Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
COL17A1	1308	broad.mit.edu	36	10	105820223	105820223	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:105820223G>A	uc001kxr.1	-	c.558C>T	c.(556-558)CCC>CCT	p.P186P	COL17A1_uc009xxo.1_Silent_p.P186P|COL17A1_uc009xxp.1_Silent_p.P186P	NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	186	Cytoplasmic (Potential).|Nonhelical region (NC16).				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane				ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)										0.147383	180.326304	267.072768	107	619	GG		KEEP	---	---	---	---	capture			Silent	SNP	105820223	105820223	3812	10	G	A	A	47	47	COL17A1	A	2	2
MRC1	4360	broad.mit.edu	36	10	18178599	18178599	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:18178599C>T	uc001ipm.1	+	c.1149C>T	c.(1147-1149)ATC>ATT	p.I383I		NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor	383	Extracellular (Potential).|C-type lectin 2.				receptor-mediated endocytosis	integral to plasma membrane	mannose binding|receptor activity				0						GBM(115;1153 1594 28187 28781 35884)								0.45	51.940627	52.028145	18	22	CC		KEEP	---	---	---	---	capture			Silent	SNP	18178599	18178599	10148	10	C	T	T	30	30	MRC1	T	2	2
ZMYND17	118490	broad.mit.edu	36	10	74857947	74857947	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:74857947G>A	uc009xrh.1	-	c.171C>T	c.(169-171)ACC>ACT	p.T57T	ZMYND17_uc001juc.2_Silent_p.T34T|ZMYND17_uc001jud.1_Silent_p.T34T|ZMYND17_uc009xrg.1_5'UTR	NM_001024593	NP_001019764	Q4VC12	ZMY17_HUMAN	zinc finger, MYND domain containing 17	34							zinc ion binding			ovary(1)	1	Prostate(51;0.0119)													0.136364	13.630424	22.084693	9	57	GG		KEEP	---	---	---	---	capture			Silent	SNP	74857947	74857947	18300	10	G	A	A	43	43	ZMYND17	A	2	2
ZMIZ1	57178	broad.mit.edu	36	10	80728198	80728199	+	Nonsense_Mutation	DNP	CC	AG	AG			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:80728198_80728199CC>AG	uc001kaf.1	+	c.1521_1522CC>AG	c.(1519-1524)TACCCC>TAAGCC	p.507_508YP>*A	ZMIZ1_uc001kag.1_Nonsense_Mutation_p.383_384YP>*A|ZMIZ1_uc001kad.1_Nonsense_Mutation_p.507_508YP>*A	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17	507_508	Pro-rich.				transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)	3	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)											0.235294	7.916586	8.989495	4	13	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	DNP	80728198	80728199	18287	10	CC	AG	AG	18	18	ZMIZ1	AG	5	3
IFIT5	24138	broad.mit.edu	36	10	91168257	91168257	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:91168257C>T	uc001kgk.1	+	c.1321C>T	c.(1321-1323)CTA>TTA	p.L441L		NM_012420	NP_036552	Q13325	IFIT5_HUMAN	interferon-induced protein with	441	TPR 8.						binding				0														0.286765	110.96768	116.516262	39	97	CC		KEEP	---	---	---	---	capture			Silent	SNP	91168257	91168257	7826	10	C	T	T	24	24	IFIT5	T	2	2
IFIT5	24138	broad.mit.edu	36	10	91168333	91168333	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:91168333C>T	uc001kgk.1	+	c.1397C>T	c.(1396-1398)CCA>CTA	p.P466L		NM_012420	NP_036552	Q13325	IFIT5_HUMAN	interferon-induced protein with	466	TPR 8.						binding				0														0.247191	57.408553	62.584541	22	67	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	91168333	91168333	7826	10	C	T	T	21	21	IFIT5	T	2	2
ARHGAP32	9743	broad.mit.edu	36	11	128347842	128347842	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:128347842C>A	uc009zcp.1	-	c.3727G>T	c.(3727-3729)GAT>TAT	p.D1243Y	ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.1_Missense_Mutation_p.D202Y|ARHGAP32_uc001qez.1_Missense_Mutation_p.D894Y	NM_014715	NP_055530	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 2	1243					cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5														0.127042	94.797009	169.589497	70	481	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128347842	128347842	893	11	C	A	A	31	31	ARHGAP32	A	3	3
OR5D13	390142	broad.mit.edu	36	11	55297801	55297801	+	Nonsense_Mutation	SNP	T	A	A			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55297801T>A	uc001nhu.1	+	c.312T>A	c.(310-312)TGT>TGA	p.C104*		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	104	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2		all_epithelial(135;0.196)												0.330508	104.684345	107.688937	39	79	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	55297801	55297801	11564	11	T	A	A	60	60	OR5D13	A	5	4
OR5T1	390155	broad.mit.edu	36	11	55800629	55800629	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55800629C>G	uc001nio.1	+	c.939C>G	c.(937-939)ATC>ATG	p.I313M		NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T,	313	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)	3	Esophageal squamous(21;0.00448)													0.302632	66.898988	69.540237	23	53	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55800629	55800629	11591	11	C	G	G	29	29	OR5T1	G	3	3
TNKS1BP1	85456	broad.mit.edu	36	11	56826647	56826647	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:56826647G>A	uc001njr.1	-	c.4545C>T	c.(4543-4545)GCC>GCT	p.A1515A	TNKS1BP1_uc001njp.1_Silent_p.A87A|TNKS1BP1_uc001njq.1_Silent_p.A87A|TNKS1BP1_uc001njs.1_Silent_p.A1515A	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	1515	Tankyrase-binding.|Acidic.				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)												0.215385	34.314464	39.174366	14	51	GG		KEEP	---	---	---	---	capture			Silent	SNP	56826647	56826647	16861	11	G	A	A	47	47	TNKS1BP1	A	2	2
MRGPRD	116512	broad.mit.edu	36	11	68504701	68504701	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:68504701C>A	uc001oon.1	-	c.331G>T	c.(331-333)GTG>TTG	p.V111L		NM_198923	NP_944605	Q8TDS7	MRGRD_HUMAN	MAS-related GPR, member D	111	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(1)	1			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)											0.14	9.898115	16.152888	7	43	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	68504701	68504701	10155	11	C	A	A	20	20	MRGPRD	A	3	3
NOX4	50507	broad.mit.edu	36	11	88817046	88817046	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:88817046C>T	uc001pct.1	-	c.352G>A	c.(352-354)GTG>ATG	p.V118M	NOX4_uc001pcx.1_Intron|NOX4_uc001pcu.1_Missense_Mutation_p.V44M|NOX4_uc001pcv.1_Missense_Mutation_p.V118M|NOX4_uc009yvo.1_Non-coding_Transcript|NOX4_uc009yvp.1_Missense_Mutation_p.V118M|NOX4_uc001pcw.1_Intron|NOX4_uc009yvq.1_Missense_Mutation_p.V94M|NOX4_uc009yvr.1_Missense_Mutation_p.V93M|NOX4_uc009yvs.1_Non-coding_Transcript	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	118	Helical; (Potential).|Ferric oxidoreductase.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|oxidation-reduction process|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)												0.192308	10.962862	13.259947	5	21	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88817046	88817046	10962	11	C	T	T	19	19	NOX4	T	1	1
TDG	6996	broad.mit.edu	36	12	102897919	102897919	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:102897919A>C	uc001tkg.1	+	c.347A>C	c.(346-348)GAA>GCA	p.E116A	TDG_uc009zuk.1_Missense_Mutation_p.E112A	NM_003211	NP_003202	Q13569	TDG_HUMAN	thymine-DNA glycosylase	116					depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(302;0.00114)										0.135593	7.76052	15.356806	8	51	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	102897919	102897919	16251	12	A	C	C	9	9	TDG	C	4	4
CIT	11113	broad.mit.edu	36	12	118612370	118612370	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:118612370G>A	uc001txj.1	-	c.6155C>T	c.(6154-6156)GCC>GTC	p.A2052V	CIT_uc001txh.1_Missense_Mutation_p.A1528V|CIT_uc001txi.1_Missense_Mutation_p.A2010V	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	2010					intracellular signal transduction|protein phosphorylation		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)					p.A2052V(AN3CA-Tumor)	1263				0.367647	70.355239	71.402831	25	43	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118612370	118612370	3573	12	G	A	A	42	42	CIT	A	2	2
POLE	5426	broad.mit.edu	36	12	131719336	131719336	+	Silent	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:131719336G>T	uc001uks.1	-	c.6123C>A	c.(6121-6123)GTC>GTA	p.V2041V	POLE_uc001ukq.1_Silent_p.V251V|POLE_uc001ukr.1_Silent_p.V845V	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA polymerase epsilon catalytic subunit	2041					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|lung(1)|central_nervous_system(1)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)										0.12069	11.494653	19.665822	7	51	GG		KEEP	---	---	---	---	capture			Silent	SNP	131719336	131719336	12624	12	G	T	T	37	37	POLE	T	3	3
LRRK2	120892	broad.mit.edu	36	12	39015186	39015186	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:39015186C>G	uc001rmg.2	+	c.5908C>G	c.(5908-5910)CTA>GTA	p.L1970V	LRRK2_uc009zjw.1_Missense_Mutation_p.L808V|LRRK2_uc001rmi.2_Missense_Mutation_p.L803V	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1970	Protein kinase.				activation of MAPKK activity|determination of adult lifespan|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(11)|lung(2)|upper_aerodigestive_tract(1)|large_intestine(1)|stomach(1)|urinary_tract(1)|pancreas(1)	18	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)								1771				0.632653	626.79801	631.34702	186	108	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39015186	39015186	9409	12	C	G	G	24	24	LRRK2	G	3	3
STAT2	6773	broad.mit.edu	36	12	55030186	55030186	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:55030186C>T	uc001slc.1	-	c.1171G>A	c.(1171-1173)GGG>AGG	p.G391R	STAT2_uc001slb.1_5'Flank|STAT2_uc001sld.1_Missense_Mutation_p.G387R	NM_005419	NP_005410	P52630	STAT2_HUMAN	signal transducer and activator of transcription	391					interspecies interaction between organisms|JAK-STAT cascade|regulation of transcription from RNA polymerase II promoter|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	cytosol|nucleoplasm|plasma membrane	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3														0.101695	12.108094	30.783504	12	106	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55030186	55030186	15785	12	C	T	T	22	22	STAT2	T	2	2
TMTC4	84899	broad.mit.edu	36	13	100076326	100076326	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:100076326C>T	uc001vot.1	-	c.1586G>A	c.(1585-1587)AGA>AAA	p.R529K	TMTC4_uc001vou.1_Missense_Mutation_p.R510K|TMTC4_uc001vov.1_Missense_Mutation_p.R255K|TMTC4_uc001vow.1_Missense_Mutation_p.R293K	NM_032813	NP_001073137	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat	510	TPR 2.					integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)													0.262431	263.944235	282.37445	95	267	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100076326	100076326	16804	13	C	T	T	24	24	TMTC4	T	2	2
TPTE2	93492	broad.mit.edu	36	13	18904630	18904630	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:18904630A>G	uc001umd.1	-	c.1205T>C	c.(1204-1206)ATT>ACT	p.I402T	TPTE2_uc001ume.1_Missense_Mutation_p.I325T|TPTE2_uc009zzl.1_Missense_Mutation_p.I291T|TPTE2_uc009zzm.1_Missense_Mutation_p.I73T|TPTE2_uc009zzk.1_Non-coding_Transcript	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	402	C2 tensin-type.					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)										0.68595	579.829419	587.276993	166	76	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18904630	18904630	16975	13	A	G	G	4	4	TPTE2	G	4	4
RFC3	5983	broad.mit.edu	36	13	33302865	33302865	+	Missense_Mutation	SNP	G	T	T	rs41553716	unknown	TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:33302865G>T	uc001uuz.1	+	c.583G>T	c.(583-585)GTG>TTG	p.V195L	RFC3_uc001uva.1_Missense_Mutation_p.V195L	NM_002915	NP_002906	P40938	RFC3_HUMAN	replication factor C 3 isoform 1	195					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|response to organophosphorus|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding				0		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)										0.166667	10.356523	13.517377	5	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33302865	33302865	13717	13	G	T	T	40	40	RFC3	T	3	3
LRCH1	23143	broad.mit.edu	36	13	46160016	46160016	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:46160016T>G	uc001vbk.1	+	c.851T>G	c.(850-852)TTT>TGT	p.F284C	LRCH1_uc010acp.1_Missense_Mutation_p.F284C|LRCH1_uc001vbj.1_Missense_Mutation_p.F284C|LRCH1_uc001vbl.2_Missense_Mutation_p.F284C	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)	284	LRR 9.									ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)										0.28	20.518833	21.603975	7	18	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46160016	46160016	9305	13	T	G	G	64	64	LRCH1	G	4	4
STK24	8428	broad.mit.edu	36	13	97925560	97925560	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:97925560T>C	uc001vnm.1	-	c.420A>G	c.(418-420)ATA>ATG	p.I140M	STK24_uc001vnn.1_Missense_Mutation_p.I128M	NM_003576	NP_003567	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24 isoform a	140	Protein kinase.				cellular component disassembly involved in apoptosis|protein phosphorylation|signal transduction	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)											0.285714	6.587701	7.16948	4	10	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	97925560	97925560	15813	13	T	C	C	57	57	STK24	C	4	4
CDC42BPB	9578	broad.mit.edu	36	14	102482618	102482618	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:102482618A>C	uc001ymi.1	-	c.3688T>G	c.(3688-3690)TTG>GTG	p.L1230V	CDC42BPB_uc001ymj.1_Missense_Mutation_p.L332V	NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta	1230					actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction|protein phosphorylation	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|lung(2)|ovary(1)|breast(1)|skin(1)	8		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)						1085				0.225806	8.793864	10.952724	7	24	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	102482618	102482618	3201	14	A	C	C	3	3	CDC42BPB	C	4	4
C14orf79	122616	broad.mit.edu	36	14	104524219	104524219	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:104524219G>A	uc001ypy.1	+	c.406G>A	c.(406-408)GCC>ACC	p.A136T	C14orf79_uc001ypz.1_Non-coding_Transcript	NM_174891	NP_777551	Q96F83	CN079_HUMAN	hypothetical protein LOC122616	136											0		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00326)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0181)											0.391304	50.53517	51.012433	18	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	104524219	104524219	1830	14	G	A	A	46	46	C14orf79	A	2	2
HSPA2	3306	broad.mit.edu	36	14	64077530	64077530	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:64077530C>T	uc001xhj.2	+	c.210C>T	c.(208-210)GAC>GAT	p.D70D	HSPA2_uc001xhk.2_Silent_p.D70D	NM_021979	NP_068814	P54652	HSP72_HUMAN	heat shock 70kDa protein 2	70					response to unfolded protein|spermatid development	cell surface	ATP binding|unfolded protein binding			skin(1)	1				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		Pancreas(136;1211 1835 24894 31984 38227)								0.375	16.84548	17.065145	6	10	CC		KEEP	---	---	---	---	capture			Silent	SNP	64077530	64077530	7710	14	C	T	T	19	19	HSPA2	T	1	1
PRTG	283659	broad.mit.edu	36	15	53719156	53719156	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:53719156G>A	uc002adg.1	-	c.2300C>T	c.(2299-2301)GCT>GTT	p.A767V		NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin	767	Fibronectin type-III 4.				multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)	2				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)										0.118421	41.080326	84.57789	36	268	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53719156	53719156	13089	15	G	A	A	34	34	PRTG	A	2	2
PRTG	283659	broad.mit.edu	36	15	53719245	53719245	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:53719245G>A	uc002adg.1	-	c.2211C>T	c.(2209-2211)TCC>TCT	p.S737S		NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin	737	Fibronectin type-III 4.				multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)	2				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)										0.107692	19.641027	49.402675	21	174	GG		KEEP	---	---	---	---	capture			Silent	SNP	53719245	53719245	13089	15	G	A	A	47	47	PRTG	A	2	2
IQCH	64799	broad.mit.edu	36	15	65555098	65555098	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:65555098C>T	uc002aqo.1	+	c.2687C>T	c.(2686-2688)ACC>ATC	p.T896I	IQCH_uc002aqq.1_Missense_Mutation_p.T553I|IQCH_uc002aqp.1_Missense_Mutation_p.T557I	NM_001031715	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H isoform 1	896										ovary(1)	1				Colorectal(3;0.0856)										0.44	98.959258	99.195036	33	42	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	65555098	65555098	8114	15	C	T	T	18	18	IQCH	T	2	2
ADPGK	83440	broad.mit.edu	36	15	70831762	70831762	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:70831762G>T	uc002avg.2	-	c.1467C>A	c.(1465-1467)TTC>TTA	p.F489L	ADPGK_uc002ave.2_Missense_Mutation_p.F214L|ADPGK_uc002avi.2_Missense_Mutation_p.F366L|ADPGK_uc002avf.2_Missense_Mutation_p.F488L|ADPGK_uc002avh.2_Missense_Mutation_p.F250L	NM_031284	NP_112574	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	489	ADPK.				glycolysis	extracellular region	ADP-specific glucokinase activity|metal ion binding				0														0.263158	11.965211	12.930304	5	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70831762	70831762	331	15	G	T	T	33	33	ADPGK	T	3	3
MAN2A2	4122	broad.mit.edu	36	15	89255159	89255159	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:89255159C>T	uc010bnz.1	+	c.1839C>T	c.(1837-1839)ACC>ACT	p.T613T	MAN2A2_uc002bqa.1_Non-coding_Transcript|MAN2A2_uc002bqb.1_Non-coding_Transcript|MAN2A2_uc002bqc.1_Silent_p.T613T|MAN2A2_uc010boa.1_Silent_p.T655T	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	613	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)											0.349206	65.63027	66.894671	22	41	CC		KEEP	---	---	---	---	capture			Silent	SNP	89255159	89255159	9598	15	C	T	T	24	24	MAN2A2	T	2	2
ADCY7	113	broad.mit.edu	36	16	48884854	48884854	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:48884854G>A	uc002egd.1	+	c.776G>A	c.(775-777)CGT>CAT	p.R259H	ADCY7_uc002egb.1_Missense_Mutation_p.R259H|ADCY7_uc002egc.1_Missense_Mutation_p.R259H	NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7	259	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding				0		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)									0.477477	168.370211	168.418856	53	58	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48884854	48884854	300	16	G	A	A	40	40	ADCY7	A	1	1
SLC6A2	6530	broad.mit.edu	36	16	54276616	54276616	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:54276616G>C	uc002eif.1	+	c.705G>C	c.(703-705)TGG>TGC	p.W235C	SLC6A2_uc010ccd.1_Missense_Mutation_p.W235C|SLC6A2_uc002eig.1_Missense_Mutation_p.W235C|SLC6A2_uc002eih.1_Missense_Mutation_p.W235C|SLC6A2_uc002eii.1_Missense_Mutation_p.W130C|SLC6A2_uc002eij.1_5'UTR	NM_001043	NP_001034	P23975	SC6A2_HUMAN	solute carrier family 6 member 2	235	Helical; Name=4; (Potential).				synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity			ovary(2)|pancreas(2)	4				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)									0.10219	9.152788	30.795098	14	123	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54276616	54276616	15180	16	G	C	C	42	42	SLC6A2	C	3	3
SF3B3	23450	broad.mit.edu	36	16	69120364	69120364	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:69120364T>A	uc002ezf.1	+	c.158T>A	c.(157-159)CTA>CAA	p.L53Q	SNORD111B_uc010cfv.1_5'Flank	NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3	53					nuclear mRNA splicing, via spliceosome|protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)												0.111111	8.81767	20.933076	9	72	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69120364	69120364	14641	16	T	A	A	53	53	SF3B3	A	4	4
IRF8	3394	broad.mit.edu	36	16	84500099	84500099	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:84500099C>T	uc002fjh.1	+	c.177C>T	c.(175-177)GCC>GCT	p.A59A	IRF8_uc002fji.2_Silent_p.A59A|IRF8_uc010chp.1_Non-coding_Transcript	NM_002163	NP_002154	Q02556	IRF8_HUMAN	interferon regulatory factor 8	59	IRF tryptophan pentad repeat.				interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(2)|ovary(1)	3		Prostate(104;0.0771)												0.585366	75.201815	75.462329	24	17	CC		KEEP	---	---	---	---	capture			Silent	SNP	84500099	84500099	8139	16	C	T	T	24	24	IRF8	T	2	2
TRIM16	10626	broad.mit.edu	36	17	15472977	15472977	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:15472977T>A	uc002gox.1	-	c.1372A>T	c.(1372-1374)AGT>TGT	p.S458C	TRIM16_uc002gor.1_Intron|TRIM16_uc002gow.1_Missense_Mutation_p.S242C|TRIM16_uc002goy.1_Missense_Mutation_p.S328C	NM_006470	NP_006461	O95361	TRI16_HUMAN	tripartite motif-containing 16	458	B30.2/SPRY.				histone H3 acetylation|histone H4 acetylation|positive regulation of gene-specific transcription|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|transcription activator activity|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)										0.149425	9.803165	20.097801	13	74	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15472977	15472977	17035	17	T	A	A	55	55	TRIM16	A	4	4
DPH1	1801	broad.mit.edu	36	17	1890614	1890614	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:1890614C>T	uc002fts.1	+	c.987C>T	c.(985-987)TTC>TTT	p.F329F	DPH1_uc002ftr.1_Non-coding_Transcript|DPH1_uc002ftt.1_Silent_p.F313F|DPH1_uc010cjx.1_Silent_p.F189F|DPH1_uc002ftu.1_Silent_p.F85F|DPH1_uc002ftv.1_Silent_p.F85F|DPH1_uc002ftw.2_Silent_p.F57F|OVCA2_uc002ftx.1_5'Flank	NM_001383	NP_001374	Q9BZG8	DPH1_HUMAN	diptheria toxin resistance protein required for	329					peptidyl-diphthamide biosynthetic process from peptidyl-histidine|translation	cytoplasm|nucleus				pancreas(1)	1														0.334532	266.680668	273.420804	93	185	CC		KEEP	---	---	---	---	capture			Silent	SNP	1890614	1890614	4903	17	C	T	T	30	30	DPH1	T	2	2
KCNJ12	3768	broad.mit.edu	36	17	21259981	21259981	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:21259981C>T	uc002gyv.1	+	c.734C>T	c.(733-735)CCG>CTG	p.P245L	KCNJ12_uc010cre.1_Missense_Mutation_p.P245L	NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	245	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)	3				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)						Prostate(3;0.18)			0.375	16.445855	16.665275	6	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	21259981	21259981	8351	17	C	T	T	23	23	KCNJ12	T	1	1
NF1	4763	broad.mit.edu	36	17	26582035	26582035	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:26582035C>T	uc002hgg.1	+	c.3163C>T	c.(3163-3165)CAA>TAA	p.Q1055*	NF1_uc002hgh.1_Nonsense_Mutation_p.Q1055*|NF1_uc002hgi.1_Nonsense_Mutation_p.Q88*|NF1_uc010csn.1_Nonsense_Mutation_p.Q915*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1055					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(3)		soft_tissue(155)|central_nervous_system(56)|large_intestine(27)|lung(19)|haematopoietic_and_lymphoid_tissue(13)|ovary(12)|autonomic_ganglia(7)|skin(3)|stomach(2)|breast(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	300		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)						847	TCGA GBM(6;<1E-8)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.489796	77.596225	77.600695	24	25	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	26582035	26582035	10756	17	C	T	T	21	21	NF1	T	5	2
CCT6B	10693	broad.mit.edu	36	17	30290380	30290380	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:30290380G>A	uc002hig.1	-	c.1148C>T	c.(1147-1149)ACT>ATT	p.T383I	CCT6B_uc010ctg.1_Missense_Mutation_p.T346I	NM_006584	NP_006575	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B	383					chaperone-mediated protein complex assembly|protein folding|spermatogenesis	cytoplasm	ATP binding|protein transporter activity|unfolded protein binding			pancreas(1)	1		Ovarian(249;0.17)												0.152672	37.816599	52.939684	20	111	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30290380	30290380	3085	17	G	A	A	36	36	CCT6B	A	2	2
HOXB1	3211	broad.mit.edu	36	17	43962031	43962031	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:43962031G>A	uc002ink.1	-	c.783C>T	c.(781-783)CGC>CGT	p.R261R		NM_002144	NP_002135	P14653	HXB1_HUMAN	homeobox B1	261	Homeobox.					nucleus	protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity			ovary(1)	1														0.326531	129.247252	133.172452	48	99	GG		KEEP	---	---	---	---	capture			Silent	SNP	43962031	43962031	7591	17	G	A	A	38	38	HOXB1	A	1	1
ABCC3	8714	broad.mit.edu	36	17	46116075	46116075	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:46116075G>A	uc002isl.1	+	c.3913G>A	c.(3913-3915)GTG>ATG	p.V1305M	ABCC3_uc002isn.1_Missense_Mutation_p.V59M	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3	1305	Cytoplasmic (By similarity).|ABC transporter 2.				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			central_nervous_system(1)	1			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)					438				0.21393	50.333186	65.642386	43	158	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46116075	46116075	55	17	G	A	A	44	44	ABCC3	A	2	2
PPM1E	22843	broad.mit.edu	36	17	54398032	54398032	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:54398032T>G	uc002iwx.1	+	c.779T>G	c.(778-780)CTA>CGA	p.L260R	PPM1E_uc010ddd.1_Intron	NM_014906	NP_055721	Q8WY54	PPM1E_HUMAN	protein phosphatase 1E	269	PP2C-like.				protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(3)|lung(1)	4	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)							128				0.277778	86.622095	91.409411	30	78	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54398032	54398032	12773	17	T	G	G	53	53	PPM1E	G	4	4
LLGL2	3993	broad.mit.edu	36	17	71081218	71081218	+	Silent	SNP	G	C	C			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71081218G>C	uc002joh.1	+	c.2787G>C	c.(2785-2787)GTG>GTC	p.V929V	LLGL2_uc002joi.1_Silent_p.V929V|LLGL2_uc010dgg.1_Silent_p.V929V|LLGL2_uc002joj.1_Silent_p.V918V	NM_001031803	NP_001026973	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 isoform c	929					cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding			ovary(2)	2	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)											0.833333	9.947353	10.531033	5	1	GG		KEEP	---	---	---	---	capture			Silent	SNP	71081218	71081218	9163	17	G	C	C	47	47	LLGL2	C	3	3
RHBDF2	79651	broad.mit.edu	36	17	71981335	71981335	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71981335T>G	uc002jrq.1	-	c.1810A>C	c.(1810-1812)ACC>CCC	p.T604P	RHBDF2_uc002jrp.1_Missense_Mutation_p.T575P|RHBDF2_uc002jrr.1_Missense_Mutation_p.T456P	NM_024599	NP_078875	Q6PJF5	RHDF2_HUMAN	rhomboid, veinlet-like 6 isoform 1	604	Lumenal (Potential).				negative regulation of protein secretion	endoplasmic reticulum membrane|integral to membrane	serine-type endopeptidase activity				0														0.75	9.727853	9.953132	3	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71981335	71981335	13795	17	T	G	G	59	59	RHBDF2	G	4	4
TP53	7157	broad.mit.edu	36	17	7520140	7520140	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7520140C>T	uc002gim.2	-	c.272G>A	c.(271-273)TGG>TAG	p.W91*	TP53_uc002gig.1_Nonsense_Mutation_p.W91*|TP53_uc002gih.1_Nonsense_Mutation_p.W91*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Nonsense_Mutation_p.W91*|TP53_uc010cni.1_Nonsense_Mutation_p.W91*|TP53_uc002gij.2_Nonsense_Mutation_p.W91*|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010cnk.1_Nonsense_Mutation_p.W106*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	91	Interaction with WWOX.		W -> C (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.0?(6)|p.W91*(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.D48fs*55(1)|p.A88fs*52(1)|p.W91fs*13(1)|p.P87fs*54(1)|p.P13fs*18(1)|p.S33fs*23(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		Pancreas(47;798 1329 9957 10801)		111		690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.608696	40.847276	41.085843	14	9	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	7520140	7520140	16923	17	C	T	T	21	21	TP53	T	5	2
NWD1	284434	broad.mit.edu	36	19	16735670	16735670	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:16735670C>T	uc002net.2	+	c.1760C>T	c.(1759-1761)ACG>ATG	p.T587M	NWD1_uc002neu.2_Missense_Mutation_p.T722M|NWD1_uc002nev.2_Missense_Mutation_p.T516M	NM_001007525	NP_001007526	Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	722							ATP binding			ovary(2)|pancreas(2)	4														0.326087	87.624953	90.090159	30	62	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16735670	16735670	11186	19	C	T	T	19	19	NWD1	T	1	1
IL12RB1	3594	broad.mit.edu	36	19	18047568	18047568	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:18047568C>T	uc002nhx.1	-	c.811G>A	c.(811-813)GTT>ATT	p.V271I	IL12RB1_uc002nhw.1_Missense_Mutation_p.V231I|IL12RB1_uc002nhy.1_Missense_Mutation_p.V231I	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1	231	Extracellular (Potential).|Fibronectin type-III 2.				cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1														0.3125	44.407888	45.909926	15	33	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18047568	18047568	7927	19	C	T	T	19	19	IL12RB1	T	1	1
PDE4C	5143	broad.mit.edu	36	19	18192288	18192288	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:18192288G>A	uc002nik.2	-	c.633C>T	c.(631-633)GAC>GAT	p.D211D	PDE4C_uc002nil.2_Silent_p.D211D|PDE4C_uc002nif.2_De_novo_Start_OutOfFrame|PDE4C_uc002nig.2_Intron|PDE4C_uc002nih.2_Intron|PDE4C_uc010ebk.1_Silent_p.D105D|PDE4C_uc002nii.2_Silent_p.D179D|PDE4C_uc010ebl.1_De_novo_Start_InFrame|PDE4C_uc010ebm.1_Non-coding_Transcript|PDE4C_uc002nim.1_Nonsense_Mutation_p.R195*	NM_000923	NP_001092289	Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific isoform	211				D -> Y (in Ref. 2; AAD47053/AAD47054).	signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Dyphylline(DB00651)									0.285714	10.394766	10.971481	4	10	GG		KEEP	---	---	---	---	capture			Silent	SNP	18192288	18192288	12062	19	G	A	A	40	40	PDE4C	A	1	1
ZNF626	199777	broad.mit.edu	36	19	20600080	20600080	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:20600080T>C	uc002npb.1	-	c.443A>G	c.(442-444)GAT>GGT	p.D148G	ZNF626_uc002npc.1_Missense_Mutation_p.D72G	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	148					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0														0.315789	17.143573	17.71686	6	13	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20600080	20600080	18645	19	T	C	C	50	50	ZNF626	C	4	4
FSD1	79187	broad.mit.edu	36	19	4262860	4262860	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:4262860A>G	uc002lzy.1	+	c.512A>G	c.(511-513)GAC>GGC	p.D171G	FSD1_uc002lzz.1_Missense_Mutation_p.D171G|FSD1_uc002maa.1_5'UTR	NM_024333	NP_077309	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing	171	Fibronectin type-III.				cell division|mitosis	cleavage furrow|microtubule|microtubule organizing center|nucleus					0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)										0.206897	8.027204	10.346699	6	23	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4262860	4262860	6320	19	A	G	G	10	10	FSD1	G	4	4
TMEM143	55260	broad.mit.edu	36	19	53528356	53528356	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:53528356T>G	uc002pix.1	-	c.1312A>C	c.(1312-1314)AAA>CAA	p.K438Q	TMEM143_uc002piw.1_Non-coding_Transcript|TMEM143_uc002piy.1_Missense_Mutation_p.K403Q|TMEM143_uc010elw.1_Missense_Mutation_p.K338Q	NM_018273	NP_060743	Q96AN5	TM143_HUMAN	transmembrane protein 143	438						integral to membrane|mitochondrion					0		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)										0.25	6.390434	7.302296	4	12	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53528356	53528356	16589	19	T	G	G	63	63	TMEM143	G	4	4
SYT5	6861	broad.mit.edu	36	19	60381425	60381425	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:60381425T>C	uc002qjm.1	-	c.203A>G	c.(202-204)CAG>CGG	p.Q68R	SYT5_uc002qjn.1_Missense_Mutation_p.Q68R|SYT5_uc002qjo.1_Missense_Mutation_p.Q68R|SYT5_uc002qjp.1_Intron	NM_003180	NP_003171	O00445	SYT5_HUMAN	synaptotagmin V	68	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion|synaptic transmission	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane	metal ion binding|transporter activity				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)										0.363636	7.18822	7.3715	4	7	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60381425	60381425	15998	19	T	C	C	55	55	SYT5	C	4	4
MUC16	94025	broad.mit.edu	36	19	8929683	8929683	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:8929683G>C	uc002mkp.1	-	c.18763C>G	c.(18763-18765)CCC>GCC	p.P6255A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6257	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			ovary(15)|large_intestine(1)|pancreas(1)|breast(1)|skin(1)	19														0.12035	71.986386	136.525125	55	402	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8929683	8929683	10367	19	G	C	C	44	44	MUC16	C	3	3
MUC16	94025	broad.mit.edu	36	19	8943506	8943506	+	Silent	SNP	T	C	C			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:8943506T>C	uc002mkp.1	-	c.9309A>G	c.(9307-9309)GAA>GAG	p.E3103E		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3104	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			ovary(15)|large_intestine(1)|pancreas(1)|breast(1)|skin(1)	19														0.385204	475.956792	480.476008	151	241	TT		KEEP	---	---	---	---	capture			Silent	SNP	8943506	8943506	10367	19	T	C	C	56	56	MUC16	C	4	4
MOV10	4343	broad.mit.edu	36	1	113040899	113040899	+	Silent	SNP	G	C	C			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:113040899G>C	uc001eck.1	+	c.2106G>C	c.(2104-2106)CTG>CTC	p.L702L	MOV10_uc001ecl.1_Intron|MOV10_uc001ecm.1_Silent_p.L642L|MOV10_uc001ecn.1_Silent_p.L702L|MOV10_uc001eco.1_Silent_p.L702L	NM_020963	NP_066014	Q9HCE1	MOV10_HUMAN	Mov10, Moloney leukemia virus 10, homolog	702					mRNA cleavage involved in gene silencing by miRNA|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body	ATP binding|helicase activity|protein binding|RNA binding			ovary(4)	4	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)										0.16129	19.110469	25.880416	10	52	GG		KEEP	---	---	---	---	capture			Silent	SNP	113040899	113040899	10110	1	G	C	C	46	46	MOV10	C	3	3
PTGFRN	5738	broad.mit.edu	36	1	117293609	117293609	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:117293609G>A	uc001egv.1	+	c.1105G>A	c.(1105-1107)GGC>AGC	p.G369S		NM_020440	NP_065173	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor negative regulator	369	Ig-like C2-type 3.|Extracellular (Potential).					endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	protein binding			liver(1)	1	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)										0.601449	521.954105	524.434555	166	110	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	117293609	117293609	13205	1	G	A	A	47	47	PTGFRN	A	2	2
VPS72	6944	broad.mit.edu	36	1	149415849	149415849	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:149415849A>T	uc001exe.1	-	c.990T>A	c.(988-990)CAT>CAA	p.H330Q	TMOD4_uc001exd.1_5'Flank|TMOD4_uc001exc.2_5'Flank	NM_005997	NP_005988	Q15906	VPS72_HUMAN	transcription factor-like 1	330					chromatin modification|negative regulation of transcription from RNA polymerase II promoter	nucleus|protein complex	DNA binding|RNA polymerase II transcription factor activity|sequence-specific DNA binding transcription factor activity			breast(1)|pancreas(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			Pancreas(109;1131 2287 3209 24201)								0.294118	12.570666	13.214294	5	12	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	149415849	149415849	17784	1	A	T	T	8	8	VPS72	T	4	4
UBE2Q1	55585	broad.mit.edu	36	1	152794616	152794616	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:152794616T>A	uc001fff.1	-	c.449A>T	c.(448-450)AAG>ATG	p.K150M		NM_017582	NP_060052	Q7Z7E8	UB2Q1_HUMAN	ubiquitin-conjugating enzyme E2Q	150					post-translational protein modification		ATP binding|protein binding|ubiquitin-protein ligase activity				0	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)											0.179104	13.053695	19.568582	12	55	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	152794616	152794616	17426	1	T	A	A	56	56	UBE2Q1	A	4	4
DUSP27	92235	broad.mit.edu	36	1	165355273	165355273	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:165355273C>T	uc001geb.1	+	c.601C>T	c.(601-603)CAG>TAG	p.Q201*		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	201	Tyrosine-protein phosphatase.				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3														0.349091	264.488481	270.027019	96	179	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	165355273	165355273	5009	1	C	T	T	21	21	DUSP27	T	5	2
NADK	65220	broad.mit.edu	36	1	1676777	1676777	+	Splice_Site_SNP	SNP	T	A	A			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:1676777T>A	uc001aie.1	-	c.e9_splice_site			NADK_uc009vkw.1_Splice_Site_SNP|NADK_uc001aic.1_Splice_Site_SNP|NADK_uc001aid.2_Splice_Site_SNP|NADK_uc009vkx.1_Splice_Site_SNP	NM_023018	NP_075394			NAD kinase						ATP metabolic process|NAD metabolic process|water-soluble vitamin metabolic process	cytosol	ATP binding|metal ion binding|NAD+ kinase activity|protein binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)										0.277778	6.849304	7.66353	5	13	TT		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	1676777	1676777	10533	1	T	A	A	55	55	NADK	A	5	4
SCYL3	57147	broad.mit.edu	36	1	168090608	168090608	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:168090608C>T	uc001ggs.2	-	c.1596G>A	c.(1594-1596)TGG>TGA	p.W532*	SCYL3_uc001ggt.2_Nonsense_Mutation_p.W478*|SCYL3_uc001ggu.2_Non-coding_Transcript	NM_181093	NP_851607	Q8IZE3	PACE1_HUMAN	SCY1-like 3 isoform 2	532					cell migration|protein phosphorylation	Golgi apparatus|lamellipodium	ATP binding|protein binding|protein kinase activity			ovary(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)									1996				0.393617	111.753665	112.685069	37	57	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	168090608	168090608	14434	1	C	T	T	30	30	SCYL3	T	5	2
FAM129A	116496	broad.mit.edu	36	1	183030767	183030767	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:183030767C>T	uc001gra.1	-	c.2754G>A	c.(2752-2754)CAG>CAA	p.Q918Q	FAM129A_uc001grb.1_Intron	NM_052966	NP_443198	Q9BZQ8	NIBAN_HUMAN	niban protein isoform 2	918					negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)	3														0.516827	711.631359	711.734099	215	201	CC		KEEP	---	---	---	---	capture			Silent	SNP	183030767	183030767	5633	1	C	T	T	24	24	FAM129A	T	2	2
LRRN2	10446	broad.mit.edu	36	1	202855558	202855558	+	Silent	SNP	T	G	G			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:202855558T>G	uc001hbe.1	-	c.186A>C	c.(184-186)GCA>GCC	p.A62A	MDM4_uc001hbc.2_Intron|MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Silent_p.A62A|LRRN2_uc009xbf.1_Silent_p.A62A|LRRN2_uc001hbg.2_Silent_p.A62A	NM_006338	NP_963924	O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	62	Extracellular (Potential).|LRRNT.				cell adhesion	integral to membrane	receptor activity			central_nervous_system(2)	2	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)											0.416667	11.069405	11.142786	5	7	TT		KEEP	---	---	---	---	capture			Silent	SNP	202855558	202855558	9411	1	T	G	G	55	55	LRRN2	G	4	4
ITPKB	3707	broad.mit.edu	36	1	224903096	224903096	+	Splice_Site_SNP	SNP	C	A	A			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:224903096C>A	uc001hqg.1	-	c.e2_splice_site				NM_002221	NP_002212			1D-myo-inositol-trisphosphate 3-kinase B								ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity			ovary(4)|central_nervous_system(1)	5		Prostate(94;0.0773)				Colon(84;110 1851 5306 33547)								0.102902	23.861949	83.442185	39	340	CC		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	224903096	224903096	8222	1	C	A	A	32	32	ITPKB	A	5	3
ZBTB40	9923	broad.mit.edu	36	1	22689401	22689401	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:22689401G>T	uc001bft.2	+	c.373G>T	c.(373-375)GTG>TTG	p.V125L	ZBTB40_uc001bfu.2_Missense_Mutation_p.V125L|ZBTB40_uc009vqi.1_Missense_Mutation_p.V125L	NM_001083621	NP_055685	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	125					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)										0.096774	7.609616	32.875597	15	140	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22689401	22689401	18128	1	G	T	T	44	44	ZBTB40	T	3	3
AGT	183	broad.mit.edu	36	1	228908351	228908351	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:228908351G>T	uc001hty.2	-	c.1075C>A	c.(1075-1077)CTC>ATC	p.L359I	AGT_uc009xfe.1_Missense_Mutation_p.L359I|AGT_uc009xff.1_Missense_Mutation_p.L331I	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein	359					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|oxygen and reactive oxygen species metabolic process|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of gene-specific transcription|positive regulation of inflammatory response|positive regulation of macrophage derived foam cell differentiation|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|regulation of natriuresis|regulation of proteolysis|regulation of renal output by angiotensin|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)									0.10084	6.812684	25.749624	12	107	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	228908351	228908351	402	1	G	T	T	33	33	AGT	T	3	3
AGT	183	broad.mit.edu	36	1	228912817	228912817	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:228912817A>T	uc001hty.2	-	c.403T>A	c.(403-405)TCC>ACC	p.S135T	AGT_uc009xfe.1_Missense_Mutation_p.S135T|AGT_uc009xff.1_Missense_Mutation_p.S107T	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein	135					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|oxygen and reactive oxygen species metabolic process|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of gene-specific transcription|positive regulation of inflammatory response|positive regulation of macrophage derived foam cell differentiation|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|regulation of natriuresis|regulation of proteolysis|regulation of renal output by angiotensin|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)									0.194444	7.996678	11.147061	7	29	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	228912817	228912817	402	1	A	T	T	11	11	AGT	T	4	4
EPHB2	2048	broad.mit.edu	36	1	23092001	23092001	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:23092001C>T	uc009vqj.1	+	c.1466C>T	c.(1465-1467)CCC>CTC	p.P489L	EPHB2_uc001bge.1_Missense_Mutation_p.P489L|EPHB2_uc001bgf.1_Missense_Mutation_p.P489L	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor	489	Fibronectin type-III 2.|Extracellular (Potential).				axon guidance|protein phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)						437				0.180556	50.655039	64.488385	26	118	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23092001	23092001	5368	1	C	T	T	22	22	EPHB2	T	2	2
OR2M4	26245	broad.mit.edu	36	1	246469554	246469554	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:246469554G>A	uc001iec.1	+	c.701G>A	c.(700-702)CGT>CAT	p.R234H		NM_017504	NP_059974	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M,	234	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(2)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)											0.568627	375.92548	376.766981	116	88	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	246469554	246469554	11418	1	G	A	A	40	40	OR2M4	A	1	1
PUM1	9698	broad.mit.edu	36	1	31182211	31182211	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:31182211C>T	uc001bsk.1	-	c.3409G>A	c.(3409-3411)GAT>AAT	p.D1137N	PUM1_uc001bsf.1_Missense_Mutation_p.D767N|PUM1_uc001bsg.1_Missense_Mutation_p.D833N|PUM1_uc001bsh.1_Missense_Mutation_p.D1101N|PUM1_uc001bsi.1_Missense_Mutation_p.D1099N|PUM1_uc001bsj.1_Missense_Mutation_p.D1075N|SNORD103A_uc009vts.1_Intron	NM_001020658	NP_001018494	Q14671	PUM1_HUMAN	pumilio 1 isoform 1	1099	PUM-HD.|Pumilio 7.				cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)										0.174274	75.056505	99.276702	42	199	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31182211	31182211	13283	1	C	T	T	31	31	PUM1	T	1	1
ZNF642	339559	broad.mit.edu	36	1	40733928	40733928	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:40733928C>T	uc001cfo.1	+	c.1191C>T	c.(1189-1191)CAC>CAT	p.H397H	ZNF642_uc009vwb.1_Silent_p.H397H	NM_198494	NP_940896	Q49AA0	ZN642_HUMAN	zinc finger protein 642	397	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.81e-19)											0.210526	19.778994	22.724703	8	30	CC		KEEP	---	---	---	---	capture			Silent	SNP	40733928	40733928	18653	1	C	T	T	18	18	ZNF642	T	2	2
FPGT	8790	broad.mit.edu	36	1	74443487	74443487	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:74443487C>T	uc001dgb.1	+	c.1168C>T	c.(1168-1170)CCA>TCA	p.P390S	TNNI3K_uc001dgc.1_Intron|TNNI3K_uc001dgd.2_Intron|TNNI3K_uc001dge.1_Intron	NM_003838	NP_003829	O14772	FPGT_HUMAN	fucose-1-phosphate guanyltransferase	390					fucose metabolic process	cytoplasm	fucose-1-phosphate guanylyltransferase activity|GTP binding				0														0.174603	44.972826	57.564247	22	104	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74443487	74443487	6283	1	C	T	T	30	30	FPGT	T	2	2
RRBP1	6238	broad.mit.edu	36	20	17543405	17543405	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:17543405G>T	uc002wpv.1	-	c.2872C>A	c.(2872-2874)CTG>ATG	p.L958M	RRBP1_uc002wpu.2_Missense_Mutation_p.L732M|RRBP1_uc002wpw.1_Missense_Mutation_p.L958M|RRBP1_uc010gcl.1_Missense_Mutation_p.L732M|RRBP1_uc002wpt.1_Missense_Mutation_p.L328M	NM_001042576	NP_004578	Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	1391	Cytoplasmic (Potential).				protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1														0.131148	41.343713	73.631492	32	212	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17543405	17543405	14158	20	G	T	T	34	34	RRBP1	T	3	3
SIGLEC1	6614	broad.mit.edu	36	20	3623425	3623425	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:3623425G>A	uc002wja.1	-	c.2829C>T	c.(2827-2829)GCC>GCT	p.A943A	SIGLEC1_uc002wiz.2_Silent_p.A943A|SIGLEC1_uc002wjb.1_5'Flank	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	943	Ig-like C2-type 9.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|breast(1)|central_nervous_system(1)	8														0.333333	8.560246	8.934141	5	10	GG		KEEP	---	---	---	---	capture			Silent	SNP	3623425	3623425	14800	20	G	A	A	47	47	SIGLEC1	A	2	2
YTHDF1	54915	broad.mit.edu	36	20	61305147	61305148	+	Missense_Mutation	DNP	GA	AG	AG			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:61305147_61305148GA>AG	uc002yeh.1	-	c.589_590TC>CT	c.(589-591)TCC>CTC	p.S197L		NM_017798	NP_060268	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	197										ovary(2)	2														0.210526	11.972425	14.927913	8	30	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	61305147	61305148	18081	20	GA	AG	AG	41	41	YTHDF1	AG	2	2
DOPEY2	9980	broad.mit.edu	36	21	36539574	36539574	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:36539574G>A	uc002yvg.1	+	c.3426G>A	c.(3424-3426)GAG>GAA	p.E1142E	DOPEY2_uc002yvh.2_5'UTR	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	1142					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2														0.5	9.996912	9.996912	4	4	GG		KEEP	---	---	---	---	capture			Silent	SNP	36539574	36539574	4892	21	G	A	A	33	33	DOPEY2	A	2	2
HLCS	3141	broad.mit.edu	36	21	37230897	37230897	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:37230897C>T	uc010gnb.1	-	c.718G>A	c.(718-720)GGA>AGA	p.G240R	HLCS_uc002yvs.1_Missense_Mutation_p.G240R|HLCS_uc010gnc.1_Missense_Mutation_p.G387R	NM_000411	NP_000402	P50747	BPL1_HUMAN	holocarboxylase synthetase	240					cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)									0.282051	147.943845	156.2674	55	140	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37230897	37230897	7504	21	C	T	T	22	22	HLCS	T	2	2
TRAPPC10	7109	broad.mit.edu	36	21	44323876	44323876	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:44323876G>A	uc002zea.1	+	c.1473G>A	c.(1471-1473)AGG>AGA	p.R491R	TRAPPC10_uc010gpo.1_Silent_p.R202R	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	491					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2														0.316667	54.308378	56.099117	19	41	GG		KEEP	---	---	---	---	capture			Silent	SNP	44323876	44323876	17001	21	G	A	A	41	41	TRAPPC10	A	2	2
TXNRD2	10587	broad.mit.edu	36	22	18250944	18250944	+	Silent	SNP	A	C	C			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:18250944A>C	uc002zqk.1	-	c.990T>G	c.(988-990)GCT>GCG	p.A330A	TXNRD2_uc002zqj.1_Non-coding_Transcript|TXNRD2_uc002zqm.1_Non-coding_Transcript|TXNRD2_uc002zqn.1_Non-coding_Transcript|TXNRD2_uc002zqo.1_Non-coding_Transcript|TXNRD2_uc002zql.1_Silent_p.A84A|TXNRD2_uc002zqp.1_Non-coding_Transcript|TXNRD2_uc002zqq.1_5'Flank|TXNRD2_uc002zqr.1_Silent_p.A329A	NM_006440		Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2 precursor	330					cell redox homeostasis|oxidation-reduction process|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)													0.285714	7.695216	8.271983	4	10	AA		KEEP	---	---	---	---	capture			Silent	SNP	18250944	18250944	17364	22	A	C	C	7	7	TXNRD2	C	4	4
CABIN1	23523	broad.mit.edu	36	22	22839704	22839704	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:22839704C>T	uc002zzi.1	+	c.4289C>T	c.(4288-4290)ACA>ATA	p.T1430I	CABIN1_uc002zzj.1_Missense_Mutation_p.T1351I|CABIN1_uc002zzl.1_Missense_Mutation_p.T1430I	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1430					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.219512	11.366181	14.337385	9	32	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22839704	22839704	2644	22	C	T	T	17	17	CABIN1	T	2	2
SF3A1	10291	broad.mit.edu	36	22	29063096	29063097	+	Missense_Mutation	DNP	GG	CT	CT			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:29063096_29063097GG>CT	uc003ahl.1	-	c.2024_2025CC>AG	c.(2023-2025)CCC>CAG	p.P675Q		NM_005877	NP_005868	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa isoform 1	675	Poly-Pro.				nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding			ovary(3)|large_intestine(1)|pancreas(1)	5														0.215686	14.292673	18.111367	11	40	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	29063096	29063097	14635	22	GG	CT	CT	47	47	SF3A1	CT	3	3
TMPRSS6	164656	broad.mit.edu	36	22	35796580	35796580	+	Silent	SNP	A	C	C			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:35796580A>C	uc003aqt.1	-	c.1731T>G	c.(1729-1731)GGT>GGG	p.G577G	TMPRSS6_uc003aqs.1_Silent_p.G586G	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	586	Peptidase S1.|Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)	5														0.2	10.821113	14.637246	9	36	AA		KEEP	---	---	---	---	capture			Silent	SNP	35796580	35796580	16792	22	A	C	C	6	6	TMPRSS6	C	4	4
PNPLA3	80339	broad.mit.edu	36	22	42654313	42654313	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr22:42654313T>C	uc003bei.1	+	c.353T>C	c.(352-354)CTT>CCT	p.L118P	PNPLA3_uc010gzm.1_Non-coding_Transcript	NM_025225	NP_079501	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	118	Lumenal (Potential).|Patatin.				triglyceride biosynthetic process|triglyceride catabolic process	integral to membrane	diolein transacylation activity|mono-olein transacylation activity|phospholipase A2 activity|triglyceride lipase activity				0		Ovarian(80;0.024)|all_neural(38;0.0416)												0.256494	207.08632	223.646136	79	229	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42654313	42654313	12593	22	T	C	C	56	56	PNPLA3	C	4	4
SLC9A4	389015	broad.mit.edu	36	2	102486534	102486534	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:102486534G>A	uc002tbz.2	+	c.916G>A	c.(916-918)GTC>ATC	p.V306I		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	306	Helical; Name=I/M7; (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			central_nervous_system(1)	1														0.189474	34.299792	42.869849	18	77	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	102486534	102486534	15213	2	G	A	A	40	40	SLC9A4	A	1	1
POTEF	728378	broad.mit.edu	36	2	130559985	130559985	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:130559985G>A	uc010fmh.1	-	c.1650C>T	c.(1648-1650)GTC>GTT	p.V550V	POTEF_uc010fmg.1_Silent_p.V14V|POTEF_uc010fmi.1_Non-coding_Transcript|POTEF_uc010fmj.1_Non-coding_Transcript	NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	550						cell cortex	ATP binding			ovary(2)|skin(1)	3														0.269231	20.213373	21.462797	7	19	GG		KEEP	---	---	---	---	capture			Silent	SNP	130559985	130559985	12695	2	G	A	A	37	37	POTEF	A	1	1
GRB14	2888	broad.mit.edu	36	2	165091810	165091810	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:165091810C>T	uc002ucl.1	-	c.563G>A	c.(562-564)AGA>AAA	p.R188K	GRB14_uc002ucm.1_Non-coding_Transcript|GRB14_uc010fpf.1_Non-coding_Transcript	NM_004490	NP_004481	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	188	Ras-associating.				blood coagulation|leukocyte migration	cytosol|endosome membrane|Golgi membrane|microsome|plasma membrane	SH3/SH2 adaptor activity			ovary(5)|lung(1)	6														0.2	36.693163	44.23406	18	72	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	165091810	165091810	7034	2	C	T	T	32	32	GRB14	T	2	2
LRP2	4036	broad.mit.edu	36	2	169804484	169804484	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:169804484C>A	uc002ues.1	-	c.4093G>T	c.(4093-4095)GTT>TTT	p.V1365F		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1365	Extracellular (Potential).|EGF-like 5.				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	23				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)					2055				0.151163	87.368427	127.492912	52	292	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	169804484	169804484	9329	2	C	A	A	17	17	LRP2	A	3	3
GLS	2744	broad.mit.edu	36	2	191526598	191526598	+	Splice_Site_SNP	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:191526598G>T	uc002usf.2	+	c.e15_splice_site			GLS_uc002ush.2_Splice_Site_SNP	NM_014905	NP_055720			glutaminase						cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)									0.333333	558.815311	572.92084	191	382	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	191526598	191526598	6731	2	G	T	T	44	44	GLS	T	5	3
GTF3C3	9330	broad.mit.edu	36	2	197344726	197344726	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:197344726G>T	uc002uts.1	-	c.2251C>A	c.(2251-2253)CAT>AAT	p.H751N		NM_012086	NP_036218	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide	751	TPR 10.				5S class rRNA transcription from RNA polymerase III type 1 promoter|tRNA transcription from RNA polymerase III promoter	transcription factor TFIIIC complex	DNA binding|protein binding			ovary(3)|breast(3)|pancreas(1)	7														0.146853	33.479733	50.623287	21	122	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	197344726	197344726	7154	2	G	T	T	46	46	GTF3C3	T	3	3
CRYBA2	1412	broad.mit.edu	36	2	219563919	219563919	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:219563919G>A	uc002vjj.1	-	c.345C>T	c.(343-345)AAC>AAT	p.N115N	CRYBA2_uc002vjk.1_Silent_p.N115N	NM_057094	NP_476435	P53672	CRBA2_HUMAN	crystallin, beta A2	115	Beta/gamma crystallin 'Greek key' 3.						structural constituent of eye lens				0		Renal(207;0.0474)		Epithelial(149;9.77e-07)|all cancers(144;0.000167)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.457627	85.920185	86.01219	27	32	GG		KEEP	---	---	---	---	capture			Silent	SNP	219563919	219563919	4047	2	G	A	A	36	36	CRYBA2	A	2	2
CCDC108	255101	broad.mit.edu	36	2	219582906	219582910	+	Missense	Complex_substitution	ACCNC	GAGNT	GAGNT			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:219582906_219582908ACC>GAG	uc002vjl.1	-	c.e27_splice_site				NM_194302	NP_919278			coiled-coil domain containing 108 isoform 1							integral to membrane	structural molecule activity			ovary(2)|pancreas(1)	3		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.8	8.634698	9.009837	4	1	AA		KEEP	---	---	---	---	capture			Missense	Complex_substitution	219582906	219582910	2863	2	ACCNC	GAGNT	GAGNT	6	6	CCDC108	GAGNT	5	5
ACSL3	2181	broad.mit.edu	36	2	223497418	223497418	+	Nonsense_Mutation	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:223497418G>T	uc002vni.1	+	c.1153G>T	c.(1153-1155)GAA>TAA	p.E385*	ACSL3_uc002vnj.1_Nonsense_Mutation_p.E385*	NM_004457	NP_976251	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	385	Cytoplasmic (Potential).				long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|fatty-acyl-CoA synthase activity|long-chain fatty acid-CoA ligase activity|protein binding			ovary(2)	2		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)									0.277778	7.457152	8.265158	5	13	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	223497418	223497418	179	2	G	T	T	41	41	ACSL3	T	5	3
GALNT14	79623	broad.mit.edu	36	2	30988637	30988637	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:30988637C>T	uc002rns.1	-	c.1471G>A	c.(1471-1473)GCC>ACC	p.A491T	GALNT14_uc002rnq.1_Missense_Mutation_p.A466T|GALNT14_uc002rnr.1_Missense_Mutation_p.A486T	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	486	Lumenal (Potential).|Ricin B-type lectin.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	Acute lymphoblastic leukemia(172;0.155)													0.138614	22.486876	35.236642	14	87	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30988637	30988637	6476	2	C	T	T	27	27	GALNT14	T	1	1
CD96	10225	broad.mit.edu	36	3	112838753	112838753	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:112838753G>A	uc003dxw.1	+	c.1390G>A	c.(1390-1392)GAA>AAA	p.E464K	CD96_uc003dxx.1_Missense_Mutation_p.E448K|CD96_uc010hpy.1_Missense_Mutation_p.E447K	NM_198196	NP_937839	P40200	TACT_HUMAN	CD96 antigen isoform 1 precursor	464	Extracellular (Potential).|Pro/Ser/Thr-rich.				cell adhesion|immune response|regulation of immune response	integral to plasma membrane				central_nervous_system(1)	1														0.647059	33.225721	33.549968	11	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	112838753	112838753	3176	3	G	A	A	45	45	CD96	A	2	2
UMPS	7372	broad.mit.edu	36	3	125939205	125939205	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:125939205G>A	uc003ehl.2	+	c.411G>A	c.(409-411)GAG>GAA	p.E137E	UMPS_uc003ehm.2_Non-coding_Transcript|UMPS_uc003ehn.2_5'UTR	NM_000373	NP_000364	P11172	PYR5_HUMAN	uridine monophosphate synthase	137	OPRTase.				'de novo' pyrimidine base biosynthetic process|'de novo' UMP biosynthetic process|pyrimidine nucleoside biosynthetic process	cytosol|nucleus	orotate phosphoribosyltransferase activity|orotidine-5'-phosphate decarboxylase activity			kidney(1)	1				GBM - Glioblastoma multiforme(114;0.146)										0.387324	322.06684	325.231243	110	174	GG		KEEP	---	---	---	---	capture			Silent	SNP	125939205	125939205	17539	3	G	A	A	35	35	UMPS	A	2	2
CLCN2	1181	broad.mit.edu	36	3	185558729	185558730	+	Missense_Mutation	DNP	GT	TG	TG			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:185558729_185558730GT>TG	uc003foi.2	-	c.415_416AC>CA	c.(415-417)ACC>CAC	p.T139H	CLCN2_uc003foh.2_5'Flank|CLCN2_uc010hya.1_Missense_Mutation_p.T139H	NM_004366	NP_004357	P51788	CLCN2_HUMAN	chloride channel 2	139	Helical; (By similarity).					chloride channel complex	voltage-gated chloride channel activity				0	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)									0.266667	6.788858	7.530469	4	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	185558729	185558730	3599	3	GT	TG	TG	44	44	CLCN2	TG	3	3
ZNF619	285267	broad.mit.edu	36	3	40504508	40504508	+	Silent	SNP	C	G	G			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:40504508C>G	uc010hhz.1	+	c.1476C>G	c.(1474-1476)CTC>CTG	p.L492L	ZNF619_uc003ckj.1_Silent_p.L485L	NM_173656	NP_775927	C9JRN5	C9JRN5_HUMAN	zinc finger protein 619 isoform 4	501					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)										0.636364	135.352973	136.430306	42	24	CC		KEEP	---	---	---	---	capture			Silent	SNP	40504508	40504508	18638	3	C	G	G	32	32	ZNF619	G	3	3
TRIM2	23321	broad.mit.edu	36	4	154411097	154411097	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:154411097C>T	uc003ing.1	+	c.110C>T	c.(109-111)CCC>CTC	p.P37L	TRIM2_uc003inh.1_Missense_Mutation_p.P37L|TRIM2_uc003ini.1_Missense_Mutation_p.P55L	NM_015271	NP_056086	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 1	37	RING-type.					cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)										0.514286	181.153823	181.172672	54	51	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	154411097	154411097	17038	4	C	T	T	22	22	TRIM2	T	2	2
WDR17	116966	broad.mit.edu	36	4	177306448	177306448	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:177306448A>G	uc003iuj.1	+	c.1937A>G	c.(1936-1938)GAT>GGT	p.D646G	WDR17_uc003iuk.1_Missense_Mutation_p.D622G|WDR17_uc003ium.2_Missense_Mutation_p.D622G|WDR17_uc003iul.1_Intron|WDR17_uc003iun.1_5'Flank	NM_170710	NP_851782	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	646	WD 11.									ovary(2)|pancreas(1)	3		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)										0.859155	217.312595	226.145912	61	10	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	177306448	177306448	17850	4	A	G	G	12	12	WDR17	G	4	4
TLR3	7098	broad.mit.edu	36	4	187237054	187237054	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:187237054C>T	uc003iyq.1	+	c.508C>T	c.(508-510)CTG>TTG	p.L170L		NM_003265	NP_003256	O15455	TLR3_HUMAN	toll-like receptor 3	170	Lumenal (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|defense response to bacterium|defense response to virus|detection of virus|hyperosmotic response|I-kappaB phosphorylation|inflammatory response|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of osteoclast differentiation|positive regulation of chemokine production|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of inflammatory response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of toll-like receptor signaling pathway|positive regulation of tumor necrosis factor production|toll-like receptor 3 signaling pathway	endoplasmic reticulum membrane|endosome membrane|integral to plasma membrane	double-stranded RNA binding|transmembrane receptor activity			ovary(2)	2		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)						155				0.303571	88.207044	92.064972	34	78	CC		KEEP	---	---	---	---	capture			Silent	SNP	187237054	187237054	16482	4	C	T	T	28	28	TLR3	T	2	2
DHX15	1665	broad.mit.edu	36	4	24159744	24159745	+	Splice_Site_DNP	DNP	CT	GA	GA			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:24159744_24159745CT>GA	uc003gqx.1	-	c.e6_splice_site				NM_001358	NP_001349			DEAH (Asp-Glu-Ala-His) box polypeptide 15						mRNA processing|RNA splicing	U12-type spliceosomal complex	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity			ovary(1)	1		Breast(46;0.0503)												0.44	34.321438	34.399797	11	14	CC		KEEP	---	---	---	---	capture			Splice_Site_DNP	DNP	24159744	24159745	4680	4	CT	GA	GA	24	24	DHX15	GA	5	3
GABRB1	2560	broad.mit.edu	36	4	47100360	47100360	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:47100360T>A	uc003gxh.1	+	c.710T>A	c.(709-711)TTT>TAT	p.F237Y		NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	237	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)									0.352785	385.962732	393.166811	133	244	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47100360	47100360	6417	4	T	A	A	64	64	GABRB1	A	4	4
WDFY3	23001	broad.mit.edu	36	4	85880578	85880578	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:85880578G>T	uc003hpd.1	-	c.6250C>A	c.(6250-6252)CAG>AAG	p.Q2084K		NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	2084						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)										0.102564	18.065903	48.752518	20	175	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	85880578	85880578	17842	4	G	T	T	48	48	WDFY3	T	3	3
RAP1GDS1	5910	broad.mit.edu	36	4	99492691	99492691	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:99492691C>T	uc003htw.2	+	c.280C>T	c.(280-282)CCA>TCA	p.P94S	RAP1GDS1_uc003htu.2_Missense_Mutation_p.P93S|RAP1GDS1_uc003htx.2_Missense_Mutation_p.P93S|RAP1GDS1_uc003htv.2_Missense_Mutation_p.P94S|RAP1GDS1_uc003hty.2_Missense_Mutation_p.P94S|RAP1GDS1_uc003htz.2_Missense_Mutation_p.P93S|RAP1GDS1_uc003hua.2_Missense_Mutation_p.P94S	NM_001100426	NP_001093896	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1 isoform	93	ARM 1.						binding|GTPase activator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)						187				0.126437	14.560389	26.418059	11	76	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99492691	99492691	13499	4	C	T	T	18	18	RAP1GDS1	T	2	2
SLCO4C1	353189	broad.mit.edu	36	5	101613337	101613337	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:101613337C>T	uc003knm.1	-	c.1524G>A	c.(1522-1524)TCG>TCA	p.S508S		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	508	Kazal-like.|Extracellular (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)										0.148936	12.090398	17.653581	7	40	CC		KEEP	---	---	---	---	capture			Silent	SNP	101613337	101613337	15227	5	C	T	T	27	27	SLCO4C1	T	1	1
DTWD2	285605	broad.mit.edu	36	5	118352021	118352021	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:118352021T>G	uc003ksa.1	-	c.85A>C	c.(85-87)AAG>CAG	p.K29Q		NM_173666	NP_775937	Q8NBA8	DTWD2_HUMAN	DTW domain containing 2	29											0		all_epithelial(76;0.0982)|Prostate(80;0.121)		OV - Ovarian serous cystadenocarcinoma(64;0.000228)|Epithelial(69;0.000941)|all cancers(49;0.00939)								OREG0016736	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.444444	7.892958	7.917797	4	5	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118352021	118352021	4977	5	T	G	G	63	63	DTWD2	G	4	4
LOX	4015	broad.mit.edu	36	5	121439021	121439021	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:121439021G>A	uc003ksu.1	-	c.855C>T	c.(853-855)TCC>TCT	p.S285S	LOX_uc010jcp.1_5'Flank|LOX_uc010jcq.1_5'UTR|LOX_uc010jcr.1_5'UTR	NM_002317	NP_002308	P28300	LYOX_HUMAN	lysyl oxidase preproprotein	285	Lysyl-oxidase like.				oxidation-reduction process|protein modification process	extracellular space	copper ion binding|protein-lysine 6-oxidase activity			lung(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)										0.527778	185.775078	185.847278	57	51	GG		KEEP	---	---	---	---	capture			Silent	SNP	121439021	121439021	9270	5	G	A	A	35	35	LOX	A	2	2
HINT1	3094	broad.mit.edu	36	5	130523128	130523128	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:130523128C>T	uc003kve.2	-	c.292G>A	c.(292-294)GTG>ATG	p.V98M	HINT1_uc003kvf.2_Non-coding_Transcript	NM_005340	NP_005331	P49773	HINT1_HUMAN	histidine triad nucleotide binding protein 1	98	HIT.				signal transduction	cytoplasm|cytoskeleton|nucleus	hydrolase activity|protein kinase C binding				0		all_cancers(142;0.0452)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Adenosine monophosphate(DB00131)									0.342466	362.262767	370.266237	125	240	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130523128	130523128	7396	5	C	T	T	18	18	HINT1	T	2	2
NMUR2	56923	broad.mit.edu	36	5	151752036	151752036	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:151752036G>A	uc003luv.2	-	c.1157C>T	c.(1156-1158)TCA>TTA	p.S386L		NM_020167	NP_064552	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	386	Cytoplasmic (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity			ovary(2)	2		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)											0.239796	112.415883	124.542299	47	149	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	151752036	151752036	10910	5	G	A	A	45	45	NMUR2	A	2	2
CDH12	1010	broad.mit.edu	36	5	21838200	21838200	+	Silent	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:21838200G>T	uc010iuc.1	-	c.1089C>A	c.(1087-1089)GGC>GGA	p.G363G	CDH12_uc003jgk.1_Silent_p.G363G	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	363	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2														0.109756	6.389877	18.697709	9	73	GG		KEEP	---	---	---	---	capture			Silent	SNP	21838200	21838200	3227	5	G	T	T	42	42	CDH12	T	3	3
C6	729	broad.mit.edu	36	5	41238960	41238960	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:41238960G>A	uc003jml.1	-	c.157C>T	c.(157-159)CAG>TAG	p.Q53*	C6_uc003jmk.2_Nonsense_Mutation_p.Q44*	NM_001115131	NP_001108603	P13671	CO6_HUMAN	complement component 6 precursor	44	TSP type-1 1.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)	5		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)												0.247934	75.58465	82.586148	30	91	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	41238960	41238960	2416	5	G	A	A	47	47	C6	A	5	2
C6	729	broad.mit.edu	36	5	41239095	41239095	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:41239095G>A	uc003jml.1	-	c.22C>T	c.(22-24)CAA>TAA	p.Q8*	C6_uc003jmk.2_5'UTR	NM_001115131	NP_001108603	P13671	CO6_HUMAN	complement component 6 precursor	Error:Variant_position_missing_in_P13671_after_alignment					complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)	5		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)												0.298701	122.719511	128.345133	46	108	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	41239095	41239095	2416	5	G	A	A	45	45	C6	A	5	2
ACTBL2	345651	broad.mit.edu	36	5	56813692	56813692	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:56813692G>A	uc003jrm.1	-	c.600C>T	c.(598-600)AAC>AAT	p.N200N		NM_001017992	NP_001017992	Q562R1	ACTBL_HUMAN	actin, beta-like 2	200						cytoplasm|cytoskeleton	ATP binding			ovary(3)	3		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)										0.179641	123.706234	155.952566	60	274	GG		KEEP	---	---	---	---	capture			Silent	SNP	56813692	56813692	195	5	G	A	A	36	36	ACTBL2	A	2	2
PDE4D	5144	broad.mit.edu	36	5	59320259	59320259	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:59320259G>T	uc003jsb.2	-	c.85C>A	c.(85-87)CCT>ACT	p.P29T		NM_006203	NP_006194	Q08499	PDE4D_HUMAN	cAMP-specific phosphodiesterase 4D isoform 2	Error:Variant_position_missing_in_Q08499_after_alignment					signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)									0.507937	679.744941	679.768714	224	217	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	59320259	59320259	12063	5	G	T	T	43	43	PDE4D	T	3	3
BEND3	57673	broad.mit.edu	36	6	107497161	107497162	+	Missense_Mutation	DNP	AG	TC	TC			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:107497161_107497162AG>TC	uc003prs.1	-	c.1926_1927CT>GA	c.(1924-1929)CGCTGC>CGGAGC	p.C643S		NM_001080450	NP_001073919	Q5T5X7	BEND3_HUMAN	BEN domain containing 3	643	BEN 3.									ovary(3)	3														0.833333	12.078795	12.701487	5	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	107497161	107497162	1422	6	AG	TC	TC	7	7	BEND3	TC	4	4
MTHFD1L	25902	broad.mit.edu	36	6	151299714	151299714	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:151299714C>T	uc003qob.1	+	c.1338C>T	c.(1336-1338)GTC>GTT	p.V446V	MTHFD1L_uc003qoc.1_Silent_p.V394V	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+	446	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)										0.198098	281.109918	334.667458	125	506	CC		KEEP	---	---	---	---	capture			Silent	SNP	151299714	151299714	10321	6	C	T	T	29	29	MTHFD1L	T	2	2
RPS6KA2	6196	broad.mit.edu	36	6	166756790	166756790	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:166756790C>T	uc003qvd.1	-	c.1762G>A	c.(1762-1764)GCG>ACG	p.A588T	RPS6KA2_uc010kkl.1_Missense_Mutation_p.A474T|RPS6KA2_uc003qvb.1_Missense_Mutation_p.A563T|RPS6KA2_uc003qvc.1_Missense_Mutation_p.A571T|RPS6KA2_uc010kkk.1_5'UTR	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	563	Protein kinase 2.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|protein phosphorylation|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)						997				0.388704	327.983313	331.255744	117	184	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	166756790	166756790	14131	6	C	T	T	27	27	RPS6KA2	T	1	1
VPS52	6293	broad.mit.edu	36	6	33326617	33326617	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:33326617C>T	uc003odm.1	-	c.2151G>A	c.(2149-2151)AAG>AAA	p.K717K	VPS52_uc003odn.1_Silent_p.K528K	NM_022553	NP_072047	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52	717					protein transport	endosome membrane|Golgi apparatus				ovary(4)	4														0.258503	93.430203	101.250942	38	109	CC		KEEP	---	---	---	---	capture			Silent	SNP	33326617	33326617	17781	6	C	T	T	32	32	VPS52	T	2	2
CUL9	23113	broad.mit.edu	36	6	43289580	43289580	+	Silent	SNP	C	A	A			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:43289580C>A	uc003ouk.1	+	c.5640C>A	c.(5638-5640)CTC>CTA	p.L1880L	CUL9_uc003oul.1_Silent_p.L1852L|CUL9_uc010jyk.1_Silent_p.L1032L|CUL9_uc003oun.1_5'UTR	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	1880					regulation of mitotic metaphase/anaphase transition|ubiquitin-dependent protein catabolic process	anaphase-promoting complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|central_nervous_system(1)	6														0.0875	11.455389	66.54456	28	292	CC		KEEP	---	---	---	---	capture			Silent	SNP	43289580	43289580	4221	6	C	A	A	29	29	CUL9	A	3	3
CD2AP	23607	broad.mit.edu	36	6	47655154	47655154	+	Silent	SNP	C	G	G			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:47655154C>G	uc003oyw.1	+	c.978C>G	c.(976-978)GTC>GTG	p.V326V		NM_012120	NP_036252	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	326	SH3 3.				cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)	1			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)											0.183333	12.978299	18.647687	11	49	CC		KEEP	---	---	---	---	capture			Silent	SNP	47655154	47655154	3122	6	C	G	G	30	30	CD2AP	G	3	3
RHAG	6005	broad.mit.edu	36	6	49691373	49691373	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:49691373A>G	uc003ozk.2	-	c.563T>C	c.(562-564)ATC>ACC	p.I188T	RHAG_uc010jzl.1_Missense_Mutation_p.I188T|RHAG_uc010jzm.1_Missense_Mutation_p.I188T	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	188	Helical; (Potential).				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)	1	Lung NSC(77;0.0255)					Ovarian(176;476 2003 7720 43408 44749)								0.384615	44.115307	44.570538	15	24	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49691373	49691373	13790	6	A	G	G	12	12	RHAG	G	4	4
TFAP2D	83741	broad.mit.edu	36	6	50820799	50820799	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:50820799C>T	uc003paf.1	+	c.904C>T	c.(904-906)CGG>TGG	p.R302W		NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1	302	H-S-H (helix-span-helix), dimerization.				regulation of transcription, DNA-dependent		DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)													0.173913	35.246608	44.478117	16	76	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	50820799	50820799	16318	6	C	T	T	31	31	TFAP2D	T	1	1
LGSN	51557	broad.mit.edu	36	6	64048168	64048168	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:64048168G>C	uc003peh.1	-	c.1247C>G	c.(1246-1248)CCT>CGT	p.P416R	LGSN_uc003pei.1_3'UTR	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	416					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(1)	1					L-Glutamic Acid(DB00142)									0.3125	79.01535	82.020124	30	66	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64048168	64048168	9085	6	G	C	C	35	35	LGSN	C	3	3
LGSN	51557	broad.mit.edu	36	6	64048230	64048230	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:64048230G>C	uc003peh.1	-	c.1185C>G	c.(1183-1185)ATC>ATG	p.I395M	LGSN_uc003pei.1_3'UTR	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	395					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(1)	1					L-Glutamic Acid(DB00142)									0.220183	65.546437	73.401189	24	85	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64048230	64048230	9085	6	G	C	C	45	45	LGSN	C	3	3
ACTL6B	51412	broad.mit.edu	36	7	100091047	100091047	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100091047G>A	uc003uvy.1	-	c.201C>T	c.(199-201)ATC>ATT	p.I67I	ACTL6B_uc003uvz.1_Non-coding_Transcript	NM_016188	NP_057272	O94805	ACL6B_HUMAN	actin-like 6B	67	Essential for mediating its function in dendritic development; may contribute to neuronal-specific targeting (By similarity).				chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex|SWI/SNF complex	ATP binding|protein binding|structural constituent of cytoskeleton			ovary(1)	1	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)													0.149425	23.719201	33.975035	13	74	GG		KEEP	---	---	---	---	capture			Silent	SNP	100091047	100091047	200	7	G	A	A	37	37	ACTL6B	A	1	1
SRRT	51593	broad.mit.edu	36	7	100321854	100321854	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100321854C>T	uc003uwy.2	+	c.1509C>T	c.(1507-1509)CGC>CGT	p.R503R	SRRT_uc010lhl.1_Silent_p.R502R|SRRT_uc003uxa.2_Silent_p.R502R|SRRT_uc003uwz.2_Silent_p.R503R|SRRT_uc003uwx.2_Silent_p.R423R	NM_015908	NP_056992	Q9BXP5	SRRT_HUMAN	arsenate resistance protein 2 isoform a	503					cell proliferation|primary microRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding			ovary(2)	2														0.151515	17.903234	25.58358	10	56	CC		KEEP	---	---	---	---	capture			Silent	SNP	100321854	100321854	15687	7	C	T	T	27	27	SRRT	T	1	1
CHRM2	1129	broad.mit.edu	36	7	136351228	136351228	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:136351228A>G	uc003vtf.1	+	c.1076A>G	c.(1075-1077)AAT>AGT	p.N359S	CHRM2_uc003vtg.1_Missense_Mutation_p.N359S|CHRM2_uc003vtm.1_Missense_Mutation_p.N359S|CHRM2_uc003vtj.1_Missense_Mutation_p.N359S|CHRM2_uc003vtk.1_Missense_Mutation_p.N359S|CHRM2_uc003vtl.1_Missense_Mutation_p.N359S|CHRM2_uc003vti.1_Missense_Mutation_p.N359S|CHRM2_uc003vto.1_Missense_Mutation_p.N359S|CHRM2_uc003vtn.1_Missense_Mutation_p.N359S|CHRM2_uc010lmw.1_Missense_Mutation_p.N359S	NM_001006630	NP_001006633	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	359	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)									0.12	13.244986	27.409291	12	88	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	136351228	136351228	3511	7	A	G	G	4	4	CHRM2	G	4	4
TRPV5	56302	broad.mit.edu	36	7	142337378	142337378	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:142337378C>T	uc003wby.1	-	c.246G>A	c.(244-246)GCG>GCA	p.A82A	TRPV5_uc003wbz.2_Silent_p.A82A	NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	82	Cytoplasmic (Potential).|ANK 2.				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)	5	Melanoma(164;0.059)													0.160665	104.535659	144.103535	58	303	CC		KEEP	---	---	---	---	capture			Silent	SNP	142337378	142337378	17150	7	C	T	T	27	27	TRPV5	T	1	1
OR2F1	26211	broad.mit.edu	36	7	143288582	143288582	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:143288582G>A	uc003wds.1	+	c.586G>A	c.(586-588)GAG>AAG	p.E196K		NM_012369	NP_036501	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F,	196	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.0903)													0.174779	146.425735	191.575892	79	373	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	143288582	143288582	11402	7	G	A	A	45	45	OR2F1	A	2	2
CRYGN	155051	broad.mit.edu	36	7	150764249	150764249	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:150764249C>T	uc003wke.1	-	c.366G>A	c.(364-366)AGG>AGA	p.R122R	CRYGN_uc003wkf.1_Intron|CRYGN_uc003wkg.1_Non-coding_Transcript|CRYGN_uc010lqd.1_Non-coding_Transcript	NM_144727	NP_653328	Q8WXF5	CRGN_HUMAN	gammaN-crystallin	122	Beta/gamma crystallin 'Greek key' 3.										0			OV - Ovarian serous cystadenocarcinoma(82;0.00358)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)										0.190476	16.378757	20.141225	8	34	CC		KEEP	---	---	---	---	capture			Silent	SNP	150764249	150764249	4057	7	C	T	T	22	22	CRYGN	T	2	2
PRKAG2	51422	broad.mit.edu	36	7	151109382	151109383	+	Missense_Mutation	DNP	GG	CT	CT			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:151109382_151109383GG>CT	uc003wkk.1	-	c.254_255CC>AG	c.(253-255)CCC>CAG	p.P85Q	PRKAG2_uc003wkj.1_Missense_Mutation_p.P41Q|PRKAG2_uc010lqe.1_Non-coding_Transcript|PRKAG2_uc003wkm.1_Missense_Mutation_p.P85Q	NM_016203	NP_077747	Q9UGJ0	AAKG2_HUMAN	AMP-activated protein kinase gamma2 subunit	85					ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			kidney(1)	1	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)										0.175	6.451272	10.529441	7	33	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	151109382	151109383	12944	7	GG	CT	CT	35	35	PRKAG2	CT	3	3
UBE3C	9690	broad.mit.edu	36	7	156693348	156693348	+	Silent	SNP	A	G	G			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:156693348A>G	uc010lqs.1	+	c.1767A>G	c.(1765-1767)CAA>CAG	p.Q589Q	UBE3C_uc003wng.2_Silent_p.Q589Q	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	589					protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			large_intestine(1)|ovary(1)	2		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)										0.092715	15.868551	66.312604	28	274	AA		KEEP	---	---	---	---	capture			Silent	SNP	156693348	156693348	17439	7	A	G	G	4	4	UBE3C	G	4	4
ABCB5	340273	broad.mit.edu	36	7	20649671	20649671	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:20649671C>A	uc010kuh.1	+	c.569C>A	c.(568-570)TCT>TAT	p.S190Y		NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	376	Extracellular (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			large_intestine(1)|ovary(1)|pancreas(1)	3														0.126761	14.346278	82.279347	63	434	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20649671	20649671	45	7	C	A	A	32	32	ABCB5	A	3	3
POU6F2	11281	broad.mit.edu	36	7	39213641	39213641	+	Silent	SNP	A	C	C			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:39213641A>C	uc003thb.1	+	c.408A>C	c.(406-408)GGA>GGC	p.G136G	POU6F2_uc010kxo.1_Silent_p.G128G	NM_007252	NP_009183	P78424	PO6F2_HUMAN	POU domain, class 6, transcription factor 2	136					central nervous system development|ganglion mother cell fate determination|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1														0.166667	6.701786	11.135414	7	35	AA		KEEP	---	---	---	---	capture			Silent	SNP	39213641	39213641	12715	7	A	C	C	10	10	POU6F2	C	4	4
HECW1	23072	broad.mit.edu	36	7	43548032	43548032	+	Silent	SNP	A	G	G			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:43548032A>G	uc003tid.1	+	c.4158A>G	c.(4156-4158)GAA>GAG	p.E1386E		NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	1386	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(7)|breast(2)|skin(2)|pancreas(1)|lung(1)	13										944				0.595041	239.719043	240.676568	72	49	AA		KEEP	---	---	---	---	capture			Silent	SNP	43548032	43548032	7325	7	A	G	G	4	4	HECW1	G	4	4
TBRG4	9238	broad.mit.edu	36	7	45115155	45115155	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:45115155C>T	uc003tmv.1	-	c.207G>A	c.(205-207)GAG>GAA	p.E69E	TBRG4_uc003tmu.1_5'Flank|TBRG4_uc003tmw.1_Silent_p.E69E|TBRG4_uc003tmx.1_Silent_p.E69E|SNORA5B_uc003tna.2_5'Flank	NM_004749	NP_004740	Q969Z0	TBRG4_HUMAN	cell cycle progression 2 protein isoform 1	69					apoptosis|cell cycle arrest|cellular respiration|G1 phase of mitotic cell cycle|positive regulation of cell proliferation	mitochondrion	ATP binding|protein binding|protein kinase activity				0														0.27933	120.666791	128.513769	50	129	CC		KEEP	---	---	---	---	capture			Silent	SNP	45115155	45115155	16175	7	C	T	T	32	32	TBRG4	T	2	2
ABCA13	154664	broad.mit.edu	36	7	48208432	48208432	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:48208432C>T	uc003toq.1	+	c.42C>T	c.(40-42)CCC>CCT	p.P14P	ABCA13_uc003top.1_5'UTR|ABCA13_uc010kyr.1_5'UTR	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	69					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10														0.137566	41.5257	65.56457	26	163	CC		KEEP	---	---	---	---	capture			Silent	SNP	48208432	48208432	32	7	C	T	T	24	24	ABCA13	T	2	2
IKZF1	10320	broad.mit.edu	36	7	50417815	50417815	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:50417815G>A	uc003tow.2	+	c.505G>A	c.(505-507)GGG>AGG	p.G169R	IKZF1_uc003tox.2_Missense_Mutation_p.G169R|IKZF1_uc003toy.2_Missense_Mutation_p.G169R|IKZF1_uc003toz.2_Missense_Mutation_p.G139R|IKZF1_uc010kyx.1_Intron	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	169					cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding	p.?(60)		haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)								226				0.4	13.09893	13.186101	4	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	50417815	50417815	7915	7	G	A	A	39	39	IKZF1	A	1	1
SLC29A4	222962	broad.mit.edu	36	7	5305417	5305417	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:5305417G>A	uc003sod.1	+	c.1042G>A	c.(1042-1044)GTG>ATG	p.V348M	SLC29A4_uc003soc.1_Missense_Mutation_p.V348M|SLC29A4_uc003soe.1_Missense_Mutation_p.V334M|SLC29A4_uc010ksw.1_Non-coding_Transcript	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN	solute carrier family 29 (nucleoside	348	Cytoplasmic (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity			liver(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)										0.613793	285.397338	287.044653	89	56	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5305417	5305417	15034	7	G	A	A	40	40	SLC29A4	A	1	1
SAMD9L	219285	broad.mit.edu	36	7	92602275	92602275	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:92602275A>C	uc003umh.1	-	c.946T>G	c.(946-948)TGT>GGT	p.C316G	SAMD9L_uc003umj.1_Missense_Mutation_p.C316G|SAMD9L_uc003umi.1_Missense_Mutation_p.C316G|SAMD9L_uc010lfb.1_Missense_Mutation_p.C316G|SAMD9L_uc003umk.1_Missense_Mutation_p.C316G|SAMD9L_uc010lfc.1_Missense_Mutation_p.C316G|SAMD9L_uc010lfd.1_Missense_Mutation_p.C316G|SAMD9L_uc010lfe.1_Missense_Mutation_p.C316G	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	316										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)											0.119565	17.666448	30.725926	11	81	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	92602275	92602275	14307	7	A	C	C	8	8	SAMD9L	C	4	4
TFPI2	7980	broad.mit.edu	36	7	93354084	93354084	+	Missense_Mutation	SNP	C	T	T	rs12669450	by-cluster,by-frequency,by-hapmap	TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:93354084C>T	uc003unb.1	-	c.710G>A	c.(709-711)CGG>CAG	p.R237Q	GNGT1_uc003umx.1_Intron|TFPI2_uc003umy.1_Missense_Mutation_p.R231Q|TFPI2_uc003umz.1_3'UTR|TFPI2_uc003una.1_Missense_Mutation_p.R220Q|TFPI2_uc010lfg.1_Missense_Mutation_p.R107Q	NM_006528	NP_006519	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2	231					blood coagulation	proteinaceous extracellular matrix	extracellular matrix structural constituent|serine-type endopeptidase inhibitor activity			pancreas(1)	1	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)											0.093863	21.545261	67.462356	26	251	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	93354084	93354084	16337	7	C	T	T	23	23	TFPI2	T	1	1
SLC18A1	6570	broad.mit.edu	36	8	20049463	20049463	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:20049463G>A	uc003wzm.1	-	c.1261C>T	c.(1261-1263)CGC>TGC	p.R421C	SLC18A1_uc003wzl.1_Missense_Mutation_p.R208C|SLC18A1_uc010ltf.1_Non-coding_Transcript|SLC18A1_uc003wzn.1_Missense_Mutation_p.R389C|SLC18A1_uc003wzo.1_Missense_Mutation_p.R389C	NM_003053	NP_003044	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine),	421	Cytoplasmic (Potential).				neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2				Colorectal(74;0.0747)										0.251969	75.334457	82.437922	32	95	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20049463	20049463	14921	8	G	A	A	40	40	SLC18A1	A	1	1
ANK1	286	broad.mit.edu	36	8	41673412	41673412	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr8:41673412T>A	uc003xom.1	-	c.2797A>T	c.(2797-2799)AGC>TGC	p.S933C	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.1_Missense_Mutation_p.S208C|ANK1_uc003xoi.1_Missense_Mutation_p.S892C|ANK1_uc003xoj.1_Missense_Mutation_p.S892C|ANK1_uc003xok.1_Missense_Mutation_p.S892C|ANK1_uc003xol.1_Missense_Mutation_p.S892C	NM_020475	NP_065208	P16157	ANK1_HUMAN	ankyrin 1 isoform 4	892					axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)|breast(1)	8	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)											0.47619	34.751553	34.76169	10	11	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41673412	41673412	623	8	T	A	A	55	55	ANK1	A	4	4
SLC26A7	115111	broad.mit.edu	36	8	92434359	92434359	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:92434359C>T	uc003yez.1	+	c.1273C>T	c.(1273-1275)CGA>TGA	p.R425*	SLC26A7_uc003yex.1_Nonsense_Mutation_p.R425*|SLC26A7_uc003yey.1_Non-coding_Transcript|SLC26A7_uc003yfa.1_Nonsense_Mutation_p.R425*	NM_134266	NP_599028	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform b	425	Helical; (Potential).					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)											0.310345	26.064303	26.993461	9	20	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	92434359	92434359	15019	8	C	T	T	23	23	SLC26A7	T	5	1
SUSD1	64420	broad.mit.edu	36	9	113951454	113951454	+	Silent	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:113951454G>A	uc004bfu.1	-	c.264C>T	c.(262-264)CAC>CAT	p.H88H	SUSD1_uc010mui.1_Silent_p.H88H|SUSD1_uc010muj.1_Silent_p.H88H	NM_022486	NP_071931	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	88	EGF-like 2; calcium-binding (Potential).|Extracellular (Potential).					integral to membrane	calcium ion binding				0														0.442529	215.728577	216.231542	77	97	GG		KEEP	---	---	---	---	capture			Silent	SNP	113951454	113951454	15927	9	G	A	A	48	48	SUSD1	A	2	2
TSC1	7248	broad.mit.edu	36	9	134766856	134766856	+	Nonsense_Mutation	SNP	T	A	A			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:134766856T>A	uc004cca.1	-	c.2443A>T	c.(2443-2445)AAG>TAG	p.K815*	TSC1_uc004ccb.2_Nonsense_Mutation_p.K814*	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1	815	Potential.				activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.?(1)		lung(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|ovary(1)|bone(1)	9				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)						536		OREG0019577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.820433	877.094936	908.289573	265	58	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	134766856	134766856	17156	9	T	A	A	62	62	TSC1	A	5	4
IFNA13	3447	broad.mit.edu	36	9	21358002	21358002	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:21358002G>C	uc003zpa.1	-	c.5C>G	c.(4-6)GCC>GGC	p.A2G		NM_006900	NP_008831	P01562	IFNA1_HUMAN	interferon, alpha 13 precursor	2					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding			ovary(1)	1				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)										0.388889	14.814048	15.010671	7	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	21358002	21358002	7834	9	G	C	C	42	42	IFNA13	C	3	3
PTCH1	5727	broad.mit.edu	36	9	97249111	97249111	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:97249111G>T	uc004avk.2	-	c.4248C>A	c.(4246-4248)TTC>TTA	p.F1416L	PTCH1_uc010mro.1_Missense_Mutation_p.F1265L|PTCH1_uc010mrp.1_Missense_Mutation_p.F1265L|PTCH1_uc010mrq.1_Missense_Mutation_p.F1265L|PTCH1_uc004avl.2_Missense_Mutation_p.F1265L|PTCH1_uc010mrr.1_Missense_Mutation_p.F1350L|PTCH1_uc004avm.2_Missense_Mutation_p.F1415L|PTCH1_uc010mrn.1_Missense_Mutation_p.F208L	NM_000264	NP_001077076	Q13635	PTC1_HUMAN	patched isoform L	1416	Cytoplasmic (Potential).				embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity			skin(229)|central_nervous_system(43)|bone(33)|upper_aerodigestive_tract(10)|lung(5)|large_intestine(4)|oesophagus(3)|ovary(3)|breast(2)|vulva(1)	333		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)								509				0.206452	61.617776	74.012884	32	123	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	97249111	97249111	13184	9	G	T	T	41	41	PTCH1	T	3	3
ODZ1	10178	broad.mit.edu	36	X	123613588	123613588	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:123613588G>T	uc010nqy.1	-	c.1436C>A	c.(1435-1437)ACA>AAA	p.T479K	ODZ1_uc004euj.1_Missense_Mutation_p.T479K	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1	479	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	22										623				0.158798	141.342637	193.060376	74	392	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	123613588	123613588	11239	23	G	T	T	48	48	ODZ1	T	3	3
GPR112	139378	broad.mit.edu	36	X	135257472	135257472	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:135257472C>T	uc004ezu.1	+	c.3941C>T	c.(3940-3942)TCG>TTG	p.S1314L	GPR112_uc010nsb.1_Missense_Mutation_p.S1109L|GPR112_uc010nsc.1_Missense_Mutation_p.S1081L	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1314	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	11	Acute lymphoblastic leukemia(192;0.000127)									487				0.450644	323.741325	324.235267	105	128	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	135257472	135257472	6903	23	C	T	T	31	31	GPR112	T	1	1
ZIC3	7547	broad.mit.edu	36	X	136479889	136479889	+	Silent	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:136479889C>T	uc004fak.1	+	c.1398C>T	c.(1396-1398)TAC>TAT	p.Y466Y		NM_003413	NP_003404	O60481	ZIC3_HUMAN	zinc finger protein of the cerebellum 3	466					cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription activator activity|zinc ion binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)													0.17801	72.141402	90.784751	34	157	CC		KEEP	---	---	---	---	capture			Silent	SNP	136479889	136479889	18271	23	C	T	T	19	19	ZIC3	T	1	1
L1CAM	3897	broad.mit.edu	36	X	152786982	152786982	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:152786982G>A	uc004fjb.1	-	c.1672C>T	c.(1672-1674)CGA>TGA	p.R558*	L1CAM_uc004fjc.1_Nonsense_Mutation_p.R558*|L1CAM_uc004fjd.1_Nonsense_Mutation_p.R372*	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	558	Ig-like C2-type 6.|Extracellular (Potential).				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)													0.155556	9.498381	14.602471	7	38	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	152786982	152786982	8911	23	G	A	A	37	37	L1CAM	A	5	1
WNK3	65267	broad.mit.edu	36	X	54280546	54280546	+	Nonsense_Mutation	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:54280546G>T	uc004dtc.1	-	c.4178C>A	c.(4177-4179)TCG>TAG	p.S1393*	WNK3_uc004dtd.1_Nonsense_Mutation_p.S1346*	NM_020922	NP_065973	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 1	1346					intracellular protein kinase cascade|protein phosphorylation		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11									p.S1393L(ESS1-Tumor)	290				0.515625	99.365284	99.37861	33	31	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	54280546	54280546	17953	23	G	T	T	37	37	WNK3	T	5	3
SPIN3	169981	broad.mit.edu	36	X	57037372	57037372	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1396-01	TCGA-14-1396-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:57037372T>G	uc004dux.1	-	c.734A>C	c.(733-735)GAT>GCT	p.D245A	SPIN3_uc004duu.2_Intron|SPIN3_uc004duv.2_Intron|SPIN3_uc004duw.2_Intron|SPIN3_uc010nkj.1_Missense_Mutation_p.D245A	NM_001010862	NP_001010862	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	245					gamete generation					ovary(1)|central_nervous_system(1)	2														0.175	6.988647	10.99592	7	33	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57037372	57037372	15567	23	T	G	G	50	50	SPIN3	G	4	4
ZC3H12B	340554	broad.mit.edu	36	X	64638952	64638952	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:64638952G>T	uc010nko.1	+	c.1616G>T	c.(1615-1617)GGT>GTT	p.G539V		NM_001010888	NP_001010888	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	539							endonuclease activity|nucleic acid binding|zinc ion binding			lung(1)|kidney(1)|pancreas(1)	3														0.637295	1016.645444	1024.767682	311	177	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64638952	64638952	18150	23	G	T	T	44	44	ZC3H12B	T	3	3
TEX11	56159	broad.mit.edu	36	X	69691280	69691280	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1396-01	TCGA-14-1396-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:69691280C>T	uc004dyl.1	-	c.2281G>A	c.(2281-2283)GAA>AAA	p.E761K	TEX11_uc004dyk.1_Missense_Mutation_p.E436K|TEX11_uc004dym.1_Missense_Mutation_p.E746K	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1	761							protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)													0.267241	166.843441	178.196806	62	170	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69691280	69691280	16301	23	C	T	T	30	30	TEX11	T	2	2
NHSL2	340527	broad.mit.edu	36	X	71277268	71277268	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1396-01	TCGA-14-1396-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:71277268G>A	uc010nli.1	+	c.2452G>A	c.(2452-2454)GGC>AGC	p.G818S	NHSL2_uc004eak.1_Missense_Mutation_p.G683S|NHSL2_uc010nlj.1_Missense_Mutation_p.G683S	NM_001013627	NP_001013649			NHS-like 2												0	Renal(35;0.156)													0.442857	96.318826	96.517067	31	39	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71277268	71277268	10813	23	G	A	A	39	39	NHSL2	A	1	1
KLHL4	56062	broad.mit.edu	36	X	86775447	86775447	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1396-01	TCGA-14-1396-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:86775447A>G	uc004efa.1	+	c.1592A>G	c.(1591-1593)CAT>CGT	p.H531R	KLHL4_uc004efb.1_Missense_Mutation_p.H531R	NM_057162	NP_476503	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 2	531	Kelch 3.					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5														0.091518	27.255357	102.550825	41	407	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	86775447	86775447	8705	23	A	G	G	8	8	KLHL4	G	4	4
ADRB1	153	broad.mit.edu	36	10	115794290	115794291	+	Frame_Shift_Del	DEL	GT	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:115794290_115794291delGT	uc001lba.1	+	c.409_410delGT	c.(409-411)GTGfs	p.V137fs		NM_000684	NP_000675	P08588	ADRB1_HUMAN	beta-1-adrenergic receptor	137	Helical; Name=3; (By similarity).				positive regulation of cAMP biosynthetic process	integral to plasma membrane	alpha-2A adrenergic receptor binding|beta1-adrenergic receptor activity|protein heterodimerization activity				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0124)|all cancers(201;0.0298)	Acebutolol(DB01193)|Alprenolol(DB00866)|Amiodarone(DB01118)|Arbutamine(DB01102)|Atenolol(DB00335)|Betaxolol(DB00195)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bretylium(DB01158)|Carteolol(DB00521)|Carvedilol(DB01136)|Desipramine(DB01151)|Dobutamine(DB00841)|Dopamine(DB00988)|Epinephrine(DB00668)|Esmolol(DB00187)|Isoetharine(DB00221)|Isoproterenol(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Metipranolol(DB01214)|Metoprolol(DB00264)|Nadolol(DB01203)|Norepinephrine(DB00368)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Pindolol(DB00960)|Practolol(DB01297)|Propranolol(DB00571)|Risperidone(DB00734)|Timolol(DB00373)|Ziprasidone(DB00246)									0.40			67	102				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	115794290	115794291	341	10	GT	-	-	36	36	ADRB1	-	5	5
DLG5	9231	broad.mit.edu	36	10	79236518	79236522	+	Splice_Site_Del	DEL	TTACA	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:79236518_79236522delTTACA	uc001jzk.1	-	c.e26_splice_site			DLG5_uc009xru.1_Splice_Site_Del|DLG5_uc001jzi.1_Splice_Site_Del|DLG5_uc001jzj.1_Splice_Site_Del	NM_004747	NP_004738			discs large homolog 5						cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)											0.54			14	12				---	---	---	---	capture_indel			Splice_Site_Del	DEL	79236518	79236522	4738	10	TTACA	-	-	56	56	DLG5	-	5	5
PHF21A	51317	broad.mit.edu	36	11	45916405	45916405	+	Frame_Shift_Del	DEL	C	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:45916405_45916405delC	uc001ncc.2	-	c.1484_1484delG	c.(1483-1485)AGAfs	p.R495fs	PHF21A_uc001ncb.2_Frame_Shift_Del_p.R449fs|PHF21A_uc009ykx.1_Frame_Shift_Del_p.R449fs|PHF21A_uc001nca.1_Frame_Shift_Del_p.R231fs	NM_001101802	NP_001095272	Q96BD5	PF21A_HUMAN	BRAF35/HDAC2 complex isoform a	495	Required for transcriptional repression.|PHD-type.				blood coagulation|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex	DNA binding|zinc ion binding			central_nervous_system(1)	1														0.54			64	55				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	45916405	45916405	12256	11	C	-	-	32	32	PHF21A	-	5	5
LTBP2	4053	broad.mit.edu	36	14	74037359	74037360	+	Frame_Shift_Ins	INS	-	G	G			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:74037359_74037360insG	uc001xqa.1	-	c.5446_5447insC	c.(5446-5448)CACfs	p.H1816fs		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	1816	EGF-like 20; calcium-binding (Potential).				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)										0.38			3	5				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	74037359	74037360	9450	14	-	G	G	59	59	LTBP2	G	5	5
LYZL6	57151	broad.mit.edu	36	17	31290376	31290377	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:31290376_31290377delAG	uc002hkj.1	-	c.97_98delCT	c.(97-99)CTGfs	p.L33fs	LYZL6_uc002hkk.1_Frame_Shift_Del_p.L33fs	NM_020426	NP_065159	O75951	LYZL6_HUMAN	lysozyme-like 6	33					cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)										0.52			87	81				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	31290376	31290377	9511	17	AG	-	-	7	7	LYZL6	-	5	5
LUC7L3	51747	broad.mit.edu	36	17	46173564	46173566	+	In_Frame_Del	DEL	CCA	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:46173564_46173566delCCA	uc002isq.2	+	c.309_311delCCA	c.(307-312)GGCCAT>GGT	p.H104del	LUC7L3_uc002isp.1_In_Frame_Del_p.H28del|LUC7L3_uc002isr.1_In_Frame_Del_p.H104del|LUC7L3_uc002iss.1_In_Frame_Del_p.H104del	NM_016424	NP_057508	O95232	LC7L3_HUMAN	cisplatin resistance-associated overexpressed	104					apoptosis|mRNA processing|response to stress|RNA splicing	focal adhesion|nuclear speck	DNA binding|mRNA binding|protein binding				0														0.33			39	81				---	---	---	---	capture_indel			In_Frame_Del	DEL	46173564	46173566	9460	17	CCA	-	-	26	26	LUC7L3	-	5	5
VMO1	284013	broad.mit.edu	36	17	4635647	4635675	+	Frame_Shift_Del	DEL	AGGTAGGCGCCGCCGCGACACCACAGCGG	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:4635647_4635675delAGGTAGGCGCCGCCGCGACACCACAGCGG	uc002fyx.1	-	c.331_359delCCGCTGTGGTGTCGCGGCGGCGCCTACCT	c.(331-360)CCGCTGTGGTGTCGCGGCGGCGCCTACCTAfs	p.P111fs	VMO1_uc002fyy.1_3'UTR	NM_182566	NP_872372	Q7Z5L0	VMO1_HUMAN	vitelline membrane outer layer 1 isoform 1	111_120					vitelline membrane formation	extracellular region				ovary(1)	1														0.36			9	16				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	4635647	4635675	17744	17	AGGTAGGCGCCGCCGCGACACCACAGCGG	-	-	15	15	VMO1	-	5	5
SIRT2	22933	broad.mit.edu	36	19	44072591	44072592	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:44072591_44072592insC	uc002ojt.1	-	c.259_260insG	c.(259-261)ATCfs	p.I87fs	SIRT2_uc010egh.1_Frame_Shift_Ins_p.I50fs|SIRT2_uc010egi.1_Frame_Shift_Ins_p.I50fs|SIRT2_uc002ojs.1_Frame_Shift_Ins_p.I67fs|SIRT2_uc002oju.1_Frame_Shift_Ins_p.I50fs|SIRT2_uc002ojv.1_Frame_Shift_Ins_p.I87fs|SIRT2_uc010egj.1_Frame_Shift_Ins_p.I50fs	NM_012237	NP_085096	Q8IXJ6	SIRT2_HUMAN	sirtuin 2 isoform 1	87	Deacetylase sirtuin-type.|NAD (By similarity).				cell division|chromatin silencing at rDNA|chromatin silencing at telomere|mitosis|negative regulation of striated muscle tissue development|protein ADP-ribosylation|regulation of exit from mitosis|regulation of phosphorylation|response to redox state	chromatin silencing complex|cytoplasm|microtubule	histone acetyltransferase binding|histone deacetylase binding|NAD+ binding|NAD-dependent histone deacetylase activity|transcription factor binding|tubulin deacetylase activity|ubiquitin binding|zinc ion binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)											0.46			302	353				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	44072591	44072592	14833	19	-	C	C	12	12	SIRT2	C	5	5
ZNF780A	284323	broad.mit.edu	36	19	45273092	45273112	+	In_Frame_Del	DEL	CATTCCCTGCATTCAAAGGGT	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:45273092_45273112delCATTCCCTGCATTCAAAGGGT	uc002omy.1	-	c.1077_1097delACCCTTTGAATGCAGGGAATG	c.(1075-1098)AAACCCTTTGAATGCAGGGAATGT>AAT	p.359_366KPFECREC>N	ZNF780A_uc002omw.2_Intron|ZNF780A_uc002omx.1_In_Frame_Del_p.325_332KPFECREC>N|ZNF780A_uc002omz.1_In_Frame_Del_p.359_366KPFECREC>N	NM_001010880	NP_001010880	O75290	Z780A_HUMAN	zinc finger protein 780A isoform b	359_366	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)													0.44			15	19				---	---	---	---	capture_indel			In_Frame_Del	DEL	45273092	45273112	18750	19	CATTCCCTGCATTCAAAGGGT	-	-	17	17	ZNF780A	-	5	5
LMTK3	114783	broad.mit.edu	36	19	53693354	53693355	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:53693354_53693355delCA	uc002pjk.1	-	c.2870_2871delTG	c.(2869-2871)GTGfs	p.V957fs		NM_001080434	NP_001073903			lemur tyrosine kinase 3											lung(5)|central_nervous_system(1)	6		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)						193				0.49			17	18				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	53693354	53693355	9189	19	CA	-	-	25	25	LMTK3	-	5	5
TNFSF9	8744	broad.mit.edu	36	19	6485609	6485610	+	Splice_Site_Ins	INS	-	G	G			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:6485609_6485610insG	uc002mfh.1	+	c.e3_splice_site				NM_003811	NP_003802			tumor necrosis factor (ligand) superfamily,						apoptosis|cell proliferation|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1														0.41			7	10				---	---	---	---	capture_indel			Splice_Site_Ins	INS	6485609	6485610	16853	19	-	G	G	7	7	TNFSF9	G	5	5
PTBP1	5725	broad.mit.edu	36	19	750435	750438	+	Frame_Shift_Del	DEL	GGTA	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:750435_750438delGGTA	uc002lpp.1	+	c.31_34delGGTA	c.(31-36)GGTACAfs	p.G11fs	PTBP1_uc002lpq.1_Frame_Shift_Del_p.G11fs|PTBP1_uc002lpr.1_Frame_Shift_Del_p.G11fs|PTBP1_uc002lps.1_Frame_Shift_Del_p.G11fs|PTBP1_uc002lpt.1_Non-coding_Transcript|PTBP1_uc002lpu.1_5'UTR	NM_002819	NP_002810	P26599	PTBP1_HUMAN	polypyrimidine tract-binding protein 1 isoform	11_12					nuclear mRNA splicing, via spliceosome	heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|poly-pyrimidine tract binding|protein binding			kidney(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)								OREG0025110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.83			337	69				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	750435	750438	13179	19	GGTA	-	-	47	47	PTBP1	-	5	5
PLXNA2	5362	broad.mit.edu	36	1	206273385	206273408	+	In_Frame_Del	DEL	GCCACACCTTGACCCCACTTTCCA	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:206273385_206273408delGCCACACCTTGACCCCACTTTCCA	uc001hgz.1	-	c.4934_4957delTGGAAAGTGGGGTCAAGGTGTGGC	c.(4933-4959)CTGGAAAGTGGGGTCAAGGTGTGGCAT>CAT	p.LESGVKVW1645del		NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2	1645_1652	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.199)										0.43			40	54				---	---	---	---	capture_indel			In_Frame_Del	DEL	206273385	206273408	12546	1	GCCACACCTTGACCCCACTTTCCA	-	-	46	46	PLXNA2	-	5	5
DISP1	84976	broad.mit.edu	36	1	221243912	221243919	+	Frame_Shift_Del	DEL	CTGCTTCA	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:221243912_221243919delCTGCTTCA	uc001hnu.1	+	c.2550_2557delCTGCTTCA	c.(2548-2559)AGCTGCTTCATTfs	p.S850fs		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	850_853					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)										0.32			31	67				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	221243912	221243919	4718	1	CTGCTTCA	-	-	28	28	DISP1	-	5	5
PARP1	142	broad.mit.edu	36	1	224640001	224640007	+	Splice_Site_Del	DEL	AGATCTG	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:224640001_224640007delAGATCTG	uc001hqd.2	-	c.e7_splice_site				NM_001618	NP_001609			poly (ADP-ribose) polymerase family, member 1						cellular response to insulin stimulus|protein ADP-ribosylation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nuclear envelope|nucleolus|transcription factor complex	DNA binding|identical protein binding|NAD+ ADP-ribosyltransferase activity|protein N-terminus binding|transcription factor binding|zinc ion binding			ovary(2)|breast(2)|lung(1)	5	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)						1012				0.56			167	132				---	---	---	---	capture_indel			Splice_Site_Del	DEL	224640001	224640007	11871	1	AGATCTG	-	-	3	3	PARP1	-	5	5
JMJD4	65094	broad.mit.edu	36	1	225989142	225989153	+	Splice_Site_Del	DEL	TGAAATGAAAGG	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:225989142_225989153delTGAAATGAAAGG	uc001hrb.1	-	c.e2_splice_site			SNAP47_uc001hqz.1_Intron|SNAP47_uc001hra.1_Intron|JMJD4_uc001hrc.1_Splice_Site_Del|SNAP47_uc001hrd.2_5'Flank|SNAP47_uc001hre.2_5'Flank|SNAP47_uc001hrf.1_5'Flank	NM_023007	NP_075383			jumonji domain containing 4												0		Prostate(94;0.0885)												0.66			206	104				---	---	---	---	capture_indel			Splice_Site_Del	DEL	225989142	225989153	8255	1	TGAAATGAAAGG	-	-	55	55	JMJD4	-	5	5
OBSCN	84033	broad.mit.edu	36	1	226591624	226591625	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:226591624_226591625insC	uc009xez.1	+	c.16717_16718insC	c.(16717-16719)TCCfs	p.S5573fs	OBSCN_uc001hsn.1_Frame_Shift_Ins_p.S5573fs|OBSCN_uc001hsr.1_Frame_Shift_Ins_p.S201fs	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	5573					apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			large_intestine(7)|breast(5)|ovary(4)|skin(2)|stomach(1)|central_nervous_system(1)|pancreas(1)	21		Prostate(94;0.0405)							p.S5573fs(SNU1040-Tumor)|p.S5573fs(RL952-Tumor)	4006				0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	226591624	226591625	11217	1	-	C	C	50	50	OBSCN	C	5	5
MYO18B	84700	broad.mit.edu	36	22	24753086	24753096	+	Frame_Shift_Del	DEL	TCGGAGGCGGT	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:24753086_24753096delTCGGAGGCGGT	uc003abz.1	+	c.7146_7156delTCGGAGGCGGT	c.(7144-7158)CCTCGGAGGCGGTGTfs	p.P2382fs	MYO18B_uc003aca.1_Frame_Shift_Del_p.P2263fs|MYO18B_uc010guy.1_Frame_Shift_Del_p.P2264fs|MYO18B_uc010guz.1_Frame_Shift_Del_p.P2262fs|MYO18B_uc010gva.1_Frame_Shift_Del_p.P365fs|MYO18B_uc010gvb.1_Non-coding_Transcript	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2382_2386						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12									p.R2385Q(CW2-Tumor)|p.R2384K(HUT102-Tumor)	968				0.43			133	173				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	24753086	24753096	10461	22	TCGGAGGCGGT	-	-	54	54	MYO18B	-	5	5
SEZ6L	23544	broad.mit.edu	36	22	25091352	25091371	+	Frame_Shift_Del	DEL	GCATGTGACAACCCAGGGCT	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:25091352_25091371delGCATGTGACAACCCAGGGCT	uc003acb.1	+	c.2614_2633delGCATGTGACAACCCAGGGCT	c.(2614-2634)GCATGTGACAACCCAGGGCTGfs	p.A872fs	SEZ6L_uc003acc.1_Frame_Shift_Del_p.A872fs|SEZ6L_uc003acd.1_Frame_Shift_Del_p.A808fs|SEZ6L_uc003ace.1_Intron|SEZ6L_uc003acf.1_Frame_Shift_Del_p.A645fs|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	872_878	Sushi 5.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6														0.48			44	47				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	25091352	25091371	14632	22	GCATGTGACAACCCAGGGCT	-	-	42	42	SEZ6L	-	5	5
PRKD3	23683	broad.mit.edu	36	2	37337348	37337348	+	Frame_Shift_Del	DEL	T	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:37337348_37337348delT	uc002rqd.1	-	c.2374_2374delA	c.(2374-2376)ATGfs	p.M792fs	PRKD3_uc002rqe.1_Frame_Shift_Del_p.M392fs	NM_005813	NP_005804	O94806	KPCD3_HUMAN	protein kinase D3	792	Protein kinase.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|protein phosphorylation	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)				Melanoma(80;621 1355 8613 11814 51767)				569				0.45			9	11				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	37337348	37337348	12963	2	T	-	-	49	49	PRKD3	-	5	5
SLC1A4	6509	broad.mit.edu	36	2	65070689	65070701	+	Frame_Shift_Del	DEL	GTTCATCATCAAG	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:65070689_65070701delGTTCATCATCAAG	uc002sdg.1	+	c.408_420delGTTCATCATCAAG	c.(406-420)GCGTTCATCATCAAGfs	p.A136fs	SLC1A4_uc010fcv.1_Frame_Shift_Del_p.A136fs	NM_003038	NP_003029	P43007	SATT_HUMAN	solute carrier family 1, member 4 isoform 1	136_140	Extracellular (Potential).				cellular nitrogen compound metabolic process|cognition|synaptic transmission, glutamatergic	integral to plasma membrane|intermediate filament|melanosome	chloride channel activity|L-alanine transmembrane transporter activity|L-cystine transmembrane transporter activity|L-hydroxyproline transmembrane transporter activity|L-proline transmembrane transporter activity|L-serine transmembrane transporter activity|L-threonine transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(1)	1					L-Alanine(DB00160)									0.83			34	7				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	65070689	65070701	14930	2	GTTCATCATCAAG	-	-	40	40	SLC1A4	-	5	5
COL8A1	1295	broad.mit.edu	36	3	100996245	100996254	+	Frame_Shift_Del	DEL	AGTGGGCAAA	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:100996245_100996254delAGTGGGCAAA	uc003dti.1	+	c.813_822delAGTGGGCAAA	c.(811-822)GGAGTGGGCAAAfs	p.G271fs	COL8A1_uc003dtg.1_Frame_Shift_Del_p.G270fs|COL8A1_uc003dth.1_Frame_Shift_Del_p.G270fs	NM_020351	NP_065084	P27658	CO8A1_HUMAN	alpha 1 type VIII collagen precursor	270_273	Triple-helical region (COL1).				angiogenesis|cell adhesion	basement membrane|collagen type VIII					0														0.76			13	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	100996245	100996254	3843	3	AGTGGGCAAA	-	-	11	11	COL8A1	-	5	5
MST1	4485	broad.mit.edu	36	3	49697501	49697502	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:49697501_49697502insC	uc003cxg.1	-	c.1527_1528insG	c.(1525-1530)GGGTCTfs	p.G509fs		NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	509_510	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GBM(110;181 1524 8005 22865 46297)								0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	49697501	49697502	10283	3	-	C	C	10	10	MST1	C	5	5
ASB5	140458	broad.mit.edu	36	4	177383409	177383410	+	Frame_Shift_Ins	INS	-	AA	AA			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:177383409_177383410insAA	uc003iuq.1	-	c.273_274insTT	c.(271-276)TCACAGfs	p.S91fs	ASB5_uc003iup.1_Frame_Shift_Ins_p.S38fs	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein	91_92	ANK 1.				intracellular signal transduction						0		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)										0.52			44	41				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	177383409	177383410	1044	4	-	AA	AA	48	48	ASB5	AA	5	5
LIMCH1	22998	broad.mit.edu	36	4	41057668	41057669	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:41057668_41057669insC	uc003gvu.2	+	c.54_55insC	c.(52-57)CCGCCCfs	p.P18fs	LIMCH1_uc003gvt.1_5'UTR|LIMCH1_uc003gvv.2_Frame_Shift_Ins_p.P18fs|LIMCH1_uc003gvw.2_Frame_Shift_Ins_p.P18fs|LIMCH1_uc003gvx.2_Frame_Shift_Ins_p.P18fs|LIMCH1_uc003gwe.2_Frame_Shift_Ins_p.P18fs	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a	18_19					actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)	3														0.38			3	5				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	41057668	41057669	9123	4	-	C	C	38	38	LIMCH1	C	5	5
SIL1	64374	broad.mit.edu	36	5	138314851	138314852	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:138314851_138314852insC	uc003ldm.1	-	c.936_937insG	c.(934-939)GGGCTGfs	p.G312fs	SIL1_uc003ldn.1_Frame_Shift_Ins_p.G311fs|SIL1_uc003ldo.1_Frame_Shift_Ins_p.G312fs|SIL1_uc003ldp.1_Frame_Shift_Ins_p.G312fs	NM_022464	NP_071909	Q9H173	SIL1_HUMAN	SIL1 protein precursor	312_313					intracellular protein transport|protein folding|transmembrane transport	endoplasmic reticulum lumen	unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)											0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	138314851	138314852	14816	5	-	C	C	34	34	SIL1	C	5	5
PCDHB16	57717	broad.mit.edu	36	5	140542647	140542649	+	In_Frame_Del	DEL	TGG	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140542647_140542649delTGG	uc003liv.1	+	c.329_331delTGG	c.(328-333)ATGGAA>AAA	p.110_111ME>K	PCDHB16_uc010jfw.1_Intron	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	110_111	Extracellular (Potential).|Cadherin 1.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)											0.62			74	46				---	---	---	---	capture_indel			In_Frame_Del	DEL	140542647	140542649	11961	5	TGG	-	-	51	51	PCDHB16	-	5	5
PIK3R1	5295	broad.mit.edu	36	5	67624979	67624981	+	In_Frame_Del	DEL	TAA	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:67624979_67624981delTAA	uc003jva.1	+	c.1211_1213delTAA	c.(1210-1215)TTAATA>TTA	p.I405del	PIK3R1_uc003jvb.1_In_Frame_Del_p.I405del|PIK3R1_uc003jvc.1_In_Frame_Del_p.I105del|PIK3R1_uc003jvd.1_In_Frame_Del_p.I135del|PIK3R1_uc003jve.1_In_Frame_Del_p.I84del	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	405	SH2 1.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(5)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	99		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)					370	TCGA GBM(4;<1E-8)			0.57			35	26				---	---	---	---	capture_indel			In_Frame_Del	DEL	67624979	67624981	12342	5	TAA	-	-	61	61	PIK3R1	-	5	5
TRIM24	8805	broad.mit.edu	36	7	137915953	137915957	+	Frame_Shift_Del	DEL	GTTAA	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:137915953_137915957delGTTAA	uc003vuc.1	+	c.2692_2696delGTTAA	c.(2692-2697)GTTAAGfs	p.V898fs	TRIM24_uc003vub.1_Frame_Shift_Del_p.V864fs	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha	898_899	Nuclear localization signal (Potential).				cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(2)|ovary(1)|breast(1)	4						Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)				258				0.38			88	141				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	137915953	137915957	17042	7	GTTAA	-	-	48	48	TRIM24	-	5	5
DLC1	10395	broad.mit.edu	36	8	12987689	12987698	+	Stop_Codon_Del	DEL	GATCACCTAG	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:12987689_12987698delGATCACCTAG	uc003wwm.1	-				DLC1_uc003wwl.1_Stop_Codon_Del|DLC1_uc003wwk.1_Stop_Codon_Del	NM_182643	NP_872584			deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7									p.S1527Y(HCC1359-Tumor)	739				0.36			168	300				---	---	---	---	capture_indel			Stop_Codon_Del	DEL	12987689	12987698	4730	8	GATCACCTAG	-	-	45	45	DLC1	-	5	5
KIFC2	90990	broad.mit.edu	36	8	145663402	145663405	+	Frame_Shift_Del	DEL	GGTC	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:145663402_145663405delGGTC	uc003zcz.1	+	c.339_342delGGTC	c.(337-342)GAGGTCfs	p.E113fs	CYHR1_uc003zcv.2_5'Flank|CYHR1_uc003zcw.2_5'Flank|CYHR1_uc003zcx.2_5'Flank|CYHR1_uc003zcy.2_5'Flank	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	kinesin family member C2	113_114					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)									OREG0019057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.33			9	18				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	145663402	145663405	8624	8	GGTC	-	-	35	35	KIFC2	-	5	5
C9orf114	51490	broad.mit.edu	36	9	130625981	130625981	+	Frame_Shift_Del	DEL	C	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:130625981_130625981delC	uc004bwd.1	-	c.928_928delG	c.(928-930)GTGfs	p.V310fs	C9orf114_uc010mym.1_Non-coding_Transcript|C9orf114_uc004bwe.1_Intron	NM_016390	NP_057474	Q5T280	CI114_HUMAN	hypothetical protein LOC51490	310											0														0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	130625981	130625981	2562	9	C	-	-	18	18	C9orf114	-	5	5
IFNA17	3451	broad.mit.edu	36	9	21217721	21217732	+	In_Frame_Del	DEL	GTGATTCTTTGG	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:21217721_21217732delGTGATTCTTTGG	uc003zos.1	-	c.441_452delCCAAAGAATCAC	c.(439-453)TTCCAAAGAATCACT>TTT	p.QRIT148del	IFNA14_uc003zoo.1_Intron	NM_021268	NP_067091	P01571	IFN17_HUMAN	interferon, alpha 17	148_151					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding				0				Lung(24;2.13e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)										0.50			12	12				---	---	---	---	capture_indel			In_Frame_Del	DEL	21217721	21217732	7837	9	GTGATTCTTTGG	-	-	36	36	IFNA17	-	5	5
KDM5C	8242	broad.mit.edu	36	X	53247614	53247626	+	Frame_Shift_Del	DEL	CGGCGGTAGTGCT	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:53247614_53247626delCGGCGGTAGTGCT	uc004drz.1	-	c.1892_1904delAGCACTACCGCCG	c.(1891-1905)GAGCACTACCGCCGGfs	p.E631fs	KDM5C_uc004dsa.1_Frame_Shift_Del_p.E630fs|KDM5C_uc010nkb.1_Frame_Shift_Del_p.E56fs	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C	631_635					chromatin modification|oxidation-reduction process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18														0.41			38	54				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	53247614	53247626	8441	23	CGGCGGTAGTGCT	-	-	23	23	KDM5C	-	5	5
STARD8	9754	broad.mit.edu	36	X	67853924	67853935	+	In_Frame_Del	DEL	GCGTCCTCACCG	-	-			TCGA-14-1396-01	TCGA-14-1396-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:67853924_67853935delGCGTCCTCACCG	uc004dxb.1	+	c.443_454delGCGTCCTCACCG	c.(442-456)AGCGTCCTCACCGAG>AAG	p.148_152SVLTE>K	STARD8_uc004dxa.1_In_Frame_Del_p.68_72SVLTE>K|STARD8_uc004dxc.2_In_Frame_Del_p.68_72SVLTE>K	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	68_72					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6														0.37			29	49				---	---	---	---	capture_indel			In_Frame_Del	DEL	67853924	67853935	15782	23	GCGTCCTCACCG	-	-	34	34	STARD8	-	5	5
