Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
BTRC	8945	broad.mit.edu	36	10	103271482	103271482	+	Missense_Mutation	SNP	T	G	G			TCGA-16-0861-01	TCGA-16-0861-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:103271482T>G	uc001kta.1	+	c.421T>G	c.(421-423)TTT>GTT	p.F141V	BTRC_uc001ktb.1_Missense_Mutation_p.F105V|BTRC_uc001ktc.1_Missense_Mutation_p.F115V	NM_033637	NP_378663	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing protein	141					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of gene-specific transcription|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex	specific transcriptional repressor activity			ovary(1)	1		Colorectal(252;0.234)								243				0.850746	180.899485	188.806873	57	10	TT		KEEP	---	---	---	---	capture		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)	Missense_Mutation	SNP	103271482	103271482	1603	10	T	G	G	56	56	BTRC	G	4	4
PITX3	5309	broad.mit.edu	36	10	103980770	103980770	+	Missense_Mutation	SNP	C	A	A			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:103980770C>A	uc001kuu.1	-	c.400G>T	c.(400-402)GCG>TCG	p.A134S		NM_005029	NP_005020	O75364	PITX3_HUMAN	paired-like homeodomain 3	134					dopaminergic neuron differentiation|lens morphogenesis in camera-type eye|midbrain development|regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription activator activity				0		Colorectal(252;0.00957)												0.727273	27.00817	27.526003	8	3	CC		KEEP	---	---	---	---	capture		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)	Missense_Mutation	SNP	103980770	103980770	12380	10	C	A	A	27	27	PITX3	A	3	3
ELMOD1	55531	broad.mit.edu	36	11	107023430	107023430	+	Silent	SNP	T	A	A			TCGA-16-0861-01	TCGA-16-0861-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:107023430T>A	uc001pjn.1	+	c.447T>A	c.(445-447)ACT>ACA	p.T149T	ELMOD1_uc001pjm.1_Silent_p.T149T	NM_018712	NP_061182	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1 isoform 1	149	ELMO.				phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)												0.188889	34.222967	42.373945	17	73	TT		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)	Silent	SNP	107023430	107023430	5260	11	T	A	A	54	54	ELMOD1	A	4	4
INSC	387755	broad.mit.edu	36	11	15154137	15154137	+	Missense_Mutation	SNP	A	C	C			TCGA-16-0861-01	TCGA-16-0861-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:15154137A>C	uc001mly.1	+	c.472A>C	c.(472-474)ACC>CCC	p.T158P	INSC_uc001mlz.1_Missense_Mutation_p.T111P|INSC_uc001mma.1_Missense_Mutation_p.T111P|INSC_uc001mmb.1_Missense_Mutation_p.T111P|INSC_uc001mmc.1_Missense_Mutation_p.T111P	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a	158					cell differentiation|nervous system development	cytoplasm	binding			ovary(2)|central_nervous_system(1)	3														0.285714	8.693512	9.271031	4	10	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15154137	15154137	8065	11	A	C	C	10	10	INSC	C	4	4
TMEM132A	54972	broad.mit.edu	36	11	60460088	60460088	+	Silent	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:60460088G>C	uc001nqi.1	+	c.2208G>C	c.(2206-2208)GGG>GGC	p.G736G	TMEM132A_uc001nqj.1_Silent_p.G735G|TMEM132A_uc001nqm.1_5'UTR	NM_017870	NP_060340	Q24JP5	T132A_HUMAN	transmembrane protein 132A isoform a	735	Binds to HSPA5/GRP78 (By similarity).|Confers cellular localization similar to full-length form (By similarity).|Extracellular (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane					0														0.388889	14.017115	14.211437	7	11	GG		KEEP	---	---	---	---	capture			Silent	SNP	60460088	60460088	16576	11	G	C	C	42	42	TMEM132A	C	3	3
ZNHIT2	741	broad.mit.edu	36	11	64641394	64641394	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:64641394G>C	uc001ocw.1	-	c.308C>G	c.(307-309)GCG>GGG	p.A103G		NM_014205	NP_055020	Q9UHR6	ZNHI2_HUMAN	zinc finger, HIT domain containing 2	103							metal ion binding			breast(1)	1														0.571429	9.290955	9.322124	4	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64641394	64641394	18811	11	G	C	C	38	38	ZNHIT2	C	3	3
C11orf30	56946	broad.mit.edu	36	11	75842063	75842063	+	Missense_Mutation	SNP	A	C	C			TCGA-16-0861-01	TCGA-16-0861-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:75842063A>C	uc001oxn.1	+	c.228A>C	c.(226-228)TTA>TTC	p.L76F	C11orf30_uc001oxl.1_Missense_Mutation_p.L76F|C11orf30_uc001oxm.1_Missense_Mutation_p.L76F|C11orf30_uc001oxj.2_Missense_Mutation_p.L76F|C11orf30_uc001oxk.2_Missense_Mutation_p.L76F|C11orf30_uc009yuj.1_Missense_Mutation_p.L76F	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein	76	Interaction with BRCA2.|ENT.				chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6														0.478261	78.251295	78.269966	22	24	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75842063	75842063	1674	11	A	C	C	13	13	C11orf30	C	4	4
KSR2	283455	broad.mit.edu	36	12	116683354	116683354	+	Silent	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:116683354C>T	uc001two.2	-	c.744G>A	c.(742-744)CCG>CCA	p.P248P		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	277	Pro-rich.				intracellular signal transduction|protein phosphorylation	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(7)|central_nervous_system(2)|large_intestine(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)									623				0.415385	386.117141	388.158177	135	190	CC		KEEP	---	---	---	---	capture			Silent	SNP	116683354	116683354	8905	12	C	T	T	27	27	KSR2	T	1	1
RERG	85004	broad.mit.edu	36	12	15153376	15153376	+	Nonsense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:15153376G>A	uc001rcs.1	-	c.535C>T	c.(535-537)CGA>TGA	p.R179*	RERG_uc001rct.1_Nonsense_Mutation_p.R179*	NM_032918	NP_116307	Q96A58	RERG_HUMAN	RAS-like, estrogen-regulated, growth inhibitor	179					negative regulation of cell growth|negative regulation of cell proliferation|response to hormone stimulus|small GTPase mediated signal transduction	cytosol|membrane|nucleus	estrogen receptor binding|GDP binding|GTP binding|GTPase activity				0														0.684211	178.279756	181.15416	65	30	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	15153376	15153376	13701	12	G	A	A	38	38	RERG	A	5	1
AVPR1A	552	broad.mit.edu	36	12	61830124	61830124	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:61830124G>A	uc001sro.1	-	c.760C>T	c.(760-762)CGC>TGC	p.R254C		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	254	Cytoplasmic (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0					Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)									0.43609	340.684952	341.625855	116	150	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Missense_Mutation	SNP	61830124	61830124	1252	12	G	A	A	38	38	AVPR1A	A	1	1
SYT1	6857	broad.mit.edu	36	12	78217424	78217424	+	Nonsense_Mutation	SNP	G	T	T			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:78217424G>T	uc001sys.1	+	c.772G>T	c.(772-774)GAG>TAG	p.E258*	SYT1_uc001syt.1_Nonsense_Mutation_p.E258*|SYT1_uc001syu.1_Nonsense_Mutation_p.E255*|SYT1_uc001syv.1_Nonsense_Mutation_p.E258*|SYT1_uc001syw.1_Nonsense_Mutation_p.E258*	NM_005639	NP_005630	P21579	SYT1_HUMAN	synaptotagmin I	258	Cytoplasmic (Potential).|Phospholipid binding (Probable).				detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			pancreas(2)|skin(2)|ovary(1)	5														0.406417	216.453935	217.887851	76	111	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	78217424	78217424	15986	12	G	T	T	45	45	SYT1	T	5	3
WNK1	65125	broad.mit.edu	36	12	868643	868643	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:868643C>T	uc001qio.2	+	c.5441C>T	c.(5440-5442)GCG>GTG	p.A1814V	WNK1_uc001qip.2_Missense_Mutation_p.A1567V|WNK1_uc001qir.2_Missense_Mutation_p.A987V	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1814					intracellular protein kinase cascade|ion transport|neuron development|protein phosphorylation	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			ovary(5)|breast(4)|large_intestine(1)|lung(1)|central_nervous_system(1)	12	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)					Colon(19;451 567 6672 12618 28860)				913				0.307692	152.549459	158.539804	56	126	CC		KEEP	---	---	---	---	capture	Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)		Missense_Mutation	SNP	868643	868643	17951	12	C	T	T	27	27	WNK1	T	1	1
MTUS2	23281	broad.mit.edu	36	13	28573102	28573102	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:28573102C>T	uc001usl.2	+	c.2669C>T	c.(2668-2670)GCC>GTC	p.A890V		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	880	Sufficient for interaction with KIF2C.|Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.					cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0										344				0.75	10.227706	10.454016	3	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	28573102	28573102	10359	13	C	T	T	26	26	MTUS2	T	2	2
PDS5B	23047	broad.mit.edu	36	13	32225545	32225545	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:32225545G>C	uc010abf.1	+	c.2812G>C	c.(2812-2814)GAG>CAG	p.E938Q	PDS5B_uc010abg.1_Non-coding_Transcript	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog	938					cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)												0.41358	213.593461	214.649926	67	95	GG		KEEP	---	---	---	---	capture		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)	Missense_Mutation	SNP	32225545	32225545	12113	13	G	C	C	45	45	PDS5B	C	3	3
RABGGTA	5875	broad.mit.edu	36	14	23808717	23808717	+	Missense_Mutation	SNP	A	C	C			TCGA-16-0861-01	TCGA-16-0861-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:23808717A>C	uc001wof.1	-	c.451T>G	c.(451-453)TTT>GTT	p.F151V	RABGGTA_uc001woe.1_Non-coding_Transcript|RABGGTA_uc001wog.1_Missense_Mutation_p.F151V|RABGGTA_uc001woh.1_Non-coding_Transcript|RABGGTA_uc001woi.1_Non-coding_Transcript	NM_004581	NP_004572	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	151	PFTA 3.				visual perception		Rab geranylgeranyltransferase activity|zinc ion binding				0														0.235294	6.388389	7.481915	4	13	AA		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(265;0.0184)	Missense_Mutation	SNP	23808717	23808717	13426	14	A	C	C	2	2	RABGGTA	C	4	4
GZMB	3002	broad.mit.edu	36	14	24170993	24170993	+	Nonsense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:24170993G>A	uc001wps.1	-	c.511C>T	c.(511-513)CGA>TGA	p.R171*	GZMB_uc010ama.1_Nonsense_Mutation_p.R159*|GZMB_uc010amb.1_Non-coding_Transcript	NM_004131	NP_004122	P10144	GRAB_HUMAN	granzyme B precursor	171	Peptidase S1.				activation of pro-apoptotic gene products|cleavage of lamin|cytolysis|induction of apoptosis by intracellular signals	cytosol|immunological synapse|nucleus	protein binding|serine-type endopeptidase activity				0														0.638158	313.610795	316.164327	97	55	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(265;0.028)	Nonsense_Mutation	SNP	24170993	24170993	7196	14	G	A	A	37	37	GZMB	A	5	1
NIN	51199	broad.mit.edu	36	14	50308917	50308917	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:50308917C>T	uc001wyi.1	-	c.833G>A	c.(832-834)CGA>CAA	p.R278Q	NIN_uc001wyj.1_Non-coding_Transcript|NIN_uc001wyk.1_Missense_Mutation_p.R278Q|NIN_uc010anx.1_Missense_Mutation_p.R284Q|NIN_uc001wym.1_Missense_Mutation_p.R278Q|NIN_uc001wyo.1_Missense_Mutation_p.R278Q|NIN_uc001wyp.1_Missense_Mutation_p.R240Q	NM_020921	NP_065972	Q8N4C6	NIN_HUMAN	ninein isoform 2	278					centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	all_epithelial(31;0.00244)|Breast(41;0.127)									745				0.586957	85.732264	86.036401	27	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	50308917	50308917	10818	14	C	T	T	31	31	NIN	T	1	1
SMEK1	55671	broad.mit.edu	36	14	91017901	91017901	+	Silent	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:91017901A>G	uc001xzn.1	-	c.687T>C	c.(685-687)GCT>GCC	p.A229A	SMEK1_uc001xzm.1_Silent_p.A229A|SMEK1_uc001xzo.1_Silent_p.A229A|SMEK1_uc010atz.1_Intron|SMEK1_uc001xzp.1_Non-coding_Transcript|SMEK1_uc001xzq.1_Silent_p.A105A	NM_032560	NP_115949	Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1	229						microtubule organizing center|nucleus	protein binding				0		all_cancers(154;0.0691)|all_epithelial(191;0.219)												0.776699	290.427503	297.669426	80	23	AA		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(157;0.221)	Silent	SNP	91017901	91017901	15291	14	A	G	G	3	3	SMEK1	G	4	4
ASB2	51676	broad.mit.edu	36	14	93475280	93475280	+	Missense_Mutation	SNP	T	G	G			TCGA-16-0861-01	TCGA-16-0861-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:93475280T>G	uc001ycd.1	-	c.1448A>C	c.(1447-1449)CAC>CCC	p.H483P	ASB2_uc001ycb.1_Missense_Mutation_p.H161P|ASB2_uc001ycc.1_Missense_Mutation_p.H467P|ASB2_uc001yce.1_Missense_Mutation_p.H413P	NM_016150	NP_057234	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box-containing protein	467					intracellular signal transduction					pancreas(1)	1		all_cancers(154;0.13)												0.571429	6.792882	6.808677	4	3	TT		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)	Missense_Mutation	SNP	93475280	93475280	1041	14	T	G	G	59	59	ASB2	G	4	4
C15orf2	23742	broad.mit.edu	36	15	22472940	22472940	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:22472940C>T	uc001ywo.1	+	c.833C>T	c.(832-834)GCG>GTG	p.A278V		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	278					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|kidney(1)|central_nervous_system(1)	6		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)							p.A278V(SNU81-Tumor)|p.A278V(M059K-Tumor)	443				0.396552	128.745335	129.824147	46	70	CC		KEEP	---	---	---	---	capture		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	Missense_Mutation	SNP	22472940	22472940	1834	15	C	T	T	27	27	C15orf2	T	1	1
SLC27A2	11001	broad.mit.edu	36	15	48261957	48261957	+	Missense_Mutation	SNP	T	C	C			TCGA-16-0861-01	TCGA-16-0861-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr15:48261957T>C	uc001zxw.1	+	c.41T>C	c.(40-42)TTC>TCC	p.F14S	SLC27A2_uc010bes.1_Missense_Mutation_p.F14S	NM_003645	NP_003636	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid	14	Helical; (Potential).				bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity			ovary(1)	1		all_lung(180;0.00177)												0.277778	9.964798	10.766838	5	13	TT		KEEP	---	---	---	---	capture		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)	Missense_Mutation	SNP	48261957	48261957	15023	15	T	C	C	62	62	SLC27A2	C	4	4
TLN2	83660	broad.mit.edu	36	15	60915018	60915018	+	Silent	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:60915018C>T	uc002alb.2	+	c.7158C>T	c.(7156-7158)GAC>GAT	p.D2386D	TLN2_uc002alc.2_Silent_p.D779D	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	2386	I/LWEQ.				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cell-cell junction|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(4)|breast(2)	6														0.358566	250.691236	255.107563	90	161	CC		KEEP	---	---	---	---	capture			Silent	SNP	60915018	60915018	16478	15	C	T	T	19	19	TLN2	T	1	1
SV2B	9899	broad.mit.edu	36	15	89612774	89612774	+	Silent	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:89612774C>T	uc002bqv.1	+	c.1308C>T	c.(1306-1308)TAC>TAT	p.Y436Y	SV2B_uc002bqt.1_Silent_p.Y436Y|SV2B_uc002bqu.2_Non-coding_Transcript	NM_014848	NP_055663	Q7L1I2	SV2B_HUMAN	synaptic vesicle protein 2B homolog	436	Extracellular (Potential).				neurotransmitter transport|transmembrane transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			ovary(3)|central_nervous_system(2)	5	Lung NSC(78;0.0987)|all_lung(78;0.172)													0.475	284.732558	284.839047	95	105	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(143;0.0895)		Silent	SNP	89612774	89612774	15938	15	C	T	T	19	19	SV2B	T	1	1
ATXN2L	11273	broad.mit.edu	36	16	28752051	28752051	+	Silent	SNP	A	T	T			TCGA-16-0861-01	TCGA-16-0861-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:28752051A>T	uc002dqy.1	+	c.1830A>T	c.(1828-1830)CCA>CCT	p.P610P	ATXN2L_uc010byl.1_Silent_p.P586P|ATXN2L_uc002drb.1_Silent_p.P610P|ATXN2L_uc002dqz.1_Silent_p.P610P|ATXN2L_uc002dra.1_Silent_p.P610P|ATXN2L_uc002drc.1_Silent_p.P610P|ATXN2L_uc002dre.1_Silent_p.P610P|ATXN2L_uc002drf.1_Silent_p.P19P|ATXN2L_uc002drg.1_5'Flank	NM_148414	NP_680780	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform C	610						membrane				ovary(1)	1														0.369427	153.554143	155.925539	58	99	AA		KEEP	---	---	---	---	capture			Silent	SNP	28752051	28752051	1232	16	A	T	T	6	6	ATXN2L	T	4	4
TNFRSF12A	51330	broad.mit.edu	36	16	3010407	3010407	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:3010407G>C	uc002csv.2	+	c.8G>C	c.(7-9)CGG>CCG	p.R3P	CLDN6_uc002csu.2_5'Flank|TNFRSF12A_uc002csw.2_Missense_Mutation_p.R3P	NM_016639	NP_057723	Q9NP84	TNR12_HUMAN	tumor necrosis factor receptor superfamily,	3					angiogenesis|apoptosis	integral to membrane	receptor activity				0										264				0.210526	6.808383	8.269355	4	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3010407	3010407	16827	16	G	C	C	39	39	TNFRSF12A	C	3	3
CCDC135	84229	broad.mit.edu	36	16	56299049	56299049	+	Silent	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:56299049G>A	uc002emi.1	+	c.1035G>A	c.(1033-1035)AAG>AAA	p.K345K	CCDC135_uc002emj.1_Silent_p.K345K|CCDC135_uc002emk.1_Silent_p.K280K	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135	345						cytoplasm				central_nervous_system(1)	1														0.355932	60.656004	61.735953	21	38	GG		KEEP	---	---	---	---	capture			Silent	SNP	56299049	56299049	2889	16	G	A	A	33	33	CCDC135	A	2	2
DNAH9	1770	broad.mit.edu	36	17	11749783	11749783	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:11749783G>C	uc002gne.1	+	c.11681G>C	c.(11680-11682)GGA>GCA	p.G3894A	DNAH9_uc010coo.1_Missense_Mutation_p.G3188A|DNAH9_uc002gnf.1_Missense_Mutation_p.G206A	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	3894	AAA 6 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	10		Breast(5;0.0122)|all_epithelial(5;0.131)												0.16	7.480991	13.168091	8	42	GG		KEEP	---	---	---	---	capture		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	Missense_Mutation	SNP	11749783	11749783	4791	17	G	C	C	41	41	DNAH9	C	3	3
HS3ST3A1	9955	broad.mit.edu	36	17	13340738	13340738	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:13340738A>G	uc002gob.1	-	c.722T>C	c.(721-723)GTG>GCG	p.V241A		NM_006042	NP_006033	Q9Y663	HS3SA_HUMAN	heparan sulfate D-glucosaminyl	241	Lumenal (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity			ovary(1)|central_nervous_system(1)	2		all_lung(20;0.114)												0.184049	53.109572	68.617576	30	133	AA		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)	Missense_Mutation	SNP	13340738	13340738	7659	17	A	G	G	6	6	HS3ST3A1	G	4	4
MRC2	9902	broad.mit.edu	36	17	58110990	58110990	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:58110990G>A	uc002jad.1	+	c.2293G>A	c.(2293-2295)GTA>ATA	p.V765I	MRC2_uc010ddq.1_Non-coding_Transcript|MRC2_uc002jae.1_5'Flank|MRC2_uc002jaf.1_5'Flank	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	765	Extracellular (Potential).|C-type lectin 4.				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)	2														0.479167	66.121011	66.139125	23	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	58110990	58110990	10150	17	G	A	A	40	40	MRC2	A	1	1
FBF1	85302	broad.mit.edu	36	17	71422481	71422481	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71422481G>C	uc002jqc.2	-	c.2711C>G	c.(2710-2712)GCC>GGC	p.A904G	FBF1_uc002jqa.1_Intron|FBF1_uc002jqb.2_Intron|FBF1_uc010dgr.1_Missense_Mutation_p.A215G	NM_001080542	NP_001074011	A6NLR5	A6NLR5_HUMAN	Fas (TNFRSF6) binding factor 1	904											0														0.285714	9.192749	9.770969	4	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71422481	71422481	5931	17	G	C	C	42	42	FBF1	C	3	3
GUCY2D	3000	broad.mit.edu	36	17	7850719	7850719	+	Missense_Mutation	SNP	C	G	G			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7850719C>G	uc002gjt.2	+	c.1340C>G	c.(1339-1341)CCC>CGC	p.P447R		NM_000180	NP_000171	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane	447	Extracellular (Potential).				intracellular signal transduction|protein phosphorylation|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			skin(1)	1		Prostate(122;0.157)								285				0.466667	44.848005	44.876939	14	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7850719	7850719	7177	17	C	G	G	22	22	GUCY2D	G	3	3
CIDEA	1149	broad.mit.edu	36	18	12264219	12264219	+	Missense_Mutation	SNP	A	T	T			TCGA-16-0861-01	TCGA-16-0861-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr18:12264219A>T	uc002kqu.2	+	c.560A>T	c.(559-561)GAG>GTG	p.E187V	CIDEA_uc002kqt.2_Missense_Mutation_p.E153V|CIDEA_uc010dlc.1_Non-coding_Transcript	NM_198289	NP_938031	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a isoform	153					DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change|lipid metabolic process|lipid storage|negative regulation of apoptosis|negative regulation of cytokine secretion|negative regulation of lipid catabolic process|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of sequestering of triglyceride|temperature homeostasis	mitochondrial envelope|nucleus	protein homodimerization activity			ovary(1)|central_nervous_system(1)	2														0.280255	109.429399	116.248696	44	113	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12264219	12264219	3559	18	A	T	T	11	11	CIDEA	T	4	4
DSC1	1823	broad.mit.edu	36	18	26990013	26990013	+	Silent	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:26990013G>A	uc002kwn.1	-	c.462C>T	c.(460-462)CAC>CAT	p.H154H	DSC1_uc002kwm.1_Silent_p.H154H	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein	154	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)	3														0.441441	148.863106	149.193823	49	62	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(10;0.00778)		Silent	SNP	26990013	26990013	4949	18	G	A	A	40	40	DSC1	A	1	1
ARHGAP28	79822	broad.mit.edu	36	18	6884892	6884892	+	Splice_Site_SNP	SNP	T	C	C			TCGA-16-0861-01	TCGA-16-0861-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr18:6884892T>C	uc002knc.1	+	c.1749_splice	c.e15+2	p.M583_splice	ARHGAP28_uc002knd.1_Splice_Site_SNP_p.M476_splice|ARHGAP28_uc002kne.1_Splice_Site_SNP_p.M476_splice|ARHGAP28_uc002knf.1_Splice_Site_SNP_p.M467_splice	NM_030672	NP_109597			Rho GTPase activating protein 28 isoform b						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)												0.464286	167.582998	167.707038	52	60	TT		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	6884892	6884892	889	18	T	C	C	57	57	ARHGAP28	C	5	4
RAVER1	125950	broad.mit.edu	36	19	10305014	10305014	+	Missense_Mutation	SNP	T	G	G			TCGA-16-0861-01	TCGA-16-0861-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:10305014T>G	uc002moa.1	-	c.221A>C	c.(220-222)AAC>ACC	p.N74T		NM_133452	NP_597709	Q8IY67	RAVR1_HUMAN	RAVER1	57	Nuclear localization signal (Potential).					cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding			ovary(1)	1														0.206897	7.731903	10.04841	6	23	TT		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)		Missense_Mutation	SNP	10305014	10305014	13555	19	T	G	G	60	60	RAVER1	G	4	4
ZFR2	23217	broad.mit.edu	36	19	3776268	3776268	+	Silent	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:3776268C>T	uc002lyw.2	-	c.1173G>A	c.(1171-1173)GCG>GCA	p.A391A		NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	391						intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2														0.272727	7.220374	7.732424	3	8	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)	Silent	SNP	3776268	3776268	18250	19	C	T	T	27	27	ZFR2	T	1	1
ZNF527	84503	broad.mit.edu	36	19	42571275	42571275	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:42571275G>C	uc010efk.1	+	c.484G>C	c.(484-486)GAC>CAC	p.D162H	ZNF527_uc002ogf.2_Missense_Mutation_p.D130H	NM_032453	NP_115829	Q8NB42	ZN527_HUMAN	zinc finger protein 527	162					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2														0.428571	171.509638	172.038657	51	68	GG		KEEP	---	---	---	---	capture	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		Missense_Mutation	SNP	42571275	42571275	18562	19	G	C	C	33	33	ZNF527	C	3	3
FCGBP	8857	broad.mit.edu	36	19	45059669	45059669	+	Silent	SNP	C	G	G			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:45059669C>G	uc002omp.2	-	c.13131G>C	c.(13129-13131)ACG>ACC	p.T4377T		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4377	TIL 10.					extracellular region	protein binding			ovary(4)|central_nervous_system(1)	5	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)													0.18	9.735101	14.597897	9	41	CC		KEEP	---	---	---	---	capture	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		Silent	SNP	45059669	45059669	6015	19	C	G	G	27	27	FCGBP	G	3	3
INSR	3643	broad.mit.edu	36	19	7135472	7135472	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:7135472C>T	uc002mgd.1	-	c.829G>A	c.(829-831)GAC>AAC	p.D277N	INSR_uc002mge.1_Missense_Mutation_p.D277N|INSR_uc002mgf.2_Missense_Mutation_p.D277N	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	277	Cys-rich.				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of gene-specific transcription|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)					649				0.402299	103.122211	103.843575	35	52	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7135472	7135472	8074	19	C	T	T	30	30	INSR	T	2	2
RAB11B	9230	broad.mit.edu	36	19	8374383	8374383	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:8374383G>A	uc002mju.2	+	c.598G>A	c.(598-600)GTG>ATG	p.V200M	RAB11B_uc010dwb.1_Missense_Mutation_p.V133M	NM_004218	NP_004209	Q15907	RB11B_HUMAN	RAB11B, member RAS oncogene family	200					cell cycle|protein transport|small GTPase mediated signal transduction	plasma membrane	GDP binding|GTP binding|GTPase activity				0														0.348837	117.034189	119.635994	45	84	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8374383	8374383	13351	19	G	A	A	40	40	RAB11B	A	1	1
VAV3	10451	broad.mit.edu	36	1	108219063	108219063	+	Missense_Mutation	SNP	C	A	A			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:108219063C>A	uc001dvk.1	-	c.304G>T	c.(304-306)GTT>TTT	p.V102F	VAV3_uc001dvl.1_5'UTR	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform	102	CH.				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(4)|lung(2)|breast(2)	8		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)												0.346535	101.992021	104.093209	35	66	CC		KEEP	---	---	---	---	capture		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)	Missense_Mutation	SNP	108219063	108219063	17698	1	C	A	A	17	17	VAV3	A	3	3
FLG	2312	broad.mit.edu	36	1	150551576	150551576	+	Nonsense_Mutation	SNP	C	A	A			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150551576C>A	uc001ezu.1	-	c.2410G>T	c.(2410-2412)GAG>TAG	p.E804*		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	804	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)	9	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)													0.417647	589.538964	592.567389	213	297	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(543;0.206)		Nonsense_Mutation	SNP	150551576	150551576	6160	1	C	A	A	29	29	FLG	A	5	3
DNAJC6	9829	broad.mit.edu	36	1	65617730	65617730	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:65617730G>A	uc001dce.1	+	c.601G>A	c.(601-603)GTG>ATG	p.V201M	DNAJC6_uc001dcc.1_Missense_Mutation_p.V175M|DNAJC6_uc001dcd.1_Missense_Mutation_p.V144M	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	144	Phosphatase tensin-type.				cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3														0.412752	335.561994	337.543904	123	175	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	65617730	65617730	4836	1	G	A	A	48	48	DNAJC6	A	2	2
PAX1	5075	broad.mit.edu	36	20	21643242	21643242	+	Missense_Mutation	SNP	C	G	G			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:21643242C>G	uc002wsj.2	+	c.1124C>G	c.(1123-1125)GCG>GGG	p.A375G		NM_006192	NP_006183	P15863	PAX1_HUMAN	paired box 1	469					regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding			kidney(1)	1														0.444444	10.744753	10.760069	4	5	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	21643242	21643242	11898	20	C	G	G	27	27	PAX1	G	3	3
GSS	2937	broad.mit.edu	36	20	32980357	32980357	+	Missense_Mutation	SNP	T	A	A			TCGA-16-0861-01	TCGA-16-0861-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:32980357T>A	uc002xbg.1	-	c.1360A>T	c.(1360-1362)ATC>TTC	p.I454F	GSS_uc002xbh.1_Non-coding_Transcript	NM_000178	NP_000169	P48637	GSHB_HUMAN	glutathione synthetase	454					nervous system development|response to oxidative stress|xenobiotic metabolic process	cytosol	ATP binding|glutathione binding|glutathione synthase activity|magnesium ion binding|protein homodimerization activity			ovary(3)	3					Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)									0.340206	195.607548	199.978069	66	128	TT		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(18;0.035)		Missense_Mutation	SNP	32980357	32980357	7109	20	T	A	A	51	51	GSS	A	4	4
NCAPH2	29781	broad.mit.edu	36	22	49303280	49303280	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:49303280A>G	uc003blx.2	+	c.433A>G	c.(433-435)ATC>GTC	p.I145V	NCAPH2_uc003blq.2_Missense_Mutation_p.I145V|NCAPH2_uc003blv.2_Missense_Mutation_p.I145V|NCAPH2_uc003blr.2_Missense_Mutation_p.I145V|NCAPH2_uc010hbb.1_5'UTR|NCAPH2_uc003bls.2_Non-coding_Transcript|NCAPH2_uc003blt.2_Non-coding_Transcript|NCAPH2_uc003blu.2_Non-coding_Transcript|NCAPH2_uc003blw.2_Non-coding_Transcript|NCAPH2_uc003bly.2_Non-coding_Transcript	NM_152299	NP_689512	Q6IBW4	CNDH2_HUMAN	kleisin beta isoform 2	145					chromosome condensation	chromosome|nucleus				ovary(1)	1		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)												0.237762	71.555819	80.570244	34	109	AA		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(115;0.212)	Missense_Mutation	SNP	49303280	49303280	10609	22	A	G	G	8	8	NCAPH2	G	4	4
TUBA3D	113457	broad.mit.edu	36	2	131954276	131954276	+	Silent	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:131954276C>T	uc002tsu.2	+	c.540C>T	c.(538-540)GCC>GCT	p.A180A		NM_080386	NP_525125	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	180					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0						Ovarian(137;2059 2432 35543 39401)								0.252551	259.678663	281.44824	99	293	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(221;0.13)	Silent	SNP	131954276	131954276	17302	2	C	T	T	23	23	TUBA3D	T	1	1
LY75	4065	broad.mit.edu	36	2	160437249	160437249	+	Silent	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:160437249A>G	uc002ubb.2	-	c.2076T>C	c.(2074-2076)GAT>GAC	p.D692D	LY75_uc010fos.1_Silent_p.D692D|LY75_uc002ubc.2_Silent_p.D692D|LY75_uc010fot.1_Silent_p.D692D	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75	692	Extracellular (Potential).|C-type lectin 4.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0														0.461883	302.39305	302.675748	103	120	AA		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(177;0.132)	Silent	SNP	160437249	160437249	9476	2	A	G	G	8	8	LY75	G	4	4
LRP2	4036	broad.mit.edu	36	2	169717637	169717637	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:169717637G>A	uc002ues.1	-	c.12379C>T	c.(12379-12381)CGC>TGC	p.R4127C		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4127	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	23					Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)				p.R4127S(MJ-Tumor)|p.R4127S(SKOV3-Tumor)|p.R4127S(ONCODG1-Tumor)|p.R4127S(NIHOVCAR3-Tumor)	2055				0.402105	576.85588	580.826427	191	284	GG		KEEP	---	---	---	---	capture		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Missense_Mutation	SNP	169717637	169717637	9329	2	G	A	A	39	39	LRP2	A	1	1
TTN	7273	broad.mit.edu	36	2	179151098	179151098	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179151098G>A	uc002umr.1	-	c.60686C>T	c.(60685-60687)CCG>CTG	p.P20229L	TTN_uc002ums.1_Missense_Mutation_p.P13924L|TTN_uc010frc.1_Missense_Mutation_p.P13857L|TTN_uc010frd.1_Missense_Mutation_p.P13732L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	21156										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153									p.P20229L(NALM6-Tumor)|p.P20229L(MOLT13-Tumor)	8722				0.39011	218.589846	220.513174	71	111	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		Missense_Mutation	SNP	179151098	179151098	17290	2	G	A	A	39	39	TTN	A	1	1
PTPRN	5798	broad.mit.edu	36	2	219868000	219868000	+	Silent	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:219868000G>A	uc002vkz.1	-	c.2616C>T	c.(2614-2616)TTC>TTT	p.F872F	PTPRN_uc002vla.1_Silent_p.F843F|MIR153-1_hsa-mir-153-1|MI0000463_5'Flank	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	872	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)	3		Renal(207;0.0474)												0.242424	16.580469	18.580218	8	25	GG		KEEP	---	---	---	---	capture		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)	Silent	SNP	219868000	219868000	13264	2	G	A	A	41	41	PTPRN	A	2	2
EHD3	30845	broad.mit.edu	36	2	31320816	31320816	+	Missense_Mutation	SNP	A	T	T			TCGA-16-0861-01	TCGA-16-0861-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:31320816A>T	uc002rnu.1	+	c.400A>T	c.(400-402)AAC>TAC	p.N134Y		NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	134					blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)													0.373333	76.878081	77.935847	28	47	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31320816	31320816	5168	2	A	T	T	9	9	EHD3	T	4	4
BIRC6	57448	broad.mit.edu	36	2	32627915	32627915	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:32627915G>A	uc010ezu.1	+	c.13007G>A	c.(13006-13008)AGT>AAT	p.S4336N		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	4336					anti-apoptosis|apoptosis|post-translational protein modification	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					Pancreas(94;175 1509 16028 18060 45422)				1555				0.342593	105.637073	108.003662	37	71	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32627915	32627915	1463	2	G	A	A	36	36	BIRC6	A	2	2
DLEC1	9940	broad.mit.edu	36	3	38114024	38114024	+	Silent	SNP	T	C	C			TCGA-16-0861-01	TCGA-16-0861-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr3:38114024T>C	uc003chp.1	+	c.2457T>C	c.(2455-2457)TTT>TTC	p.F819F	DLEC1_uc003cho.1_Silent_p.F819F|DLEC1_uc010hgv.1_Silent_p.F819F|DLEC1_uc003chr.1_5'UTR|DLEC1_uc010hgx.1_Non-coding_Transcript	NM_007337	NP_031363	Q9Y238	DLEC1_HUMAN	deleted in lung and esophageal cancer 1 isoform	819					negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|breast(1)|skin(1)	8														0.386364	104.528904	105.524974	34	54	TT		KEEP	---	---	---	---	capture		KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)	Silent	SNP	38114024	38114024	4732	3	T	C	C	63	63	DLEC1	C	4	4
FGA	2243	broad.mit.edu	36	4	155727457	155727457	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:155727457C>T	uc003iod.1	-	c.574G>A	c.(574-576)GTA>ATA	p.V192I	FGA_uc003ioe.1_Missense_Mutation_p.V192I|FGA_uc003iof.1_Intron	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	192	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	NSCLC(143;340 1922 20892 22370 48145)								0.385542	188.268732	190.171945	64	102	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	155727457	155727457	6067	4	C	T	T	20	20	FGA	T	2	2
FRYL	285527	broad.mit.edu	36	4	48270013	48270013	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:48270013G>C	uc003gyh.1	-	c.2851C>G	c.(2851-2853)CTA>GTA	p.L951V	FRYL_uc003gyk.1_Missense_Mutation_p.L951V	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	951					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1														0.417323	176.960103	177.716133	53	74	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48270013	48270013	6314	4	G	C	C	36	36	FRYL	C	3	3
ZNF608	57507	broad.mit.edu	36	5	124011326	124011326	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:124011326C>T	uc003ktq.1	-	c.2650G>A	c.(2650-2652)GAT>AAT	p.D884N	ZNF608_uc003ktr.1_Intron|ZNF608_uc003kts.1_Missense_Mutation_p.D884N|ZNF608_uc003ktt.1_Missense_Mutation_p.D884N	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	884						intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)								447				0.463087	200.144718	200.32249	69	80	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)	Missense_Mutation	SNP	124011326	124011326	18629	5	C	T	T	31	31	ZNF608	T	1	1
DNAH5	1767	broad.mit.edu	36	5	13882731	13882731	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:13882731C>T	uc003jfd.2	-	c.6332G>A	c.(6331-6333)CGT>CAT	p.R2111H		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2111	AAA 1 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|breast(1)|central_nervous_system(1)|pancreas(1)	17	Lung NSC(4;0.00476)													0.403974	175.139141	176.35746	61	90	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	13882731	13882731	4787	5	C	T	T	19	19	DNAH5	T	1	1
PCDHB15	56121	broad.mit.edu	36	5	140605786	140605786	+	Missense_Mutation	SNP	T	G	G			TCGA-16-0861-01	TCGA-16-0861-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140605786T>G	uc003lje.1	+	c.456T>G	c.(454-456)TTT>TTG	p.F152L		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	152	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)	4														0.405	265.514987	267.096496	81	119	TT		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		Missense_Mutation	SNP	140605786	140605786	11960	5	T	G	G	62	62	PCDHB15	G	4	4
N4BP3	23138	broad.mit.edu	36	5	177481471	177481471	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:177481471G>A	uc003mik.1	+	c.1498G>A	c.(1498-1500)GTG>ATG	p.V500M	N4BP3_uc003mil.1_Missense_Mutation_p.V169M	NM_015111	NP_055926	O15049	N4BP3_HUMAN	Nedd4 binding protein 3	500	Potential.					cytoplasmic vesicle membrane					0	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)												0.466667	17.816608	17.831463	7	8	GG		KEEP	---	---	---	---	capture	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Missense_Mutation	SNP	177481471	177481471	10508	5	G	A	A	40	40	N4BP3	A	1	1
RASGEF1C	255426	broad.mit.edu	36	5	179488120	179488120	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:179488120G>T	uc003mlq.1	-	c.535C>A	c.(535-537)CCC>ACC	p.P179T	RASGEF1C_uc003mlr.1_Missense_Mutation_p.P179T|RASGEF1C_uc003mlp.2_Missense_Mutation_p.P28T	NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	179					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)												0.428571	94.603998	94.936161	33	44	GG		KEEP	---	---	---	---	capture	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Missense_Mutation	SNP	179488120	179488120	13532	5	G	T	T	42	42	RASGEF1C	T	3	3
DST	667	broad.mit.edu	36	6	56450186	56450186	+	Silent	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:56450186G>A	uc003pcz.2	-	c.14700C>T	c.(14698-14700)GGC>GGT	p.G4900G	DST_uc003pcy.2_Silent_p.G4574G	NM_183380	NP_899236	Q03001	DYST_HUMAN	dystonin isoform 1	6986	Spectrin 20.				cell adhesion|cell cycle arrest|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasmic membrane-bounded vesicle|hemidesmosome|microtubule plus end|nucleus	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein C-terminus binding			ovary(7)|central_nervous_system(6)	13	Lung NSC(77;0.103)								p.G4574G(HCC1569-Tumor)|p.G4574G(PF382-Tumor)	2498				0.393782	217.374229	219.273966	76	117	GG		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		Silent	SNP	56450186	56450186	4967	6	G	A	A	38	38	DST	A	1	1
ME1	4199	broad.mit.edu	36	6	84112721	84112721	+	Missense_Mutation	SNP	A	T	T			TCGA-16-0861-01	TCGA-16-0861-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:84112721A>T	uc003pjy.1	-	c.490T>A	c.(490-492)TGT>AGT	p.C164S		NM_002395	NP_002386	P48163	MAOX_HUMAN	cytosolic malic enzyme 1	164					carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|oxidation-reduction process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			ovary(1)	1		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)			NADH(DB00157)									0.25	36.227696	39.406102	14	42	AA		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(397;0.0641)	Missense_Mutation	SNP	84112721	84112721	9806	6	A	T	T	7	7	ME1	T	4	4
IQUB	154865	broad.mit.edu	36	7	122939402	122939402	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:122939402G>T	uc003vkn.1	-	c.229C>A	c.(229-231)CAA>AAA	p.Q77K	IQUB_uc003vko.1_Missense_Mutation_p.Q77K|IQUB_uc010lkt.1_Non-coding_Transcript|IQUB_uc003vkp.1_Missense_Mutation_p.Q77K|IQUB_uc003vkq.1_Missense_Mutation_p.Q77K	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	77										ovary(3)|large_intestine(1)	4														0.408784	368.11175	370.265443	121	175	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	122939402	122939402	8123	7	G	T	T	48	48	IQUB	T	3	3
CNTNAP2	26047	broad.mit.edu	36	7	146460351	146460351	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:146460351C>T	uc003weu.1	+	c.1165C>T	c.(1165-1167)CGG>TGG	p.R389W		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	389	Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)												0.387931	260.518656	263.063608	90	142	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		Missense_Mutation	SNP	146460351	146460351	3785	7	C	T	T	19	19	CNTNAP2	T	1	1
NOS3	4846	broad.mit.edu	36	7	150324836	150324836	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:150324836G>C	uc003wif.1	+	c.472G>C	c.(472-474)GCA>CCA	p.A158P		NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 (endothelial cell)	158	Interaction with NOSIP.				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|oxidation-reduction process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)	7	all_neural(206;0.219)				L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)					755				0.375	9.313161	9.577684	6	10	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Missense_Mutation	SNP	150324836	150324836	10947	7	G	C	C	42	42	NOS3	C	3	3
TECPR1	25851	broad.mit.edu	36	7	97700813	97700813	+	Missense_Mutation	SNP	T	G	G			TCGA-16-0861-01	TCGA-16-0861-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:97700813T>G	uc003upg.1	-	c.1528A>C	c.(1528-1530)ACC>CCC	p.T510P	TECPR1_uc003uph.1_Missense_Mutation_p.T440P	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	510						integral to membrane	protein binding			pancreas(1)	1														0.347826	8.09304	8.700758	8	15	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	97700813	97700813	16270	7	T	G	G	59	59	TECPR1	G	4	4
SUSD1	64420	broad.mit.edu	36	9	113900696	113900696	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:113900696G>T	uc004bfu.1	-	c.1349C>A	c.(1348-1350)ACG>AAG	p.T450K	SUSD1_uc010mui.1_Missense_Mutation_p.T450K|SUSD1_uc010muj.1_Missense_Mutation_p.T450K	NM_022486	NP_071931	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	450	Extracellular (Potential).					integral to membrane	calcium ion binding				0														0.431694	245.694145	246.438309	79	104	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	113900696	113900696	15927	9	G	T	T	40	40	SUSD1	T	3	3
FKBP15	23307	broad.mit.edu	36	9	114986887	114986887	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:114986887G>A	uc004bgs.2	-	c.1517C>T	c.(1516-1518)TCA>TTA	p.S506L	FKBP15_uc004bgr.2_5'Flank|FKBP15_uc010mut.1_Missense_Mutation_p.S374L|FKBP15_uc010muu.1_Missense_Mutation_p.S570L	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	506					endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3														0.285714	7.988851	8.569742	4	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	114986887	114986887	6143	9	G	A	A	45	45	FKBP15	A	2	2
IARS	3376	broad.mit.edu	36	9	94047066	94047067	+	Missense_Mutation	DNP	GC	AA	AA			TCGA-16-0861-01	TCGA-16-0861-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:94047066_94047067GC>AA	uc004art.1	-	c.2899_2900GC>TT	c.(2899-2901)GCT>TTT	p.A967F	IARS_uc004ars.1_Missense_Mutation_p.A812F|IARS_uc004aru.2_Missense_Mutation_p.A967F|IARS_uc010mqr.1_Missense_Mutation_p.A857F|IARS_uc010mqs.1_Missense_Mutation_p.A967F|IARS_uc010mqt.1_Missense_Mutation_p.A190F|IARS_uc010mqu.1_5'Flank	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	967					isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)	1					L-Isoleucine(DB00167)									0.403101	161.774446	162.833583	52	77	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	94047066	94047067	7773	9	GC	AA	AA	34	34	IARS	AA	2	2
F9	2158	broad.mit.edu	36	X	138470680	138470680	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:138470680G>A	uc004fas.1	+	c.838G>A	c.(838-840)GGT>AGT	p.G280S	F9_uc004fat.1_Missense_Mutation_p.G242S	NM_000133	NP_000124	P00740	FA9_HUMAN	coagulation factor IX preproprotein	280	Peptidase S1.				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)									0.769231	246.096796	252.141099	70	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	138470680	138470680	5548	23	G	A	A	35	35	F9	A	2	2
ATP11C	286410	broad.mit.edu	36	X	138692503	138692503	+	Silent	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:138692503A>G	uc004faz.1	-	c.1830T>C	c.(1828-1830)GAT>GAC	p.D610D	ATP11C_uc004fay.1_Non-coding_Transcript|ATP11C_uc004fba.1_Silent_p.D610D	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	610	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)													0.627907	192.971142	194.207258	54	32	AA		KEEP	---	---	---	---	capture			Silent	SNP	138692503	138692503	1140	23	A	G	G	4	4	ATP11C	G	4	4
DKC1	1736	broad.mit.edu	36	X	153647833	153647833	+	Missense_Mutation	SNP	C	G	G			TCGA-16-0861-01	TCGA-16-0861-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:153647833C>G	uc004fmm.1	+	c.412C>G	c.(412-414)CGA>GGA	p.R138G	DKC1_uc010nvf.1_Missense_Mutation_p.R138G|SNORA36A_uc004fmn.1_5'Flank	NM_001363	NP_001354	O60832	DKC1_HUMAN	dyskerin isoform 1	138					cell proliferation|pseudouridine synthesis|rRNA processing	Cajal body|nucleolus|telomerase holoenzyme complex	protein binding|pseudouridine synthase activity|RNA binding|telomerase activity				0	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)													0.227273	9.761972	11.268658	5	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	153647833	153647833	4721	23	C	G	G	19	19	DKC1	G	3	3
PTEN	5728	broad.mit.edu	36	10	89675295	89675298	+	Splice_Site_Del	DEL	GTAA	-	-			TCGA-16-0861-01	TCGA-16-0861-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:89675295_89675298delGTAA	uc001kfb.1	+	c.e4_splice_site				NM_000314	NP_000305			phosphatase and tensin homolog						apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.?(13)|p.L70fs*7(2)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)				31	(U87MG-Tumor)|(SNU1040-Tumor)|(YKG1-Tumor)	264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.58			14	10				---	---	---	---	capture_indel			Splice_Site_Del	DEL	89675295	89675298	13192	10	GTAA	-	-	48	48	PTEN	-	5	5
HEATR5A	25938	broad.mit.edu	36	14	30922570	30922586	+	Frame_Shift_Del	DEL	GTGAAGACTTATGTCCA	-	-			TCGA-16-0861-01	TCGA-16-0861-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:30922570_30922586delGTGAAGACTTATGTCCA	uc001wrf.2	-	c.609_625delTGGACATAAGTCTTCAC	c.(607-627)ACTGGACATAAGTCTTCACCTfs	p.T203fs	HEATR5A_uc010ami.1_Frame_Shift_Del_p.T101fs|HEATR5A_uc001wrg.1_Frame_Shift_Del_p.T85fs	NM_015473	NP_056288			HEAT repeat containing 5A											ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)										0.49			65	68				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	30922570	30922586	7314	14	GTGAAGACTTATGTCCA	-	-	44	44	HEATR5A	-	5	5
REXO1	57455	broad.mit.edu	36	19	1778021	1778023	+	In_Frame_Del	DEL	GGA	-	-			TCGA-16-0861-01	TCGA-16-0861-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:1778021_1778023delGGA	uc002lua.2	-	c.1765_1767delTCC	c.(1765-1767)TCCdel	p.S589del	REXO1_uc010dsr.1_In_Frame_Del_p.S543del	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	589	Ser-rich.					nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.31			4	9				---	---	---	---	capture_indel			In_Frame_Del	DEL	1778021	1778023	13711	19	GGA	-	-	47	47	REXO1	-	5	5
