Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
SLK	9748	broad.mit.edu	36	10	105751190	105751190	+	Splice_Site_SNP	SNP	A	C	C			TCGA-15-1446-01	TCGA-15-1446-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:105751190A>C	uc001kxo.1	+	c.e8_splice_site			SLK_uc001kxp.1_Splice_Site_SNP	NM_014720	NP_055535			serine/threonine kinase 2						apoptosis|nucleotide-excision repair|protein phosphorylation	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity			ovary(2)|lung(1)|kidney(1)	4		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		NSCLC(111;540 1651 1927 4474 17706)				837				0.186047	8.86806	12.855949	8	35	AA		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	105751190	105751190	15246	10	A	C	C	7	7	SLK	C	5	4
GAD2	2572	broad.mit.edu	36	10	26546882	26546882	+	Missense_Mutation	SNP	G	T	T			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:26546882G>T	uc001isp.1	+	c.242G>T	c.(241-243)AGC>ATC	p.S81I	GAD2_uc001isq.1_Missense_Mutation_p.S81I|GAD2_uc009xkr.1_Missense_Mutation_p.S81I	NM_000818	NP_000809	Q05329	DCE2_HUMAN	glutamate decarboxylase 2	81					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)	1					L-Glutamic Acid(DB00142)									0.571429	11.699715	11.730701	4	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26546882	26546882	6431	10	G	T	T	34	34	GAD2	T	3	3
RET	5979	broad.mit.edu	36	10	42930188	42930190	+	Missense_Mutation	TNP	CTG	ACC	ACC			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:42930188_42930190CTG>ACC	uc001jal.1	+	c.2134_2136CTG>ACC	c.(2134-2136)CTG>ACC	p.L712T	RET_uc001jak.1_Missense_Mutation_p.L712T	NM_020975	NP_066124	P07949	RET_HUMAN	ret proto-oncogene isoform a	712	Cytoplasmic (Potential).	Breakpoint for translocation to form PCM1-RET; RET-CCDC6; RET-GOLGA5; RET- TRIM24 and RET-TRIM33 oncogenes.			homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development|protein phosphorylation	integral to membrane	ATP binding|calcium ion binding|transcription activator activity|transmembrane receptor protein tyrosine kinase activity			thyroid(381)|adrenal_gland(20)|lung(6)|large_intestine(5)|ovary(4)|central_nervous_system(3)|urinary_tract(1)	420		Ovarian(717;0.0423)			Sunitinib(DB01268)	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		1		536				0.8	8.695519	9.108299	4	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	42930188	42930190	13705	10	CTG	ACC	ACC	24	24	RET	ACC	3	3
EGR2	1959	broad.mit.edu	36	10	64243335	64243335	+	Missense_Mutation	SNP	G	T	T			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:64243335G>T	uc001jmi.1	-	c.1069C>A	c.(1069-1071)CTG>ATG	p.L357M	EGR2_uc001jmh.1_Missense_Mutation_p.L299M|EGR2_uc009xph.1_Missense_Mutation_p.L357M	NM_000399	NP_000390	P11161	EGR2_HUMAN	early growth response 2 protein isoform a	357	C2H2-type 1.				fat cell differentiation|gene-specific transcription from RNA polymerase II promoter	nucleus	DNA binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding|zinc ion binding			ovary(2)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)													0.3	10.032893	10.753981	6	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64243335	64243335	5161	10	G	T	T	34	34	EGR2	T	3	3
TET1	80312	broad.mit.edu	36	10	70003988	70003988	+	Missense_Mutation	SNP	G	C	C			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:70003988G>C	uc001jok.2	+	c.1887G>C	c.(1885-1887)AAG>AAC	p.K629N		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	629					DNA demethylation|inner cell mass cell differentiation|oxidation-reduction process|stem cell maintenance	nucleus	iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)	5										280				0.173913	8.861058	13.498651	8	38	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70003988	70003988	16296	10	G	C	C	33	33	TET1	C	3	3
KCNMA1	3778	broad.mit.edu	36	10	78374728	78374728	+	Missense_Mutation	SNP	C	A	A			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:78374728C>A	uc001jxn.1	-	c.2711G>T	c.(2710-2712)GGT>GTT	p.G904V	KCNMA1_uc001jxj.1_Missense_Mutation_p.G850V|KCNMA1_uc009xrt.1_Missense_Mutation_p.G695V|KCNMA1_uc001jxm.1_Missense_Mutation_p.G846V|KCNMA1_uc001jxo.1_Missense_Mutation_p.G887V|KCNMA1_uc001jxk.1_Missense_Mutation_p.G522V|KCNMA1_uc001jxl.1_Missense_Mutation_p.G529V	NM_002247	NP_002238	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium	904	Cytoplasmic (Potential).				cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|catalytic activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)									0.238095	6.758044	8.082421	5	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	78374728	78374728	8378	10	C	A	A	18	18	KCNMA1	A	3	3
KCNMA1	3778	broad.mit.edu	36	10	78441805	78441805	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:78441805G>A	uc001jxn.1	-	c.2018C>T	c.(2017-2019)GCA>GTA	p.A673V	KCNMA1_uc001jxj.1_Missense_Mutation_p.A677V|KCNMA1_uc009xrt.1_Missense_Mutation_p.A493V|KCNMA1_uc001jxm.1_Missense_Mutation_p.A673V|KCNMA1_uc001jxo.1_Missense_Mutation_p.A673V|KCNMA1_uc001jxk.1_Missense_Mutation_p.A288V|KCNMA1_uc001jxl.1_Missense_Mutation_p.A327V	NM_002247	NP_002238	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium	673	Cytoplasmic (Potential).				cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|catalytic activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)									0.15	7.15778	18.969663	15	85	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	78441805	78441805	8378	10	G	A	A	46	46	KCNMA1	A	2	2
KIF11	3832	broad.mit.edu	36	10	94399697	94399697	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:94399697G>A	uc001kic.1	+	c.2896G>A	c.(2896-2898)GAA>AAA	p.E966K		NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11	966					blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding				0						Colon(47;212 1003 2764 4062 8431)								0.216216	6.931413	9.74959	8	29	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	94399697	94399697	8583	10	G	A	A	33	33	KIF11	A	2	2
DSCAML1	57453	broad.mit.edu	36	11	116819820	116819820	+	Missense_Mutation	SNP	G	T	T			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:116819820G>T	uc001prh.1	-	c.4034C>A	c.(4033-4035)GCT>GAT	p.A1345D		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1285	Extracellular (Potential).|Ig-like C2-type 10.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)	5	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)										0.434211	92.255856	92.543225	33	43	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116819820	116819820	4953	11	G	T	T	34	34	DSCAML1	T	3	3
ABCG4	64137	broad.mit.edu	36	11	118534771	118534771	+	Missense_Mutation	SNP	C	G	G			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:118534771C>G	uc001pvs.1	+	c.1359C>G	c.(1357-1359)TTC>TTG	p.F453L	ABCG4_uc009zar.1_Missense_Mutation_p.F453L	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN	ATP-binding cassette, subfamily G, member 4	453	ABC transmembrane type-2.|Cytoplasmic (Potential).				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)										0.148515	11.436684	23.462466	15	86	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118534771	118534771	71	11	C	G	G	29	29	ABCG4	G	3	3
PLEKHA7	144100	broad.mit.edu	36	11	16795335	16795335	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:16795335G>A	uc001mmo.1	-	c.1454C>T	c.(1453-1455)TCG>TTG	p.S485L	PLEKHA7_uc001mmn.1_Missense_Mutation_p.S193L	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A	485					epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(1)	1														0.244898	23.26544	26.180634	12	37	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16795335	16795335	12487	11	G	A	A	37	37	PLEKHA7	A	1	1
GDPD4	220032	broad.mit.edu	36	11	76605978	76605978	+	Missense_Mutation	SNP	C	T	T			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:76605978C>T	uc001oyf.1	-	c.1555G>A	c.(1555-1557)GAT>AAT	p.D519N		NM_182833	NP_878253	Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain	Error:Variant_position_missing_in_Q6W3E5_after_alignment					glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding				0														0.405405	137.75082	138.619602	45	66	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	76605978	76605978	6594	11	C	T	T	32	32	GDPD4	T	2	2
WSCD2	9671	broad.mit.edu	36	12	107128056	107128056	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:107128056G>A	uc001tms.1	+	c.526G>A	c.(526-528)GGC>AGC	p.G176S	WSCD2_uc001tmt.1_Missense_Mutation_p.G176S	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	176	WSC 1.					integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3														0.5	12.400093	12.400093	4	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	107128056	107128056	17981	12	G	A	A	39	39	WSCD2	A	1	1
OAS2	4939	broad.mit.edu	36	12	111931357	111931357	+	Missense_Mutation	SNP	G	T	T			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:111931357G>T	uc001tuj.1	+	c.1978G>T	c.(1978-1980)GCA>TCA	p.A660S	OAS2_uc001tui.1_Missense_Mutation_p.A660S	NM_016817	NP_058197	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2 isoform 1	660	OAS domain 2.				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|membrane|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(1)	1						Pancreas(199;709 2232 18410 33584 35052)								0.099174	6.715565	26.157675	12	109	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	111931357	111931357	11205	12	G	T	T	34	34	OAS2	T	3	3
FBXW8	26259	broad.mit.edu	36	12	115946443	115946443	+	Silent	SNP	C	T	T			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:115946443C>T	uc001twg.1	+	c.1476C>T	c.(1474-1476)GGC>GGT	p.G492G	FBXW8_uc001twf.1_Silent_p.G426G|FBXW8_uc009zwp.1_Non-coding_Transcript	NM_153348	NP_699179	Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8 isoform	492	WD 5.						protein binding			ovary(2)|pancreas(1)	3	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)										0.200906	289.250368	344.291294	133	529	CC		KEEP	---	---	---	---	capture			Silent	SNP	115946443	115946443	6007	12	C	T	T	27	27	FBXW8	T	1	1
KDM2B	84678	broad.mit.edu	36	12	120366297	120366297	+	Silent	SNP	C	T	T			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:120366297C>T	uc001uat.1	-	c.2352G>A	c.(2350-2352)AAG>AAA	p.K784K	KDM2B_uc001uas.1_Silent_p.K753K|KDM2B_uc009zxe.1_Silent_p.K753K|KDM2B_uc001uau.1_Intron|KDM2B_uc009zxf.1_Silent_p.K784K|KDM2B_uc001uao.1_Silent_p.K32K|KDM2B_uc001uap.1_Non-coding_Transcript|KDM2B_uc001uaq.1_Silent_p.K224K|KDM2B_uc001uar.1_Silent_p.K375K	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	784					oxidation-reduction process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)	1												OREG0022201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.304762	82.955003	86.529512	32	73	CC		KEEP	---	---	---	---	capture			Silent	SNP	120366297	120366297	8431	12	C	T	T	24	24	KDM2B	T	2	2
GRIN2B	2904	broad.mit.edu	36	12	13616112	13616112	+	Silent	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:13616112G>A	uc001rbt.2	-	c.2064C>T	c.(2062-2064)AAC>AAT	p.N688N		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	688	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|lung(2)|skin(1)	10					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)				p.N688N(HS895.T-Tumor)	371				0.105431	18.438858	66.918982	33	280	GG		KEEP	---	---	---	---	capture			Silent	SNP	13616112	13616112	7059	12	G	A	A	40	40	GRIN2B	A	1	1
METTL7A	25840	broad.mit.edu	36	12	49605433	49605433	+	Silent	SNP	A	C	C			TCGA-15-1446-01	TCGA-15-1446-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:49605433A>C	uc001rxb.1	+	c.345A>C	c.(343-345)CGA>CGC	p.R115R	METTL7A_uc001rwz.2_Non-coding_Transcript|METTL7A_uc001rxa.1_Non-coding_Transcript	NM_014033	NP_054752	Q9H8H3	MET7A_HUMAN	methyltransferase like 7A	115						endoplasmic reticulum|lipid particle|membrane	methyltransferase activity				0														0.410526	118.603929	119.268844	39	56	AA		KEEP	---	---	---	---	capture			Silent	SNP	49605433	49605433	9895	12	A	C	C	10	10	METTL7A	C	4	4
STAT2	6773	broad.mit.edu	36	12	55036562	55036562	+	Missense_Mutation	SNP	G	C	C			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:55036562G>C	uc001slc.1	-	c.61C>G	c.(61-63)CTT>GTT	p.L21V	STAT2_uc001sld.1_Missense_Mutation_p.L21V	NM_005419	NP_005410	P52630	STAT2_HUMAN	signal transducer and activator of transcription	21					interspecies interaction between organisms|JAK-STAT cascade|regulation of transcription from RNA polymerase II promoter|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	cytosol|nucleoplasm|plasma membrane	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3														0.197183	33.716182	39.775333	14	57	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55036562	55036562	15785	12	G	C	C	34	34	STAT2	C	3	3
SLC17A8	246213	broad.mit.edu	36	12	99338020	99338020	+	Silent	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:99338020G>A	uc001tho.1	+	c.1722G>A	c.(1720-1722)GAG>GAA	p.E574E	SLC17A8_uc009ztx.1_Silent_p.E524E	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent	574	Cytoplasmic (Potential).				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3														0.352941	34.688883	35.337619	12	22	GG		KEEP	---	---	---	---	capture			Silent	SNP	99338020	99338020	14919	12	G	A	A	34	34	SLC17A8	A	2	2
OR11H6	122748	broad.mit.edu	36	14	19761997	19761997	+	Missense_Mutation	SNP	C	A	A			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:19761997C>A	uc001vwr.1	+	c.289C>A	c.(289-291)CCA>ACA	p.P97T		NM_001004480	NP_001004480	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H,	97	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)										0.121622	11.226881	21.609663	9	65	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19761997	19761997	11335	14	C	A	A	22	22	OR11H6	A	3	3
PSMB11	122706	broad.mit.edu	36	14	22581494	22581494	+	Missense_Mutation	SNP	T	A	A			TCGA-15-1446-01	TCGA-15-1446-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:22581494T>A	uc010ake.1	+	c.220T>A	c.(220-222)TAT>AAT	p.Y74N		NM_001099780	NP_001093250	A5LHX3	PSB11_HUMAN	proteasome subunit beta5t	74					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)										0.285714	6.587362	7.16947	4	10	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22581494	22581494	13129	14	T	A	A	53	53	PSMB11	A	4	4
CDH24	64403	broad.mit.edu	36	14	22587411	22587411	+	Missense_Mutation	SNP	T	C	C			TCGA-15-1446-01	TCGA-15-1446-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:22587411T>C	uc001wil.1	-	c.2078A>G	c.(2077-2079)GAG>GGG	p.E693G	CDH24_uc001wik.2_Non-coding_Transcript|CDH24_uc010akf.1_Missense_Mutation_p.E655G|CDH24_uc001wim.1_Missense_Mutation_p.E655G	NM_022478	NP_071923	Q86UP0	CAD24_HUMAN	cadherin-like 24 isoform 1	693	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|cell-cell adhesion|homophilic cell adhesion	cell-cell junction|cell-cell junction|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|delta-catenin binding			central_nervous_system(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)										0.189189	10.498676	13.851105	7	30	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22587411	22587411	3238	14	T	C	C	54	54	CDH24	C	4	4
FITM1	161247	broad.mit.edu	36	14	23671343	23671343	+	Missense_Mutation	SNP	G	T	T			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:23671343G>T	uc001wmf.1	+	c.350G>T	c.(349-351)CGC>CTC	p.R117L		NM_203402	NP_981947	A5D6W6	FITM1_HUMAN	fat-inducing transcript 1	117	Extracellular (Potential).				lipid particle organization|positive regulation of sequestering of triglyceride	endoplasmic reticulum membrane|integral to membrane					0														0.177215	85.316819	108.574178	42	195	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23671343	23671343	6136	14	G	T	T	38	38	FITM1	T	3	3
C15orf53	400359	broad.mit.edu	36	15	36777714	36777714	+	Silent	SNP	T	C	C			TCGA-15-1446-01	TCGA-15-1446-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr15:36777714T>C	uc001zkf.1	+	c.216T>C	c.(214-216)GAT>GAC	p.D72D		NM_207444	NP_997327	Q8NAA6	CO053_HUMAN	hypothetical protein LOC400359	72											0		all_cancers(109;1.75e-13)|all_epithelial(112;1.02e-11)|Lung NSC(122;1.9e-09)|all_lung(180;4.04e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)		GBM - Glioblastoma multiforme(113;8.39e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0321)										0.157895	6.729035	13.120314	9	48	TT		KEEP	---	---	---	---	capture			Silent	SNP	36777714	36777714	1851	15	T	C	C	51	51	C15orf53	C	4	4
PRTG	283659	broad.mit.edu	36	15	53716674	53716674	+	Missense_Mutation	SNP	A	C	C			TCGA-15-1446-01	TCGA-15-1446-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr15:53716674A>C	uc002adg.1	-	c.2609T>G	c.(2608-2610)GTC>GGC	p.V870G		NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin	870	Fibronectin type-III 5.				multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)	2				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)										0.157895	6.614595	8.733175	3	16	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53716674	53716674	13089	15	A	C	C	10	10	PRTG	C	4	4
ZNF609	23060	broad.mit.edu	36	15	62579337	62579337	+	Silent	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:62579337G>A	uc002ann.1	+	c.666G>A	c.(664-666)GCG>GCA	p.A222A	ZNF609_uc010bgy.1_Silent_p.A222A	NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609	222						nucleus	zinc ion binding			ovary(1)	1														0.126984	10.054217	18.612109	8	55	GG		KEEP	---	---	---	---	capture			Silent	SNP	62579337	62579337	18630	15	G	A	A	38	38	ZNF609	A	1	1
MAN2A2	4122	broad.mit.edu	36	15	89253709	89253709	+	Missense_Mutation	SNP	T	G	G			TCGA-15-1446-01	TCGA-15-1446-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr15:89253709T>G	uc010bnz.1	+	c.1345T>G	c.(1345-1347)TTC>GTC	p.F449V	MAN2A2_uc002bqa.1_Non-coding_Transcript|MAN2A2_uc002bqb.1_Non-coding_Transcript|MAN2A2_uc002bqc.1_Missense_Mutation_p.F449V|MAN2A2_uc010boa.1_Missense_Mutation_p.F491V	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	449	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)											0.16	7.657525	13.184432	8	42	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	89253709	89253709	9598	15	T	G	G	56	56	MAN2A2	G	4	4
TMC5	79838	broad.mit.edu	36	16	19379125	19379125	+	Silent	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:19379125G>A	uc002dgc.2	+	c.1116G>A	c.(1114-1116)CAG>CAA	p.Q372Q	TMC5_uc002dgb.2_Silent_p.Q372Q|TMC5_uc002dgd.1_Silent_p.Q126Q|TMC5_uc002dge.2_Silent_p.Q126Q|TMC5_uc002dgf.2_Silent_p.Q34Q|TMC5_uc002dgg.2_Silent_p.Q13Q	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a	372	Extracellular (Potential).					integral to membrane					0														0.285714	16.840838	17.706412	6	15	GG		KEEP	---	---	---	---	capture			Silent	SNP	19379125	19379125	16518	16	G	A	A	34	34	TMC5	A	2	2
HIRIP3	8479	broad.mit.edu	36	16	29912965	29912966	+	Missense_Mutation	DNP	CT	GA	GA			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:29912965_29912966CT>GA	uc002dve.1	-	c.1001_1002AG>TC	c.(1000-1002)GAG>GTC	p.E334V	BOLA2_uc010bzb.1_Intron|BOLA2_uc010bzc.1_Intron|HIRIP3_uc002dvf.1_Intron|HIRIP3_uc010bzn.1_Intron|INO80E_uc002dvg.1_5'Flank|INO80E_uc002dvh.1_5'Flank|INO80E_uc002dvi.1_5'Flank|INO80E_uc002dvj.1_5'Flank|INO80E_uc002dvk.1_5'Flank	NM_003609	NP_003600	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3	334					chromatin assembly or disassembly	nucleus	protein binding				0														0.166667	20.868799	32.281604	18	90	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	29912965	29912966	7406	16	CT	GA	GA	24	24	HIRIP3	GA	3	3
PLA2G15	23659	broad.mit.edu	36	16	66850604	66850604	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:66850604G>A	uc002evr.1	+	c.782G>A	c.(781-783)CGG>CAG	p.R261Q	PLA2G15_uc002evs.1_Missense_Mutation_p.R82Q	NM_012320	NP_036452	Q8NCC3	PAG15_HUMAN	lysophospholipase 3 (lysosomal phospholipase	261					fatty acid catabolic process	extracellular region|lysosome	lysophospholipase activity|phosphatidylcholine-sterol O-acyltransferase activity|phospholipid binding			ovary(1)	1														0.241803	241.91813	271.614205	118	370	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66850604	66850604	12418	16	G	A	A	39	39	PLA2G15	A	1	1
ERBB2	2064	broad.mit.edu	36	17	35137087	35137087	+	Missense_Mutation	SNP	A	C	C			TCGA-15-1446-01	TCGA-15-1446-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:35137087A>C	uc002hso.1	+	c.3173A>C	c.(3172-3174)GAC>GCC	p.D1058A	ERBB2_uc002hsm.1_Missense_Mutation_p.D1028A|ERBB2_uc002hsp.1_Missense_Mutation_p.D861A|ERBB2_uc010cwb.1_Intron	NM_004448	NP_001005862	P04626	ERBB2_HUMAN	erbB-2 isoform a	1058	Cytoplasmic (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(71)|central_nervous_system(16)|ovary(13)|stomach(12)|breast(5)|upper_aerodigestive_tract(4)|large_intestine(3)|liver(3)|endometrium(2)|pancreas(1)	130	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)			1		271	TCGA GBM(5;<1E-8)			0.263158	6.649011	7.630414	5	14	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35137087	35137087	5399	17	A	C	C	10	10	ERBB2	C	4	4
KRT15	3866	broad.mit.edu	36	17	36926712	36926712	+	Silent	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:36926712G>A	uc002hwy.1	-	c.612C>T	c.(610-612)GGC>GGT	p.G204G	KRT15_uc002hwz.1_Silent_p.G106G|KRT15_uc002hxa.1_Silent_p.G39G|KRT15_uc002hxb.1_Silent_p.G39G	NM_002275	NP_002266	P19012	K1C15_HUMAN	keratin 15	204	Rod.|Coil 1B.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000286)												0.145455	13.069598	19.718016	8	47	GG		KEEP	---	---	---	---	capture			Silent	SNP	36926712	36926712	8767	17	G	A	A	38	38	KRT15	A	1	1
CDC27	996	broad.mit.edu	36	17	42571105	42571105	+	Missense_Mutation	SNP	T	G	G			TCGA-15-1446-01	TCGA-15-1446-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:42571105T>G	uc002ile.2	-	c.1721A>C	c.(1720-1722)GAG>GCG	p.E574A	CDC27_uc002ild.2_Missense_Mutation_p.E568A|CDC27_uc002ilf.2_Missense_Mutation_p.E567A	NM_001114091	NP_001107563	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 1	568	TPR 4.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein binding			lung(2)|breast(2)|ovary(1)	5														0.24359	22.02634	26.765352	19	59	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42571105	42571105	3194	17	T	G	G	54	54	CDC27	G	4	4
LAMA3	3909	broad.mit.edu	36	18	19660752	19660752	+	Missense_Mutation	SNP	C	T	T			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:19660752C>T	uc002kuq.1	+	c.2660C>T	c.(2659-2661)CCC>CTC	p.P887L	LAMA3_uc002kur.1_Missense_Mutation_p.P887L	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	887	Domain IV 1 (domain IV B).				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|central_nervous_system(1)	9	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)									0.363636	7.790648	7.97301	4	7	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19660752	19660752	8930	18	C	T	T	22	22	LAMA3	T	2	2
OR10H4	126541	broad.mit.edu	36	19	15921427	15921427	+	Missense_Mutation	SNP	G	C	C			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:15921427G>C	uc002nbv.1	+	c.610G>C	c.(610-612)GTG>CTG	p.V204L		NM_001004465	NP_001004465	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H,	204	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2														0.088115	27.161063	110.849318	43	445	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15921427	15921427	11314	19	G	C	C	44	44	OR10H4	C	3	3
NCAN	1463	broad.mit.edu	36	19	19217164	19217164	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:19217164G>A	uc002nlz.1	+	c.3535G>A	c.(3535-3537)GCG>ACG	p.A1179T	NCAN_uc002nma.1_Intron	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3	1179	C-type lectin.				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)											0.282486	648.375345	686.000608	250	635	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19217164	19217164	10603	19	G	A	A	38	38	NCAN	A	1	1
GPATCH1	55094	broad.mit.edu	36	19	38294507	38294508	+	Missense_Mutation	DNP	GT	AA	AA			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:38294507_38294508GT>AA	uc002nug.1	+	c.1623_1624GT>AA	c.(1621-1626)GAGTGG>GAAAGG	p.W542R	GPATCH1_uc002nuh.1_5'Flank	NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	542					nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome	nucleic acid binding				0	Esophageal squamous(110;0.137)					Pancreas(67;88 1713 4567 18227)								0.263158	7.357419	8.329772	5	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	38294507	38294508	6864	19	GT	AA	AA	36	36	GPATCH1	AA	2	2
RYR1	6261	broad.mit.edu	36	19	43754597	43754597	+	Silent	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:43754597G>A	uc002oit.1	+	c.13845G>A	c.(13843-13845)GGG>GGA	p.G4615G	RYR1_uc002oiu.1_Silent_p.G4610G	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	4615					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)	10	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)									0.109589	9.254187	20.263836	8	65	GG		KEEP	---	---	---	---	capture			Silent	SNP	43754597	43754597	14248	19	G	A	A	43	43	RYR1	A	2	2
LILRB2	10288	broad.mit.edu	36	19	59472567	59472567	+	Silent	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:59472567G>A	uc002qfb.1	-	c.1389C>T	c.(1387-1389)ATC>ATT	p.I463I	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.1_Silent_p.I463I|LILRB2_uc010erj.1_Non-coding_Transcript|LILRB2_uc002qfc.1_Silent_p.I462I	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	463	Helical; (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)										0.204819	30.022909	36.745455	17	66	GG		KEEP	---	---	---	---	capture			Silent	SNP	59472567	59472567	9117	19	G	A	A	37	37	LILRB2	A	1	1
IL6R	3570	broad.mit.edu	36	1	152675096	152675096	+	Missense_Mutation	SNP	A	G	G			TCGA-15-1446-01	TCGA-15-1446-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:152675096A>G	uc001fez.1	+	c.835A>G	c.(835-837)ATC>GTC	p.I279V	IL6R_uc001ffa.1_Missense_Mutation_p.I279V	NM_000565	NP_000556	P08887	IL6RA_HUMAN	interleukin 6 receptor isoform 1 precursor	279	Fibronectin type-III.|Extracellular (Potential).			I->D: Complete loss of ligand-binding.	acute-phase response|ciliary neurotrophic factor-mediated signaling pathway|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|endocrine pancreas development|hepatic immune response|monocyte chemotaxis|negative regulation of collagen biosynthetic process|negative regulation of interleukin-8 production|neutrophil mediated immunity|positive regulation of activation of Janus kinase activity|positive regulation of anti-apoptosis|positive regulation of chemokine production|positive regulation of chemokine production|positive regulation of interleukin-6 production|positive regulation of leukocyte chemotaxis|positive regulation of leukocyte chemotaxis|positive regulation of MAPKKK cascade|positive regulation of osteoblast differentiation|positive regulation of smooth muscle cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of apoptosis	apical plasma membrane|basolateral plasma membrane|extracellular space|interleukin-6 receptor complex	ciliary neurotrophic factor binding|enzyme binding|protein homodimerization activity			ovary(3)|breast(1)	4	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)											0.5	20.230648	20.230648	10	10	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	152675096	152675096	8003	1	A	G	G	8	8	IL6R	G	4	4
XCL2	6846	broad.mit.edu	36	1	166776969	166776969	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:166776969G>A	uc001gfn.2	-	c.190C>T	c.(190-192)CGT>TGT	p.R64C		NM_003175	NP_003166	Q9UBD3	XCL2_HUMAN	chemokine (C motif) ligand 2	64					blood circulation|chemotaxis|immune response|signal transduction	extracellular space	chemokine activity			ovary(1)	1	all_hematologic(923;0.215)													0.247423	59.857495	65.487379	24	73	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	166776969	166776969	18005	1	G	A	A	40	40	XCL2	A	1	1
MR1	3140	broad.mit.edu	36	1	179288239	179288239	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:179288239G>A	uc001goq.1	+	c.850G>A	c.(850-852)GGT>AGT	p.G284S	MR1_uc001gor.1_Missense_Mutation_p.G239S|MR1_uc001gos.1_Intron	NM_001531	NP_001522	Q95460	HMR1_HUMAN	major histocompatibility complex, class	284	Extracellular (Potential).|Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I|immune response	endoplasmic reticulum|extracellular region|integral to membrane|MHC class I protein complex	MHC class I receptor activity				0						Colon(174;1412 1962 45296 46549 47110)								0.181818	53.121507	65.599291	24	108	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	179288239	179288239	10144	1	G	A	A	39	39	MR1	A	1	1
ZBTB41	360023	broad.mit.edu	36	1	195435944	195435944	+	Nonsense_Mutation	SNP	C	A	A			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:195435944C>A	uc001gtx.1	-	c.283G>T	c.(283-285)GAA>TAA	p.E95*	ZBTB41_uc009wyz.1_Non-coding_Transcript	NM_194314	NP_919290	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	95	BTB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2														0.146341	13.456224	23.330084	12	70	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	195435944	195435944	18129	1	C	A	A	30	30	ZBTB41	A	5	3
LYST	1130	broad.mit.edu	36	1	234040088	234040088	+	Missense_Mutation	SNP	G	T	T			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:234040088G>T	uc001hxj.1	-	c.653C>A	c.(652-654)GCT>GAT	p.A218D	LYST_uc009xgb.1_Non-coding_Transcript|LYST_uc001hxl.1_Missense_Mutation_p.A218D	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	218					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)											0.085937	8.653311	53.131477	22	234	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	234040088	234040088	9505	1	G	T	T	34	34	LYST	T	3	3
CCDC24	149473	broad.mit.edu	36	1	44230611	44230611	+	Silent	SNP	C	A	A			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:44230611C>A	uc001clj.1	+	c.267C>A	c.(265-267)CTC>CTA	p.L89L	CCDC24_uc001clk.2_Silent_p.L45L|CCDC24_uc009vxc.1_Silent_p.L53L	NM_152499	NP_689712	Q8N4L8	CCD24_HUMAN	coiled-coil domain containing 24	89											0	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)												0.363636	6.486297	6.670227	4	7	CC		KEEP	---	---	---	---	capture			Silent	SNP	44230611	44230611	2921	1	C	A	A	30	30	CCDC24	A	3	3
SON	6651	broad.mit.edu	36	21	33846539	33846539	+	Silent	SNP	C	G	G			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:33846539C>G	uc002yse.1	+	c.3132C>G	c.(3130-3132)GCC>GCG	p.A1044A	SON_uc002ysb.1_Silent_p.A1044A|SON_uc002ysc.1_Silent_p.A1044A|SON_uc002ysd.2_Silent_p.A35A|SON_uc002ysf.1_Intron|SON_uc002ysg.2_Silent_p.A35A	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	1044	14 X 6 AA repeats of [ED]-R-S-M-M-S.				anti-apoptosis	nuclear speck	DNA binding|double-stranded RNA binding			ovary(3)	3														0.227273	6.656472	8.167904	5	17	CC		KEEP	---	---	---	---	capture			Silent	SNP	33846539	33846539	15426	21	C	G	G	24	24	SON	G	3	3
TTLL12	23170	broad.mit.edu	36	22	41908953	41908953	+	Silent	SNP	C	G	G			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:41908953C>G	uc003bdq.1	-	c.324G>C	c.(322-324)GGG>GGC	p.G108G	TTLL12_uc003bdr.1_Silent_p.G108G	NM_015140	NP_055955	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	108					protein modification process		tubulin-tyrosine ligase activity			central_nervous_system(1)	1		Ovarian(80;0.221)|Glioma(61;0.222)												0.176471	6.323014	9.691257	6	28	CC		KEEP	---	---	---	---	capture			Silent	SNP	41908953	41908953	17280	22	C	G	G	26	26	TTLL12	G	3	3
ANAPC1	64682	broad.mit.edu	36	2	112308901	112308902	+	Missense_Mutation	DNP	TT	AC	AC			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:112308901_112308902TT>AC	uc002thi.1	-	c.2134_2135AA>GT	c.(2134-2136)AAT>GTT	p.N712V		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	712					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm					0														0.333333	9.563133	9.935582	5	10	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	112308901	112308902	601	2	TT	AC	AC	52	52	ANAPC1	AC	4	4
WDR35	57539	broad.mit.edu	36	2	19999460	19999461	+	Splice_Site_DNP	DNP	CC	GA	GA			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:19999460_19999461CC>GA	uc002rdi.1	-	c.e21_splice_site			WDR35_uc002rdh.1_Splice_Site_DNP|WDR35_uc002rdj.1_Splice_Site_DNP|WDR35_uc010ext.1_Splice_Site_DNP|WDR35_uc002rdk.2_Splice_Site_DNP	NM_001006657	NP_001006658			WD repeat domain 35 isoform 1											ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)													0.28	10.399437	11.499235	7	18	CC		KEEP	---	---	---	---	capture			Splice_Site_DNP	DNP	19999460	19999461	17862	2	CC	GA	GA	18	18	WDR35	GA	5	3
AOX1	316	broad.mit.edu	36	2	201211184	201211184	+	Missense_Mutation	SNP	C	A	A			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:201211184C>A	uc002uvx.1	+	c.2482C>A	c.(2482-2484)CAT>AAT	p.H828N	AOX1_uc010fsu.1_Missense_Mutation_p.H194N	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	828					inflammatory response|oxidation-reduction process|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)	5					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)									0.09589	7.021944	42.92837	21	198	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	201211184	201211184	739	2	C	A	A	17	17	AOX1	A	3	3
NCL	4691	broad.mit.edu	36	2	232029038	232029038	+	Missense_Mutation	SNP	T	C	C			TCGA-15-1446-01	TCGA-15-1446-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:232029038T>C	uc002vru.1	-	c.1759A>G	c.(1759-1761)ACA>GCA	p.T587A	SNORA75_uc002vrv.1_5'Flank	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin	587	RRM 4.				angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)										0.352174	725.340824	738.627748	243	447	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	232029038	232029038	10625	2	T	C	C	58	58	NCL	C	4	4
OTOF	9381	broad.mit.edu	36	2	26543873	26543873	+	Missense_Mutation	SNP	C	A	A			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:26543873C>A	uc002rhk.1	-	c.4091G>T	c.(4090-4092)GGC>GTC	p.G1364V	OTOF_uc002rhh.1_Missense_Mutation_p.G597V|OTOF_uc002rhi.1_Missense_Mutation_p.G674V|OTOF_uc002rhj.1_Missense_Mutation_p.G597V	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	1364	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GBM(102;732 1451 20652 24062 31372)								0.109091	7.230239	23.885259	12	98	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26543873	26543873	11715	2	C	A	A	26	26	OTOF	A	3	3
EMILIN1	11117	broad.mit.edu	36	2	27156596	27156596	+	Missense_Mutation	SNP	T	A	A			TCGA-15-1446-01	TCGA-15-1446-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:27156596T>A	uc002rii.2	+	c.244T>A	c.(244-246)TAC>AAC	p.Y82N	EMILIN1_uc010eyq.1_Missense_Mutation_p.Y82N	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	82	EMI.				cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)													0.2	6.656269	8.757082	5	20	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	27156596	27156596	5285	2	T	A	A	57	57	EMILIN1	A	4	4
DUSP2	1844	broad.mit.edu	36	2	96173366	96173366	+	Missense_Mutation	SNP	G	C	C			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:96173366G>C	uc002svk.2	-	c.868C>G	c.(868-870)CGC>GGC	p.R290G		NM_004418	NP_004409	Q05923	DUS2_HUMAN	dual specificity phosphatase 2	290	Tyrosine-protein phosphatase.				endoderm formation|inactivation of MAPK activity|regulation of apoptosis	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/threonine phosphatase activity				0		Ovarian(717;0.0228)												0.25	7.696929	8.603565	4	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	96173366	96173366	5004	2	G	C	C	38	38	DUSP2	C	3	3
CASR	846	broad.mit.edu	36	3	123486478	123486478	+	Missense_Mutation	SNP	A	C	C			TCGA-15-1446-01	TCGA-15-1446-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:123486478A>C	uc003eew.2	+	c.3017A>C	c.(3016-3018)AAC>ACC	p.N1006T	CASR_uc003eev.2_Missense_Mutation_p.N996T	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	996	Cytoplasmic (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)									0.26087	9.1442	10.33778	6	17	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	123486478	123486478	2801	3	A	C	C	2	2	CASR	C	4	4
C3orf20	84077	broad.mit.edu	36	3	14789323	14789323	+	Missense_Mutation	SNP	G	T	T			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:14789323G>T	uc003byy.1	+	c.2652G>T	c.(2650-2652)GAG>GAT	p.E884D	C3orf20_uc003byz.1_Missense_Mutation_p.E762D|C3orf20_uc003bza.1_Missense_Mutation_p.E762D|C3orf20_uc003bzb.1_3'UTR	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	884						cytoplasm|integral to membrane				ovary(3)	3														0.169811	37.08355	48.020317	18	88	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14789323	14789323	2306	3	G	T	T	34	34	C3orf20	T	3	3
TNIK	23043	broad.mit.edu	36	3	172375769	172375769	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:172375769G>A	uc003fhh.1	-	c.739C>T	c.(739-741)CGG>TGG	p.R247W	TNIK_uc003fhi.1_Missense_Mutation_p.R247W|TNIK_uc003fhj.1_Missense_Mutation_p.R247W|TNIK_uc003fhk.1_Missense_Mutation_p.R247W|TNIK_uc003fhl.1_Missense_Mutation_p.R247W|TNIK_uc003fhm.1_Missense_Mutation_p.R247W|TNIK_uc003fhn.1_Missense_Mutation_p.R247W|TNIK_uc003fho.1_Missense_Mutation_p.R247W	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	247	Protein kinase.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)							743				0.203791	101.209409	118.393508	43	168	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	172375769	172375769	16854	3	G	A	A	39	39	TNIK	A	1	1
RPSA	3921	broad.mit.edu	36	3	39428251	39428251	+	Nonsense_Mutation	SNP	C	G	G			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:39428251C>G	uc003cjq.1	+	c.621C>G	c.(619-621)TAC>TAG	p.Y207*	RPSA_uc003cjp.1_Nonsense_Mutation_p.Y202*|RPSA_uc003cjr.1_Nonsense_Mutation_p.Y202*|RPSA_uc003cjt.1_Non-coding_Transcript	NM_002295	NP_002286	P08865	RSSA_HUMAN	ribosomal protein SA	202					cell adhesion|endocrine pancreas development|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|ribosomal small subunit assembly|rRNA export from nucleus|translational elongation|translational termination|viral transcription	90S preribosome|cytosolic small ribosomal subunit|nucleus|plasma membrane	protein binding|receptor activity|ribosome binding|structural constituent of ribosome			lung(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0509)|Kidney(284;0.064)										0.102041	7.676526	23.160822	10	88	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	39428251	39428251	14143	3	C	G	G	20	20	RPSA	G	5	3
NISCH	11188	broad.mit.edu	36	3	52496432	52496432	+	Silent	SNP	G	C	C			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:52496432G>C	uc003ded.2	+	c.1884G>C	c.(1882-1884)CGG>CGC	p.R628R	NISCH_uc003dee.2_Silent_p.R117R|NISCH_uc003deg.1_Non-coding_Transcript	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	628	Necessary for homooligomerization and targeting to endosomes.|Interaction with PAK1 (By similarity).				apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)										0.875	22.750338	23.827555	7	1	GG		KEEP	---	---	---	---	capture			Silent	SNP	52496432	52496432	10833	3	G	C	C	43	43	NISCH	C	3	3
CACNA2D3	55799	broad.mit.edu	36	3	54579045	54579045	+	Silent	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:54579045G>A	uc003dhf.1	+	c.762G>A	c.(760-762)CCG>CCA	p.P254P	CACNA2D3_uc003dhg.1_Silent_p.P160P|CACNA2D3_uc003dhh.1_Non-coding_Transcript|CACNA2D3_uc010hmv.1_5'UTR	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	254	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)										0.314645	772.444562	799.143132	275	599	GG		KEEP	---	---	---	---	capture			Silent	SNP	54579045	54579045	2666	3	G	A	A	37	37	CACNA2D3	A	1	1
SPRY1	10252	broad.mit.edu	36	4	124543116	124543116	+	Missense_Mutation	SNP	T	A	A			TCGA-15-1446-01	TCGA-15-1446-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:124543116T>A	uc003ifa.1	+	c.920T>A	c.(919-921)CTG>CAG	p.L307Q	SPRY1_uc003ifb.1_Missense_Mutation_p.L307Q|SPRY1_uc010inv.1_Missense_Mutation_p.L307Q	NM_199327	NP_955359	O43609	SPY1_HUMAN	sprouty homolog 1, antagonist of FGF signaling	307	Cys-rich.				epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|lamellipodium|plasma membrane				skin(2)|ovary(1)	3														0.183673	8.6272	13.263202	9	40	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	124543116	124543116	15619	4	T	A	A	55	55	SPRY1	A	4	4
PALLD	23022	broad.mit.edu	36	4	169869356	169869357	+	Missense_Mutation	DNP	CC	AA	AA			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:169869356_169869357CC>AA	uc003iru.1	+	c.1671_1672CC>AA	c.(1669-1674)GACCAC>GAAAAC	p.557_558DH>EN	PALLD_uc003irv.1_Missense_Mutation_p.175_176DH>EN	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin	557_558					cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		Esophageal Squamous(109;1482 1532 18347 40239 51172)								0.24	7.825364	9.381544	6	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	169869356	169869357	11823	4	CC	AA	AA	18	18	PALLD	AA	3	3
UGT2B4	7363	broad.mit.edu	36	4	70395984	70395984	+	Missense_Mutation	SNP	A	C	C			TCGA-15-1446-01	TCGA-15-1446-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:70395984A>C	uc003hek.2	-	c.185T>G	c.(184-186)ATT>AGT	p.I62S	UGT2B4_uc003hel.2_Missense_Mutation_p.I62S	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family,	62					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity				0														0.16835	101.214948	132.122307	50	247	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70395984	70395984	17519	4	A	C	C	4	4	UGT2B4	C	4	4
GABRG2	2566	broad.mit.edu	36	5	161512778	161512778	+	Silent	SNP	C	T	T			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:161512778C>T	uc010jjc.1	+	c.1374C>T	c.(1372-1374)GAC>GAT	p.D458D	GABRG2_uc003lyy.2_Silent_p.D418D|GABRG2_uc003lyz.2_Silent_p.D410D	NM_198903	NP_944493	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	410	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)	4	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)										0.479798	597.016617	597.157069	190	206	CC		KEEP	---	---	---	---	capture			Silent	SNP	161512778	161512778	6423	5	C	T	T	19	19	GABRG2	T	1	1
AHRR	57491	broad.mit.edu	36	5	480978	480978	+	Silent	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:480978G>A	uc003jav.1	+	c.831G>A	c.(829-831)CCG>CCA	p.P277P	AHRR_uc003jaw.1_Silent_p.P255P|AHRR_uc010isy.1_Silent_p.P105P|AHRR_uc010isz.1_Silent_p.P255P|AHRR_uc003jax.1_Silent_p.P18P|AHRR_uc003jay.1_Silent_p.P115P	NM_020731	NP_065782	A9YTQ3	AHRR_HUMAN	arylhydrocarbon receptor repressor	259					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity|transcription regulator activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)											0.388889	67.172955	67.753408	21	33	GG		KEEP	---	---	---	---	capture			Silent	SNP	480978	480978	420	5	G	A	A	40	40	AHRR	A	1	1
NSUN2	54888	broad.mit.edu	36	5	6657757	6657757	+	Silent	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:6657757G>A	uc003jdu.1	-	c.1779C>T	c.(1777-1779)AGC>AGT	p.S593S	NSUN2_uc003jdv.1_Silent_p.S357S|NSUN2_uc003jds.1_Silent_p.S39S|NSUN2_uc003jdt.1_Silent_p.S357S	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family 2 protein	593						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1														0.498246	455.136894	455.137685	142	143	GG		KEEP	---	---	---	---	capture			Silent	SNP	6657757	6657757	11083	5	G	A	A	38	38	NSUN2	A	1	1
C6orf15	29113	broad.mit.edu	36	6	31187837	31187837	+	Missense_Mutation	SNP	G	C	C			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:31187837G>C	uc003nsk.1	-	c.278C>G	c.(277-279)TCT>TGT	p.S93C	PSORS1C1_uc003nsl.1_5'Flank|PSORS1C1_uc010jsj.1_5'Flank	NM_014070	NP_054789	Q6UXA7	CF015_HUMAN	STG protein	93											0														0.296296	15.984433	16.989989	8	19	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31187837	31187837	2440	6	G	C	C	33	33	C6orf15	C	3	3
STK19	8859	broad.mit.edu	36	6	32056456	32056456	+	Silent	SNP	A	G	G	rs7743469	by-cluster,by-2hit-2allele	TCGA-15-1446-01	TCGA-15-1446-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:32056456A>G	uc003nyv.1	+	c.960A>G	c.(958-960)GAA>GAG	p.E320E	STK19_uc003nyt.1_Silent_p.E273E|STK19_uc010jtm.1_Silent_p.E273E|STK19_uc003nyw.1_Silent_p.E316E|STK19_uc010jtn.1_Non-coding_Transcript|C4B_uc003nyy.2_5'Flank|C4B_uc010jto.1_5'Flank	NM_032454	NP_115830	P49842	STK19_HUMAN	serine/threonine kinase 19 isoform 2	320					protein phosphorylation	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			skin(4)	4									p.E320E(M07E-Tumor)|p.E320E(NCIH2110-Tumor)|p.E320E(KNS62-Tumor)|p.E320E(RMUGS-Tumor)|p.E320E(KATOIII-Tumor)|p.E320E(MKN7-Tumor)|p.E320E(NCIH1299-Tumor)|p.E320E(HCC95-Tumor)|p.E320E(MUTZ5-Tumor)|p.E320E(OCIAML5-Tumor)|p.E320E(GRANTA519-Tumor)|p.E320E(8MGBA-Tumor)|p.E320E(SKMEL5-Tumor)|p.E320E(LS180-Tumor)|p.E320E(NCIH146-Tumor)|p.E320E(T98G-Tumor)|p.E320E(KYSE180-Tumor)|p.E320E(JEKO1-Tumor)|p.E320E(SIGM5-Tumor)|p.E320E(CAS1-Tumor)|p.E320E(LCLC97TM1-Tumor)|p.E320E(MONOMAC6-Tumor)|p.E320E(HEC265-Tumor)|p.E320E(HCC78-Tumor)|p.E320E(THP1-Tumor)|p.E320E(KMS28BM-Tumor)|p.E320E(NCIH520-Tumor)|p.E320E(NCIH1930-Tumor)|p.E320E(HS739.T-Tumor)|p.E320E(HCC1599-Tumor)|p.E320E(HUG1N-Tumor)|p.E320E(MOLM13-Tumor)|p.E320E(BDCM-Tumor)|p.E320E(JHH1-Tumor)|p.E320E(PANC04.03-Tumor)|p.E320E(TE11-Tumor)|p.E320E(KMS27-Tumor)|p.E320E(CAL120-Tumor)|p.E320E(MHHES1-Tumor)|p.E320E(HUT78-Tumor)|p.E320E(BICR56-Tumor)|p.E320E(NCIH524-Tumor)|p.E320E(SBC5-Tumor)|p.E320E(CAPAN1-Tumor)|p.E320E(RKN-Tumor)|p.E320E(SNU886-Tumor)|p.E320E(REH-Tumor)|p.E320E(LN18-Tumor)|p.E320E(SW1271-Tumor)|p.E320E(JVM2-Tumor)|p.E320E(NCIH1355-Tumor)|p.E320E(CI1-Tumor)|p.E320E(HEL-Tumor)|p.E320E(RL952-Tumor)|p.E320E(RL-Tumor)	192				0.220779	38.035002	43.562806	17	60	AA		KEEP	---	---	---	---	capture			Silent	SNP	32056456	32056456	15812	6	A	G	G	2	2	STK19	G	4	4
TNXB	7148	broad.mit.edu	36	6	32120896	32120896	+	Missense_Mutation	SNP	G	C	C			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:32120896G>C	uc003nzl.2	-	c.10786C>G	c.(10786-10788)CAG>GAG	p.Q3596E	TNXB_uc003nzg.1_Missense_Mutation_p.Q27E|TNXB_uc003nzh.1_Missense_Mutation_p.Q65E	NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	3643	Fibronectin type-III 28.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0														0.206897	6.716748	9.0504	6	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32120896	32120896	16887	6	G	C	C	47	47	TNXB	C	3	3
DNAH8	1769	broad.mit.edu	36	6	38939637	38939637	+	Silent	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:38939637G>A	uc003ooe.1	+	c.5670G>A	c.(5668-5670)CAG>CAA	p.Q1890Q		NM_001371	NP_001362	Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy polypeptide 8	1890	AAA 1 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(5)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	17										2979				0.124514	44.015503	79.444696	32	225	GG		KEEP	---	---	---	---	capture			Silent	SNP	38939637	38939637	4790	6	G	A	A	36	36	DNAH8	A	2	2
IQUB	154865	broad.mit.edu	36	7	122930233	122930233	+	Splice_Site_SNP	SNP	C	T	T			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:122930233C>T	uc003vkn.1	-	c.e5_splice_site			IQUB_uc003vko.1_Splice_Site_SNP|IQUB_uc010lkt.1_Splice_Site_SNP|IQUB_uc003vkp.1_Splice_Site_SNP|IQUB_uc003vkq.1_3'UTR	NM_178827	NP_849149			IQ motif and ubiquitin domain containing											ovary(3)|large_intestine(1)	4														0.099502	11.055824	43.289696	20	181	CC		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	122930233	122930233	8123	7	C	T	T	18	18	IQUB	T	5	2
DGKI	9162	broad.mit.edu	36	7	136990040	136990040	+	Missense_Mutation	SNP	C	T	T			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:136990040C>T	uc003vtt.1	-	c.716G>A	c.(715-717)GGA>GAA	p.G239E	DGKI_uc003vtu.1_5'UTR	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	239					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2														0.190476	26.760356	32.405385	12	51	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	136990040	136990040	4650	7	C	T	T	30	30	DGKI	T	2	2
NCAPG2	54892	broad.mit.edu	36	7	158150164	158150164	+	Missense_Mutation	SNP	G	C	C			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:158150164G>C	uc003wnv.1	-	c.1519C>G	c.(1519-1521)CTG>GTG	p.L507V	NCAPG2_uc010lqu.1_Missense_Mutation_p.L299V|NCAPG2_uc003wnw.1_Non-coding_Transcript|NCAPG2_uc003wnx.1_Missense_Mutation_p.L507V	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5	507					cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)										0.3125	9.461672	9.966932	5	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	158150164	158150164	10607	7	G	C	C	33	33	NCAPG2	C	3	3
PMS2	5395	broad.mit.edu	36	7	5996064	5996064	+	Missense_Mutation	SNP	T	C	C			TCGA-15-1446-01	TCGA-15-1446-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:5996064T>C	uc003spl.1	-	c.1037A>G	c.(1036-1038)CAA>CGA	p.Q346R	PMS2_uc003spj.1_Missense_Mutation_p.Q240R|PMS2_uc003spk.1_Missense_Mutation_p.Q211R|PMS2_uc010kte.1_Intron|PMS2_uc010ktf.1_Missense_Mutation_p.Q346R	NM_000535	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 isoform	346					mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding			central_nervous_system(1)	1		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)						812				0.144737	7.061044	16.331209	11	65	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5996064	5996064	12569	7	T	C	C	63	63	PMS2	C	4	4
COL14A1	7373	broad.mit.edu	36	8	121288384	121288384	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:121288384G>A	uc003yox.1	+	c.1061G>A	c.(1060-1062)GGG>GAG	p.G354E	COL14A1_uc010mde.1_Missense_Mutation_p.G32E|COL14A1_uc003yoy.2_Missense_Mutation_p.G32E	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1	354	Fibronectin type-III 2.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)							1131				0.142857	73.169468	109.292231	42	252	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	121288384	121288384	3809	8	G	A	A	43	43	COL14A1	A	2	2
ABCA1	19	broad.mit.edu	36	9	106586426	106586426	+	Silent	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:106586426G>A	uc004bcl.1	-	c.6777C>T	c.(6775-6777)AGC>AGT	p.S2259S	NIPSNAP3B_uc004bcj.1_Intron	NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	2259					Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol binding|cholesterol transporter activity|phospholipid binding|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|ovary(4)|central_nervous_system(1)|pancreas(1)	10				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)									0.219737	378.323334	433.327272	167	593	GG		KEEP	---	---	---	---	capture			Silent	SNP	106586426	106586426	29	9	G	A	A	34	34	ABCA1	A	2	2
TOMM5	401505	broad.mit.edu	36	9	37582514	37582514	+	Missense_Mutation	SNP	C	A	A			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:37582514C>A	uc004aaf.1	-	c.16G>T	c.(16-18)GGC>TGC	p.G6C	TOMM5_uc004aae.2_5'Flank|TOMM5_uc010mlx.1_Missense_Mutation_p.G6C	NM_001001790		Q8N4H5	TOM5_HUMAN	translocase of outer mitochondrial membrane 5	6					protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane translocase complex					0														0.235294	6.488555	7.581955	4	13	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37582514	37582514	16901	9	C	A	A	22	22	TOMM5	A	3	3
C9orf102	375748	broad.mit.edu	36	9	97683085	97683085	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1446-01	TCGA-15-1446-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:97683085G>A	uc004avt.2	+	c.193G>A	c.(193-195)GTC>ATC	p.V65I	C9orf102_uc010mrx.1_Non-coding_Transcript|C9orf102_uc010mry.1_5'UTR|C9orf102_uc010mrz.1_5'UTR	NM_001010895	NP_001010895	Q5T890	RAD26_HUMAN	RAD26L hypothetical protein	65					DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding				0		Acute lymphoblastic leukemia(62;0.0559)												0.32	22.59264	23.31155	8	17	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	97683085	97683085	2558	9	G	A	A	40	40	C9orf102	A	1	1
NRK	203447	broad.mit.edu	36	X	105039907	105039907	+	Nonsense_Mutation	SNP	C	T	T			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:105039907C>T	uc004emd.1	+	c.1618C>T	c.(1618-1620)CAG>TAG	p.Q540*	NRK_uc010npc.1_Nonsense_Mutation_p.Q208*	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	540	Gln-rich.				protein phosphorylation		ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14										430				0.75	6.420686	6.644376	3	1	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	105039907	105039907	11060	23	C	T	T	25	25	NRK	T	5	2
USP9X	8239	broad.mit.edu	36	X	40960208	40960208	+	Missense_Mutation	SNP	A	G	G			TCGA-15-1446-01	TCGA-15-1446-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:40960208A>G	uc004dfb.1	+	c.5444A>G	c.(5443-5445)TAT>TGT	p.Y1815C	USP9X_uc004dfc.1_Missense_Mutation_p.Y1815C	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	1815					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			ovary(1)	1						Ovarian(172;1807 2695 35459 49286)								0.170732	8.492777	12.709907	7	34	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40960208	40960208	17654	23	A	G	G	16	16	USP9X	G	4	4
HUWE1	10075	broad.mit.edu	36	X	53634698	53634698	+	Missense_Mutation	SNP	C	G	G			TCGA-15-1446-01	TCGA-15-1446-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:53634698C>G	uc004dso.1	-	c.4082G>C	c.(4081-4083)GGA>GCA	p.G1361A	HUWE1_uc004dsn.1_Missense_Mutation_p.G186A|HUWE1_uc004dsp.1_Missense_Mutation_p.G1361A	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	1361					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17														0.21875	13.206387	15.541146	7	25	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53634698	53634698	7761	23	C	G	G	30	30	HUWE1	G	3	3
HEPH	9843	broad.mit.edu	36	X	65335502	65335502	+	Missense_Mutation	SNP	T	G	G			TCGA-15-1446-01	TCGA-15-1446-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:65335502T>G	uc004dwn.1	+	c.1780T>G	c.(1780-1782)TGG>GGG	p.W594G	HEPH_uc004dwm.1_Missense_Mutation_p.W591G|HEPH_uc004dwo.1_Missense_Mutation_p.W324G|HEPH_uc010nkr.1_Intron|HEPH_uc004dwp.1_Missense_Mutation_p.W591G	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	591	Plastocyanin-like 4.|Extracellular (Potential).				cellular iron ion homeostasis|copper ion transport|oxidation-reduction process|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9										386				0.135714	7.998647	26.088035	19	121	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	65335502	65335502	7337	23	T	G	G	55	55	HEPH	G	4	4
DHRS12	79758	broad.mit.edu	36	13	51271702	51271703	+	Frame_Shift_Del	DEL	GC	-	-			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:51271702_51271703delGC	uc001vfs.1	-	c.94_95delGC	c.(94-96)GCAfs	p.A32fs	DHRS12_uc001vfr.1_Frame_Shift_Del_p.A32fs|DHRS12_uc001vfq.2_Frame_Shift_Del_p.G53fs	NM_001031719	NP_001026889	A0PJE2	DHR12_HUMAN	dehydrogenase/reductase (SDR family) member 12	Error:Variant_position_missing_in_A0PJE2_after_alignment					oxidation-reduction process		binding|oxidoreductase activity				0		Breast(56;0.00173)|Prostate(109;0.00899)|Lung NSC(96;0.0199)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.81e-08)										0.56			25	20				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	51271702	51271703	4667	13	GC	-	-	46	46	DHRS12	-	5	5
NARF	26502	broad.mit.edu	36	17	78039223	78039245	+	Frame_Shift_Del	DEL	GTGGCTGGAGGGGATCAACTCCC	-	-			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:78039223_78039245delGTGGCTGGAGGGGATCAACTCCC	uc010dit.1	+	c.1410_1432delGTGGCTGGAGGGGATCAACTCCC	c.(1408-1434)GAGTGGCTGGAGGGGATCAACTCCCCCfs	p.E470fs	NARF_uc002kff.2_Frame_Shift_Del_p.E365fs|NARF_uc002kfg.2_Frame_Shift_Del_p.E424fs|NARF_uc002kfj.2_Frame_Shift_Del_p.E376fs|NARF_uc002kfi.2_Non-coding_Transcript|NARF_uc002kfh.2_Frame_Shift_Del_p.E470fs|NARF_uc002kfk.1_Non-coding_Transcript	NM_031968	NP_114174	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor isoform b	424_432						lamin filament	lamin binding			skin(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)											0.49			41	43				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	78039223	78039245	10563	17	GTGGCTGGAGGGGATCAACTCCC	-	-	36	36	NARF	-	5	5
PPP4R1	9989	broad.mit.edu	36	18	9573112	9573113	+	Splice_Site_Ins	INS	-	G	G			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:9573112_9573113insG	uc002koe.1	-	c.e9_splice_site			PPP4R1_uc002kod.1_Splice_Site_Ins	NM_001042388	NP_001035847			protein phosphatase 4, regulatory subunit 1						protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity				0						Melanoma(188;1232 2082 5061 11948 35994)								0.47			46	52				---	---	---	---	capture_indel			Splice_Site_Ins	INS	9573112	9573113	12839	18	-	G	G	53	53	PPP4R1	G	5	5
FUBP1	8880	broad.mit.edu	36	1	78208289	78208290	+	Splice_Site_Ins	INS	-	A	A			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:78208289_78208290insA	uc001dii.1	-	c.e2_splice_site			FUBP1_uc001dih.2_Splice_Site_Ins	NM_003902	NP_003893			far upstream element-binding protein						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			central_nervous_system(2)|lung(1)	3														0.33			3	6				---	---	---	---	capture_indel			Splice_Site_Ins	INS	78208289	78208290	6343	1	-	A	A	53	53	FUBP1	A	5	5
ZMAT5	55954	broad.mit.edu	36	22	28457243	28457248	+	In_Frame_Del	DEL	GCCACC	-	-			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:28457243_28457248delGCCACC	uc003agm.1	-	c.479_484delGGTGGC	c.(478-486)GGGTGGCCT>GCT	p.160_162GWP>A	CABP7_uc003agl.1_3'UTR|ZMAT5_uc003agn.1_In_Frame_Del_p.160_162GWP>A	NM_019103	NP_061976	Q9UDW3	ZMAT5_HUMAN	zinc finger, matrin type 5	160_162					mRNA processing|RNA splicing	cytoplasm|U12-type spliceosomal complex	nucleic acid binding|zinc ion binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(5;0.000597)|all cancers(5;0.0534)|Epithelial(10;0.0574)											0.36			5	9				---	---	---	---	capture_indel			In_Frame_Del	DEL	28457243	28457248	18286	22	GCCACC	-	-	42	42	ZMAT5	-	5	5
CBX7	23492	broad.mit.edu	36	22	37867323	37867324	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:37867323_37867324delTC	uc003axb.1	-	c.177_178delGA	c.(175-180)GAGAAGfs	p.E59fs	CBX7_uc003axc.1_Frame_Shift_Del_p.E59fs	NM_175709	NP_783640	O95931	CBX7_HUMAN	chromobox homolog 7	59_60	Chromo.				chromatin assembly or disassembly|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding			ovary(1)	1	Melanoma(58;0.04)					GBM(46;845 904 3560 9866 23971)								0.42			28	38				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	37867323	37867324	2842	22	TC	-	-	62	62	CBX7	-	5	5
COL7A1	1294	broad.mit.edu	36	3	48596759	48596760	+	Frame_Shift_Ins	INS	-	G	G			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:48596759_48596760insG	uc003ctz.2	-	c.4172_4173insC	c.(4171-4173)CCAfs	p.P1391fs		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	1391	Triple-helical region.|Interrupted collagenous region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(2)	9				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	48596759	48596760	3842	3	-	G	G	55	55	COL7A1	G	5	5
ARHGAP24	83478	broad.mit.edu	36	4	87135730	87135736	+	Frame_Shift_Del	DEL	TGTGGGC	-	-			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:87135730_87135736delTGTGGGC	uc003hpk.1	+	c.1899_1905delTGTGGGC	c.(1897-1905)TTTGTGGGCfs	p.F633fs	ARHGAP24_uc003hpl.1_Frame_Shift_Del_p.F538fs|ARHGAP24_uc010ikf.1_Frame_Shift_Del_p.F548fs|ARHGAP24_uc003hpm.1_Frame_Shift_Del_p.F540fs	NM_001025616	NP_001036134	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1	633_635					angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)										0.67			45	22				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	87135730	87135736	885	4	TGTGGGC	-	-	63	63	ARHGAP24	-	5	5
TMEM161B	153396	broad.mit.edu	36	5	87538750	87538750	+	Frame_Shift_Del	DEL	T	-	-			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:87538750_87538750delT	uc003kjc.1	-	c.450_450delA	c.(448-450)AAAfs	p.K150fs	TMEM161B_uc010jax.1_Non-coding_Transcript	NM_153354	NP_699185	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	150	Helical; (Potential).					integral to membrane					0		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	87538750	87538750	16611	5	T	-	-	56	56	TMEM161B	-	5	5
AMPH	273	broad.mit.edu	36	7	38400294	38400294	+	Frame_Shift_Del	DEL	A	-	-			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:38400294_38400294delA	uc003tgu.1	-	c.1444_1444delT	c.(1444-1446)TCAfs	p.S482fs	AMPH_uc003tgt.1_Frame_Shift_Del_p.S367fs|AMPH_uc003tgv.1_Frame_Shift_Del_p.S440fs|AMPH_uc003tgw.1_Frame_Shift_Del_p.S505fs|AMPH_uc010kxl.1_Non-coding_Transcript	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	482					endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)	4														0.50			4	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	38400294	38400294	591	7	A	-	-	10	10	AMPH	-	5	5
SH3GLB2	56904	broad.mit.edu	36	9	130811287	130811288	+	Frame_Shift_Ins	INS	-	G	G			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:130811287_130811288insG	uc004bww.1	-	c.1025_1026insC	c.(1024-1026)CCTfs	p.P342fs	SH3GLB2_uc004bwv.1_Frame_Shift_Ins_p.P333fs|SH3GLB2_uc004bwx.1_Frame_Shift_Ins_p.P333fs	NM_020145	NP_064530	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	333					filopodium assembly|signal transduction	cytoplasm|nucleus	cytoskeletal adaptor activity|SH3 domain binding				0														0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	130811287	130811288	14746	9	-	G	G	7	7	SH3GLB2	G	5	5
SARDH	1757	broad.mit.edu	36	9	135587368	135587368	+	Frame_Shift_Del	DEL	A	-	-			TCGA-15-1446-01	TCGA-15-1446-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:135587368_135587368delA	uc004cep.2	-	c.508_508delT	c.(508-510)TCGfs	p.S170fs	SARDH_uc004ceo.1_Frame_Shift_Del_p.S170fs	NM_007101	NP_009032	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	170					glycine catabolic process|oxidation-reduction process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)										0.48			23	25				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	135587368	135587368	14322	9	A	-	-	10	10	SARDH	-	5	5
