.mit.edu	36	20	61697482	61697482	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:61697482G>A	uc002yfp.1	-	c.544C>T	c.(544-546)CTC>TTC	p.L182F	GMEB2_uc002yfo.1_Missense_Mutation_p.L104F|GMEB2_uc002yfq.1_Missense_Mutation_p.L182F	NM_012384	NP_036516	Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding	182					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding|RNA polymerase II transcription factor activity				0	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)											0.529412	15.828376	15.838595	9	8	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61697482	61697482	6757	20	G	A	A	35	35	GMEB2	A	2	2
PAK7	57144	broad.mit.edu	36	20	9509423	9509423	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:9509423G>A	uc002wnl.2	-	c.359C>T	c.(358-360)GCG>GTG	p.A120V	PAK7_uc002wnk.2_Missense_Mutation_p.A120V|PAK7_uc002wnj.2_Missense_Mutation_p.A120V|PAK7_uc010gby.1_Missense_Mutation_p.A120V	NM_020341	NP_817127	Q9P286	PAK7_HUMAN	p21-activated kinase 7	120	Linker.				protein phosphorylation		ATP binding|protein binding|protein serine/threonine kinase activity			lung(7)|skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	15			COAD - Colon adenocarcinoma(9;0.194)							177				0.132626	149.375781	248.054639	100	654	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9509423	9509423	11821	20	G	A	A	38	38	PAK7	A	1	1
SYNJ1	8867	broad.mit.edu	36	21	32980026	32980026	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:32980026C>T	uc002yqh.1	-	c.1021G>A	c.(1021-1023)GGA>AGA	p.G341R	SYNJ1_uc002yqf.1_Missense_Mutation_p.G341R|SYNJ1_uc002yqg.1_Missense_Mutation_p.G341R|SYNJ1_uc002yqi.1_Missense_Mutation_p.G341R	NM_003895	NP_003886	O43426	SYNJ1_HUMAN	synaptojanin 1 isoform a	341	SAC.						inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			ovary(4)	4														0.5	57.546789	57.546789	18	18	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32980026	32980026	15973	21	C	T	T	22	22	SYNJ1	T	2	2
ASCC2	84164	broad.mit.edu	36	22	28519349	28519349	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:28519349C>A	uc003agr.1	-	c.1919G>T	c.(1918-1920)AGG>ATG	p.R640M	ASCC2_uc003ags.1_Non-coding_Transcript|ASCC2_uc003agt.1_Missense_Mutation_p.R640M	NM_032204	NP_115580	Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit	640					regulation of transcription, DNA-dependent|transcription, DNA-dependent						0			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)											0.208955	17.893723	23.177051	14	53	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	28519349	28519349	1050	22	C	A	A	24	24	ASCC2	A	3	3
CCDC157	550631	broad.mit.edu	36	22	29101601	29101602	+	Nonsense_Mutation	DNP	CC	TT	TT			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:29101601_29101602CC>TT	uc003ahn.1	+	c.1653_1654CC>TT	c.(1651-1656)CTCCAA>CTTTAA	p.Q552*		NM_001017437	NP_001017437	Q569K6	CC157_HUMAN	hypothetical protein LOC550631	603	Potential.									central_nervous_system(1)	1														0.533333	31.16148	31.188156	16	14	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	DNP	29101601	29101602	2911	22	CC	TT	TT	30	30	CCDC157	TT	5	2
SEC14L4	284904	broad.mit.edu	36	22	29217948	29217948	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:29217948C>G	uc003aid.1	-	c.784G>C	c.(784-786)GGT>CGT	p.G262R	SEC14L4_uc003aie.1_Missense_Mutation_p.G247R|SEC14L4_uc003aif.1_Missense_Mutation_p.G208R	NM_174977	NP_777637	Q9UDX3	S14L4_HUMAN	SEC14p-like protein TAP3	262	GOLD.					integral to membrane|intracellular	lipid binding|transporter activity				0					Vitamin E(DB00163)									0.338235	40.154907	41.751974	23	45	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29217948	29217948	14470	22	C	G	G	22	22	SEC14L4	G	3	3
LIMK2	3985	broad.mit.edu	36	22	30002799	30002799	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:30002799G>A	uc003akj.1	+	c.1734G>A	c.(1732-1734)GAG>GAA	p.E578E	LIMK2_uc003akg.1_Silent_p.E516E|LIMK2_uc003akh.1_Intron|LIMK2_uc003aki.1_Intron|LIMK2_uc003akk.1_Intron	NM_001031801	NP_001026971	P53671	LIMK2_HUMAN	LIM domain kinase 2 isoform 1	Error:Variant_position_missing_in_P53671_after_alignment					protein phosphorylation	mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2										431				0.333333	7.389868	7.688147	4	8	GG		KEEP	---	---	---	---	capture			Silent	SNP	30002799	30002799	9128	22	G	A	A	35	35	LIMK2	A	2	2
ZBED4	9889	broad.mit.edu	36	22	48665212	48665212	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:48665212C>A	uc003bix.2	+	c.1898C>A	c.(1897-1899)ACA>AAA	p.T633K	ZBED4_uc010hai.1_Missense_Mutation_p.T633K	NM_014838	NP_055653	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	633						cytoplasm|nucleus	DNA binding|metal ion binding|protein dimerization activity			ovary(2)	2		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)										0.137255	11.493869	17.985174	7	44	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48665212	48665212	18104	22	C	A	A	17	17	ZBED4	A	3	3
XIRP2	129446	broad.mit.edu	36	2	167782924	167782924	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:167782924G>A	uc002udx.1	+	c.726G>A	c.(724-726)ATG>ATA	p.M242I	XIRP2_uc010fpn.1_Missense_Mutation_p.M275I|XIRP2_uc010fpo.1_Missense_Mutation_p.M242I|XIRP2_uc010fpp.1_Missense_Mutation_p.M242I|XIRP2_uc002udy.2_Missense_Mutation_p.M67I|XIRP2_uc010fpq.1_Missense_Mutation_p.M20I|XIRP2_uc010fpr.1_Missense_Mutation_p.M20I	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	67					actin cytoskeleton organization	cell junction	actin binding			ovary(6)|pancreas(1)|skin(1)	8														0.166667	8.498738	11.627921	5	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	167782924	167782924	18011	2	G	A	A	45	45	XIRP2	A	2	2
ITGA4	3676	broad.mit.edu	36	2	182107824	182107824	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:182107824C>T	uc002unu.1	+	c.2920C>T	c.(2920-2922)CGT>TGT	p.R974C	ITGA4_uc002unv.1_Missense_Mutation_p.R219C	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	974	Extracellular (Potential).				B cell differentiation|blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)									0.424242	87.620539	87.942636	28	38	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	182107824	182107824	8182	2	C	T	T	19	19	ITGA4	T	1	1
NT5C1B	93034	broad.mit.edu	36	2	18631087	18631087	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:18631087G>A	uc010exr.1	-	c.172C>T	c.(172-174)CGC>TGC	p.R58C	NT5C1B_uc002rcy.1_Missense_Mutation_p.R118C|NT5C1B_uc002rcz.1_Missense_Mutation_p.R118C|NT5C1B_uc002rda.1_Missense_Mutation_p.R58C|NT5C1B_uc010exs.1_Missense_Mutation_p.R118C|NT5C1B_uc002rdb.1_5'Flank	NM_033253	NP_150278	Q96P26	5NT1B_HUMAN	5' nucleotidase, cytosolic IB isoform 2	118	Ser-rich.				purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)												0.40991	516.129755	519.279112	182	262	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18631087	18631087	11091	2	G	A	A	38	38	NT5C1B	A	1	1
COL3A1	1281	broad.mit.edu	36	2	189558210	189558210	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:189558210G>A	uc002uqj.1	+	c.325G>A	c.(325-327)GGA>AGA	p.G109R		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	109					axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)					1079				0.59	201.737315	202.44398	59	41	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	189558210	189558210	3826	2	G	A	A	43	43	COL3A1	A	2	2
COL5A2	1290	broad.mit.edu	36	2	189612245	189612245	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:189612245C>T	uc002uqk.1	-	c.3923G>A	c.(3922-3924)AGT>AAT	p.S1308N	COL5A2_uc010frx.1_Missense_Mutation_p.S884N	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	1308	Fibrillar collagen NC1.				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)											0.116279	18.43588	37.131181	15	114	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	189612245	189612245	3835	2	C	T	T	20	20	COL5A2	T	2	2
CPS1	1373	broad.mit.edu	36	2	211213014	211213014	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:211213014G>A	uc010fur.1	+	c.2963G>A	c.(2962-2964)GGT>GAT	p.G988D	CPS1_uc002vee.2_Missense_Mutation_p.G982D|CPS1_uc010fus.1_Missense_Mutation_p.G531D	NM_001122633	NP_001116105	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform a	982			G -> D (in CPS1D).		carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)	12				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)										0.861333	1102.785588	1150.139222	323	52	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	211213014	211213014	3961	2	G	A	A	44	44	CPS1	A	2	2
SLC23A3	151295	broad.mit.edu	36	2	219742808	219742808	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:219742808C>A	uc010fwb.1	-	c.143G>T	c.(142-144)AGC>ATC	p.S48I	NHEJ1_uc002vjq.2_Non-coding_Transcript|SLC23A3_uc002vjs.1_5'Flank|SLC23A3_uc002vjt.1_5'Flank	NM_144712	NP_653313	Q6PIS1	S23A3_HUMAN	solute carrier family 23 (nucleobase	48	Cytoplasmic (Potential).				transmembrane transport	integral to membrane	protein binding|transporter activity				0		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.108108	7.758654	19.01783	8	66	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	219742808	219742808	14961	2	C	A	A	28	28	SLC23A3	A	3	3
GBX2	2637	broad.mit.edu	36	2	236739399	236739399	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:236739399C>T	uc002vvw.1	-	c.944G>A	c.(943-945)GGG>GAG	p.G315E	GBX2_uc010fyn.1_Non-coding_Transcript	NM_001485	NP_001476	P52951	GBX2_HUMAN	gastrulation brain homeo box 2	315					regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity				0		Breast(86;0.00235)|Renal(207;0.00339)|all_hematologic(139;0.00357)|all_lung(227;0.0616)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|Lung NSC(271;0.179)		Epithelial(121;4.5e-25)|OV - Ovarian serous cystadenocarcinoma(60;5.16e-11)|BRCA - Breast invasive adenocarcinoma(100;3.4e-05)|Lung(119;0.00195)|LUSC - Lung squamous cell carcinoma(224;0.00471)										0.134328	10.760874	19.436719	9	58	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	236739399	236739399	6547	2	C	T	T	22	22	GBX2	T	2	2
COL6A3	1293	broad.mit.edu	36	2	237928289	237928289	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:237928289C>T	uc002vwl.2	-	c.6619G>A	c.(6619-6621)GGA>AGA	p.G2207R	COL6A3_uc002vwk.2_Missense_Mutation_p.G2040R|COL6A3_uc002vwm.2_Missense_Mutation_p.G2006R|COL6A3_uc002vwn.2_Missense_Mutation_p.G2007R|COL6A3_uc002vwo.2_Missense_Mutation_p.G2001R|COL6A3_uc002vwp.1_Missense_Mutation_p.G28R	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2207	Triple-helical region.|Collagen-like 3.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|pancreas(1)	15		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)										0.37931	33.119206	33.489184	11	18	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	237928289	237928289	3839	2	C	T	T	23	23	COL6A3	T	1	1
PRKD3	23683	broad.mit.edu	36	2	37366934	37366934	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:37366934C>T	uc002rqd.1	-	c.800G>A	c.(799-801)AGA>AAA	p.R267K	PRKD3_uc002rqf.1_Missense_Mutation_p.R267K	NM_005813	NP_005804	O94806	KPCD3_HUMAN	protein kinase D3	267					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|protein phosphorylation	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)				Melanoma(80;621 1355 8613 11814 51767)				569				0.29108	169.402855	177.709894	62	151	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37366934	37366934	12963	2	C	T	T	32	32	PRKD3	T	2	2
CYP1B1	1545	broad.mit.edu	36	2	38155975	38155975	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0866-01	TCGA-14-0866-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:38155975T>C	uc002rqo.2	-	c.61A>G	c.(61-63)ACC>GCC	p.T21A		NM_000104	NP_000095	Q16678	CP1B1_HUMAN	cytochrome P450, family 1, subfamily B,	21					oxidation-reduction process|visual perception|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			ovary(1)|central_nervous_system(1)	2		all_hematologic(82;0.21)			Estrone(DB00655)					68				0.285714	9.432218	10.304852	6	15	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38155975	38155975	4316	2	T	C	C	58	58	CYP1B1	C	4	4
STON1-GTF2A1L	286749	broad.mit.edu	36	2	48662668	48662668	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:48662668G>A	uc002rwp.1	+	c.1392G>A	c.(1390-1392)CCG>CCA	p.P464P	STON1_uc002rwo.2_Silent_p.P464P|STON1_uc010fbm.1_Silent_p.P464P|STON1_uc002rwr.1_Non-coding_Transcript|STON1_uc002rwq.1_Silent_p.P464P	NM_172311	NP_758515	B7ZL16	B7ZL16_HUMAN	STON1-GTF2A1L protein	464					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex	RNA polymerase II transcription factor activity			ovary(3)|pancreas(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)											0.148551	73.619443	106.320243	41	235	GG		KEEP	---	---	---	---	capture			Silent	SNP	48662668	48662668	15837	2	G	A	A	37	37	STON1-GTF2A1L	A	1	1
CCDC104	112942	broad.mit.edu	36	2	55624934	55624934	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:55624934G>A	uc002ryx.2	+	c.927G>A	c.(925-927)ATG>ATA	p.M309I	CCDC104_uc002ryy.2_Missense_Mutation_p.M284I	NM_080667	NP_542398	Q96G28	CC104_HUMAN	coiled-coil domain containing 104	284										ovary(1)	1			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)											0.352564	150.86834	153.862728	55	101	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55624934	55624934	2859	2	G	A	A	48	48	CCDC104	A	2	2
BMP10	27302	broad.mit.edu	36	2	68946359	68946359	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:68946359C>T	uc002sez.1	-	c.1183G>A	c.(1183-1185)GAG>AAG	p.E395K		NM_014482	NP_055297	O95393	BMP10_HUMAN	bone morphogenetic protein 10 preproprotein	395					activin receptor signaling pathway|adult heart development|atrial cardiac muscle tissue morphogenesis|BMP signaling pathway|cardiac muscle cell proliferation|heart trabecula formation|negative regulation of cardiac muscle hypertrophy|negative regulation of cell growth|negative regulation of endothelial cell migration|Notch signaling pathway|pathway-restricted SMAD protein phosphorylation|positive regulation of cardiac muscle cell proliferation|positive regulation of cardiac muscle hypertrophy|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent|sarcomere organization|ventricular cardiac muscle cell development|ventricular cardiac muscle tissue morphogenesis	cell surface|extracellular space|Z disc	cytokine activity|growth factor activity|receptor serine/threonine kinase binding			ovary(2)	2														0.12	40.620105	76.005131	30	220	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	68946359	68946359	1482	2	C	T	T	32	32	BMP10	T	2	2
FANCD2	2177	broad.mit.edu	36	3	10056038	10056038	+	Silent	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:10056038C>T	uc003buw.1	+	c.567C>T	c.(565-567)GGC>GGT	p.G189G	FANCD2_uc003bux.1_Silent_p.G189G|FANCD2_uc003buy.1_Silent_p.G189G|FANCD2_uc003buv.2_Silent_p.G189G	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform	189	Interaction with FANCE.				DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)						587				0.376623	83.754153	84.783166	29	48	CC		KEEP	---	---	---	---	capture			Silent	SNP	10056038	10056038	5901	3	C	T	T	25	25	FANCD2	T	2	2
CD86	942	broad.mit.edu	36	3	123305299	123305299	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:123305299G>A	uc003eet.1	+	c.315G>A	c.(313-315)AAG>AAA	p.K105K	CD86_uc003eeu.1_Silent_p.K99K	NM_175862	NP_008820	P42081	CD86_HUMAN	CD86 antigen isoform 1	105	Ig-like V-type.|Extracellular (Potential).				cell-cell signaling|interspecies interaction between organisms|positive regulation of cell proliferation|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of lymphotoxin A biosynthetic process|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation	integral to membrane	coreceptor activity|protein binding|transcription activator activity			pancreas(1)	1				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)	GBM(67;1379 1389 36064 39806)								0.247803	348.254678	381.098668	141	428	GG		KEEP	---	---	---	---	capture			Silent	SNP	123305299	123305299	3171	3	G	A	A	35	35	CD86	A	2	2
CNTN4	152330	broad.mit.edu	36	3	2917382	2917382	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:2917382G>T	uc003bpc.1	+	c.954G>T	c.(952-954)TGG>TGT	p.W318C	CNTN4_uc003bpb.1_5'UTR|CNTN4_uc003bpd.1_Missense_Mutation_p.W318C|CNTN4_uc003bpe.1_5'UTR|CNTN4_uc003bpf.1_5'UTR	NM_175607	NP_783302	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	318	Ig-like C2-type 4.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)										0.446352	305.588869	306.166891	104	129	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2917382	2917382	3781	3	G	T	T	41	41	CNTN4	T	3	3
MLH1	4292	broad.mit.edu	36	3	37045336	37045336	+	Silent	SNP	A	G	G			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:37045336A>G	uc003cgl.1	+	c.1467A>G	c.(1465-1467)GAA>GAG	p.E489E	MLH1_uc010hge.1_Silent_p.E489E|MLH1_uc003cgn.2_Silent_p.E248E|MLH1_uc010hgi.1_Silent_p.E131E|MLH1_uc010hgj.1_Silent_p.E131E|MLH1_uc010hgk.1_Silent_p.E131E|MLH1_uc010hgl.1_Silent_p.E64E|MLH1_uc010hgm.1_Non-coding_Transcript|MLH1_uc010hgn.1_Silent_p.E131E|MLH1_uc010hgo.1_Silent_p.E131E	NM_000249	NP_000240	P40692	MLH1_HUMAN	MutL protein homolog 1	489	Interaction with EXO1.				mismatch repair|somatic hypermutation of immunoglobulin genes	chiasma|MutLalpha complex|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|protein binding	p.0?(1)		large_intestine(40)|haematopoietic_and_lymphoid_tissue(8)|ovary(6)|pancreas(5)|stomach(3)|central_nervous_system(3)|endometrium(3)|skin(2)|prostate(2)|NS(1)	73								1		349				0.152778	7.961022	16.310369	11	61	AA		KEEP	---	---	---	---	capture			Silent	SNP	37045336	37045336	10007	3	A	G	G	1	1	MLH1	G	4	4
MST1R	4486	broad.mit.edu	36	3	49903040	49903040	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49903040C>T	uc003cxy.2	-	c.3692G>A	c.(3691-3693)CGC>CAC	p.R1231H		NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	1231	Cytoplasmic (Potential).|Protein kinase.				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|protein phosphorylation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)						205				0.85654	1339.782609	1397.965431	406	68	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49903040	49903040	10284	3	C	T	T	27	27	MST1R	T	1	1
ANKRD17	26057	broad.mit.edu	36	4	74219748	74219748	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:74219748A>G	uc003hgp.1	-	c.3184T>C	c.(3184-3186)TCT>CCT	p.S1062P	ANKRD17_uc003hgo.1_Missense_Mutation_p.S949P|ANKRD17_uc003hgq.1_Missense_Mutation_p.S811P|ANKRD17_uc003hgr.1_Missense_Mutation_p.S1061P	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	1062					interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(2)|lung(1)	8	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)											0.497959	379.030292	379.031114	122	123	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74219748	74219748	649	4	A	G	G	11	11	ANKRD17	G	4	4
TRIM36	55521	broad.mit.edu	36	5	114527167	114527167	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:114527167C>T	uc003kqs.1	-	c.245G>A	c.(244-246)CGA>CAA	p.R82Q	TRIM36_uc003kqt.1_Intron	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN	tripartite motif-containing 36 isoform 1	82	RING-type; degenerate.					acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding			ovary(4)|lung(2)|breast(2)	8		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)						304				0.337571	702.647029	719.148116	239	469	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	114527167	114527167	17054	5	C	T	T	31	31	TRIM36	T	1	1
PCDHA10	56139	broad.mit.edu	36	5	140216710	140216710	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140216710C>T	uc003lhx.1	+	c.893C>T	c.(892-894)ACG>ATG	p.T298M	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA4_uc003lhi.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.1_Intron|PCDHA6_uc003lho.1_Intron|PCDHA6_uc003lhn.1_Intron|PCDHA7_uc003lhq.1_Intron|PCDHA8_uc003lhs.1_Intron|PCDHA9_uc003lhu.1_Intron|PCDHA10_uc003lhw.1_Missense_Mutation_p.T298M|PCDHA10_uc003lhv.1_Missense_Mutation_p.T298M	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	298	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|breast(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.107056	43.451624	106.318543	44	367	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140216710	140216710	11940	5	C	T	T	19	19	PCDHA10	T	1	1
CDH9	1007	broad.mit.edu	36	5	26917162	26917162	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:26917162G>A	uc003jgs.1	-	c.2210C>T	c.(2209-2211)ACG>ATG	p.T737M		NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	737	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)	5						Melanoma(8;187 585 15745 40864 52829)								0.12766	27.389419	52.802343	24	164	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26917162	26917162	3246	5	G	A	A	40	40	CDH9	A	1	1
TNPO1	3842	broad.mit.edu	36	5	72179972	72179972	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:72179972C>A	uc003kck.2	+	c.20C>A	c.(19-21)ACC>AAC	p.T7N	TNPO1_uc003kch.2_5'UTR|TNPO1_uc003kci.2_5'UTR|TNPO1_uc003kcg.2_5'UTR	NM_002270	NP_694858	Q92973	TNPO1_HUMAN	transportin 1 isoform 1	7					interspecies interaction between organisms|mRNA metabolic process|protein import into nucleus, translocation	cytosol|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			skin(3)|urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)	7		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)										0.25	6.859359	8.003715	5	15	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	72179972	72179972	16876	5	C	A	A	18	18	TNPO1	A	3	3
ADCY2	108	broad.mit.edu	36	5	7810571	7810571	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:7810571A>G	uc003jdz.1	+	c.1966A>G	c.(1966-1968)AAA>GAA	p.K656E		NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	656					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)	6														0.25	7.456688	8.601511	5	15	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7810571	7810571	295	5	A	G	G	5	5	ADCY2	G	4	4
AKD1	221264	broad.mit.edu	36	6	109978168	109978168	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:109978168G>T	uc003ptq.1	-	c.1342C>A	c.(1342-1344)CAT>AAT	p.H448N				Q5TCS8	AKD1_HUMAN	Homo sapiens cDNA FLJ42177 fis, clone THYMU2030264.	928					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1														0.381443	110.748292	111.944898	37	60	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	109978168	109978168	463	6	G	T	T	46	46	AKD1	T	3	3
LAMA4	3910	broad.mit.edu	36	6	112567772	112567772	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:112567772G>A	uc003pvu.2	-	c.2985C>T	c.(2983-2985)ACC>ACT	p.T995T	LAMA4_uc003pvv.2_Silent_p.T988T|LAMA4_uc003pvt.2_Silent_p.T988T	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	995	Laminin G-like 1.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)										0.204819	18.592001	25.357061	17	66	GG		KEEP	---	---	---	---	capture			Silent	SNP	112567772	112567772	8931	6	G	A	A	47	47	LAMA4	A	2	2
FAM26E	254228	broad.mit.edu	36	6	116943808	116943808	+	Missense_Mutation	SNP	C	T	T	rs35398770	unknown	TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:116943808C>T	uc003pwy.1	+	c.893C>T	c.(892-894)ACG>ATG	p.T298M		NM_153711	NP_714922	Q8N5C1	FA26E_HUMAN	hypothetical protein LOC254228	298						integral to membrane					0		all_cancers(87;0.0608)|all_epithelial(87;0.05)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0242)|all cancers(137;0.0419)|OV - Ovarian serous cystadenocarcinoma(136;0.0671)|Epithelial(106;0.212)										0.335329	802.78776	822.801492	280	555	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116943808	116943808	5770	6	C	T	T	19	19	FAM26E	T	1	1
L3MBTL3	84456	broad.mit.edu	36	6	130433920	130433920	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:130433920G>A	uc003qbt.1	+	c.1199G>A	c.(1198-1200)CGT>CAT	p.R400H	L3MBTL3_uc003qbu.1_Missense_Mutation_p.R375H	NM_032438	NP_115814	Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 isoform a	400	MBT 2.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)	5				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)										0.103139	20.606506	55.549946	23	200	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130433920	130433920	8916	6	G	A	A	40	40	L3MBTL3	A	1	1
STXBP5	134957	broad.mit.edu	36	6	147567472	147567472	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:147567472C>G	uc003qlz.2	+	c.111C>G	c.(109-111)ATC>ATG	p.I37M	STXBP5_uc010khz.1_Missense_Mutation_p.I37M|STXBP5_uc003qlx.2_Non-coding_Transcript|STXBP5_uc003qly.2_5'Flank	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	37					exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)										0.227273	7.359949	8.867387	5	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	147567472	147567472	15876	6	C	G	G	30	30	STXBP5	G	3	3
SFT2D1	113402	broad.mit.edu	36	6	166658066	166658066	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0866-01	TCGA-14-0866-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:166658066T>C	uc003qux.1	-	c.359A>G	c.(358-360)AAG>AGG	p.K120R		NM_145169	NP_660152	Q8WV19	SFT2A_HUMAN	SFT2 domain containing 1	120	Lumenal (Potential).				protein transport|vesicle-mediated transport	integral to membrane				central_nervous_system(1)	1		Breast(66;0.000148)|Prostate(117;0.109)|Ovarian(120;0.199)		OV - Ovarian serous cystadenocarcinoma(33;2.63e-19)|BRCA - Breast invasive adenocarcinoma(81;4.92e-06)|GBM - Glioblastoma multiforme(31;4.58e-05)										0.148936	6.586837	12.161306	7	40	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	166658066	166658066	14675	6	T	C	C	56	56	SFT2D1	C	4	4
OR2J2	26707	broad.mit.edu	36	6	29249673	29249673	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:29249673G>A	uc003nma.2	+	c.282G>A	c.(280-282)TCG>TCA	p.S94S		NM_030905	NP_112167	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J,	94	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.16777	150.327858	197.549371	76	377	GG		KEEP	---	---	---	---	capture			Silent	SNP	29249673	29249673	11409	6	G	A	A	40	40	OR2J2	A	1	1
DDR1	780	broad.mit.edu	36	6	30968178	30968178	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:30968178G>A	uc003nrv.1	+	c.979G>A	c.(979-981)GGG>AGG	p.G327R	DDR1_uc010jse.1_Missense_Mutation_p.G327R|DDR1_uc003nrq.1_Missense_Mutation_p.G327R|DDR1_uc003nrs.1_Missense_Mutation_p.G327R|DDR1_uc003nrt.1_Missense_Mutation_p.G327R|DDR1_uc003nrr.1_Missense_Mutation_p.G327R|DDR1_uc003nru.1_Missense_Mutation_p.G327R|DDR1_uc003nrw.1_Missense_Mutation_p.G126R|DDR1_uc003nry.1_5'Flank|DDR1_uc003nrx.1_5'Flank	NM_013994	NP_054700	Q08345	DDR1_HUMAN	discoidin domain receptor family, member 1	327	Extracellular (Potential).				cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane	ATP binding|protein binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|central_nervous_system(3)|large_intestine(1)|ovary(1)	9					Imatinib(DB00619)					411				0.134921	24.521703	40.781494	17	109	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30968178	30968178	4507	6	G	A	A	43	43	DDR1	A	2	2
BRD2	6046	broad.mit.edu	36	6	33050329	33050329	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:33050329A>G	uc010juh.1	+	c.142A>G	c.(142-144)ATG>GTG	p.M48V	BRD2_uc003ocn.2_Missense_Mutation_p.M48V|BRD2_uc003oco.2_Non-coding_Transcript|BRD2_uc003ocq.2_Missense_Mutation_p.M48V|BRD2_uc003ocp.2_5'UTR	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2	48					spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5										227				0.383721	192.404541	194.443654	66	106	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33050329	33050329	1533	6	A	G	G	4	4	BRD2	G	4	4
BRPF3	27154	broad.mit.edu	36	6	36277497	36277497	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:36277497C>A	uc003olv.2	+	c.1420C>A	c.(1420-1422)CTT>ATT	p.L474I	BRPF3_uc010jwb.1_Missense_Mutation_p.L474I|BRPF3_uc010jwc.1_Non-coding_Transcript	NM_015695	NP_056510	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	474					histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding			ovary(1)	1														0.147541	60.690944	89.772051	36	208	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36277497	36277497	1552	6	C	A	A	28	28	BRPF3	A	3	3
KIF6	221458	broad.mit.edu	36	6	39621368	39621368	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:39621368C>T	uc003oot.2	-	c.1256G>A	c.(1255-1257)CGT>CAT	p.R419H	KIF6_uc010jxa.1_Missense_Mutation_p.R210H|KIF6_uc010jxb.1_Missense_Mutation_p.R419H	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	419					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3														0.390071	164.441422	165.91669	55	86	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39621368	39621368	8619	6	C	T	T	19	19	KIF6	T	1	1
PRICKLE4	29964	broad.mit.edu	36	6	41861129	41861129	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:41861129C>G	uc003ore.1	+	c.455C>G	c.(454-456)CCT>CGT	p.P152R	PRICKLE4_uc003ord.1_Non-coding_Transcript|TOMM6_uc003org.1_5'Flank	NM_013397	NP_037529	Q2TBC4	PRIC4_HUMAN	over-expressed breast tumor protein	112	LIM zinc-binding 1.					nucleus	zinc ion binding				0	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)											0.564103	65.523883	65.661296	22	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41861129	41861129	12932	6	C	G	G	24	24	PRICKLE4	G	3	3
PKHD1	5314	broad.mit.edu	36	6	51809176	51809176	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:51809176G>T	uc003pah.1	-	c.8158C>A	c.(8158-8160)CCC>ACC	p.P2720T	PKHD1_uc010jzn.1_Missense_Mutation_p.P703T|PKHD1_uc003pai.1_Missense_Mutation_p.P2720T	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2720	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			ovary(12)|large_intestine(5)|central_nervous_system(3)	20	Lung NSC(77;0.0605)									1537				0.147493	84.453229	124.89857	50	289	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51809176	51809176	12396	6	G	T	T	42	42	PKHD1	T	3	3
KIAA1586	57691	broad.mit.edu	36	6	57025926	57025926	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:57025926A>G	uc003pdj.1	+	c.670A>G	c.(670-672)AAG>GAG	p.K224E		NM_020931	NP_065982	Q9HCI6	K1586_HUMAN	hypothetical protein LOC57691	224							nucleic acid binding				0	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)											0.17094	16.468141	28.576371	20	97	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57025926	57025926	8554	6	A	G	G	1	1	KIAA1586	G	4	4
DSP	1832	broad.mit.edu	36	6	7510622	7510622	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:7510622G>A	uc003mxp.1	+	c.809G>A	c.(808-810)CGA>CAA	p.R270Q	DSP_uc003mxq.1_Missense_Mutation_p.R270Q	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	270	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)	8	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)										0.175325	55.13807	70.446136	27	127	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7510622	7510622	4965	6	G	A	A	37	37	DSP	A	1	1
TRPV6	55503	broad.mit.edu	36	7	142284379	142284379	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:142284379G>A	uc003wbx.1	-	c.666C>T	c.(664-666)TAC>TAT	p.Y222Y	TRPV6_uc003wbw.1_Silent_p.Y8Y|TRPV6_uc010lou.1_Silent_p.Y93Y	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	222	Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(1)	1	Melanoma(164;0.059)													0.14	144.176591	231.668666	98	602	GG		KEEP	---	---	---	---	capture			Silent	SNP	142284379	142284379	17151	7	G	A	A	40	40	TRPV6	A	1	1
RADIL	55698	broad.mit.edu	36	7	4805622	4805622	+	Silent	SNP	A	T	T			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:4805622A>T	uc003snj.1	-	c.3141T>A	c.(3139-3141)CGT>CGA	p.R1047R	RADIL_uc003sng.1_Non-coding_Transcript|RADIL_uc003snh.1_Silent_p.R343R|RADIL_uc003sni.1_Silent_p.R552R	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor	1047	PDZ.				cell adhesion|multicellular organismal development|signal transduction		protein binding			central_nervous_system(2)|pancreas(2)|breast(1)	5		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)										0.241935	20.321032	24.164782	15	47	AA		KEEP	---	---	---	---	capture			Silent	SNP	4805622	4805622	13457	7	A	T	T	10	10	RADIL	T	4	4
MLXIPL	51085	broad.mit.edu	36	7	72648502	72648502	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:72648502G>C	uc003tyn.1	-	c.1975C>G	c.(1975-1977)CAG>GAG	p.Q659E	MLXIPL_uc003tyj.1_Missense_Mutation_p.Q38E|MLXIPL_uc003tyk.1_Missense_Mutation_p.Q657E|MLXIPL_uc003tyl.1_Missense_Mutation_p.Q657E|MLXIPL_uc003tym.1_Missense_Mutation_p.Q659E|MLXIPL_uc003tyo.1_Non-coding_Transcript|MLXIPL_uc003typ.1_Missense_Mutation_p.Q565E	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN	Williams Beuren syndrome chromosome region 14	659	Basic motif.				anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of glycolysis|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription activator activity|transcription factor binding|transcription repressor activity			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)												0.212121	8.696263	11.239808	7	26	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	72648502	72648502	10027	7	G	C	C	46	46	MLXIPL	C	3	3
TNFRSF10B	8795	broad.mit.edu	36	8	22936396	22936396	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:22936396G>A	uc003xcu.1	-	c.1056C>T	c.(1054-1056)GAC>GAT	p.D352D	TNFRSF10B_uc003xcs.1_Silent_p.D117D|TNFRSF10B_uc003xct.1_Silent_p.D323D|TNFRSF10B_uc003xcv.1_Silent_p.D250D	NM_003842	NP_003833	O14763	TR10B_HUMAN	tumor necrosis factor receptor superfamily,	352	Death.|Cytoplasmic (Potential).				activation of caspase activity|activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cell surface receptor linked signaling pathway|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane|plasma membrane	caspase activator activity|receptor activity|TRAIL binding				0		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)		GBM(94;1064 1342 1839 21060 42553)				305				0.4329	292.698582	293.595334	100	131	GG		KEEP	---	---	---	---	capture			Silent	SNP	22936396	22936396	16822	8	G	A	A	36	36	TNFRSF10B	A	2	2
ADAM9	8754	broad.mit.edu	36	8	38993901	38993901	+	Silent	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:38993901G>A	uc003xmr.1	+	c.417G>A	c.(415-417)TTG>TTA	p.L139L	ADAM9_uc003xmq.1_Silent_p.L139L|ADAM9_uc010lwr.1_Non-coding_Transcript	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	139	Extracellular (Potential).				activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|integrin-mediated signaling pathway|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway|visual perception	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)											0.323529	91.792324	94.638582	33	69	GG		KEEP	---	---	---	---	capture			Silent	SNP	38993901	38993901	254	8	G	A	A	46	46	ADAM9	A	2	2
MFHAS1	9258	broad.mit.edu	36	8	8786999	8786999	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0866-01	TCGA-14-0866-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr8:8786999T>C	uc003wsj.1	-	c.980A>G	c.(979-981)GAT>GGT	p.D327G		NM_004225	NP_004216	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified	327	LRR 12.										0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		Melanoma(103;1201 2045 17515 28966)								0.294118	8.815695	9.499797	5	12	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8786999	8786999	9911	8	T	C	C	50	50	MFHAS1	C	4	4
ZNF883	169834	broad.mit.edu	36	9	114799829	114799829	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0866-01	TCGA-14-0866-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:114799829C>T	uc004bgl.2	-	c.532G>A	c.(532-534)GAA>AAA	p.E178K		NM_001101338	NP_001094808	P0CG24	ZN883_HUMAN	hypothetical protein LOC169834	178					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0														0.333333	6.350094	6.496652	2	4	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	114799829	114799829	18802	9	C	T	T	30	30	ZNF883	T	2	2
DNM1	1759	broad.mit.edu	36	9	130021331	130021331	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:130021331G>A	uc010mxv.1	+	c.568G>A	c.(568-570)GCC>ACC	p.A190T	DNM1_uc010mxr.1_Missense_Mutation_p.A190T|DNM1_uc010mxs.1_Missense_Mutation_p.A190T|DNM1_uc010mxt.1_Missense_Mutation_p.A190T|DNM1_uc010mxu.1_Missense_Mutation_p.A190T	NM_004408	NP_004399	Q05193	DYN1_HUMAN	dynamin 1 isoform 1	190					receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity|motor activity			ovary(2)	2						GBM(113;146 1575 2722 28670 29921)								0.53125	102.444376	102.498544	34	30	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130021331	130021331	4853	9	G	A	A	38	38	DNM1	A	1	1
TRUB2	26995	broad.mit.edu	36	9	130111774	130111774	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:130111774G>C	uc004buq.1	-	c.872C>G	c.(871-873)GCT>GGT	p.A291G		NM_015679	NP_056494	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase homolog 2	291					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(1)	1														0.164179	10.369574	17.576595	11	56	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130111774	130111774	17154	9	G	C	C	34	34	TRUB2	C	3	3
ATG4A	115201	broad.mit.edu	36	X	107267871	107267871	+	Silent	SNP	A	C	C			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:107267871A>C	uc004enr.1	+	c.729A>C	c.(727-729)GCA>GCC	p.A243A	ATG4A_uc004ent.1_Intron|ATG4A_uc004ens.1_Silent_p.A159A|ATG4A_uc010npi.1_Non-coding_Transcript|ATG4A_uc004enu.1_Silent_p.A159A	NM_052936	NP_443168	Q8WYN0	ATG4A_HUMAN	autophagy-related cysteine endopeptidase 2	243					autophagy|protein transport|proteolysis	cytoplasm	cysteine-type peptidase activity			pancreas(1)	1														0.307692	7.290226	7.721911	4	9	AA		KEEP	---	---	---	---	capture			Silent	SNP	107267871	107267871	1115	23	A	C	C	8	8	ATG4A	C	4	4
KLHL13	90293	broad.mit.edu	36	X	116928057	116928057	+	Silent	SNP	G	T	T			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:116928057G>T	uc004eql.1	-	c.601C>A	c.(601-603)CGG>AGG	p.R201R	KLHL13_uc004eqk.1_Silent_p.R150R|KLHL13_uc004eqm.1_Silent_p.R150R	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	201	BACK.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)	1														0.465517	61.79761	61.85908	27	31	GG		KEEP	---	---	---	---	capture			Silent	SNP	116928057	116928057	8681	23	G	T	T	40	40	KLHL13	T	3	3
KLHL13	90293	broad.mit.edu	36	X	116937661	116937661	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0866-01	TCGA-14-0866-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:116937661T>A	uc004eql.1	-	c.421A>T	c.(421-423)AGC>TGC	p.S141C	KLHL13_uc004eqk.1_Missense_Mutation_p.S90C|KLHL13_uc004eqm.1_Missense_Mutation_p.S90C	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	141	BTB.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)	1														0.15942	10.892585	18.525651	11	58	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116937661	116937661	8681	23	T	A	A	54	54	KLHL13	A	4	4
SLITRK4	139065	broad.mit.edu	36	X	142544432	142544432	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:142544432A>G	uc004fbx.1	-	c.2159T>C	c.(2158-2160)GTT>GCT	p.V720A	SLITRK4_uc004fby.1_Missense_Mutation_p.V720A|SLITRK4_uc010nsn.1_Missense_Mutation_p.V720A	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein	720	Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)													0.65625	68.968812	69.656252	21	11	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	142544432	142544432	15243	23	A	G	G	2	2	SLITRK4	G	4	4
MAGEB3	4114	broad.mit.edu	36	X	30163984	30163984	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:30163984A>G	uc004dca.1	+	c.22A>G	c.(22-24)ACG>GCG	p.T8A	MAGEB3_uc010ngg.1_Missense_Mutation_p.T8A	NM_002365	NP_002356	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	8											0														0.950249	712.974814	731.881256	191	10	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30163984	30163984	9558	23	A	G	G	14	14	MAGEB3	G	4	4
CXorf22	170063	broad.mit.edu	36	X	35917383	35917383	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:35917383G>A	uc004ddj.1	+	c.2740G>A	c.(2740-2742)GAA>AAA	p.E914K	CXorf22_uc010ngv.1_Non-coding_Transcript	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	914										large_intestine(1)|lung(1)|ovary(1)	3														0.714286	51.032046	51.897012	15	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35917383	35917383	4262	23	G	A	A	41	41	CXorf22	A	2	2
USP11	8237	broad.mit.edu	36	X	46983419	46983419	+	Silent	SNP	T	A	A			TCGA-14-0866-01	TCGA-14-0866-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:46983419T>A	uc004dhp.1	+	c.312T>A	c.(310-312)CTT>CTA	p.L104L	USP11_uc004dhq.1_5'UTR	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific protease 11	104	DUSP.				protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|central_nervous_system(1)	2														0.189189	7.788496	11.158263	7	30	TT		KEEP	---	---	---	---	capture			Silent	SNP	46983419	46983419	17604	23	T	A	A	63	63	USP11	A	4	4
P2RY4	5030	broad.mit.edu	36	X	69395525	69395525	+	Silent	SNP	A	G	G			TCGA-14-0866-01	TCGA-14-0866-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:69395525A>G	uc004dxz.1	-	c.675T>C	c.(673-675)CGT>CGC	p.R225R		NM_002565	NP_002556	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y4	225	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0														0.162791	8.494965	13.159418	7	36	AA		KEEP	---	---	---	---	capture			Silent	SNP	69395525	69395525	11766	23	A	G	G	10	10	P2RY4	G	4	4
SRPX2	27286	broad.mit.edu	36	X	99808518	99808518	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0866-01	TCGA-14-0866-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:99808518G>A	uc004egb.1	+	c.893G>A	c.(892-894)CGC>CAC	p.R298H		NM_014467	NP_055282	O60687	SRPX2_HUMAN	sushi-repeat-containing protein, X-linked 2	298	Sushi 3.				angiogenesis|cell motility|cell-cell adhesion|positive regulation of cell migration involved in sprouting angiogenesis|regulation of phosphorylation	cytoplasm|extracellular region	receptor binding			ovary(2)	2														0.904762	170.981266	181.249886	57	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99808518	99808518	15679	23	G	A	A	38	38	SRPX2	A	1	1
HSPA12A	259217	broad.mit.edu	36	10	118456753	118456754	+	Frame_Shift_Ins	INS	-	T	T			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:118456753_118456754insT	uc001lct.1	-	c.73_74insA	c.(73-75)GCCfs	p.A25fs	HSPA12A_uc001lcu.1_5'UTR	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	25							ATP binding			ovary(1)	1				all cancers(201;0.0158)										0.69			35	16				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	118456753	118456754	7703	10	-	T	T	42	42	HSPA12A	T	5	5
TUBGCP2	10844	broad.mit.edu	36	10	134957091	134957108	+	In_Frame_Del	DEL	GATCCTGTGCACCAGCTC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:134957091_134957108delGATCCTGTGCACCAGCTC	uc009ybk.1	-	c.772_789delGAGCTGGTGCACAGGATC	c.(772-789)GAGCTGGTGCACAGGATCdel	p.ELVHRI258del	TUBGCP2_uc001lmf.1_5'Flank|TUBGCP2_uc001lmg.1_In_Frame_Del_p.ELVHRI258del|TUBGCP2_uc001lmh.1_Non-coding_Transcript	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	258_263					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	cytoplasmic microtubule|cytosol|microtubule organizing center|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)										0.37			37	63				---	---	---	---	capture_indel			In_Frame_Del	DEL	134957091	134957108	17321	10	GATCCTGTGCACCAGCTC	-	-	41	41	TUBGCP2	-	5	5
NRG3	10718	broad.mit.edu	36	10	83625217	83625218	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:83625217_83625218insC	uc001kco.1	+	c.141_142insC	c.(139-144)GAGCCCfs	p.E47fs	NRG3_uc001kcp.1_5'Flank|NRG3_uc001kcq.1_5'Flank	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3	47_48	Extracellular (Potential).				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity				0				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	83625217	83625218	11054	10	-	C	C	34	34	NRG3	C	5	5
CDHR1	92211	broad.mit.edu	36	10	85963065	85963074	+	Frame_Shift_Del	DEL	TTGACATCAC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:85963065_85963074delTTGACATCAC	uc001kcv.1	+	c.2021_2030delTTGACATCAC	c.(2020-2031)ATTGACATCACAfs	p.I674fs	CDHR1_uc001kcw.2_Frame_Shift_Del_p.I674fs|CDHR1_uc009xst.1_Frame_Shift_Del_p.I378fs|CDHR1_uc001kcx.1_5'UTR	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN	protocadherin 21 precursor	674_677	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion		calcium ion binding|receptor activity			ovary(1)	1														0.35			43	80				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	85963065	85963074	3247	10	TTGACATCAC	-	-	52	52	CDHR1	-	5	5
KIF11	3832	broad.mit.edu	36	10	94395203	94395204	+	Frame_Shift_Ins	INS	-	T	T			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:94395203_94395204insT	uc001kic.1	+	c.2371_2372insT	c.(2371-2373)ACAfs	p.T791fs		NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11	791					blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding				0						Colon(47;212 1003 2764 4062 8431)								0.43			27	36				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	94395203	94395204	8583	10	-	T	T	14	14	KIF11	T	5	5
ESRRA	2101	broad.mit.edu	36	11	63838393	63838402	+	Frame_Shift_Del	DEL	CGCTGGAGGC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:63838393_63838402delCGCTGGAGGC	uc001nzq.1	+	c.549_558delCGCTGGAGGC	c.(547-558)GTCGCTGGAGGCfs	p.V183fs	ESRRA_uc001nzr.1_Frame_Shift_Del_p.V183fs|ESRRA_uc001nzs.1_Frame_Shift_Del_p.V183fs|ESRRA_uc009ypn.1_Non-coding_Transcript	NM_004451	NP_004442	P11474	ERR1_HUMAN	estrogen-related receptor alpha	183_186					positive regulation of gene-specific transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein domain specific binding|sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding				0														0.38			6	10				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	63838393	63838402	5453	11	CGCTGGAGGC	-	-	31	31	ESRRA	-	5	5
CCDC87	55231	broad.mit.edu	36	11	66116378	66116399	+	Frame_Shift_Del	DEL	AGTTCAGGTTGAGGTTAGAGCA	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:66116378_66116399delAGTTCAGGTTGAGGTTAGAGCA	uc001oiq.2	-	c.664_685delTGCTCTAACCTCAACCTGAACT	c.(664-687)TGCTCTAACCTCAACCTGAACTACfs	p.C222fs	CCS_uc001oir.1_5'Flank	NM_018219	NP_060689	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	222_229										ovary(1)	1														0.37			28	48				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	66116378	66116399	2987	11	AGTTCAGGTTGAGGTTAGAGCA	-	-	15	15	CCDC87	-	5	5
IGHMBP2	3508	broad.mit.edu	36	11	68461097	68461127	+	Frame_Shift_Del	DEL	AGCAGAAACTTCCAGAAAAGAAAAAGAAAAA	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:68461097_68461127delAGCAGAAACTTCCAGAAAAGAAAAAGAAAAA	uc001ook.1	+	c.2573_2603delAGCAGAAACTTCCAGAAAAGAAAAAGAAAAA	c.(2572-2604)CAGCAGAAACTTCCAGAAAAGAAAAAGAAAAAAfs	p.Q858fs	IGHMBP2_uc001ool.1_Frame_Shift_Del_p.Q482fs|IGHMBP2_uc001oom.1_Frame_Shift_Del_p.Q436fs	NM_002180	NP_002171	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	858_868	Nuclear localization signal (Potential).|Poly-Lys.				cell death|DNA recombination|DNA repair|DNA replication|protein homooligomerization|transcription, DNA-dependent|translation	axon|growth cone|nucleus|ribonucleoprotein complex	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' RNA helicase activity|ribosome binding|single-stranded DNA binding|transcription factor binding|tRNA binding|zinc ion binding				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)											0.54			106	92				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	68461097	68461127	7892	11	AGCAGAAACTTCCAGAAAAGAAAAAGAAAAA	-	-	7	7	IGHMBP2	-	5	5
KCTD14	65987	broad.mit.edu	36	11	77405453	77405458	+	In_Frame_Del	DEL	AACTTG	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:77405453_77405458delAACTTG	uc001oyw.2	-	c.597_602delCAAGTT	c.(595-603)GTCAAGTTT>GTT	p.KF200del		NM_023930	NP_076419	Q9BQ13	KCD14_HUMAN	potassium channel tetramerisation domain	200_201						voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1e-24)			NSCLC(86;414 1416 18100 32729 49271)|Esophageal Squamous(156;1132 1858 11406 36132 46748)				54				0.47			16	18				---	---	---	---	capture_indel			In_Frame_Del	DEL	77405453	77405458	8407	11	AACTTG	-	-	1	1	KCTD14	-	5	5
ATP8A2	51761	broad.mit.edu	36	13	25241266	25241272	+	Frame_Shift_Del	DEL	GCCAACG	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:25241266_25241272delGCCAACG	uc001uqk.1	+	c.2467_2473delGCCAACG	c.(2467-2475)GCCAACGATfs	p.A823fs	ATP8A2_uc010aaj.1_Frame_Shift_Del_p.A373fs	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	783_785	Cytoplasmic (Potential).	Magnesium (By similarity).			ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)	3		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)										0.53			117	102				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	25241266	25241272	1212	13	GCCAACG	-	-	38	38	ATP8A2	-	5	5
CORO2B	10391	broad.mit.edu	36	15	66774585	66774585	+	Frame_Shift_Del	DEL	T	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:66774585_66774585delT	uc002arj.2	+	c.269_269delT	c.(268-270)GTGfs	p.V90fs	CORO2B_uc010bic.1_Frame_Shift_Del_p.V85fs	NM_006091	NP_006082	Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	90	WD 1.				actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding			ovary(3)|large_intestine(1)	4														0.37			178	298				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	66774585	66774585	3895	15	T	-	-	59	59	CORO2B	-	5	5
MAN2A2	4122	broad.mit.edu	36	15	89257527	89257534	+	Frame_Shift_Del	DEL	GACATATC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:89257527_89257534delGACATATC	uc010bnz.1	+	c.2605_2612delGACATATC	c.(2605-2613)GACATATCAfs	p.D869fs	MAN2A2_uc002bqa.1_Non-coding_Transcript|MAN2A2_uc002bqb.1_Non-coding_Transcript|MAN2A2_uc002bqc.1_Frame_Shift_Del_p.D869fs	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	Error:Variant_position_missing_in_P49641_after_alignment					mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)											0.43			21	28				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	89257527	89257534	9598	15	GACATATC	-	-	41	41	MAN2A2	-	5	5
GNPTG	84572	broad.mit.edu	36	16	1351938	1351941	+	Frame_Shift_Del	DEL	GCCT	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:1351938_1351941delGCCT	uc002clm.1	+	c.298_301delGCCT	c.(298-303)GCCTACfs	p.A100fs		NM_032520	NP_115909	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphotransferase, gamma	100_101	PRKCSH.					extracellular region|Golgi apparatus	protein binding			central_nervous_system(1)	1		Hepatocellular(780;0.0893)												0.47			34	38				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	1351938	1351941	6815	16	GCCT	-	-	38	38	GNPTG	-	5	5
PARD6A	50855	broad.mit.edu	36	16	66252974	66252978	+	Frame_Shift_Del	DEL	GCTAT	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:66252974_66252978delGCTAT	uc002ett.1	+	c.179_183delGCTAT	c.(178-183)GGCTATfs	p.G60fs	ACD_uc002etp.2_5'Flank|ACD_uc002etq.2_5'Flank|ACD_uc002etr.2_5'Flank|PARD6A_uc002ets.1_Frame_Shift_Del_p.G60fs|PARD6A_uc002etu.1_5'UTR	NM_016948	NP_058644	Q9NPB6	PAR6A_HUMAN	par-6 partitioning defective 6 homolog alpha	60_61	Interaction with PRKCI and PRKCZ.|OPR.				cell cycle|cell division|cell-cell junction maintenance|tight junction assembly|viral reproduction	cytosol|nucleus|ruffle|tight junction	GTP-dependent protein binding|Rho GTPase binding|transcription factor binding			ovary(1)	1		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)										0.39			31	49				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	66252974	66252978	11862	16	GCTAT	-	-	42	42	PARD6A	-	5	5
PHLPP2	23035	broad.mit.edu	36	16	70240382	70240387	+	In_Frame_Del	DEL	ATTTGT	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:70240382_70240387delATTTGT	uc002fax.1	-	c.3879_3884delACAAAT	c.(3877-3885)GAACAAATG>GAG	p.QM1294del	PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.1_In_Frame_Del_p.QM1227del	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	1294_1295						cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			central_nervous_system(1)	1														0.31			19	43				---	---	---	---	capture_indel			In_Frame_Del	DEL	70240382	70240387	12279	16	ATTTGT	-	-	8	8	PHLPP2	-	5	5
CTRB2	440387	broad.mit.edu	36	16	73798510	73798519	+	Frame_Shift_Del	DEL	CCCAGCAGGA	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:73798510_73798519delCCCAGCAGGA	uc002fdr.1	-	c.22_31delTCCTGCTGGG	c.(22-33)TCCTGCTGGGCCfs	p.S8fs		NM_001025200	NP_001020371	Q6GPI1	CTRB2_HUMAN	chymotrypsinogen B2	8_11				WALLGTT -> FSLVGAA (in Ref. 3; AAH73145).	digestion|proteolysis	extracellular space	serine-type endopeptidase activity				0														0.62			5	3				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	73798510	73798519	4185	16	CCCAGCAGGA	-	-	26	26	CTRB2	-	5	5
CDT1	81620	broad.mit.edu	36	16	87402147	87402147	+	Frame_Shift_Del	DEL	C	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:87402147_87402147delC	uc002flu.1	+	c.1601_1601delC	c.(1600-1602)GCAfs	p.A534fs		NM_030928	NP_112190	Q9H211	CDT1_HUMAN	chromatin licensing and DNA replication factor	534					DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0476)		Melanoma(159;511 3380 30971)								0.42			5	7				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	87402147	87402147	3309	16	C	-	-	25	25	CDT1	-	5	5
PRPF8	10594	broad.mit.edu	36	17	1511411	1511414	+	Frame_Shift_Del	DEL	ACGA	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:1511411_1511414delACGA	uc002fte.1	-	c.4239_4242delTCGT	c.(4237-4242)GATCGTfs	p.D1413fs		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	1413_1414					nuclear mRNA splicing, via spliceosome|response to stimulus|visual perception	catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			ovary(2)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)										0.35			333	614				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	1511411	1511414	13018	17	ACGA	-	-	6	6	PRPF8	-	5	5
FLII	2314	broad.mit.edu	36	17	18098564	18098565	+	Frame_Shift_Ins	INS	-	T	T			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:18098564_18098565insT	uc002gsr.1	-	c.570_571insA	c.(568-573)CAGCTCfs	p.Q190fs	FLII_uc002gsq.1_Frame_Shift_Ins_p.Q62fs|FLII_uc010cpy.1_Frame_Shift_Ins_p.Q179fs|FLII_uc002gss.1_Frame_Shift_Ins_p.Q190fs	NM_002018	NP_002009	Q13045	FLII_HUMAN	flightless I homolog	190_191	Interaction with LRRFIP1 and LRRFIP2.|LRR 8.				multicellular organismal development|muscle contraction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	actin binding			central_nervous_system(1)	1	all_neural(463;0.228)													0.38			20	32				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	18098564	18098565	6163	17	-	T	T	34	34	FLII	T	5	5
KCNH6	81033	broad.mit.edu	36	17	58969653	58969654	+	Frame_Shift_Ins	INS	-	A	A			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:58969653_58969654insA	uc002jay.1	+	c.1852_1853insA	c.(1852-1854)GGGfs	p.G618fs	KCNH6_uc002jaz.1_Frame_Shift_Ins_p.G565fs|KCNH6_uc002jba.1_Frame_Shift_Ins_p.G116fs	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	618	cNMP.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|signal transduction						0					Ibutilide(DB00308)									0.42			25	34				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	58969653	58969654	8341	17	-	A	A	47	47	KCNH6	A	5	5
PRDX2	7001	broad.mit.edu	36	19	12771805	12771812	+	Splice_Site_Del	DEL	TGAAGACA	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:12771805_12771812delTGAAGACA	uc002mvd.1	-	c.e5_splice_site				NM_005809	NP_005800			peroxiredoxin 2 isoform a						anti-apoptosis|cell redox homeostasis|hydrogen peroxide catabolic process|oxidation-reduction process|removal of superoxide radicals		thioredoxin peroxidase activity				0														0.32			12	25				---	---	---	---	capture_indel			Splice_Site_Del	DEL	12771805	12771812	12908	19	TGAAGACA	-	-	55	55	PRDX2	-	5	5
ZNF565	147929	broad.mit.edu	36	19	41366311	41366311	+	Frame_Shift_Del	DEL	A	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:41366311_41366311delA	uc002odn.1	-	c.397_397delT	c.(397-399)TGCfs	p.C133fs	ZNF565_uc010ees.1_Frame_Shift_Del_p.C68fs|ZNF565_uc002odo.1_Frame_Shift_Del_p.C133fs	NM_152477	NP_689690	Q8N9K5	ZN565_HUMAN	zinc finger protein 565	133					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)											0.46			112	129				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	41366311	41366311	18591	19	A	-	-	6	6	ZNF565	-	5	5
CPT1C	126129	broad.mit.edu	36	19	54892482	54892488	+	Frame_Shift_Del	DEL	CTGGATC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:54892482_54892488delCTGGATC	uc002ppj.1	+	c.229_235delCTGGATC	c.(229-237)CTGGATCCTfs	p.L77fs	CPT1C_uc002ppl.2_Frame_Shift_Del_p.L77fs|CPT1C_uc002ppi.1_5'UTR|CPT1C_uc010eng.1_Frame_Shift_Del_p.L77fs|CPT1C_uc010enh.1_Frame_Shift_Del_p.L77fs|CPT1C_uc002ppk.1_Frame_Shift_Del_p.L77fs	NM_152359	NP_689572	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C isoform 2	77_79	Mitochondrial intermembrane (Potential).				fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)										0.34			82	158				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	54892482	54892488	3972	19	CTGGATC	-	-	28	28	CPT1C	-	5	5
KIR2DL1	3802	broad.mit.edu	36	19	59986251	59986252	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:59986251_59986252delTT	uc010erz.1	+	c.859_860delTT	c.(859-861)TTCfs	p.F287fs	KIR2DS4_uc010erv.1_Intron|KIR2DS4_uc010erx.1_Intron|KIR2DS4_uc010esa.1_Intron|KIR3DP1_uc002qgw.1_Intron|KIR2DL3_uc010erw.1_Intron|KIR2DL1_uc002qgz.1_Frame_Shift_Del_p.F171fs|KIR2DL1_uc010ery.1_Frame_Shift_Del_p.F171fs|KIR2DL1_uc002qhb.1_Frame_Shift_Del_p.F261fs	NM_014218	NP_055033	P43626	KI2L1_HUMAN	killer cell immunoglobulin-like receptor, two	261	Helical; (Potential).				immune response|natural killer cell inhibitory signaling pathway	integral to plasma membrane	protein binding|receptor activity				0				GBM - Glioblastoma multiforme(193;0.0192)		GBM(72;624 1217 3963 34152 38303)								0.86			6	1				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	59986251	59986252	8628	19	TT	-	-	56	56	KIR2DL1	-	5	5
EPS8L1	54869	broad.mit.edu	36	19	60285647	60285648	+	Frame_Shift_Ins	INS	-	G	G			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:60285647_60285648insG	uc002qis.2	+	c.1079_1080insG	c.(1078-1080)TCGfs	p.S360fs	EPS8L1_uc010ess.1_Frame_Shift_Ins_p.S342fs|EPS8L1_uc010est.1_Frame_Shift_Ins_p.S360fs|EPS8L1_uc010esu.1_Non-coding_Transcript|EPS8L1_uc002qiu.1_Frame_Shift_Ins_p.S233fs|EPS8L1_uc002qiv.1_Frame_Shift_Ins_p.S6fs|EPS8L1_uc002qiw.1_Frame_Shift_Ins_p.S107fs	NM_133180	NP_573441	Q8TE68	ES8L1_HUMAN	epidermal growth factor receptor pathway	360						cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		Ovarian(149;255 1863 3636 27051 29647)								0.33			3	6				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	60285647	60285648	5388	19	-	G	G	31	31	EPS8L1	G	5	5
MED16	10025	broad.mit.edu	36	19	824539	824546	+	Frame_Shift_Del	DEL	CACAAATT	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:824539_824546delCACAAATT	uc002lqd.1	-	c.1808_1815delAATTTGTG	c.(1807-1815)GAATTTGTGfs	p.E603fs	MED16_uc010drw.1_Frame_Shift_Del_p.E428fs|MED16_uc002lqe.2_Frame_Shift_Del_p.E592fs|MED16_uc002lqf.2_Frame_Shift_Del_p.E592fs	NM_005481	NP_005472	Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	603_605					androgen receptor signaling pathway|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	receptor activity|thyroid hormone receptor binding|thyroid hormone receptor coactivator activity|transcription activator activity|vitamin D receptor binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.31			9	20				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	824539	824546	9823	19	CACAAATT	-	-	25	25	MED16	-	5	5
HRNR	388697	broad.mit.edu	36	1	150460044	150460049	+	In_Frame_Del	DEL	AAGACT	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:150460044_150460049delAAGACT	uc001ezt.1	-	c.680_685delAGTCTT	c.(679-687)CAGTCTTCT>CCT	p.227_229QSS>P		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	227_229	2.				keratinization		calcium ion binding|protein binding			ovary(1)	1	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.31			75	170				---	---	---	---	capture_indel			In_Frame_Del	DEL	150460044	150460049	7653	1	AAGACT	-	-	9	9	HRNR	-	5	5
PANK4	55229	broad.mit.edu	36	1	2442509	2442510	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:2442509_2442510delGG	uc001ajm.1	-	c.312_313delCC	c.(310-315)TGCCTGfs	p.C104fs		NM_018216	NP_060686	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	104_105					coenzyme A biosynthetic process	cytoplasm	ATP binding|pantothenate kinase activity			large_intestine(1)|ovary(1)	2	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)										0.40			21	32				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	2442509	2442510	11836	1	GG	-	-	35	35	PANK4	-	5	5
HPDL	84842	broad.mit.edu	36	1	45566223	45566230	+	Frame_Shift_Del	DEL	GGTGGCAA	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:45566223_45566230delGGTGGCAA	uc001cne.1	+	c.816_823delGGTGGCAA	c.(814-825)GGGGTGGCAACTfs	p.G272fs		NM_032756	NP_116145	Q96IR7	HPDL_HUMAN	glyoxalase domain containing 1	272_275					aromatic amino acid family metabolic process|oxidation-reduction process		4-hydroxyphenylpyruvate dioxygenase activity|metal ion binding				0	Acute lymphoblastic leukemia(166;0.155)													0.33			14	29				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	45566223	45566230	7625	1	GGTGGCAA	-	-	43	43	HPDL	-	5	5
MAST2	23139	broad.mit.edu	36	1	46273023	46273024	+	Frame_Shift_Ins	INS	-	AT	AT			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:46273023_46273024insAT	uc001cov.1	+	c.4095_4096insAT	c.(4093-4098)CCCCTGfs	p.P1365fs	MAST2_uc001cow.1_Frame_Shift_Ins_p.P1364fs|MAST2_uc001cpa.2_Intron	NM_015112	NP_055927	Q6P0Q8	MAST2_HUMAN	microtubule associated serine/threonine kinase	1365_1366					protein phosphorylation|regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|breast(1)	9	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)									975				0.41			58	85				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	46273023	46273024	9709	1	-	AT	AT	22	22	MAST2	AT	5	5
C1orf163	65260	broad.mit.edu	36	1	52936472	52936490	+	Splice_Site_Del	DEL	GCCGCTCACCGTCCGGGTC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:52936472_52936490delGCCGCTCACCGTCCGGGTC	uc001cui.1	-	c.e1_splice_site				NM_023077	NP_075565			hypothetical protein LOC65260								binding				0														0.72			258	100				---	---	---	---	capture_indel			Splice_Site_Del	DEL	52936472	52936490	2078	1	GCCGCTCACCGTCCGGGTC	-	-	34	34	C1orf163	-	5	5
SERBP1	26135	broad.mit.edu	36	1	67668348	67668350	+	In_Frame_Del	DEL	TGG	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:67668348_67668350delTGG	uc001ddv.1	-	c.222_224delCCA	c.(220-225)TCCCAG>TCG	p.Q75del	SERBP1_uc001ddw.1_In_Frame_Del_p.Q75del|SERBP1_uc001ddx.1_In_Frame_Del_p.Q75del|SERBP1_uc001ddy.1_In_Frame_Del_p.Q75del	NM_001018067	NP_001018077	Q8NC51	PAIRB_HUMAN	SERPINE1 mRNA binding protein 1 isoform 1	75					regulation of mRNA stability	nucleus|perinuclear region of cytoplasm	mRNA 3'-UTR binding|protein binding				0														0.52			17	16				---	---	---	---	capture_indel			In_Frame_Del	DEL	67668348	67668350	14561	1	TGG	-	-	55	55	SERBP1	-	5	5
FAM73A	374986	broad.mit.edu	36	1	78111386	78111387	+	In_Frame_Ins	INS	-	TAA	TAA			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:78111386_78111387insTAA	uc001dhx.1	+	c.1673_1674insTAA	c.(1672-1674)TTT>TTTAAT	p.558_559insN		NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN	hypothetical protein LOC374986	558_559						integral to membrane				ovary(1)	1				Colorectal(170;0.226)										0.46			79	94				---	---	---	---	capture_indel			In_Frame_Ins	INS	78111386	78111387	5841	1	-	TAA	TAA	64	64	FAM73A	TAA	5	5
SAMD11	148398	broad.mit.edu	36	1	869219	869242	+	In_Frame_Del	DEL	AACCCTGCGGGCCCCGGAGCGAGA	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:869219_869242delAACCCTGCGGGCCCCGGAGCGAGA	uc001abw.1	+	c.1869_1892delAACCCTGCGGGCCCCGGAGCGAGA	c.(1867-1893)CCAACCCTGCGGGCCCCGGAGCGAGAA>CCA	p.TLRAPERE624del	SAMD11_uc001abx.1_In_Frame_Del_p.TLRAPERE487del	NM_152486	NP_689699	Q96NU1	SAM11_HUMAN	sterile alpha motif domain containing 11	624_631						nucleus					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.74e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000472)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)										0.35			13	24				---	---	---	---	capture_indel			In_Frame_Del	DEL	869219	869242	14296	1	AACCCTGCGGGCCCCGGAGCGAGA	-	-	5	5	SAMD11	-	5	5
C20orf46	55321	broad.mit.edu	36	20	1109987	1110000	+	Frame_Shift_Del	DEL	GGAGACACCCCCAG	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:1109987_1110000delGGAGACACCCCCAG	uc010gaa.1	-	c.263_276delCTGGGGGTGTCTCC	c.(262-276)CCTGGGGGTGTCTCCfs	p.P88fs	C20orf46_uc002weq.1_Frame_Shift_Del_p.P88fs	NM_018354	NP_060824	Q9NUR3	CT046_HUMAN	hypothetical protein LOC55321	88_92						integral to membrane	protein binding			ovary(1)	1														0.34			51	101				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	1109987	1110000	2193	20	GGAGACACCCCCAG	-	-	35	35	C20orf46	-	5	5
DLGAP4	22839	broad.mit.edu	36	20	34493871	34493872	+	Frame_Shift_Del	DEL	CC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:34493871_34493872delCC	uc002xff.1	+	c.337_338delCC	c.(337-339)CCCfs	p.P113fs		NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a	113					cell-cell signaling	membrane	protein binding			ovary(1)|skin(1)	2	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)												0.30			49	112				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	34493871	34493872	4742	20	CC	-	-	26	26	DLGAP4	-	5	5
DIDO1	11083	broad.mit.edu	36	20	60994663	60994684	+	Frame_Shift_Del	DEL	CACACTCTGCATGTTAATAAAT	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:60994663_60994684delCACACTCTGCATGTTAATAAAT	uc002ydr.1	-	c.3177_3198delATTTATTAACATGCAGAGTGTG	c.(3175-3198)GGATTTATTAACATGCAGAGTGTGfs	p.G1059fs	DIDO1_uc002yds.1_Frame_Shift_Del_p.G1059fs|DIDO1_uc002ydt.1_Frame_Shift_Del_p.G1059fs|DIDO1_uc002ydu.1_Frame_Shift_Del_p.G1059fs	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	1059_1066					apoptosis	cytoplasm|nucleus	zinc ion binding			ovary(3)	3	Breast(26;5.68e-08)					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)								0.52			216	202				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	60994663	60994684	4701	20	CACACTCTGCATGTTAATAAAT	-	-	21	21	DIDO1	-	5	5
UCKL1	54963	broad.mit.edu	36	20	62042038	62042039	+	In_Frame_Ins	INS	-	AAA	AAA			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:62042038_62042039insAAA	uc010gkn.1	-	c.1475_1476insTTT	c.(1474-1476)CAC>CATTTC	p.492_493insF	UCKL1_uc002yhj.1_In_Frame_Ins_p.135_136insF|UCKL1_uc010gkm.1_In_Frame_Ins_p.101_102insF	NM_017859	NP_060329	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	492_493					interspecies interaction between organisms	endoplasmic reticulum|nucleus	ATP binding|phosphotransferase activity, alcohol group as acceptor|protein binding|uridine kinase activity				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)													0.85			491	85				---	---	---	---	capture_indel			In_Frame_Ins	INS	62042038	62042039	17483	20	-	AAA	AAA	36	36	UCKL1	AAA	5	5
ZNF295	49854	broad.mit.edu	36	21	42287029	42287032	+	Frame_Shift_Del	DEL	TTAT	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:42287029_42287032delTTAT	uc002zab.2	-	c.242_245delATAA	c.(241-246)GATAATfs	p.D81fs	ZNF295_uc002yzz.2_Frame_Shift_Del_p.D81fs|ZNF295_uc002yzy.2_Frame_Shift_Del_p.D81fs|ZNF295_uc002zaa.2_Frame_Shift_Del_p.D81fs|ZNF295_uc010gou.1_Frame_Shift_Del_p.D81fs|ZNF295_uc010gov.1_Frame_Shift_Del_p.D81fs|ZNF295_uc002zac.2_Frame_Shift_Del_p.D81fs	NM_001098402	NP_065778	Q9ULJ3	ZN295_HUMAN	zinc finger protein 295 isoform L	81_82	Mediates homodimerization.|BTB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	methyl-CpG binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2														0.43			74	100				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	42287029	42287032	18419	21	TTAT	-	-	52	52	ZNF295	-	5	5
PIWIL3	440822	broad.mit.edu	36	22	23482526	23482545	+	Frame_Shift_Del	DEL	TTCTATGTTGATCAAGTAAA	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:23482526_23482545delTTCTATGTTGATCAAGTAAA	uc003abd.1	-	c.483_502delTTTACTTGATCAACATAGAA	c.(481-504)ATTTTACTTGATCAACATAGAAGGfs	p.I161fs	PIWIL3_uc010gut.1_Frame_Shift_Del_p.I161fs	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3	161_168					cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4														0.68			134	64				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	23482526	23482545	12383	22	TTCTATGTTGATCAAGTAAA	-	-	56	56	PIWIL3	-	5	5
ELFN2	114794	broad.mit.edu	36	22	36099208	36099208	+	Frame_Shift_Del	DEL	C	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:36099208_36099208delC	uc003asq.2	-	c.2313_2313delG	c.(2311-2313)GAGfs	p.E771fs	ELFN2_uc010gxg.1_Frame_Shift_Del_p.E771fs	NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62	771	Cytoplasmic (Potential).					cell surface|integral to membrane				ovary(1)	1	Melanoma(58;0.0574)													0.64			27	15				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	36099208	36099208	5250	22	C	-	-	28	28	ELFN2	-	5	5
LDOC1L	84247	broad.mit.edu	36	22	43271643	43271649	+	Frame_Shift_Del	DEL	ATAGCCC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:43271643_43271649delATAGCCC	uc003beu.1	-	c.452_458delGGGCTAT	c.(451-459)TGGGCTATCfs	p.W151fs	LDOC1L_uc010gzs.1_Frame_Shift_Del_p.W151fs	NM_032287	NP_115663	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	151_153										ovary(1)	1		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)										0.64			138	79				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	43271643	43271649	9034	22	ATAGCCC	-	-	12	12	LDOC1L	-	5	5
IGFBP5	3488	broad.mit.edu	36	2	217251922	217251949	+	Frame_Shift_Del	DEL	CCTTCTTCACTGCTTCAGCCTTCAGCTC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:217251922_217251949delCCTTCTTCACTGCTTCAGCCTTCAGCTC	uc002vgj.2	-	c.436_463delGAGCTGAAGGCTGAAGCAGTGAAGAAGG	c.(436-465)GAGCTGAAGGCTGAAGCAGTGAAGAAGGACfs	p.E146fs		NM_000599	NP_000590	P24593	IBP5_HUMAN	insulin-like growth factor binding protein 5	146_155					negative regulation of insulin-like growth factor receptor signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of translation|signal transduction	insulin-like growth factor binding protein complex	insulin-like growth factor I binding				0		Renal(323;0.0822)		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)						26				0.60			112	74				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	217251922	217251949	7883	2	CCTTCTTCACTGCTTCAGCCTTCAGCTC	-	-	30	30	IGFBP5	-	5	5
CTDSP1	58190	broad.mit.edu	36	2	218976200	218976210	+	Frame_Shift_Del	DEL	ACGCAGACCCA	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:218976200_218976210delACGCAGACCCA	uc002vhy.1	+	c.473_483delACGCAGACCCA	c.(472-483)TACGCAGACCCAfs	p.Y158fs	CTDSP1_uc002vhx.1_Frame_Shift_Del_p.Y157fs|CTDSP1_uc002vhz.1_Frame_Shift_Del_p.Y17fs	NM_021198	NP_067021	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,	158_161	FCP1 homology.				protein dephosphorylation|regulation of transcription from RNA polymerase II promoter	nucleus	CTD phosphatase activity|metal ion binding|protein binding			ovary(1)	1		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.52			29	27				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	218976200	218976210	4162	2	ACGCAGACCCA	-	-	14	14	CTDSP1	-	5	5
C2orf85	285093	broad.mit.edu	36	2	242463297	242463302	+	In_Frame_Del	DEL	GGGGCC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:242463297_242463302delGGGGCC	uc010fzu.1	+	c.917_922delGGGGCC	c.(916-924)TGGGGCCCC>TCC	p.306_308WGP>S		NM_173821	NP_776182	Q14D33	CB085_HUMAN	hypothetical protein LOC285093	306_308						integral to membrane				ovary(1)	1														0.33			10	20				---	---	---	---	capture_indel			In_Frame_Del	DEL	242463297	242463302	2292	2	GGGGCC	-	-	47	47	C2orf85	-	5	5
TRIM43	129868	broad.mit.edu	36	2	95623804	95623807	+	Frame_Shift_Del	DEL	GTTC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:95623804_95623807delGTTC	uc002suv.1	+	c.306_309delGTTC	c.(304-309)ATGTTCfs	p.M102fs		NM_138800	NP_620155	Q96BQ3	TRI43_HUMAN	tripartite motif-containing 43	102_103	B box-type.					intracellular	zinc ion binding			ovary(1)	1														0.52			12	11				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	95623804	95623807	17062	2	GTTC	-	-	48	48	TRIM43	-	5	5
GALNTL2	117248	broad.mit.edu	36	3	16225071	16225091	+	In_Frame_Del	DEL	CCCCTCAAAGGACCTGCAGCG	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:16225071_16225091delCCCCTCAAAGGACCTGCAGCG	uc003car.2	+	c.969_989delCCCCTCAAAGGACCTGCAGCG	c.(967-990)TACCCCTCAAAGGACCTGCAGCGT>TAT	p.PSKDLQR324del	GALNTL2_uc003caq.2_In_Frame_Del_p.PSKDLQR57del	NM_054110	NP_473451	Q8N3T1	GLTL2_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	324_330	Lumenal (Potential).					Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1														0.70			561	238				---	---	---	---	capture_indel			In_Frame_Del	DEL	16225071	16225091	6486	3	CCCCTCAAAGGACCTGCAGCG	-	-	18	18	GALNTL2	-	5	5
PRDM5	11107	broad.mit.edu	36	4	121850939	121850941	+	In_Frame_Del	DEL	GTG	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:121850939_121850941delGTG	uc003idn.1	-	c.1701_1703delCAC	c.(1699-1704)CACACT>CAT	p.T568del	PRDM5_uc003ido.1_In_Frame_Del_p.T537del|PRDM5_uc010ine.1_3'UTR	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	568					histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	promoter binding|repressing transcription factor binding|specific transcriptional repressor activity|zinc ion binding			central_nervous_system(1)|pancreas(1)	2														0.32			154	322				---	---	---	---	capture_indel			In_Frame_Del	DEL	121850939	121850941	12902	4	GTG	-	-	36	36	PRDM5	-	5	5
FSTL4	23105	broad.mit.edu	36	5	132589250	132589265	+	Frame_Shift_Del	DEL	TAAAAGGGAGAGCTGT	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:132589250_132589265delTAAAAGGGAGAGCTGT	uc003kyn.1	-	c.1161_1176delACAGCTCTCCCTTTTA	c.(1159-1176)AAACAGCTCTCCCTTTTAfs	p.K387fs	FSTL4_uc003kym.1_5'UTR	NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	387_392	Ig-like 2.					extracellular region	calcium ion binding			central_nervous_system(1)	1		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)											0.39			9	14				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	132589250	132589265	6330	5	TAAAAGGGAGAGCTGT	-	-	53	53	FSTL4	-	5	5
NDST1	3340	broad.mit.edu	36	5	149894744	149894752	+	In_Frame_Del	DEL	GAGCAGATG	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:149894744_149894752delGAGCAGATG	uc003lsk.2	+	c.1219_1227delGAGCAGATG	c.(1219-1227)GAGCAGATGdel	p.EQM407del	NDST1_uc003lsl.2_In_Frame_Del_p.EQM407del|NDST1_uc003lsm.1_In_Frame_Del_p.EQM407del	NM_001543	NP_001534	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan	407_409	Heparan sulfate N-deacetylase 1.|Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process|inflammatory response	Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			breast(1)	1		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)											0.50			19	19				---	---	---	---	capture_indel			In_Frame_Del	DEL	149894744	149894752	10654	5	GAGCAGATG	-	-	37	37	NDST1	-	5	5
KIF4B	285643	broad.mit.edu	36	5	154374025	154374034	+	Frame_Shift_Del	DEL	TGTCTTACTT	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:154374025_154374034delTGTCTTACTT	uc010jih.1	+	c.413_422delTGTCTTACTT	c.(412-423)GTGTCTTACTTAfs	p.V138fs		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	138_141	Kinesin-motor.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)											0.45			45	55				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	154374025	154374034	8615	5	TGTCTTACTT	-	-	59	59	KIF4B	-	5	5
PDZD2	23037	broad.mit.edu	36	5	32110231	32110232	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:32110231_32110232insC	uc003jhl.1	+	c.3262_3263insC	c.(3262-3264)GAAfs	p.E1088fs	PDZD2_uc003jhm.1_Frame_Shift_Ins_p.E1088fs	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	1088					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|large_intestine(1)	7														0.50			55	54				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	32110231	32110232	12122	5	-	C	C	41	41	PDZD2	C	5	5
THBS2	7058	broad.mit.edu	36	6	169362228	169362237	+	Frame_Shift_Del	DEL	GTACTTGAGG	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:169362228_169362237delGTACTTGAGG	uc003qwt.1	-	c.3492_3501delCCTCAAGTAC	c.(3490-3501)GACCTCAAGTACfs	p.D1164fs		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	1164_1167	TSP C-terminal.				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(4)	4		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		Esophageal Squamous(91;219 1934 18562 44706)								0.64			14	8				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	169362228	169362237	16382	6	GTACTTGAGG	-	-	40	40	THBS2	-	5	5
HIST1H3H	8357	broad.mit.edu	36	6	27885943	27885945	+	In_Frame_Del	DEL	AGC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:27885943_27885945delAGC	uc003njm.1	+	c.113_115delAGC	c.(112-117)AAGCCC>ACC	p.38_39KP>T	HIST1H2BL_uc003njl.1_5'Flank	NM_003536	NP_066298	P68431	H31_HUMAN	histone cluster 1, H3h	38_39					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1														0.50			52	52				---	---	---	---	capture_indel			In_Frame_Del	DEL	27885943	27885945	7447	6	AGC	-	-	3	3	HIST1H3H	-	5	5
SFRS18	25957	broad.mit.edu	36	6	99965563	99965563	+	Splice_Site_Del	DEL	T	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:99965563_99965563delT	uc003ppo.2	-	c.e5_splice_site			SFRS18_uc003ppp.2_Splice_Site_Del|SFRS18_uc003ppq.2_Splice_Site_Del|SFRS18_uc003ppr.2_Splice_Site_Del|SFRS18_uc003ppt.2_3'UTR|SFRS18_uc003pps.2_3'UTR	NM_032870	NP_116259			splicing factor, arginine/serine-rich 130							nuclear speck					0		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0631)										0.39			72	112				---	---	---	---	capture_indel			Splice_Site_Del	DEL	99965563	99965563	14664	6	T	-	-	53	53	SFRS18	-	5	5
AEBP1	165	broad.mit.edu	36	7	44119812	44119816	+	Frame_Shift_Del	DEL	TGTTG	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:44119812_44119816delTGTTG	uc003tkb.1	+	c.2904_2908delTGTTG	c.(2902-2910)AATGTTGACfs	p.N968fs	AEBP1_uc003tkc.2_Frame_Shift_Del_p.N543fs|AEBP1_uc003tkd.1_Frame_Shift_Del_p.N218fs	NM_001129	NP_001120	Q8IUX7	AEBP1_HUMAN	adipocyte enhancer binding protein 1 precursor	968_970	Interaction with PTEN (By similarity).|Required for transcriptional repression (By similarity).				cell adhesion|muscle organ development|proteolysis|regulation of transcription, DNA-dependent|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0														0.35			138	254				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	44119812	44119816	350	7	TGTTG	-	-	51	51	AEBP1	-	5	5
TSNARE1	203062	broad.mit.edu	36	8	143425062	143425070	+	In_Frame_Del	DEL	CTTCCCCGT	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:143425062_143425070delCTTCCCCGT	uc003ywj.1	-	c.179_187delACGGGGAAG	c.(178-189)GACGGGGAAGGT>GGT	p.DGE60del	TSNARE1_uc003ywk.1_In_Frame_Del_p.DGE60del|TSNARE1_uc003ywl.2_Intron	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	60_62					vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)													0.50			40	40				---	---	---	---	capture_indel			In_Frame_Del	DEL	143425062	143425070	17181	8	CTTCCCCGT	-	-	24	24	TSNARE1	-	5	5
ARHGAP39	80728	broad.mit.edu	36	8	145728503	145728503	+	Frame_Shift_Del	DEL	C	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:145728503_145728503delC	uc003zds.1	-	c.2974_2974delG	c.(2974-2976)GTCfs	p.V992fs	ARHGAP39_uc003zdt.1_Frame_Shift_Del_p.V961fs	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	961	Rho-GAP.				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0														0.58			15	11				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	145728503	145728503	896	8	C	-	-	19	19	ARHGAP39	-	5	5
RNF170	81790	broad.mit.edu	36	8	42830591	42830611	+	In_Frame_Del	DEL	TGATATAAGATAGAAAAAAGC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:42830591_42830611delTGATATAAGATAGAAAAAAGC	uc003xpm.1	-	c.625_645delGCTTTTTTCTATCTTATATCA	c.(625-645)GCTTTTTTCTATCTTATATCAdel	p.AFFYLIS209del	RNF170_uc010lxp.1_In_Frame_Del_p.AFFYLIS125del|RNF170_uc003xpn.1_In_Frame_Del_p.AFFYLIS113del|RNF170_uc003xpo.1_In_Frame_Del_p.AFFYLIS209del|RNF170_uc003xpp.1_In_Frame_Del_p.AFFYLIS113del	NM_030954	NP_112216	Q96K19	RN170_HUMAN	ring finger protein 170	209_215	Helical; (Potential).					integral to membrane	zinc ion binding				0	all_lung(13;1.25e-11)|Lung NSC(13;3.55e-10)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00645)|Lung NSC(58;0.0176)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)											0.33			11	22				---	---	---	---	capture_indel			In_Frame_Del	DEL	42830591	42830611	13939	8	TGATATAAGATAGAAAAAAGC	-	-	59	59	RNF170	-	5	5
C1GALT1C1	29071	broad.mit.edu	36	X	119644122	119644137	+	Frame_Shift_Del	DEL	AGAAAACCAATGCATC	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:119644122_119644137delAGAAAACCAATGCATC	uc004esy.1	-	c.913_928delGATGCATTGGTTTTCT	c.(913-930)GATGCATTGGTTTTCTTAfs	p.D305fs	C1GALT1C1_uc004esz.1_Frame_Shift_Del_p.D305fs|C1GALT1C1_uc010nqr.1_Frame_Shift_Del_p.D305fs	NM_152692	NP_689905	Q96EU7	C1GLC_HUMAN	C1GALT1-specific chaperone 1	305_310	Lumenal (Potential).					integral to membrane					0														0.45			50	62				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	119644122	119644137	2020	23	AGAAAACCAATGCATC	-	-	3	3	C1GALT1C1	-	5	5
AFF2	2334	broad.mit.edu	36	X	147775116	147775116	+	Frame_Shift_Del	DEL	C	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:147775116_147775116delC	uc004fcp.1	+	c.1267_1267delC	c.(1267-1269)CTTfs	p.L423fs	AFF2_uc004fcq.1_Frame_Shift_Del_p.L413fs|AFF2_uc004fcr.1_Frame_Shift_Del_p.L384fs|AFF2_uc004fcs.1_Frame_Shift_Del_p.L390fs|AFF2_uc004fco.2_Frame_Shift_Del_p.L384fs	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	423					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)													0.32			39	83				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	147775116	147775116	358	23	C	-	-	28	28	AFF2	-	5	5
SYN1	6853	broad.mit.edu	36	X	47319551	47319555	+	Frame_Shift_Del	DEL	GCTCT	-	-			TCGA-14-0866-01	TCGA-14-0866-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:47319551_47319555delGCTCT	uc004die.1	-	c.1221_1225delAGAGC	c.(1219-1227)GTAGAGCTCfs	p.V407fs	SYN1_uc004did.1_Frame_Shift_Del_p.V407fs	NM_006950	NP_008881	P17600	SYN1_HUMAN	synapsin I isoform Ia	407_409	C; actin-binding and synaptic-vesicle binding.					cell junction|Golgi apparatus	actin binding|ATP binding|ligase activity|transporter activity			ovary(1)	1														0.85			114	20				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	47319551	47319555	15961	23	GCTCT	-	-	34	34	SYN1	-	5	5
