Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AGRN	375790	broad.mit.edu	37	1	957793	957793	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:957793C>T	uc001ack.1	+	2	464	c.414C>T	c.(412-414)CTC>CTT	p.L138L		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	138	NtA.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		ACTCCAGCCTCATGCGGATCA	0.632													6	66	---	---	---	---	PASS
AGRN	375790	broad.mit.edu	37	1	981368	981368	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:981368C>T	uc001ack.1	+	16	2755	c.2705C>T	c.(2704-2706)GCG>GTG	p.A902V		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	902					axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		GCGACCTGTGCGGAGATGCGC	0.667													7	39	---	---	---	---	PASS
GLTPD1	80772	broad.mit.edu	37	1	1263143	1263143	+	Nonstop_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1263143G>C	uc001aeo.2	+	3	1060	c.645G>C	c.(643-645)TAG>TAC	p.*215Y		NM_001029885	NP_001025056	Q5TA50	GLTD1_HUMAN	glycolipid transfer protein domain containing 1	215						cytoplasm	glycolipid binding|glycolipid transporter activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;4.95e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ACCTGCCCTAGGGGCGGGAAG	0.682													4	26	---	---	---	---	PASS
ACTRT2	140625	broad.mit.edu	37	1	2939345	2939345	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2939345G>T	uc001ajz.2	+	1	1300	c.1095G>T	c.(1093-1095)AAG>AAT	p.K365N		NM_080431	NP_536356	Q8TDY3	ACTT2_HUMAN	actin-related protein M2	365						cytoplasm|cytoskeleton					0	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		CAGACTTCAAGGAGTTTGGGA	0.602													7	202	---	---	---	---	PASS
CASP9	842	broad.mit.edu	37	1	15844888	15844888	+	Silent	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15844888C>A	uc001awn.2	-	2	230	c.135G>T	c.(133-135)CGG>CGT	p.R45R	CASP9_uc001awm.1_Silent_p.R45R|CASP9_uc001awo.2_Silent_p.R45R|CASP9_uc001awp.2_5'UTR|CASP9_uc009voi.2_5'UTR|CASP9_uc010obm.1_5'UTR|CASP9_uc001awq.2_5'UTR	NM_001229	NP_001220	P55211	CASP9_HUMAN	caspase 9 isoform alpha preproprotein	45	CARD.				activation of caspase activity by cytochrome c|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol	cysteine-type endopeptidase activity|enzyme activator activity|protein binding			central_nervous_system(1)|kidney(1)	2		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		CAGAGCCTGCCCGCTGTTTGG	0.498													17	41	---	---	---	---	PASS
KLHDC7A	127707	broad.mit.edu	37	1	18808683	18808683	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18808683G>T	uc001bax.2	+	1	1260	c.1208G>T	c.(1207-1209)CGG>CTG	p.R403L	KLHDC7A_uc009vpg.2_Missense_Mutation_p.R185L	NM_152375	NP_689588	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	403						integral to membrane				ovary(2)|upper_aerodigestive_tract(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AGAAGCAGCCGGGAGCCCCAT	0.667													3	16	---	---	---	---	PASS
DCDC2B	149069	broad.mit.edu	37	1	32678369	32678369	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32678369C>A	uc001bun.2	+	6	689	c.689C>A	c.(688-690)TCG>TAG	p.S230*		NM_001099434	NP_001092904	A2VCK2	DCD2B_HUMAN	doublecortin domain containing 2B	230					intracellular signal transduction						0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CCTCCAGGCTCGAAGTCTAGG	0.587													4	53	---	---	---	---	PASS
DLGAP3	58512	broad.mit.edu	37	1	35332751	35332751	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35332751C>T	uc001byc.2	-	9	2619	c.2619G>A	c.(2617-2619)GCG>GCA	p.A873A		NM_001080418	NP_001073887	O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated	873					cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)				CCCAGAAACCCGCCAGGTCCT	0.577											OREG0013353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	59	---	---	---	---	PASS
SMAP2	64744	broad.mit.edu	37	1	40874374	40874374	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40874374A>G	uc001cfj.2	+	3	352	c.287A>G	c.(286-288)TAT>TGT	p.Y96C	SMAP2_uc010ojh.1_Missense_Mutation_p.Y96C|SMAP2_uc001cfk.2_Missense_Mutation_p.Y66C|SMAP2_uc010oji.1_Missense_Mutation_p.Y13C	NM_022733	NP_073570	Q8WU79	SMAP2_HUMAN	small ArfGAP2	96	Arf-GAP.				regulation of ARF GTPase activity	cytoplasm|nucleus	ARF GTPase activator activity|zinc ion binding				0	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)			TATGAAGCCTATCTTCCTGAG	0.448													18	56	---	---	---	---	PASS
STIL	6491	broad.mit.edu	37	1	47765602	47765602	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47765602G>A	uc001crc.1	-	6	831	c.676C>T	c.(676-678)CAA>TAA	p.Q226*	TAL1_uc001crb.1_Intron|STIL_uc010omn.1_Nonsense_Mutation_p.Q179*|STIL_uc010omo.1_Nonsense_Mutation_p.Q226*|STIL_uc001crd.1_Nonsense_Mutation_p.Q226*|STIL_uc001cre.1_Nonsense_Mutation_p.Q226*|STIL_uc001crg.1_Nonsense_Mutation_p.Q179*	NM_003035	NP_003026	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus isoform 2	226					cell proliferation|multicellular organismal development	centrosome|cytosol				lung(2)|skin(1)	3		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				CCTTGAACTTGAGAAATATTC	0.333													7	37	---	---	---	---	PASS
DNTTIP2	30836	broad.mit.edu	37	1	94343061	94343061	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94343061C>G	uc001dqf.2	-	2	468	c.430G>C	c.(430-432)GAA>CAA	p.E144Q	DNTTIP2_uc010otm.1_RNA|DNTTIP2_uc009wdo.1_Intron	NM_014597	NP_055412	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal,	144					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		ACATGAGATTCTGCTTCAGAC	0.413													16	26	---	---	---	---	PASS
HIPK1	204851	broad.mit.edu	37	1	114483925	114483925	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114483925A>T	uc001eem.2	+	2	1081	c.920A>T	c.(919-921)AAG>ATG	p.K307M	HIPK1_uc001eel.2_Missense_Mutation_p.K307M|HIPK1_uc001een.2_Missense_Mutation_p.K307M	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	307	Protein kinase.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGAAGCTCAAGAGTCTTGGT	0.458													15	29	---	---	---	---	PASS
SEC22B	9554	broad.mit.edu	37	1	145103915	145103915	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145103915G>A	uc001eml.1	+	2	223	c.83G>A	c.(82-84)CGG>CAG	p.R28Q	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883	O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B	28	Longin.|Cytoplasmic (Potential).				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0						CAGTCTGGCCGGGACCTTCAA	0.418													6	26	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152325832	152325832	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152325832C>T	uc001ezw.3	-	3	4503	c.4430G>A	c.(4429-4431)AGA>AAA	p.R1477K	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1477	Filaggrin 5.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGGGCATGTCTAGTGGTATC	0.507													38	291	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155319173	155319173	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155319173T>C	uc009wqq.2	-	19	7994	c.7514A>G	c.(7513-7515)TAT>TGT	p.Y2505C	RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Missense_Mutation_p.Y2500C|MIR555_hsa-mir-555|MI0003561_5'Flank	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	2505	Bromo.				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CACTGTCTTATAGTAACCAGT	0.408													19	35	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155408137	155408137	+	Missense_Mutation	SNP	C	T	T	rs142217207		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155408137C>T	uc009wqq.2	-	5	6289	c.5809G>A	c.(5809-5811)GAG>AAG	p.E1937K	ASH1L_uc001fkt.2_Missense_Mutation_p.E1937K	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	1937					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TTCTCTTGCTCTTCTTCCTCT	0.343													22	97	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157490979	157490979	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157490979C>T	uc001fqu.2	-	11	2501	c.2343G>A	c.(2341-2343)CTG>CTA	p.L781L	FCRL5_uc009wsm.2_Silent_p.L781L	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	781	Extracellular (Potential).|Ig-like C2-type 8.					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GGTACAGGATCAGGGGAGAGC	0.612													18	55	---	---	---	---	PASS
OR10X1	128367	broad.mit.edu	37	1	158549012	158549012	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158549012G>T	uc010pin.1	-	1	678	c.678C>A	c.(676-678)ACC>ACA	p.T226T		NM_001004477	NP_001004477	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X,	226	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					TGAGCAGAAGGGTACCCAGCA	0.473													5	73	---	---	---	---	PASS
MAEL	84944	broad.mit.edu	37	1	166962035	166962035	+	Silent	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166962035C>A	uc001gdy.1	+	4	509	c.438C>A	c.(436-438)CTC>CTA	p.L146L	MAEL_uc001gdz.1_Silent_p.L115L|MAEL_uc009wvf.1_RNA	NM_032858	NP_116247	Q96JY0	MAEL_HUMAN	maelstrom homolog	146					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|multicellular organismal development|piRNA metabolic process|spermatogenesis	piP-body	DNA binding			skin(1)	1						AGTATTCTCTCCAAGAAGGTA	0.363													14	47	---	---	---	---	PASS
TDRD5	163589	broad.mit.edu	37	1	179609118	179609118	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179609118A>T	uc001gnf.1	+	10	1915	c.1665A>T	c.(1663-1665)GAA>GAT	p.E555D	TDRD5_uc010pnp.1_Missense_Mutation_p.E555D|TDRD5_uc001gnh.1_Missense_Mutation_p.E110D	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	555	Tudor.				DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						AGAAACAGGAAGTTGAAGTGT	0.413													28	96	---	---	---	---	PASS
RGS8	85397	broad.mit.edu	37	1	182635995	182635995	+	Intron	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182635995C>T	uc010pnw.1	-						RGS8_uc001gpn.1_Intron|RGS8_uc001gpm.1_Intron	NM_001102450	NP_001095920	P57771	RGS8_HUMAN	regulator of G-protein signalling 8 isoform 2						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)	1						GGCACGTGGCCGTACTACTCA	0.493													18	42	---	---	---	---	PASS
RGL1	23179	broad.mit.edu	37	1	183885717	183885717	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183885717C>T	uc001gqo.2	+	16	2043	c.1886C>T	c.(1885-1887)TCG>TTG	p.S629L	RGL1_uc001gqm.2_Missense_Mutation_p.S664L|RGL1_uc010pog.1_Missense_Mutation_p.S627L|RGL1_uc010poh.1_Missense_Mutation_p.S627L|RGL1_uc010poi.1_Missense_Mutation_p.S600L	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation	629					cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						CGCTCTGTCTCGGTGACGTCC	0.507													48	100	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	185959424	185959424	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185959424G>T	uc001grq.1	+	22	3455	c.3226G>T	c.(3226-3228)GGA>TGA	p.G1076*	HMCN1_uc001grr.1_Nonsense_Mutation_p.G417*	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1076	Ig-like C2-type 8.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CAGAGTGTTTGGAGATCAACG	0.423													8	378	---	---	---	---	PASS
TATDN3	128387	broad.mit.edu	37	1	212965318	212965318	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212965318G>C	uc001hjo.2	+	1	149	c.55G>C	c.(55-57)GAC>CAC	p.D19H	NSL1_uc001hjm.2_5'Flank|NSL1_uc001hjn.2_5'Flank|NSL1_uc010pti.1_5'Flank|TATDN3_uc010ptj.1_Missense_Mutation_p.D19H|TATDN3_uc010ptk.1_Missense_Mutation_p.D19H|TATDN3_uc001hjp.2_Missense_Mutation_p.D19H|TATDN3_uc010ptl.1_Missense_Mutation_p.D19H	NM_001042552	NP_001036017	Q17R31	TATD3_HUMAN	TatD DNase domain containing 3 isoform 1	19						nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)		CTCCGCCCCGGACTTTGACCG	0.662													3	15	---	---	---	---	PASS
PTPN14	5784	broad.mit.edu	37	1	214551397	214551397	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214551397G>T	uc001hkk.1	-	14	2864	c.2593C>A	c.(2593-2595)CTG>ATG	p.L865M	PTPN14_uc010pty.1_Missense_Mutation_p.L766M	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type	865					lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GCCAACATCAGCGGCCTCTTC	0.522													13	41	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215963407	215963407	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215963407C>A	uc001hku.1	-	51	10563	c.10176G>T	c.(10174-10176)ATG>ATT	p.M3392I		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3392	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTACCTTCATCATCATTCCAG	0.333										HNSCC(13;0.011)			10	44	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216062110	216062110	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216062110G>C	uc001hku.1	-	41	8268	c.7881C>G	c.(7879-7881)ATC>ATG	p.I2627M		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2627	Extracellular (Potential).|Fibronectin type-III 13.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTGGACTTGGGATCCCTTCCG	0.498										HNSCC(13;0.011)			12	32	---	---	---	---	PASS
BPNT1	10380	broad.mit.edu	37	1	220253061	220253061	+	Intron	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220253061T>C	uc001hma.2	-						BPNT1_uc010pug.1_Intron|BPNT1_uc010puh.1_Intron|BPNT1_uc001hmb.3_Intron	NM_006085	NP_006076	O95861	BPNT1_HUMAN	3'(2'), 5'-bisphosphate nucleotidase 1						3'-phosphoadenosine 5'-phosphosulfate metabolic process|nervous system development|xenobiotic metabolic process	cytosol	3'(2'),5'-bisphosphate nucleotidase activity			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0558)		ATATGAGAGTTTGAGTACCTT	0.378													15	39	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237837447	237837447	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237837447A>G	uc001hyl.1	+	59	8762	c.8642A>G	c.(8641-8643)GAG>GGG	p.E2881G	RYR2_uc010pxz.1_5'Flank	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2881	Modulator (Potential).|Cytoplasmic (By similarity).|4 X approximate repeats.|Calmodulin-binding (Potential).|4.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACAGCCAAAGAGAAAGCCAAG	0.423													21	92	---	---	---	---	PASS
OR2W5	441932	broad.mit.edu	37	1	247655048	247655048	+	Missense_Mutation	SNP	C	A	A	rs141044958		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247655048C>A	uc001icz.1	+	1	619	c.619C>A	c.(619-621)CCT>ACT	p.P207T		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	207					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GGGTGGCTCTCCTCCTGGTGC	0.567													23	85	---	---	---	---	PASS
OR2W5	441932	broad.mit.edu	37	1	247655049	247655049	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247655049C>A	uc001icz.1	+	1	620	c.620C>A	c.(619-621)CCT>CAT	p.P207H		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	207					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GGTGGCTCTCCTCCTGGTGCC	0.567													25	83	---	---	---	---	PASS
MATN3	4148	broad.mit.edu	37	2	20200307	20200307	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20200307C>A	uc002rdl.2	-	5	1126	c.1063G>T	c.(1063-1065)GGT>TGT	p.G355C	MATN3_uc010exu.1_Missense_Mutation_p.G313C	NM_002381	NP_002372	O15232	MATN3_HUMAN	matrilin 3 precursor	355	EGF-like 3.				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCATGGGTACCCAAAGCACAT	0.393													4	24	---	---	---	---	PASS
TMEM214	54867	broad.mit.edu	37	2	27260448	27260448	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27260448C>G	uc002ria.3	+	9	1140	c.1030C>G	c.(1030-1032)CAG>GAG	p.Q344E	TMEM214_uc010yle.1_RNA|TMEM214_uc002rib.3_Missense_Mutation_p.Q299E	NM_017727	NP_060197	Q6NUQ4	TM214_HUMAN	transmembrane protein 214 isoform 1	344						integral to membrane	protein binding				0						GCAGCTGTGTCAGCTCTACCC	0.547													18	61	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32712731	32712731	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32712731G>T	uc010ezu.2	+	41	7965	c.7831G>T	c.(7831-7833)GGA>TGA	p.G2611*		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	2611					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GTCTCCCACTGGAACAGATGA	0.328													5	119	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32832614	32832614	+	Silent	SNP	A	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32832614A>T	uc010ezu.2	+	72	14297	c.14163A>T	c.(14161-14163)ACA>ACT	p.T4721T		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	4721					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					CCAGTGGCACACAGAGTTCTC	0.423													31	137	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40656932	40656932	+	Silent	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40656932T>C	uc002rrx.2	-	1	513	c.489A>G	c.(487-489)GCA>GCG	p.A163A	SLC8A1_uc002rry.2_Silent_p.A163A|SLC8A1_uc002rrz.2_Silent_p.A163A|SLC8A1_uc002rsa.2_Silent_p.A163A|SLC8A1_uc002rsd.3_Silent_p.A163A|SLC8A1_uc002rsb.1_Silent_p.A163A|SLC8A1_uc010fan.1_Silent_p.A163A|SLC8A1_uc002rsc.1_Silent_p.A163A	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	163	Extracellular (Potential).|Alpha-1.				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CGAGGTCTCCTGCAGTGAAGT	0.473													9	41	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43986038	43986038	+	Splice_Site	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43986038G>A	uc010yny.1	+	27	4025	c.3942_splice	c.e27-1	p.R1314_splice		NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H							cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				tttttttttAGGCAGCTTTGC	0.378													4	15	---	---	---	---	PASS
SRBD1	55133	broad.mit.edu	37	2	45826850	45826850	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45826850C>A	uc002rus.2	-	4	462	c.386G>T	c.(385-387)AGG>ATG	p.R129M		NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	129					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			CTTTTTAGTCCTTCGAACTGT	0.423													6	142	---	---	---	---	PASS
GMCL1	64395	broad.mit.edu	37	2	70064701	70064701	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70064701A>G	uc002sfu.2	+	2	490	c.283A>G	c.(283-285)AAA>GAA	p.K95E		NM_178439	NP_848526	Q96IK5	GMCL1_HUMAN	germ cell-less	95					cell differentiation|multicellular organismal development|spermatogenesis	nuclear matrix				ovary(3)	3						GAGTACATCTAAATATATTTA	0.239													6	22	---	---	---	---	PASS
CYP26B1	56603	broad.mit.edu	37	2	72359529	72359529	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72359529C>A	uc002sih.1	-	6	1366	c.1366G>T	c.(1366-1368)GTG>TTG	p.V456L	CYP26B1_uc010yra.1_Missense_Mutation_p.V439L|CYP26B1_uc010yrb.1_Missense_Mutation_p.V381L	NM_019885	NP_063938	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily b,	456					cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			skin(2)	2						GCCAGCTCCACCGCCAGCACC	0.657													3	7	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	79878739	79878739	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79878739C>G	uc010ysh.1	+	1	62	c.57C>G	c.(55-57)ATC>ATG	p.I19M	CTNNA2_uc010yse.1_Missense_Mutation_p.I19M|CTNNA2_uc010ysf.1_Missense_Mutation_p.I19M|CTNNA2_uc010ysg.1_Missense_Mutation_p.I19M|hsa-mir-4264|MI0015877_5'Flank	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	19					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GTTTGGAAATCCGGACGCTAA	0.398													8	64	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89247247	89247247	+	RNA	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89247247C>A	uc010ytr.1	-	100		c.7937G>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TACCTGGGAGCCAGAGCAGCA	0.512													28	88	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89265772	89265772	+	RNA	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89265772C>G	uc010ytr.1	-	95		c.7794G>C			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GGGTGTGTAACACTGTGGGAG	0.512													42	102	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89340006	89340006	+	RNA	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89340006G>A	uc010ytr.1	-	64		c.5853C>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TCTGGATGTCGCATCTGGAAC	0.458													54	162	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90260124	90260124	+	RNA	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90260124T>C	uc010fhm.2	+	30		c.4107T>C								Parts of antibodies, mostly variable regions.																		GCATCCACTTTGCAAAGTGGG	0.478													18	167	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	124979288	124979288	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124979288G>T	uc002tno.2	+	2	453	c.89G>T	c.(88-90)TGT>TTT	p.C30F	CNTNAP5_uc010flu.2_Missense_Mutation_p.C30F	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	30	F5/8 type C.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		ATAGACAACTGTGATGATCCA	0.428													6	23	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	137814720	137814720	+	Silent	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137814720G>C	uc002tva.1	+	2	777	c.777G>C	c.(775-777)TCG>TCC	p.S259S	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_Silent_p.S149S	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		ATCATCATTCGAAGTCTTGGG	0.388													6	62	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162751233	162751233	+	Missense_Mutation	SNP	G	T	T	rs61748241		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162751233G>T	uc002ubx.3	+	11	1423	c.1239G>T	c.(1237-1239)TTG>TTT	p.L413F	SLC4A10_uc010fpa.1_Missense_Mutation_p.L425F|SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Missense_Mutation_p.L383F|SLC4A10_uc010zcs.1_Missense_Mutation_p.L394F	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	413	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						GTAATGACTTGGTATCAGGAA	0.323													4	46	---	---	---	---	PASS
CCDC141	285025	broad.mit.edu	37	2	179702022	179702022	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179702022C>G	uc002unf.1	-	13	2256	c.2199G>C	c.(2197-2199)AAG>AAC	p.K733N	CCDC141_uc002une.1_Missense_Mutation_p.K183N	NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	733							protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			AGGCAGTACTCTTTTCCACGA	0.473													18	42	---	---	---	---	PASS
PARD3B	117583	broad.mit.edu	37	2	206023503	206023503	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206023503G>T	uc002var.1	+	11	1699	c.1492G>T	c.(1492-1494)GAG>TAG	p.E498*	PARD3B_uc010fub.1_Nonsense_Mutation_p.E498*|PARD3B_uc002vao.1_Nonsense_Mutation_p.E498*|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Nonsense_Mutation_p.E498*	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform	498	PDZ 3.				cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		GCTCACCTTTGAGATCCCCCT	0.468													10	158	---	---	---	---	PASS
PIKFYVE	200576	broad.mit.edu	37	2	209200098	209200098	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209200098C>T	uc002vcz.2	+	25	4369	c.4211C>T	c.(4210-4212)CCA>CTA	p.P1404L	PIKFYVE_uc002vcy.1_Missense_Mutation_p.P1348L	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	1404					cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						CGTCAGGCCCCATTAAAAGTG	0.343													19	72	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216251681	216251681	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216251681C>T	uc002vfa.2	-	28	4609	c.4343G>A	c.(4342-4344)GGT>GAT	p.G1448D	FN1_uc002vfb.2_Missense_Mutation_p.G1357D|FN1_uc002vfc.2_Missense_Mutation_p.G1357D|FN1_uc002vfd.2_Missense_Mutation_p.G1448D|FN1_uc002vfe.2_Missense_Mutation_p.G1357D|FN1_uc002vff.2_Missense_Mutation_p.G1357D|FN1_uc002vfg.2_Missense_Mutation_p.G1357D|FN1_uc002vfh.2_Missense_Mutation_p.G1357D|FN1_uc002vfi.2_Missense_Mutation_p.G1448D|FN1_uc002vfj.2_Missense_Mutation_p.G1448D|FN1_uc002vez.2_5'UTR|FN1_uc010zjp.1_Missense_Mutation_p.G75D	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGAATCAAGACCTGTTTTTCC	0.458													5	19	---	---	---	---	PASS
BHLHE40	8553	broad.mit.edu	37	3	5023083	5023083	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5023083G>T	uc003bqf.2	+	4	572	c.265G>T	c.(265-267)GGT>TGT	p.G89C	uc003bqe.1_5'Flank|uc010hce.1_5'Flank|BHLHE40_uc011asw.1_5'UTR	NM_003670	NP_003661	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40	89	Helix-loop-helix motif.					Golgi apparatus|nucleolus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCAGACTTTGGGTCACTTGGA	0.413													6	181	---	---	---	---	PASS
GRIP2	80852	broad.mit.edu	37	3	14549198	14549198	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14549198T>A	uc011avi.1	-	19	2383	c.2383A>T	c.(2383-2385)ATC>TTC	p.I795F	GRIP2_uc010heh.2_RNA|GRIP2_uc011avh.1_Missense_Mutation_p.I326F	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2	697	PDZ 6.				synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1						CCCACGTGGATGGCACCAGTC	0.622													8	18	---	---	---	---	PASS
QRICH1	54870	broad.mit.edu	37	3	49094466	49094466	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49094466C>G	uc010hkq.2	-	4	1463	c.1167G>C	c.(1165-1167)ATG>ATC	p.M389I	QRICH1_uc003cvu.2_Missense_Mutation_p.M389I|QRICH1_uc003cvv.2_Missense_Mutation_p.M389I	NM_198880	NP_942581	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	389	Gln-rich.									ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TGTTGCCATTCATGAACTGTG	0.473													6	30	---	---	---	---	PASS
HYAL1	3373	broad.mit.edu	37	3	50338437	50338437	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50338437C>T	uc003czp.2	-	3	1104	c.972G>A	c.(970-972)TGG>TGA	p.W324*	HYAL3_uc003czc.1_5'Flank|HYAL3_uc003czd.1_5'Flank|HYAL3_uc003cze.1_5'Flank|HYAL3_uc003czf.1_5'Flank|HYAL3_uc003czg.1_5'Flank|NAT6_uc003czi.2_5'Flank|NAT6_uc003czj.2_5'Flank|NAT6_uc003czk.3_5'Flank|NAT6_uc003czl.1_5'Flank|HYAL1_uc003czm.2_Nonsense_Mutation_p.W142*|HYAL1_uc003czo.2_Nonsense_Mutation_p.W65*|HYAL1_uc003czq.2_Intron|HYAL1_uc003czr.2_Nonsense_Mutation_p.W324*|HYAL1_uc003czn.2_5'UTR|HYAL1_uc003czs.2_Nonsense_Mutation_p.W324*|HYAL1_uc003czt.2_Nonsense_Mutation_p.W324*	NM_033159	NP_149349	Q12794	HYAL1_HUMAN	hyaluronoglucosaminidase 1 isoform 1	324						extracellular space|lysosome	hyalurononglucosaminidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)	Hyaluronidase(DB00070)	TTGTATTTTCCCAGCTCACCC	0.627													4	9	---	---	---	---	PASS
DNAH12	201625	broad.mit.edu	37	3	57528591	57528591	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57528591C>G	uc003dit.2	-	2	188	c.7G>C	c.(7-9)GAT>CAT	p.D3H	DNAH12_uc003diu.2_Missense_Mutation_p.D3H	NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1	3	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						TTGTTTGCATCTGACATCTTG	0.418													11	23	---	---	---	---	PASS
PDZRN3	23024	broad.mit.edu	37	3	73437214	73437214	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73437214C>T	uc003dpl.1	-	8	1519	c.1423G>A	c.(1423-1425)GGG>AGG	p.G475R	PDZRN3_uc011bgh.1_Missense_Mutation_p.G132R|PDZRN3_uc010hoe.1_Missense_Mutation_p.G173R|PDZRN3_uc011bgf.1_Missense_Mutation_p.G192R|PDZRN3_uc011bgg.1_Missense_Mutation_p.G195R	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	475	PDZ 2.						ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		ACCTCTATCCCATTAATCTTT	0.403													18	59	---	---	---	---	PASS
EPHA6	285220	broad.mit.edu	37	3	96533764	96533764	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96533764A>T	uc010how.1	+	1	340	c.297A>T	c.(295-297)GAA>GAT	p.E99D	EPHA6_uc003drp.1_Missense_Mutation_p.E99D	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	5						integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						GGGGCTGCGAAGTCCGGGAAT	0.562													5	35	---	---	---	---	PASS
OR5K3	403277	broad.mit.edu	37	3	98109533	98109533	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98109533G>C	uc011bgw.1	+	1	24	c.24G>C	c.(22-24)TTG>TTC	p.L8F		NM_001005516	NP_001005516	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K,	8	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATCACTCCTTGATAGCTGAGT	0.388													16	46	---	---	---	---	PASS
IMPG2	50939	broad.mit.edu	37	3	100994577	100994577	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100994577C>T	uc003duq.1	-	6	799	c.596G>A	c.(595-597)AGT>AAT	p.S199N	IMPG2_uc011bhe.1_Missense_Mutation_p.S62N	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	199	Extracellular (Potential).				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						ATGTGGAACACTGAGAGTAGT	0.423													10	38	---	---	---	---	PASS
ILDR1	286676	broad.mit.edu	37	3	121712684	121712684	+	Silent	SNP	A	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121712684A>T	uc003ees.2	-	7	1018	c.912T>A	c.(910-912)CCT>CCA	p.P304P	ILDR1_uc003eeq.2_Silent_p.P272P|ILDR1_uc003eer.2_Silent_p.P260P|ILDR1_uc010hrg.2_Silent_p.P215P	NM_175924	NP_787120	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor	304	Cytoplasmic (Potential).					cytosol|integral to membrane|plasma membrane	receptor activity			skin(1)	1				GBM - Glioblastoma multiforme(114;0.156)		CTTTGAGGTCAGGGGGCAGAG	0.582													8	34	---	---	---	---	PASS
ADCY5	111	broad.mit.edu	37	3	123044199	123044199	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123044199G>T	uc003egh.1	-	8	2058	c.2058C>A	c.(2056-2058)GGC>GGA	p.G686G	ADCY5_uc003egg.1_Silent_p.G319G|ADCY5_uc003egi.1_Silent_p.G245G	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	686	Cytoplasmic (Potential).				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		ACACCTGGTTGCCACCCAGGT	0.622													14	57	---	---	---	---	PASS
KBTBD12	166348	broad.mit.edu	37	3	127649097	127649097	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127649097C>G	uc010hsr.2	+	3	1466	c.1463C>G	c.(1462-1464)GCT>GGT	p.A488G	KBTBD12_uc003ejy.3_Missense_Mutation_p.A95G|KBTBD12_uc010hsq.2_Intron|KBTBD12_uc003eka.3_Missense_Mutation_p.A63G	NM_207335	NP_997218	Q3ZCT8	KBTBC_HUMAN	kelch domain containing 6	488	Kelch 2.									ovary(1)	1						TTCAGTACAGCTGTAGTCAAC	0.418													3	22	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	149700113	149700113	+	IGR	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149700113C>G								PFN2 (11372 upstream) : TSC22D2 (426675 downstream)																							CAGTCTCACTCGATGATGCCG	0.502													38	184	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	150903113	150903113	+	Intron	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150903113T>C	uc003eyp.2	+						MED12L_uc011bnz.1_Intron|MED12L_uc003eyn.2_Intron|MED12L_uc003eyo.2_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTGTTGGTCATTAGGTTGCGC	0.502													5	42	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164780248	164780248	+	Missense_Mutation	SNP	T	C	C	rs148454534		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164780248T>C	uc003fei.2	-	9	993	c.931A>G	c.(931-933)ATA>GTA	p.I311V		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	311	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TATGTTACTATTGGAGTAGGC	0.323										HNSCC(35;0.089)			11	33	---	---	---	---	PASS
SERPINI2	5276	broad.mit.edu	37	3	167189518	167189518	+	Silent	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167189518T>C	uc003fer.1	-	1	163	c.105A>G	c.(103-105)CAA>CAG	p.Q35Q	SERPINI2_uc003fes.1_Silent_p.Q45Q|SERPINI2_uc003fet.1_Silent_p.Q35Q	NM_006217	NP_006208	O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin),	35					cellular component movement|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(2)|urinary_tract(1)	3						AGGAAACCTCTTGATAAAGAT	0.393													22	115	---	---	---	---	PASS
PHC3	80012	broad.mit.edu	37	3	169846593	169846593	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169846593G>A	uc010hws.1	-	8	1695	c.1631C>T	c.(1630-1632)TCA>TTA	p.S544L	PHC3_uc003fgl.2_Missense_Mutation_p.S556L|PHC3_uc011bpq.1_Missense_Mutation_p.S503L|PHC3_uc011bpr.1_Missense_Mutation_p.S470L	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	544	Pro-rich.				multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			TTCCTCTTCTGACACCAAAGC	0.507													50	228	---	---	---	---	PASS
FNDC3B	64778	broad.mit.edu	37	3	172028654	172028654	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172028654C>A	uc003fhy.2	+	11	1409	c.1237C>A	c.(1237-1239)CTT>ATT	p.L413I	FNDC3B_uc003fhz.3_Missense_Mutation_p.L413I|FNDC3B_uc003fia.2_Missense_Mutation_p.L344I	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	413	Fibronectin type-III 2.					endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		CACCAACTACCTTTTAGAGTG	0.318													6	163	---	---	---	---	PASS
ECT2	1894	broad.mit.edu	37	3	172479422	172479422	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172479422C>A	uc003fii.2	+	7	752	c.614C>A	c.(613-615)CCA>CAA	p.P205Q	ECT2_uc010hwv.1_Missense_Mutation_p.P236Q|ECT2_uc003fih.2_Missense_Mutation_p.P204Q|ECT2_uc003fij.1_Missense_Mutation_p.P205Q|ECT2_uc003fik.1_Missense_Mutation_p.P205Q|ECT2_uc003fil.1_Missense_Mutation_p.P236Q	NM_018098	NP_060568	Q9H8V3	ECT2_HUMAN	epithelial cell transforming sequence 2 oncogene	205	BRCT 1.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|ovary(1)|skin(1)	4	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			CTAGGTACTCCAATTATGAAG	0.323													6	90	---	---	---	---	PASS
NLGN1	22871	broad.mit.edu	37	3	173998368	173998368	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173998368C>A	uc003fio.1	+	7	2170	c.1747C>A	c.(1747-1749)CAA>AAA	p.Q583K	NLGN1_uc003fip.1_Missense_Mutation_p.Q583K	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	600	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CCAGAAAGACCAACTTTATCT	0.403													5	81	---	---	---	---	PASS
PSMD2	5708	broad.mit.edu	37	3	184020467	184020467	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184020467G>T	uc003fnn.1	+	7	897	c.864G>T	c.(862-864)GTG>GTT	p.V288V	PSMD2_uc011brj.1_Silent_p.V129V|PSMD2_uc011brk.1_Silent_p.V158V	NM_002808	NP_002799	Q13200	PSMD2_HUMAN	proteasome 26S non-ATPase subunit 2	288					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding				0	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	CTCTCCACAGGGTAGTACAGA	0.517													7	160	---	---	---	---	PASS
JAKMIP1	152789	broad.mit.edu	37	4	6080655	6080655	+	Intron	SNP	C	T	T	rs142678738	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6080655C>T	uc003giu.3	-						JAKMIP1_uc010idb.1_Intron|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Intron|JAKMIP1_uc010ide.2_Intron	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein						protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						GGTGCACCATCGCAGGCTCAC	0.572													8	25	---	---	---	---	PASS
KLF3	51274	broad.mit.edu	37	4	38691456	38691456	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38691456C>T	uc003gth.3	+	4	983	c.651C>T	c.(649-651)CCC>CCT	p.P217P	KLF3_uc003gtg.2_Silent_p.P217P	NM_016531	NP_057615	P57682	KLF3_HUMAN	Kruppel-like factor 3 (basic)	217	Pro-rich.				multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2						AAATGTCACCCCCCTTAATGA	0.403													20	65	---	---	---	---	PASS
PDS5A	23244	broad.mit.edu	37	4	39839563	39839563	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39839563C>A	uc003guv.3	-	32	4463	c.3923G>T	c.(3922-3924)GGT>GTT	p.G1308V	PDS5A_uc010ifo.2_Missense_Mutation_p.G1268V	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog	1308					cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						TGCTTCCAAACCCCCAGGGCT	0.448													14	47	---	---	---	---	PASS
N4BP2	55728	broad.mit.edu	37	4	40121557	40121557	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40121557G>T	uc003guy.3	+	9	2164	c.1826G>T	c.(1825-1827)AGA>ATA	p.R609I	N4BP2_uc010ifq.2_Missense_Mutation_p.R529I|N4BP2_uc010ifr.2_Missense_Mutation_p.R529I	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2	609						cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8						TACAGCCCAAGAGACGATGAA	0.313													8	34	---	---	---	---	PASS
N4BP2	55728	broad.mit.edu	37	4	40121558	40121558	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40121558A>T	uc003guy.3	+	9	2165	c.1827A>T	c.(1825-1827)AGA>AGT	p.R609S	N4BP2_uc010ifq.2_Missense_Mutation_p.R529S|N4BP2_uc010ifr.2_Missense_Mutation_p.R529S	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2	609						cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8						ACAGCCCAAGAGACGATGAAG	0.313													8	33	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47746482	47746482	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47746482G>T	uc003gxm.2	-	5	829	c.736C>A	c.(736-738)CAA>AAA	p.Q246K	CORIN_uc011bzf.1_Missense_Mutation_p.Q107K|CORIN_uc011bzg.1_Missense_Mutation_p.Q179K|CORIN_uc011bzh.1_Missense_Mutation_p.Q246K|CORIN_uc011bzi.1_Missense_Mutation_p.Q246K|CORIN_uc003gxn.3_Missense_Mutation_p.Q246K	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin	246	Extracellular (Potential).|FZ 1.				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						CTTTCAGTTTGGTTTCTAAAC	0.433													7	177	---	---	---	---	PASS
CWH43	80157	broad.mit.edu	37	4	49046872	49046872	+	Intron	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49046872C>T	uc003gyv.2	+						CWH43_uc011bzl.1_Intron	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog						GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						CAGGTGAGCACAGGGGTTTGA	0.353													15	44	---	---	---	---	PASS
AREG	374	broad.mit.edu	37	4	75312497	75312497	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75312497G>T	uc011cbl.1	+	2	518	c.308G>T	c.(307-309)AGA>ATA	p.R103I		NM_001657	NP_001648	P15514	AREG_HUMAN	amphiregulin preproprotein	103					cell proliferation|cell-cell signaling|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|positive regulation of DNA replication	cell surface|extracellular space|integral to membrane	cytokine activity|growth factor activity				0			Lung(101;0.196)			GATTCAGTCAGAGGTGAGTAG	0.448													6	139	---	---	---	---	PASS
HELQ	113510	broad.mit.edu	37	4	84328720	84328720	+	Intron	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84328720T>C	uc003hom.2	-						HELQ_uc010ikb.2_Intron|HELQ_uc003hol.3_Intron|HELQ_uc010ikc.2_Intron	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308								ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						GCATCTACATTAAAAAATTAA	0.403								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					6	18	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85781555	85781555	+	Intron	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85781555C>G	uc003hpd.2	-						WDFY3_uc003hpf.2_Intron	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GTCTGGCAACCTGGACTTACC	0.478													11	62	---	---	---	---	PASS
MTTP	4547	broad.mit.edu	37	4	100504545	100504545	+	Silent	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100504545T>C	uc003hvc.3	+	4	520	c.264T>C	c.(262-264)AAT>AAC	p.N88N	MTTP_uc011cej.1_Silent_p.N115N|MTTP_uc003hvb.2_Silent_p.N88N	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large	88	Vitellogenin.				lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	AGGATGTAAATGTTGAAAATG	0.343													12	124	---	---	---	---	PASS
DKK2	27123	broad.mit.edu	37	4	107847083	107847083	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107847083C>A	uc003hyi.2	-	2	951	c.246G>T	c.(244-246)AAG>AAT	p.K82N	DKK2_uc010ilw.1_RNA|DKK2_uc003hyj.1_Missense_Mutation_p.K82N	NM_014421	NP_055236	Q9UBU2	DKK2_HUMAN	dickkopf homolog 2 precursor	82	DKK-type Cys-1.				multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space				ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		CTTCACACTCCTTATCACTGC	0.468													5	44	---	---	---	---	PASS
QRFPR	84109	broad.mit.edu	37	4	122261669	122261669	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122261669C>T	uc010inj.1	-	2	816	c.437G>A	c.(436-438)GGA>GAA	p.G146E	QRFPR_uc010ink.1_RNA|QRFPR_uc003ids.2_Missense_Mutation_p.G146E|QRFPR_uc010inl.1_Missense_Mutation_p.G146E	NM_198179	NP_937822	Q96P65	QRFPR_HUMAN	G protein-coupled receptor 103	146	Cytoplasmic (Potential).					plasma membrane	neuropeptide Y receptor activity				0						ATGCACAAGTCCCTGGTGCCT	0.488													10	26	---	---	---	---	PASS
SMARCA5	8467	broad.mit.edu	37	4	144457612	144457612	+	Silent	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144457612C>A	uc003ijg.2	+	11	1738	c.1276C>A	c.(1276-1278)CGG>AGG	p.R426R		NM_003601	NP_003592	O60264	SMCA5_HUMAN	SWI/SNF-related matrix-associated	426					CenH3-containing nucleosome assembly at centromere|nucleosome positioning|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	condensed chromosome|nucleolus|nucleoplasm|NURF complex|RSF complex	ATP binding|ATPase activity|DNA binding|helicase activity|nucleosome binding|protein binding			skin(1)	1	all_hematologic(180;0.158)					TAGGTATACTCGGATATTAAT	0.363													4	36	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153245437	153245437	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153245437C>G	uc003ims.2	-	11	1903	c.1754G>C	c.(1753-1755)AGT>ACT	p.S585T	FBXW7_uc011cii.1_Missense_Mutation_p.S585T|FBXW7_uc003imt.2_Missense_Mutation_p.S585T|FBXW7_uc011cih.1_Missense_Mutation_p.S409T|FBXW7_uc003imq.2_Missense_Mutation_p.S505T|FBXW7_uc003imr.2_Missense_Mutation_p.S467T	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	585	WD 6.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TTCCATTCCACTTGTTAACGA	0.413			Mis|N|D|F		colorectal|endometrial|T-ALL								3	19	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177052851	177052851	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177052851G>T	uc003iuj.2	+	8	1288	c.1132G>T	c.(1132-1134)GAT>TAT	p.D378Y	WDR17_uc003iuk.2_Missense_Mutation_p.D354Y|WDR17_uc003ium.3_Missense_Mutation_p.D354Y|WDR17_uc003iul.1_Intron	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	378										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TGGACTTTATGATATGGGAGC	0.383													34	84	---	---	---	---	PASS
SNX25	83891	broad.mit.edu	37	4	186263206	186263206	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186263206C>G	uc003ixh.2	+	12	1820	c.1631C>G	c.(1630-1632)ACT>AGT	p.T544S	SNX25_uc010ish.2_Missense_Mutation_p.T315S|SNX25_uc003ixi.2_Missense_Mutation_p.T48S	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25	544	PX.				cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		GGAGTTGAAACTAAGAACTGG	0.423													32	106	---	---	---	---	PASS
SORBS2	8470	broad.mit.edu	37	4	186559238	186559238	+	Intron	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186559238G>A	uc003iyl.2	-						SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Missense_Mutation_p.R301C|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Intron|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cky.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Intron|SORBS2_uc003iyd.2_Missense_Mutation_p.R434C|SORBS2_uc003iye.2_Missense_Mutation_p.R308C|SORBS2_uc003iya.2_Missense_Mutation_p.R255C|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Missense_Mutation_p.R341C|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		CTTACCGGGCGTCCAAACTCC	0.368													20	71	---	---	---	---	PASS
SLC6A18	348932	broad.mit.edu	37	5	1232344	1232344	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1232344C>T	uc003jby.1	+	2	294	c.171C>T	c.(169-171)CTC>CTT	p.L57L		NM_182632	NP_872438	Q96N87	S6A18_HUMAN	solute carrier family 6, member 18	57	Helical; Name=2; (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GGGCCTTCCTCATCCCCTACG	0.687													4	7	---	---	---	---	PASS
CARD6	84674	broad.mit.edu	37	5	40852313	40852313	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40852313G>C	uc003jmg.2	+	3	954	c.879G>C	c.(877-879)TTG>TTC	p.L293F		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	293					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						TGTTATGTTTGAACATGGATA	0.393													10	41	---	---	---	---	PASS
CCDC125	202243	broad.mit.edu	37	5	68616152	68616152	+	Silent	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68616152C>A	uc003jvv.1	-	1	259	c.216G>T	c.(214-216)GCG>GCT	p.A72A	CCDC125_uc003jvx.1_Silent_p.A72A|CCDC125_uc003jvy.1_RNA|CCDC125_uc003jvw.2_5'UTR|CCDC125_uc003jvz.1_Silent_p.A72A	NM_176816	NP_789786	Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	72						cytoplasm					0		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		ACTGAAAACTCGCTTCATTTC	0.388													4	133	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70835476	70835476	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70835476G>T	uc003kbp.1	+	28	6285	c.6022G>T	c.(6022-6024)GTA>TTA	p.V2008L	BDP1_uc003kbo.2_Missense_Mutation_p.V2008L|BDP1_uc003kbq.1_RNA|BDP1_uc003kbr.1_Intron	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	2008					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		ACAGGGTGATGGTAAGAATGA	0.358													7	25	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70855849	70855849	+	Silent	SNP	A	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70855849A>C	uc003kbp.1	+	37	7544	c.7281A>C	c.(7279-7281)GGA>GGC	p.G2427G	BDP1_uc003kbq.1_RNA|BDP1_uc003kbr.1_RNA	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	2427					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TTACCTCAGGAAGCACACTGA	0.418													14	63	---	---	---	---	PASS
MRPS27	23107	broad.mit.edu	37	5	71521968	71521968	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71521968C>T	uc003kbz.3	-	9	789	c.753G>A	c.(751-753)TGG>TGA	p.W251*	MRPS27_uc003kca.3_Nonsense_Mutation_p.W195*|MRPS27_uc011cse.1_Nonsense_Mutation_p.W265*|MRPS27_uc011csd.1_Nonsense_Mutation_p.W32*|MRPS27_uc010iyz.1_RNA	NM_015084	NP_055899	Q92552	RT27_HUMAN	mitochondrial ribosomal protein S27	251						mitochondrion|ribosome					0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-53)		AGCCTGGTTTCCATATCAGAG	0.498													14	42	---	---	---	---	PASS
HMGCR	3156	broad.mit.edu	37	5	74654482	74654482	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74654482G>T	uc003kdp.2	+	16	2143	c.1987G>T	c.(1987-1989)GGT>TGT	p.G663C	HMGCR_uc011cst.1_Missense_Mutation_p.G683C|HMGCR_uc003kdq.2_Missense_Mutation_p.G610C|HMGCR_uc010izo.2_5'UTR|HMGCR_uc010izp.2_5'UTR	NM_000859	NP_000850	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-Coenzyme A reductase	663	Catalytic.				cholesterol biosynthetic process|coenzyme A metabolic process|germ cell migration|gonad development|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal membrane	hydroxymethylglutaryl-CoA reductase (NADPH) activity|NADP binding			ovary(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Cerivastatin(DB00439)|Fluvastatin(DB01095)|Lovastatin(DB00227)|NADH(DB00157)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	TTGTTAACAGGGTACAGAGAA	0.348													5	66	---	---	---	---	PASS
BHMT	635	broad.mit.edu	37	5	78423633	78423633	+	Silent	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78423633C>A	uc003kfu.3	+	7	969	c.864C>A	c.(862-864)GCC>GCA	p.A288A	BHMT_uc011cti.1_Silent_p.A135A	NM_001713	NP_001704	Q93088	BHMT1_HUMAN	betaine-homocysteine methyltransferase	288	Hcy-binding.				protein methylation|regulation of homocysteine metabolic process	cytoplasm	betaine-homocysteine S-methyltransferase activity|homocysteine S-methyltransferase activity|zinc ion binding			ovary(1)	1		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	CCAGAGAGGCCTACAACCTGG	0.502													11	36	---	---	---	---	PASS
HAPLN1	1404	broad.mit.edu	37	5	82948608	82948608	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82948608G>T	uc003kim.2	-	2	207	c.136C>A	c.(136-138)CAA>AAA	p.Q46K	HAPLN1_uc003kin.2_Missense_Mutation_p.Q46K	NM_001884	NP_001875	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	46	Ig-like V-type.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			large_intestine(3)|ovary(1)|skin(1)	5		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)		ACCTTGGCTTGCTCTGCTTCC	0.353													11	29	---	---	---	---	PASS
PPIP5K2	23262	broad.mit.edu	37	5	102513644	102513644	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102513644T>C	uc003kod.3	+	23	3236	c.2717T>C	c.(2716-2718)TTG>TCG	p.L906S	PPIP5K2_uc011cva.1_RNA|PPIP5K2_uc003koe.2_Missense_Mutation_p.L906S|PPIP5K2_uc003kof.2_Missense_Mutation_p.L207S	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1	906					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)|skin(1)	2						GACAAAAATTTGCCATCTGGC	0.393													8	87	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	129015459	129015459	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129015459C>A	uc003kvb.1	+	17	2491	c.2491C>A	c.(2491-2493)CTC>ATC	p.L831I	ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	831	Spacer.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CTTTATAGCTCTCCGAGATGC	0.348													15	51	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	129040093	129040093	+	Intron	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129040093C>T	uc003kvb.1	+						ADAMTS19_uc010jdh.1_Intron	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AGGTGAGAACCATTCTGTATA	0.438													20	64	---	---	---	---	PASS
REEP2	51308	broad.mit.edu	37	5	137780462	137780462	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137780462C>T	uc003lcz.2	+	5	445	c.323C>T	c.(322-324)ACG>ATG	p.T108M	REEP2_uc003lda.2_Missense_Mutation_p.T108M|REEP2_uc011cyt.1_Missense_Mutation_p.T69M	NM_016606	NP_057690	Q9BRK0	REEP2_HUMAN	receptor accessory protein 2	108						integral to membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GAGTACATCACGCAGGCCCGA	0.602													7	29	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140572150	140572150	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140572150C>A	uc003lix.2	+	1	199	c.25C>A	c.(25-27)CCA>ACA	p.P9T		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	9					calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTTGTGCTTCCCAAGACAAAG	0.473													6	87	---	---	---	---	PASS
PCDHGA9	56107	broad.mit.edu	37	5	140784058	140784058	+	Silent	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140784058G>C	uc003lkh.1	+	1	1539	c.1539G>C	c.(1537-1539)GTG>GTC	p.V513V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Silent_p.V513V	NM_018921	NP_061744	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9 isoform 1	513	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACACTGGTGTGCTGTATGCTC	0.458													9	43	---	---	---	---	PASS
PDE6A	5145	broad.mit.edu	37	5	149276332	149276332	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149276332C>A	uc003lrg.3	-	11	1535	c.1415G>T	c.(1414-1416)AGA>ATA	p.R472I		NM_000440	NP_000431	P16499	PDE6A_HUMAN	phosphodiesterase 6A	472					cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			ATACACCTCTCTGGTTTTCTG	0.522													6	138	---	---	---	---	PASS
HMMR	3161	broad.mit.edu	37	5	162910151	162910151	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162910151G>C	uc003lzf.2	+	14	1837	c.1655G>C	c.(1654-1656)AGA>ACA	p.R552T	HMMR_uc003lzh.2_Missense_Mutation_p.R553T|HMMR_uc003lzg.2_Missense_Mutation_p.R537T|HMMR_uc011dem.1_Missense_Mutation_p.R466T|uc003lzi.2_RNA	NM_012484	NP_036616	O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor isoform b	552						cell surface|cytoplasm	hyaluronic acid binding				0	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)		GAAGACTTTAGAAAACAGCTG	0.333													19	66	---	---	---	---	PASS
SLC22A23	63027	broad.mit.edu	37	6	3287237	3287237	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3287237C>T	uc003mvm.3	-	7	1402	c.1402G>A	c.(1402-1404)GAC>AAC	p.D468N	uc003mvi.1_RNA|SLC22A23_uc003mvn.3_Missense_Mutation_p.D187N|SLC22A23_uc003mvo.3_Missense_Mutation_p.D187N|SLC22A23_uc003mvp.1_RNA|SLC22A23_uc010jnn.2_Missense_Mutation_p.D468N|SLC22A23_uc003mvq.1_RNA	NM_015482	NP_056297	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23 isoform a	468	Helical; (Potential).				ion transport	integral to membrane	transmembrane transporter activity			ovary(1)	1	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				GTATAGTAGTCAGCATAGAAG	0.612													13	27	---	---	---	---	PASS
HIST1H4H	8365	broad.mit.edu	37	6	26285637	26285637	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26285637T>C	uc003nhm.2	-	1	91	c.91A>G	c.(91-93)ACT>GCT	p.T31A	HIST1H4H_uc003nhl.1_RNA	NM_003543	NP_003534	P62805	H4_HUMAN	histone cluster 1, H4h	31					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(2)	2						GCTGGCTTAGTGATGCCCTGG	0.532										HNSCC(76;0.23)			24	52	---	---	---	---	PASS
HIST1H4I	8294	broad.mit.edu	37	6	27107140	27107140	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27107140G>T	uc003niy.1	+	1	53	c.53G>T	c.(52-54)CGC>CTC	p.R18L	HIST1H2BK_uc003nix.1_Intron	NM_003495	NP_003486	P62805	H4_HUMAN	histone cluster 1, H4i	18					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			lung(1)	1						GGTGCCAAGCGCCACCGCAAG	0.607			T	BCL6	NHL								6	17	---	---	---	---	PASS
BAT4	7918	broad.mit.edu	37	6	31630476	31630476	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31630476G>T	uc003nvn.2	-	3	1283	c.638C>A	c.(637-639)CCC>CAC	p.P213H	C6orf47_uc003nvm.1_5'Flank|BAT4_uc003nvo.3_Missense_Mutation_p.P213H|BAT4_uc003nvp.3_Missense_Mutation_p.P213H|BAT4_uc003nvq.2_Missense_Mutation_p.P213H	NM_033177	NP_149417	O95872	GPAN1_HUMAN	HLA-B associated transcript 4	213						intracellular	nucleic acid binding				0						CTGGAGGGAGGGAGTAGGAGA	0.557													6	109	---	---	---	---	PASS
EHMT2	10919	broad.mit.edu	37	6	31864517	31864517	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31864517G>T	uc003nxz.1	-	3	204	c.194C>A	c.(193-195)TCA>TAA	p.S65*	EHMT2_uc003nxy.1_5'UTR|EHMT2_uc011don.1_Nonsense_Mutation_p.S122*|EHMT2_uc003nya.1_Nonsense_Mutation_p.S65*|EHMT2_uc003nyb.1_Nonsense_Mutation_p.S65*|C2_uc003nyc.2_5'Flank|C2_uc011doo.1_5'Flank	NM_006709	NP_006700	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	65					DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			ovary(1)	1						GGCTGGAGATGAGGGGCCAGC	0.577													5	69	---	---	---	---	PASS
SKIV2L	6499	broad.mit.edu	37	6	31937152	31937152	+	Silent	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31937152G>A	uc003nyn.1	+	27	3884	c.3495G>A	c.(3493-3495)CTG>CTA	p.L1165L	SKIV2L_uc011dou.1_Silent_p.L1007L|SKIV2L_uc011dov.1_Silent_p.L972L|STK19_uc003nyt.2_5'Flank|STK19_uc011dow.1_5'Flank|STK19_uc011dox.1_5'Flank|STK19_uc003nyv.2_5'Flank|STK19_uc003nyw.2_5'Flank|STK19_uc010jtn.1_5'Flank	NM_006929	NP_008860	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like homolog	1165						nucleus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						TGGGGGAGCTGAATTTTGGGC	0.582													7	31	---	---	---	---	PASS
ATF6B	1388	broad.mit.edu	37	6	32088564	32088564	+	Silent	SNP	G	T	T	rs140760727		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32088564G>T	uc003nzn.2	-	8	849	c.816C>A	c.(814-816)CTC>CTA	p.L272L	ATF6B_uc003nzm.1_5'Flank|ATF6B_uc003nzo.2_Silent_p.L269L|ATF6B_uc003nzp.1_5'Flank|ATF6B_uc011dpg.1_Silent_p.L206L|ATF6B_uc011dph.1_Silent_p.L272L	NM_004381	NP_004372	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta isoform	272	Cytoplasmic (Potential).				response to unfolded protein|signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GTGGCTGGACGAGGGACTGCA	0.408													6	152	---	---	---	---	PASS
RGL2	5863	broad.mit.edu	37	6	33262491	33262491	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33262491C>G	uc003odv.2	-	11	1460	c.1327G>C	c.(1327-1329)GAT>CAT	p.D443H	RGL2_uc003odu.2_Missense_Mutation_p.D3H|RGL2_uc010jur.2_Missense_Mutation_p.D3H|RGL2_uc003odw.2_Missense_Mutation_p.D361H|RGL2_uc011drb.1_Missense_Mutation_p.D361H	NM_004761	NP_004752	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation	443	Ras-GEF.				Ras protein signal transduction|regulation of small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity			skin(3)|lung(1)|breast(1)|pancreas(1)	6						GAGGCTGCATCCAGCATCACA	0.587													44	52	---	---	---	---	PASS
KIF6	221458	broad.mit.edu	37	6	39330271	39330271	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39330271G>A	uc003oot.2	-	17	1980	c.1885C>T	c.(1885-1887)CCT>TCT	p.P629S	KIF6_uc003oos.2_Missense_Mutation_p.P80S|KIF6_uc010jwz.1_Missense_Mutation_p.P4S|KIF6_uc010jxa.1_Missense_Mutation_p.P420S|KIF6_uc011dua.1_Missense_Mutation_p.P612S|KIF6_uc010jxb.1_Missense_Mutation_p.P573S	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	629	Potential.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						GGCATCAGAGGCACGGCCATG	0.517											OREG0017415	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	85	57	---	---	---	---	PASS
GPR116	221395	broad.mit.edu	37	6	46847578	46847578	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46847578T>C	uc003oyo.3	-	9	1302	c.1013A>G	c.(1012-1014)CAC>CGC	p.H338R	GPR116_uc003oyp.3_Intron|GPR116_uc003oyq.3_Missense_Mutation_p.H338R|GPR116_uc010jzi.1_Missense_Mutation_p.H10R|GPR116_uc003oyr.2_Missense_Mutation_p.H338R	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	338	Ig-like 1.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			AGTGATGTTGTGGATGGTGAG	0.423													15	38	---	---	---	---	PASS
TFAP2B	7021	broad.mit.edu	37	6	50791271	50791271	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50791271C>A	uc003pag.2	+	2	399	c.233C>A	c.(232-234)CCC>CAC	p.P78H		NM_003221	NP_003212	Q92481	AP2B_HUMAN	transcription factor AP-2 beta	78	Gln/Pro-rich (transactivation domain).				nervous system development|positive regulation of transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0	Lung NSC(77;0.156)					CAGCCGCTCCCCTACCACCAG	0.687													5	20	---	---	---	---	PASS
PAQR8	85315	broad.mit.edu	37	6	52268164	52268164	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52268164C>T	uc003pao.3	+	2	327	c.153C>T	c.(151-153)ATC>ATT	p.I51I		NM_133367	NP_588608	Q8TEZ7	MPRB_HUMAN	progestin and adipoQ receptor family member	51	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|oogenesis	integral to membrane|plasma membrane	receptor activity|steroid binding				0	Lung NSC(77;0.0875)					AGCCTTACATCCGCACCGGCT	0.602													6	12	---	---	---	---	PASS
C6orf167	253714	broad.mit.edu	37	6	97676876	97676876	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97676876G>A	uc003ppb.2	-	14	2199	c.1933C>T	c.(1933-1935)CAT>TAT	p.H645Y	C6orf167_uc011eaf.1_Missense_Mutation_p.H605Y	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714	645					double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		AGTTTTTCATGGGAAGGATAC	0.423													21	73	---	---	---	---	PASS
MCHR2	84539	broad.mit.edu	37	6	100390823	100390823	+	Splice_Site	SNP	A	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100390823A>C	uc003pqh.1	-	4	902	c.587_splice	c.e4+1	p.W196_splice	MCHR2_uc003pqi.1_Splice_Site_p.W196_splice	NM_001040179	NP_001035269	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2							integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		TTCACAACTTACCAGAGTACA	0.413													21	31	---	---	---	---	PASS
SIM1	6492	broad.mit.edu	37	6	100838803	100838803	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100838803C>A	uc003pqj.3	-	11	1942	c.1735G>T	c.(1735-1737)GAG>TAG	p.E579*	SIM1_uc010kcu.2_Nonsense_Mutation_p.E579*	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	579	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	p.E579D(1)		ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		AATCTGTTCTCTTCTTCTTTA	0.443													5	77	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112506499	112506499	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112506499G>C	uc003pvu.2	-	9	1326	c.1017C>G	c.(1015-1017)ATC>ATG	p.I339M	LAMA4_uc003pvv.2_Missense_Mutation_p.I332M|LAMA4_uc003pvt.2_Missense_Mutation_p.I332M	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	339	Potential.|Domain II and I.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CAGCATTGTTGATTTGTATCT	0.383													30	174	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117707019	117707019	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117707019C>T	uc003pxp.1	-	15	2330	c.2131G>A	c.(2131-2133)GAT>AAT	p.D711N	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	711	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TTATACCAATCCATGTCTCAA	0.378			T	GOPC|ROS1	glioblastoma|NSCLC								11	49	---	---	---	---	PASS
GPR126	57211	broad.mit.edu	37	6	142764490	142764490	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142764490C>T	uc010khc.2	+	26	4048	c.3637C>T	c.(3637-3639)CAA>TAA	p.Q1213*	GPR126_uc010khd.2_Nonsense_Mutation_p.Q1185*|GPR126_uc010khe.2_Silent_p.D1197D|GPR126_uc010khf.2_Silent_p.D1169D|GPR126_uc011edv.1_Silent_p.D257D	NM_020455	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126 alpha 1	1213	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		CTTCCATGGACAAGTCCTTGT	0.438													29	250	---	---	---	---	PASS
HIVEP2	3097	broad.mit.edu	37	6	143090845	143090845	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143090845G>T	uc003qjd.2	-	5	5774	c.5031C>A	c.(5029-5031)TCC>TCA	p.S1677S		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	1677					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TTGGATTACAGGAACTAATGC	0.433													7	126	---	---	---	---	PASS
ARID1B	57492	broad.mit.edu	37	6	157528347	157528347	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157528347G>T	uc003qqn.2	+	20	6170	c.6018G>T	c.(6016-6018)ACG>ACT	p.T2006T	ARID1B_uc003qqo.2_Silent_p.T1966T|ARID1B_uc003qqp.2_Silent_p.T1953T	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	2011					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GGGATAACACGTTGGTCACGT	0.542													17	74	---	---	---	---	PASS
C6orf35	729515	broad.mit.edu	37	6	157743751	157743751	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157743751C>G	uc003sih.3	-	2	438	c.175G>C	c.(175-177)GAA>CAA	p.E59Q		NM_018452	NP_060922	Q9NWH2	CF035_HUMAN	hypothetical protein LOC729515	59						integral to membrane					0						TTGAACCATTCAGGGCTTTTC	0.373													51	89	---	---	---	---	PASS
MAS1	4142	broad.mit.edu	37	6	160328351	160328351	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160328351C>T	uc003qsz.2	+	1	378	c.364C>T	c.(364-366)CTG>TTG	p.L122L		NM_002377	NP_002368	P04201	MAS_HUMAN	MAS1 oncogene	122	Helical; Name=3; (Potential).				anatomical structure morphogenesis|cell proliferation|protein kinase C signaling cascade	integral to plasma membrane	angiotensin type II receptor activity			ovary(2)|lung(2)	4		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.6e-06)		GGGCCTCTATCTGCTGACGGC	0.488													27	118	---	---	---	---	PASS
UNC93A	54346	broad.mit.edu	37	6	167721257	167721257	+	Intron	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167721257G>C	uc003qvq.2	+						UNC93A_uc003qvr.2_Intron	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1							integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TTTCCCCTCTGCACCCCCAGG	0.612													10	40	---	---	---	---	PASS
SMOC2	64094	broad.mit.edu	37	6	169053880	169053880	+	Missense_Mutation	SNP	C	G	G	rs151010390		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169053880C>G	uc003qws.1	+	11	1277	c.1257C>G	c.(1255-1257)GAC>GAG	p.D419E	SMOC2_uc003qwr.1_Missense_Mutation_p.D430E|SMOC2_uc011egu.1_Missense_Mutation_p.D96E	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	419	EF-hand 2.				signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CGAAAGAGGACGGCAAAGCGG	0.527													9	54	---	---	---	---	PASS
DGKB	1607	broad.mit.edu	37	7	14789810	14789810	+	Intron	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14789810G>A	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron|DGKB_uc011jxv.1_Intron	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	AATATTTCTAGCTTCAATGCA	0.169													8	25	---	---	---	---	PASS
ANKMY2	57037	broad.mit.edu	37	7	16644386	16644386	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16644386C>A	uc003sti.2	-	8	1171	c.971G>T	c.(970-972)GGA>GTA	p.G324V	ANKMY2_uc010ktz.2_RNA	NM_020319	NP_064715	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	324	MYND-type.					cilium	zinc ion binding			central_nervous_system(1)	1	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TCCCTTTTCTCCACAGGTAGT	0.453													30	58	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21721271	21721271	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21721271G>T	uc003svc.2	+	31	5482	c.5451G>T	c.(5449-5451)GTG>GTT	p.V1817V		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1817	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CCAGAGACGTGGTGGCAAAAC	0.393									Kartagener_syndrome				5	101	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21805045	21805045	+	Splice_Site	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21805045G>T	uc003svc.2	+	56	8993	c.8962_splice	c.e56-1	p.I2988_splice		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TGTCTCCACAGATCATTTTGT	0.483									Kartagener_syndrome				31	94	---	---	---	---	PASS
ADCY1	107	broad.mit.edu	37	7	45649987	45649987	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45649987C>A	uc003tne.3	+	3	817	c.799C>A	c.(799-801)CTC>ATC	p.L267I	ADCY1_uc003tnd.2_Missense_Mutation_p.L42I	NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	267	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GGAGCGGCTCCTCATGAGCCT	0.622													6	84	---	---	---	---	PASS
SBDS	51119	broad.mit.edu	37	7	66453478	66453478	+	Silent	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66453478C>G	uc003tvm.1	-	5	817	c.633G>C	c.(631-633)CTG>CTC	p.L211L		NM_016038	NP_057122	Q9Y3A5	SBDS_HUMAN	Shwachman-Bodian-Diamond syndrome protein	211					bone marrow development|bone mineralization|leukocyte chemotaxis|mature ribosome assembly|mitotic spindle stabilization|positive regulation of translation|ribosomal large subunit biogenesis|rRNA processing	cytoplasm|nucleolus|nucleoplasm|spindle pole	microtubule binding|ribosome binding|rRNA binding			ovary(1)	1						CCGGGTCAATCAGACATACCT	0.398			Gene Conversion			AML|MDS			Shwachman-Diamond_syndrome				8	40	---	---	---	---	PASS
STYXL1	51657	broad.mit.edu	37	7	75634626	75634626	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75634626C>T	uc003uej.3	-	6	723	c.550G>A	c.(550-552)GAC>AAC	p.D184N	STYXL1_uc003uef.2_5'UTR|STYXL1_uc011kgf.1_Missense_Mutation_p.D46N|STYXL1_uc011kgg.1_Missense_Mutation_p.D36N|STYXL1_uc003ueh.2_Missense_Mutation_p.D46N|STYXL1_uc003uek.3_Missense_Mutation_p.D88N|STYXL1_uc003uel.2_Missense_Mutation_p.D184N|STYXL1_uc003uem.2_Missense_Mutation_p.D184N|STYXL1_uc010ldg.1_RNA|STYXL1_uc010ldh.1_Missense_Mutation_p.D184N|STYXL1_uc003uen.1_Missense_Mutation_p.D184N	NM_016086	NP_057170	Q9Y6J8	STYL1_HUMAN	map kinase phosphatase-like protein MK-STYX	184	Tyrosine-protein phosphatase.				intracellular signal transduction|protein dephosphorylation	intracellular	protein binding|protein tyrosine/serine/threonine phosphatase activity				0						ATTTTCAAGTCCTTCTGAATC	0.393													11	38	---	---	---	---	PASS
SEMA3E	9723	broad.mit.edu	37	7	82997159	82997159	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82997159G>A	uc003uhy.1	-	17	2537	c.2071C>T	c.(2071-2073)CAT>TAT	p.H691Y		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	691					axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				ATCCTGTGATGCCTGTCCTCC	0.483													10	58	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86468972	86468972	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86468972C>T	uc003uid.2	+	4	3241	c.2142C>T	c.(2140-2142)ACC>ACT	p.T714T	GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Silent_p.T586T|GRM3_uc010leh.2_Silent_p.T306T	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	714	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	CCCCAGGCACCAGGAGGTATA	0.498													11	47	---	---	---	---	PASS
RUNDC3B	154661	broad.mit.edu	37	7	87459208	87459208	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87459208G>A	uc003ujb.2	+	12	1696	c.1285G>A	c.(1285-1287)GAT>AAT	p.D429N	RUNDC3B_uc011khe.1_Missense_Mutation_p.D412N|RUNDC3B_uc003ujc.2_Missense_Mutation_p.D363N|RUNDC3B_uc003ujd.2_Missense_Mutation_p.D285N	NM_138290	NP_612147	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B isoform a	429										skin(1)	1	Esophageal squamous(14;0.00164)					AGGTAAGGAAGATACTCCCTC	0.323													5	99	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91709170	91709170	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91709170C>T	uc003ulg.2	+	31	7948	c.7723C>T	c.(7723-7725)CAA>TAA	p.Q2575*	AKAP9_uc003ulf.2_Nonsense_Mutation_p.Q2567*|AKAP9_uc003uli.2_Nonsense_Mutation_p.Q2198*|AKAP9_uc003ulj.2_Nonsense_Mutation_p.Q345*	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	2587	Glu-rich.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCAAGATAATCAAACAATTTC	0.343			T	BRAF	papillary thyroid								13	79	---	---	---	---	PASS
PON2	5445	broad.mit.edu	37	7	95034736	95034736	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95034736C>A	uc003unv.2	-	9	1092	c.971G>T	c.(970-972)GGG>GTG	p.G324V	PON2_uc003unu.2_Missense_Mutation_p.G312V|PON2_uc010lfk.2_RNA|PON2_uc003unw.2_Missense_Mutation_p.G237V	NM_000305	NP_000296	Q15165	PON2_HUMAN	paraoxonase 2 isoform 1	324					aromatic compound catabolic process	extracellular region|plasma membrane	arylesterase activity|identical protein binding|metal ion binding				0	all_cancers(62;9.35e-11)|all_epithelial(64;3.37e-09)		STAD - Stomach adenocarcinoma(171;0.0151)			GAGAACAGACCCATTGTTGGC	0.423													6	110	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100676099	100676099	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100676099G>C	uc003uxp.1	+	3	1455	c.1402G>C	c.(1402-1404)GAG>CAG	p.E468Q	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	468	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|5.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GGCCAGTTCTGAGGCTAGCAA	0.478													15	243	---	---	---	---	PASS
GPR85	54329	broad.mit.edu	37	7	112724255	112724255	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112724255G>C	uc010ljv.2	-	2	1039	c.522C>G	c.(520-522)TTC>TTG	p.F174L	GPR85_uc003vgp.1_Missense_Mutation_p.F174L|GPR85_uc003vgq.2_Missense_Mutation_p.F174L|GPR85_uc010ljw.1_Missense_Mutation_p.F174L	NM_001146266	NP_001139738	P60893	GPR85_HUMAN	G protein-coupled receptor 85	174	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|central_nervous_system(1)	2						AGCGGTGTTGGAAGGTGCATT	0.478													18	44	---	---	---	---	PASS
ZC3HAV1	56829	broad.mit.edu	37	7	138764611	138764611	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138764611C>A	uc003vun.2	-	4	1464	c.1076G>T	c.(1075-1077)TGG>TTG	p.W359L	ZC3HAV1_uc003vuo.2_5'Flank|ZC3HAV1_uc003vup.2_Missense_Mutation_p.W359L	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1	359					response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1						GAGGCTCTTCCAGTTGGGGGC	0.532													5	78	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149481129	149481129	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149481129G>A	uc010lpk.2	+	18	2611	c.2611G>A	c.(2611-2613)GAG>AAG	p.E871K	SSPO_uc010lpl.1_Missense_Mutation_p.E206K	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	871	TIL 2.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GTGGGACCCTGAGGGCCAGTG	0.652													4	4	---	---	---	---	PASS
SLC7A2	6542	broad.mit.edu	37	8	17409474	17409474	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17409474C>G	uc011kyc.1	+	6	1203	c.1034C>G	c.(1033-1035)TCT>TGT	p.S345C	SLC7A2_uc011kyd.1_Missense_Mutation_p.S385C|SLC7A2_uc011kye.1_Missense_Mutation_p.S385C|SLC7A2_uc011kyf.1_Missense_Mutation_p.S345C	NM_001008539	NP_001008539	P52569	CTR2_HUMAN	solute carrier family 7, member 2 isoform 2	345	Helical; (Potential).				cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity			ovary(2)|skin(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	GCAGCTGGTTCTCTCTGCGCC	0.488													12	19	---	---	---	---	PASS
GTF2E2	2961	broad.mit.edu	37	8	30470002	30470002	+	Intron	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30470002T>C	uc003xig.2	-							NM_002095	NP_002086	P29084	T2EB_HUMAN	general transcription factor IIE, polypeptide 2,						regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	transcription factor TFIIE complex	DNA binding|protein binding				0				KIRC - Kidney renal clear cell carcinoma(542;0.113)|Kidney(114;0.135)		CTAAAGCCTGTAACAGTGATA	0.259													7	9	---	---	---	---	PASS
FNTA	2339	broad.mit.edu	37	8	42932394	42932394	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42932394G>T	uc003xps.2	+	6	717	c.669G>T	c.(667-669)GTG>GTT	p.V223V	FNTA_uc003xpt.2_Silent_p.V132V|FNTA_uc003xpu.2_Silent_p.V156V|FNTA_uc003xpv.2_RNA	NM_002027	NP_002018	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha isoform a	223	PFTA 4.				cellular component disassembly involved in apoptosis|positive regulation of deacetylase activity|positive regulation of tubulin deacetylation|protein farnesylation|protein geranylgeranylation|transforming growth factor beta receptor signaling pathway	cytosol|microtubule associated complex	alpha-tubulin binding|CAAX-protein geranylgeranyltransferase activity|microtubule binding|protein farnesyltransferase activity			ovary(1)	1	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			TGCAGTATGTGGACCAACTTC	0.328													4	51	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55542765	55542765	+	Missense_Mutation	SNP	T	A	A	rs145297510		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55542765T>A	uc003xsd.1	+	4	6471	c.6323T>A	c.(6322-6324)ATT>AAT	p.I2108N	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	2108					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CTCTTAGATATTTGCCAAGTT	0.348													10	32	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61736458	61736458	+	Silent	SNP	T	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61736458T>A	uc003xue.2	+	13	3738	c.3261T>A	c.(3259-3261)ATT>ATA	p.I1087I	CHD7_uc003xuf.2_Silent_p.I200I	NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1087	Helicase ATP-binding.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TTGAGATGATTTTGACTGATT	0.423													25	50	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77766782	77766782	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77766782C>G	uc003yav.2	+	10	7877	c.7490C>G	c.(7489-7491)CCC>CGC	p.P2497R	ZFHX4_uc003yau.1_Missense_Mutation_p.P2542R|ZFHX4_uc003yaw.1_Missense_Mutation_p.P2497R	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2497						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATATTTGACCCCAACAATCCG	0.542										HNSCC(33;0.089)			21	111	---	---	---	---	PASS
IMPA1	3612	broad.mit.edu	37	8	82571595	82571595	+	Silent	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82571595G>A	uc003ych.2	-	9	952	c.825C>T	c.(823-825)GAC>GAT	p.D275D	IMPA1_uc011lfq.1_Silent_p.D334D|IMPA1_uc011lfr.1_3'UTR	NM_005536	NP_005527	P29218	IMPA1_HUMAN	inositol(myo)-1(or 4)-monophosphatase 1 isoform	275					inositol phosphate dephosphorylation|phosphatidylinositol biosynthetic process|signal transduction	cytoplasm	inositol-1(or 4)-monophosphatase activity|metal ion binding|protein homodimerization activity			skin(1)	1					Lithium(DB01356)	ATTAATCTTCGTCGTCTCGTT	0.373													6	48	---	---	---	---	PASS
LRRCC1	85444	broad.mit.edu	37	8	86044014	86044014	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86044014G>T	uc003ycw.2	+	12	1940	c.1786G>T	c.(1786-1788)GAG>TAG	p.E596*	LRRCC1_uc010lzz.1_RNA|LRRCC1_uc010maa.1_Nonsense_Mutation_p.E297*|LRRCC1_uc003ycx.2_Nonsense_Mutation_p.E503*|LRRCC1_uc003ycy.2_Nonsense_Mutation_p.E576*	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a	596	Potential.				cell division|mitosis	centriole|nucleus					0						TGAAACAAGGGAGTTTTTTAC	0.333													5	32	---	---	---	---	PASS
TMEM67	91147	broad.mit.edu	37	8	94792820	94792820	+	Splice_Site	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94792820G>T	uc011lgk.1	+	8	786	c.715_splice	c.e8-1	p.V239_splice	TMEM67_uc010mat.1_Splice_Site_p.V154_splice|TMEM67_uc010maw.2_Intron|TMEM67_uc003yga.3_Splice_Site_p.V158_splice	NM_153704	NP_714915	Q5HYA8	MKS3_HUMAN	meckelin isoform 1						cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding			ovary(2)	2	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			TTCTGTTGTAGGTATATGCCA	0.323													6	149	---	---	---	---	PASS
SLC30A8	169026	broad.mit.edu	37	8	118184913	118184913	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118184913G>A	uc003yoh.2	+	8	1333	c.1103G>A	c.(1102-1104)TGT>TAT	p.C368Y	SLC30A8_uc010mcz.2_Missense_Mutation_p.C319Y|SLC30A8_uc011lia.1_Missense_Mutation_p.C319Y|SLC30A8_uc003yog.2_Missense_Mutation_p.C319Y	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8	368	Cytoplasmic (Potential).				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			GAAGACCCCTGTGACTAGCTC	0.473													41	96	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143624969	143624969	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143624969T>A	uc003ywm.2	+	29	4640	c.4457T>A	c.(4456-4458)ATG>AAG	p.M1486K		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1486	Cytoplasmic (Potential).|Necessary for interaction with MAGI1.				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CAGAAGATCATGCACACCCGG	0.677													3	8	---	---	---	---	PASS
RPS6	6194	broad.mit.edu	37	9	19376297	19376297	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19376297C>A	uc003znv.1	-	6	786	c.744G>T	c.(742-744)CAG>CAT	p.Q248H	RPS6_uc003znu.1_Missense_Mutation_p.Q217H	NM_001010	NP_001001	P62753	RS6_HUMAN	ribosomal protein S6	248					endocrine pancreas development|glucose homeostasis|insulin receptor signaling pathway|positive regulation of apoptosis|rRNA processing|TOR signaling cascade|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding			ovary(1)	1		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)		AATCTTATTTCTGACTGGATT	0.383													19	53	---	---	---	---	PASS
TOPORS	10210	broad.mit.edu	37	9	32542506	32542506	+	Missense_Mutation	SNP	G	T	T	rs140126403		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32542506G>T	uc003zrb.2	-	3	2184	c.2017C>A	c.(2017-2019)CGT>AGT	p.R673S	TOPORS_uc003zrc.2_Missense_Mutation_p.R606S	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich	673	Interaction with TOP1.|Arg-rich.|Interaction with p53/TP53.				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TCACTGCTACGAGACCTTGAT	0.378													6	249	---	---	---	---	PASS
CHMP5	51510	broad.mit.edu	37	9	33278108	33278108	+	Intron	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33278108C>G	uc003zsl.3	+						SUGT1P1_uc010mjq.1_Intron|CHMP5_uc003zsm.3_Intron|CHMP5_uc011lnv.1_Intron	NM_016410	NP_057494	Q9NZZ3	CHMP5_HUMAN	chromatin modifying protein 5						cellular membrane organization|protein transport	cytosol|endosome membrane	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			GTTTCAATCTCAGAGTTGGAT	0.408													10	24	---	---	---	---	PASS
NFX1	4799	broad.mit.edu	37	9	33318767	33318767	+	Nonsense_Mutation	SNP	G	T	T	rs142065044		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33318767G>T	uc003zsq.2	+	8	1688	c.1627G>T	c.(1627-1629)GGA>TGA	p.G543*	SUGT1P1_uc010mjq.1_Intron|NFX1_uc011lnw.1_Nonsense_Mutation_p.G543*|NFX1_uc003zso.2_Nonsense_Mutation_p.G543*|NFX1_uc003zsp.1_Nonsense_Mutation_p.G543*|NFX1_uc010mjr.1_Nonsense_Mutation_p.G543*|NFX1_uc003zsr.2_Nonsense_Mutation_p.G543*	NM_002504	NP_002495	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	543					inflammatory response|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|ligase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		TGTGTTATGTGGAACCGATGT	0.383													6	185	---	---	---	---	PASS
PRSS3	5646	broad.mit.edu	37	9	33797929	33797929	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33797929G>T	uc003ztj.3	+	3	474	c.474G>T	c.(472-474)AGG>AGT	p.R158S	uc003ztk.1_Intron|PRSS3_uc003zti.3_Missense_Mutation_p.R115S|PRSS3_uc003ztl.3_Missense_Mutation_p.R101S	NM_007343	NP_031369	P35030	TRY3_HUMAN	mesotrypsin isoform 1 preproprotein	158	Peptidase S1.				digestion|endothelial cell migration|zymogen activation	extracellular space	calcium ion binding|protein binding|serine-type endopeptidase activity|serine-type peptidase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)			AATACAACAGGGACACTCTGG	0.547													6	157	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90501472	90501472	+	Silent	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90501472T>C	uc004app.3	+	4	2105	c.2070T>C	c.(2068-2070)GAT>GAC	p.D690D	C9orf79_uc004apo.1_Silent_p.D502D	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	690						integral to membrane				ovary(3)	3						GCAGGAAGGATGTGCAGAAGA	0.607													12	50	---	---	---	---	PASS
ABO	28	broad.mit.edu	37	9	136131307	136131307	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136131307C>A	uc004cda.1	-	8	836	c.811G>T	c.(811-813)GGG>TGG	p.G271W	ABO_uc010naf.1_Missense_Mutation_p.G130W|ABO_uc011mcz.1_Missense_Mutation_p.G130W|ABO_uc010nag.1_Missense_Mutation_p.G130W	NM_020469	NP_065202	P16442	BGAT_HUMAN	ABO blood group (alpha	271	Lumenal (Potential).				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	fucosylgalactoside 3-alpha-galactosyltransferase activity|glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity|metal ion binding				0				OV - Ovarian serous cystadenocarcinoma(145;5.82e-06)|Epithelial(140;3.45e-05)		ACCGACCCCCCGAAGAACCCC	0.677													4	16	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139916916	139916916	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139916916G>C	uc011mem.1	-	5	599	c.451C>G	c.(451-453)CTG>GTG	p.L151V	ABCA2_uc011mel.1_Missense_Mutation_p.L152V|ABCA2_uc004ckl.1_Missense_Mutation_p.L82V|ABCA2_uc004ckm.1_Missense_Mutation_p.L182V|ABCA2_uc004cko.1_5'UTR|ABCA2_uc010nca.2_Missense_Mutation_p.L82V	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	151					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACCGAGTCCAGAGAGAAGGAA	0.637													5	6	---	---	---	---	PASS
FXYD4	53828	broad.mit.edu	37	10	43869962	43869962	+	Intron	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43869962C>A	uc001jaq.1	+							NM_173160	NP_775183	P59646	FXYD4_HUMAN	FXYD domain containing ion transport regulator 4							integral to membrane					0						TGAGTGAGGCCCCCAAACAGC	0.537													14	63	---	---	---	---	PASS
IPMK	253430	broad.mit.edu	37	10	59956140	59956140	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59956140C>G	uc001jkb.2	-	6	1271	c.948G>C	c.(946-948)AAG>AAC	p.K316N		NM_152230	NP_689416	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase	316						nucleus	ATP binding|inositol trisphosphate 6-kinase activity			ovary(1)	1						GCGCATACATCTTGGACAAGC	0.378													24	50	---	---	---	---	PASS
CCAR1	55749	broad.mit.edu	37	10	70513624	70513624	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70513624G>C	uc001joo.2	+	11	1253	c.1134G>C	c.(1132-1134)ATG>ATC	p.M378I	CCAR1_uc001jol.1_RNA|CCAR1_uc001jom.1_Missense_Mutation_p.M183I|CCAR1_uc009xpx.1_Missense_Mutation_p.M352I|CCAR1_uc001jon.1_Missense_Mutation_p.M324I|CCAR1_uc010qiz.1_Missense_Mutation_p.M363I|CCAR1_uc010qja.1_Missense_Mutation_p.M363I|CCAR1_uc010qjb.1_RNA|SNORD98_uc001jop.1_5'Flank	NM_018237	NP_060707	Q8IX12	CCAR1_HUMAN	cell-cycle and apoptosis regulatory protein 1	378					apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7						GTTGTGACATGATGGAACTAA	0.343													23	57	---	---	---	---	PASS
KIAA1279	26128	broad.mit.edu	37	10	70775423	70775423	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70775423G>A	uc001joy.2	+	7	1213	c.1117G>A	c.(1117-1119)GCC>ACC	p.A373T		NM_015634	NP_056449	Q96EK5	KBP_HUMAN	KIF1 binding protein	373					cell differentiation|mitochondrial transport|nervous system development	mitochondrion	kinesin binding			ovary(1)	1						ACTGTGTGATGCCATCTCTGC	0.413													20	72	---	---	---	---	PASS
MMRN2	79812	broad.mit.edu	37	10	88703344	88703344	+	Silent	SNP	C	T	T	rs140752811		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88703344C>T	uc001kea.2	-	6	1324	c.1197G>A	c.(1195-1197)GAG>GAA	p.E399E	MMRN2_uc010qmn.1_Silent_p.E42E|MMRN2_uc009xtb.2_Silent_p.E356E	NM_024756	NP_079032	Q9H8L6	MMRN2_HUMAN	multimerin 2 precursor	399	Potential.					extracellular space				large_intestine(1)	1						CCCTCATGTCCTCCAGGGTGT	0.617													16	49	---	---	---	---	PASS
PIK3AP1	118788	broad.mit.edu	37	10	98392786	98392786	+	Intron	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98392786C>A	uc001kmq.2	-						PIK3AP1_uc001kmo.2_Nonsense_Mutation_p.G11*|PIK3AP1_uc001kmp.2_Intron	NM_152309	NP_689522	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1							cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		agacaagatccatagcaggcc	0.000													4	28	---	---	---	---	PASS
PIK3AP1	118788	broad.mit.edu	37	10	98469674	98469674	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98469674A>T	uc001kmq.2	-	2	208	c.80T>A	c.(79-81)CTG>CAG	p.L27Q		NM_152309	NP_689522	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	27						cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		CAGGGTCTGCAGGTACTGGCA	0.597													5	21	---	---	---	---	PASS
RRP12	23223	broad.mit.edu	37	10	99126316	99126316	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99126316C>A	uc001knf.2	-	28	3417	c.3278G>T	c.(3277-3279)CGA>CTA	p.R1093L	RRP12_uc001kne.2_Missense_Mutation_p.R108L|RRP12_uc009xvl.2_Missense_Mutation_p.R210L|RRP12_uc009xvm.2_Missense_Mutation_p.R811L|RRP12_uc010qou.1_Missense_Mutation_p.R1032L|RRP12_uc009xvn.2_Missense_Mutation_p.R993L	NM_015179	NP_055994	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog isoform 1	1093						integral to membrane|nuclear membrane|nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		CTCCTTGCCTCGGCTTCTTTC	0.592													4	68	---	---	---	---	PASS
GBF1	8729	broad.mit.edu	37	10	104129063	104129063	+	Silent	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104129063C>A	uc001kux.1	+	24	3306	c.3066C>A	c.(3064-3066)ATC>ATA	p.I1022I	GBF1_uc001kuy.1_Silent_p.I1022I|GBF1_uc001kuz.1_Silent_p.I1023I	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	1022					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		ATGGTGACATCCTGCGGGAGG	0.502													9	75	---	---	---	---	PASS
C10orf88	80007	broad.mit.edu	37	10	124712423	124712423	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124712423C>G	uc001lgw.2	-	2	515	c.290G>C	c.(289-291)AGA>ACA	p.R97T	C10orf88_uc001lgx.2_5'UTR	NM_024942	NP_079218	Q9H8K7	CJ088_HUMAN	hypothetical protein LOC80007	97											0		all_neural(114;0.0765)|Lung NSC(174;0.163)|all_lung(145;0.205)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0735)		TTCCATATTTCTTGCTGAACT	0.453													6	79	---	---	---	---	PASS
BUB3	9184	broad.mit.edu	37	10	124915190	124915190	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124915190G>T	uc001lhe.2	+	3	454	c.212G>T	c.(211-213)TGG>TTG	p.W71L	BUB3_uc009yah.2_Missense_Mutation_p.W23L|BUB3_uc001lhf.3_Missense_Mutation_p.W71L|BUB3_uc001lhd.2_Missense_Mutation_p.W71L|BUB3_uc010qud.1_5'UTR	NM_004725	NP_004716	O43684	BUB3_HUMAN	budding uninhibited by benzimidazoles 3 isoform	71	WD 2.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|attachment of spindle microtubules to kinetochore|cell division|meiosis|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle	condensed chromosome kinetochore|cytosol|nucleus	protein binding			ovary(1)	1		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)				ACGCATGCCTGGAGTGGAGGA	0.353													4	41	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129903515	129903515	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129903515A>C	uc001lke.2	-	13	6784	c.6589T>G	c.(6589-6591)TTG>GTG	p.L2197V	MKI67_uc001lkf.2_Missense_Mutation_p.L1837V|MKI67_uc009yav.1_Missense_Mutation_p.L1772V|MKI67_uc009yaw.1_Missense_Mutation_p.L1347V	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	2197	16 X 122 AA approximate repeats.|10.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				AGCTCTTTCAAGCCAGCCAAG	0.502													24	108	---	---	---	---	PASS
PHRF1	57661	broad.mit.edu	37	11	611692	611692	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:611692C>G	uc001lqe.2	+	18	4996	c.4865C>G	c.(4864-4866)GCG>GGG	p.A1622G	PHRF1_uc010qwc.1_Missense_Mutation_p.A1621G|PHRF1_uc010qwd.1_Missense_Mutation_p.A1620G|PHRF1_uc010qwe.1_Missense_Mutation_p.A1618G|PHRF1_uc009yca.1_RNA	NM_020901	NP_065952	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1622							RNA polymerase binding|zinc ion binding				0						CTGGTGAAGGCGTACGTGGAC	0.602													15	26	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1266003	1266003	+	Silent	SNP	A	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1266003A>T	uc009ycr.1	+	48	9933	c.9807A>T	c.(9805-9807)CCA>CCT	p.P3269P	MUC5B_uc001ltb.2_Silent_p.P2634P	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	2631	7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCACGCTTCCAGTGTGGATCA	0.637													11	56	---	---	---	---	PASS
TOLLIP	54472	broad.mit.edu	37	11	1311618	1311618	+	Missense_Mutation	SNP	C	T	T	rs143130045		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1311618C>T	uc001lte.2	-	3	316	c.205G>A	c.(205-207)GGC>AGC	p.G69S	TOLLIP_uc001ltd.2_5'UTR|TOLLIP_uc009ycu.2_Intron|TOLLIP_uc001ltf.2_Missense_Mutation_p.G19S	NM_019009	NP_061882	Q9H0E2	TOLIP_HUMAN	toll interacting protein	69	C2.				cell-cell signaling|inflammatory response|innate immune response|intracellular signal transduction|leukocyte activation|phosphorylation	cytosol|interleukin-1 receptor complex|interleukin-18 receptor complex	kinase binding|signal transducer activity|Toll-like receptor binding				0		all_cancers(49;7.62e-05)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00152)|Lung(200;0.09)|LUSC - Lung squamous cell carcinoma(625;0.107)		CGGGTCATGCCGTAATTCTTG	0.592													7	17	---	---	---	---	PASS
LOC338651	338651	broad.mit.edu	37	11	1619128	1619128	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1619128C>G	uc009ycx.1	+	2	979	c.228C>G	c.(226-228)AAC>AAG	p.N76K	LOC338651_uc001ltt.1_RNA|KRTAP5-2_uc001ltv.2_Missense_Mutation_p.C118S	NR_021489				SubName: Full=cDNA FLJ30579 fis, clone BRAWH2006989, weakly similar to DNA-DIRECTED RNA POLYMERASE II LARGEST SUBUNIT;          EC=2.7.7.6;												0						GGGCTTACAACAGCTGGACTG	0.652													17	82	---	---	---	---	PASS
NUP98	4928	broad.mit.edu	37	11	3727819	3727819	+	Silent	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3727819C>A	uc001lyh.2	-	21	3072	c.2781G>T	c.(2779-2781)GTG>GTT	p.V927V	NUP98_uc001lyi.2_Silent_p.V927V|NUP98_uc001lyg.2_5'UTR	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	944					carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		TGTCCAGTTCCACAACCCTCC	0.468			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								6	125	---	---	---	---	PASS
OR51G2	81282	broad.mit.edu	37	11	4936660	4936660	+	Silent	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4936660G>A	uc001lzr.1	-	1	234	c.234C>T	c.(232-234)CTC>CTT	p.L78L		NM_001005238	NP_001005238	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G,	78	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGCAAAGGGAGAGACCCAGGT	0.473													5	48	---	---	---	---	PASS
HBE1	3046	broad.mit.edu	37	11	5289729	5289729	+	Silent	SNP	G	C	C	rs145809569	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5289729G>C	uc001mal.1	-	3	667	c.414C>G	c.(412-414)GTC>GTG	p.V138V	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Silent_p.V138V	NM_005330	NP_005321	P02100	HBE_HUMAN	epsilon globin	138					blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGCAATGGCGACAGCAGACA	0.557													4	143	---	---	---	---	PASS
OR51B2	79345	broad.mit.edu	37	11	5344990	5344990	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5344990G>T	uc001mao.1	-	1	593	c.538C>A	c.(538-540)CAA>AAA	p.Q180K	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033180	NP_149420	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B,	180	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATGATTTCTTGGTGGAGGCAG	0.378													4	53	---	---	---	---	PASS
OR51Q1	390061	broad.mit.edu	37	11	5444070	5444070	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5444070C>G	uc010qzd.1	+	1	640	c.640C>G	c.(640-642)CTG>GTG	p.L214V	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004757	NP_001004757	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q,	214	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CGTGGATCCTCTGCTCATTGT	0.498													17	61	---	---	---	---	PASS
OR52E4	390081	broad.mit.edu	37	11	5905886	5905886	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5905886T>A	uc010qzs.1	+	1	364	c.364T>A	c.(364-366)TAT>AAT	p.Y122N	TRIM5_uc001mbq.1_Intron	NM_001005165	NP_001005165	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E,	122	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGTCATGGCTTATGACCGCTT	0.448													7	67	---	---	---	---	PASS
OR52E4	390081	broad.mit.edu	37	11	5906038	5906038	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5906038G>T	uc010qzs.1	+	1	516	c.516G>T	c.(514-516)GGG>GGT	p.G172G	TRIM5_uc001mbq.1_Intron	NM_001005165	NP_001005165	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CATTCTGTGGGCATAACATCG	0.453													13	61	---	---	---	---	PASS
CNGA4	1262	broad.mit.edu	37	11	6262865	6262865	+	Nonsense_Mutation	SNP	T	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6262865T>A	uc001mco.2	+	5	1229	c.1122T>A	c.(1120-1122)TAT>TAA	p.Y374*	CNGA4_uc010raa.1_Nonsense_Mutation_p.Y143*|CNGA4_uc001mcn.2_Nonsense_Mutation_p.Y334*	NM_001037329	NP_001032406	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	374	cNMP.|Cytoplasmic (Potential).				response to stimulus|sensory perception of smell		cAMP binding			skin(1)	1		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGGTGAATATGTATGCCGCA	0.557													60	128	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6643179	6643179	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6643179C>T	uc001mem.1	-	21	10138	c.9728G>A	c.(9727-9729)GGC>GAC	p.G3243D	TPP1_uc001mek.1_5'Flank|TPP1_uc001mel.1_5'Flank|TPP1_uc010rar.1_5'Flank	NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	3243	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGACAGGGAGCCTTCATGGCT	0.637													7	13	---	---	---	---	PASS
EIF4G2	1982	broad.mit.edu	37	11	10822354	10822354	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10822354G>T	uc001mjc.2	-	16	1985	c.1568C>A	c.(1567-1569)CCA>CAA	p.P523Q	EIF4G2_uc001mjb.2_Missense_Mutation_p.P317Q|EIF4G2_uc009ygf.2_Missense_Mutation_p.P317Q|EIF4G2_uc001mjd.2_Missense_Mutation_p.P485Q	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	523					cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GATAAGCGGTGGATTAGTTTT	0.383													5	53	---	---	---	---	PASS
USP47	55031	broad.mit.edu	37	11	11970068	11970068	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11970068G>C	uc001mjs.2	+	22	4074	c.3311G>C	c.(3310-3312)AGA>ACA	p.R1104T	USP47_uc001mjr.2_Missense_Mutation_p.R1036T|USP47_uc009ygi.2_5'Flank	NM_017944	NP_060414	Q96K76	UBP47_HUMAN	ubiquitin specific protease 47	1124					base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)		GGAGAATACAGAGTTAAAGTA	0.299													3	58	---	---	---	---	PASS
NELL1	4745	broad.mit.edu	37	11	20907010	20907010	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20907010A>G	uc001mqe.2	+	5	680	c.527A>G	c.(526-528)GAC>GGC	p.D176G	NELL1_uc001mqf.2_Missense_Mutation_p.D176G|NELL1_uc009yid.2_Missense_Mutation_p.D204G|NELL1_uc010rdo.1_Missense_Mutation_p.D119G|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	176	TSP N-terminal.				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						CGTGTGATAGACCCTCCAGAT	0.418													8	25	---	---	---	---	PASS
RCN1	5954	broad.mit.edu	37	11	32122089	32122089	+	Intron	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32122089C>T	uc010reb.1	+						RCN1_uc010rea.1_Intron|RCN1_uc001mtk.2_Intron	NM_002901	NP_002892	Q15293	RCN1_HUMAN	reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)					CCTTTTGCTTCCTAGGAAACC	0.458													8	35	---	---	---	---	PASS
ABTB2	25841	broad.mit.edu	37	11	34181441	34181441	+	Intron	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34181441G>A	uc001mvl.1	-							NM_145804	NP_665803	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing								DNA binding			central_nervous_system(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				TTTGTTATCTGAGGCTGCCTA	0.522													9	26	---	---	---	---	PASS
GYLTL1B	120071	broad.mit.edu	37	11	45947906	45947906	+	Intron	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45947906G>T	uc001nbv.1	+						GYLTL1B_uc001nbw.1_Intron|GYLTL1B_uc001nbx.1_Intron|GYLTL1B_uc001nby.1_5'Flank|GYLTL1B_uc001nbz.1_5'Flank	NM_152312	NP_689525	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B						muscle cell homeostasis	Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.226)		AAGGTGAGTGGGACAAGAGGC	0.612													6	70	---	---	---	---	PASS
OR5F1	338674	broad.mit.edu	37	11	55761502	55761502	+	Silent	SNP	A	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55761502A>T	uc010riv.1	-	1	600	c.600T>A	c.(598-600)TCT>TCA	p.S200S		NM_003697	NP_003688	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F,	200	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)					CAGCCAAAATAGAACTTATGC	0.453													7	54	---	---	---	---	PASS
OR5T1	390155	broad.mit.edu	37	11	56043843	56043843	+	Silent	SNP	T	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56043843T>A	uc001nio.1	+	1	729	c.729T>A	c.(727-729)GCT>GCA	p.A243A		NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T,	243	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)	3	Esophageal squamous(21;0.00448)					TGCAGTCTGCTGAAGGGAGGA	0.423													20	117	---	---	---	---	PASS
ZDHHC5	25921	broad.mit.edu	37	11	57466569	57466569	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57466569C>T	uc001nkx.1	+	11	2917	c.1661C>T	c.(1660-1662)TCA>TTA	p.S554L	ZDHHC5_uc001nky.1_Missense_Mutation_p.S501L|ZDHHC5_uc001nkz.1_Missense_Mutation_p.S368L	NM_015457	NP_056272	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC domain containing 5	554						integral to membrane	acyltransferase activity|zinc ion binding			skin(1)	1						CTGCGCCAGTCACCCCCACTC	0.612													14	43	---	---	---	---	PASS
FAM111B	374393	broad.mit.edu	37	11	58893612	58893612	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58893612T>C	uc001nnl.2	+	4	2285	c.2042T>C	c.(2041-2043)ATT>ACT	p.I681T	FAM111B_uc001nnm.2_Missense_Mutation_p.I651T|FAM111B_uc010rko.1_Missense_Mutation_p.I651T	NM_198947	NP_945185	Q6SJ93	F111B_HUMAN	hypothetical protein LOC374393 isoform a	681							catalytic activity			ovary(2)	2						CATGCCCTTATTGAATTTGGT	0.363													20	59	---	---	---	---	PASS
PATL1	219988	broad.mit.edu	37	11	59420425	59420425	+	Silent	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59420425G>C	uc001noe.3	-	10	1331	c.1188C>G	c.(1186-1188)CTC>CTG	p.L396L	PATL1_uc009yms.1_Silent_p.L366L|PATL1_uc010rkw.1_Silent_p.L101L	NM_152716	NP_689929	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog	396	Region H.				cytoplasmic mRNA processing body assembly|deadenylation-dependent decapping of nuclear-transcribed mRNA	cytoplasmic mRNA processing body	protein binding|RNA binding			ovary(1)	1						GATCCTTTCGGAGATGATCTT	0.473													4	135	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62294858	62294858	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62294858G>T	uc001ntl.2	-	5	7331	c.7031C>A	c.(7030-7032)CCA>CAA	p.P2344Q	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	2344					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				ATCCAATTCTGGACCTTTTAA	0.438													6	110	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64417926	64417926	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64417926G>T	uc001oar.2	-	16	3542	c.3103C>A	c.(3103-3105)CTC>ATC	p.L1035I	NRXN2_uc001oas.2_Missense_Mutation_p.L995I|NRXN2_uc001oaq.2_Missense_Mutation_p.L702I	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:Variant_position_missing_in_P58401_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						CCACCTTTGAGATCGAGGTTT	0.637													5	72	---	---	---	---	PASS
LRP5	4041	broad.mit.edu	37	11	68201264	68201264	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68201264G>A	uc001ont.2	+	18	4033	c.3958G>A	c.(3958-3960)GAG>AAG	p.E1320K	LRP5_uc009ysg.2_Missense_Mutation_p.E730K	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein	1320	LDL-receptor class A 2.|Extracellular (Potential).				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						CTGCGACGGCGAGGCAGACTG	0.706													6	13	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71724063	71724063	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71724063G>A	uc001orl.1	-	15	4658	c.4486C>T	c.(4486-4488)CGA>TGA	p.R1496*	NUMA1_uc009ysw.1_Nonsense_Mutation_p.R1059*|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Nonsense_Mutation_p.R1496*|NUMA1_uc001orn.2_Nonsense_Mutation_p.R1059*|NUMA1_uc009ysx.1_Nonsense_Mutation_p.R1496*|NUMA1_uc001oro.1_Nonsense_Mutation_p.R1496*	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	1496	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						TGTGCTTCTCGCTGCACCTCA	0.597			T	RARA	APL								13	67	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92088060	92088060	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92088060G>A	uc001pdj.3	+	1	2799	c.2782G>A	c.(2782-2784)GAT>AAT	p.D928N		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	928	Cadherin 8.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTTTTTAGATGATGTCAATGA	0.438										TCGA Ovarian(4;0.039)			25	91	---	---	---	---	PASS
CWF19L2	143884	broad.mit.edu	37	11	107299540	107299540	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107299540T>C	uc010rvp.1	-	8	1448	c.1418A>G	c.(1417-1419)AAG>AGG	p.K473R	CWF19L2_uc001pjh.3_RNA|CWF19L2_uc009yxo.2_RNA	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control	473							catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		AAATGTAGACTTTGTATCCCG	0.348													14	118	---	---	---	---	PASS
TMEM136	219902	broad.mit.edu	37	11	120198201	120198201	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120198201C>T	uc001pxh.1	+	2	114	c.51C>T	c.(49-51)CTC>CTT	p.L17L	TMEM136_uc001pxg.2_Silent_p.L39L|TMEM136_uc010rzm.1_Silent_p.L17L|TMEM136_uc001pxj.2_Silent_p.L39L|TMEM136_uc009zas.1_5'UTR|TMEM136_uc001pxi.1_Intron	NM_174926	NP_777586	Q6ZRR5	TM136_HUMAN	transmembrane protein 136	17	Helical; (Potential).					integral to membrane		p.W17*(1)		ovary(1)	1		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		GTGGCTGGCTCTCGCTCTATA	0.507													11	25	---	---	---	---	PASS
ARHGEF12	23365	broad.mit.edu	37	11	120352085	120352085	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120352085C>G	uc001pxl.1	+	39	4361	c.4354C>G	c.(4354-4356)CAC>GAC	p.H1452D	ARHGEF12_uc009zau.1_Missense_Mutation_p.H1349D	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	1452					apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		GGAATCCACCCACCAGCAGCA	0.547			T	MLL	AML								5	29	---	---	---	---	PASS
SORL1	6653	broad.mit.edu	37	11	121440877	121440877	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121440877C>G	uc001pxx.2	+	23	3315	c.3235C>G	c.(3235-3237)CTT>GTT	p.L1079V		NM_003105	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor containing LDLR class	1079	Extracellular (Potential).|LDL-receptor class A 1.				cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity			ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GAACACCTGTCTTCGCAACCA	0.483													12	89	---	---	---	---	PASS
VWA5A	4013	broad.mit.edu	37	11	123995012	123995012	+	Silent	SNP	A	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123995012A>G	uc001pzu.2	+	11	1442	c.1233A>G	c.(1231-1233)AGA>AGG	p.R411R	VWA5A_uc001pzr.2_Silent_p.R411R|VWA5A_uc001pzs.2_Silent_p.R411R|VWA5A_uc010sae.1_Silent_p.R427R|VWA5A_uc001pzt.2_Silent_p.R411R	NM_001130142	NP_001123614	O00534	VMA5A_HUMAN	BCSC-1 isoform 1	411	VWFA.									upper_aerodigestive_tract(1)|ovary(1)	2						GGATCAACAGACAGAAACACA	0.398													3	17	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	124121210	124121210	+	IGR	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124121210C>T								OR8G2 (24900 upstream) : OR8D1 (58527 downstream)																							TTGCAGCCATCTTCAATCAGC	0.438													15	32	---	---	---	---	PASS
OR8A1	390275	broad.mit.edu	37	11	124440254	124440254	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124440254A>G	uc010san.1	+	1	290	c.290A>G	c.(289-291)AAG>AGG	p.K97R		NM_001005194	NP_001005194	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A,	97	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		ATTACCCCTAAGATGCTGGTG	0.453													28	63	---	---	---	---	PASS
ADAMTS8	11095	broad.mit.edu	37	11	130286975	130286975	+	Intron	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130286975G>A	uc001qgg.3	-							NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1						negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		GAAGTTCTGCGTGGCGGGGAG	0.627													6	32	---	---	---	---	PASS
C12orf5	57103	broad.mit.edu	37	12	4460527	4460527	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4460527G>C	uc001qmp.2	+	5	444	c.365G>C	c.(364-366)GGA>GCA	p.G122A		NM_020375	NP_065108	Q9NQ88	TIGAR_HUMAN	TP53-induced glycolysis and apoptosis regulator	122						intracellular	fructose-2,6-bisphosphate 2-phosphatase activity			skin(1)	1			all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)			CCGCCCGGAGGAGAGACGCTG	0.488													8	29	---	---	---	---	PASS
ATN1	1822	broad.mit.edu	37	12	7045484	7045484	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7045484C>G	uc001qrw.1	+	5	1291	c.1054C>G	c.(1054-1056)CTG>GTG	p.L352V	ATN1_uc001qrx.1_Missense_Mutation_p.L352V|ATN1_uc001qry.1_Missense_Mutation_p.L351V	NM_001007026	NP_001007027	P54259	ATN1_HUMAN	atrophin-1	352					cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						GGGCCCAACTCTGGCTCCTTC	0.607													12	140	---	---	---	---	PASS
PRH2	5555	broad.mit.edu	37	12	11081919	11081919	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11081919C>A	uc009zhr.2	+	1	85	c.47C>A	c.(46-48)GCT>GAT	p.A16D	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH2_uc001qzh.2_Missense_Mutation_p.A16D|PRH2_uc001qzi.3_Missense_Mutation_p.A16D	NM_001110213	NP_001103683	P02810	PRPC_HUMAN	proline-rich protein HaeIII subfamily 2	16						extracellular space	protein binding				0						TTCAGCTCAGCTCAGGACTTA	0.517													11	73	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12278319	12278319	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12278319C>T	uc001rah.3	-	21	4502	c.4360G>A	c.(4360-4362)GGA>AGA	p.G1454R	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.G1409R	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	1454	Cytoplasmic (Potential).				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				CCACTGCTTCCCCCCATGATA	0.423													15	16	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12279620	12279620	+	Intron	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12279620C>G	uc001rah.3	-						BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Intron	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein						cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				TCCATCCTGACTCACCTGGAA	0.438													30	21	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12291458	12291458	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12291458C>T	uc001rah.3	-	16	3550	c.3408G>A	c.(3406-3408)CGG>CGA	p.R1136R	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Silent_p.R1136R	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	1136	Extracellular (Potential).|LDL-receptor class B 19.|Beta-propeller 4.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				CTAATACTATCCGGTTAGCAC	0.363													20	58	---	---	---	---	PASS
KCNH3	23416	broad.mit.edu	37	12	49933230	49933230	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49933230C>T	uc001ruh.1	+	1	291	c.31C>T	c.(31-33)CAG>TAG	p.Q11*	KCNH3_uc010smj.1_5'UTR	NM_012284	NP_036416	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H	11	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	two-component sensor activity|voltage-gated potassium channel activity				0						CCTGGCGCCGCAGAACACCTT	0.662													5	23	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53448097	53448097	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53448097G>C	uc001sbp.2	+	7	529	c.394G>C	c.(394-396)GAC>CAC	p.D132H	uc001sbk.1_Intron|TENC1_uc001sbl.2_Missense_Mutation_p.D8H|TENC1_uc001sbm.2_Missense_Mutation_p.D142H|TENC1_uc001sbn.2_Missense_Mutation_p.D142H|TENC1_uc001sbo.1_Missense_Mutation_p.D132H	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase	132	Phosphatase tensin-type.				intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding			ovary(1)|pancreas(1)	2						CTGGGACTTAGACCTCACCTA	0.701													11	18	---	---	---	---	PASS
TARBP2	6895	broad.mit.edu	37	12	53899577	53899577	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53899577C>T	uc001sdo.2	+	8	1374	c.886C>T	c.(886-888)CGT>TGT	p.R296C	TARBP2_uc001sdp.2_Missense_Mutation_p.R275C|TARBP2_uc001sdq.2_Missense_Mutation_p.R152C|TARBP2_uc001sdr.2_Missense_Mutation_p.R152C|TARBP2_uc001sds.2_Missense_Mutation_p.P253L|TARBP2_uc001sdt.2_Missense_Mutation_p.R275C|TARBP2_uc001sdu.2_Missense_Mutation_p.R152C|TARBP2_uc001sdv.2_RNA	NM_134323	NP_599150	Q15633	TRBP2_HUMAN	TAR RNA binding protein 2 isoform a	296	Sufficient for interaction with DICER1.|DRBM 3.|Sufficient for interaction with PRKRA.				miRNA loading onto RISC involved in gene silencing by miRNA|negative regulation of defense response to virus by host|negative regulation of protein kinase activity|positive regulation of viral genome replication|pre-miRNA processing|production of siRNA involved in RNA interference|regulation of transcription from RNA polymerase II promoter|regulation of translation|regulation of viral transcription|targeting of mRNA for destruction involved in RNA interference	cytosol|nucleus|perinuclear region of cytoplasm|RNA-induced silencing complex	double-stranded RNA binding|protein homodimerization activity|siRNA binding			central_nervous_system(1)	1						TGCCTGCTGCCGTGTCCTCAG	0.612													6	41	---	---	---	---	PASS
KIAA0748	9840	broad.mit.edu	37	12	55356381	55356381	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55356381C>G	uc001sgn.3	-	9	1411	c.1301G>C	c.(1300-1302)AGA>ACA	p.R434T	KIAA0748_uc001sgl.3_Missense_Mutation_p.R296T|KIAA0748_uc001sgm.3_Missense_Mutation_p.R181T|KIAA0748_uc010spb.1_Missense_Mutation_p.R181T|KIAA0748_uc010spc.1_Missense_Mutation_p.R296T|KIAA0748_uc010spd.1_Missense_Mutation_p.R434T|KIAA0748_uc001sgo.3_RNA	NM_001098815	NP_001092285	A2RU30	K0748_HUMAN	hypothetical protein LOC9840	434										ovary(1)|central_nervous_system(1)	2						TCTGCTCTTTCTTTTCCAGAA	0.502													35	106	---	---	---	---	PASS
GLI1	2735	broad.mit.edu	37	12	57857822	57857822	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57857822G>A	uc001snx.2	+	3	219	c.141G>A	c.(139-141)ATG>ATA	p.M47I	GLI1_uc009zpp.2_RNA|GLI1_uc009zpq.2_Intron|GLI1_uc009zpr.1_Intron	NM_005269	NP_005260	P08151	GLI1_HUMAN	GLI family zinc finger 1 isoform 1	47					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding			skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15			GBM - Glioblastoma multiforme(3;3.99e-32)			CTAACCTCATGTCCGGCCCCC	0.557													37	107	---	---	---	---	PASS
AGAP2	116986	broad.mit.edu	37	12	58135684	58135684	+	Intron	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58135684C>T	uc001spr.2	-							NM_014770	NP_055585	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-S						axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						GAGGGCTGACCTTTCTCTTAC	0.522													23	81	---	---	---	---	PASS
TSPAN31	6302	broad.mit.edu	37	12	58139669	58139669	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58139669A>T	uc001spt.2	+	2	359	c.205A>T	c.(205-207)AAC>TAC	p.N69Y	TSPAN31_uc009zqb.2_Intron|TSPAN31_uc010ssa.1_5'UTR	NM_005981	NP_005972	Q12999	TSN31_HUMAN	sarcoma amplified sequence	69	Cytoplasmic (Potential).				positive regulation of cell proliferation	integral to plasma membrane|membrane fraction					0	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			GGGTGCTGTCAACCACCACCA	0.562													10	41	---	---	---	---	PASS
PTPRR	5801	broad.mit.edu	37	12	71286540	71286540	+	Silent	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71286540C>A	uc001swi.1	-	2	692	c.276G>T	c.(274-276)CCG>CCT	p.P92P		NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	92	Extracellular (Potential).				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		GATTGAGAGACGGGTCATATG	0.433													30	83	---	---	---	---	PASS
TPH2	121278	broad.mit.edu	37	12	72338230	72338230	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72338230C>G	uc009zrw.1	+	3	553	c.412C>G	c.(412-414)CCA>GCA	p.P138A	TPH2_uc001swy.2_Missense_Mutation_p.P48A	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	138					aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity			ovary(2)|central_nervous_system(1)|skin(1)	4					L-Tryptophan(DB00150)	GCTGAATCCTCCAGAGAACAT	0.423													25	83	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	73015517	73015517	+	Silent	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73015517C>A	uc001sxa.2	+	15	2556	c.2526C>A	c.(2524-2526)TCC>TCA	p.S842S		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	842	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						ATTGGATTTCCAGCAACAGGA	0.398													9	40	---	---	---	---	PASS
OSBPL8	114882	broad.mit.edu	37	12	76767175	76767175	+	Silent	SNP	T	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76767175T>A	uc001sye.1	-	18	2346	c.1866A>T	c.(1864-1866)TCA>TCT	p.S622S	OSBPL8_uc001syf.1_Silent_p.S580S|OSBPL8_uc001syg.1_Silent_p.S580S|OSBPL8_uc001syh.1_Silent_p.S597S	NM_020841	NP_065892	Q9BZF1	OSBL8_HUMAN	oxysterol-binding protein-like protein 8 isoform	622					lipid transport		lipid binding			ovary(1)	1						TAAGTTTCCCTGATATTTGAT	0.308													20	54	---	---	---	---	PASS
E2F7	144455	broad.mit.edu	37	12	77417881	77417881	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77417881C>T	uc001sym.3	-	13	2886	c.2650G>A	c.(2650-2652)GTC>ATC	p.V884I	E2F7_uc009zse.2_3'UTR	NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	884					cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						CTCTTCAGGACAGGGTCTCCA	0.542													14	49	---	---	---	---	PASS
TBX3	6926	broad.mit.edu	37	12	115114128	115114128	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115114128C>T	uc001tvt.1	-	6	2053	c.1089G>A	c.(1087-1089)TCG>TCA	p.S363S	TBX3_uc001tvu.1_Silent_p.S343S	NM_016569	NP_057653	O15119	TBX3_HUMAN	T-box 3 protein isoform 2	363					anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	sequence-specific DNA binding			ovary(2)|skin(1)	3	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CTTTGAGGTTCGATGTCCCTA	0.547													16	49	---	---	---	---	PASS
TMED2	10959	broad.mit.edu	37	12	124074954	124074954	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124074954G>T	uc001ufg.2	+	3	547	c.439G>T	c.(439-441)GAA>TAA	p.E147*		NM_006815	NP_006806	Q15363	TMED2_HUMAN	coated vesicle membrane protein precursor	147	Lumenal (Potential).				protein transport|vesicle-mediated transport	COPI coated vesicle membrane|ER-Golgi intermediate compartment|integral to membrane|microsome|zymogen granule membrane	protein binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000138)|Epithelial(86;0.000613)|all cancers(50;0.00745)		TGTAAAGCACGAACAGGAATA	0.433													4	53	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124915226	124915226	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124915226G>T	uc010tba.1	-	9	1107	c.990C>A	c.(988-990)CGC>CGA	p.R330R	NCOR2_uc010tay.1_Silent_p.R330R|NCOR2_uc010taz.1_Silent_p.R330R|NCOR2_uc010tbb.1_Silent_p.R330R|NCOR2_uc010tbc.1_Silent_p.R330R|NCOR2_uc001ugj.1_Silent_p.R330R|NCOR2_uc001ugk.1_Silent_p.R330R	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	330					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CGTAGTACTCGCGCACCTTGC	0.652													14	64	---	---	---	---	PASS
ATP7B	540	broad.mit.edu	37	13	52511767	52511767	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52511767C>A	uc001vfw.2	-	18	3905	c.3748G>T	c.(3748-3750)GCC>TCC	p.A1250S	ATP7B_uc010adv.2_Missense_Mutation_p.A820S|ATP7B_uc001vfx.2_Missense_Mutation_p.A1043S|ATP7B_uc001vfy.2_Missense_Mutation_p.A1139S|ATP7B_uc010tgt.1_Missense_Mutation_p.A1185S|ATP7B_uc010tgu.1_Missense_Mutation_p.A1202S|ATP7B_uc010tgv.1_Missense_Mutation_p.A1172S|ATP7B_uc001vfv.2_Missense_Mutation_p.A522S|ATP7B_uc010tgs.1_Missense_Mutation_p.A461S	NM_000053	NP_000044	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	1250	Cytoplasmic (Potential).				ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)		TGGACCTTGGCCACCTTGTGC	0.542									Wilson_disease				5	116	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77844568	77844568	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77844568T>A	uc001vkf.2	-	7	1028	c.937A>T	c.(937-939)ATG>TTG	p.M313L	MYCBP2_uc010aev.2_5'UTR	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	313					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CACTTGTGCATTAAAGCTGCT	0.338													15	30	---	---	---	---	PASS
TPP2	7174	broad.mit.edu	37	13	103279418	103279418	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103279418G>A	uc001vpi.3	+	7	944	c.841G>A	c.(841-843)GAA>AAA	p.E281K		NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II	281					proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AGAAGAACCTGAACGGAATGG	0.463													29	79	---	---	---	---	PASS
TEP1	7011	broad.mit.edu	37	14	20857439	20857439	+	Missense_Mutation	SNP	G	T	T	rs145088591		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20857439G>T	uc001vxe.2	-	17	2523	c.2483C>A	c.(2482-2484)CCC>CAC	p.P828H	TEP1_uc010ahk.2_Missense_Mutation_p.P178H|TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Missense_Mutation_p.P720H	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	828					telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CACATCATTGGGATTCAAATC	0.418													5	70	---	---	---	---	PASS
METT11D1	64745	broad.mit.edu	37	14	21465057	21465057	+	3'UTR	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21465057G>A	uc001vyn.2	+	14					METT11D1_uc001vym.2_3'UTR|METT11D1_uc001vyo.2_3'UTR|METT11D1_uc001vyp.2_3'UTR|METT11D1_uc001vyq.2_3'UTR|SLC39A2_uc001vyr.2_5'Flank|SLC39A2_uc001vys.2_5'Flank	NM_022734	NP_073571	Q9H7H0	MET17_HUMAN	methyltransferase 11 domain containing 1 isoform						translation	mitochondrion|ribosome	copper ion binding|methyltransferase activity				0	all_cancers(95;0.00267)		OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0191)		TGATGAGGATGTGTAACAAGT	0.512													10	26	---	---	---	---	PASS
LRP10	26020	broad.mit.edu	37	14	23346451	23346451	+	Silent	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23346451G>A	uc001whd.2	+	7	2410	c.1857G>A	c.(1855-1857)AAG>AAA	p.K619K	LRP10_uc001whe.2_Intron	NM_014045	NP_054764	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein	619	Pro-rich.|Cytoplasmic (Potential).				endocytosis	coated pit|integral to membrane				central_nervous_system(1)	1	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		TGCCCATCAAGGCTCCCCTCC	0.657													9	29	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23901920	23901920	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23901920C>T	uc001wjx.2	-	5	536	c.430G>A	c.(430-432)GGC>AGC	p.G144S		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	144	Myosin head-like.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CTCTTCTTGCCCCGGTAGGCA	0.592													14	57	---	---	---	---	PASS
ADCY4	196883	broad.mit.edu	37	14	24788418	24788418	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24788418C>G	uc001wov.2	-	23	2848	c.2842G>C	c.(2842-2844)GAT>CAT	p.D948H	ADCY4_uc001wow.2_Missense_Mutation_p.D948H|ADCY4_uc010toh.1_Missense_Mutation_p.D634H|ADCY4_uc001wox.2_Missense_Mutation_p.D948H|ADCY4_uc001woy.2_Missense_Mutation_p.D948H	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	948	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)		CGTTCAGCATCCTGGCAATGG	0.552													22	55	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30105516	30105516	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30105516C>T	uc001wqh.2	-	7	1351	c.1170G>A	c.(1168-1170)GAG>GAA	p.E390E		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	390					cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TGTTGGCGTCCTCGTGGTCTG	0.502													36	149	---	---	---	---	PASS
G2E3	55632	broad.mit.edu	37	14	31071194	31071194	+	Intron	SNP	T	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31071194T>G	uc001wqk.2	+						G2E3_uc010tpe.1_Intron|G2E3_uc010tpf.1_Intron	NM_017769	NP_060239	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin ligase						apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						CATGGAAATTTAAATCTGTAG	0.264													10	19	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42356690	42356690	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42356690C>G	uc001wvm.2	+	3	2060	c.862C>G	c.(862-864)CTC>GTC	p.L288V	LRFN5_uc010ana.2_Missense_Mutation_p.L288V	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	288	Extracellular (Potential).|Ig-like.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGAGCCTCCTCTCATTACTCG	0.493										HNSCC(30;0.082)			15	64	---	---	---	---	PASS
TXNDC16	57544	broad.mit.edu	37	14	52907400	52907400	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52907400G>T	uc001wzs.2	-	19	2334	c.1885C>A	c.(1885-1887)CAG>AAG	p.Q629K	TXNDC16_uc010tqu.1_Missense_Mutation_p.Q624K|TXNDC16_uc010aoe.2_RNA	NM_020784	NP_065835	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16 isoform 1	629					cell redox homeostasis	extracellular region					0	Breast(41;0.0716)					AATGGTTTCTGAAGTCTGAAA	0.343													9	23	---	---	---	---	PASS
C14orf135	64430	broad.mit.edu	37	14	60581998	60581998	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60581998C>T	uc001xer.3	+	3	996	c.474C>T	c.(472-474)GGC>GGT	p.G158G	C14orf135_uc001xeq.2_Silent_p.G158G	NM_022495	NP_071940	Q63HM2	CN135_HUMAN	hepatitis C virus F protein-binding protein 2	392	Helical; (Potential).					integral to membrane				ovary(2)	2		Myeloproliferative disorder(585;0.163)		OV - Ovarian serous cystadenocarcinoma(108;0.127)		CTATTGTGGGCTATGGTTTGA	0.353													23	121	---	---	---	---	PASS
ADAM20	8748	broad.mit.edu	37	14	70991102	70991102	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70991102G>A	uc001xme.2	-	2	768	c.523C>T	c.(523-525)CTT>TTT	p.L175F		NM_003814	NP_003805	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20 preproprotein	125					proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		CAGGTACTAAGGGCAACCAAG	0.483													10	46	---	---	---	---	PASS
PROX2	283571	broad.mit.edu	37	14	75329373	75329373	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75329373G>A	uc001xqr.1	-	1	1165	c.1165C>T	c.(1165-1167)CCA>TCA	p.P389S	PROX2_uc001xqq.1_Intron	NM_001080408	NP_001073877	Q3B8N5	PROX2_HUMAN	prospero homeobox 2	389					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)		AGGACCAATGGTTGCGGCTTA	0.572													12	48	---	---	---	---	PASS
KCNK10	54207	broad.mit.edu	37	14	88707111	88707111	+	Silent	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88707111G>A	uc001xwo.2	-	3	898	c.441C>T	c.(439-441)AAC>AAT	p.N147N	KCNK10_uc001xwm.2_Silent_p.N152N|KCNK10_uc001xwn.2_Silent_p.N152N	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	147					signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						GGCTGCTGTTGTTGGAAGAGT	0.448													23	125	---	---	---	---	PASS
CPSF2	53981	broad.mit.edu	37	14	92600506	92600506	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92600506C>G	uc001yah.1	+	4	538	c.301C>G	c.(301-303)CTT>GTT	p.L101V		NM_017437	NP_059133	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2	101					histone mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	hydrolase activity|protein binding|RNA binding			ovary(2)	2		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		CATGTATGATCTTTATCAGGT	0.363													16	50	---	---	---	---	PASS
RTL1	388015	broad.mit.edu	37	14	101348272	101348272	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101348272C>T	uc010txj.1	-	1	2913	c.2854G>A	c.(2854-2856)GAG>AAG	p.E952K	MIR433_hsa-mir-433|MI0001723_RNA|uc001yig.3_5'Flank|MIR127_hsa-mir-127|MI0000472_5'Flank|MIR432_hsa-mir-432|MI0003133_5'Flank|uc010txk.1_5'Flank|MIR136_hsa-mir-136|MI0000475_5'Flank	NM_001134888	NP_001128360	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	952										pancreas(1)	1						GCTAGATCCTCTGTGTTGAGA	0.527													26	91	---	---	---	---	PASS
MIR656	724026	broad.mit.edu	37	14	101533061	101533061	+	RNA	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101533061C>A	hsa-mir-656|MI0003678	+			c.1C>A																				0						TCAGTGGTACCTGAAATAGGT	0.532													5	43	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107198985	107198985	+	RNA	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107198985G>A	uc010tyt.1	-	21		c.1713C>T								Parts of antibodies, mostly variable regions.												0						TTCATTTGCAGATACAGTGAG	0.498													38	117	---	---	---	---	PASS
LCMT2	9836	broad.mit.edu	37	15	43621302	43621302	+	Silent	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43621302C>G	uc001zrg.2	-	1	1590	c.1386G>C	c.(1384-1386)CTG>CTC	p.L462L	LCMT2_uc010udn.1_Silent_p.L41L|ADAL_uc001zrh.2_5'Flank|ADAL_uc010udo.1_5'Flank	NM_014793	NP_055608	O60294	LCMT2_HUMAN	leucine carboxyl methyltransferase 2	462					tRNA processing		methyltransferase activity|protein binding				0		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	TTGTCACTTTCAGGTCCTCAG	0.463													19	52	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48787692	48787692	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48787692A>G	uc001zwx.1	-	21	2841	c.2513T>C	c.(2512-2514)TTG>TCG	p.L838S		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	838	EGF-like 13; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TGTTGGATCCAAAGTACTTTC	0.348													10	153	---	---	---	---	PASS
FEM1B	10116	broad.mit.edu	37	15	68582855	68582855	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68582855C>T	uc002arg.2	+	2	1774	c.1159C>T	c.(1159-1161)CGA>TGA	p.R387*	FEM1B_uc002arh.2_Nonsense_Mutation_p.R307*	NM_015322	NP_056137	Q9UK73	FEM1B_HUMAN	fem-1 homolog b	387					apoptosis|induction of apoptosis|regulation of DNA damage checkpoint|regulation of ubiquitin-protein ligase activity	cytoplasm|nucleus	death receptor binding|ubiquitin-protein ligase activity				0						GGATCTTCTTCGATTTGCTCA	0.398													7	38	---	---	---	---	PASS
HCN4	10021	broad.mit.edu	37	15	73617643	73617643	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73617643C>A	uc002avp.2	-	5	2727	c.1733G>T	c.(1732-1734)CGG>CTG	p.R578L		NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic	578	Cytoplasmic (Potential).				blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)		GCTCACCTCCCGCAGGGGCTC	0.677													4	19	---	---	---	---	PASS
KIAA1024	23251	broad.mit.edu	37	15	79750082	79750082	+	Silent	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79750082T>C	uc002bew.1	+	2	1668	c.1593T>C	c.(1591-1593)AGT>AGC	p.S531S	KIAA1024_uc010unk.1_Silent_p.S531S	NM_015206	NP_056021	Q9UPX6	K1024_HUMAN	hypothetical protein LOC23251	531						integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4						TGAGCATCAGTGGCTCCACGG	0.493													14	20	---	---	---	---	PASS
CACNA1H	8912	broad.mit.edu	37	16	1260849	1260849	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1260849G>T	uc002cks.2	+	21	4349	c.4101G>T	c.(4099-4101)CTG>CTT	p.L1367L	CACNA1H_uc002ckt.2_Silent_p.L1367L|CACNA1H_uc002cku.2_Silent_p.L73L|CACNA1H_uc010brj.2_Silent_p.L73L|CACNA1H_uc002ckv.2_Silent_p.L73L	NM_021098	NP_066921	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type,	1367	Helical; Name=S3 of repeat III; (Potential).|III.				aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(2)	2		Hepatocellular(780;0.00369)			Flunarizine(DB04841)|Mibefradil(DB01388)	GGAACCTGCTGGATGGGCTGC	0.677													4	42	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1397706	1397706	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1397706C>T	uc002clk.1	+	31	3014	c.3014C>T	c.(3013-3015)ACC>ATC	p.T1005I	BAIAP3_uc002clj.2_Missense_Mutation_p.T987I|BAIAP3_uc010uuz.1_Missense_Mutation_p.T970I|BAIAP3_uc010uva.1_Missense_Mutation_p.T942I|BAIAP3_uc010uvc.1_Missense_Mutation_p.T934I	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	1005					G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				CCGCAGAGGACCCTGGAGCAG	0.677													4	20	---	---	---	---	PASS
TBL3	10607	broad.mit.edu	37	16	2024958	2024958	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2024958G>A	uc002cnu.1	+	7	596	c.494G>A	c.(493-495)CGC>CAC	p.R165H	TBL3_uc002cnv.1_Missense_Mutation_p.R51H|TBL3_uc010bsb.1_5'UTR|TBL3_uc010bsc.1_Missense_Mutation_p.R51H|TBL3_uc010uvt.1_5'UTR|TBL3_uc002cnw.1_5'Flank	NM_006453	NP_006444	Q12788	TBL3_HUMAN	transducin beta-like 3	165	WD 3.				G-protein signaling, coupled to cGMP nucleotide second messenger|rRNA processing	nucleolus|small-subunit processome	receptor signaling protein activity				0						GACCCTACACGCCTGCTGCTC	0.677													15	39	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2152826	2152826	+	Silent	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2152826G>A	uc002cos.1	-	24	9146	c.8937C>T	c.(8935-8937)TTC>TTT	p.F2979F	PKD1_uc002cot.1_Silent_p.F2979F|PKD1_uc010bse.1_RNA	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2979	Extracellular (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						CCGGGGAAATGAAGAAGGTGT	0.657													17	33	---	---	---	---	PASS
TBC1D24	57465	broad.mit.edu	37	16	2550850	2550850	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2550850G>T	uc002cql.2	+	8	1711	c.1571G>T	c.(1570-1572)CGG>CTG	p.R524L	TBC1D24_uc002cqk.2_Missense_Mutation_p.R518L|TBC1D24_uc002cqm.2_Intron|TBC1D24_uc010bsm.2_RNA	NM_020705	NP_065756	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	524	TLD.				neuron projection development	cytoplasm	protein binding|Rab GTPase activator activity				0						GACCTGAACCGGGGCCGCACA	0.652											OREG0023552	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	14	---	---	---	---	PASS
CLDN6	9074	broad.mit.edu	37	16	3065490	3065490	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3065490C>A	uc002csu.3	-	2	593	c.533G>T	c.(532-534)GGG>GTG	p.G178V		NM_021195	NP_067018	P56747	CLD6_HUMAN	claudin 6	178	Helical; (Potential).				calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity				0						CAGCAACCCCCCACCCAGCAA	0.672													4	20	---	---	---	---	PASS
ABCC1	4363	broad.mit.edu	37	16	16219669	16219669	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16219669C>T	uc010bvi.2	+	26	3895	c.3720C>T	c.(3718-3720)GTC>GTT	p.V1240V	ABCC1_uc010bvj.2_Silent_p.V1181V|ABCC1_uc010bvk.2_Silent_p.V1184V|ABCC1_uc010bvl.2_Silent_p.V1240V|ABCC1_uc010bvm.2_Silent_p.V1125V|ABCC1_uc002del.3_Silent_p.V1134V	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	1240	Helical; Name=17.|ABC transmembrane type-1 2.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	ACTCACAGGTCACCACGTACT	0.453													5	27	---	---	---	---	PASS
POLR3E	55718	broad.mit.edu	37	16	22325429	22325429	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22325429G>A	uc002dkk.2	+	8	658	c.502G>A	c.(502-504)GAC>AAC	p.D168N	POLR3E_uc002dkj.1_Missense_Mutation_p.D168N|POLR3E_uc002dkm.2_Missense_Mutation_p.D132N|POLR3E_uc010vbr.1_Missense_Mutation_p.D168N|POLR3E_uc002dkl.2_Missense_Mutation_p.D168N|POLR3E_uc010vbs.1_Missense_Mutation_p.D132N|POLR3E_uc010vbt.1_Missense_Mutation_p.D112N	NM_018119	NP_060589	Q9NVU0	RPC5_HUMAN	RNA polymerase III polypeptide E	168					innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA-directed RNA polymerase activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.012)		TGAGGCGGAAGACGATGTTAA	0.632													6	21	---	---	---	---	PASS
LCMT1	51451	broad.mit.edu	37	16	25186343	25186343	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25186343G>T	uc002dnx.1	+	10	1128	c.970G>T	c.(970-972)GGA>TGA	p.G324*	LCMT1_uc002dny.1_Nonsense_Mutation_p.G269*|LCMT1_uc002dnz.1_Nonsense_Mutation_p.G224*|LCMT1_uc002doa.1_Nonsense_Mutation_p.G169*	NM_016309	NP_057393	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1 isoform a	324							protein binding|protein C-terminal carboxyl O-methyltransferase activity|S-adenosylmethionine-dependent methyltransferase activity				0				GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	AACCAAAGGAGGAAATGAGCT	0.358													4	22	---	---	---	---	PASS
VPS35	55737	broad.mit.edu	37	16	46710571	46710571	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46710571T>A	uc002eef.3	-	8	937	c.838A>T	c.(838-840)AAT>TAT	p.N280Y	VPS35_uc002eed.2_Missense_Mutation_p.N101Y|VPS35_uc002eee.2_Missense_Mutation_p.N241Y	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35	280					protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AGAAAAGGATTCAAAGTCTGG	0.363													15	50	---	---	---	---	PASS
PHKB	5257	broad.mit.edu	37	16	47732384	47732384	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47732384T>A	uc002eev.3	+	30	3081	c.3029T>A	c.(3028-3030)CTG>CAG	p.L1010Q	PHKB_uc002eeu.3_Missense_Mutation_p.L1003Q|PHKB_uc002eew.3_Missense_Mutation_p.L251Q	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a	1010					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TCCATTGTACTGGAAAGAAAC	0.368													15	41	---	---	---	---	PASS
NOD2	64127	broad.mit.edu	37	16	50745378	50745378	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50745378A>C	uc002egm.1	+	4	1661	c.1556A>C	c.(1555-1557)CAG>CCG	p.Q519P	NOD2_uc010cbk.1_Missense_Mutation_p.Q492P|NOD2_uc002egl.1_Missense_Mutation_p.Q297P|NOD2_uc010cbl.1_Missense_Mutation_p.Q297P|NOD2_uc010cbm.1_Missense_Mutation_p.Q297P|NOD2_uc010cbn.1_RNA|NOD2_uc010cbo.1_RNA|NOD2_uc010cbp.1_5'Flank|NOD2_uc010cbq.1_5'Flank|NOD2_uc010cbr.1_5'Flank	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	519	NACHT.				activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				CTGATTCTGCAGCATTTTCTG	0.592													21	46	---	---	---	---	PASS
CA7	766	broad.mit.edu	37	16	66881002	66881002	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66881002C>A	uc002eqi.2	+	2	219	c.110C>A	c.(109-111)TCC>TAC	p.S37Y	uc002eqh.2_Intron|CA7_uc002eqj.2_5'UTR	NM_005182	NP_005173	P43166	CAH7_HUMAN	carbonic anhydrase VII isoform 1	37					one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		AATATCATCTCCAGCCAGGCT	0.577													14	32	---	---	---	---	PASS
MARVELD3	91862	broad.mit.edu	37	16	71674862	71674862	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71674862A>G	uc002fau.2	+	3	1228	c.1165A>G	c.(1165-1167)AAA>GAA	p.K389E	PHLPP2_uc002fav.2_RNA|MARVELD3_uc010cge.2_3'UTR	NM_001017967	NP_001017967	Q96A59	MALD3_HUMAN	MARVEL domain containing 3 isoform 1	392	Cytoplasmic (Potential).					integral to membrane				skin(1)	1		Ovarian(137;0.125)				GAAGCGCTACAAAGGCAGCCG	0.547													5	27	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76513408	76513408	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76513408C>A	uc002feu.1	+	14	2240	c.1855C>A	c.(1855-1857)CCA>ACA	p.P619T	CNTNAP4_uc002fev.1_Missense_Mutation_p.P483T|CNTNAP4_uc010chb.1_Missense_Mutation_p.P546T|CNTNAP4_uc002fex.1_Missense_Mutation_p.P622T|CNTNAP4_uc002few.2_Missense_Mutation_p.P594T	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	619	Extracellular (Potential).|Fibrinogen C-terminal.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						TCCCCTGGAACCATTTCTTCT	0.333													16	78	---	---	---	---	PASS
OSGIN1	29948	broad.mit.edu	37	16	83999366	83999366	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83999366C>T	uc002fha.2	+	7	1820	c.1437C>T	c.(1435-1437)ATC>ATT	p.I479I	NECAB2_uc002fhd.2_5'Flank|OSGIN1_uc002fhb.2_Silent_p.I396I|OSGIN1_uc002fhc.2_Silent_p.I396I	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	479					cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						TGGTCCTCATCGGCTCCCACC	0.637													7	29	---	---	---	---	PASS
SLC7A5	8140	broad.mit.edu	37	16	87902863	87902863	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87902863C>A	uc002fkm.2	-	1	238	c.166G>T	c.(166-168)GTG>TTG	p.V56L		NM_003486	NP_003477	Q01650	LAT1_HUMAN	solute carrier family 7 (cationic amino acid	56	Helical; (Potential).				blood coagulation|cell differentiation|cellular amino acid metabolic process|ion transport|leukocyte migration|nervous system development	apical plasma membrane|cytosol|integral to membrane	neutral amino acid transmembrane transporter activity|peptide antigen binding				0				BRCA - Breast invasive adenocarcinoma(80;0.049)		ATGATGGCCACGCCGTTGAGC	0.706													6	46	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578202	7578202	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578202A>T	uc002gim.2	-	6	841	c.647T>A	c.(646-648)GTG>GAG	p.V216E	TP53_uc002gig.1_Missense_Mutation_p.V216E|TP53_uc002gih.2_Missense_Mutation_p.V216E|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.V84E|TP53_uc010cng.1_Missense_Mutation_p.V84E|TP53_uc002gii.1_Missense_Mutation_p.V84E|TP53_uc010cnh.1_Missense_Mutation_p.V216E|TP53_uc010cni.1_Missense_Mutation_p.V216E|TP53_uc002gij.2_Missense_Mutation_p.V216E|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.V123E|TP53_uc002gio.2_Missense_Mutation_p.V84E|TP53_uc010vug.1_Missense_Mutation_p.V177E	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	216	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|V -> M (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.V216M(49)|p.V216del(8)|p.0?(7)|p.V216L(7)|p.V216E(4)|p.V216G(3)|p.V216A(3)|p.V216fs*31(2)|p.H214fs*5(2)|p.V216fs*6(2)|p.K164_P219del(1)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V216fs*5(1)|p.V216_Y220delVVVPY(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.V216fs*28(1)|p.S215_V218>R(1)|p.T211fs*28(1)|p.D207_V216del10(1)|p.S215_V216insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGGCACCACCACACTATGTCG	0.537		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			7	14	---	---	---	---	PASS
PFAS	5198	broad.mit.edu	37	17	8167591	8167591	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8167591C>A	uc002gkr.2	+	16	1994	c.1853C>A	c.(1852-1854)CCG>CAG	p.P618Q	PFAS_uc010vuv.1_Missense_Mutation_p.P194Q|PFAS_uc010cnw.1_Missense_Mutation_p.P118Q|PFAS_uc002gks.2_5'Flank	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	618					'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GATGCCCCCCCGACACCCCTG	0.602													3	15	---	---	---	---	PASS
PFAS	5198	broad.mit.edu	37	17	8170927	8170927	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8170927G>A	uc002gkr.2	+	26	3467	c.3326G>A	c.(3325-3327)CGT>CAT	p.R1109H	PFAS_uc010vuv.1_Missense_Mutation_p.R685H|PFAS_uc002gks.2_Missense_Mutation_p.R188H	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	1109	Glutamine amidotransferase type-1.				'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GACACTTTCCGTGGCGTGGCC	0.627													19	40	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10293781	10293781	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10293781C>A	uc002gmm.2	-	40	5899	c.5804G>T	c.(5803-5805)AGT>ATT	p.S1935I	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1935	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						TTACTCTGCACTGATTTTTGT	0.473									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				18	74	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10315780	10315780	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10315780C>A	uc002gmm.2	-	14	1418	c.1323G>T	c.(1321-1323)TGG>TGT	p.W441C	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	441	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						GGGTGACCATCCACAGGAACA	0.493									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				52	106	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10433009	10433009	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10433009T>C	uc010coi.2	-	24	3117	c.2989A>G	c.(2989-2991)AAG>GAG	p.K997E	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.K997E|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	997	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TTGGTCAGCTTAGCAATGGTT	0.498													37	66	---	---	---	---	PASS
CCDC144A	9720	broad.mit.edu	37	17	16593711	16593711	+	5'UTR	SNP	A	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16593711A>T	uc002gqk.1	+	1						NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A												0						GTAGCTCGCTACTGATGGCCT	0.637													3	1	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18044424	18044424	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18044424C>A	uc010vxh.1	+	21	5836	c.5498C>A	c.(5497-5499)CCA>CAA	p.P1833Q		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	1833	Myosin head-like.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					GAGGGATTTCCAGTGCGCCTG	0.547											OREG0024223	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	28	---	---	---	---	PASS
KRT14	3861	broad.mit.edu	37	17	39740083	39740083	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39740083C>A	uc002hxf.1	-	4	917	c.856G>T	c.(856-858)GAG>TAG	p.E286*	JUP_uc010wfs.1_Intron|KRT14_uc010cxp.1_Nonsense_Mutation_p.E286*	NM_000526	NP_000517	P02533	K1C14_HUMAN	keratin 14	286	Rod.|Coil 2.				epidermis development|hemidesmosome assembly|intermediate filament bundle assembly	cytosol|keratin filament|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.000307)				TCACGCATCTCGTTCAGAATG	0.562													6	150	---	---	---	---	PASS
B4GALNT2	124872	broad.mit.edu	37	17	47241536	47241536	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47241536G>T	uc002ion.2	+	8	1092	c.1033G>T	c.(1033-1035)GAG>TAG	p.E345*	B4GALNT2_uc010wlt.1_Nonsense_Mutation_p.E259*|B4GALNT2_uc010wlu.1_Nonsense_Mutation_p.E285*	NM_153446	NP_703147	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	345	Lumenal (Potential).				lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity			large_intestine(1)|ovary(1)	2			all cancers(6;0.000316)			GAGTATTCGAGAGTATTACCC	0.483													6	202	---	---	---	---	PASS
ANKFN1	162282	broad.mit.edu	37	17	54451996	54451996	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54451996G>T	uc002iun.1	+	7	875	c.840G>T	c.(838-840)ATG>ATT	p.M280I		NM_153228	NP_694960	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain	280	Fibronectin type-III.									large_intestine(1)|ovary(1)	2						TCTGTCTCATGGTAACCAGCA	0.468													7	167	---	---	---	---	PASS
TRIM37	4591	broad.mit.edu	37	17	57109409	57109409	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57109409C>G	uc002iwy.3	-	18	2240	c.1796G>C	c.(1795-1797)AGA>ACA	p.R599T	TRIM37_uc002iwz.3_Missense_Mutation_p.R599T|TRIM37_uc002ixa.3_Missense_Mutation_p.R477T|TRIM37_uc010woc.1_Missense_Mutation_p.R565T	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein	599						perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					ATGTGTTCTTCTTGATATTCT	0.363									Mulibrey_Nanism				24	99	---	---	---	---	PASS
APPBP2	10513	broad.mit.edu	37	17	58556552	58556552	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58556552C>A	uc002iys.1	-	4	748	c.460G>T	c.(460-462)GAT>TAT	p.D154Y	APPBP2_uc010ddl.1_Missense_Mutation_p.D83Y	NM_006380	NP_006371	Q92624	APBP2_HUMAN	amyloid beta precursor protein-binding protein	154					intracellular protein transport	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|nucleus	microtubule motor activity|protein binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			AGCATCTCATCGTGTAGAGTA	0.393													4	67	---	---	---	---	PASS
EFCAB3	146779	broad.mit.edu	37	17	60460380	60460380	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60460380C>G	uc002izu.1	+	2	118	c.40C>G	c.(40-42)CCT>GCT	p.P14A	EFCAB3_uc010wpc.1_Missense_Mutation_p.P66A	NM_173503	NP_775774	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3 isoform b	14							calcium ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			TAAGCTGAATCCTCTAACAAA	0.299													4	71	---	---	---	---	PASS
MGAT5B	146664	broad.mit.edu	37	17	74921168	74921168	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74921168C>G	uc002jti.2	+	8	1282	c.1179C>G	c.(1177-1179)TTC>TTG	p.F393L	MGAT5B_uc002jth.2_Missense_Mutation_p.F382L	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN	N-acetylglucosaminyltranferase VB isoform 2	382	Lumenal (Potential).					Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3						GACTCTCCTTCAAGAAGTACC	0.657													9	65	---	---	---	---	PASS
USP36	57602	broad.mit.edu	37	17	76831437	76831437	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76831437T>C	uc002jvz.1	-	4	725	c.400A>G	c.(400-402)AAT>GAT	p.N134D	USP36_uc002jwa.1_Missense_Mutation_p.N134D|USP36_uc002jwd.1_Missense_Mutation_p.N134D	NM_025090	NP_079366	Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	134					ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			ATGGTGGCATTGAGAAAGCAG	0.587													16	63	---	---	---	---	PASS
SPIRE1	56907	broad.mit.edu	37	18	12463419	12463419	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12463419G>T	uc002kre.2	-	12	1616	c.1569C>A	c.(1567-1569)TCC>TCA	p.S523S	SPIRE1_uc002krc.2_RNA|SPIRE1_uc010wzw.1_Silent_p.S389S|SPIRE1_uc010wzx.1_Silent_p.S312S|SPIRE1_uc010wzy.1_Silent_p.S509S	NM_001128626	NP_001122098	Q08AE8	SPIR1_HUMAN	spire homolog 1 isoform a	523						cytoskeleton|perinuclear region of cytoplasm	actin binding				0						CCTTTTCAATGGAATGTCGTC	0.473													4	42	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21424984	21424984	+	Silent	SNP	A	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21424984A>G	uc002kuq.2	+	30	3701	c.3615A>G	c.(3613-3615)CTA>CTG	p.L1205L	LAMA3_uc002kur.2_Silent_p.L1205L	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	1205	Domain IV 1 (domain IV B).				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TCCGTGTTCTAGTGGTGCCTG	0.348													9	31	---	---	---	---	PASS
CXXC1	30827	broad.mit.edu	37	18	47812290	47812290	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47812290C>G	uc002leq.3	-	5	1201	c.468G>C	c.(466-468)CAG>CAC	p.Q156H	CXXC1_uc002lep.3_Missense_Mutation_p.Q13H|CXXC1_uc002ler.3_Missense_Mutation_p.Q156H|CXXC1_uc010doy.2_Missense_Mutation_p.Q156H|CXXC1_uc002les.2_Missense_Mutation_p.Q156H	NM_014593	NP_055408	Q9P0U4	CXXC1_HUMAN	CXXC finger 1 (PHD domain) isoform 2	156					histone H3-K4 methylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck|Set1C/COMPASS complex	protein binding|unmethylated CpG binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						gctgctgctgctggtgatgct	0.468													3	19	---	---	---	---	PASS
ATP8B1	5205	broad.mit.edu	37	18	55361814	55361814	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55361814C>T	uc002lgw.2	-	10	1029	c.1029G>A	c.(1027-1029)ACG>ACA	p.T343T	uc002lgv.1_Intron	NM_005603	NP_005594	O43520	AT8B1_HUMAN	ATPase, class I, type 8B, member 1	343	Helical; (Potential).				ATP biosynthetic process|bile acid and bile salt transport|negative regulation of transcription, DNA-dependent	apical plasma membrane|integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			breast(5)|ovary(2)|central_nervous_system(2)|lung(1)	10		Colorectal(73;0.229)				AAATAAATACCGTGTAAACCA	0.303									Byler_disease				4	18	---	---	---	---	PASS
SOCS6	9306	broad.mit.edu	37	18	67992780	67992780	+	Silent	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67992780C>A	uc002lkr.1	+	2	1192	c.876C>A	c.(874-876)ACC>ACA	p.T292T	SOCS6_uc010dqq.2_Silent_p.T292T	NM_004232	NP_004223	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	292					defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)|lung(1)	2		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				TGATTGGCACCACGGGAGTCA	0.542													5	88	---	---	---	---	PASS
PLIN4	729359	broad.mit.edu	37	19	4512463	4512463	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4512463G>T	uc002mar.1	-	3	1467	c.1467C>A	c.(1465-1467)TCC>TCA	p.S489S	PLIN4_uc010dub.1_5'Flank	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	489	27 X 33 AA approximate tandem repeat.|12.					lipid particle|plasma membrane					0						TGAGCCCAGTGGACACAGCAT	0.617													27	103	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9072615	9072615	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9072615T>C	uc002mkp.2	-	3	15035	c.14831A>G	c.(14830-14832)GAT>GGT	p.D4944G		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	4946	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGTGGACTGATCAGGGCCAGG	0.498													16	100	---	---	---	---	PASS
RGL3	57139	broad.mit.edu	37	19	11515847	11515847	+	Silent	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11515847G>C	uc002mrp.2	-	9	1225	c.1161C>G	c.(1159-1161)CTC>CTG	p.L387L	RGL3_uc002mrn.2_Silent_p.L151L|RGL3_uc002mrm.2_Silent_p.L151L|RGL3_uc002mro.2_Silent_p.L387L	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation	387	Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						CTCTGCTGCTGAGGTGGTTGT	0.542													20	97	---	---	---	---	PASS
RGL3	57139	broad.mit.edu	37	19	11515889	11515889	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11515889G>C	uc002mrp.2	-	9	1183	c.1119C>G	c.(1117-1119)TTC>TTG	p.F373L	RGL3_uc002mrn.2_Missense_Mutation_p.F137L|RGL3_uc002mrm.2_Missense_Mutation_p.F137L|RGL3_uc002mro.2_Missense_Mutation_p.F373L	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation	373	Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						AAAGTTTCCTGAAAGTAGATA	0.547													16	80	---	---	---	---	PASS
RGL3	57139	broad.mit.edu	37	19	11515910	11515910	+	Intron	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11515910G>T	uc002mrp.2	-						RGL3_uc002mrn.2_Intron|RGL3_uc002mrm.2_Intron|RGL3_uc002mro.2_Intron	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						GCGGTTCCCTGGAAGGACAGG	0.567													17	61	---	---	---	---	PASS
ZNF564	163050	broad.mit.edu	37	19	12638156	12638156	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12638156G>A	uc002mty.2	-	4	976	c.766C>T	c.(766-768)CAG>TAG	p.Q256*	ZNF709_uc002mtx.3_Intron	NM_144976	NP_659413	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	256	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CCACATTCCTGACATTTATAA	0.413													16	70	---	---	---	---	PASS
MAST1	22983	broad.mit.edu	37	19	12969501	12969501	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12969501C>T	uc002mvm.2	+	12	1442	c.1314C>T	c.(1312-1314)TTC>TTT	p.F438F	MAST1_uc002mvk.2_Silent_p.F434F	NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase	438	Protein kinase.				cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						TCGGCATGTTCTGCTCCTTTG	0.587													10	31	---	---	---	---	PASS
MAP1S	55201	broad.mit.edu	37	19	17835935	17835935	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17835935G>T	uc002nhe.1	+	4	390	c.381G>T	c.(379-381)GAG>GAT	p.E127D	MAP1S_uc010eaz.1_RNA|MAP1S_uc010eba.1_Missense_Mutation_p.E127D|MAP1S_uc002nhf.1_Intron|MAP1S_uc010xpv.1_Missense_Mutation_p.E101D	NM_018174	NP_060644	Q66K74	MAP1S_HUMAN	BPY2 interacting protein 1	127	Necessary for the microtubule-organizing center localization.				apoptosis|brain development|microtubule bundle formation|mitochondrion transport along microtubule|neuron projection morphogenesis	cytosol|dendrite|microtubule|neuronal cell body|nucleus|perinuclear region of cytoplasm|spindle|synapse	actin filament binding|beta-tubulin binding|DNA binding|microtubule binding			central_nervous_system(1)	1						AGACGGGGGAGCTGCTGCTAC	0.617													24	47	---	---	---	---	PASS
ZNF714	148206	broad.mit.edu	37	19	21299686	21299686	+	Silent	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21299686G>A	uc002npo.3	+	5	576	c.216G>A	c.(214-216)CTG>CTA	p.L72L	ZNF714_uc002npl.2_5'UTR|ZNF714_uc010ecp.1_Silent_p.L24L|ZNF714_uc002npn.2_RNA	NM_182515	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	72					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAGTGATACTGAGAAGACATG	0.353													8	53	---	---	---	---	PASS
ATP4A	495	broad.mit.edu	37	19	36050025	36050025	+	Silent	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36050025C>A	uc002oal.1	-	8	1154	c.1125G>T	c.(1123-1125)GTG>GTT	p.V375V	ATP4A_uc010eee.1_5'Flank	NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	375	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	CCAATGTCTCCACCGCCTCCA	0.597													7	260	---	---	---	---	PASS
LGALS4	3960	broad.mit.edu	37	19	39297206	39297206	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39297206C>T	uc002ojg.2	-	4	583	c.369G>A	c.(367-369)GAG>GAA	p.E123E	LGALS4_uc010xuj.1_Silent_p.E123E	NM_006149	NP_006140	P56470	LEG4_HUMAN	galectin-4	123	Galectin 1.				cell adhesion	cytosol|plasma membrane	sugar binding			ovary(1)|skin(1)	2	all_cancers(60;1.02e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			GGTGCCCGTACTCATAGAAGG	0.552													28	22	---	---	---	---	PASS
IRGC	56269	broad.mit.edu	37	19	44223137	44223137	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44223137C>G	uc002oxh.2	+	2	574	c.427C>G	c.(427-429)CGC>GGC	p.R143G		NM_019612	NP_062558	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	143						membrane	GTP binding|hydrolase activity, acting on acid anhydrides			ovary(1)|central_nervous_system(1)|skin(1)	3		Prostate(69;0.0435)				GGTCTCCCCCCGCCGCTGCGG	0.652													3	3	---	---	---	---	PASS
DHX34	9704	broad.mit.edu	37	19	47883023	47883023	+	Silent	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47883023G>T	uc010xyn.1	+	14	3104	c.2763G>T	c.(2761-2763)GTG>GTT	p.V921V	DHX34_uc010xyo.1_Silent_p.V50V	NM_014681	NP_055496	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	921						intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CCCGCCTGGTGGCCGATGGCT	0.632													4	38	---	---	---	---	PASS
SLC6A16	28968	broad.mit.edu	37	19	49796648	49796648	+	Intron	SNP	A	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49796648A>C	uc002pmz.2	-						SLC6A16_uc002pna.2_Intron	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16							integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		CACTGGAGAAAACATGAGATC	0.498													10	28	---	---	---	---	PASS
CCDC155	147872	broad.mit.edu	37	19	49910146	49910146	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49910146G>A	uc002pnm.1	+	10	976	c.802G>A	c.(802-804)GGG>AGG	p.G268R	CCDC155_uc010emx.1_Missense_Mutation_p.G241R	NM_144688	NP_653289	Q8N6L0	CC155_HUMAN	coiled-coil domain containing 155	268	Potential.					integral to membrane	calcium ion binding			ovary(1)|central_nervous_system(1)	2						CTTCTAGAACGGGAAGCTGCT	0.398													5	19	---	---	---	---	PASS
KLK1	3816	broad.mit.edu	37	19	51323551	51323551	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51323551G>T	uc002ptk.1	-	3	394	c.355C>A	c.(355-357)CAC>AAC	p.H119N	KLK1_uc010ycg.1_RNA	NM_002257	NP_002248	P06870	KLK1_HUMAN	kallikrein 1 preproprotein	119	Peptidase S1.				proteolysis	nucleus	serine-type endopeptidase activity				0		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ATGAGGTCGTGGCTGTAGTCC	0.587													5	77	---	---	---	---	PASS
ZNF614	80110	broad.mit.edu	37	19	52520455	52520455	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52520455C>G	uc002pyj.2	-	5	798	c.396G>C	c.(394-396)TTG>TTC	p.L132F	ZNF614_uc002pyi.3_Missense_Mutation_p.L132F|ZNF614_uc010epj.2_5'UTR	NM_025040	NP_079316	Q8N883	ZN614_HUMAN	zinc finger protein 614	132					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	5		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TTTTTCTGTACAAGTCAAATG	0.338													7	20	---	---	---	---	PASS
ZNF765	91661	broad.mit.edu	37	19	53912075	53912075	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53912075C>A	uc010ydx.1	+	6	1594	c.1267C>A	c.(1267-1269)CAG>AAG	p.Q423K	ZNF765_uc002qbm.2_Missense_Mutation_p.Q423K|ZNF765_uc002qbn.2_Intron	NM_001040185	NP_001035275	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	423	C2H2-type 8; atypical.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		CTTCAATCAGCAGTTAACCCT	0.373													53	67	---	---	---	---	PASS
LILRA4	23547	broad.mit.edu	37	19	54849797	54849797	+	Silent	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54849797C>A	uc002qfj.2	-	3	282	c.225G>T	c.(223-225)CTG>CTT	p.L75L	LILRA4_uc002qfi.2_Silent_p.L9L	NM_012276	NP_036408	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor subfamily	75	Ig-like C2-type 1.|Extracellular (Potential).					integral to membrane	receptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		TTTCAGACTCCAGTGTTTTTA	0.517													6	186	---	---	---	---	PASS
LILRA2	11027	broad.mit.edu	37	19	55087554	55087554	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55087554C>A	uc002qgg.3	+	6	1322	c.1233C>A	c.(1231-1233)GAC>GAA	p.D411E	LILRA2_uc010ern.2_Missense_Mutation_p.D411E|LILRA2_uc002qgf.2_Missense_Mutation_p.D411E|LILRA2_uc010yfe.1_Missense_Mutation_p.D411E|LILRA2_uc010yff.1_Missense_Mutation_p.D399E|LILRA2_uc010ero.2_Missense_Mutation_p.D399E|LILRA2_uc010yfg.1_Intron	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	411	Ig-like C2-type 4.|Extracellular (Potential).				defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		TCCCCAGTGACCCCCTGGAGC	0.612													113	120	---	---	---	---	PASS
BRSK1	84446	broad.mit.edu	37	19	55813535	55813535	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55813535C>T	uc002qkg.2	+	9	1133	c.856C>T	c.(856-858)CTA>TTA	p.L286L	BRSK1_uc002qkf.2_Silent_p.L302L|BRSK1_uc002qkh.2_5'UTR	NM_032430	NP_115806	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	286					establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		TCCTTGGTACCTGTGAGTATG	0.562											OREG0025680	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	101	374	---	---	---	---	PASS
NLRP11	204801	broad.mit.edu	37	19	56297101	56297101	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56297101G>T	uc010ygf.1	-	12	3703	c.2992C>A	c.(2992-2994)CAG>AAG	p.Q998K	NLRP11_uc002qlz.2_Missense_Mutation_p.Q845K|NLRP11_uc002qmb.2_Missense_Mutation_p.Q899K|NLRP11_uc002qmc.2_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	998							ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		GAACCTGGCTGAGAAGCAGGT	0.393													5	124	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57640914	57640914	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57640914G>A	uc002qny.2	+	4	1227	c.871G>A	c.(871-873)GGA>AGA	p.G291R		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	291					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CCCCAATTTGGGAAACACCTG	0.468													19	41	---	---	---	---	PASS
IDH3B	3420	broad.mit.edu	37	20	2644303	2644303	+	Intron	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2644303C>G	uc002wgp.2	-						IDH3B_uc002wgq.2_Intron|IDH3B_uc002wgr.2_Intron|IDH3B_uc010zpz.1_Intron	NM_006899	NP_008830	O43837	IDH3B_HUMAN	isocitrate dehydrogenase 3, beta subunit isoform						isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	electron carrier activity|isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0					NADH(DB00157)	CGAGGCCACTCACCTTGAACA	0.592													10	31	---	---	---	---	PASS
SLC23A2	9962	broad.mit.edu	37	20	4866555	4866555	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4866555C>A	uc002wlg.1	-	7	858	c.483G>T	c.(481-483)AGG>AGT	p.R161S	SLC23A2_uc010zqr.1_Intron|SLC23A2_uc002wlh.1_Missense_Mutation_p.R161S|SLC23A2_uc002wli.2_Missense_Mutation_p.R160S	NM_005116	NP_005107	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase	161					L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2						ACAGGGGTAACCTAAAAGAAA	0.443													9	29	---	---	---	---	PASS
SEC23B	10483	broad.mit.edu	37	20	18529360	18529360	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18529360C>T	uc002wqz.1	+	16	2294	c.1851C>T	c.(1849-1851)TCC>TCT	p.S617S	SEC23B_uc002wra.1_Silent_p.S617S|SEC23B_uc002wrb.1_Silent_p.S617S|SEC23B_uc010zsb.1_Silent_p.S599S|SEC23B_uc002wrc.1_Silent_p.S617S	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B	617					ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						TGACCCAGTCCCTCATCATGA	0.473													5	41	---	---	---	---	PASS
PPDPF	79144	broad.mit.edu	37	20	62153023	62153023	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62153023C>G	uc002yff.2	+	4	276	c.136C>G	c.(136-138)CTC>GTC	p.L46V		NM_024299	NP_077275	Q9H3Y8	PPDPF_HUMAN	pancreatic progenitor cell differentiation and	46					cell differentiation|multicellular organismal development						0						TCTCTCAGGTCTCCCCAAGGC	0.632													5	39	---	---	---	---	PASS
CLDN8	9073	broad.mit.edu	37	21	31588225	31588225	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31588225C>G	uc002ynu.1	-	1	94	c.19G>C	c.(19-21)GAA>CAA	p.E7Q		NM_199328	NP_955360	P56748	CLD8_HUMAN	claudin 8	7	Cytoplasmic (Potential).				calcium-independent cell-cell adhesion	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity				0						CCAGCGATTTCTAAGGCATGG	0.512													10	37	---	---	---	---	PASS
KRTAP19-3	337970	broad.mit.edu	37	21	31864183	31864183	+	Silent	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31864183G>A	uc002yog.1	-	1	93	c.93C>T	c.(91-93)AGC>AGT	p.S31S		NM_181609	NP_853640	Q7Z4W3	KR193_HUMAN	keratin associated protein 19-3	31						intermediate filament					0						GTCTGCGGAAGCTGCCACATC	0.577													39	119	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47754536	47754536	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47754536C>A	uc002zji.3	+	3	600	c.493C>A	c.(493-495)CCA>ACA	p.P165T	PCNT_uc002zjj.2_Missense_Mutation_p.P47T|PCNT_uc010gqk.1_RNA	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	165					cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					CAGTGACCACCCACCAGAACA	0.547													5	80	---	---	---	---	PASS
SLC25A18	83733	broad.mit.edu	37	22	18064177	18064177	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18064177G>A	uc002zmp.1	+	5	691	c.197G>A	c.(196-198)CGA>CAA	p.R66Q	SLC25A18_uc010gqx.2_Missense_Mutation_p.R66Q|SLC25A18_uc002zmq.1_Missense_Mutation_p.R66Q	NM_031481	NP_113669	Q9H1K4	GHC2_HUMAN	solute carrier	66	Solcar 1.|Helical; Name=2; (Potential).					integral to membrane|mitochondrial inner membrane	binding|symporter activity				0				Lung(27;0.124)	L-Glutamic Acid(DB00142)	GGCATGTACCGAGGTGGGCTT	0.637													20	45	---	---	---	---	PASS
TCN2	6948	broad.mit.edu	37	22	31003382	31003382	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31003382G>T	uc003aip.1	+	1	222	c.64G>T	c.(64-66)GAA>TAA	p.E22*	PES1_uc003ain.1_5'Flank|PES1_uc003aio.1_5'Flank|TCN2_uc003aiq.1_Nonsense_Mutation_p.E22*|TCN2_uc003air.1_Nonsense_Mutation_p.E22*	NM_000355	NP_000346	P20062	TCO2_HUMAN	transcobalamin II precursor	22					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGAGATGTGTGGTGAGTAACT	0.542													5	29	---	---	---	---	PASS
DEPDC5	9681	broad.mit.edu	37	22	32241209	32241209	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32241209G>T	uc003als.2	+	30	3122	c.2980G>T	c.(2980-2982)GAT>TAT	p.D994Y	DEPDC5_uc011als.1_Missense_Mutation_p.D925Y|DEPDC5_uc011alu.1_Missense_Mutation_p.D1003Y|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.D994Y|DEPDC5_uc003alu.2_Missense_Mutation_p.D443Y|DEPDC5_uc003alv.2_RNA|DEPDC5_uc011alw.1_Missense_Mutation_p.D324Y|DEPDC5_uc003alw.2_Missense_Mutation_p.D292Y|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_5'UTR	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	994					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						GCATCGCTCGGATCGCATGAT	0.607													8	17	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32477933	32477933	+	Silent	SNP	A	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32477933A>G	uc003amc.2	+	6	790	c.558A>G	c.(556-558)GCA>GCG	p.A186A	SLC5A1_uc011alz.1_Silent_p.A59A	NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	186	Helical; (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						TCTTATTGGCAATCACTGCCC	0.478													12	67	---	---	---	---	PASS
CYTH4	27128	broad.mit.edu	37	22	37707538	37707538	+	Silent	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37707538G>A	uc003arf.2	+	11	1043	c.927G>A	c.(925-927)TCG>TCA	p.S309S	CYTH4_uc011amw.1_Silent_p.S252S|CYTH4_uc010gxe.2_Intron	NM_013385	NP_037517	Q9UIA0	CYH4_HUMAN	cytohesin 4	309	PH.				regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						AGAACCTCTCGGTGCAGAAGG	0.562													11	32	---	---	---	---	PASS
TUBGCP6	85378	broad.mit.edu	37	22	50662625	50662625	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50662625G>A	uc003bkb.1	-	13	2727	c.2215C>T	c.(2215-2217)CGA>TGA	p.R739*	TUBGCP6_uc003bka.1_5'Flank|TUBGCP6_uc010har.1_Nonsense_Mutation_p.R739*|TUBGCP6_uc010has.1_RNA|TUBGCP6_uc010hat.1_5'UTR|TUBGCP6_uc003bkd.1_Nonsense_Mutation_p.R93*	NM_020461	NP_065194	Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	739					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TCCCTGTCTCGGAGTTCACGG	0.627													12	33	---	---	---	---	PASS
CSF2RA	1438	broad.mit.edu	37	X	1424405	1424405	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1424405T>A	uc010nct.2	+	13	1432	c.1110T>A	c.(1108-1110)CAT>CAA	p.H370Q	CSF2RA_uc011mhb.1_Missense_Mutation_p.H370Q|CSF2RA_uc004cpq.2_3'UTR|CSF2RA_uc004cpn.2_Missense_Mutation_p.H370Q|CSF2RA_uc004cpo.2_Missense_Mutation_p.H370Q|CSF2RA_uc010ncu.2_RNA|CSF2RA_uc011mhc.1_Missense_Mutation_p.H237Q|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Missense_Mutation_p.H404Q|CSF2RA_uc004cpr.2_3'UTR	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain	370	Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ATGATAACCATGAGGTGGAAG	0.552													7	197	---	---	---	---	PASS
NLGN4X	57502	broad.mit.edu	37	X	5811256	5811256	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5811256G>C	uc010ndh.2	-	6	2554	c.2053C>G	c.(2053-2055)CTC>GTC	p.L685V	NLGN4X_uc004crp.2_Missense_Mutation_p.L705V|NLGN4X_uc004crq.2_Missense_Mutation_p.L685V|NLGN4X_uc010ndi.2_Missense_Mutation_p.L722V|NLGN4X_uc004crr.2_Missense_Mutation_p.L685V|NLGN4X_uc010ndj.2_Missense_Mutation_p.L685V	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor	685	Helical; (Potential).				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4						AGGAAGAGGAGCGACGCCCCG	0.532													44	23	---	---	---	---	PASS
CXorf22	170063	broad.mit.edu	37	X	35944122	35944122	+	Intron	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35944122C>T	uc004ddj.2	+						CXorf22_uc010ngv.2_Intron	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063											large_intestine(1)|lung(1)|ovary(1)	3						GACTCTCTTTCTCCCACTGAA	0.269													12	6	---	---	---	---	PASS
ZNF41	7592	broad.mit.edu	37	X	47308087	47308087	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47308087C>A	uc004dhs.3	-	4	1275	c.1208G>T	c.(1207-1209)GGA>GTA	p.G403V	ZNF41_uc004dhu.3_Missense_Mutation_p.G395V|ZNF41_uc004dht.3_Missense_Mutation_p.G275V|ZNF41_uc004dhv.3_Missense_Mutation_p.G371V|ZNF41_uc004dhw.3_Missense_Mutation_p.G363V|ZNF41_uc004dhy.3_Missense_Mutation_p.G361V|ZNF41_uc004dhx.3_Missense_Mutation_p.G361V|ZNF41_uc011mlm.1_Missense_Mutation_p.G275V	NM_153380	NP_700359	P51814	ZNF41_HUMAN	zinc finger protein 41	403	C2H2-type 4.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3		all_lung(315;0.000129)				AAAGGCTTTTCCACATTCACT	0.403													8	22	---	---	---	---	PASS
ZNF41	7592	broad.mit.edu	37	X	47308088	47308088	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47308088C>A	uc004dhs.3	-	4	1274	c.1207G>T	c.(1207-1209)GGA>TGA	p.G403*	ZNF41_uc004dhu.3_Nonsense_Mutation_p.G395*|ZNF41_uc004dht.3_Nonsense_Mutation_p.G275*|ZNF41_uc004dhv.3_Nonsense_Mutation_p.G371*|ZNF41_uc004dhw.3_Nonsense_Mutation_p.G363*|ZNF41_uc004dhy.3_Nonsense_Mutation_p.G361*|ZNF41_uc004dhx.3_Nonsense_Mutation_p.G361*|ZNF41_uc011mlm.1_Nonsense_Mutation_p.G275*	NM_153380	NP_700359	P51814	ZNF41_HUMAN	zinc finger protein 41	403	C2H2-type 4.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3		all_lung(315;0.000129)				AAGGCTTTTCCACATTCACTG	0.398													8	22	---	---	---	---	PASS
XAGE3	170626	broad.mit.edu	37	X	52893869	52893869	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52893869C>G	uc004dre.2	-	4	308	c.248G>C	c.(247-249)GGA>GCA	p.G83A	XAGE3_uc004drf.2_Missense_Mutation_p.G83A	NM_130776	NP_570132	Q8WTP9	GAGD4_HUMAN	XAGE-3 protein	83											0						AGGACCATTTCCACATTCACC	0.433													18	28	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53231158	53231158	+	Intron	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53231158G>C	uc004drz.2	-						KDM5C_uc011moc.1_Intron|KDM5C_uc011mod.1_Intron|KDM5C_uc004dsa.2_Intron	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						CGGACAACCTGAAGAACACAA	0.483			N|F|S		clear cell renal carcinoma								14	24	---	---	---	---	PASS
FAM123B	139285	broad.mit.edu	37	X	63412922	63412922	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63412922C>A	uc004dvo.2	-	2	518	c.245G>T	c.(244-246)GGG>GTG	p.G82V		NM_152424	NP_689637	Q5JTC6	F123B_HUMAN	family with sequence similarity 123B	82					Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		p.0?(40)		kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						GCTGCCTTTCCCAGAACCTTT	0.527													11	17	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76889176	76889176	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76889176G>C	uc004ecp.3	-	18	5066	c.4834C>G	c.(4834-4836)CTT>GTT	p.L1612V	ATRX_uc004ecq.3_Missense_Mutation_p.L1574V|ATRX_uc004eco.3_Missense_Mutation_p.L1397V	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1612	Helicase ATP-binding.				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TCACACAAAAGAACTGTATGA	0.328			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						11	10	---	---	---	---	PASS
TBX22	50945	broad.mit.edu	37	X	79282782	79282782	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79282782C>G	uc010nmg.1	+	7	960	c.826C>G	c.(826-828)CCT>GCT	p.P276A	TBX22_uc004edi.1_Missense_Mutation_p.P156A|TBX22_uc004edj.1_Missense_Mutation_p.P276A	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN	T-box 22 isoform 1	276	T-box.				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						AGAAAGAAATCCTTTTGCTAA	0.318													3	10	---	---	---	---	PASS
BRWD3	254065	broad.mit.edu	37	X	79971739	79971739	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79971739C>T	uc004edt.2	-	20	2505	c.2242G>A	c.(2242-2244)GAA>AAA	p.E748K	BRWD3_uc010nmi.1_RNA|BRWD3_uc004edo.2_Missense_Mutation_p.E344K|BRWD3_uc004edp.2_Missense_Mutation_p.E577K|BRWD3_uc004edq.2_Missense_Mutation_p.E344K|BRWD3_uc010nmj.1_Missense_Mutation_p.E344K|BRWD3_uc004edr.2_Missense_Mutation_p.E418K|BRWD3_uc004eds.2_Missense_Mutation_p.E344K|BRWD3_uc004edu.2_Missense_Mutation_p.E418K|BRWD3_uc004edv.2_Missense_Mutation_p.E344K|BRWD3_uc004edw.2_Missense_Mutation_p.E344K|BRWD3_uc004edx.2_Missense_Mutation_p.E344K|BRWD3_uc004edy.2_Missense_Mutation_p.E344K|BRWD3_uc004edz.2_Missense_Mutation_p.E418K|BRWD3_uc004eea.2_Missense_Mutation_p.E418K|BRWD3_uc004eeb.2_Missense_Mutation_p.E344K	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	748										ovary(4)	4						GTTCGACATTCTTCCTGTACC	0.294													12	20	---	---	---	---	PASS
CYLC1	1538	broad.mit.edu	37	X	83128726	83128726	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83128726C>G	uc004eei.1	+	4	1031	c.1010C>G	c.(1009-1011)TCT>TGT	p.S337C	CYLC1_uc004eeh.1_Missense_Mutation_p.S336C	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	337	2.				cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5						GATGCTGAATCTGGAGACTCa	0.234													10	12	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105152885	105152885	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105152885C>A	uc004emd.2	+	13	1555	c.1252C>A	c.(1252-1254)CCA>ACA	p.P418T	NRK_uc010npc.1_Missense_Mutation_p.P86T	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	418	Gln-rich.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						GGTATTCATGCCACTGCAGGC	0.597										HNSCC(51;0.14)			10	15	---	---	---	---	PASS
RGAG1	57529	broad.mit.edu	37	X	109694758	109694758	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109694758G>T	uc004eor.1	+	3	1159	c.913G>T	c.(913-915)GGA>TGA	p.G305*	RGAG1_uc011msr.1_Nonsense_Mutation_p.G305*	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	305										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						TCTAGACTCTGGAATAATGTC	0.478													6	113	---	---	---	---	PASS
AMOT	154796	broad.mit.edu	37	X	112058618	112058618	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:112058618C>A	uc004epr.2	-	2	1360	c.1360G>T	c.(1360-1362)GGA>TGA	p.G454*	AMOT_uc004eps.2_Nonsense_Mutation_p.G45*|AMOT_uc004ept.1_Nonsense_Mutation_p.G454*	NM_001113490	NP_001106962	Q4VCS5	AMOT_HUMAN	angiomotin isoform 1	454	Potential.				actin cytoskeleton organization|cell-cell junction assembly|negative regulation of angiogenesis|negative regulation of vascular permeability|positive regulation of blood vessel endothelial cell migration|positive regulation of cell size|positive regulation of stress fiber assembly|regulation of cell migration	actin filament|cell surface|cytoplasm|endocytic vesicle|external side of plasma membrane|integral to membrane|lamellipodium|ruffle|stress fiber|tight junction|tight junction	angiostatin binding|protein binding|receptor activity			ovary(1)	1						TCATAGCATCCTTCCAACTCT	0.478													7	164	---	---	---	---	PASS
OPN1LW	5956	broad.mit.edu	37	X	153416411	153416411	+	Silent	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153416411C>T	uc004fjz.3	+	2	429	c.396C>T	c.(394-396)ACC>ACT	p.T132T		NM_020061	NP_064445	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	132	Helical; Name=3; (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGGCTACACCGTCTCCCTGT	0.607													12	17	---	---	---	---	PASS
F8	2157	broad.mit.edu	37	X	154185447	154185447	+	Splice_Site	SNP	C	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154185447C>T	uc004fmt.2	-	11	1709	c.1538_splice	c.e11-1	p.G513_splice		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor						acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TGTTTTACACCTACCCACAAG	0.363													12	10	---	---	---	---	PASS
PRKCZ	5590	broad.mit.edu	37	1	2020671	2020672	+	Intron	INS	-	G	G	rs72502761		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2020671_2020672insG	uc001aiq.2	+						PRKCZ_uc001air.2_Intron|PRKCZ_uc010nyw.1_Intron	NM_002744	NP_002735	Q05513	KPCZ_HUMAN	protein kinase C, zeta isoform 1						anti-apoptosis|intracellular signal transduction|negative regulation of insulin receptor signaling pathway|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein complex assembly|peptidyl-serine phosphorylation|platelet activation	endosome	ATP binding|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(2)	6	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)		TGGCAGACGCCATGAGGAAGGA	0.569													3	3	---	---	---	---	
NPHP4	261734	broad.mit.edu	37	1	6011179	6011179	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6011179delT	uc001alq.1	-						NPHP4_uc001als.1_Intron|NPHP4_uc009vlt.1_Intron|NPHP4_uc001alt.1_Intron	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin						actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		aaagccaagatgtgattagca	0.294													4	2	---	---	---	---	
H6PD	9563	broad.mit.edu	37	1	9299113	9299113	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9299113delT	uc001apt.2	+							NM_004285	NP_004276	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase precursor							endoplasmic reticulum lumen	6-phosphogluconolactonase activity|glucose 1-dehydrogenase|glucose-6-phosphate dehydrogenase activity|NADP binding				0	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)	NADH(DB00157)	aatttaatggttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	9530119	9530119	+	IGR	DEL	G	-	-	rs70979751		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9530119delG								SPSB1 (100531 upstream) : SLC25A33 (69409 downstream)																							cagagagaaaggaaagaaagg	0.000													2	4	---	---	---	---	
CLSTN1	22883	broad.mit.edu	37	1	9806774	9806775	+	Intron	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9806774_9806775insA	uc001aqh.2	-						CLSTN1_uc001aqi.2_Intron|CLSTN1_uc010oag.1_Intron	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN	calsyntenin 1 isoform 1						homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding			skin(1)	1	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		tgtctcaaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
UBE4B	10277	broad.mit.edu	37	1	10171161	10171161	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10171161delC	uc001aqs.3	+						UBE4B_uc001aqr.3_Intron|UBE4B_uc010oai.1_Intron|UBE4B_uc010oaj.1_Intron	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1						apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		aGTCTTTCCACCATATCTATC	0.050													4	2	---	---	---	---	
MTOR	2475	broad.mit.edu	37	1	11307502	11307502	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11307502delG	uc001asd.2	-							NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated						cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						GATTGTTCCTGTGTCTGCTGC	0.393													4	2	---	---	---	---	
PRDM2	7799	broad.mit.edu	37	1	14125941	14125941	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14125941delA	uc001avi.2	+						PRDM2_uc001avg.2_Intron|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	retinoblastoma protein-binding zinc finger							Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		actccatctcaaaaaaaaaaa	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	14664164	14664164	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14664164delG								PRDM2 (512592 upstream) : KAZ (261049 downstream)																							cgatgtgggtggatcacctga	0.100													4	2	---	---	---	---	
KAZ	23254	broad.mit.edu	37	1	15159881	15159882	+	Intron	DEL	GT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15159881_15159882delGT	uc001avm.3	+						KAZ_uc009vog.1_Intron|KAZ_uc010obj.1_Intron	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						gggagcactggtgtgtgtgtgg	0.045													4	2	---	---	---	---	
KAZ	23254	broad.mit.edu	37	1	15405946	15405946	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15405946delT	uc001avm.3	+							NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						TGTTGGCTTATTTTTTTTTTT	0.333													4	2	---	---	---	---	
FBLIM1	54751	broad.mit.edu	37	1	16080642	16080643	+	5'Flank	INS	-	T	T	rs141903369	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16080642_16080643insT	uc001axd.1	+							NM_017556	NP_060026	Q8WUP2	FBLI1_HUMAN	filamin-binding LIM protein-1 isoform a						cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytoskeleton|cytosol|focal adhesion|intracellular membrane-bounded organelle	zinc ion binding			skin(1)	1		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		TCCCACTTGGCtttttttcctt	0.302													3	3	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16917461	16917462	+	Intron	DEL	CT	-	-	rs35460036		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16917461_16917462delCT	uc009vos.1	-						NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CACCAAGGTACTCTCTGCTTTT	0.282													4	2	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16923614	16923615	+	Intron	INS	-	TATC	TATC	rs113590421		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16923614_16923615insTATC	uc009vos.1	-							NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		tgaagtccatttatctattttt	0.035													6	4	---	---	---	---	
ESPNP	284729	broad.mit.edu	37	1	17030903	17030905	+	Intron	DEL	GAG	-	-	rs150669528		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17030903_17030905delGAG	uc001azn.1	-							NR_026567				RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;												0						AGAGATCGACGAGGAGGGGGCCT	0.640													9	4	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17081047	17081048	+	Intron	INS	-	T	T	rs148428698		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17081047_17081048insT	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TCCTCGTCTAATTTTTTTTACA	0.361													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18937824	18937839	+	IGR	DEL	GAAGGAAGGAAGGAAA	-	-	rs71018095	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18937824_18937839delGAAGGAAGGAAGGAAA								KLHDC7A (125285 upstream) : PAX7 (19661 downstream)																							aggaaggaaggaaggaaggaaggaaagaaagaaAAA	0.227													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	22607875	22607875	+	IGR	DEL	G	-	-	rs2860379		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22607875delG								WNT4 (137490 upstream) : ZBTB40 (170469 downstream)																							aaaaaaaaaagaaaagaaaag	0.080													3	3	---	---	---	---	
EPHB2	2048	broad.mit.edu	37	1	23131407	23131407	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23131407delA	uc009vqj.1	+						EPHB2_uc001bge.2_Intron|EPHB2_uc001bgf.2_Intron|EPHB2_uc010odu.1_Intron	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor						axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		ctccctccccatttccttctc	0.259									Hereditary_Prostate_Cancer				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	25408146	25408146	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25408146delG								RUNX3 (116534 upstream) : SYF2 (140621 downstream)																							cctgtgaggtgggtgtcatga	0.249													4	2	---	---	---	---	
STMN1	3925	broad.mit.edu	37	1	26219171	26219172	+	Intron	INS	-	CG	CG			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26219171_26219172insCG	uc010oev.1	-						STMN1_uc001bky.2_5'Flank	NM_001145454	NP_001138926	P16949	STMN1_HUMAN	stathmin 1 isoform b						cell differentiation|intracellular signal transduction|microtubule depolymerization|mitotic spindle organization|nervous system development|response to virus	cytoplasm|microtubule	signal transducer activity|tubulin binding				0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000163)|all_lung(284;0.000234)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.013)|READ - Rectum adenocarcinoma(331;0.0649)		CAAACGCCCCCGGGCCTCTCAT	0.609													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	29721802	29721803	+	IGR	INS	-	CG	CG	rs146786298	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29721802_29721803insCG								PTPRU (68487 upstream) : None (None downstream)																							acacacacacacacacacacac	0.342													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	33910441	33910441	+	IGR	DEL	G	-	-	rs35502730		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33910441delG								PHC2 (13826 upstream) : ZSCAN20 (27791 downstream)																							TTTACTACCAGGGAAAGGTGG	0.199													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	34730386	34730386	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34730386delG								C1orf94 (45657 upstream) : MIR552 (404814 downstream)																							gggagagagtggtgtgattct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	35672050	35672051	+	IGR	DEL	AC	-	-	rs5773497		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35672050_35672051delAC								SFPQ (13307 upstream) : ZMYM4 (62517 downstream)																							gtctcaaaatacacacacacac	0.010													4	2	---	---	---	---	
KIAA0319L	79932	broad.mit.edu	37	1	36017644	36017644	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36017644delA	uc001byx.2	-						KIAA0319L_uc010ohw.1_Intron|KIAA0319L_uc001byz.2_Intron|KIAA0319L_uc010ohx.1_Intron	NM_024874	NP_079150	Q8IZA0	K319L_HUMAN	dyslexia susceptibility 2-like							cytoplasmic vesicle part|integral to membrane	protein binding			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GGTACTGGGTAAAAAAAAAAA	0.224													3	4	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39561927	39561927	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39561927delG	uc010ois.1	+						MACF1_uc010oir.1_Intron	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ggtgaaaggagggcaggaggg	0.000													4	2	---	---	---	---	
HIVEP3	59269	broad.mit.edu	37	1	42011367	42011369	+	Intron	DEL	CAC	-	-	rs72324958		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42011367_42011369delCAC	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001cgy.2_Intron	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				tcaccaccatcaccaccaccacc	0.000													4	3	---	---	---	---	
NSUN4	387338	broad.mit.edu	37	1	46806275	46806276	+	5'Flank	DEL	AG	-	-	rs75181710		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46806275_46806276delAG	uc001cpr.1	+						NSUN4_uc010omc.1_5'Flank|NSUN4_uc009vyf.1_5'Flank|NSUN4_uc009vyg.1_5'Flank|NSUN4_uc001cpt.1_5'Flank|NSUN4_uc001cps.1_5'Flank	NM_199044	NP_950245	Q96CB9	NSUN4_HUMAN	NOL1/NOP2/Sun domain family 4 protein								methyltransferase activity				0	Acute lymphoblastic leukemia(166;0.155)					gcatccaggcagagtcattatt	0.297											OREG0013456	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	5	---	---	---	---	
CYP4B1	1580	broad.mit.edu	37	1	47278763	47278763	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47278763delG	uc001cqm.3	+						CYP4B1_uc009vyl.1_Intron|CYP4B1_uc001cqn.3_Intron|CYP4B1_uc009vym.2_Intron|CYP4B1_uc010omk.1_Intron|CYP4B1_uc010oml.1_Intron	NM_000779	NP_000770	P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B,						xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					TCTTAGGGCTGGGTAATCCCT	0.423													4	2	---	---	---	---	
DMRTB1	63948	broad.mit.edu	37	1	53927475	53927476	+	Intron	INS	-	GT	GT			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53927475_53927476insGT	uc001cvq.1	+							NM_033067	NP_149056	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal,						sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						GCCCAGGCACAGTGTGTGTGTC	0.609													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58289050	58289050	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58289050delG	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						GGTTGTGACTGGGGAGGTTGG	0.383													4	2	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62630997	62630998	+	Intron	INS	-	CTTTT	CTTTT	rs146578747	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62630997_62630998insCTTTT	uc009wag.2	+							NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						tctttccttTCCTTTtttcttt	0.129													3	3	---	---	---	---	
JAK1	3716	broad.mit.edu	37	1	65305800	65305800	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65305800delC	uc001dbu.1	-						JAK1_uc009wam.1_Intron|JAK1_uc009wal.1_Intron	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1						interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		TCTCTAAAAGCCCTGGGCTCA	0.498			Mis		ALL								4	2	---	---	---	---	
SGIP1	84251	broad.mit.edu	37	1	67120228	67120228	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67120228delA	uc001dcr.2	+						SGIP1_uc010opd.1_Intron|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting						positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						ACAGTATAAGAAAAAAAAAAT	0.259													4	2	---	---	---	---	
PTGER3	5733	broad.mit.edu	37	1	71496929	71496936	+	Intron	DEL	ACACACAC	-	-	rs71814392		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71496929_71496936delACACACAC	uc001dfg.1	-						PTGER3_uc001dfh.1_Intron|PTGER3_uc001dfi.1_Intron|PTGER3_uc001dfj.1_Intron|PTGER3_uc001dfk.1_Intron|PTGER3_uc001dfl.1_Intron|PTGER3_uc009wbm.1_Intron|PTGER3_uc001dfm.1_Intron|PTGER3_uc001dfn.2_Intron|PTGER3_uc009wbn.1_Intron|PTGER3_uc009wbo.2_Intron|PTGER3_uc001dfo.2_Intron|PTGER3_uc001dfp.1_Intron|PTGER3_uc001dfq.2_Intron	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform						cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)	TGGCAGGAAAacacacacacacacacac	0.255													4	2	---	---	---	---	
LRRIQ3	127255	broad.mit.edu	37	1	74595655	74595656	+	Intron	INS	-	A	A	rs141011164	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74595655_74595656insA	uc001dfy.3	-						LRRIQ3_uc001dfz.3_Intron	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3											ovary(2)	2						gcccccccaccaaaaaaaagtc	0.000													3	3	---	---	---	---	
GBP2	2634	broad.mit.edu	37	1	89592433	89592434	+	5'Flank	INS	-	GTGTGT	GTGTGT	rs148237206	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89592433_89592434insGTGTGT	uc001dmz.1	-						GBP2_uc001dmy.1_Intron	NM_004120	NP_004111	P32456	GBP2_HUMAN	guanylate binding protein 2,						interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)	1		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		atcataccagcgtgtgtgtgtg	0.000													4	2	---	---	---	---	
CDC7	8317	broad.mit.edu	37	1	91965330	91965333	+	5'Flank	DEL	TTCT	-	-	rs74811942		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91965330_91965333delTTCT	uc001doe.2	+						CDC7_uc001dof.2_5'Flank|CDC7_uc010osw.1_5'Flank|CDC7_uc009wdc.2_5'Flank	NM_003503	NP_003494	O00311	CDC7_HUMAN	cell division cycle 7						cell cycle checkpoint|cell division|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|positive regulation of cell proliferation|regulation of S phase	cytoplasm|nucleoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	5		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		tcccattgtcttctttcttttatt	0.000													2	6	---	---	---	---	
GLMN	11146	broad.mit.edu	37	1	92758290	92758290	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92758290delT	uc001dor.2	-						GLMN_uc009wdg.2_Intron|GLMN_uc001dos.2_Intron	NM_053274	NP_444504	Q92990	GLMN_HUMAN	glomulin						muscle cell differentiation|negative regulation of T cell proliferation|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of phosphorylation|regulation of gene expression, epigenetic|vasculogenesis	intracellular	hepatocyte growth factor receptor binding			skin(1)	1		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		ttttcttttcttttttttttt	0.000									Multiple_Glomus_Tumors_(of_the_Skin)_Familial				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	104816113	104816114	+	IGR	INS	-	CA	CA	rs140598220	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104816113_104816114insCA								AMY1A (608941 upstream) : None (None downstream)																							TGTTTTATGATcacacacacac	0.114													4	2	---	---	---	---	
C1orf194	127003	broad.mit.edu	37	1	109655680	109655680	+	5'Flank	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109655680delA	uc009wev.2	-						KIAA1324_uc001dwq.2_5'Flank|KIAA1324_uc009wex.1_5'Flank|KIAA1324_uc009wey.2_5'Flank|KIAA1324_uc010ovg.1_5'Flank|C1orf194_uc001dwp.3_5'Flank|C1orf194_uc009wew.2_Intron	NM_001122961	NP_001116433	Q5T5A4	CA194_HUMAN	hypothetical protein LOC127003											ovary(1)	1						CGCACCTAACAAAAGGCTTTC	0.343													4	2	---	---	---	---	
PHTF1	10745	broad.mit.edu	37	1	114242392	114242393	+	Frame_Shift_Ins	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114242392_114242393insT	uc009wgp.1	-	16	2527_2528	c.2075_2076insA	c.(2074-2076)AAGfs	p.K692fs	PHTF1_uc001edm.2_Frame_Shift_Ins_p.K449fs	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	692						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCTTATTTGGCTTTTTTTCCAT	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116422584	116422585	+	IGR	DEL	AC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116422584_116422585delAC								NHLH2 (38837 upstream) : SLC22A15 (96534 downstream)																							acacacacagacacacacacac	0.203													4	2	---	---	---	---	
IGSF3	3321	broad.mit.edu	37	1	117137539	117137540	+	Intron	INS	-	G	G	rs143026687		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117137539_117137540insG	uc001egr.1	-						IGSF3_uc001egq.1_Intron|IGSF3_uc001egs.1_Intron	NM_001007237	NP_001007238	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3 isoform 2							integral to membrane				ovary(2)	2	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		CCCCCTGCCCCCGTTCATGCCC	0.589													2	6	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120557030	120557031	+	Intron	DEL	AA	-	-	rs112721190		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120557030_120557031delAA	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		accccatctcaaaaaaaaaaaa	0.183			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142611645	142611646	+	IGR	INS	-	C	C	rs147203214		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142611645_142611646insC								None (None upstream) : None (None downstream)																							tgtaacacaaaagggctgagac	0.020													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142615927	142615927	+	5'Flank	DEL	T	-	-	rs111980196		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142615927delT	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		ccaTGGTTTGTTTTTTGtttt	0.020													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142642170	142642170	+	Intron	DEL	A	-	-	rs113636242		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142642170delA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		ACTTTCAGGTAGAATTGGGGT	0.423													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142649332	142649333	+	Intron	INS	-	TT	TT	rs141768307	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142649332_142649333insTT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		gacccagctaatttttttgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142794193	142794193	+	Intron	DEL	T	-	-	rs61816023	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142794193delT	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		cacatcgcagtgggtttacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142901691	142901692	+	Intron	INS	-	T	T	rs148238158	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142901691_142901692insT	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		ctaaaatttcctttttttgttg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143412865	143412865	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143412865delA								None (None upstream) : LOC100286793 (234774 downstream)																							aggctgacagaaggatggaca	0.000													4	2	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144928113	144928113	+	Intron	DEL	A	-	-	rs67719372		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144928113delA	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Intron|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		agaaggaaagaaaaaaaagag	0.219			T	PDGFRB	MPD								4	2	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144972391	144972391	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144972391delA	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emg.1_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCATCCTTTCAAAAAAAAAAA	0.284			T	PDGFRB	MPD								3	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144994160	144994160	+	Intron	DEL	C	-	-	rs57198963		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144994160delC	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emg.1_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		gcctgagcaacagggcaagaa	0.179			T	PDGFRB	MPD								4	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145048529	145048529	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145048529delC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						aactgggaggcccccccccag	0.000													5	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145559011	145559012	+	Intron	DEL	GT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145559011_145559012delGT	uc001emp.3	+						ANKRD35_uc010oyx.1_Intron|ANKRD35_uc001eob.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGTGGGCAACgtgtgtgtgtgt	0.441													6	3	---	---	---	---	
BCL9	607	broad.mit.edu	37	1	147049627	147049628	+	Intron	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147049627_147049628delTG	uc001epq.2	+							NM_004326	NP_004317	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9						Wnt receptor signaling pathway	nucleus	protein binding			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.115)					TTTCTACCAAtgtgtgtgtgtg	0.153			T	IGH@|IGL@	B-ALL								5	3	---	---	---	---	
VPS72	6944	broad.mit.edu	37	1	151149879	151149880	+	Intron	DEL	AG	-	-	rs11350080		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151149879_151149880delAG	uc001exe.1	-						TMOD4_uc001exd.2_5'Flank|TMOD4_uc001exc.3_5'Flank|TMOD4_uc010pct.1_5'Flank|VPS72_uc001exf.1_3'UTR	NM_005997	NP_005988	Q15906	VPS72_HUMAN	transcription factor-like 1						chromatin modification|negative regulation of transcription from RNA polymerase II promoter	nucleus|protein complex	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|pancreas(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			aaaaaaaaaaagaaaagaaaga	0.114													4	2	---	---	---	---	
KIAA0907	22889	broad.mit.edu	37	1	155886693	155886694	+	Intron	DEL	GA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155886693_155886694delGA	uc001fmi.1	-						KIAA0907_uc001fmj.1_Intron|KIAA0907_uc009wrk.1_Intron|KIAA0907_uc009wrl.1_Intron	NM_014949	NP_055764	Q7Z7F0	K0907_HUMAN	hypothetical protein LOC22889												0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			CAAAAGTAGGGATTTTTTTTTT	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157088339	157088344	+	IGR	DEL	TTTCTT	-	-	rs10522191		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157088339_157088344delTTTCTT								ETV3L (18739 upstream) : ETV3 (6115 downstream)																							GCTCATCCTCTTTCTTTTTCTTTTTT	0.558													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157453180	157453181	+	IGR	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157453180_157453181delTC								ETV3 (344797 upstream) : FCRL5 (29987 downstream)																							tatgttcgcatctctctctctc	0.223													4	2	---	---	---	---	
F11R	50848	broad.mit.edu	37	1	161002923	161002923	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161002923delA	uc010pjw.1	-						F11R_uc001fxf.3_Intron	NM_016946	NP_058642	Q9Y624	JAM1_HUMAN	F11 receptor precursor						blood coagulation|inflammatory response|interspecies interaction between organisms|leukocyte migration|tight junction assembly	integral to membrane|tight junction				ovary(2)	2	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00207)			TATAGCTGGTAAACTCCAAGA	0.303													4	2	---	---	---	---	
UCK2	7371	broad.mit.edu	37	1	165817898	165817899	+	Intron	DEL	CA	-	-	rs77004702		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165817898_165817899delCA	uc001gdp.2	+						UCK2_uc010plb.1_Intron	NM_012474	NP_036606	Q9BZX2	UCK2_HUMAN	uridine-cytidine kinase 2						pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|phosphotransferase activity, alcohol group as acceptor|uridine kinase activity			ovary(1)	1	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					cacacacacccacacacacaca	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	165895618	165895620	+	IGR	DEL	TAT	-	-	rs34675168		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165895618_165895620delTAT								UCK2 (18281 upstream) : FAM78B (133796 downstream)																							TGCTAATAGATATTTTTtttttt	0.197													4	2	---	---	---	---	
BLZF1	8548	broad.mit.edu	37	1	169337677	169337678	+	Intron	INS	-	TTG	TTG	rs141658818	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169337677_169337678insTTG	uc001gfx.1	+						NME7_uc001gfu.2_5'Flank|NME7_uc010plq.1_5'Flank|NME7_uc001gft.2_5'Flank|BLZF1_uc001gfw.2_Intron|BLZF1_uc001gfy.2_Intron|NME7_uc001gfv.1_5'Flank	NM_003666	NP_003657	Q9H2G9	GO45_HUMAN	basic leucine zipper nuclear factor 1						cell proliferation|Golgi organization|Golgi to plasma membrane protein transport|regulation of cell growth|regulation of transcription from RNA polymerase II promoter	Golgi lumen|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding			skin(1)	1	all_hematologic(923;0.208)					TTAGGGAAAGATTGTTCCGGGA	0.505													4	2	---	---	---	---	
DNM3	26052	broad.mit.edu	37	1	171996756	171996759	+	Intron	DEL	ACAG	-	-	rs112333756		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171996756_171996759delACAG	uc001gie.2	+						DNM3_uc001gid.3_Intron|DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						acacacacacacagagagagagaa	0.000													4	3	---	---	---	---	
DNM3	26052	broad.mit.edu	37	1	172362744	172362745	+	Intron	INS	-	AAG	AAG	rs145993082	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172362744_172362745insAAG	uc001gie.2	+						DNM3_uc001gif.2_Intron|DNM3_uc001gih.1_Intron|PIGC_uc001gii.1_RNA|PIGC_uc001gij.1_RNA	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						CAGCCCTCTAAAAGTCTGACTT	0.431													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	172624759	172624761	+	IGR	DEL	AGG	-	-	rs142793251		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172624759_172624761delAGG								C1orf9 (43788 upstream) : FASLG (3424 downstream)																							GCAGGGAAGAAGGAGATGTAAAA	0.433													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	173196693	173196693	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173196693delG								TNFSF4 (20222 upstream) : PRDX6 (249793 downstream)																							ttatctcactggggcttgtca	0.000													4	2	---	---	---	---	
TNR	7143	broad.mit.edu	37	1	175470080	175470080	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175470080delA	uc009wwu.1	-						TNR_uc010pmz.1_Intron	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					CTTGTGCTCCAgtgggttaga	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	178638769	178638770	+	IGR	INS	-	TT	TT	rs67223351		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178638769_178638770insTT								C1orf220 (120745 upstream) : RALGPS2 (55530 downstream)																							tctttcttttcttttttttttt	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	182966836	182966837	+	IGR	INS	-	TGTT	TGTT	rs149819911	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182966836_182966837insTGTT								C1orf14 (44283 upstream) : LAMC1 (25758 downstream)																							gggggattgtgtgtttgtttgt	0.000													4	2	---	---	---	---	
C1orf21	81563	broad.mit.edu	37	1	184528723	184528724	+	Intron	INS	-	CCTT	CCTT	rs141160537	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184528723_184528724insCCTT	uc001gqv.1	+							NM_030806	NP_110433	Q9H246	CA021_HUMAN	chromosome 1 open reading frame 21												0		Breast(1374;0.00262)		Colorectal(1306;4.8e-08)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)		ctctcttcctcccttccttcct	0.010													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	199130136	199130137	+	IGR	INS	-	G	G	rs142603788	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199130136_199130137insG								MIR181A1 (301854 upstream) : NR5A2 (866633 downstream)																							gaaggaaggaagaaggaaggaa	0.149													6	3	---	---	---	---	
PKP1	5317	broad.mit.edu	37	1	201285246	201285249	+	Intron	DEL	GGAT	-	-	rs112858674	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201285246_201285249delGGAT	uc001gwd.2	+						PKP1_uc001gwe.2_Intron|PKP1_uc009wzm.2_Intron	NM_000299	NP_000290	Q13835	PKP1_HUMAN	plakophilin 1 isoform 1b						cell adhesion|cellular component disassembly involved in apoptosis|multicellular organismal development	desmosome|intermediate filament|nucleus	intermediate filament binding|signal transducer activity|structural constituent of epidermis			ovary(2)	2						atggatggacggatggacggacgg	0.108													4	2	---	---	---	---	
FMOD	2331	broad.mit.edu	37	1	203156971	203156971	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203156971delC	uc010pqi.1	-						CHI3L1_uc001gzi.2_5'Flank|CHI3L1_uc001gzj.2_5'Flank	NM_002023		Q06828	FMOD_HUMAN	fibromodulin precursor						transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)			tctaatttttccaggctggtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	203393119	203393120	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203393119_203393120insA								FMOD (72830 upstream) : PRELP (51763 downstream)																							tccgtctcaagaaaaaaaaaag	0.228													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	204035359	204035359	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204035359delG								C1orf157 (24967 upstream) : SOX13 (6887 downstream)																							CCGCCACTCAGGAAATAGGAG	0.527													4	2	---	---	---	---	
CNTN2	6900	broad.mit.edu	37	1	205023029	205023031	+	Intron	DEL	CTC	-	-	rs143776414		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205023029_205023031delCTC	uc001hbr.2	+						CNTN2_uc001hbq.1_Intron	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor						axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGCTGAGGTTCTCCTCCCAGGGG	0.606													1	5	---	---	---	---	
TRAF3IP3	80342	broad.mit.edu	37	1	209944408	209944409	+	Intron	INS	-	GT	GT			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209944408_209944409insGT	uc001hho.2	+						TRAF3IP3_uc001hhl.2_Intron|TRAF3IP3_uc001hhm.1_Intron|TRAF3IP3_uc001hhn.2_Intron|TRAF3IP3_uc009xcr.2_Intron	NM_025228	NP_079504	Q9Y228	T3JAM_HUMAN	TRAF3-interacting JNK-activating modulator							integral to membrane	protein binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.045)		tgcatgtggaggtgtgtgtgca	0.030													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	212720055	212720056	+	IGR	INS	-	G	G	rs148315183	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212720055_212720056insG								NENF (100336 upstream) : ATF3 (18641 downstream)																							ACTATAAGGGTGCATTGAAACA	0.262													4	2	---	---	---	---	
BATF3	55509	broad.mit.edu	37	1	212863209	212863210	+	Intron	DEL	AC	-	-	rs72010326		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212863209_212863210delAC	uc001hjl.1	-							NM_018664	NP_061134	Q9NR55	BATF3_HUMAN	basic leucine zipper transcription factor,						transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.0046)|all cancers(67;0.00785)|GBM - Glioblastoma multiforme(131;0.0731)|Epithelial(68;0.0781)		acacacagatacacacagtcac	0.094													4	2	---	---	---	---	
RPS6KC1	26750	broad.mit.edu	37	1	213434712	213434712	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213434712delA	uc010ptr.1	+						RPS6KC1_uc001hkd.2_Intron|RPS6KC1_uc010pts.1_Intron|RPS6KC1_uc010ptt.1_Intron|RPS6KC1_uc010ptu.1_Intron|RPS6KC1_uc010ptv.1_Intron|RPS6KC1_uc001hke.2_Intron	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide						cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		TGACTGCATCAAAAAAAAAAA	0.353													4	2	---	---	---	---	
PTPN14	5784	broad.mit.edu	37	1	214532561	214532561	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214532561delT	uc001hkk.1	-							NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		ACtttttttcttttttttttt	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	214850476	214850476	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214850476delA								CENPF (12564 upstream) : KCNK2 (328409 downstream)																							ATTTCCTGTTAAGGCCCTTAT	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	215540008	215540009	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215540008_215540009insT								KCNK2 (129573 upstream) : KCTD3 (200726 downstream)																							TTTATTACCTAtttttttttga	0.104													4	2	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	217029695	217029696	+	Intron	DEL	AC	-	-	rs150024523		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217029695_217029696delAC	uc001hky.1	-						ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	TCTCTCTTCAacacacacacac	0.302													5	4	---	---	---	---	
SLC30A10	55532	broad.mit.edu	37	1	219932909	219932909	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219932909delA	uc001hlu.1	-									Q6XR72	ZNT10_HUMAN	Synthetic construct DNA, clone: pF1KB7405, Homo sapiens SLC30A10 gene for solute carrier family 30, member 10, without stop codon, in Flexi system.						zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		AAGGGGAGAGAAAAAAAAAAA	0.313													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	221069869	221069869	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221069869delT								HLX (11471 upstream) : LOC400804 (433401 downstream)																							GTCAAAGGCCTTTGGTCTGTT	0.607													4	2	---	---	---	---	
LIN9	286826	broad.mit.edu	37	1	226443926	226443926	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226443926delA	uc001hqa.2	-						LIN9_uc001hqb.2_Intron|LIN9_uc001hqc.2_Intron|LIN9_uc009xel.1_Intron	NM_173083	NP_775106	Q5TKA1	LIN9_HUMAN	lin-9 homolog						cell cycle|DNA replication	nucleoplasm					0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		tctacatactaaaaaaaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229236366	229236366	+	IGR	DEL	T	-	-	rs72210079		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229236366delT								RHOU (353957 upstream) : RAB4A (170513 downstream)																							aGACTATAGCttttttttttt	0.134													6	3	---	---	---	---	
PCNXL2	80003	broad.mit.edu	37	1	233273042	233273053	+	Intron	DEL	GTGTGAGTGTGG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233273042_233273053delGTGTGAGTGTGG	uc001hvl.2	-						PCNXL2_uc001hvm.1_Intron|PCNXL2_uc009xfu.2_Intron|PCNXL2_uc001hvp.1_Intron|PCNXL2_uc009xfv.1_Intron	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				gtgtgagtgagtgtgagtgtgggtgtgagtgt	0.000													4	3	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245598275	245598276	+	Intron	INS	-	TCCA	TCCA	rs72284276		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245598275_245598276insTCCA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			ATGCTCTTTTGtccatccatcc	0.050													4	2	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245667743	245667744	+	Intron	INS	-	T	T	rs145517353	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245667743_245667744insT	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			ctttctttttctttttttttga	0.020													1	10	---	---	---	---	
SMYD3	64754	broad.mit.edu	37	1	246485220	246485220	+	Intron	DEL	T	-	-	rs77605086		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246485220delT	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		tctcagctaatttttttttta	0.000													4	3	---	---	---	---	
SMYD3	64754	broad.mit.edu	37	1	246489707	246489707	+	Intron	DEL	A	-	-	rs66465718		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246489707delA	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		GCTAGTGAAGAAAAAAAAAAA	0.378													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	248602823	248602827	+	IGR	DEL	ACACA	-	-	rs79656834		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248602823_248602827delACACA								OR2T1 (32419 upstream) : OR2T2 (13272 downstream)																							ACCTGTGGTCACACAACACACGTTC	0.420													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7629377	7629384	+	IGR	DEL	AAGGAAGG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7629377_7629384delAAGGAAGG								RNF144A (445070 upstream) : LOC339788 (433174 downstream)																							aggaaggagaaaggaaggaaggaaggaa	0.000													4	2	---	---	---	---	
C2orf48	348738	broad.mit.edu	37	2	10333449	10333449	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10333449delG	uc002rai.1	+						hsa-mir-4261|MI0015868_5'Flank	NM_182626	NP_872432	Q96LS8	CB048_HUMAN	hypothetical protein LOC348738												0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)		CTGCTGCTGTGGGGCAGGGAG	0.358													4	2	---	---	---	---	
NBAS	51594	broad.mit.edu	37	2	15550587	15550588	+	Intron	DEL	AA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15550587_15550588delAA	uc002rcc.1	-						NBAS_uc010exl.1_Intron|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4						GTGTTAGGGCAAAAAAAAAATT	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16270725	16270726	+	IGR	INS	-	AC	AC			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16270725_16270726insAC								MYCN (183597 upstream) : FAM49A (463175 downstream)																							TTTatactcaaacacacacaca	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18657218	18657227	+	IGR	DEL	GGGAAGGGAA	-	-	rs71965200		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18657218_18657227delGGGAAGGGAA								KCNS3 (542994 upstream) : NT5C1B (78764 downstream)																							gggaaggcgggggaagggaagggaagggaa	0.162													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	24715834	24715835	+	IGR	INS	-	AAAA	AAAA	rs142850129	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24715834_24715835insAAAA								ITSN2 (132437 upstream) : NCOA1 (71344 downstream)																							AGGCTAGTCTCAAAAAAAAAGC	0.416													4	2	---	---	---	---	
OST4	100128731	broad.mit.edu	37	2	27297232	27297233	+	5'Flank	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27297232_27297233insT	uc002rig.2	-							NM_001134693	NP_001128165	P0C6T2	OST4_HUMAN	dolichyl-diphosphooligosaccharide--protein							integral to membrane					0						GCCCAAATCACttttttttttt	0.233													2	4	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28176512	28176512	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28176512delA	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					CGATCTCACCAAAAAAAAAAA	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	30352822	30352823	+	IGR	DEL	GA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30352822_30352823delGA								ALK (208390 upstream) : YPEL5 (16927 downstream)																							tgagccgacTGAGAGAGAGAGA	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	33960947	33960948	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33960947_33960948insA								MYADML (7663 upstream) : None (None downstream)																							actctgtcaccaaaaaaaacca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	35041389	35041390	+	IGR	DEL	CA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35041389_35041390delCA								None (None upstream) : None (None downstream)																							TATATAGACCcacacacacaca	0.030													4	2	---	---	---	---	
CRIM1	51232	broad.mit.edu	37	2	36777185	36777186	+	3'UTR	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36777185_36777186delTG	uc002rpd.2	+	17						NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN	cysteine-rich motor neuron 1 precursor						nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				agagtatgtatgtgtgtgtgtg	0.317													4	2	---	---	---	---	
EIF2AK2	5610	broad.mit.edu	37	2	37382080	37382081	+	Intron	INS	-	T	T	rs143886500		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37382080_37382081insT	uc010ynh.1	-						EIF2AK2_uc010fac.2_Intron|EIF2AK2_uc010fad.2_Intron	NM_002759	NP_002750	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha						evasion by virus of host immune response|modulation by virus of host cellular process|negative regulation of osteoblast proliferation|protein autophosphorylation|response to virus|viral infectious cycle	cytosol	ATP binding|double-stranded RNA binding|eukaryotic translation initiation factor 2alpha kinase activity|protein binding|protein phosphatase type 2A regulator activity			ovary(2)|lung(2)|pancreas(1)	5		all_hematologic(82;0.248)				cttttcttctattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42164474	42164474	+	3'UTR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42164474delT	uc002rsf.1	-	4										SubName: Full=cDNA FLJ42903 fis, clone BRHIP3013765;																		GGATTTGTGCTTCATAGACTC	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42229782	42229782	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42229782delG								None (None upstream) : PKDCC (45379 downstream)																							ctctggctttgggggaagcca	0.055													4	2	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	50903278	50903278	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50903278delA	uc010fbq.2	-						NRXN1_uc002rxe.3_Intron	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			cttgttttttaaaagagtctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	56050958	56050959	+	IGR	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56050958_56050959delTG								PNPT1 (129947 upstream) : EFEMP1 (42144 downstream)																							AGCTGTGGGCTGTGTGTGTGTT	0.322													4	2	---	---	---	---	
CCT4	10575	broad.mit.edu	37	2	62111233	62111234	+	Intron	DEL	AC	-	-	rs67487542		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62111233_62111234delAC	uc002sbo.2	-						CCT4_uc010ypp.1_Intron|CCT4_uc010ypq.1_Intron|CCT4_uc010ypr.1_Intron|CCT4_uc010yps.1_Intron	NM_006430	NP_006421	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)						'de novo' posttranslational protein folding	melanosome|microtubule organizing center|nucleus	ATP binding|unfolded protein binding			ovary(2)	2	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			ACATTAAGATACAAAGTTACAT	0.342													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65377431	65377433	+	IGR	DEL	TTG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65377431_65377433delTTG								RAB1A (19996 upstream) : ACTR2 (77396 downstream)																							ggagttttatttgttgttgttgt	0.000													5	3	---	---	---	---	
DYSF	8291	broad.mit.edu	37	2	71845282	71845285	+	Intron	DEL	GTGT	-	-	rs151014845		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71845282_71845285delGTGT	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						ggtagaggtggtgtgtgtgtgtgt	0.000													6	3	---	---	---	---	
EXOC6B	23233	broad.mit.edu	37	2	72846309	72846310	+	Intron	DEL	AG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72846309_72846310delAG	uc010fep.2	-						EXOC6B_uc002sij.2_Intron	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						ATACACAGCCagagagagagag	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	74343673	74343674	+	IGR	DEL	GT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74343673_74343674delGT								TET3 (8373 upstream) : BOLA3 (18854 downstream)																							gggtgtggtggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
SLC4A5	57835	broad.mit.edu	37	2	74574543	74574543	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74574543delT	uc002skl.2	-									Q9BY07	S4A5_HUMAN	Homo sapiens mRNA for dynactin 1 isoform 1 variant protein.							apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						TTCTTTCCTCTtttttttttc	0.189													4	2	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	79521341	79521343	+	Intron	DEL	GAA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79521341_79521343delGAA	uc010yse.1	+							NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						agaagaagaggaagaagaagaag	0.084													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	82539057	82539057	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82539057delT								None (None upstream) : None (None downstream)																							tgggtgggcctgagaagttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	85196304	85196304	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85196304delA								TMSB10 (62505 upstream) : KCMF1 (1927 downstream)																							AAAACCAAGCAAATGAAATCT	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89848584	89848585	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89848584_89848585insT								FLJ40330 (742459 upstream) : None (None downstream)																							taataaaaaaaaaCAaacggaa	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89858340	89858349	+	IGR	DEL	TCCATTCCAT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89858340_89858349delTCCATTCCAT								FLJ40330 (752215 upstream) : None (None downstream)																							actattcaaatccattccattccattccat	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91852212	91852213	+	IGR	INS	-	T	T	rs141351604	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91852212_91852213insT								LOC654342 (4237 upstream) : GGT8P (111155 downstream)																							tctatactttgttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92085541	92085541	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92085541delG								GGT8P (115388 upstream) : FKSG73 (43618 downstream)																							gcagagataaggccttgctgg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92258401	92258401	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92258401delA								FKSG73 (127907 upstream) : None (None downstream)																							GCTGGTTAGCAAAGTGGTCTG	0.468													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	95352669	95352669	+	IGR	DEL	T	-	-	rs111846658		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95352669delT								None (None upstream) : ANKRD20B (74006 downstream)																							ttttttggtgttttttttttt	0.000													3	3	---	---	---	---	
ANKRD36	375248	broad.mit.edu	37	2	97823873	97823873	+	Frame_Shift_Del	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97823873delA	uc010yva.1	+	16	1534	c.1290delA	c.(1288-1290)AGAfs	p.R430fs	ANKRD36_uc010yuz.1_RNA|ANKRD36_uc010fic.2_Frame_Shift_Del_p.R149fs|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	430											0						TTACGAACAGAAGGACTATTT	0.259													3	4	---	---	---	---	
ANKRD36	375248	broad.mit.edu	37	2	97827818	97827819	+	Intron	INS	-	T	T	rs34725305		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97827818_97827819insT	uc010yva.1	+						ANKRD36_uc010fic.2_Intron|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron|ANKRD36_uc002sxq.1_5'Flank	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36												0						CTGAAGATTTCTTTTTTTTTTT	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	101932368	101932368	+	IGR	DEL	A	-	-	rs67365385		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101932368delA								RNF149 (7216 upstream) : CREG2 (32448 downstream)																							tagccacattaaaaaaaAGAA	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	102237845	102237845	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102237845delA								RFX8 (146680 upstream) : MAP4K4 (76643 downstream)																							actccatctcaaaaaaaaaaG	0.254													4	2	---	---	---	---	
SLC9A4	389015	broad.mit.edu	37	2	103103637	103103638	+	Intron	INS	-	GTGT	GTGT	rs146863140	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103103637_103103638insGTGT	uc002tbz.3	+							NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						GCTCACAGCTGgtgtgtgtgtg	0.411													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	105151769	105151769	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105151769delA								LOC150568 (22555 upstream) : POU3F3 (320200 downstream)																							aatagcatagaaaaaaaaaga	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	105275283	105275284	+	IGR	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105275283_105275284delTG								LOC150568 (146069 upstream) : POU3F3 (196685 downstream)																							tgtgtgtgtttgtgtgtgtgtg	0.248													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	108354067	108354067	+	IGR	DEL	A	-	-	rs112282653		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108354067delA								ST6GAL2 (850504 upstream) : LOC729121 (85453 downstream)																							ggccattatgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	108434821	108434822	+	IGR	INS	-	TT	TT	rs70956230		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108434821_108434822insTT								ST6GAL2 (931258 upstream) : LOC729121 (4698 downstream)																							tccttccttccctccttccttc	0.000													4	3	---	---	---	---	
LIMS1	3987	broad.mit.edu	37	2	109181282	109181282	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109181282delA	uc002tef.2	+							NM_004987	NP_004978	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1						cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding				0						ACAACACTGTAAAAAAAAAAA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114814798	114814801	+	IGR	DEL	TCCT	-	-	rs149609245		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114814798_114814801delTCCT								ACTR3 (98631 upstream) : DPP10 (385098 downstream)																							tccctccctctccttccttccttc	0.103													2	4	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	115519700	115519701	+	Intron	INS	-	CCA	CCA			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115519700_115519701insCCA	uc002tla.1	+						DPP10_uc002tlb.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TTCTCCTGTATCCACCACCTTC	0.416													4	2	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	116507782	116507782	+	Intron	DEL	C	-	-	rs144774571		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116507782delC	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						AAGGGTGCTTCCCTACTCCCT	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122442030	122442030	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122442030delG	uc002tnj.1	+											Homo sapiens cDNA FLJ40945 fis, clone UTERU2008747.																		acaccttggtggccactttta	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	124361755	124361755	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124361755delC								None (None upstream) : CNTNAP5 (421109 downstream)																							GAGAAACAAGCCAGAGAAAAG	0.403													4	2	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	125403144	125403144	+	Intron	DEL	C	-	-	rs34475010		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125403144delC	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		gcccctgtatctaaacaataa	0.179													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127121841	127121841	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127121841delC								None (None upstream) : GYPC (291843 downstream)																							TGGGATAGATCCAGAGAATGG	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	128824753	128824754	+	IGR	INS	-	A	A	rs113610724		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128824753_128824754insA								SAP130 (39120 upstream) : UGGT1 (24000 downstream)																							agactccatctaaaaaaaaaaa	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129559945	129559948	+	IGR	DEL	TTCC	-	-	rs111791928		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129559945_129559948delTTCC								HS6ST1 (483774 upstream) : None (None downstream)																							ttccttccttttccttccttcctt	0.015													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130676183	130676184	+	IGR	INS	-	G	G	rs55873251		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130676183_130676184insG								None (None upstream) : LOC389033 (4251 downstream)																							aaagaaagaaaagaaagaaaga	0.000													3	3	---	---	---	---	
PLEKHB2	55041	broad.mit.edu	37	2	131890777	131890777	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131890777delT	uc002tsg.3	+						PLEKHB2_uc002tsh.2_Intron|PLEKHB2_uc002tsj.3_Intron|PLEKHB2_uc002tsf.3_Intron|PLEKHB2_uc010zao.1_Intron|PLEKHB2_uc010zap.1_Intron|PLEKHB2_uc010zaq.1_Intron|PLEKHB2_uc002tsi.3_Intron	NM_001100623	NP_001094093	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B							membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)		GTGTAACACGTTTTTAAGATA	0.274													4	2	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	132981315	132981315	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132981315delG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						tgcagaatctgcaagtggaca	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133051232	133051232	+	IGR	DEL	T	-	-	rs75806498		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133051232delT								NCRNA00164 (35690 upstream) : GPR39 (122915 downstream)																							attttcactcttgtgtttcat	0.085													5	3	---	---	---	---	
NCKAP5	344148	broad.mit.edu	37	2	133723478	133723479	+	Intron	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133723478_133723479delTG	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1								protein binding				0						CATGACTCTTtgtgtgtgtgtg	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134679253	134679254	+	IGR	DEL	TG	-	-	rs147318708		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134679253_134679254delTG								NCKAP5 (353222 upstream) : MGAT5 (332576 downstream)																							ggagactctctgttgctgctct	0.000													4	2	---	---	---	---	
MGAT5	4249	broad.mit.edu	37	2	135179576	135179577	+	Intron	DEL	AA	-	-	rs111527960		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135179576_135179577delAA	uc002ttv.1	+							NM_002410	NP_002401	Q09328	MGT5A_HUMAN	N-acetylglucosaminyltransferase V						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0964)		gtgtgtatacaaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	137096877	137096878	+	IGR	INS	-	CA	CA	rs147074271	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137096877_137096878insCA								CXCR4 (221152 upstream) : THSD7B (426237 downstream)																							tgggattttgtcaCACACACAC	0.030													2	4	---	---	---	---	
MBD5	55777	broad.mit.edu	37	2	149152290	149152291	+	Intron	DEL	TC	-	-	rs35533753		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149152290_149152291delTC	uc002twm.3	+							NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5							chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		tcaatttcattctgtctttata	0.000													4	2	---	---	---	---	
MMADHC	27249	broad.mit.edu	37	2	150431892	150431903	+	Intron	DEL	GGGGAGATGAAG	-	-	rs66640457		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150431892_150431903delGGGGAGATGAAG	uc002txb.2	-						MMADHC_uc002txc.2_Intron|MMADHC_uc010fnu.2_Intron	NM_015702	NP_056517	Q9H3L0	MMAD_HUMAN	methylmalonic aciduria (cobalamin deficiency)							mitochondrion				central_nervous_system(1)|skin(1)	2						aggggaagatggggagatgaagggggagatgg	0.259													3	3	---	---	---	---	
RIF1	55183	broad.mit.edu	37	2	152292281	152292282	+	Intron	INS	-	T	T	rs75364982	byFrequency	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152292281_152292282insT	uc002txm.2	+						RIF1_uc002txl.2_Intron|RIF1_uc010fnv.1_Intron|RIF1_uc002txn.2_Intron|RIF1_uc002txo.2_Intron|RIF1_uc010zby.1_Intron	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1						cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TCTGTTTTTTGTTTTTTTTTTT	0.307													4	2	---	---	---	---	
PKP4	8502	broad.mit.edu	37	2	159416893	159416894	+	Intron	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159416893_159416894insA	uc002tzv.2	+						PKP4_uc002tzt.1_Intron|PKP4_uc002tzu.2_Intron|PKP4_uc002tzw.2_Intron|PKP4_uc002tzx.2_Intron|PKP4_uc002tzy.1_Intron|PKP4_uc002tzz.1_Intron	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a						cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						TGATTTTATGTAAAAAAAAAAT	0.327										HNSCC(62;0.18)			4	2	---	---	---	---	
KCNH7	90134	broad.mit.edu	37	2	163572457	163572458	+	Intron	DEL	TG	-	-	rs71410032		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163572457_163572458delTG	uc002uch.1	-						KCNH7_uc002uci.2_Intron	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	agcatgTCTTtgtgtgtgtgtg	0.089													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	164322646	164322647	+	IGR	DEL	GT	-	-	rs113284740		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164322646_164322647delGT								KCNH7 (627406 upstream) : FIGN (141471 downstream)																							GAATTTTGAAgtgtgtgtgtgt	0.287													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	165748289	165748289	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165748289delG								COBLL1 (49611 upstream) : SLC38A11 (6523 downstream)																							TTATAGATACGGAACAGAGGA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	170639546	170639548	+	IGR	DEL	GTT	-	-	rs140072906		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170639546_170639548delGTT								KLHL23 (33108 upstream) : SSB (15841 downstream)																							aggaggattggttgaggccaggt	0.064													4	2	---	---	---	---	
CYBRD1	79901	broad.mit.edu	37	2	172411457	172411458	+	3'UTR	INS	-	GGAT	GGAT			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172411457_172411458insGGAT	uc002ugy.3	+	4					CYBRD1_uc002ugz.3_3'UTR	NM_024843	NP_079119	Q53TN4	CYBR1_HUMAN	cytochrome b reductase 1 isoform 1						cellular iron ion homeostasis|electron transport chain|transmembrane transport	integral to membrane	ferric-chelate reductase activity|metal ion binding				0						TTAATCACAAAGGATGGTTTCT	0.312													4	2	---	---	---	---	
CYBRD1	79901	broad.mit.edu	37	2	172412837	172412837	+	3'UTR	DEL	T	-	-	rs11297167		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172412837delT	uc002ugy.3	+	4					CYBRD1_uc002ugz.3_3'UTR	NM_024843	NP_079119	Q53TN4	CYBR1_HUMAN	cytochrome b reductase 1 isoform 1						cellular iron ion homeostasis|electron transport chain|transmembrane transport	integral to membrane	ferric-chelate reductase activity|metal ion binding				0						TATTTTGAGCTTTGGGTTCTC	0.433													2	5	---	---	---	---	
RAPGEF4	11069	broad.mit.edu	37	2	173790316	173790319	+	Intron	DEL	ACAC	-	-	rs140580872		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173790316_173790319delACAC	uc002uhv.3	+						RAPGEF4_uc002uhu.2_Intron|RAPGEF4_uc002uhw.3_Intron|RAPGEF4_uc010zec.1_Intron|RAPGEF4_uc010zed.1_Intron|RAPGEF4_uc010zee.1_Intron|RAPGEF4_uc010fqo.2_Intron|RAPGEF4_uc010zef.1_Intron|RAPGEF4_uc010zeg.1_5'Flank|RAPGEF4_uc010fqp.1_5'Flank|RAPGEF4_uc010zeh.1_5'Flank	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			CTCTGTCTGTacacacacacacac	0.186													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174184230	174184230	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174184230delT								ZAK (51494 upstream) : CDCA7 (35331 downstream)																							caattgtaccttttattttag	0.000													4	2	---	---	---	---	
NFE2L2	4780	broad.mit.edu	37	2	178212424	178212425	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178212424_178212425insT	uc002uli.3	-						LOC100130691_uc002ulk.1_Intron	NM_001145412	NP_001138884	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 2						transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TTTCTTCTTTCTTTTTTTTTCT	0.386			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			4	2	---	---	---	---	
AGPS	8540	broad.mit.edu	37	2	178356738	178356738	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178356738delT	uc002ull.2	+						AGPS_uc010zfb.1_Intron	NM_003659	NP_003650	O00116	ADAS_HUMAN	alkyldihydroxyacetone phosphate synthase						ether lipid biosynthetic process	peroxisomal matrix|peroxisomal membrane|plasma membrane	alkylglycerone-phosphate synthase activity|flavin adenine dinucleotide binding|oxidoreductase activity			ovary(2)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			ggtcttgagctcctgtcctaa	0.055													4	2	---	---	---	---	
DUSP19	142679	broad.mit.edu	37	2	183947538	183947538	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183947538delG	uc002upd.2	+						DUSP19_uc010frp.2_Intron|DUSP19_uc010zfr.1_Intron|DUSP19_uc002upe.2_Intron	NM_080876	NP_543152	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19 isoform 1						JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|positive regulation of JNK cascade|positive regulation of JUN kinase activity	cytoplasm	JUN kinase phosphatase activity|MAP-kinase scaffold activity|mitogen-activated protein kinase kinase kinase binding|protein kinase activator activity|protein kinase inhibitor activity|protein tyrosine phosphatase activity			ovary(4)|pancreas(1)	5						cttcccttttgttcgttcgtt	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	186164640	186164641	+	IGR	INS	-	A	A	rs148201525	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186164640_186164641insA								ZNF804A (360428 upstream) : None (None downstream)																							gggtcttgggcgccccctccaa	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	186579080	186579080	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186579080delT								ZNF804A (774868 upstream) : ZC3H15 (771805 downstream)																							cttcttcttcttttttttttt	0.000													4	2	---	---	---	---	
HIBCH	26275	broad.mit.edu	37	2	191120555	191120556	+	Intron	DEL	GA	-	-	rs142295017		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191120555_191120556delGA	uc002uru.2	-						HIBCH_uc002urv.2_Intron	NM_014362	NP_055177	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-Coenzyme A hydrolase isoform						branched chain family amino acid catabolic process	mitochondrial matrix	3-hydroxyisobutyryl-CoA hydrolase activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			cttaggaatggagagagagaga	0.000													6	3	---	---	---	---	
NAB1	4664	broad.mit.edu	37	2	191511179	191511180	+	5'Flank	DEL	GC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191511179_191511180delGC	uc002usb.2	+						NAB1_uc010fsc.2_5'Flank	NM_005966	NP_005957	Q13506	NAB1_HUMAN	NGFI-A binding protein 1						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			TCAGATACAGGCGAATGCTTCA	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	200668180	200668184	+	Intron	DEL	TTTGG	-	-	rs112955392		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200668180_200668184delTTTGG	uc002uvg.2	-											Homo sapiens hypothetical protein LOC348751, mRNA (cDNA clone IMAGE:5311172).																		tttgttttgttttggtttggtttgg	0.215													3	3	---	---	---	---	
FAM126B	285172	broad.mit.edu	37	2	201934324	201934325	+	Intron	DEL	AC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201934324_201934325delAC	uc002uws.3	-						FAM126B_uc002uwu.2_Intron|FAM126B_uc002uwv.2_Intron|FAM126B_uc002uww.1_Intron|NDUFB3_uc002uwx.3_5'Flank	NM_173822	NP_776183	Q8IXS8	F126B_HUMAN	hypothetical protein LOC285172							intracellular				ovary(1)	1						cataaaagcaacacacacacac	0.213													4	2	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	205597230	205597231	+	Intron	INS	-	TT	TT	rs67804427		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205597230_205597231insTT	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		GTAAGGATATCttttttttttt	0.158													5	3	---	---	---	---	
CREB1	1385	broad.mit.edu	37	2	208456460	208456460	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208456460delT	uc002vcc.2	+						CREB1_uc002vcd.2_Intron|FAM119A_uc002vce.2_Intron	NM_134442	NP_604391	P16220	CREB1_HUMAN	cAMP responsive element binding protein 1						activation of phospholipase C activity|axon guidance|innate immune response|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway		protein dimerization activity|transcription cofactor activity		EWSR1/CREB1(42)	soft_tissue(42)|breast(1)|central_nervous_system(1)	44				LUSC - Lung squamous cell carcinoma(261;0.0768)|Epithelial(149;0.127)|Lung(261;0.145)	Adenosine monophosphate(DB00131)|Bromocriptine(DB01200)|Naloxone(DB01183)	cccagcctccttttgattagt	0.000			T	EWSR1	clear cell sarcoma|angiomatoid fibrous histiocytoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	208496102	208496102	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208496102delA								FAM119A (6037 upstream) : CCNYL1 (80162 downstream)																							atctctactgaaaatgcaaag	0.000													4	2	---	---	---	---	
SPAG16	79582	broad.mit.edu	37	2	214509433	214509434	+	Intron	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214509433_214509434delTC	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		tttctctctttctctctctctc	0.000													4	2	---	---	---	---	
ABCA12	26154	broad.mit.edu	37	2	215984673	215984673	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215984673delT	uc002vew.2	-						ABCA12_uc010zjn.1_Intron	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		aaaaagatcattataccaaaa	0.000													4	2	---	---	---	---	
RESP18	389075	broad.mit.edu	37	2	220192875	220192876	+	Intron	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220192875_220192876insA	uc002vlc.3	-						RESP18_uc002vlb.2_Intron|RESP18_uc010zle.1_Intron	NM_001007089	NP_001007090	Q5W5W9	RES18_HUMAN	regulated endocrine-specific protein 18							endoplasmic reticulum|extracellular region|Golgi apparatus					0						ggtggccttttaaaatcatatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	224522660	224522661	+	IGR	INS	-	GT	GT			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224522660_224522661insGT								SCG2 (55539 upstream) : AP1S3 (97387 downstream)																							tatgtgtatgcgcgcgtgtgtg	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	227092979	227092981	+	IGR	DEL	TTG	-	-	rs57072144		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227092979_227092981delTTG								KIAA1486 (497508 upstream) : IRS1 (503053 downstream)																							tttccttattttgttgttgttgt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	233377511	233377512	+	IGR	INS	-	TG	TG	rs139297672	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233377511_233377512insTG								ECEL1 (24979 upstream) : CHRND (13410 downstream)																							gtgcgtgtgtatgtgtgtgtgt	0.401													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235040582	235040583	+	IGR	DEL	TG	-	-	rs145766296		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235040582_235040583delTG								SPP2 (54806 upstream) : ARL4C (361105 downstream)																							CCAGAGAAcctgtgtgtgtgtc	0.069													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	236386030	236386030	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236386030delT								SH3BP4 (421674 upstream) : AGAP1 (16706 downstream)																							TTTGTGTTTGTTTTTTTTtca	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	238853378	238853379	+	IGR	INS	-	G	G	rs140012190	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238853378_238853379insG								RAMP1 (32625 upstream) : UBE2F (22321 downstream)																							gcccagacatagggggtccctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239676423	239676423	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239676423delA								ASB1 (315533 upstream) : TWIST2 (80250 downstream)																							CACATTGATTACTCCTCTGTT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	240472120	240472121	+	IGR	DEL	CA	-	-	rs67585450		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240472120_240472121delCA								HDAC4 (148774 upstream) : NDUFA10 (428037 downstream)																							cacacacacgcacacacacaca	0.292													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	5110220	5110220	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5110220delA								BHLHE40 (83357 upstream) : ARL8B (53710 downstream)																							catcactattaaaaatgcaaa	0.179													4	2	---	---	---	---	
VGLL4	9686	broad.mit.edu	37	3	11744205	11744206	+	Intron	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11744205_11744206insA	uc003bwf.2	-						VGLL4_uc003bwg.2_Intron	NM_014667	NP_055482	Q14135	VGLL4_HUMAN	vestigial like 4 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		gatcccatctcaaaaaaaaaaa	0.173													4	4	---	---	---	---	
MKRN2	23609	broad.mit.edu	37	3	12610667	12610668	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12610667_12610668insT	uc003bxd.2	+						MKRN2_uc003bxe.2_Intron|MKRN2_uc011aus.1_Intron	NM_014160	NP_054879	Q9H000	MKRN2_HUMAN	makorin ring finger protein 2							intracellular	ligase activity|nucleic acid binding|zinc ion binding				0						Attttcttttcttttttttttt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	17971480	17971481	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17971480_17971481insT								TBC1D5 (187240 upstream) : SATB1 (417785 downstream)																							tacttaagccctttttggacca	0.064													4	2	---	---	---	---	
EFHB	151651	broad.mit.edu	37	3	19946899	19946899	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19946899delA	uc003cbl.3	-						EFHB_uc003cbm.2_Intron	NM_144715	NP_653316	Q8N7U6	EFHB_HUMAN	EF hand domain family, member B						signal transduction	proteinaceous extracellular matrix	calcium ion binding				0						ATAAAGATAGAAAAAAAAAAG	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	27047737	27047737	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27047737delT								LRRC3B (295474 upstream) : NEK10 (104658 downstream)																							ggggaacctgttttttttttt	0.000													4	2	---	---	---	---	
ZCWPW2	152098	broad.mit.edu	37	3	28445681	28445681	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28445681delA	uc003ceh.2	+						ZCWPW2_uc003cei.2_Intron	NM_001040432	NP_001035522	Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2								zinc ion binding			ovary(2)	2						aattaacaagaaaaaaaaaac	0.000													4	2	---	---	---	---	
TRANK1	9881	broad.mit.edu	37	3	36879646	36879647	+	Intron	DEL	AC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36879646_36879647delAC	uc003cgj.2	-							NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1						DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						TAacacacaaacacacacacac	0.391													5	3	---	---	---	---	
ITGA9	3680	broad.mit.edu	37	3	37701474	37701475	+	Intron	INS	-	ACAC	ACAC	rs145646998	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37701474_37701475insACAC	uc003chd.2	+							NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor						axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		AAGATGATGTAacacacacaca	0.257													2	4	---	---	---	---	
MYRIP	25924	broad.mit.edu	37	3	40161231	40161231	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40161231delG	uc003cka.2	+						MYRIP_uc010hhu.2_Intron|MYRIP_uc010hhv.2_Intron|MYRIP_uc010hhw.2_Intron|MYRIP_uc010hhx.1_Intron|MYRIP_uc011ayz.1_Intron	NM_015460	NP_056275	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein						intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		gacacaggaaggggaacatca	0.000													3	3	---	---	---	---	
SACM1L	22908	broad.mit.edu	37	3	45736759	45736759	+	Intron	DEL	T	-	-	rs11366079		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45736759delT	uc003cos.2	+						SACM1L_uc011bag.1_Intron|SACM1L_uc011bah.1_Intron	NM_014016	NP_054735	Q9NTJ5	SAC1_HUMAN	suppressor of actin 1							Golgi apparatus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		GATTTAAttcttttttttttt	0.159													4	2	---	---	---	---	
SACM1L	22908	broad.mit.edu	37	3	45755730	45755732	+	Intron	DEL	TTT	-	-	rs112928052	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45755730_45755732delTTT	uc003cos.2	+						SACM1L_uc011bag.1_Intron|SACM1L_uc011bah.1_Intron	NM_014016	NP_054735	Q9NTJ5	SAC1_HUMAN	suppressor of actin 1							Golgi apparatus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		TGCTATTTTGTTTGTTTTTTTTT	0.300													4	2	---	---	---	---	
RBM6	10180	broad.mit.edu	37	3	50114316	50114316	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50114316delA	uc003cyc.2	+						RBM6_uc003cyd.2_Intron|RBM6_uc003cye.2_Intron|RBM6_uc011bdi.1_Intron|RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron	NM_005777	NP_005768	P78332	RBM6_HUMAN	RNA binding motif protein 6						RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		gactccatctaaaaaaaaaaa	0.184													4	2	---	---	---	---	
CACNA1D	776	broad.mit.edu	37	3	53839966	53839967	+	Intron	INS	-	C	C	rs141385250	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53839966_53839967insC	uc003dgv.3	+						CACNA1D_uc003dgu.3_Intron|CACNA1D_uc003dgy.3_Intron|CACNA1D_uc003dgw.3_Intron|CACNA1D_uc011bes.1_Intron	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	tccctcctcctcctccctcatc	0.000													4	3	---	---	---	---	
C3orf67	200844	broad.mit.edu	37	3	58996960	58996960	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58996960delC	uc003dkt.1	-						uc003dku.1_Intron|C3orf67_uc003dkv.1_Intron|C3orf67_uc003dkw.2_Intron|C3orf67_uc011bfg.1_Intron	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844												0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		cctgtctctactaaaaataca	0.000													4	2	---	---	---	---	
ATXN7	6314	broad.mit.edu	37	3	63959819	63959820	+	Intron	INS	-	T	T	rs140786826	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63959819_63959820insT	uc003dlw.3	+						ATXN7_uc003dlv.2_Intron|ATXN7_uc010hnv.2_Intron|ATXN7_uc010hnw.2_Intron|ATXN7_uc011bfn.1_Intron	NM_000333	NP_000324	O15265	ATX7_HUMAN	ataxin 7 isoform a						cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		ATCTTGGATGCTTTAAGACCCT	0.243													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	72310727	72310728	+	IGR	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72310727_72310728delTG								PROK2 (476370 upstream) : RYBP (113023 downstream)																							tgtgtgtgtctgtgtgtgtgtg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	72798123	72798126	+	IGR	DEL	CACA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72798123_72798126delCACA								RYBP (302349 upstream) : SHQ1 (304 downstream)																							cacgcacacgcacacacacacaca	0.049													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75991116	75991121	+	IGR	DEL	CTCTCT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75991116_75991121delCTCTCT								ZNF717 (156446 upstream) : None (None downstream)																							ATAAACAGCCCTCTCTCTCTCTCTGT	0.374													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	82899420	82899422	+	IGR	DEL	CTT	-	-	rs13067064		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:82899420_82899422delCTT								None (None upstream) : None (None downstream)																							tctcctcctccttcttgtttttt	0.039													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	83049451	83049452	+	IGR	DEL	TG	-	-	rs10575776		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83049451_83049452delTG								None (None upstream) : None (None downstream)																							tgtgcgtgcatgtgtgtgtgtg	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	86248884	86248885	+	IGR	DEL	CT	-	-	rs35293591		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86248884_86248885delCT								CADM2 (130936 upstream) : VGLL3 (738240 downstream)																							agtacagcccctgtgtgtccct	0.000													3	3	---	---	---	---	
ARL13B	200894	broad.mit.edu	37	3	93757331	93757331	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93757331delT	uc003drc.2	+						ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Intron|ARL13B_uc003drf.2_Intron|ARL13B_uc003drg.2_Intron	NM_182896	NP_878899	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 2-like 1 isoform 1								GTP binding				0						TGTTTCTTTCTTTTTTTTTTT	0.209													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	94251389	94251390	+	IGR	DEL	GG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94251389_94251390delGG								NSUN3 (405759 upstream) : LOC255025 (405717 downstream)																							TGTTGTGCCTGGTCATCTATCA	0.421													4	2	---	---	---	---	
LOC100302640	100302640	broad.mit.edu	37	3	106583416	106583416	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106583416delA	uc003dwf.3	-											Homo sapiens cDNA clone IMAGE:5284861.												0						tctcaaaaacaaaaaaaaaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	107852082	107852082	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107852082delG								CD47 (42147 upstream) : IFT57 (27578 downstream)																							CTATAATGTAGGGGAAATCAT	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	113543560	113543561	+	IGR	INS	-	A	A	rs76274427		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113543560_113543561insA								ATP6V1A (12659 upstream) : GRAMD1C (3468 downstream)																							acttcatctccaaaaaaaaaag	0.000													4	2	---	---	---	---	
POPDC2	64091	broad.mit.edu	37	3	119371867	119371870	+	Intron	DEL	GTGA	-	-	rs10590436		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119371867_119371870delGTGA	uc003ecx.1	-						POPDC2_uc010hqw.1_Intron|POPDC2_uc003ecy.1_Intron	NM_022135	NP_071418	Q9HBU9	POPD2_HUMAN	popeye protein 2							integral to membrane				central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.242)		CCTTAAAAGGgtgagtgagtgtgt	0.309													4	2	---	---	---	---	
KALRN	8997	broad.mit.edu	37	3	123751133	123751133	+	5'Flank	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123751133delC	uc003ehd.2	+									O60229	KALRN_HUMAN	Homo sapiens cDNA FLJ41073 fis, clone 3NB692008178.						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						CAGCCCCTCTCCCCACTTTAA	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	125515432	125515434	+	IGR	DEL	TAA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125515432_125515434delTAA								MIR548I1 (6037 upstream) : LOC100125556 (120010 downstream)																							cttagaaggttaatgatgtgtcc	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	125944384	125944385	+	IGR	INS	-	AGAC	AGAC	rs143267491	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125944384_125944385insAGAC								ALDH1L1 (44899 upstream) : KLF15 (117093 downstream)																							CAAAGGAAAAGAGTTTGGTGAC	0.119													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	134398905	134398906	+	IGR	DEL	AC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134398905_134398906delAC								KY (28427 upstream) : EPHB1 (115354 downstream)																							taagacacagacacacacacac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137519700	137519701	+	IGR	INS	-	AA	AA	rs140892680	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137519700_137519701insAA								SOX14 (35304 upstream) : CLDN18 (197957 downstream)																							ctgtactggttaaaaaaaaaag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	138612956	138612956	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138612956delA								PIK3CB (134771 upstream) : FOXL2 (50111 downstream)																							TTTTCAAAACAAAAAAAATAC	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	140630100	140630101	+	IGR	DEL	AA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140630100_140630101delAA								TRIM42 (210109 upstream) : SLC25A36 (30561 downstream)																							AGTGATCAGGAAAAAAAAAAAA	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	141567302	141567303	+	IGR	DEL	CA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141567302_141567303delCA								GRK7 (31412 upstream) : ATP1B3 (28167 downstream)																							cacacacacgcacacacacaca	0.257													4	2	---	---	---	---	
PLS1	5357	broad.mit.edu	37	3	142354898	142354898	+	Intron	DEL	T	-	-	rs111815917		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142354898delT	uc010huv.2	+						PLS1_uc003euz.2_Intron	NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1							cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1						cacctgctaattttttttttt	0.000													1	5	---	---	---	---	
PCOLCE2	26577	broad.mit.edu	37	3	142602721	142602721	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142602721delA	uc003evd.2	-							NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2							extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)|skin(1)	3						TCTTTATGCCAGGGGTGCCTG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	145767099	145767100	+	IGR	DEL	GA	-	-	rs7636812		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145767099_145767100delGA								None (None upstream) : PLOD2 (20128 downstream)																							atggaatcatgagtggttgctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	146995077	146995077	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146995077delA								PLSCR5 (671074 upstream) : ZIC4 (108760 downstream)																							TCTGGACTGtaaaaaaaaaaa	0.209													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	152367136	152367137	+	IGR	INS	-	T	T	rs11378598		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152367136_152367137insT								MBNL1 (183568 upstream) : P2RY1 (185599 downstream)																							CTCACTGAGTCTTTTTTTTTTT	0.292													4	2	---	---	---	---	
MME	4311	broad.mit.edu	37	3	154899708	154899708	+	3'UTR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154899708delA	uc010hvr.1	+	23					MME_uc003fab.1_3'UTR|MME_uc003fac.1_3'UTR|MME_uc003fad.1_3'UTR|MME_uc003fae.1_3'UTR	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase						cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	ATTTGCCTTTAAAAAAAAAAG	0.179													4	2	---	---	---	---	
PLCH1	23007	broad.mit.edu	37	3	155256734	155256735	+	Intron	INS	-	A	A	rs150639038	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155256734_155256735insA	uc011bok.1	-						PLCH1_uc011boj.1_Intron|PLCH1_uc011bol.1_Intron	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			aaggacataacaaaaaaaaaag	0.000													4	4	---	---	---	---	
RSRC1	51319	broad.mit.edu	37	3	158158403	158158404	+	Intron	DEL	AA	-	-	rs2362964	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158158403_158158404delAA	uc003fbt.2	+						RSRC1_uc011bou.1_Intron|RSRC1_uc003fbu.1_Intron|RSRC1_uc003fbv.2_Intron	NM_016625	NP_057709	Q96IZ7	RSRC1_HUMAN	arginine/serine-rich coiled-coil 1						nucleocytoplasmic transport	cytoplasm|nuclear speck	protein binding				0			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)			ACACACACACAAATCCACACCA	0.238													4	2	---	---	---	---	
OTOL1	131149	broad.mit.edu	37	3	161219667	161219667	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161219667delT	uc011bpb.1	+							NM_001080440	NP_001073909	A6NHN0	OTOL1_HUMAN	otolin-1 precursor							collagen					0						CCTCAATACAttttttttgac	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	168582254	168582254	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168582254delT								C3orf50 (33882 upstream) : MECOM (219033 downstream)																							CTAAATGTGATTTGAATTGCC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	169910241	169910242	+	IGR	DEL	AA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169910241_169910242delAA								PHC3 (10704 upstream) : PRKCI (29978 downstream)																							aagaaatgctaaaagctgttct	0.000													4	2	---	---	---	---	
SLC7A14	57709	broad.mit.edu	37	3	170255742	170255742	+	Intron	DEL	T	-	-	rs5854375		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170255742delT	uc003fgz.2	-						CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid							integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TCTAAACATATTTTTTTTCTT	0.388													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	172137302	172137303	+	IGR	INS	-	CT	CT	rs148878414	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172137302_172137303insCT								FNDC3B (18812 upstream) : GHSR (25648 downstream)																							aacacttatccctctctctctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177306093	177306094	+	IGR	INS	-	TTG	TTG	rs141644085	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177306093_177306094insTTG								TBL1XR1 (391045 upstream) : KCNMB2 (948130 downstream)																							cacacacacacTTGTACAGTAC	0.287													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	178147217	178147217	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178147217delA								None (None upstream) : KCNMB2 (107007 downstream)																							CAGTCTCTCTAATGCTGTCCC	0.418													4	2	---	---	---	---	
ACTL6A	86	broad.mit.edu	37	3	179302399	179302400	+	Intron	INS	-	A	A	rs11353729		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179302399_179302400insA	uc003fjw.2	+						ACTL6A_uc003fjx.2_Intron|ACTL6A_uc003fjy.2_Intron	NM_004301	NP_004292	O96019	ACL6A_HUMAN	actin-like 6A isoform 1						chromatin remodeling|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|nervous system development|regulation of growth|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	Ino80 complex|npBAF complex|NuA4 histone acetyltransferase complex|plasma membrane|SWI/SNF complex	ATP binding|chromatin binding			ovary(1)	1	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			gactccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	183783309	183783310	+	IGR	INS	-	T	T	rs59656757		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183783309_183783310insT								HTR3C (4850 upstream) : HTR3E (31542 downstream)																							TGTAtttttccttttttttttt	0.208													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184204791	184204794	+	IGR	DEL	TCCC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184204791_184204794delTCCC								CHRD (97172 upstream) : EPHB3 (74793 downstream)																							ccttatagattccctccctccctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185568470	185568470	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185568470delT								IGF2BP2 (25643 upstream) : TRA2B (63890 downstream)																							GGCTGGAttctttttttttca	0.214													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185590370	185590370	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185590370delA								IGF2BP2 (47543 upstream) : TRA2B (41990 downstream)																							tttttttttgagatggaatct	0.000													4	2	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	186038536	186038536	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186038536delA	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TGAGAATGTTAAAAAAAAAAG	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	187281000	187281000	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187281000delA								RTP4 (191633 upstream) : SST (105696 downstream)																							gaacaccaggaggtgggatta	0.129													4	2	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188549195	188549195	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188549195delA	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		CAGCTGCTAGAAAGTCCTGAT	0.512			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	3	---	---	---	---	
LEPREL1	55214	broad.mit.edu	37	3	189831237	189831237	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189831237delG	uc011bsk.1	-						LEPREL1_uc003fsg.2_Intron	NM_018192	NP_060662	Q8IVL5	P3H2_HUMAN	leprecan-like 1 isoform a						collagen metabolic process|negative regulation of cell proliferation|peptidyl-proline hydroxylation	basement membrane|endoplasmic reticulum|Golgi apparatus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			breast(3)|ovary(1)	4	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CTGCCCCAAAGCAGTTAGTTG	0.348													4	2	---	---	---	---	
TMEM207	131920	broad.mit.edu	37	3	190147698	190147698	+	Intron	DEL	G	-	-	rs5855335		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190147698delG	uc003fsj.2	-							NM_207316	NP_997199	Q6UWW9	TM207_HUMAN	transmembrane protein 207 precursor							integral to membrane					0	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		AGTCACCACAGGGGGGAAAAA	0.363													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	190829675	190829676	+	IGR	DEL	CG	-	-	rs74271634		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190829675_190829676delCG								SNAR-I (233836 upstream) : OSTN (100646 downstream)																							cacatgcacacgcacacacaca	0.163													3	4	---	---	---	---	
OSTN	344901	broad.mit.edu	37	3	190964394	190964394	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190964394delA	uc011bsn.1	+							NM_198184	NP_937827	P61366	OSTN_HUMAN	osteocrin precursor						cell differentiation|multicellular organismal development|ossification		hormone activity			pancreas(1)|skin(1)	2	all_cancers(143;6.79e-09)|Ovarian(172;0.103)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000254)		accctgtatcaaaaaaaaaaa	0.005													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193886288	193886289	+	IGR	DEL	GT	-	-	rs66542207	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193886288_193886289delGT								HES1 (29892 upstream) : LOC100131551 (131135 downstream)																							CCTGTTTGGGgtgtgtgtgtgt	0.347													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194301947	194301948	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194301947_194301948insT								ATP13A3 (112979 upstream) : TMEM44 (6455 downstream)																							TTATGGttttgttttttttttg	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195288627	195288627	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195288627delT								PPP1R2 (18403 upstream) : APOD (6946 downstream)																							gagttaaggcttttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195364327	195364329	+	IGR	DEL	TCC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195364327_195364329delTCC								APOD (53251 upstream) : SDHAP2 (20581 downstream)																							TATTCTTAAATCCTCCTTTTTTT	0.350													2	6	---	---	---	---	
MUC20	200958	broad.mit.edu	37	3	195447642	195447642	+	5'Flank	DEL	G	-	-	rs11185521		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195447642delG	uc010hzo.2	+							NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L						protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		aaaaaaaaaagaaGCTAGTGA	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195767345	195767345	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195767345delT								SDHAP1 (50195 upstream) : TFRC (8811 downstream)																							tgtctttccctctttatatgt	0.000													4	2	---	---	---	---	
UBXN7	26043	broad.mit.edu	37	3	196142651	196142652	+	Intron	INS	-	A	A	rs75952123		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196142651_196142652insA	uc003fwm.3	-						UBXN7_uc003fwn.3_Intron|UBXN7_uc010iae.2_Intron|UBXN7_uc010iaf.2_Intron	NM_015562	NP_056377	O94888	UBXN7_HUMAN	UBX domain containing 7								protein binding			ovary(2)|pancreas(1)	3						gacttcatctcaaaaaaaaaaa	0.163													3	3	---	---	---	---	
IQCG	84223	broad.mit.edu	37	3	197639913	197639913	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197639913delG	uc003fyo.2	-						IQCG_uc003fyn.2_Intron|IQCG_uc003fyp.2_Intron|IQCG_uc003fym.2_5'UTR	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G												0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		GGCTTAAAAAGGGGGATTCCG	0.587													4	2	---	---	---	---	
KIAA1530	57654	broad.mit.edu	37	4	1356904	1356905	+	Intron	INS	-	C	C	rs146797277	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1356904_1356905insC	uc003gde.3	+						KIAA1530_uc010ibv.2_5'Flank	NM_020894	NP_065945	Q2YD98	K1530_HUMAN	hypothetical protein LOC57654												0			OV - Ovarian serous cystadenocarcinoma(23;0.0138)			GGTTTGAGGGGTACCACGGCCT	0.550													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	1516348	1516349	+	IGR	INS	-	TGG	TGG			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1516348_1516349insTGG								CRIPAK (126566 upstream) : FAM53A (125260 downstream)																							ggtggtggtgatggtggtgatg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3634306	3634306	+	IGR	DEL	C	-	-	rs67244989		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3634306delC								LRPAP1 (100082 upstream) : ADRA2C (133769 downstream)																							CACCTCAGTTCCTGCAGTGCC	0.378													4	3	---	---	---	---	
CRMP1	1400	broad.mit.edu	37	4	5818412	5818412	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5818412delC	uc003gin.1	-						EVC_uc003gim.1_Intron			Q14194	DPYL1_HUMAN	SubName: Full=cDNA FLJ37406 fis, clone BRAMY2028282, highly similar to Dihydropyrimidinase-related protein 1; SubName: Full=Collapsin response mediator protein 1, isoform CRA_d;						axon guidance|pyrimidine base catabolic process	cytosol|microtubule organizing center|spindle	dihydropyrimidinase activity|protein binding			ovary(2)	2				Colorectal(103;0.0721)		ttccctccctcccttcccttc	0.000													4	2	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7224247	7224248	+	Intron	INS	-	G	G	rs143755437	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7224247_7224248insG	uc003gkb.3	+							NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						ggcatggtgatgaagcactcgt	0.000													5	4	---	---	---	---	
ABLIM2	84448	broad.mit.edu	37	4	8072898	8072898	+	Intron	DEL	C	-	-	rs33972489		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8072898delC	uc003gko.2	-						ABLIM2_uc003gkl.2_Intron|ABLIM2_uc003gkj.3_Intron|ABLIM2_uc003gkm.3_Intron|ABLIM2_uc003gkp.2_Intron|ABLIM2_uc003gkq.2_Intron|ABLIM2_uc003gkr.2_Intron|ABLIM2_uc003gks.3_Intron|ABLIM2_uc011bwl.1_Intron	NM_001130084	NP_001123556	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2						axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding			pancreas(3)	3						GGGGGCAGCGCCATCCGTCCC	0.677													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	8794573	8794576	+	IGR	DEL	CACA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8794573_8794576delCACA								CPZ (173087 upstream) : HMX1 (74197 downstream)																							cacgtgtgcgcacacacacagaga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9792059	9792059	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9792059delC								DRD5 (6427 upstream) : SLC2A9 (35791 downstream)																							GGAAAGCATGCCCAGTATGGC	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	11203129	11203131	+	IGR	DEL	CCA	-	-	rs34606866		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11203129_11203131delCCA								CLNK (516743 upstream) : MIR572 (167320 downstream)																							CCAAGAGAAGCCACCACCACCAC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	11889326	11889339	+	IGR	DEL	CTAATATCATCATC	-	-	rs139973880		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11889326_11889339delCTAATATCATCATC								HS3ST1 (458789 upstream) : None (None downstream)																							agaccagaggctaatatcatcatccagcattatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13922020	13922021	+	Intron	DEL	CA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13922020_13922021delCA	uc003gna.1	+											Homo sapiens cDNA FLJ34570 fis, clone KIDNE2008072.																		TACATGTGTGCACACACACACT	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	14055488	14055489	+	IGR	INS	-	AC	AC	rs147393434	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14055488_14055489insAC								BOD1L (426160 upstream) : CPEB2 (950033 downstream)																							AGTTTTTCAGTacacacacaca	0.282													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	17245187	17245187	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17245187delA								LDB2 (344763 upstream) : QDPR (242833 downstream)																							actctgtctcaaaaaaaaaaa	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	17394538	17394539	+	IGR	INS	-	G	G	rs142891718		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17394538_17394539insG								LDB2 (494114 upstream) : QDPR (93481 downstream)																							gggtggaaggaaaaaagaaaga	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	26139995	26139996	+	IGR	INS	-	A	A	rs71641799		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26139995_26139996insA								C4orf52 (208495 upstream) : RBPJ (181336 downstream)																							TGGCACTAGAGAAAAAAAAAAA	0.446													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	32415130	32415131	+	IGR	INS	-	A	A	rs145258721	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32415130_32415131insA								None (None upstream) : None (None downstream)																							tcagacaagacaaaaaaaaagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33842579	33842579	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33842579delA								None (None upstream) : None (None downstream)																							TAAAAGACATAAATAGAAGTA	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33861276	33861279	+	IGR	DEL	TTAT	-	-	rs113847075		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33861276_33861279delTTAT								None (None upstream) : None (None downstream)																							AATTTTCAAGTTATTTTTTTCAAA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	37736575	37736575	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37736575delA								RELL1 (48576 upstream) : PGM2 (91707 downstream)																							tttaagcggtaactgggtcat	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38272627	38272628	+	IGR	DEL	AC	-	-	rs71641340		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38272627_38272628delAC								TBC1D1 (131834 upstream) : FLJ13197 (341694 downstream)																							GTATTCCATAacacacacacac	0.252													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38309359	38309359	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38309359delT								TBC1D1 (168566 upstream) : FLJ13197 (304963 downstream)																							cccagatgtgtttataaagtt	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	39397440	39397443	+	IGR	DEL	TTCT	-	-	rs111782171		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39397440_39397443delTTCT								RFC1 (29445 upstream) : KLB (11030 downstream)																							ttctttttccttctttcttccttt	0.108													4	4	---	---	---	---	
PDS5A	23244	broad.mit.edu	37	4	39974654	39974663	+	Intron	DEL	TTTTGCAATT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39974654_39974663delTTTTGCAATT	uc003guv.3	-						PDS5A_uc010ifo.2_Intron|PDS5A_uc003guw.3_Intron	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						ttattttatattttGCAATTTTTTTTTCCA	0.286													4	2	---	---	---	---	
APBB2	323	broad.mit.edu	37	4	41125119	41125120	+	Intron	DEL	CT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41125119_41125120delCT	uc003gvl.2	-						APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						cttgccccagctctctctctct	0.000													4	2	---	---	---	---	
CWH43	80157	broad.mit.edu	37	4	49027279	49027279	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49027279delT	uc003gyv.2	+						CWH43_uc011bzl.1_Intron	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog						GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						tcctgtatcattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49214065	49214066	+	IGR	INS	-	A	A	rs111752255		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49214065_49214066insA								CWH43 (149972 upstream) : None (None downstream)																							gccgtagctgggaccccagttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49239290	49239290	+	5'Flank	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49239290delA	uc003gyy.2	-											DQ587539																		gccagaaattaaaaaagtgct	0.055													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49255712	49255712	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49255712delA								CWH43 (191619 upstream) : None (None downstream)																							AACTTGGGGGAAAAAAAAGAG	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53420814	53420817	+	IGR	DEL	TCTC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53420814_53420817delTCTC								SPATA18 (457357 upstream) : USP46 (36312 downstream)																							ATTCATTTATtctctctctctctc	0.304													5	3	---	---	---	---	
SRD5A3	79644	broad.mit.edu	37	4	56236599	56236600	+	3'UTR	DEL	CA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56236599_56236600delCA	uc003hau.2	+	5					uc003hav.1_Intron|uc003haw.1_Intron	NM_024592	NP_078868	Q9H8P0	PORED_HUMAN	steroid 5 alpha-reductase 3						androgen biosynthetic process|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|polyprenol catabolic process	endoplasmic reticulum membrane|integral to membrane	3-oxo-5-alpha-steroid 4-dehydrogenase activity|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor				0	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.0179)			CAAACAGCTTcacacacacaca	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	56929233	56929237	+	IGR	DEL	GAAAG	-	-	rs112714276		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56929233_56929237delGAAAG								CEP135 (29707 upstream) : KIAA1211 (107124 downstream)																							aaggaaggaagaaaggaaaggaagg	0.229													4	2	---	---	---	---	
AASDH	132949	broad.mit.edu	37	4	57205996	57205997	+	Intron	INS	-	AG	AG	rs145660500	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57205996_57205997insAG	uc003hbn.2	-						AASDH_uc010ihb.2_Intron|AASDH_uc011caa.1_Intron|AASDH_uc003hbo.2_Intron|AASDH_uc011cab.1_Intron|AASDH_uc010ihc.2_Intron	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase						fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TGTAGGAAAAAAGTTAATTGTG	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57554167	57554169	+	IGR	DEL	GAA	-	-	rs62309878		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57554167_57554169delGAA								HOPX (6295 upstream) : SPINK2 (121865 downstream)																							aggaaagaaggaaggagggaggg	0.044													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	61022132	61022133	+	IGR	INS	-	AAAC	AAAC	rs113216528		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61022132_61022133insAAAC								None (None upstream) : None (None downstream)																							gggtaatggaaaaacaaacaaa	0.000													2	4	---	---	---	---	
LPHN3	23284	broad.mit.edu	37	4	62333208	62333209	+	Intron	DEL	GA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62333208_62333209delGA	uc003hcq.3	+						LPHN3_uc010ihg.1_Intron			Q9HAR2	LPHN3_HUMAN	RecName: Full=Latrophilin-3; AltName: Full=Calcium-independent alpha-latrotoxin receptor 3; AltName: Full=Lectomedin-3; Flags: Precursor;						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						GTGTGTGTGTgagagagagaga	0.252													4	2	---	---	---	---	
UBA6	55236	broad.mit.edu	37	4	68531151	68531152	+	Intron	INS	-	TG	TG	rs60372702		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68531151_68531152insTG	uc003hdg.3	-						UBA6_uc003hdi.2_Intron|UBA6_uc003hdj.2_Intron	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2						protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0						gtttgtttgttttttttttttt	0.213													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	71674935	71674936	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71674935_71674936insA								RUFY3 (600 upstream) : GRSF1 (6563 downstream)																							gattccatctcaaaaaaaaaaa	0.173													4	2	---	---	---	---	
RCHY1	25898	broad.mit.edu	37	4	76431851	76431851	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76431851delA	uc003hik.2	-						RCHY1_uc003hij.2_Intron|RCHY1_uc003hil.2_Intron|RCHY1_uc010iip.2_Intron|RCHY1_uc010iiq.2_Intron|RCHY1_uc010iir.2_Intron	NM_015436	NP_056251	Q96PM5	ZN363_HUMAN	ring finger and CHY zinc finger domain						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein autoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nuclear speck|ubiquitin ligase complex	electron carrier activity|p53 binding|protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			pancreas(1)	1			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			gaaatacaggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	83391655	83391656	+	IGR	INS	-	CT	CT	rs148094743	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83391655_83391656insCT								ENOPH1 (9412 upstream) : TMEM150C (13948 downstream)																							ATCATTCCCCCGTCTCCTTCCA	0.475													3	4	---	---	---	---	
WDFY3	23001	broad.mit.edu	37	4	85726062	85726062	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85726062delT	uc003hpd.2	-							NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GGAAGAAATCTTTACATCTTT	0.194													4	2	---	---	---	---	
AFF1	4299	broad.mit.edu	37	4	87995458	87995458	+	Intron	DEL	A	-	-	rs111573847		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87995458delA	uc003hqj.3	+						AFF1_uc003hqh.1_Intron|AFF1_uc011ccy.1_Intron|AFF1_uc011ccz.1_Intron|AFF1_uc003hqk.3_Intron|AFF1_uc011cda.1_Intron	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia							nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		TGATGCCTTTAAAAAAAAAAA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	90915544	90915545	+	IGR	INS	-	TGTG	TGTG	rs139657601	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90915544_90915545insTGTG								MMRN1 (39766 upstream) : FAM190A (133139 downstream)																							ataagtaagtatgtgtgtgtgt	0.208													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	93036725	93036725	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93036725delT								FAM190A (513356 upstream) : GRID2 (188825 downstream)																							catagtgatatagacaatgag	0.000													4	2	---	---	---	---	
PDLIM5	10611	broad.mit.edu	37	4	95543777	95543780	+	Intron	DEL	CTCC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95543777_95543780delCTCC	uc003hti.2	+						PDLIM5_uc011cdx.1_Intron|PDLIM5_uc003hth.2_Intron|PDLIM5_uc003htj.2_Intron|PDLIM5_uc003htk.2_Intron|PDLIM5_uc011cdy.1_Intron|PDLIM5_uc003htl.2_Intron	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a						regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TTTtccctctctccctccctcctt	0.211													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	99147924	99147925	+	IGR	DEL	TG	-	-	rs34401876		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99147924_99147925delTG								C4orf37 (83533 upstream) : RAP1GDS1 (34602 downstream)																							AATACATATTtgtgtgtgtgtg	0.327													4	2	---	---	---	---	
ADH5	128	broad.mit.edu	37	4	100009952	100009953	+	5'Flank	INS	-	G	G	rs145470085	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100009952_100009953insG	uc003hui.2	-						ADH5_uc003huk.1_5'Flank|uc003hum.1_5'Flank|uc003hul.1_5'Flank	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	GGGCGGGGCGTGGGGGGGGCTT	0.723													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	100374470	100374470	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100374470delT								ADH7 (17945 upstream) : C4orf17 (57730 downstream)																							agttcttgacttttttttttt	0.000													4	2	---	---	---	---	
PPP3CA	5530	broad.mit.edu	37	4	102006188	102006189	+	Intron	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102006188_102006189insA	uc011cen.1	-						PPP3CA_uc003hvu.2_Intron|PPP3CA_uc010ilj.2_Intron|PPP3CA_uc003hvt.2_Intron|PPP3CA_uc003hvs.2_Intron|PPP3CA_uc010ilk.2_Intron	NM_000944	NP_000935	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha						protein dephosphorylation	calcineurin complex|cytosol|nucleus	calcium ion binding|calmodulin binding			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		GTGTGTCAGAGAAAaaaaacaa	0.322													4	2	---	---	---	---	
COL25A1	84570	broad.mit.edu	37	4	110059447	110059447	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110059447delC	uc003hze.1	-						COL25A1_uc003hzg.2_Intron|COL25A1_uc003hzh.1_Intron	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN	collagen, type XXV, alpha 1 isoform 1							collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		ccagcttcatccatgtccctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	128777560	128777560	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128777560delG								HSPA4L (23038 upstream) : PLK4 (24485 downstream)																							ccatttggcaggggtacaggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	132762632	132762633	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:132762632_132762633insT								None (None upstream) : None (None downstream)																							ttctttctttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	133558758	133558758	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133558758delT								None (None upstream) : PCDH10 (511712 downstream)																							cctctatctcttttttgcttc	0.025													4	2	---	---	---	---	
CCRN4L	25819	broad.mit.edu	37	4	139964674	139964675	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139964674_139964675insT	uc003ihl.2	+						CCRN4L_uc003ihk.1_3'UTR	NM_012118	NP_036250	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like						rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_hematologic(180;0.162)					CTGGTTTTCACTTTTTTTTTTT	0.381													4	2	---	---	---	---	
INPP4B	8821	broad.mit.edu	37	4	143626612	143626613	+	Intron	DEL	AC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143626612_143626613delAC	uc003iix.3	-						INPP4B_uc003iiw.3_Intron	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					cccaccccaaacacacacacac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	145477185	145477186	+	IGR	DEL	GT	-	-	rs71832426		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145477185_145477186delGT								GYPA (415281 upstream) : HHIP (89987 downstream)																							GCGCACGAGCgtgtgtgtgtgt	0.371													4	2	---	---	---	---	
TLR2	7097	broad.mit.edu	37	4	154620531	154620531	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154620531delA	uc003inq.2	+						TLR2_uc003inr.2_Intron|TLR2_uc003ins.2_Intron	NM_003264	NP_003255	O60603	TLR2_HUMAN	toll-like receptor 2 precursor						cellular response to diacyl bacterial lipopeptide|cellular response to lipoteichoic acid|cellular response to triacyl bacterial lipopeptide|detection of diacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|I-kappaB phosphorylation|induction of apoptosis|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of interferon-beta production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of Wnt receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|integral to plasma membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	Gram-positive bacterial cell surface binding|lipopolysaccharide receptor activity|peptidoglycan binding|protein heterodimerization activity|transmembrane receptor activity|triacyl lipopeptide binding			ovary(1)|lung(1)|breast(1)	3	all_hematologic(180;0.093)	Renal(120;0.117)				actatggtataaaaaggaact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	168741275	168741276	+	IGR	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168741275_168741276delTG								SPOCK3 (585534 upstream) : ANXA10 (272431 downstream)																							tgtgtgtgcatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	180304218	180304219	+	IGR	DEL	CA	-	-	rs141343454	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180304218_180304219delCA								None (None upstream) : None (None downstream)																							TCAGATTTCCCAAAGTCATTGA	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	180931685	180931686	+	IGR	DEL	CA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180931685_180931686delCA								None (None upstream) : None (None downstream)																							CACACGCTGTCACCACTTTTCC	0.386													4	2	---	---	---	---	
WWC2	80014	broad.mit.edu	37	4	184241552	184241552	+	3'UTR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184241552delA	uc010irx.2	+	23					WWC2_uc003ivk.3_3'UTR|WWC2_uc003ivl.3_RNA|WWC2_uc010iry.2_3'UTR|WWC2_uc003ivn.3_3'UTR|WWC2_uc010irz.2_3'UTR|WWC2_uc003ivo.3_3'UTR|CLDN22_uc010isa.1_5'UTR	NM_024949	NP_079225	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2											ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		ACAAAAGGATAGGGAAATAAT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190622694	190622696	+	IGR	DEL	AGA	-	-	rs5865275		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190622694_190622696delAGA								None (None upstream) : FRG1 (239278 downstream)																							aggtgaacctagaagaagtagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190842435	190842436	+	Intron	INS	-	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190842435_190842436insC	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		tagaagaaaaaaacagtgagct	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1845969	1845974	+	IGR	DEL	TCTCTA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1845969_1845974delTCTCTA								NDUFS6 (29806 upstream) : IRX4 (31567 downstream)																							tctgtctctgtctctatctctatatg	0.000													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8050308	8050316	+	IGR	DEL	AAGTTAAGT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8050308_8050316delAAGTTAAGT								MTRR (149075 upstream) : SEMA5A (984822 downstream)																							aagggaagggaagttaagtaagtaaggaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8401224	8401225	+	Intron	INS	-	A	A	rs66608235		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8401224_8401225insA	uc003jeh.1	-											Homo sapiens cDNA clone IMAGE:5297486.																		GTGGCAAGTGCAAAAAAAAAAA	0.495													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10316746	10316746	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10316746delT								CMBL (8578 upstream) : MARCH6 (37082 downstream)																							gccctgctccttctgcttctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	29451564	29451565	+	IGR	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29451564_29451565delTC								None (None upstream) : None (None downstream)																							tactacgctgtctctctgATGT	0.045													4	2	---	---	---	---	
SLC1A3	6507	broad.mit.edu	37	5	36668570	36668570	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36668570delG	uc003jkj.3	+						SLC1A3_uc011cox.1_Intron|SLC1A3_uc010iuy.2_Intron	NM_004172	NP_004163	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity						D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)	TAGGGTACCTGGAACAGAGGT	0.463													4	2	---	---	---	---	
NIPBL	25836	broad.mit.edu	37	5	37027705	37027706	+	Intron	INS	-	TT	TT	rs402065		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37027705_37027706insTT	uc003jkl.3	+						NIPBL_uc003jkk.3_Intron	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A						brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CCTGGTTGTGGttttttttttt	0.149													4	2	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37351555	37351555	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37351555delT	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TACTCAAttcttttttttttt	0.124													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	40075475	40075475	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40075475delT								DAB2 (650140 upstream) : PTGER4 (604557 downstream)																							ATCTGATGTCttttttttttt	0.249													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	42202623	42202624	+	IGR	INS	-	AAAG	AAAG	rs144656896	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42202623_42202624insAAAG								FBXO4 (260960 upstream) : GHR (221402 downstream)																							CATGGCCTAATAGAGGTTTTTA	0.332													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	46335643	46335644	+	IGR	INS	-	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46335643_46335644insC								HCN1 (639423 upstream) : None (None downstream)																							aatgaaagaaagttcaacactg	0.000													4	2	---	---	---	---	
ARL15	54622	broad.mit.edu	37	5	53579514	53579514	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53579514delC	uc003jpg.1	-						ARL15_uc010ivs.1_Intron	NM_019087	NP_061960	Q9NXU5	ARL15_HUMAN	ADP-ribosylation factor-like 15								GTP binding			ovary(1)	1		Lung NSC(810;0.000779)				CCAAGTTGTACCTTTGTAACA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	54349690	54349690	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54349690delT								GZMK (19730 upstream) : GZMA (48784 downstream)																							CAGCAGCAGATTTTGAGTTTA	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	54908452	54908453	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54908452_54908453insT								PPAP2A (77579 upstream) : SLC38A9 (13223 downstream)																							CTCttcttttctttttttttag	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	61244383	61244383	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61244383delC								FLJ37543 (242021 upstream) : KIF2A (357606 downstream)																							ttcctaacatcccagcaggcc	0.279													4	2	---	---	---	---	
NLN	57486	broad.mit.edu	37	5	65103004	65103004	+	Intron	DEL	A	-	-	rs112290196		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65103004delA	uc003juf.2	+						NLN_uc003jug.2_Intron|NLN_uc010iww.2_Intron	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor						proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		accctgtctcaaaaaaaaaaa	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	76841052	76841052	+	IGR	DEL	A	-	-	rs34064893		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76841052delA								WDR41 (52720 upstream) : OTP (83486 downstream)																							gaaagagcacaaacaatctaa	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	79695248	79695249	+	IGR	DEL	TT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79695248_79695249delTT								LOC441089 (47463 upstream) : ZFYVE16 (8589 downstream)																							aacaacaaggtttttttttttt	0.069													4	2	---	---	---	---	
MSH3	4437	broad.mit.edu	37	5	80060335	80060336	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80060335_80060336insT	uc003kgz.2	+							NM_002439	NP_002430	P20585	MSH3_HUMAN	mutS homolog 3						maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		atgcccagctattttttttttt	0.000								MMR					4	2	---	---	---	---	
SSBP2	23635	broad.mit.edu	37	5	80735987	80735988	+	Intron	DEL	TG	-	-	rs10607787		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80735987_80735988delTG	uc003kho.2	-						RNU5E_uc011cto.1_Intron|SSBP2_uc010jar.2_Intron|SSBP2_uc003khn.2_Intron|SSBP2_uc003khp.2_Intron|SSBP2_uc011ctp.1_Intron|SSBP2_uc011ctq.1_Intron|SSBP2_uc011ctr.1_Intron	NM_012446	NP_036578	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2						regulation of transcription, DNA-dependent	cytoplasm|nucleus	single-stranded DNA binding		SSBP2/JAK2(4)	haematopoietic_and_lymphoid_tissue(4)|skin(1)	5		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		CTTCTGAGACTGTGTCCACAGA	0.307													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	81256788	81256792	+	IGR	DEL	TTTTA	-	-	rs142325804		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81256788_81256792delTTTTA								SSBP2 (209716 upstream) : ATG10 (11052 downstream)																							Attttgttgtttttattttatttta	0.195													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	81721356	81721357	+	IGR	INS	-	GAG	GAG	rs28539924		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81721356_81721357insGAG								ATP6AP1L (107210 upstream) : TMEM167A (627310 downstream)																							aggaggaggaggaggaggtgga	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	88972468	88972469	+	IGR	INS	-	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88972468_88972469insC								MEF2C (772599 upstream) : CETN3 (717062 downstream)																							CAATTTAAAAATTTGAACAGCC	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	97622417	97622418	+	IGR	DEL	AC	-	-	rs111451200		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97622417_97622418delAC								None (None upstream) : RGMB (482581 downstream)																							GGTCCACAGTacacacacacac	0.193													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	105208993	105208993	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105208993delA								RAB9BP1 (773195 upstream) : None (None downstream)																							tgtagcttttaaaaatctttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	107174120	107174120	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107174120delA								EFNA5 (167524 upstream) : FBXL17 (20620 downstream)																							agaaacttagaaaagggaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	109209627	109209628	+	IGR	INS	-	TAAG	TAAG	rs142436281	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109209627_109209628insTAAG								MAN2A1 (6198 upstream) : TMEM232 (415306 downstream)																							ACTTGAGTGACTAAGTCCACTC	0.475													3	3	---	---	---	---	
AQPEP	206338	broad.mit.edu	37	5	115298087	115298087	+	5'Flank	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115298087delG	uc003kro.2	+						AQPEP_uc003krp.2_5'Flank|uc003krn.1_Frame_Shift_Del_p.P77fs	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin						proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0						GGCGCTGGCCGGGGGCGGGGG	0.667													4	2	---	---	---	---	
TNFAIP8	25816	broad.mit.edu	37	5	118708018	118708018	+	Intron	DEL	A	-	-	rs148761906		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118708018delA	uc003ksh.2	+						TNFAIP8_uc003ksf.1_Intron|TNFAIP8_uc003ksg.2_Intron|TNFAIP8_uc011cwf.1_Intron|TNFAIP8_uc003ksi.2_Intron	NM_014350	NP_055165	O95379	TFIP8_HUMAN	tumor necrosis factor, alpha-induced protein 8						anti-apoptosis|apoptosis|negative regulation of anti-apoptosis	cytoplasm	caspase inhibitor activity|protein binding			ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)		accctgtctcaaaaaaaaaaa	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	120704517	120704517	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120704517delA								PRR16 (681555 upstream) : FTMT (483133 downstream)																							tcattaacataaaaaaaattt	0.000													4	2	---	---	---	---	
LYRM7	90624	broad.mit.edu	37	5	130532364	130532364	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130532364delT	uc003kvg.1	+							NM_181705	NP_859056	Q5U5X0	LYRM7_HUMAN	Lyrm7 homolog												0		all_cancers(142;0.0377)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			tctgtatttcttttttttttt	0.000													4	2	---	---	---	---	
CDC42SE2	56990	broad.mit.edu	37	5	130630322	130630322	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130630322delG	uc003kvh.2	+						CDC42SE2_uc003kvi.2_Intron|CDC42SE2_uc003kvj.2_Intron|CDC42SE2_uc003kvk.2_Intron	NM_020240	NP_064625	Q9NRR3	C42S2_HUMAN	CDC42 small effector 2						phagocytosis|regulation of cell shape|regulation of signal transduction	cell projection|cytoplasm|cytoskeleton|phagocytic cup	protein binding|structural molecule activity				0		all_cancers(142;0.0525)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			gtgactactagggtagggaac	0.025													4	2	---	---	---	---	
SEC24A	10802	broad.mit.edu	37	5	134017933	134017933	+	Intron	DEL	A	-	-	rs79922505		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134017933delA	uc003kzs.2	+						SEC24A_uc011cxu.1_Intron	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			actctgtctcaaaaaaaaaaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	134450325	134450325	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134450325delC	uc003laj.1	+											Homo sapiens cDNA: FLJ23312 fis, clone HEP11874.																		ctcccctgttcccccccccac	0.169													4	2	---	---	---	---	
HSPA9	3313	broad.mit.edu	37	5	137897634	137897634	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137897634delT	uc003ldf.2	-						HSPA9_uc011cyw.1_Intron|SNORD63_uc003ldg.2_5'Flank	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCAAGAATACttttttttttt	0.174													4	2	---	---	---	---	
NRG2	9542	broad.mit.edu	37	5	139343943	139343944	+	Intron	DEL	AC	-	-	rs3056591		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139343943_139343944delAC	uc003lex.1	-						NRG2_uc003lev.1_Intron|NRG2_uc003lew.1_Intron|NRG2_uc003ley.1_Intron	NM_004883	NP_004874	O14511	NRG2_HUMAN	neuregulin 2 isoform 1						embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|breast(2)|ovary(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			aaatacagatacacacacacac	0.337													4	2	---	---	---	---	
HBEGF	1839	broad.mit.edu	37	5	139713521	139713522	+	3'UTR	DEL	TT	-	-	rs71783691		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139713521_139713522delTT	uc003lfi.2	-	6					HBEGF_uc010jfj.2_RNA	NM_001945	NP_001936	Q99075	HBEGF_HUMAN	heparin-binding EGF-like growth factor						epidermal growth factor receptor signaling pathway|muscle organ development|positive regulation of protein kinase B signaling cascade|positive regulation of wound healing	cell surface|extracellular space|integral to plasma membrane	epidermal growth factor receptor binding|eukaryotic cell surface binding|growth factor activity|heparin binding|receptor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			cttcttcttctttttttttttc	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	144041078	144041081	+	IGR	DEL	ACAT	-	-	rs145247086	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:144041078_144041081delACAT								KCTD16 (184134 upstream) : None (None downstream)																							acacacacacacatgcacacacac	0.275													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	144548996	144548997	+	IGR	DEL	TG	-	-	rs149988092		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:144548996_144548997delTG								KCTD16 (692052 upstream) : PRELID2 (589585 downstream)																							tgtgtgtgtttgtgtgtgtgtg	0.332													3	3	---	---	---	---	
PPP2R2B	5521	broad.mit.edu	37	5	146397603	146397610	+	Intron	DEL	CGCGCACA	-	-	rs72258825		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146397603_146397610delCGCGCACA	uc011dbv.1	-						PPP2R2B_uc003loi.3_Intron|PPP2R2B_uc003loh.3_Intron|PPP2R2B_uc003loj.3_Intron|PPP2R2B_uc003lok.3_Intron|PPP2R2B_uc011dbu.1_Intron	NM_181675	NP_858061	Q00005	2ABB_HUMAN	beta isoform of regulatory subunit B55, protein						apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			catgcatgcgcgcgcacacacacacaca	0.245													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	149866588	149866588	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149866588delC								RPS14 (37269 upstream) : NDST1 (10752 downstream)																							CAGAGCCCCACCCCCTGAACG	0.587													2	4	---	---	---	---	
DCTN4	51164	broad.mit.edu	37	5	150102363	150102363	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150102363delT	uc003lsv.2	-						DCTN4_uc003lsu.2_Intron|DCTN4_uc010jhi.2_Intron	NM_016221	NP_057305	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62) isoform b							centrosome|nucleus	protein N-terminus binding			central_nervous_system(1)	1		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTTGATGTAATTTTTTTTTTT	0.303													4	2	---	---	---	---	
GRIA1	2890	broad.mit.edu	37	5	153157749	153157760	+	Intron	DEL	GAGAGTGTGTGT	-	-	rs140073761	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153157749_153157760delGAGAGTGTGTGT	uc003lva.3	+						GRIA1_uc003luy.3_Intron|GRIA1_uc003luz.3_Intron|GRIA1_uc011dcv.1_Intron|GRIA1_uc011dcw.1_Intron|GRIA1_uc011dcx.1_Intron|GRIA1_uc011dcy.1_Intron|GRIA1_uc011dcz.1_Intron	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform						synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	gagagagagagagagtgtgtgtgtgtgtgtgt	0.179													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	154659165	154659166	+	IGR	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154659165_154659166delTG								KIF4B (261480 upstream) : SGCD (475897 downstream)																							catgcatgcatgtgtgtgtgtg	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	159574738	159574739	+	IGR	INS	-	TCTT	TCTT	rs149884969	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159574738_159574739insTCTT								PWWP2A (28286 upstream) : FABP6 (39635 downstream)																							ttctcaatctctctctttccct	0.059													5	3	---	---	---	---	
CCNJL	79616	broad.mit.edu	37	5	159726620	159726620	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159726620delA	uc003lyb.1	-						CCNJL_uc011dee.1_Intron|CCNJL_uc003lyc.1_Intron|CCNJL_uc011def.1_Intron	NM_024565	NP_078841	Q8IV13	CCNJL_HUMAN	cyclin J-like							nucleus					0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ttgttatgttaaaaaaaaaaa	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	165673674	165673675	+	IGR	DEL	GT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165673674_165673675delGT								None (None upstream) : None (None downstream)																							CTATTGGGCAgtgtgtgtgtgt	0.168													4	3	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167108938	167108939	+	Intron	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167108938_167108939delTG	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		CTCTTAGGCAtgtgtgtgtgtg	0.287													3	3	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168509578	168509579	+	Intron	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168509578_168509579delTG	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCTGTCTCTATGTGTGTGTGTG	0.243													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	168782223	168782224	+	IGR	INS	-	A	A	rs150621084	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168782223_168782224insA								SLIT3 (54090 upstream) : CCDC99 (228414 downstream)																							GGGGCTTAAAGAAAAAAAAAAC	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	168995333	168995334	+	IGR	INS	-	GTGT	GTGT	rs140842495	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168995333_168995334insGTGT								SLIT3 (267200 upstream) : CCDC99 (15304 downstream)																							TCtgtgtgtgcgtgtgtgtgtg	0.094													3	3	---	---	---	---	
KCNIP1	30820	broad.mit.edu	37	5	169834981	169834981	+	Intron	DEL	G	-	-	rs140059419		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169834981delG	uc003map.2	+							NM_001034838	NP_001030010	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1 isoform 3						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			tgtgacttaagtcaaatagct	0.119													3	4	---	---	---	---	
GABRP	2568	broad.mit.edu	37	5	170230746	170230747	+	Intron	INS	-	TGGT	TGGT	rs149998986	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170230746_170230747insTGGT	uc003mau.2	+						GABRP_uc011dev.1_Intron	NM_014211	NP_055026	O00591	GBRP_HUMAN	gamma-aminobutyric acid (GABA) A receptor, pi							cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			breast(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			catgcactatgtggttggttgg	0.000													6	3	---	---	---	---	
FBXW11	23291	broad.mit.edu	37	5	171421709	171421711	+	Intron	DEL	ACC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171421709_171421711delACC	uc003mbm.1	-						FBXW11_uc011dey.1_Intron|FBXW11_uc003mbl.1_Intron|FBXW11_uc003mbn.1_Intron	NM_012300	NP_036432	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11 isoform						cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of circadian rhythm|positive regulation of proteolysis|positive regulation of transcription, DNA-dependent|protein dephosphorylation|protein destabilization|protein polyubiquitination|rhythmic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	centrosome|cytosol|nucleus|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(1)|breast(1)	2	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			Taccattactaccaccaccacca	0.094													4	2	---	---	---	---	
STK10	6793	broad.mit.edu	37	5	171571152	171571152	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171571152delG	uc003mbo.1	-							NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10								ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			gaggtttggtgggggaagggg	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172736283	172736284	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172736283_172736284insT								NKX2-5 (74021 upstream) : STC2 (5442 downstream)																							ttttgtttttgttttttttttC	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174027160	174027160	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174027160delA								HMP19 (490979 upstream) : MSX2 (124415 downstream)																							ccagatcactaaaaggactgc	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	175361487	175361488	+	IGR	INS	-	A	A	rs145761351	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175361487_175361488insA								CPLX2 (50464 upstream) : THOC3 (25048 downstream)																							caaagaaatgcaaaaaaaaaag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	176041178	176041179	+	IGR	INS	-	CA	CA	rs34776014		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176041178_176041179insCA								GPRIN1 (4047 upstream) : SNCB (6032 downstream)																							ACCCCTGCGCGCGCGcacacac	0.436													5	5	---	---	---	---	
BTNL9	153579	broad.mit.edu	37	5	180486891	180486892	+	3'UTR	INS	-	G	G	rs151240170	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180486891_180486892insG	uc003mmt.2	+	11						NM_152547	NP_689760	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9 precursor							integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGACTGGCCCCGGGGGGCCCCC	0.683													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	1274370	1274370	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1274370delC								LOC285768 (172803 upstream) : FOXQ1 (38305 downstream)																							CTCCTCCCAGCCACCCCCATC	0.502													4	2	---	---	---	---	
GMDS	2762	broad.mit.edu	37	6	2037739	2037739	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2037739delA	uc003mtq.2	-							NM_001500	NP_001491	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase						'de novo' GDP-L-fucose biosynthetic process|GDP-mannose metabolic process|leukocyte cell-cell adhesion		coenzyme binding|GDP-mannose 4,6-dehydratase activity			central_nervous_system(1)	1	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		GAGTAGCAGGAAAGAAAACTC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	2663626	2663627	+	IGR	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2663626_2663627delTC								C6orf195 (28328 upstream) : MYLK4 (237 downstream)																							tcgctgtctgtctctctctctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	2853865	2853866	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2853865_2853866insA								SERPINB1 (11784 upstream) : SERPINB9 (33640 downstream)																							tcctggagccccctcccctctc	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	2942997	2942998	+	IGR	DEL	CC	-	-	rs138688222	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2942997_2942998delCC								SERPINB9 (39452 upstream) : SERPINB6 (5396 downstream)																							ctctctctctccctctctctct	0.000													4	2	---	---	---	---	
SLC22A23	63027	broad.mit.edu	37	6	3352340	3352341	+	Intron	INS	-	G	G	rs149896117	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3352340_3352341insG	uc003mvm.3	-						SLC22A23_uc003mvn.3_Intron|SLC22A23_uc003mvo.3_Intron|SLC22A23_uc003mvp.1_Intron|SLC22A23_uc010jnn.2_Intron|SLC22A23_uc010jno.2_Intron	NM_015482	NP_056297	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23 isoform a						ion transport	integral to membrane	transmembrane transporter activity			ovary(1)	1	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				GCAGAGGCCATGGCAAAACCAG	0.594													3	3	---	---	---	---	
SLC22A23	63027	broad.mit.edu	37	6	3352506	3352507	+	Intron	DEL	CA	-	-	rs72037226		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3352506_3352507delCA	uc003mvm.3	-						SLC22A23_uc003mvn.3_Intron|SLC22A23_uc003mvo.3_Intron|SLC22A23_uc003mvp.1_Intron|SLC22A23_uc010jnn.2_Intron|SLC22A23_uc010jno.2_Intron	NM_015482	NP_056297	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23 isoform a						ion transport	integral to membrane	transmembrane transporter activity			ovary(1)	1	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				cacagacatgcacacacacaca	0.149													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	6080756	6080757	+	IGR	DEL	AC	-	-	rs35447426		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6080756_6080757delAC								NRN1 (73123 upstream) : F13A1 (63555 downstream)																							GGATAGGGAAacacacacacac	0.441													3	3	---	---	---	---	
LY86	9450	broad.mit.edu	37	6	6612749	6612750	+	Intron	INS	-	A	A	rs143724730	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6612749_6612750insA	uc003mwy.1	+						LOC285780_uc003mww.3_Intron|LOC285780_uc003mwx.2_Intron	NM_004271	NP_004262	O95711	LY86_HUMAN	MD-1, RP105-associated precursor						apoptosis|cell proliferation|humoral immune response|inflammatory response|innate immune response	extracellular space|plasma membrane					0	Ovarian(93;0.0377)					ctgcaaaaagcaaaagaacaaa	0.000													4	2	---	---	---	---	
NEDD9	4739	broad.mit.edu	37	6	11373387	11373387	+	Intron	DEL	A	-	-	rs60623673	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11373387delA	uc010joz.2	-						NEDD9_uc003mzw.3_Intron	NM_001142393	NP_001135865	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			Cataaaaattaaaaaaaaaaa	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	12411730	12411730	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12411730delA								EDN1 (114304 upstream) : PHACTR1 (305158 downstream)																							AGTATCAGATAATCTGTTTGG	0.398													4	2	---	---	---	---	
CCDC90A	63933	broad.mit.edu	37	6	13794350	13794350	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13794350delT	uc003nbd.2	-						CCDC90A_uc010jpf.2_Intron	NM_001031713	NP_001026883	Q96AQ8	CC90A_HUMAN	coiled-coil domain containing 90A precursor							integral to membrane|mitochondrion					0	Breast(50;0.0027)|Ovarian(93;0.0964)	all_hematologic(90;0.117)				TTGAGGtttcttttttttttt	0.199													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15962607	15962608	+	IGR	DEL	AG	-	-	rs72440939		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15962607_15962608delAG								DTNBP1 (299336 upstream) : MYLIP (166709 downstream)																							agagaatgacagagagagagag	0.356													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	17335796	17335797	+	IGR	INS	-	T	T	rs145099917	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17335796_17335797insT								RBM24 (41699 upstream) : CAP2 (57939 downstream)																							tgcccagACTGttttttttttc	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	22605346	22605347	+	IGR	INS	-	AC	AC	rs148909469	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22605346_22605347insAC								HDGFL1 (34597 upstream) : None (None downstream)																							cagacacacagacacacacaca	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	26705556	26705556	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26705556delC								ZNF322A (45593 upstream) : GUSBL1 (133710 downstream)																							GCCTTGAAATCCCCTGTGTTC	0.403													4	2	---	---	---	---	
HLA-G	3135	broad.mit.edu	37	6	29817735	29817738	+	Intron	DEL	AAAC	-	-	rs28728802		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29817735_29817738delAAAC	uc011dmb.1	+							NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						tctagaacataaacaaaaacaaag	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	31015839	31015839	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31015839delG								MUC21 (58164 upstream) : HCG22 (6145 downstream)																							catatttactggacacctgct	0.129													4	2	---	---	---	---	
CCHCR1	54535	broad.mit.edu	37	6	31121875	31121876	+	Intron	DEL	AA	-	-	rs10650214		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31121875_31121876delAA	uc003nsr.3	-						CCHCR1_uc011dne.1_Intron|CCHCR1_uc003nsq.3_Intron|CCHCR1_uc003nsp.3_Intron|CCHCR1_uc010jsk.1_Intron	NM_019052	NP_061925	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1 isoform						cell differentiation|multicellular organismal development	cytoplasm|nucleus	protein binding			skin(1)	1						tagagatggcaaagagtaagta	0.193													0	6	---	---	---	---	
HLA-B	3106	broad.mit.edu	37	6	31302617	31302618	+	Intron	INS	-	T	T	rs147915095	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31302617_31302618insT	uc003ntf.2	-						HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron			P01889	1B07_HUMAN	SubName: Full=MHC class I antigen;						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0						agggcattctctttaaagtgac	0.000									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				3	6	---	---	---	---	
MICA	4276	broad.mit.edu	37	6	31378225	31378226	+	Intron	INS	-	CCT	CCT			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31378225_31378226insCCT	uc003ntk.1	+						MICA_uc003rxz.1_Intron					RecName: Full=MHC class I polypeptide-related sequence A;          Short=MIC-A; Flags: Precursor;												0		Ovarian(999;0.0253)				TGCATTTCCTGCCCCAGGAAGG	0.490													10	8	---	---	---	---	
MCCD1	401250	broad.mit.edu	37	6	31494276	31494276	+	5'Flank	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31494276delT	uc003ntp.1	+							NM_001011700	NP_001011700	P59942	MCCD1_HUMAN	mitochondrial coiled-coil domain 1 precursor							mitochondrion					0						atactgaagatttgtttccag	0.189													4	2	---	---	---	---	
MSH5	4439	broad.mit.edu	37	6	31721511	31721511	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31721511delT	uc003nwv.1	+						MSH5_uc003nwt.1_Intron|MSH5_uc003nwu.1_Intron|MSH5_uc003nww.1_Intron|MSH5_uc003nwx.1_Intron|MSH5_uc011dof.1_Intron|MSH5_uc003nwy.1_5'Flank	NM_172166	NP_751898	O43196	MSH5_HUMAN	mutS homolog 5 isoform c						chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			ovary(2)|breast(1)	3						TTCTACCCtcttttttttttt	0.234								Direct_reversal_of_damage|MMR					12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32195848	32195851	+	IGR	DEL	AAAA	-	-	rs111556494		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32195848_32195851delAAAA								NOTCH4 (4004 upstream) : C6orf10 (60452 downstream)																							ccagagtgagaaaaaaaaaaaaaa	0.118													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32969818	32969821	+	IGR	DEL	AGTT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32969818_32969821delAGTT								BRD2 (20537 upstream) : HLA-DOA (2141 downstream)																							ttagaggagcagttagtggcaaag	0.034													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	33103481	33103482	+	IGR	INS	-	A	A	rs138648816	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33103481_33103482insA								HLA-DPB1 (6591 upstream) : COL11A2 (26987 downstream)																							aaaaaataattaaaaaaaaaca	0.000													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	33324924	33324924	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33324924delG								DAXX (34131 upstream) : LYPLA2P1 (7591 downstream)																							agtccagggcggttgaggctg	0.025													4	2	---	---	---	---	
LEMD2	221496	broad.mit.edu	37	6	33747038	33747038	+	Intron	DEL	T	-	-	rs35812370		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33747038delT	uc011drm.1	-						LEMD2_uc010jvg.2_Intron|LEMD2_uc011drl.1_Intron|LEMD2_uc003ofe.2_Intron	NM_181336	NP_851853	Q8NC56	LEMD2_HUMAN	LEM domain containing 2 isoform 1							integral to nuclear inner membrane				central_nervous_system(1)	1						TCAGGGCAGCTTTTTTTTTTT	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	33798625	33798626	+	IGR	INS	-	A	A	rs146291039	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33798625_33798626insA								MLN (26832 upstream) : MIR1275 (169123 downstream)																							GACGGACAGACGGGGAGCAGGG	0.614													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	35513568	35513569	+	IGR	INS	-	TTTC	TTTC			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35513568_35513569insTTTC								TULP1 (32921 upstream) : FKBP5 (27793 downstream)																							attgttgagAGtttctttcttt	0.005													6	6	---	---	---	---	
STK38	11329	broad.mit.edu	37	6	36482979	36482979	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36482979delT	uc003omg.2	-						STK38_uc003omh.2_Intron|STK38_uc003omi.2_Intron	NM_007271	NP_009202	Q15208	STK38_HUMAN	serine/threonine kinase 38						intracellular protein kinase cascade|negative regulation of MAP kinase activity	cytoplasm|MLL5-L complex	ATP binding|magnesium ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6						AACTTACCTGTTTAAAAAAAA	0.408													1	10	---	---	---	---	
PPIL1	51645	broad.mit.edu	37	6	36829457	36829457	+	Intron	DEL	T	-	-	rs72060214		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36829457delT	uc003omu.2	-							NM_016059	NP_057143	Q9Y3C6	PPIL1_HUMAN	peptidylprolyl isomerase-like 1						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1						atgatctgtgTtttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	40566899	40566900	+	IGR	INS	-	C	C	rs142789677	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40566899_40566900insC								LRFN2 (11773 upstream) : UNC5CL (427872 downstream)																							AGAAGACGTGAAGAGTAGGCCA	0.510													3	5	---	---	---	---	
TRERF1	55809	broad.mit.edu	37	6	42290933	42290933	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42290933delT	uc003osd.2	-						TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TTTCCCCCAGttttttttttt	0.219													4	2	---	---	---	---	
TRERF1	55809	broad.mit.edu	37	6	42417205	42417205	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42417205delA	uc003osd.2	-						TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GTAGAAGAGGAAAAAAAAAAA	0.333													4	2	---	---	---	---	
TTBK1	84630	broad.mit.edu	37	6	43241745	43241748	+	Intron	DEL	TGAA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43241745_43241748delTGAA	uc003ouq.1	+							NM_032538	NP_115927	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1							cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CATAAGTGCCTGAATGAGTGTGGG	0.544													4	2	---	---	---	---	
TINAG	27283	broad.mit.edu	37	6	54174643	54174643	+	Intron	DEL	A	-	-	rs142290922		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54174643delA	uc003pcj.2	+						TINAG_uc003pci.2_Intron|TINAG_uc010jzt.2_Intron	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen						cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			AGACTGTGTCAAAAAAAAAAA	0.333													4	3	---	---	---	---	
BMP5	653	broad.mit.edu	37	6	55718141	55718142	+	Intron	DEL	TC	-	-	rs35174767		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55718141_55718142delTC	uc003pcq.2	-						BMP5_uc011dxf.1_Intron	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein						cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			tcccccgctttctctctctctc	0.149													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57240326	57240326	+	Intron	DEL	C	-	-	rs67829023		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57240326delC	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ctgatgttttccttttttttg	0.010													5	8	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57375667	57375668	+	Intron	INS	-	G	G	rs150523374		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57375667_57375668insG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGTAACCTTGTATAACGCCTTT	0.327													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57400731	57400733	+	Intron	DEL	ATT	-	-	rs140527998		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57400731_57400733delATT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		cattgacatcattatgtattatt	0.138													5	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57413168	57413168	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57413168delT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GTTTTTAGACTTTTTTTTGTA	0.333													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57432509	57432511	+	Intron	DEL	TTG	-	-	rs71675667		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57432509_57432511delTTG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		gtataacccattgtttttttttt	0.000													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57437991	57437995	+	Intron	DEL	CAAAA	-	-	rs36224981		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57437991_57437995delCAAAA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		aaaaagaaaccaaaacaaaacaaaa	0.132													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57468797	57468798	+	Intron	DEL	AA	-	-	rs36024117		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57468797_57468798delAA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TATTTGTTGGAAACATTTACTT	0.084													2	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57503574	57503575	+	Intron	INS	-	A	A	rs150588289		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57503574_57503575insA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AATTATCTCTGAAAAAAAGGCA	0.198													5	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57511818	57511818	+	Intron	DEL	G	-	-	rs11310474		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57511818delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		taggccttttgcttggaactg	0.154													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57537613	57537617	+	IGR	DEL	GTAAG	-	-	rs71961622		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57537613_57537617delGTAAG								PRIM2 (24238 upstream) : GUSBL2 (708542 downstream)																							ATTTGTAAGTGTAAGGTGTTTGCCT	0.273													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57549953	57549954	+	IGR	DEL	AG	-	-	rs141685078		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57549953_57549954delAG								PRIM2 (36578 upstream) : GUSBL2 (696205 downstream)																							aggtaccatcagagaatacata	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	63084625	63084628	+	IGR	DEL	ACAA	-	-	rs146443461		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63084625_63084628delACAA								KHDRBS2 (88525 upstream) : LGSN (901229 downstream)																							acacacacacacaaacaaacaAAT	0.250													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	73209958	73209958	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73209958delA								RIMS1 (97451 upstream) : KCNQ5 (121613 downstream)																							agaaagaaagaaaaaagaaag	0.000													4	2	---	---	---	---	
CD109	135228	broad.mit.edu	37	6	74439059	74439060	+	Intron	DEL	GT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74439059_74439060delGT	uc003php.2	+						CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Intron|CD109_uc010kba.2_Intron	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor							anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						ccacaTCAAAgtgtgtgtgtgt	0.010													9	5	---	---	---	---	
TPBG	7162	broad.mit.edu	37	6	83074571	83074572	+	5'UTR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83074571_83074572insT	uc003pjn.3	+	3					TPBG_uc010kbj.2_5'UTR|TPBG_uc003pjo.2_5'UTR	NM_006670	NP_006661	Q13641	TPBG_HUMAN	trophoblast glycoprotein precursor						cell adhesion	integral to plasma membrane				central_nervous_system(1)	1		all_cancers(76;0.000805)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0897)		BRCA - Breast invasive adenocarcinoma(397;0.107)		CGAGAGGAAAGTTTTTTTTTTC	0.703													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	87171298	87171303	+	IGR	DEL	AGGAGG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87171298_87171303delAGGAGG								SNHG5 (782847 upstream) : HTR1E (475721 downstream)																							gaggaggagaaggaggaggaggagga	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	93513445	93513445	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93513445delA								None (None upstream) : EPHA7 (436297 downstream)																							CACGGCGGGGAAAAGGGTTGT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	98473619	98473622	+	IGR	DEL	TGTG	-	-	rs151067366		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98473619_98473622delTGTG								MIR2113 (1122 upstream) : POU3F2 (808958 downstream)																							TGATCATAAAtgtgtgtgtgtgtg	0.221													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	107168063	107168064	+	Intron	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107168063_107168064delTG	uc003pro.1	-						uc003prn.1_Intron					Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 1534000.																		cacatatacatgtatgtgtata	0.040													5	3	---	---	---	---	
C6orf186	728464	broad.mit.edu	37	6	110623628	110623629	+	Intron	DEL	AC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110623628_110623629delAC	uc010kdu.1	-						C6orf186_uc003pub.2_Intron	NM_001123364	NP_001116836	Q5JXM2	CF186_HUMAN	chromosome 6 open reading frame 186 precursor							extracellular region					0						atacacatatacacacacatat	0.119													4	2	---	---	---	---	
SLC16A10	117247	broad.mit.edu	37	6	111544288	111544289	+	3'UTR	INS	-	AAAC	AAAC	rs139339854		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111544288_111544289insAAAC	uc003pus.2	+	6					SLC16A10_uc003put.2_3'UTR	NM_018593	NP_061063	Q8TF71	MOT10_HUMAN	solute carrier family 16, member 10						aromatic amino acid transport|cellular nitrogen compound metabolic process|ion transport	basolateral plasma membrane|integral to membrane	amino acid transmembrane transporter activity				0		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)		ACCTGATATTTAAAGTCTTACT	0.381													4	2	---	---	---	---	
HS3ST5	222537	broad.mit.edu	37	6	114430739	114430739	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114430739delT	uc003pwh.3	-						uc003pwf.2_Intron	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		ACAGCACTCCTTCCCTTCCTC	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	115661636	115661636	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115661636delA								HS3ST5 (998096 upstream) : FRK (601057 downstream)																							TAAACAATGGAAAAAATAACC	0.154													4	2	---	---	---	---	
DSE	29940	broad.mit.edu	37	6	116735583	116735583	+	Intron	DEL	T	-	-	rs72439055		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116735583delT	uc003pws.2	+						DSE_uc011ebf.1_Intron|DSE_uc011ebg.1_Intron|DSE_uc003pwt.2_Intron	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN	dermatan sulfate epimerase precursor						dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TGTTTGCTCAttttttttttt	0.129													4	5	---	---	---	---	
C6orf204	387119	broad.mit.edu	37	6	118790103	118790103	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118790103delA	uc003pxz.1	-							NM_001042475	NP_001035940	Q5SZL2	CF204_HUMAN	chromosome 6 open reading frame 204 isoform a							centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)		AGGTATACATAAACCCACAGA	0.373													4	2	---	---	---	---	
C6orf170	221322	broad.mit.edu	37	6	121643100	121643100	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121643100delT	uc003pyo.1	-						C6orf170_uc003pyq.1_Intron	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322						multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		AATTTTTGGCTTTTTTTTTTC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	122233027	122233028	+	IGR	DEL	CT	-	-	rs80245522		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122233027_122233028delCT								GJA1 (462155 upstream) : HSF2 (487668 downstream)																							TGTTAGCTTCCTCTCTGTGAAG	0.396													3	3	---	---	---	---	
TRDN	10345	broad.mit.edu	37	6	123812250	123812250	+	Intron	DEL	A	-	-	rs5879684		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123812250delA	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|TRDN_uc010ken.2_Intron	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		actacatctcaaaaaaaaaaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	131043547	131043547	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131043547delA								TMEM200A (279339 upstream) : LOC285733 (104777 downstream)																							gggcaaaaagaaaaaaaaaag	0.000													4	2	---	---	---	---	
TAAR9	134860	broad.mit.edu	37	6	132857794	132857795	+	5'Flank	INS	-	ATC	ATC	rs150437836	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132857794_132857795insATC	uc011eci.1	+							NM_175057	NP_778227	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9							plasma membrane	G-protein coupled receptor activity				0	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		CAGTGGACCTTAGGAGACCTGG	0.441													3	9	---	---	---	---	
AHI1	54806	broad.mit.edu	37	6	135647912	135647913	+	Intron	INS	-	G	G	rs138477848	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135647912_135647913insG	uc003qgi.2	-						AHI1_uc003qgf.2_Intron|AHI1_uc003qgg.2_Intron|AHI1_uc003qgh.2_Intron|AHI1_uc003qgj.2_Intron|AHI1_uc003qgk.3_Intron	NM_001134831	NP_001128303	Q8N157	AHI1_HUMAN	Abelson helper integration site 1 isoform a							adherens junction|cilium|microtubule basal body				ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		ttggccaggctgtctcaaactc	0.000													4	2	---	---	---	---	
C6orf217	100131814	broad.mit.edu	37	6	135855389	135855389	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135855389delA	uc003qgn.2	+						C6orf217_uc003qgo.2_Intron|C6orf217_uc010kgo.2_Intron|C6orf217_uc003qgm.2_Intron					Homo sapiens cDNA clone IMAGE:4795512.												0						AAGGGCTAATAAAAAAAAAAT	0.274													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	137628759	137628760	+	IGR	DEL	GT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137628759_137628760delGT								IFNGR1 (88192 upstream) : OLIG3 (184576 downstream)																							AGAAACCGTCgtgtgtgtgtgt	0.312													4	2	---	---	---	---	
PEX3	8504	broad.mit.edu	37	6	143792919	143792920	+	Intron	DEL	TT	-	-	rs71641631		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143792919_143792920delTT	uc003qjl.2	+						PEX3_uc011edx.1_Intron	NM_003630	NP_003621	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3						protein import into peroxisome membrane|transmembrane transport	integral to peroxisomal membrane	protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		TTTCTTTATCTTTTTTTTTATA	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	144468419	144468419	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144468419delA								SF3B5 (51665 upstream) : STX11 (3235 downstream)																							atcccccactaaaactcttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	145321045	145321046	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145321045_145321046insA								UTRN (146877 upstream) : EPM2A (625400 downstream)																							ATAACACTTACACAACCACCCA	0.322													4	2	---	---	---	---	
STXBP5	134957	broad.mit.edu	37	6	147576638	147576640	+	Intron	DEL	TTG	-	-	rs66934070		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147576638_147576640delTTG	uc003qlz.2	+						STXBP5_uc010khz.1_Intron|STXBP5_uc003qlx.2_Intron|STXBP5_uc003qly.2_Intron	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b						exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TTGTTCCTTTttgttgttgttgt	0.236													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	148228882	148228883	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148228882_148228883insA								SAMD5 (337725 upstream) : SASH1 (434846 downstream)																							TTTGTTTCCATAAAAATGCAGA	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	148425453	148425454	+	IGR	INS	-	G	G	rs142979581	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148425453_148425454insG								SAMD5 (534296 upstream) : SASH1 (238275 downstream)																							GGTCAGTGCATGGGGGCCAGTG	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	148616200	148616201	+	IGR	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148616200_148616201delTC								SAMD5 (725043 upstream) : SASH1 (47528 downstream)																							TCTTTCTCGTTCTCTCTCTCTC	0.188													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	148619943	148619944	+	IGR	INS	-	A	A	rs147986016	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148619943_148619944insA								SAMD5 (728786 upstream) : SASH1 (43785 downstream)																							aaaagagaaagaaaaaagagag	0.000													4	2	---	---	---	---	
UST	10090	broad.mit.edu	37	6	149130458	149130458	+	Intron	DEL	T	-	-	rs111440898		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149130458delT	uc003qmg.2	+							NM_005715	NP_005706	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		tagttttttgttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	150300288	150300289	+	IGR	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150300288_150300289delTG								ULBP1 (5444 upstream) : RAET1K (18868 downstream)																							GTCCAgtgtctgtgtgtgtgtg	0.396													5	3	---	---	---	---	
PLEKHG1	57480	broad.mit.edu	37	6	151059107	151059108	+	Intron	INS	-	T	T	rs113346610		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151059107_151059108insT	uc003qny.1	+						PLEKHG1_uc011eel.1_Intron|PLEKHG1_uc011eem.1_Intron|PLEKHG1_uc003qnz.2_Intron	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		accttgctaagttttttttttt	0.000													4	2	---	---	---	---	
C6orf35	729515	broad.mit.edu	37	6	157733256	157733257	+	Intron	INS	-	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157733256_157733257insC	uc003sih.3	-							NM_018452	NP_060922	Q9NWH2	CF035_HUMAN	hypothetical protein LOC729515							integral to membrane					0						TCATCATAGTGCCCCAGTGTAC	0.530													4	2	---	---	---	---	
TULP4	56995	broad.mit.edu	37	6	158788089	158788089	+	Intron	DEL	A	-	-	rs68157257		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158788089delA	uc003qrf.2	+						TULP4_uc011efo.1_Intron|TULP4_uc003qrg.2_Intron	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1						intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		TTTTGGATTGAAAAAAAAAAA	0.423													5	4	---	---	---	---	
PDE10A	10846	broad.mit.edu	37	6	166069747	166069756	+	Intron	DEL	CACACACACA	-	-	rs71948568		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166069747_166069756delCACACACACA	uc003qun.2	-						PDE10A_uc003quo.2_Intron	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	ctctctctctcacacacacacacacacaca	0.300													4	2	---	---	---	---	
RPS6KA2	6196	broad.mit.edu	37	6	167181263	167181280	+	Intron	DEL	ACACACACACACACACAC	-	-	rs67648709		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167181263_167181280delACACACACACACACACAC	uc003qvd.1	-						RPS6KA2_uc003qvc.1_Intron	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		ACCTCCTCAAacacacacacacacacacacacacacac	0.358													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168804478	168804481	+	IGR	DEL	ACTT	-	-	rs149720116		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168804478_168804481delACTT								DACT2 (84076 upstream) : SMOC2 (37550 downstream)																							tctttatataacttacttgtgccc	0.000													3	3	---	---	---	---	
SMOC2	64094	broad.mit.edu	37	6	168959485	168959486	+	Intron	DEL	AT	-	-	rs138471919		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168959485_168959486delAT	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		gcgtgtgcgcatgtgtgtgtgt	0.193													5	4	---	---	---	---	
SMOC2	64094	broad.mit.edu	37	6	168999979	168999980	+	Intron	INS	-	CA	CA	rs148009987	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168999979_168999980insCA	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		cacacacataccacacacacac	0.000													5	3	---	---	---	---	
SMOC2	64094	broad.mit.edu	37	6	169015753	169015753	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169015753delA	uc003qws.1	+						SMOC2_uc003qwr.1_Intron|SMOC2_uc011egu.1_5'Flank	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		cttcatacttacagccggcac	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	91498	91499	+	IGR	INS	-	CTT	CTT	rs147137182	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91498_91499insCTT								None (None upstream) : FAM20C (101470 downstream)																							GGGTCCAAAACCTCAGTTGTAG	0.579													1	5	---	---	---	---	
PRKAR1B	5575	broad.mit.edu	37	7	621358	621358	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:621358delT	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron|PRKAR1B_uc003six.1_Intron	NM_002735	NP_002726	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		TTTGGCCCCAttttttttttc	0.194													3	3	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	945415	945415	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:945415delA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						aggagaaaggagaaaggagaa	0.000													4	2	---	---	---	---	
MICALL2	79778	broad.mit.edu	37	7	1485933	1485934	+	Intron	DEL	AG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1485933_1485934delAG	uc003skj.3	-							NM_182924	NP_891554	Q8IY33	MILK2_HUMAN	MICAL-like 2 isoform 1							cytoplasm|cytoskeleton	zinc ion binding			central_nervous_system(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		agggggaaaaagggggaggagg	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	2707877	2707877	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2707877delG								TTYH3 (3450 upstream) : AMZ1 (11286 downstream)																							tctggggtttggggggagcac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	3241974	3241975	+	IGR	INS	-	T	T	rs140226433	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3241974_3241975insT								CARD11 (158395 upstream) : SDK1 (99105 downstream)																							ACTGTAGGGGGTGGGGACTCTG	0.540													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	13700608	13700610	+	IGR	DEL	AGA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13700608_13700610delAGA								ARL4A (970052 upstream) : ETV1 (230248 downstream)																							tgcaactcttagaagaagacata	0.000													1	5	---	---	---	---	
TRA2A	29896	broad.mit.edu	37	7	23552393	23552393	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23552393delA	uc003swi.2	-						TRA2A_uc011jzb.1_Intron|TRA2A_uc011jzc.1_Intron|TRA2A_uc011jzd.1_Intron	NM_013293	NP_037425	Q13595	TRA2A_HUMAN	transformer-2 alpha						nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding			ovary(1)	1						tcctatctttaaaaaaaaaaa	0.104													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	27427118	27427118	+	IGR	DEL	T	-	-	rs67231661		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27427118delT								EVX1 (140926 upstream) : HIBADH (137945 downstream)																							ATCTTGTAACttttttttttt	0.119													4	2	---	---	---	---	
CCDC129	223075	broad.mit.edu	37	7	31615509	31615510	+	Intron	INS	-	A	A	rs11396309		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31615509_31615510insA	uc003tcj.1	+						CCDC129_uc011kad.1_Intron|CCDC129_uc003tci.1_Intron|CCDC129_uc011kae.1_Intron|CCDC129_uc003tck.1_Intron	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129												0						ATTTTTTTTTTAAAAAGAGTAT	0.356													4	2	---	---	---	---	
PDE1C	5137	broad.mit.edu	37	7	32206983	32206983	+	Intron	DEL	T	-	-	rs113649096		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32206983delT	uc003tco.1	-							NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			ATCAACATTATTAGAATATGT	0.398													4	2	---	---	---	---	
ELMO1	9844	broad.mit.edu	37	7	37394250	37394250	+	Intron	DEL	A	-	-	rs34370233		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37394250delA	uc003tfk.1	-						ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						TTTGCTTTTCAAATTCCTTTT	0.473													2	4	---	---	---	---	
POU6F2	11281	broad.mit.edu	37	7	39333103	39333103	+	Intron	DEL	G	-	-	rs78810219		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39333103delG	uc003thb.1	+						POU6F2_uc010kxo.2_Intron	NM_007252	NP_009183	P78424	PO6F2_HUMAN	POU class 6 homeobox 2 isoform 1						central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						ATTCCTTTTTGTTGTCCGGCT	0.453													3	7	---	---	---	---	
HECW1	23072	broad.mit.edu	37	7	43421088	43421089	+	Intron	DEL	TT	-	-	rs34238162		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43421088_43421089delTT	uc003tid.1	+						HECW1_uc011kbi.1_Intron|HECW1_uc003tie.1_Intron	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						gcatggctaatttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	46173235	46173237	+	IGR	DEL	CCT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46173235_46173237delCCT								IGFBP3 (212364 upstream) : None (None downstream)																							tccttctctccctcctcctcctc	0.305													4	3	---	---	---	---	
GRB10	2887	broad.mit.edu	37	7	50771486	50771486	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50771486delG	uc003tpi.2	-						GRB10_uc003tph.3_Intron|GRB10_uc003tpj.2_Intron|GRB10_uc003tpk.2_Intron|GRB10_uc010kzb.2_Intron|GRB10_uc003tpl.2_Intron|GRB10_uc003tpm.2_Intron|GRB10_uc003tpn.2_Intron	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform						insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					AGCTAGAACTGGGAGTGTTCT	0.453									Russell-Silver_syndrome				25	14	---	---	---	---	
GRB10	2887	broad.mit.edu	37	7	50800378	50800379	+	5'Flank	INS	-	TC	TC	rs143765630	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50800378_50800379insTC	uc003tpi.2	-						GRB10_uc003tpj.2_5'Flank|GRB10_uc003tpk.2_Intron|GRB10_uc010kzb.2_Intron|GRB10_uc003tpl.2_Intron|GRB10_uc003tpm.2_Intron|GRB10_uc003tpn.2_Intron	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform						insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					TGCCTCACCCTTCTTCCCTATA	0.480									Russell-Silver_syndrome				4	2	---	---	---	---	
COBL	23242	broad.mit.edu	37	7	51216563	51216564	+	Intron	INS	-	C	C	rs146939058	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51216563_51216564insC	uc003tpr.3	-						COBL_uc003tps.2_Intron|COBL_uc011kcl.1_Intron|COBL_uc010kzc.2_Intron|COBL_uc003tpt.2_Intron|COBL_uc003tpp.3_Intron|COBL_uc003tpq.3_Intron	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog											skin(3)|ovary(2)	5	Glioma(55;0.08)					GGCATCCCCAACCCCCTTATCA	0.530													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	52315042	52315043	+	IGR	DEL	CT	-	-	rs150268851		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52315042_52315043delCT								COBL (930527 upstream) : POM121L12 (788306 downstream)																							AAATGGAAAACTCTGATCATGG	0.446													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	52448369	52448369	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52448369delT								None (None upstream) : POM121L12 (654980 downstream)																							agaatttgcctttttttcctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53170824	53170825	+	IGR	DEL	AG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53170824_53170825delAG								POM121L12 (66207 upstream) : None (None downstream)																							aaagaaagaaagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57168854	57168854	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57168854delC								DKFZp434L192 (603877 upstream) : ZNF479 (18474 downstream)																							cccaactcagcctcccaaagt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57733747	57733747	+	IGR	DEL	G	-	-	rs145756065	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57733747delG								ZNF716 (200482 upstream) : None (None downstream)																							TTGCTCCTCAGGAGCTCCCCG	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57743617	57743618	+	IGR	DEL	AG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57743617_57743618delAG								ZNF716 (210352 upstream) : None (None downstream)																							TTACATTAGTAGAGGCAAATTC	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57886274	57886275	+	IGR	INS	-	CCCA	CCCA	rs145944938	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57886274_57886275insCCCA								ZNF716 (353009 upstream) : None (None downstream)																							ACCACCTGCAGCCCAGGGCTCC	0.599													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61557561	61557561	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61557561delA								None (None upstream) : None (None downstream)																							ggaaaggttcaattctgtgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61913788	61913789	+	IGR	DEL	TT	-	-	rs111262847		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61913788_61913789delTT								None (None upstream) : LOC643955 (837883 downstream)																							ttggaaacactttttttgtaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62749239	62749239	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62749239delA								None (None upstream) : LOC643955 (2433 downstream)																							ccacacttgtaaccccaccaa	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64098115	64098116	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64098115_64098116insT								ZNF680 (74610 upstream) : ZNF107 (28395 downstream)																							caataagtcacttttttttttt	0.000													4	2	---	---	---	---	
ZNF273	10793	broad.mit.edu	37	7	64380287	64380287	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64380287delT	uc003tto.2	+						ZNF273_uc003ttl.2_Intron|ZNF273_uc003ttm.1_Intron|ZNF273_uc003ttn.2_Intron|ZNF273_uc003ttp.1_Intron	NM_021148	NP_066971	Q14593	ZN273_HUMAN	zinc finger protein 273						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(55;0.0295)|all_lung(88;0.0691)				ctattttttcttttttttttt	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	70407436	70407436	+	IGR	DEL	G	-	-	rs76288608		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70407436delG								AUTS2 (149552 upstream) : WBSCR17 (190353 downstream)																							atctcaaaaagaaaaaaaaaa	0.000													4	2	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	70718384	70718384	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70718384delC	uc003tvy.2	+							NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				gggggaactgcccccatgatt	0.000													2	4	---	---	---	---	
CLIP2	7461	broad.mit.edu	37	7	73812305	73812305	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73812305delT	uc003uam.2	+						CLIP2_uc003uan.2_Intron	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2							microtubule associated complex				skin(3)	3						tcGAGATTTCTTTTCTATTAT	0.269													4	2	---	---	---	---	
CD36	948	broad.mit.edu	37	7	80185200	80185200	+	Intron	DEL	G	-	-	rs78069624		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80185200delG	uc003uhc.2	+							NM_001127444	NP_001120916	P16671	CD36_HUMAN	CD36 antigen						cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1						atagccacttggatcatggtg	0.000													4	6	---	---	---	---	
SEMA3D	223117	broad.mit.edu	37	7	84780409	84780410	+	Intron	DEL	CA	-	-	rs67407646		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84780409_84780410delCA	uc010led.2	-						SEMA3D_uc010lee.1_Intron	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor						cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5						AAAAAAAATCcacacacacaca	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	87120779	87120779	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87120779delT								ABCB4 (15760 upstream) : ABCB1 (12169 downstream)																							TCAAAATGGATTTTTTTACAC	0.075													4	2	---	---	---	---	
STEAP4	79689	broad.mit.edu	37	7	87933956	87933957	+	Intron	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87933956_87933957delTG	uc003ujs.2	-						STEAP4_uc010lek.2_Intron|STEAP4_uc003ujt.2_Intron	NM_024636	NP_078912	Q687X5	STEA4_HUMAN	tumor necrosis factor, alpha-induced protein 9						fat cell differentiation|ion transport|iron ion homeostasis	Golgi membrane|integral to membrane|plasma membrane	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	Esophageal squamous(14;0.00802)					TTGCTGCTGTtgtgtgtgtgtg	0.317													4	2	---	---	---	---	
AKAP9	10142	broad.mit.edu	37	7	91603646	91603647	+	Intron	INS	-	T	T	rs149871677	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91603646_91603647insT	uc003ulg.2	+						AKAP9_uc003uld.3_Intron|AKAP9_uc003ule.2_Intron|AKAP9_uc003ulf.2_Intron	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2						G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			gtccaacttcattttttttgtt	0.074			T	BRAF	papillary thyroid								6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	94442949	94442950	+	IGR	INS	-	AAC	AAC	rs147401651	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94442949_94442950insAAC								PEG10 (143945 upstream) : PPP1R9A (93999 downstream)																							actctgtctcaaacaacaacaa	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	94470091	94470092	+	IGR	INS	-	A	A	rs139720229	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94470091_94470092insA								PEG10 (171087 upstream) : PPP1R9A (66857 downstream)																							ctgcctgctacgggctatgtgt	0.000													2	4	---	---	---	---	
PON2	5445	broad.mit.edu	37	7	95064965	95064966	+	5'Flank	INS	-	TG	TG	rs148516771	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95064965_95064966insTG	uc003unv.2	-						PON2_uc003unu.2_5'Flank|PON2_uc010lfk.2_5'Flank|PON2_uc003unw.2_5'Flank	NM_000305	NP_000296	Q15165	PON2_HUMAN	paraoxonase 2 isoform 1						aromatic compound catabolic process	extracellular region|plasma membrane	arylesterase activity|identical protein binding|metal ion binding				0	all_cancers(62;9.35e-11)|all_epithelial(64;3.37e-09)		STAD - Stomach adenocarcinoma(171;0.0151)			gtgtgtgtgtctgtgtgtgtgt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	96115478	96115478	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96115478delT	uc003uoh.1	-						uc011kil.1_Intron					RecName: Full=Putative uncharacterized protein FLJ42280;																		TTTTTCTACCTTTTTTTTTTT	0.413													4	2	---	---	---	---	
SMURF1	57154	broad.mit.edu	37	7	98730322	98730323	+	Intron	INS	-	AC	AC	rs146792418	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98730322_98730323insAC	uc003upu.1	-						SMURF1_uc003upv.1_Intron|SMURF1_uc003upt.2_Intron	NM_020429	NP_065162	Q9HCE7	SMUF1_HUMAN	Smad ubiquitination regulatory factor 1 isoform						BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|lung(1)	4	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			cagacacacggacacacacaca	0.000													4	3	---	---	---	---	
ZAN	7455	broad.mit.edu	37	7	100369721	100369721	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100369721delT	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron|ZAN_uc011kkd.1_Intron|ZAN_uc011kke.1_5'Flank	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ctctaaattcttttttttttt	0.254													4	3	---	---	---	---	
SH2B2	10603	broad.mit.edu	37	7	101936735	101936736	+	Intron	INS	-	A	A	rs141126119	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101936735_101936736insA	uc011kko.1	+							NM_020979	NP_066189	O14492	SH2B2_HUMAN	SH2B adaptor protein 2						blood coagulation|insulin receptor signaling pathway|intracellular signal transduction	cytosol|plasma membrane	JAK pathway signal transduction adaptor activity|SH3/SH2 adaptor activity|signal transducer activity				0						CAGAGATGGGGAAAAAAAAAAC	0.554													4	2	---	---	---	---	
SH2B2	10603	broad.mit.edu	37	7	101936804	101936804	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101936804delG	uc011kko.1	+							NM_020979	NP_066189	O14492	SH2B2_HUMAN	SH2B adaptor protein 2						blood coagulation|insulin receptor signaling pathway|intracellular signal transduction	cytosol|plasma membrane	JAK pathway signal transduction adaptor activity|SH3/SH2 adaptor activity|signal transducer activity				0						AACCGGAGGTGGGGGGGTGTA	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131747363	131747364	+	IGR	DEL	TG	-	-	rs34103152		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131747363_131747364delTG								PODXL (505987 upstream) : PLXNA4 (60728 downstream)																							TTtgtgtgtctgtgtgtgtgtg	0.327													3	3	---	---	---	---	
CREB3L2	64764	broad.mit.edu	37	7	137576702	137576703	+	Intron	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137576702_137576703delTG	uc003vtw.2	-						CREB3L2_uc003vtx.1_Intron|CREB3L2_uc003vtv.2_Intron	NM_194071	NP_919047	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like						chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160						GGTGCACATATGTGTGTGTGTG	0.272			T	FUS	fibromyxoid sarcoma								4	2	---	---	---	---	
SVOPL	136306	broad.mit.edu	37	7	138282322	138282322	+	Intron	DEL	A	-	-	rs34853135		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138282322delA	uc011kqh.1	-						SVOPL_uc003vue.2_Intron	NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1							integral to membrane	transmembrane transporter activity				0						GACAGGTACTAATGCTGATTT	0.308													4	2	---	---	---	---	
KIAA1147	57189	broad.mit.edu	37	7	141374031	141374032	+	Intron	DEL	AC	-	-	rs35125206		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141374031_141374032delAC	uc003vwk.2	-							NM_001080392	NP_001073861	A4D1U4	LCHN_HUMAN	hypothetical protein LOC57189											ovary(1)	1	Melanoma(164;0.0171)					CTGCAGAAAAacacacacacac	0.490													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	151618187	151618187	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151618187delG								PRKAG2 (43871 upstream) : GALNTL5 (35324 downstream)																							GGCAAGCCCTGtttttttttt	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	156160508	156160509	+	IGR	INS	-	A	A	rs143770899	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156160508_156160509insA								SHH (555541 upstream) : C7orf4 (172676 downstream)																							tcaattccttcatcgataaagt	0.208													3	3	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158129535	158129536	+	Intron	INS	-	AT	AT	rs144513449	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158129535_158129536insAT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ACGTCACTCACCCACACTCTCA	0.559													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158261712	158261713	+	Intron	DEL	CC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158261712_158261713delCC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ACTATGCACACCCACACACACT	0.550													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	158509788	158509790	+	IGR	DEL	TCC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158509788_158509790delTCC								NCAPG2 (12268 upstream) : ESYT2 (13899 downstream)																							gagaacagtttcctcctcctcct	0.000													4	4	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3881106	3881107	+	Intron	DEL	TT	-	-	rs35976423		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3881106_3881107delTT	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GCTTTTCAACtttttttttttt	0.203													4	2	---	---	---	---	
XKR5	389610	broad.mit.edu	37	8	6666557	6666557	+	3'UTR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6666557delG	uc003wqp.2	-	7					XKR5_uc003wqq.2_3'UTR	NM_207411	NP_997294	Q6UX68	XKR5_HUMAN	XK-related protein 5a							integral to membrane					0			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		TTTAGGAAGAGGTCACCAGAG	0.567													2	4	---	---	---	---	
DEFB1	1672	broad.mit.edu	37	8	6731202	6731202	+	Intron	DEL	A	-	-	rs35269640		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6731202delA	uc003wqs.2	-							NM_005218	NP_005209	P60022	DEFB1_HUMAN	defensin, beta 1 preproprotein						chemotaxis|defense response to bacterium|G-protein coupled receptor protein signaling pathway|innate immune response	extracellular region					0			STAD - Stomach adenocarcinoma(24;0.0984)	COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.128)		actagaggggaaaggaggcag	0.005													1	5	---	---	---	---	
XKR6	286046	broad.mit.edu	37	8	10849798	10849799	+	Intron	DEL	CA	-	-	rs34322292		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10849798_10849799delCA	uc003wtk.1	-							NM_173683	NP_775954	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		ctctctctctcacacacacaca	0.262													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20574924	20574925	+	IGR	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20574924_20574925delTG								LZTS1 (462121 upstream) : GFRA2 (974605 downstream)																							gtgtgtgagatgtgtgtgtgtg	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	21455979	21455979	+	IGR	DEL	T	-	-	rs75149581		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21455979delT								None (None upstream) : GFRA2 (93551 downstream)																							gAActtatcgttttttcactg	0.000													5	4	---	---	---	---	
DOK2	9046	broad.mit.edu	37	8	21691713	21691714	+	Intron	DEL	CA	-	-	rs113452795		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21691713_21691714delCA	uc003wzx.1	-							NM_003974	NP_003965	O60496	DOK2_HUMAN	docking protein 2						blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		CACAGGAGAGcacacacacaca	0.431													4	2	---	---	---	---	
PEBP4	157310	broad.mit.edu	37	8	22733909	22733909	+	Intron	DEL	T	-	-	rs34539300		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22733909delT	uc003xcn.1	-						uc003xco.1_5'Flank	NM_144962	NP_659399	Q96S96	PEBP4_HUMAN	phosphatidylethanolamine-binding protein 4							lysosome				ovary(1)|large_intestine(1)|breast(1)|skin(1)	4		Prostate(55;0.0453)|Breast(100;0.103)		Colorectal(74;0.0434)|COAD - Colon adenocarcinoma(73;0.124)		ATCCAGTGTGTGTTGAAGGAC	0.498													2	4	---	---	---	---	
PTK2B	2185	broad.mit.edu	37	8	27298880	27298880	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27298880delC	uc003xfn.1	+						PTK2B_uc003xfo.1_Intron|PTK2B_uc003xfp.1_Intron|PTK2B_uc003xfq.1_Intron|PTK2B_uc003xfr.1_Intron	NM_173174	NP_775266	Q14289	FAK2_HUMAN	PTK2B protein tyrosine kinase 2 beta isoform a						apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)		agatgaaaggccagattttcc	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37188467	37188468	+	IGR	INS	-	CA	CA	rs147600669	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37188467_37188468insCA								KCNU1 (394826 upstream) : ZNF703 (364833 downstream)																							gcgcacgcgctcacacacacac	0.431													6	4	---	---	---	---	
IDO2	169355	broad.mit.edu	37	8	39865565	39865566	+	Intron	DEL	TT	-	-	rs72200209		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39865565_39865566delTT	uc010lwy.1	+						IDO2_uc003xno.1_Intron|IDO2_uc010lwz.1_Intron|IDO2_uc003xnp.1_Intron	NM_194294	NP_919270	Q6ZQW0	I23O2_HUMAN	indoleamine-pyrrole 2,3 dioxygenase-like 1						tryptophan catabolic process to kynurenine	cytosol	heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			ovary(2)	2						gcactggcactttttttttttt	0.000													4	2	---	---	---	---	
UBE2V2	7336	broad.mit.edu	37	8	48935781	48935781	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48935781delT	uc003xqm.2	+							NM_003350	NP_003341	Q15819	UB2V2_HUMAN	ubiquitin-conjugating enzyme E2v2						cell proliferation|DNA double-strand break processing|protein polyubiquitination|regulation of DNA repair	cytoplasm|nucleus|UBC13-MMS2 complex	acid-amino acid ligase activity|protein binding				0		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00171)|all_lung(136;0.00196)				ttagatatacttttttttttt	0.000								Direct_reversal_of_damage|Rad6_pathway					4	2	---	---	---	---	
SNTG1	54212	broad.mit.edu	37	8	51705082	51705082	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51705082delA	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				CACGTTGACCAAAAATGTCTA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	52842727	52842727	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52842727delT	uc011ldp.1	+											SubName: Full=cDNA FLJ58935;																		GTGTGTGGGGTTTTTTTTTTT	0.299													4	2	---	---	---	---	
FAM150A	389658	broad.mit.edu	37	8	53479168	53479169	+	5'Flank	INS	-	T	T	rs143717867	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53479168_53479169insT	uc003xrd.2	-						FAM150A_uc011ldt.1_5'Flank	NM_207413	NP_997296	Q6UXT8	F150A_HUMAN	hypothetical protein LOC389658 precursor							extracellular region					0		Lung NSC(129;0.0919)|all_epithelial(80;0.125)|all_lung(136;0.17)				GCAAAGCAAGCTTTGCAGGAGC	0.436													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	54106425	54106427	+	IGR	DEL	AGA	-	-	rs139741810		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54106425_54106427delAGA								NPBWR1 (252972 upstream) : OPRK1 (31849 downstream)																							agtgtgtgagagaagaagagaca	0.064													3	4	---	---	---	---	
TCEA1	6917	broad.mit.edu	37	8	54927737	54927737	+	Intron	DEL	T	-	-	rs113003413		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54927737delT	uc003xru.2	-						TCEA1_uc003xrv.2_Intron|TCEA1_uc011ldw.1_Intron|TCEA1_uc003xrw.1_Intron	NM_006756	NP_006747	P23193	TCEA1_HUMAN	transcription elongation factor A 1 isoform 1						positive regulation of viral transcription|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	nucleoplasm	DNA binding|translation elongation factor activity|zinc ion binding				0		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			ATATTATCCAttttttttttt	0.124			T	PLAG1	salivary adenoma								4	2	---	---	---	---	
LYN	4067	broad.mit.edu	37	8	56900851	56900852	+	Intron	DEL	GT	-	-	rs34760211		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56900851_56900852delGT	uc003xsk.3	+						LYN_uc003xsl.3_Intron	NM_002350	NP_002341	P07948	LYN_HUMAN	Yamaguchi sarcoma viral (v-yes-1) oncogene						erythrocyte differentiation|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of cellular component movement|positive regulation of stress-activated protein kinase signaling cascade|positive regulation of tyrosine phosphorylation of STAT protein|response to DNA damage stimulus|T cell costimulation	cytosol|Golgi apparatus|membrane raft|nucleus|perinuclear region of cytoplasm	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|receptor signaling protein tyrosine kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)			AAACTCCCTGgtgtgtgtgtgt	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	60497570	60497571	+	IGR	DEL	AC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60497570_60497571delAC								TOX (465803 upstream) : CA8 (603852 downstream)																							ACACTCACAGACACACACACAC	0.183													4	2	---	---	---	---	
MTFR1	9650	broad.mit.edu	37	8	66566300	66566300	+	Intron	DEL	A	-	-	rs34665689		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66566300delA	uc003xvm.2	+						MTFR1_uc011lep.1_Intron	NM_014637	NP_055452	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1 isoform 1							mitochondrion|plasma membrane				pancreas(1)	1			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			tttgtctctcaaaaaaaaaaa	0.129													3	4	---	---	---	---	
MTFR1	9650	broad.mit.edu	37	8	66617308	66617308	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66617308delC	uc003xvm.2	+						MTFR1_uc011lep.1_Intron|MTFR1_uc003xvn.2_Intron|MTFR1_uc003xvo.1_Intron	NM_014637	NP_055452	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1 isoform 1							mitochondrion|plasma membrane				pancreas(1)	1			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			tgcctgtaatcccagcacttt	0.124													4	2	---	---	---	---	
CSPP1	79848	broad.mit.edu	37	8	68003264	68003265	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68003264_68003265insT	uc003xxi.2	+						CSPP1_uc003xxg.1_Intron|CSPP1_uc003xxh.1_Intron|CSPP1_uc003xxj.2_Intron|CSPP1_uc003xxk.2_Intron	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1							centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GATCATGTGTATTTTTTTTTTC	0.094													4	2	---	---	---	---	
PREX2	80243	broad.mit.edu	37	8	68979012	68979013	+	Intron	INS	-	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68979012_68979013insG	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						cccgtacttttggggtcctctc	0.000													4	2	---	---	---	---	
SLCO5A1	81796	broad.mit.edu	37	8	70733432	70733433	+	Intron	INS	-	A	A	rs34078991		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70733432_70733433insA	uc003xyl.2	-						SLCO5A1_uc010lzb.2_Intron|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Intron|SLCO5A1_uc010lzc.2_Intron	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GAAGAAATGTtaaaaaaaaaaa	0.114													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	76846547	76846548	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76846547_76846548insA								HNF4G (367488 upstream) : LOC100192378 (676567 downstream)																							gaaattgacccagctttgaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	84465255	84465258	+	IGR	DEL	AGTC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84465255_84465258delAGTC								None (None upstream) : RALYL (630195 downstream)																							tttttGTTTTAGTCAGTCAAAATT	0.103													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	87010647	87010647	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87010647delA								REXO1L1 (435379 upstream) : PSKH2 (50046 downstream)																							TTGCATCTATAAAAAAAAGAG	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	89019996	89019996	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89019996delC								DCAF4L2 (133700 upstream) : MMP16 (29466 downstream)																							TGAGGTGTGTCCTTAGCATCT	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	90258227	90258228	+	IGR	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90258227_90258228delTC								MMP16 (918510 upstream) : RIPK2 (511747 downstream)																							tccctCTCTGTCTCTCtctctc	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	91113917	91113918	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91113917_91113918insA								CALB1 (6230 upstream) : TMEM64 (520305 downstream)																							gactctgtctcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	94524715	94524715	+	IGR	DEL	C	-	-	rs59068283		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94524715delC								C8orf83 (494814 upstream) : FAM92A1 (188058 downstream)																							caaaacaaaacaaaaaaaaca	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	95241913	95241913	+	IGR	DEL	T	-	-	rs72453045		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95241913delT								CDH17 (12382 upstream) : GEM (19574 downstream)																							acatcataacttttttttttt	0.124													4	2	---	---	---	---	
INTS8	55656	broad.mit.edu	37	8	95869300	95869301	+	Intron	DEL	TT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95869300_95869301delTT	uc003yhb.2	+						INTS8_uc003yha.1_Intron|INTS8_uc011lgq.1_Intron|INTS8_uc011lgr.1_Intron|INTS8_uc010mba.2_Intron	NM_017864	NP_060334	Q75QN2	INT8_HUMAN	integrator complex subunit 8						snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)					GTTTGTAATCtttttttttttt	0.168													4	2	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113591117	113591117	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113591117delT	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						cacactgttgttttccaatcc	0.000										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			4	2	---	---	---	---	
TRPS1	7227	broad.mit.edu	37	8	116510106	116510106	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116510106delA	uc003ynz.2	-						TRPS1_uc011lhy.1_Intron|TRPS1_uc003yny.2_Intron|TRPS1_uc010mcy.2_Intron	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1						negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			tctggttttgaagtcctcagc	0.164									Langer-Giedion_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	117208291	117208291	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117208291delG								TRPS1 (527063 upstream) : EIF3H (448765 downstream)																							CTGTCACCATGGTGTCTAACT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	120013157	120013157	+	IGR	DEL	A	-	-	rs138296702		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120013157delA								TNFRSF11B (48774 upstream) : COLEC10 (66267 downstream)																							agtcaaccataaatgcagagg	0.000													3	5	---	---	---	---	
MRPL13	28998	broad.mit.edu	37	8	121441734	121441734	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121441734delA	uc003ypa.2	-						MRPL13_uc010mdf.2_Intron	NM_014078	NP_054797	Q9BYD1	RM13_HUMAN	mitochondrial ribosomal protein L13						translation	mitochondrial large ribosomal subunit	protein binding|structural constituent of ribosome			central_nervous_system(1)	1	Lung NSC(37;1.69e-07)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			cttaaaagttaaaaaaaaaaa	0.114													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	123476575	123476576	+	IGR	INS	-	CACA	CACA	rs10637651		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123476575_123476576insCACA								HAS2AS (819642 upstream) : ZHX2 (317325 downstream)																							gtgtgtgcacgcacacacacac	0.000													4	3	---	---	---	---	
LOC727677	727677	broad.mit.edu	37	8	128465423	128465423	+	Intron	DEL	A	-	-	rs57736090		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128465423delA	uc003yse.1	-						LOC727677_uc011liv.1_Intron					Homo sapiens isolate DGPc1_8_exons1-2-3-4-5 unknown mRNA, alternatively spliced.												0						CTTGGCCTGCAGTGGGGACTT	0.567													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	129128376	129128376	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129128376delC								PVT1 (14878 upstream) : MIR1208 (33986 downstream)																							agggatgctaccaaacatcct	0.000													3	4	---	---	---	---	
GSDMC	56169	broad.mit.edu	37	8	130768503	130768504	+	Intron	INS	-	A	A	rs145459957	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130768503_130768504insA	uc003ysr.2	-							NM_031415	NP_113603	Q9BYG8	GSDMC_HUMAN	melanoma-derived leucine zipper, extra-nuclear							mitochondrion				ovary(2)|skin(1)	3						taaggagagacaaaaaaaggtc	0.000													4	3	---	---	---	---	
ADCY8	114	broad.mit.edu	37	8	131878581	131878584	+	Intron	DEL	TCTT	-	-	rs10600050		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131878581_131878584delTCTT	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AACTTGAACATCTTTCTTCCAcag	0.275										HNSCC(32;0.087)			2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	132714101	132714101	+	IGR	DEL	T	-	-	rs35561156		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132714101delT								ADCY8 (661266 upstream) : EFR3A (202258 downstream)																							tcagtcttccttttttttttt	0.299													5	3	---	---	---	---	
KCNQ3	3786	broad.mit.edu	37	8	133184645	133184646	+	Intron	DEL	AC	-	-	rs138308682		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133184645_133184646delAC	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GCACATTAATacacacacacac	0.342													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	137116316	137116317	+	IGR	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137116316_137116317delTC								KHDRBS3 (456470 upstream) : None (None downstream)																							TCCCCGCACATCTCTCTCTCTC	0.485													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141082692	141082694	+	Intron	DEL	AGG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141082692_141082694delAGG	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						ggagaagggaaggaggaggagga	0.118													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143204362	143204363	+	IGR	DEL	CA	-	-	rs150595385		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143204362_143204363delCA								MIR1302-7 (336688 upstream) : NCRNA00051 (75354 downstream)																							cacatgtgcgcacacacacaca	0.203													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143244409	143244412	+	IGR	DEL	AGAT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143244409_143244412delAGAT								MIR1302-7 (376735 upstream) : NCRNA00051 (35305 downstream)																							atggattgacagatggatggagga	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	144361805	144361805	+	IGR	DEL	T	-	-	rs10708609		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144361805delT								ZFP41 (2706 upstream) : ZNF696 (11754 downstream)																							acaatggtggttagcgcagcc	0.139													3	3	---	---	---	---	
HEATR7A	727957	broad.mit.edu	37	8	145288249	145288250	+	Intron	INS	-	C	C	rs113676809		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145288249_145288250insC	uc003zbk.3	+						HEATR7A_uc011lla.1_Intron|HEATR7A_uc010mft.2_Intron	NM_032450	NP_115826	Q8NDA8	HTR7A_HUMAN	HEAT repeat containing 7A isoform 1								binding				0						cagctcctgcacccaccatcaa	0.272													7	5	---	---	---	---	
C8orf33	65265	broad.mit.edu	37	8	146276859	146276859	+	5'Flank	DEL	C	-	-	rs11324831		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146276859delC	uc003zfc.3	+						C8orf33_uc003zfd.2_5'Flank	NM_023080	NP_075568	Q9H7E9	CH033_HUMAN	hypothetical protein LOC65265												0	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;9.1e-38)|all cancers(56;7.37e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.243)		AAACCCTACTCAGCCTCACCT	0.562													2	4	---	---	---	---	
CDC37L1	55664	broad.mit.edu	37	9	4697384	4697386	+	Intron	DEL	TTG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4697384_4697386delTTG	uc003zio.2	+							NM_017913	NP_060383	Q7L3B6	CD37L_HUMAN	cell division cycle 37 homolog (S.							cytoplasm					0	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0318)		ATGTGGGATTTTGTTGTTGTTGT	0.340													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	6524612	6524612	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6524612delT								UHRF2 (17563 upstream) : GLDC (7854 downstream)																							AGCTTCAGTCttttttttttt	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	31628438	31628438	+	IGR	DEL	T	-	-	rs113892970		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31628438delT								None (None upstream) : ACO1 (756163 downstream)																							aatacagctattctatatata	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	32371248	32371249	+	IGR	INS	-	T	T	rs138237126	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32371248_32371249insT								None (None upstream) : ACO1 (13352 downstream)																							TGACAAGCTGATTTTTTCCTCA	0.282													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	32924788	32924791	+	IGR	DEL	CTTT	-	-	rs111970126		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32924788_32924791delCTTT								TMEM215 (135591 upstream) : APTX (47818 downstream)																							AAATTGTCGCCTTTCTCTACTTCA	0.422													3	3	---	---	---	---	
ZNF658	26149	broad.mit.edu	37	9	40771887	40771888	+	3'UTR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40771887_40771888insT	uc004abs.2	-	5					ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_3'UTR	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GAGGGTTTTTCTTTTTTTTTTT	0.406													4	2	---	---	---	---	
LOC642929	642929	broad.mit.edu	37	9	43143338	43143338	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43143338delA	uc004acy.3	-							NR_027472				Homo sapiens clone HLS_IMAGE_1031047 mRNA sequence.												0						gacttcgtctaaaaaaaaaaa	0.149													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	43844265	43844265	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43844265delG	uc004acz.1	+											Homo sapiens cDNA FLJ30083 fis, clone BGGI12001097, weakly similar to Homo sapiens contactin associated protein (Caspr) mRNA.																		AGCAGGGGGCGCTGGGGAGTT	0.542													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44084399	44084400	+	IGR	INS	-	TAATC	TAATC			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44084399_44084400insTAATC								FAM75A6 (453669 upstream) : FAM27C (905836 downstream)																							GATAAAGACTATATATAAAAAT	0.277													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44846301	44846301	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44846301delT								None (None upstream) : FAM27C (143935 downstream)																							tttttttaacttttttttttt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68386738	68386738	+	IGR	DEL	C	-	-	rs77142435		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68386738delC								FAM27B (592549 upstream) : MIR1299 (615501 downstream)																							gtctttcctgctaaaaactct	0.000													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68414977	68414978	+	IGR	DEL	AG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68414977_68414978delAG								FAM27B (620788 upstream) : MIR1299 (587261 downstream)																							gaaaaagaaaagaaagaaaaga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68473056	68473056	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68473056delT								FAM27B (678867 upstream) : MIR1299 (529183 downstream)																							TAAAAAATGATTTttttttgt	0.194													6	4	---	---	---	---	
C9orf71	169693	broad.mit.edu	37	9	71155262	71155262	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71155262delT	uc004agt.2	-							NM_153237	NP_694969	Q8N6L7	CI071_HUMAN	hypothetical protein LOC169693							integral to membrane					0						TGCGTCATGGTTTTCCCCAAA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	72025593	72025593	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72025593delC								FAM189A2 (18223 upstream) : APBA1 (16856 downstream)																							gagattgagaccagcctggcc	0.060													4	2	---	---	---	---	
TRPM3	80036	broad.mit.edu	37	9	73778247	73778258	+	Intron	DEL	TAGGTAGGTAGG	-	-	rs72331366		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73778247_73778258delTAGGTAGGTAGG	uc004aii.2	-							NM_206948	NP_996831	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						aaacaagatataggtaggtaggtaggtaggta	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	74239510	74239510	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74239510delC								TRPM3 (177690 upstream) : TMEM2 (58772 downstream)																							ttgcagtgagcggagattgca	0.000													4	2	---	---	---	---	
TMEM2	23670	broad.mit.edu	37	9	74338052	74338053	+	Intron	INS	-	A	A	rs80199212	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74338052_74338053insA	uc011lsa.1	-						TMEM2_uc010mos.2_Intron|TMEM2_uc011lsb.1_Intron	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a							integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		aacagccaaagaaaaaaaaaaa	0.010													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	76774871	76774871	+	IGR	DEL	A	-	-	rs11143818	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:76774871delA								ANXA1 (989564 upstream) : RORB (337381 downstream)																							tctcacacacacaaaaaaaaa	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	82773483	82773483	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82773483delA								TLE4 (431826 upstream) : None (None downstream)																							ACAGAGACTTAAAAAAAAAAA	0.308													4	2	---	---	---	---	
SLC28A3	64078	broad.mit.edu	37	9	86943085	86943086	+	Intron	INS	-	AA	AA			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86943085_86943086insAA	uc010mpz.2	-						SLC28A3_uc011lsy.1_Intron|SLC28A3_uc004anu.1_Intron|SLC28A3_uc010mqb.2_Intron	NM_022127	NP_071410	Q9HAS3	S28A3_HUMAN	concentrative Na+-nucleoside cotransporter						nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						cacacacacacacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	87220906	87220906	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87220906delG								SLC28A3 (237493 upstream) : NTRK2 (62560 downstream)																							TAGGAGGTAAGGCAGCCTGCA	0.572													4	2	---	---	---	---	
NTRK2	4915	broad.mit.edu	37	9	87393739	87393739	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87393739delC	uc004aoa.1	+						NTRK2_uc004anv.1_Intron|NTRK2_uc004any.1_Intron|NTRK2_uc004anz.1_Intron|NTRK2_uc011lsz.1_Intron|NTRK2_uc011lta.1_Intron|NTRK2_uc004aob.1_Intron|NTRK2_uc011ltb.1_Intron|NTRK2_uc004aoc.2_Intron	NM_001018064	NP_001018074	Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2						activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity			lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16						TCTGGTGTGTCCGTGCCTGTC	0.527										TSP Lung(25;0.17)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	94970163	94970163	+	IGR	DEL	T	-	-	rs36019987		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94970163delT								C9orf44 (48273 upstream) : IARS (2462 downstream)																							tgaagatatcttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110412144	110412145	+	IGR	INS	-	T	T	rs142600015	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110412144_110412145insT								KLF4 (160097 upstream) : None (None downstream)																							GTCCCTCCCCCGGCCTGCCCTC	0.574													3	3	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113128845	113128845	+	Intron	DEL	A	-	-	rs72033846		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113128845delA	uc010mtz.2	-						SVEP1_uc010mty.2_Intron	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						CTTTTCCTGGAAAAAAAAAAA	0.418													8	4	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113143707	113143708	+	Intron	INS	-	T	T	rs140002051	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113143707_113143708insT	uc010mtz.2	-						SVEP1_uc010mty.2_Intron	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						ttgctttctgatttcttcctta	0.000													5	3	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119264223	119264224	+	Intron	DEL	CA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119264223_119264224delCA	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron|ASTN2_uc004bjp.1_Intron|ASTN2_uc004bjq.1_Intron|ASTN2_uc011lxr.1_Intron|ASTN2_uc011lxs.1_Intron|ASTN2_uc011lxt.1_Intron|uc004bju.1_5'Flank	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						CTCGCACTTGCACACACACACA	0.480													3	6	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119621046	119621046	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119621046delG	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						TGGTCTCCTTGGAAATAACTG	0.224													4	2	---	---	---	---	
FAM125B	89853	broad.mit.edu	37	9	129186634	129186634	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129186634delG	uc004bqh.1	+						FAM125B_uc011lzy.1_Intron|FAM125B_uc010mxd.2_Intron	NM_033446	NP_258257	Q9H7P6	F125B_HUMAN	hypothetical protein LOC89853 isoform 1						protein transport	late endosome membrane					0						AGACACCAGTGGAGACGATAT	0.398													4	2	---	---	---	---	
C9orf119	375757	broad.mit.edu	37	9	131040842	131040843	+	Intron	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131040842_131040843insA	uc004bup.2	+						GOLGA2_uc011maw.1_5'Flank|GOLGA2_uc010mxw.2_5'Flank|C9orf119_uc010mxx.1_Intron	NM_001040011	NP_001035100	Q1ZZU3	SWI5_HUMAN	hypothetical protein LOC375757						double-strand break repair via homologous recombination	Swi5-Sfr1 complex	protein binding				0						aactccatctcaaaaaaaaaaa	0.035													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132172753	132172754	+	IGR	INS	-	CAC	CAC	rs144575657		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132172753_132172754insCAC								C9orf106 (87871 upstream) : C9orf50 (201752 downstream)																							accatCAGCatcaccaccgtca	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132524655	132524655	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132524655delT								PTGES (9311 upstream) : TOR1B (40777 downstream)																							tttttttttgttttttttttt	0.214													4	2	---	---	---	---	
ASS1	445	broad.mit.edu	37	9	133323686	133323687	+	Intron	DEL	CC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133323686_133323687delCC	uc004bzm.2	+						ASS1_uc004bzn.2_Intron|ASS1_uc010mza.2_Intron|ASS1_uc004bzo.2_Intron|ASS1_uc010mzb.2_Intron	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1						arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	GGCCCCAacacccacacacgtg	0.356													4	2	---	---	---	---	
ABL1	25	broad.mit.edu	37	9	133586934	133586934	+	5'Flank	DEL	A	-	-	rs77111157		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133586934delA	uc004bzv.2	+							NM_007313	NP_009297	P00519	ABL1_HUMAN	c-abl oncogene 1, receptor tyrosine kinase						actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)	actccatctgaaaaaaaaaaa	0.000			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								4	2	---	---	---	---	
ABL1	25	broad.mit.edu	37	9	133711046	133711050	+	Intron	DEL	CTCTT	-	-	rs113276697		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133711046_133711050delCTCTT	uc004bzw.2	+						ABL1_uc004bzv.2_Intron	NM_005157	NP_005148	P00519	ABL1_HUMAN	c-abl oncogene 1, receptor tyrosine kinase						actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)	tctttcttccctcttctcttctctt	0.312			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								4	2	---	---	---	---	
C9orf171	389799	broad.mit.edu	37	9	135419544	135419544	+	Intron	DEL	C	-	-	rs113277910		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135419544delC	uc004cbn.2	+						C9orf171_uc004cbo.2_Intron	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799											ovary(4)|large_intestine(1)	5						ACCTGCTCTGCCCCCCCTTGA	0.592													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	136360704	136360705	+	IGR	INS	-	T	T	rs150950874	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136360704_136360705insT								SLC2A6 (16428 upstream) : TMEM8C (19054 downstream)																							tgtgcgtgagcttgtgtgtgAG	0.109													2	4	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137720965	137720966	+	Intron	INS	-	TCAT	TCAT	rs139866702	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137720965_137720966insTCAT	uc004cfe.2	+						uc004cff.2_Intron	NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CCCTTGGTCCAtcattcattca	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138463900	138463903	+	5'Flank	DEL	GGAT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138463900_138463903delGGAT	uc004cgh.1	+						uc004cgi.1_5'Flank					Homo sapiens cDNA FLJ40922 fis, clone UTERU2006182.																		AATgatggaaggatggatggatgg	0.235													6	4	---	---	---	---	
CACNA1B	774	broad.mit.edu	37	9	140777551	140777552	+	Intron	INS	-	GGAA	GGAA	rs140080287	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140777551_140777552insGGAA	uc004cog.2	+						uc004cof.1_Intron	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,						membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	TTCTCGCTGACGGATCACAGTG	0.614													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	141038135	141038135	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141038135delG								CACNA1B (19060 upstream) : TUBBP5 (6430 downstream)																							GCGGGTCCTTGGAAATCTGTG	0.642													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3005455	3005455	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3005455delT								None (None upstream) : PFKP (104297 downstream)																							CTGCCCACCCTCCATCTCCTG	0.383													4	2	---	---	---	---	
RBM17	84991	broad.mit.edu	37	10	6131411	6131412	+	Intron	INS	-	TCC	TCC	rs151234895	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6131411_6131412insTCC	uc001ijb.2	+						RBM17_uc010qav.1_5'UTR	NM_032905	NP_116294	Q96I25	SPF45_HUMAN	RNA binding motif protein 17						mRNA processing|RNA splicing	spliceosomal complex	nucleotide binding|protein binding|RNA binding				0						ccctcttcccttcctcctcctc	0.559													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	10066403	10066404	+	IGR	DEL	CG	-	-	rs59214056	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10066403_10066404delCG								None (None upstream) : SFTA1P (759998 downstream)																							cacacacacacGAGTTCACTAT	0.272													4	2	---	---	---	---	
ARMC4	55130	broad.mit.edu	37	10	28274146	28274146	+	Intron	DEL	A	-	-	rs112048649		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28274146delA	uc009xky.2	-						ARMC4_uc010qdt.1_5'Flank|ARMC4_uc001itz.2_Intron	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4								binding			ovary(4)|skin(2)	6						GTTAGCTGCCAAAAAAAAAAA	0.313													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38569257	38569258	+	IGR	INS	-	CTT	CTT	rs138686077	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38569257_38569258insCTT								LOC100129055 (65985 upstream) : HSD17B7P2 (76050 downstream)																							ACAGAGCTCTCCTCTCTCCCAT	0.525													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	39082430	39082439	+	IGR	DEL	CATTCCATTC	-	-	rs141871112	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39082430_39082439delCATTCCATTC								LOC399744 (341350 upstream) : None (None downstream)																							cattccatttcattccattccattccattc	0.000													7	4	---	---	---	---	
OR13A1	79290	broad.mit.edu	37	10	45806024	45806024	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45806024delA	uc001jcc.1	-							NM_001004297	NP_001004297	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ggaagctgggaaatgtggtca	0.075													4	2	---	---	---	---	
ANXA8L2	244	broad.mit.edu	37	10	47750104	47750105	+	Intron	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47750104_47750105delTC	uc001jem.2	+						ANXA8L2_uc009xnh.1_Intron|ANXA8L2_uc010qgb.1_Intron|ANXA8L2_uc001jen.2_Intron|ANXA8L2_uc001jeo.1_Intron	NM_001630	NP_001621	Q5VT79	AXA82_HUMAN	annexin A8L2								calcium ion binding|calcium-dependent phospholipid binding			pancreas(1)	1						TCCATGGGAATCTCTGTATTTT	0.252													4	2	---	---	---	---	
ARHGAP22	58504	broad.mit.edu	37	10	49833739	49833740	+	Intron	DEL	AC	-	-	rs10705891		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49833739_49833740delAC	uc010qgm.1	-						ARHGAP22_uc001jgv.2_Intron	NM_021226	NP_067049	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 2						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity			ovary(1)	1						TGCAACGTGTacacacacacac	0.391													6	3	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	55738418	55738418	+	Intron	DEL	T	-	-	rs113589414		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55738418delT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				ccagaaaatgttttttttttt	0.000										HNSCC(58;0.16)			4	2	---	---	---	---	
BICC1	80114	broad.mit.edu	37	10	60308908	60308908	+	Intron	DEL	T	-	-	rs35446816		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60308908delT	uc001jki.1	+							NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						cctcagccagttttttttttt	0.000													1	5	---	---	---	---	
BICC1	80114	broad.mit.edu	37	10	60350841	60350842	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60350841_60350842insT	uc001jki.1	+							NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						CTGGCTCAGCATTTTTTTTTCT	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	62888456	62888457	+	IGR	DEL	CA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62888456_62888457delCA								RHOBTB1 (127258 upstream) : TMEM26 (277944 downstream)																							cacacacacgcacacacacaca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	66693688	66693688	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66693688delT								ANXA2P3 (107054 upstream) : CTNNA3 (986037 downstream)																							ttcactgccctaaaaatcctc	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	67557051	67557053	+	IGR	DEL	AAC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67557051_67557053delAAC								ANXA2P3 (970417 upstream) : CTNNA3 (122672 downstream)																							tctgtctcaaaacaacaacaaca	0.000													4	2	---	---	---	---	
CTNNA3	29119	broad.mit.edu	37	10	68027841	68027843	+	Intron	DEL	ATG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68027841_68027843delATG	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						ATTGTTGAAAatgatgatgatga	0.187													3	3	---	---	---	---	
MYST4	23522	broad.mit.edu	37	10	76648884	76648884	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76648884delA	uc001jwn.1	+						MYST4_uc001jwm.1_Intron|MYST4_uc001jwo.1_Intron|MYST4_uc001jwp.1_Intron	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic						histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)					AAAGGACTCTAAGACAGACAT	0.234			T	CREBBP	AML								4	2	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	87847150	87847151	+	Intron	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87847150_87847151delTG	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	taatggagtctgtgtgtgtgtg	0.213										Multiple Myeloma(13;0.14)			4	3	---	---	---	---	
BMPR1A	657	broad.mit.edu	37	10	88569079	88569080	+	Intron	DEL	CT	-	-	rs111924453		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88569079_88569080delCT	uc001kdy.2	+							NM_004329	NP_004320	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA						BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity			lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8						cagggtctcactctgtcaccca	0.050			Mis|N|F			gastrointestinal polyps			Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis				0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	92494634	92494634	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92494634delG								KIF20B (959934 upstream) : HTR7 (5944 downstream)																							TTGATTAATTGGCAGTTAAGA	0.408													4	2	---	---	---	---	
MYOF	26509	broad.mit.edu	37	10	95244278	95244279	+	5'Flank	INS	-	AAC	AAC	rs145567840	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95244278_95244279insAAC	uc001kin.2	-						MYOF_uc001kio.2_5'Flank|MYOF_uc001kip.3_5'Flank|MYOF_uc009xuf.2_5'Flank	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						tttttaccgaaaacaacaacaa	0.040													2	4	---	---	---	---	
ABCC2	1244	broad.mit.edu	37	10	101606485	101606486	+	Intron	INS	-	ACTC	ACTC	rs141094484	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101606485_101606486insACTC	uc001kqf.2	+							NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),							apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	aacagagtgaaagcctcaaaaa	0.238													8	4	---	---	---	---	
C10orf76	79591	broad.mit.edu	37	10	103753043	103753044	+	Intron	INS	-	A	A	rs79210346		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103753043_103753044insA	uc009xwy.1	-						C10orf76_uc009xwx.1_5'Flank	NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591							integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		ctcaaaaaaagaaaaaaaaaaa	0.163													4	2	---	---	---	---	
ARL3	403	broad.mit.edu	37	10	104449587	104449587	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104449587delA	uc001kwa.2	-							NM_004311	NP_004302	P36405	ARL3_HUMAN	ADP-ribosylation factor-like 3						cell cycle|cytokinesis|small GTPase mediated signal transduction	centrosome|cytoplasmic microtubule|Golgi membrane|midbody|nucleus|photoreceptor connecting cilium|spindle microtubule	GDP binding|GTP binding|metal ion binding|microtubule binding				0		Colorectal(252;0.122)		Epithelial(162;4.88e-09)|all cancers(201;1.29e-07)|BRCA - Breast invasive adenocarcinoma(275;0.22)		actccgtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
RBM20	282996	broad.mit.edu	37	10	112458010	112458011	+	Intron	INS	-	C	C	rs149875331	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112458010_112458011insC	uc001kzf.2	+							NM_001134363	NP_001127835	Q5T481	RBM20_HUMAN	RNA binding motif protein 20							nucleus	nucleotide binding|RNA binding|zinc ion binding				0						GGCAAAGACTTCCCCTATACTT	0.381													2	5	---	---	---	---	
ATRNL1	26033	broad.mit.edu	37	10	116995307	116995308	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116995307_116995308insT	uc001lcg.2	+							NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		acttattgtgattttttttttc	0.000													4	2	---	---	---	---	
PDZD8	118987	broad.mit.edu	37	10	119123693	119123694	+	Intron	DEL	GT	-	-	rs112500881		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119123693_119123694delGT	uc001lde.1	-							NM_173791	NP_776152	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8						intracellular signal transduction		metal ion binding				0		Colorectal(252;0.19)		all cancers(201;0.0121)		TAATTTATGGgtgtgtgtgtgt	0.297													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	119663993	119663994	+	IGR	DEL	AC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119663993_119663994delAC								EMX2 (354937 upstream) : RAB11FIP2 (100435 downstream)																							TCTGAGACAGACACACACACAC	0.406													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125015056	125015058	+	IGR	DEL	CAA	-	-	rs139340990	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125015056_125015058delCAA								BUB3 (90170 upstream) : GPR26 (410813 downstream)																							ccaccaccaccaacattaccatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125016343	125016343	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125016343delA								BUB3 (91457 upstream) : GPR26 (409528 downstream)																							GTAAGAACACAGGGCCCATGA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125705055	125705056	+	IGR	DEL	AC	-	-	rs112569859		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125705055_125705056delAC								CPXM2 (5276 upstream) : CHST15 (62130 downstream)																							GTTTCTGCAAacacacacacac	0.396													4	2	---	---	---	---	
OAT	4942	broad.mit.edu	37	10	126092840	126092841	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126092840_126092841insT	uc001lhp.2	-						OAT_uc001lhq.2_Intron|OAT_uc001lhr.2_Intron	NM_000274	NP_000265	P04181	OAT_HUMAN	ornithine aminotransferase precursor						cellular amino acid biosynthetic process|visual perception	mitochondrial matrix	ornithine-oxo-acid transaminase activity|protein binding|pyridoxal phosphate binding				0		all_lung(145;0.0271)|Lung NSC(174;0.0436)|Colorectal(57;0.102)|all_neural(114;0.116)			L-Ornithine(DB00129)|Pyridoxal Phosphate(DB00114)	atttattttcattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134824644	134824645	+	IGR	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134824644_134824645delTG								C10orf93 (68580 upstream) : GPR123 (59788 downstream)																							tagtgtgtgatgtgtgttagcg	0.000													5	4	---	---	---	---	
STIM1	6786	broad.mit.edu	37	11	4042364	4042366	+	Intron	DEL	TGG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4042364_4042366delTGG	uc001lyv.2	+						STIM1_uc009yef.2_Intron	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor						activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		ttgttgcctatggtggtggtggt	0.000													3	3	---	---	---	---	
OR51E1	143503	broad.mit.edu	37	11	4666349	4666350	+	Intron	INS	-	TCTG	TCTG	rs145211075		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4666349_4666350insTCTG	uc001lzi.3	+							NM_152430	NP_689643	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(3)|pancreas(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		tgtcctatcactctttctttcg	0.000													4	3	---	---	---	---	
HBG2	3048	broad.mit.edu	37	11	5583914	5583915	+	Intron	INS	-	G	G	rs146646778	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5583914_5583915insG	uc001mak.1	-									P69892	HBG2_HUMAN	Homo sapiens hemoglobin gamma-G (HBG2) mRNA, partial cds.						blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TATGGTCAAAATTAAATTCAgg	0.089													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11203811	11203812	+	IGR	INS	-	T	T	rs146876469	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11203811_11203812insT								ZBED5 (324191 upstream) : GALNTL4 (88609 downstream)																							TTTGTTTAGACTTTTTTTGTCT	0.436													6	3	---	---	---	---	
DKK3	27122	broad.mit.edu	37	11	12000686	12000686	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12000686delT	uc001mju.2	-						DKK3_uc010rcf.1_Intron|DKK3_uc001mjv.2_Intron|DKK3_uc001mjw.2_Intron|DKK3_uc010rcg.1_Intron	NM_001018057	NP_001018067	Q9UBP4	DKK3_HUMAN	dickkopf homolog 3 precursor						adrenal gland development|anatomical structure morphogenesis|negative regulation of aldosterone biosynthetic process|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cortisol biosynthetic process|negative regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	extracellular space				breast(1)	1				Epithelial(150;0.000502)		CCAGCCTGACTTTTCCCATCC	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	17661465	17661467	+	IGR	DEL	TGG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17661465_17661467delTGG								USH1C (95502 upstream) : MYOD1 (79643 downstream)																							atggtgaggatggtggtggtggt	0.000													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19716746	19716746	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19716746delC	uc001mpp.2	+							NM_001111018	NP_001104488	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						AGGTGGCCTTCAGGGAGTTGA	0.378													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19822219	19822220	+	Intron	DEL	GT	-	-	rs67884123		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19822219_19822220delGT	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						AGGAGAATGGgtgtgtgtgtgt	0.218													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	20097461	20097461	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20097461delG	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron|NAV2_uc001mpt.2_Intron|NAV2_uc009yhx.2_Intron|NAV2_uc009yhy.1_Intron|NAV2_uc009yhz.2_Intron|NAV2_uc001mpu.2_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						CATCCCTCTTGCAGCCCACTG	0.488													4	2	---	---	---	---	
LGR4	55366	broad.mit.edu	37	11	27427666	27427666	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27427666delA	uc001mrj.3	-						LGR4_uc001mrk.3_Intron	NM_018490	NP_060960	Q9BXB1	LGR4_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			ovary(1)	1						GCTCCTCTGCAGGTCTTTGTA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	28591451	28591452	+	IGR	DEL	TG	-	-	rs34841065		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28591451_28591452delTG								METT5D1 (236397 upstream) : None (None downstream)																							ctggctaatttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	30920032	30920032	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30920032delT	uc001mss.1	-						uc009yjk.1_Intron|uc009yjj.1_Intron					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		ttggggaaggtgagagagagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	42010491	42010492	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42010491_42010492insA								LRRC4C (529168 upstream) : None (None downstream)																							aagaaagaaagaaagaaagaaa	0.119													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	42356241	42356242	+	IGR	INS	-	ATCA	ATCA	rs142632743	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42356241_42356242insATCA								LRRC4C (874918 upstream) : API5 (977263 downstream)																							tccatatcactatcagcatttt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	43255351	43255352	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43255351_43255352insA								None (None upstream) : API5 (78153 downstream)																							gactccgtctcaaaaaaaaaaa	0.203													3	3	---	---	---	---	
OR4C45	403257	broad.mit.edu	37	11	48376798	48376799	+	5'Flank	INS	-	TGGC	TGGC	rs142395937	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48376798_48376799insTGGC	uc010rhw.1	-							NM_001005513	NP_001005513			olfactory receptor, family 4, subfamily C,												0						ATTTTTATTAATGACTGAGAGG	0.386													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48380107	48380107	+	IGR	DEL	T	-	-	rs112821423		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48380107delT								OR4C45 (6108 upstream) : OR4A47 (130238 downstream)																							aataagttcctttatctccat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	54994338	54994338	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:54994338delA								None (None upstream) : TRIM48 (35320 downstream)																							caatcaatagaaatgttcaac	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	59066312	59066312	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59066312delG								MPEG1 (85818 upstream) : OR5AN1 (65620 downstream)																							aggaaagaaaggaaagaaaga	0.000													4	3	---	---	---	---	
PLAC1L	219990	broad.mit.edu	37	11	59813692	59813693	+	Intron	INS	-	TCTG	TCTG	rs149961943	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59813692_59813693insTCTG	uc001nol.2	+							NM_173801	NP_776162	Q86WS3	PLACL_HUMAN	placenta-specific 1-like precursor							extracellular region				ovary(2)|skin(1)	3						ctgtctctctctctttctccct	0.158													4	2	---	---	---	---	
SLC29A2	3177	broad.mit.edu	37	11	66131975	66131977	+	Intron	DEL	TTT	-	-	rs34482391		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66131975_66131977delTTT	uc001oht.2	-						SLC29A2_uc001ohs.2_Intron|SLC29A2_uc010rpb.1_Intron|SLC29A2_uc009yrf.2_Intron|SLC29A2_uc001ohu.2_Intron|SLC29A2_uc001ohv.2_Intron	NM_001532	NP_001523	Q14542	S29A2_HUMAN	solute carrier family 29 (nucleoside						cell proliferation|nucleobase, nucleoside and nucleotide metabolic process	basolateral plasma membrane|integral to plasma membrane|nuclear membrane|nucleolus	nucleoside transmembrane transporter activity			ovary(1)	1						CATAGAGTACttttttttttttt	0.296													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	66449155	66449155	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66449155delT								RBM4B (3880 upstream) : SPTBN2 (3566 downstream)																							tgcttttgaattttttttttt	0.000													4	2	---	---	---	---	
UNC93B1	81622	broad.mit.edu	37	11	67769655	67769656	+	Intron	INS	-	ACAC	ACAC	rs60629377		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67769655_67769656insACAC	uc001omw.1	-							NM_030930	NP_112192	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1						innate immune response|intracellular protein transport|response to virus|toll-like receptor 3 signaling pathway|toll-like receptor 7 signaling pathway|toll-like receptor 9 signaling pathway	early phagosome|endoplasmic reticulum membrane|endosome|integral to membrane|lysosome					0						CCCGCTTGcatacacacacaca	0.233													4	3	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70520502	70520502	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70520502delT	uc001oqc.2	-							NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			ctctttttacttgccagcttg	0.090													4	2	---	---	---	---	
RAB6A	5870	broad.mit.edu	37	11	73446965	73446966	+	Intron	INS	-	AAAA	AAAA			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73446965_73446966insAAAA	uc001oue.2	-						RAB6A_uc001ouf.2_Intron|RAB6A_uc009yts.2_Intron|RAB6A_uc001oug.2_Intron	NM_002869	NP_002860	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family isoform a						minus-end-directed organelle transport along microtubule|peptidyl-cysteine methylation|protein targeting to Golgi|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic vesicle|cytosol|Golgi membrane|trans-Golgi network	GTP binding|GTPase activity|protein domain specific binding				0						AACCTTGCCTTAAAAAAAAAAA	0.257													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	79272420	79272420	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79272420delG								ODZ4 (120725 upstream) : None (None downstream)																							TGGATCTGCAGGGTCAGGGAC	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	79296161	79296161	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79296161delC								ODZ4 (144466 upstream) : None (None downstream)																							TTGTTCCTTTCCCAACTCTGC	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	79794205	79794208	+	IGR	DEL	TCCT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79794205_79794208delTCCT								ODZ4 (642510 upstream) : None (None downstream)																							ccttcccttctccttccttccttc	0.132													4	3	---	---	---	---	
KIAA1731	85459	broad.mit.edu	37	11	93405753	93405754	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93405753_93405754insT	uc009ywb.1	+							NM_033395	NP_203753	Q9C0D2	K1731_HUMAN	hypothetical protein LOC85459							centrosome					0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				agtgcctggcATTTTTTTTCTT	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	102623121	102623122	+	Intron	DEL	GT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102623121_102623122delGT	uc001phf.2	-											Homo sapiens mRNA for hypothetical protein, partial cds, clone:Hsa11-digit16-11-10-F.																		AGCTACACAGGTGTGTGTGTGT	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	106033762	106033762	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106033762delC								AASDHPPT (64343 upstream) : GUCY1A2 (524148 downstream)																							TTCCACTTGTCCGTGCTTCCC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	107052695	107052698	+	IGR	DEL	ACAC	-	-	rs34366729		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107052695_107052698delACAC								GUCY1A2 (163524 upstream) : CWF19L2 (144376 downstream)																							atatatacatacacacacacacac	0.000													3	3	---	---	---	---	
FAM55B	120406	broad.mit.edu	37	11	114555162	114555163	+	Intron	INS	-	AA	AA			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114555162_114555163insAA	uc009yyy.2	+							NM_182495	NP_872301	Q96DL1	FA55B_HUMAN	hypothetical protein LOC120406							integral to membrane				ovary(1)	1						aaaaagaaaagaaaaaaaaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	116359168	116359170	+	IGR	DEL	GAG	-	-	rs150647122		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116359168_116359170delGAG								CADM1 (983927 upstream) : BUD13 (259718 downstream)																							TTTGTGACCTGAGGAGGAGGAGG	0.537													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	116362623	116362624	+	IGR	INS	-	TTG	TTG	rs141117647	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116362623_116362624insTTG								CADM1 (987382 upstream) : BUD13 (256264 downstream)																							tgccatggccattgttgttgtt	0.000													4	3	---	---	---	---	
SIAE	54414	broad.mit.edu	37	11	124528137	124528140	+	Intron	DEL	CACA	-	-	rs35532447		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124528137_124528140delCACA	uc001qan.2	-							NM_170601	NP_733746	Q9HAT2	SIAE_HUMAN	sialate O-acetylesterase precursor							extracellular region|lysosome	carboxylesterase activity|sialate O-acetylesterase activity				0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)		TGTGTCTGTGcacacacacacaca	0.348													2	5	---	---	---	---	
IQSEC3	440073	broad.mit.edu	37	12	264007	264008	+	Intron	DEL	CT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:264007_264008delCT	uc001qhw.1	+						IQSEC3_uc001qhu.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		gatctctctcctgccttttcct	0.158													6	3	---	---	---	---	
ATN1	1822	broad.mit.edu	37	12	7033123	7033124	+	5'Flank	INS	-	TG	TG	rs138446205	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7033123_7033124insTG	uc001qrw.1	+							NM_001007026	NP_001007027	P54259	ATN1_HUMAN	atrophin-1						cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						ATAAAATATTTTGTGTGTGTGT	0.520											OREG0021640	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	4	---	---	---	---	
ATF7IP	55729	broad.mit.edu	37	12	14625754	14625755	+	Intron	INS	-	CA	CA	rs144417322	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14625754_14625755insCA	uc001rbw.2	+						ATF7IP_uc001rbu.2_Intron|ATF7IP_uc001rbv.1_Intron|ATF7IP_uc001rbx.2_Intron|ATF7IP_uc001rby.3_Intron|ATF7IP_uc001rca.2_Intron	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting						DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						ATGAATGTATGCACACACACAC	0.054													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	17102215	17102216	+	IGR	DEL	AC	-	-	rs10547834		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17102215_17102216delAC								LMO3 (339457 upstream) : None (None downstream)																							GCACTTacatacacacacacac	0.272													4	2	---	---	---	---	
SOX5	6660	broad.mit.edu	37	12	24169691	24169691	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24169691delT	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						TTTCCAAAGATTTTTTTTTTT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	27994485	27994486	+	IGR	INS	-	T	T	rs142049172	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27994485_27994486insT								KLHDC5 (38513 upstream) : PTHLH (116532 downstream)																							GGCCTGGGGACTACTGAAGACA	0.441													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34839722	34839722	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34839722delG								ALG10 (658488 upstream) : None (None downstream)																							tttgtgatgtgtggattcaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	41541421	41541422	+	IGR	INS	-	G	G	rs146382775	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41541421_41541422insG								CNTN1 (77327 upstream) : PDZRN4 (41365 downstream)																							agccccacaaattttaactcat	0.000													3	3	---	---	---	---	
PFKM	5213	broad.mit.edu	37	12	48500489	48500490	+	Intron	INS	-	CAAA	CAAA	rs151226090	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48500489_48500490insCAAA	uc001rrb.1	+						SENP1_uc001rqw.2_5'Flank|SENP1_uc001rqx.2_5'Flank|SENP1_uc001rqy.2_5'Flank|SENP1_uc001rqz.2_5'Flank|SENP1_uc009zkx.2_5'Flank|PFKM_uc001rra.1_Intron	NM_000289	NP_000280	P08237	K6PF_HUMAN	phosphofructokinase, muscle						fructose 6-phosphate metabolic process|glycolysis|muscle cell homeostasis	6-phosphofructokinase complex|apical plasma membrane	6-phosphofructokinase activity|ATP binding|identical protein binding|kinase binding|metal ion binding|protein C-terminus binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4						CATTCAGcaagcaaacaaacaa	0.218													4	2	---	---	---	---	
SPATS2	65244	broad.mit.edu	37	12	49774830	49774832	+	Intron	DEL	TTG	-	-	rs113668251		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49774830_49774832delTTG	uc001rud.2	+						SPATS2_uc001ruc.2_Intron|SPATS2_uc001rue.2_Intron|SPATS2_uc009zli.1_Intron|SPATS2_uc001ruf.2_Intron	NM_023071	NP_075559	Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2							cytoplasm				breast(1)	1						ttgtcaacatttgttgttgttgt	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	52237328	52237329	+	IGR	INS	-	A	A	rs5798189		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52237328_52237329insA								FIGNL2 (21120 upstream) : ANKRD33 (44464 downstream)																							gagacaatctcaaaaaaaaaaa	0.208													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	52319273	52319274	+	IGR	INS	-	G	G	rs139952790	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52319273_52319274insG								ACVRL1 (2129 upstream) : ACVR1B (26212 downstream)																							GATGTCTAGATAGATAAACCTG	0.450													4	3	---	---	---	---	
ITGA7	3679	broad.mit.edu	37	12	56082506	56082507	+	Intron	INS	-	A	A	rs35887029		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56082506_56082507insA	uc001shh.2	-						ITGA7_uc001shg.2_Intron|ITGA7_uc010sps.1_Intron|ITGA7_uc001shf.2_5'Flank|ITGA7_uc009znw.2_Intron|ITGA7_uc009znx.2_Intron	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						gactccgtctcaaaaaaaaaaa	0.233													6	3	---	---	---	---	
IFNG	3458	broad.mit.edu	37	12	68552495	68552496	+	Intron	DEL	GT	-	-	rs35314021		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68552495_68552496delGT	uc001stw.1	-							NM_000619	NP_000610	P01579	IFNG_HUMAN	interferon, gamma precursor						cell cycle arrest|interferon-gamma-mediated signaling pathway|negative regulation of interleukin-17 production|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of metanephric nephron tubule epithelial cell differentiation|negative regulation of smooth muscle cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity|positive regulation of fructose 1,6-bisphosphate metabolic process|positive regulation of interleukin-12 production|positive regulation of interleukin-23 production|positive regulation of killing of cells of other organism|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mesenchymal cell proliferation|positive regulation of nitric oxide biosynthetic process|positive regulation of osteoclast differentiation|positive regulation of peptidyl-serine phosphorylation of STAT protein|positive regulation of smooth muscle cell apoptosis|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of vitamin D biosynthetic process|protein import into nucleus, translocation|regulation of insulin secretion|regulation of interferon-gamma-mediated signaling pathway|response to virus	extracellular space	cytokine activity|interferon-gamma receptor binding				0			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Interferon gamma-1b(DB00033)|Simvastatin(DB00641)	ACAtgtgcgagtgtgtgtgtgt	0.257													4	2	---	---	---	---	
CPM	1368	broad.mit.edu	37	12	69355545	69355546	+	Intron	INS	-	ACAA	ACAA	rs149396904	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69355545_69355546insACAA	uc001sur.2	-							NM_001874	NP_001865	P14384	CBPM_HUMAN	carboxypeptidase M precursor						anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding				0	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			taaacaaaCAGACAAACAACAA	0.119													5	4	---	---	---	---	
ACSS3	79611	broad.mit.edu	37	12	81469850	81469851	+	5'Flank	INS	-	A	A	rs71904646		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81469850_81469851insA	uc001szl.1	+						ACSS3_uc001szm.1_5'Flank	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3							mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						agctcctcctcccacttttaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	85887754	85887754	+	IGR	DEL	T	-	-	rs74872837		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85887754delT								ALX1 (192195 upstream) : RASSF9 (310577 downstream)																							agttctcttctttttttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	86169095	86169095	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86169095delT								ALX1 (473536 upstream) : RASSF9 (29236 downstream)																							TTATGGCCAATTTTTTTTTTC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	89320256	89320257	+	IGR	DEL	AC	-	-	rs113164631		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89320256_89320257delAC								KITLG (346018 upstream) : DUSP6 (421582 downstream)																							GTAAACTCAAacacacacacac	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	96910087	96910088	+	Intron	INS	-	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96910087_96910088insG	uc009ztl.1	+						uc001teq.2_Intron					RecName: Full=Uncharacterized protein C12orf55;																		tgctgagaccaggggcagtgtc	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	103609330	103609334	+	IGR	DEL	TCTTT	-	-	rs66486952		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103609330_103609334delTCTTT								ASCL1 (255043 upstream) : C12orf42 (22036 downstream)																							AGATTTATTCTCTTTTCATCTCTCT	0.302													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	106546411	106546412	+	IGR	DEL	AC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106546411_106546412delAC								NUAK1 (12600 upstream) : CKAP4 (85248 downstream)																							TTTTCAGATTacacacacacac	0.312													4	2	---	---	---	---	
CORO1C	23603	broad.mit.edu	37	12	109040197	109040197	+	3'UTR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109040197delA	uc001tnj.2	-	11					CORO1C_uc009zva.2_3'UTR|CORO1C_uc010sxf.1_3'UTR	NM_014325	NP_055140	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C isoform 1						actin cytoskeleton organization|phagocytosis|signal transduction	actin cytoskeleton	actin filament binding			skin(3)	3						CAAGCTGCTGAAAAGGGCAAG	0.493													4	2	---	---	---	---	
FBXO21	23014	broad.mit.edu	37	12	117588434	117588434	+	Intron	DEL	G	-	-	rs78968605		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117588434delG	uc001twk.2	-						FBXO21_uc001twj.2_Intron|FBXO21_uc009zwq.2_Intron	NM_033624	NP_296373	O94952	FBX21_HUMAN	F-box only protein 21 isoform 1						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			kidney(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		AAGACTCCTTGTGAATGACAA	0.458													4	2	---	---	---	---	
CCDC60	160777	broad.mit.edu	37	12	119833752	119833752	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119833752delT	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		cttttctttctttttttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	121368177	121368177	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121368177delT								SPPL3 (26026 upstream) : C12orf27 (39464 downstream)																							GTGCAAACTCttttttttttt	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	121547878	121547878	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121547878delA								OASL (71098 upstream) : P2RX7 (22800 downstream)																							gggcctctctaaaaaaaaaaa	0.055													3	3	---	---	---	---	
P2RX4	5025	broad.mit.edu	37	12	121651842	121651842	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121651842delA	uc001tzr.2	+						P2RX4_uc010szr.1_Intron|P2RX4_uc010szs.1_Intron|P2RX4_uc009zxc.2_Intron|P2RX4_uc001tzs.2_Intron|P2RX4_uc009zxb.2_Intron|P2RX4_uc010szt.1_Intron	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4						endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					catctctaccaaaaatacgaa	0.000													4	2	---	---	---	---	
KNTC1	9735	broad.mit.edu	37	12	123027121	123027121	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123027121delT	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		aagaccagcctgaccaacatg	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	124755972	124755972	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124755972delT								ZNF664 (256005 upstream) : FAM101A (17738 downstream)																							ttcttcttccttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	129273225	129273225	+	IGR	DEL	T	-	-	rs12579867	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129273225delT								TMEM132C (80762 upstream) : SLC15A4 (4514 downstream)																							aaatataaaataaaaaagtaa	0.000													4	2	---	---	---	---	
GLT1D1	144423	broad.mit.edu	37	12	129339208	129339209	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129339208_129339209insT	uc001uhx.1	+						GLT1D1_uc001uhy.1_Intron	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1						biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		cgcccggctgatttttgtattt	0.000													3	3	---	---	---	---	
RIMBP2	23504	broad.mit.edu	37	12	131162667	131162667	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131162667delA	uc001uim.2	-									O15034	RIMB2_HUMAN	RecName: Full=RIMS-binding protein 2;          Short=RIM-BP2;							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TCCCACAAACAAACCTGGGTG	0.562													4	2	---	---	---	---	
GPR133	283383	broad.mit.edu	37	12	131530746	131530747	+	Intron	DEL	CT	-	-	rs67229639		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131530746_131530747delCT	uc001uit.3	+						GPR133_uc010tbm.1_Intron	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CTGGTCAGTGCTCCCTCCCTGG	0.634													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131898888	131898889	+	IGR	DEL	AG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131898888_131898889delAG								LOC116437 (201413 upstream) : SFRS8 (296746 downstream)																							TGGCAGCAACAGCTGACATACG	0.584													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19320620	19320620	+	5'Flank	DEL	T	-	-	rs113823012		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19320620delT	uc001ulv.1	-											DQ586768																		taggcctcactgaccaagtcc	0.139													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	20792754	20792755	+	IGR	INS	-	TT	TT	rs10529996		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20792754_20792755insTT								GJB2 (25640 upstream) : GJB6 (3347 downstream)																							ttctttctttctctttctttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	20923260	20923261	+	IGR	DEL	CA	-	-	rs5802060		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20923260_20923261delCA								GJB6 (116726 upstream) : CRYL1 (54548 downstream)																							cacacatgctcacatattcata	0.000													4	4	---	---	---	---	
CRYL1	51084	broad.mit.edu	37	13	21060233	21060233	+	Intron	DEL	A	-	-	rs35445120		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21060233delA	uc001une.2	-						CRYL1_uc001unf.2_Intron|CRYL1_uc001ung.2_Intron	NM_015974	NP_057058	Q9Y2S2	CRYL1_HUMAN	lambda-crystallin						fatty acid metabolic process	cytosol	3-hydroxyacyl-CoA dehydrogenase activity|L-gulonate 3-dehydrogenase activity|NAD+ binding|protein homodimerization activity				0		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		aagtttttgtattttcagtag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	21130731	21130731	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21130731delT								CRYL1 (30719 upstream) : IFT88 (10477 downstream)																							acttagctaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	23678434	23678435	+	IGR	DEL	AC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23678434_23678435delAC								None (None upstream) : SGCG (76625 downstream)																							acacacagaaacacacacacac	0.243													4	4	---	---	---	---	
MIPEP	4285	broad.mit.edu	37	13	24382495	24382495	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24382495delC	uc001uox.3	-							NM_005932	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase precursor						protein processing involved in protein targeting to mitochondrion|proteolysis	mitochondrial matrix	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		gcctcggcctcccaacgtgct	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	24958714	24958715	+	IGR	INS	-	GC	GC	rs139855556	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24958714_24958715insGC								C1QTNF9 (62049 upstream) : PARP4 (36360 downstream)																							tgtgtgtgtgtgcgcgcgcgtg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31341640	31341641	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31341640_31341641insT								ALOX5AP (3084 upstream) : C13orf33 (138671 downstream)																							AGAGAAAtttcttttttttttt	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	32049536	32049536	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32049536delT								B3GALTL (143127 upstream) : RXFP2 (264143 downstream)																							gccatttgcattttttttttt	0.030													4	2	---	---	---	---	
RXFP2	122042	broad.mit.edu	37	13	32327133	32327133	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32327133delG	uc001utt.2	+						RXFP2_uc010aba.2_Intron	NM_130806	NP_570718	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2							integral to membrane|plasma membrane					0		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		GCCCCTCTGAGGCACCATTGC	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	34287532	34287534	+	IGR	DEL	CTT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34287532_34287534delCTT								STARD13 (36600 upstream) : RFC3 (104672 downstream)																							ccttctcctccttcttcttcttc	0.108													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	34911853	34911855	+	IGR	DEL	AGA	-	-	rs34429101		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34911853_34911855delAGA								RFC3 (371159 upstream) : NBEA (604601 downstream)																							agaggagaacagaagaagaagaa	0.059													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	35120764	35120764	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35120764delG								RFC3 (580070 upstream) : NBEA (395692 downstream)																							AATCATTTGAGGTCTTTGCCA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	37088925	37088925	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37088925delC								CCNA1 (71907 upstream) : C13orf36 (159124 downstream)																							TCAAGTGGTACCATGAAGGGT	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	40405540	40405540	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40405540delG								COG6 (39738 upstream) : LOC646982 (515733 downstream)																							TGTGGCCTCTGGAATAGAGGG	0.468													4	2	---	---	---	---	
KIAA0564	23078	broad.mit.edu	37	13	42185414	42185414	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42185414delG	uc001uyj.2	-							NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a							extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		agatttctgagggcaggaagg	0.169													4	2	---	---	---	---	
DGKH	160851	broad.mit.edu	37	13	42637315	42637315	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42637315delT	uc001uyl.1	+						DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron	NM_178009	NP_821077	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TCTGGACCTATTTTTTTTTTT	0.085													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	43101364	43101365	+	IGR	INS	-	A	A	rs150448738	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43101364_43101365insA								AKAP11 (203962 upstream) : TNFSF11 (35507 downstream)																							GAGGCAGAGTGAAAACGGGTTT	0.446													2	6	---	---	---	---	
ENOX1	55068	broad.mit.edu	37	13	43794519	43794520	+	Intron	DEL	CA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43794519_43794520delCA	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron|ENOX1_uc001uyz.3_Intron	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		AATCATGACTCACAGATTTCAC	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	44801527	44801528	+	IGR	INS	-	T	T	rs34784041		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44801527_44801528insT								LOC121838 (196929 upstream) : SERP2 (146450 downstream)																							TAGTTTCTAGGTTTTTTTTTTT	0.124													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	45396509	45396510	+	IGR	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45396509_45396510delTC								TSC22D1 (245808 upstream) : NUFIP1 (116874 downstream)																							cctctcactgtctctctctctc	0.257													4	2	---	---	---	---	
GTF2F2	2963	broad.mit.edu	37	13	45708082	45708082	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45708082delT	uc001uzw.2	+						GTF2F2_uc001uzv.2_Intron	NM_004128	NP_004119	P13984	T2FB_HUMAN	general transcription factor IIF, polypeptide 2,						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	microtubule cytoskeleton|transcription factor TFIIF complex	ATP binding|ATP-dependent helicase activity|DNA binding|protein binding				0		Lung NSC(96;0.00115)|Prostate(109;0.00578)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000647)		ctggtcctcctgattccgcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	47332155	47332155	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47332155delA								LRCH1 (4982 upstream) : ESD (13237 downstream)																							ccccccccacaaaaaaaaaac	0.010													4	2	---	---	---	---	
DLEU1	10301	broad.mit.edu	37	13	50987853	50987854	+	Intron	DEL	TG	-	-	rs150002966		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50987853_50987854delTG	uc001vee.1	+						DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron|uc001vel.1_Intron|uc001vem.1_Intron|uc001veq.1_Intron|uc001ver.2_Intron|uc001ves.1_Intron|uc001vet.1_Intron|uc001veu.2_5'Flank|uc001vev.2_5'Flank					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0						TGAGAAACTCtgtgtgtgtgtg	0.401													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	55261427	55261427	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55261427delG								MIR1297 (375244 upstream) : None (None downstream)																							actgttctatggaatctgggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	57082349	57082350	+	IGR	INS	-	A	A	rs71301451		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57082349_57082350insA								None (None upstream) : PRR20C (632702 downstream)																							acaacaacaaGAAAAAACCATG	0.233													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	61620406	61620406	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61620406delT								TDRD3 (472394 upstream) : PCDH20 (363415 downstream)																							AGGAATACACTTTTTTTTTTT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	63618889	63618892	+	IGR	DEL	AGAC	-	-	rs145156908		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63618889_63618892delAGAC								None (None upstream) : OR7E156P (692676 downstream)																							agcagaacaaagacagttaatcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	63619878	63619878	+	IGR	DEL	T	-	-	rs111659226		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63619878delT								None (None upstream) : OR7E156P (691690 downstream)																							gccaatatgattcttctattc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	65594648	65594648	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65594648delT								None (None upstream) : None (None downstream)																							tttatttttatttttttttgg	0.000													4	2	---	---	---	---	
PIBF1	10464	broad.mit.edu	37	13	73542409	73542410	+	Intron	INS	-	TTGTTG	TTGTTG	rs143459095	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73542409_73542410insTTGTTG	uc001vjc.2	+						PIBF1_uc001vjb.2_Intron|PIBF1_uc010aep.2_Intron	NM_006346	NP_006337	Q8WXW3	PIBF1_HUMAN	progesterone-induced blocking factor 1							centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		gttttggggttttgttgttgtt	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	85275513	85275513	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85275513delT								SLITRK1 (818985 upstream) : None (None downstream)																							atttctattatttttactttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	91220463	91220464	+	IGR	DEL	TG	-	-	rs72161800		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91220463_91220464delTG								MIR622 (336932 upstream) : LOC144776 (322744 downstream)																							tgtatgtgtatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	91972602	91972603	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91972602_91972603insT								LOC144776 (393751 upstream) : MIR17HG (27471 downstream)																							TTGAAATACTCTTTGATTTATC	0.441													4	2	---	---	---	---	
IPO5	3843	broad.mit.edu	37	13	98657453	98657453	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98657453delT	uc001vnf.1	+						IPO5_uc001vne.2_Intron|IPO5_uc010tik.1_Intron|IPO5_uc010til.1_Intron|IPO5_uc001vng.1_Intron	NM_002271	NP_002262	O00410	IPO5_HUMAN	importin 5						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|ribosomal protein import into nucleus	cytoplasm|nuclear pore|nucleolus	GTPase inhibitor activity|protein transporter activity|Ran GTPase binding			ovary(1)|lung(1)|skin(1)	3						gcctggcttcttttttttttt	0.000													4	2	---	---	---	---	
ITGBL1	9358	broad.mit.edu	37	13	102208984	102208984	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102208984delA	uc001vpb.2	+						ITGBL1_uc010agb.2_Intron|ITGBL1_uc001vpc.3_Intron	NM_004791	NP_004782	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat						cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity			ovary(1)|skin(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					attccgtctcaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	106418193	106418194	+	IGR	INS	-	G	G	rs141144103	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106418193_106418194insG								DAOA (274811 upstream) : EFNB2 (723904 downstream)																							ctcagcagtgaattgaaactgc	0.153													0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	107117038	107117038	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107117038delT								DAOA (973656 upstream) : EFNB2 (25060 downstream)																							ttttagctacttagggggctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112220541	112220542	+	IGR	INS	-	AC	AC	rs10639057		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112220541_112220542insAC								C13orf16 (223948 upstream) : SOX1 (501371 downstream)																							AGTATCTTTCAACACATTGGAC	0.505													5	3	---	---	---	---	
C13orf28	122258	broad.mit.edu	37	13	113066918	113066918	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113066918delT	uc001vsd.1	+							NM_145248	NP_660291	Q96KW9	SPAC7_HUMAN	hypothetical protein LOC122258 precursor							extracellular region					0	all_lung(23;0.000633)|Lung NSC(43;0.0161)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0997)|Medulloblastoma(90;0.163)					catttaagtctttaacccatt	0.000													4	2	---	---	---	---	
ATP11A	23250	broad.mit.edu	37	13	113457897	113457897	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113457897delG	uc001vsi.3	+						ATP11A_uc001vsj.3_Intron|ATP11A_uc001vsm.1_Intron	NM_015205	NP_056020	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform a						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				CGTGACATCTGGGACGTTGTT	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19044801	19044802	+	IGR	INS	-	AA	AA	rs144525371		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19044801_19044802insAA								None (None upstream) : OR11H12 (332792 downstream)																							agagaatctacaaagagtgttt	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19106801	19106802	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19106801_19106802insT								None (None upstream) : OR11H12 (270792 downstream)																							gcgtttgtttgttttttttgtt	0.000													4	3	---	---	---	---	
RPGRIP1	57096	broad.mit.edu	37	14	21756340	21756340	+	Intron	DEL	T	-	-	rs11335332		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21756340delT	uc001wag.2	+							NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator						response to stimulus|visual perception	cilium				ovary(4)|breast(2)|pancreas(1)	7	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		GTCTTCTCACttttttttttt	0.199													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	23690442	23690443	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23690442_23690443insA								SLC7A8 (37593 upstream) : HOMEZ (52401 downstream)																							ctgaaaataggaaaaAAAAAAA	0.005													4	2	---	---	---	---	
THTPA	79178	broad.mit.edu	37	14	23993996	23993998	+	Intron	DEL	CTT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23993996_23993998delCTT	uc001wkb.3	+						uc001wkc.1_Intron|uc010akq.2_In_Frame_Del_p.E670del|uc010tno.1_In_Frame_Del_p.E668del			Q9BU02	THTPA_HUMAN	Homo sapiens thiamine triphosphatase mRNA, complete cds.						dephosphorylation|generation of precursor metabolites and energy|thiamine metabolic process	cytosol|nucleolus|soluble fraction	thiamin-triphosphatase activity				0	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00643)	Thiamine(DB00152)	tcctcctctacttcttcttcttc	0.384													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	32019217	32019217	+	IGR	DEL	T	-	-	rs112510915		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32019217delT								HEATR5A (92537 upstream) : NUBPL (11374 downstream)																							cttctccctcttttttttttt	0.000													4	2	---	---	---	---	
ARHGAP5	394	broad.mit.edu	37	14	32565347	32565348	+	Intron	INS	-	T	T	rs117079954		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32565347_32565348insT	uc001wrl.2	+						ARHGAP5_uc001wrm.2_Intron|ARHGAP5_uc001wrn.2_Intron|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b						cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		ctattggtttgttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	34668577	34668577	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34668577delA								EGLN3 (248290 upstream) : C14orf147 (233568 downstream)																							ATCGTAAAATAATCAGTGAAG	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	38074674	38074677	+	IGR	DEL	GTGA	-	-	rs144608849		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38074674_38074677delGTGA								FOXA1 (10185 upstream) : SSTR1 (602527 downstream)																							TGGTATGTGGGTGAGTGAGTATGG	0.407													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	54309171	54309171	+	IGR	DEL	A	-	-	rs5808744		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54309171delA								DDHD1 (689125 upstream) : BMP4 (107286 downstream)																							atgcctggccaaAACCAGGCC	0.119													5	3	---	---	---	---	
PELI2	57161	broad.mit.edu	37	14	56599239	56599239	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56599239delC	uc001xch.2	+							NM_021255	NP_067078	Q9HAT8	PELI2_HUMAN	pellino 2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of protein phosphorylation|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	protein binding			ovary(1)	1						GCTGGAGTCACCCCCGCCCTG	0.577													4	2	---	---	---	---	
C14orf37	145407	broad.mit.edu	37	14	58737826	58737826	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58737826delA	uc010tro.1	-						PSMA3_uc001xdj.1_Intron|PSMA3_uc001xdk.1_Intron|uc001xdl.2_Intron	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor							integral to membrane	binding				0						tccctaatttaaaaaaaaaaa	0.209													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62272501	62272501	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62272501delT								SNAPC1 (9356 upstream) : SYT16 (181302 downstream)																							TAAAAAGTCCttttttttttc	0.194													4	2	---	---	---	---	
FNTB	2342	broad.mit.edu	37	14	65395419	65395419	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65395419delT	uc010tsl.1	+						CHURC1_uc010tsj.1_Intron|CHURC1_uc010tsk.1_Intron|FNTB_uc010tsm.1_Intron|CHURC1_uc001xhv.1_Intron|CHURC1_uc001xhw.1_Intron	NM_002028	NP_002019	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta						protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CTTTTCTCTCTTACATGGCTT	0.353													4	2	---	---	---	---	
RAD51L1	5890	broad.mit.edu	37	14	69184007	69184008	+	Intron	INS	-	A	A	rs72518696		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69184007_69184008insA	uc001xkg.1	+							NM_133510	NP_598194	O15315	RA51B_HUMAN	RAD51-like 1 isoform 2						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)		TCTTTCAACCCCCAAAGATGAG	0.282			T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					4	2	---	---	---	---	
KIAA0247	9766	broad.mit.edu	37	14	70160032	70160039	+	Intron	DEL	CCTGTTTC	-	-	rs72179844		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70160032_70160039delCCTGTTTC	uc001xlk.2	+						KIAA0247_uc010aqz.2_Intron	NM_014734	NP_055549	Q92537	K0247_HUMAN	hypothetical protein LOC9766 precursor							integral to membrane				ovary(3)	3				all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)		CAGCTGGCAGCCTGTTTCCCTGGGTCCC	0.582													4	2	---	---	---	---	
DNAL1	83544	broad.mit.edu	37	14	74152164	74152164	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74152164delT	uc001xoq.3	+						DNAL1_uc010aru.2_Intron|DNAL1_uc010arv.2_Intron	NM_031427	NP_113615	Q4LDG9	DNAL1_HUMAN	axonemal dynein light chain 1												0				BRCA - Breast invasive adenocarcinoma(234;0.00384)|KIRC - Kidney renal clear cell carcinoma(182;0.095)		ttctgcttaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	74684834	74684834	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74684834delG								LIN52 (17717 upstream) : VSX2 (21341 downstream)																							gcgaatgcgtggcagagccgg	0.234											OREG0022797	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
C14orf166B	145497	broad.mit.edu	37	14	77324426	77324426	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77324426delC	uc001xsx.2	+						C14orf166B_uc010asn.1_Intron|C14orf166B_uc001xsw.2_Intron	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	hypothetical protein LOC145497												0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		tttatatattccagctcattt	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	77476388	77476389	+	IGR	DEL	CT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77476388_77476389delCT								C14orf166B (139743 upstream) : C14orf4 (14499 downstream)																							CTCTCCTCCCCTTTTCTGACTA	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	80887054	80887054	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80887054delT	uc001xuw.1	+											Homo sapiens, clone IMAGE:5167652, mRNA.																		gtcttcaaccttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	82007649	82007649	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82007649delC								SEL1L (7444 upstream) : None (None downstream)																							cagcagatctcccagcacagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86453573	86453574	+	IGR	INS	-	T	T	rs148245265	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86453573_86453574insT								FLRT2 (359304 upstream) : None (None downstream)																							tgtatcctttctttttttttcc	0.000													4	2	---	---	---	---	
FOXN3	1112	broad.mit.edu	37	14	89880014	89880025	+	Intron	DEL	TGGAAGAGAAGG	-	-	rs112923608	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89880014_89880025delTGGAAGAGAAGG	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron|FOXN3_uc001xxp.2_Intron	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						gggaagggaatggaagagaagggggaagggaa	0.005													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	92011862	92011865	+	IGR	DEL	TTCC	-	-	rs144218730		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92011862_92011865delTTCC								SMEK1 (35049 upstream) : C14orf184 (26923 downstream)																							ctttcctctattccttccttcctt	0.000													4	3	---	---	---	---	
SLC24A4	123041	broad.mit.edu	37	14	92850107	92850107	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92850107delC	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		AGAGATGCTTCCCAGACATCT	0.597													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95025092	95025095	+	IGR	DEL	TTCA	-	-	rs34330642		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95025092_95025095delTTCA								SERPINA12 (40911 upstream) : SERPINA4 (2684 downstream)																							TTGGCATCTCttcattcattcatt	0.270													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97152772	97152772	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97152772delG								PAPOLA (119326 upstream) : VRK1 (110912 downstream)																							atggatgaatggatgACAGAA	0.308													4	2	---	---	---	---	
BCL11B	64919	broad.mit.edu	37	14	99685383	99685383	+	Intron	DEL	T	-	-	rs5810929		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99685383delT	uc001yga.2	-						BCL11B_uc001ygb.2_Intron	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B isoform 1							nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		ttatttcttcttttttttttt	0.000			T	TLX3	T-ALL								3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99780511	99780512	+	IGR	DEL	GA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99780511_99780512delGA								BCL11B (42689 upstream) : SETD3 (83572 downstream)																							agaacatggggagagagagaga	0.000													4	2	---	---	---	---	
SNORD113-1	767561	broad.mit.edu	37	14	101389430	101389430	+	5'Flank	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101389430delC	uc001yii.1	+							NR_003229				Homo sapiens small nucleolar RNA, C/D box 113-1 (SNORD113-1), non-coding RNA.												0						taggtatattcccaagcactt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	101895580	101895580	+	IGR	DEL	T	-	-	rs35290545		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101895580delT								MIR656 (362442 upstream) : DIO3OS (122980 downstream)																							tgcatgtgtcttttttttttt	0.000													3	3	---	---	---	---	
TECPR2	9895	broad.mit.edu	37	14	102865524	102865524	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102865524delG	uc001ylw.1	+						TECPR2_uc010txw.1_Intron|TECPR2_uc010awl.2_Intron|TECPR2_uc010txx.1_Intron	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2								protein binding			lung(1)|central_nervous_system(1)|skin(1)	3						gcttgaatctgggaggcagag	0.000													2	4	---	---	---	---	
AHNAK2	113146	broad.mit.edu	37	14	105446080	105446083	+	5'Flank	DEL	ACAC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105446080_105446083delACAC	uc010axc.1	-							NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2							nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGATGCAGGGacacacacacacac	0.314													4	2	---	---	---	---	
CRIP2	1397	broad.mit.edu	37	14	105944056	105944056	+	Intron	DEL	G	-	-	rs66740942		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105944056delG	uc001yrd.1	+						CRIP2_uc010tyr.1_Intron|CRIP2_uc001yrc.2_Intron|CRIP2_uc001yre.1_Intron|CRIP2_uc001yrf.1_Intron|CRIP2_uc001yrg.2_Intron|CRIP2_uc001yrh.1_5'Flank	NM_001312	NP_001303	P52943	CRIP2_HUMAN	cysteine-rich protein 2								zinc ion binding				0		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.235)		gggtgtgtgtggggggaagcg	0.119													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20043090	20043090	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20043090delA								None (None upstream) : GOLGA6L6 (694004 downstream)																							tgtagtttttatgtgaagatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20139627	20139627	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20139627delT								None (None upstream) : GOLGA6L6 (597467 downstream)																							tgattttctgtcacttatttt	0.065													5	3	---	---	---	---	
BCL8	606	broad.mit.edu	37	15	20877913	20877916	+	Intron	DEL	TAAC	-	-	rs75410064		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20877913_20877916delTAAC	uc010tze.1	-						BCL8_uc010tzd.1_5'Flank	NR_027992				RecName: Full=Putative protein BCL8;												0						TGATTGCAAATAACTAACAACAAT	0.333													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21901698	21901698	+	IGR	DEL	G	-	-	rs113614476		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21901698delG								NF1P1 (767073 upstream) : LOC646214 (30816 downstream)																							accagaaacagggggagggtc	0.114													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21924852	21924854	+	IGR	DEL	AAA	-	-	rs144812944		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21924852_21924854delAAA								NF1P1 (790227 upstream) : LOC646214 (7660 downstream)																							acaccatctcaaaaaaaaaaaaa	0.212													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21925954	21925955	+	IGR	DEL	TT	-	-	rs113496641		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21925954_21925955delTT								NF1P1 (791329 upstream) : LOC646214 (6559 downstream)																							GCAGGGAGTCtttttttttttt	0.446													3	3	---	---	---	---	
NIPA2	81614	broad.mit.edu	37	15	23029411	23029411	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23029411delG	uc001yux.2	-						NIPA2_uc001yuy.2_Intron|NIPA2_uc001yuz.2_Intron|NIPA2_uc001yva.2_Intron|NIPA2_uc001yvb.2_Intron|NIPA2_uc010ayb.2_Intron	NM_030922	NP_112184	Q8N8Q9	NIPA2_HUMAN	non imprinted in Prader-Willi/Angelman syndrome							early endosome|integral to membrane|plasma membrane				haematopoietic_and_lymphoid_tissue(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;1.48e-06)|Epithelial(43;1.44e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000353)		aaaaaaaaaaggaaaaaattg	0.134													4	2	---	---	---	---	
GABRB3	2562	broad.mit.edu	37	15	26914752	26914753	+	Intron	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26914752_26914753delTC	uc001zaz.2	-						GABRB3_uc001zba.2_Intron|GABRB3_uc001zbb.2_Intron	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	Actcactctgtctctctctctc	0.406													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31742584	31742585	+	IGR	DEL	GA	-	-	rs112020198		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31742584_31742585delGA								KLF13 (72483 upstream) : OTUD7A (32745 downstream)																							caaaaagaacgagagagagaga	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	38992624	38992624	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38992624delG								C15orf53 (385 upstream) : C15orf54 (550261 downstream)																							TCAGGCAGGAGGGAGAGAGGG	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	39379102	39379102	+	IGR	DEL	A	-	-	rs5812080		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39379102delA								C15orf53 (386863 upstream) : C15orf54 (163783 downstream)																							GAATGGTGCTAAAAAAAAAGG	0.433													3	6	---	---	---	---	
USP50	373509	broad.mit.edu	37	15	50813323	50813323	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50813323delC	uc001zyq.3	-							NM_203494	NP_987090	E9PP86	E9PP86_HUMAN	ubiquitin specific protease 50						ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			lung(1)|breast(1)	2				all cancers(107;0.000519)|GBM - Glioblastoma multiforme(94;0.00288)		actgcaacctccacctccctg	0.000													4	2	---	---	---	---	
CYP19A1	1588	broad.mit.edu	37	15	51574986	51574986	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51574986delA	uc001zyz.3	-						CYP19A1_uc001zza.3_Intron|CYP19A1_uc001zzb.2_Intron|CYP19A1_uc010bey.1_Intron|CYP19A1_uc001zze.1_Intron	NM_031226	NP_112503	P11511	CP19A_HUMAN	cytochrome P450, family 19						estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(3)	3				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)	aaggatgactaaaggaagctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	53613701	53613701	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53613701delA								ONECUT1 (531492 upstream) : WDR72 (192237 downstream)																							atttccttgtaaaatccagtt	0.040													4	2	---	---	---	---	
TLN2	83660	broad.mit.edu	37	15	63039274	63039274	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63039274delA	uc002alb.3	+						TLN2_uc002alc.3_Intron	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2						cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						ttacctatgcaaaaaaaatgt	0.060													4	2	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66372710	66372711	+	Intron	INS	-	CA	CA	rs143748741	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66372710_66372711insCA	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						ggggaccgcagcacacacctgg	0.262													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	76037138	76037138	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76037138delA								DNM1P35 (4636 upstream) : UBE2Q2 (98484 downstream)																							actccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ADAMTSL3	57188	broad.mit.edu	37	15	84623602	84623603	+	Intron	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84623602_84623603delTC	uc002bjz.3	+						ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			tctgtctctgtctctctctctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	94510413	94510414	+	Intron	DEL	GT	-	-	rs66517255		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94510413_94510414delGT	uc002btf.1	+											Homo sapiens cDNA clone IMAGE:4827883.																		GTCGTGTGTGGTGTGTGTGTGT	0.168													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	95177414	95177415	+	IGR	INS	-	AG	AG	rs138307241	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95177414_95177415insAG								MCTP2 (150234 upstream) : LOC145820 (798907 downstream)																							ATATTTGTTATAGAGACTTGGC	0.396													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	95633865	95633866	+	IGR	DEL	CC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95633865_95633866delCC								MCTP2 (606685 upstream) : LOC145820 (342456 downstream)																							ctcctttcttcctttcttcctt	0.000													4	2	---	---	---	---	
ADAMTS17	170691	broad.mit.edu	37	15	100707776	100707777	+	Intron	DEL	GT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100707776_100707777delGT	uc002bvv.1	-						ADAMTS17_uc002bvx.1_Intron	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		GCTGTGGACAGTGACAGGATGC	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	101250152	101250153	+	IGR	INS	-	TGTG	TGTG	rs138326429	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101250152_101250153insTGTG								ASB7 (58250 upstream) : ALDH1A3 (169856 downstream)																							GAgtgtgtgcatgtgtgtgtgt	0.248													3	3	---	---	---	---	
RAB40C	57799	broad.mit.edu	37	16	643419	643419	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:643419delG	uc002chr.2	+						RAB40C_uc002chq.2_Intron	NM_021168	NP_066991	Q96S21	RB40C_HUMAN	RAB40C, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding				0		Hepatocellular(780;0.0218)				CTCCTTTGTTGGGAGGTGCCC	0.542													4	2	---	---	---	---	
ZNF263	10127	broad.mit.edu	37	16	3330232	3330233	+	Intron	DEL	AC	-	-	rs36006843		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3330232_3330233delAC	uc010uww.1	+							NM_005741	NP_005732	O14978	ZN263_HUMAN	zinc finger protein 263						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(3)|ovary(1)	4						acatacagatacacacacacac	0.050													3	3	---	---	---	---	
ADCY9	115	broad.mit.edu	37	16	4027728	4027728	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4027728delT	uc002cvx.2	-							NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						CCATGtttccttttttttttg	0.299													4	3	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	6366202	6366203	+	Intron	INS	-	AAAC	AAAC	rs151018192	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6366202_6366203insAAAC	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		TAGGATGCCGTAAACATCTTTC	0.436													3	3	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	6476087	6476088	+	Intron	DEL	CT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6476087_6476088delCT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		cattttctccctctctctctct	0.114													5	3	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	6726144	6726145	+	Intron	DEL	CA	-	-	rs59976889		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6726144_6726145delCA	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		cacacacgcgcacacacacaca	0.342													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	7883532	7883532	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7883532delA								A2BP1 (120192 upstream) : TMEM114 (735971 downstream)																							aaaaaaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
GRIN2A	2903	broad.mit.edu	37	16	10002266	10002267	+	Intron	INS	-	T	T	rs146396997	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10002266_10002267insT	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc010uyn.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	AAGAATATAGCTTTTTTTTCTT	0.297													4	3	---	---	---	---	
C16orf75	116028	broad.mit.edu	37	16	11382193	11382196	+	Intron	DEL	TTTA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11382193_11382196delTTTA	uc002daq.1	+									Q96E14	RMI2_HUMAN	Homo sapiens cDNA FLJ41770 fis, clone IMR322007225.						DNA replication	nucleus	DNA binding				0						tgctttgatctttatttcttattt	0.000			T	CIITA	PMBL|Hodgkin Lymphona|								0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	16242824	16242824	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16242824delG								ABCC1 (5896 upstream) : ABCC6 (599 downstream)																							GCTCATCTCTGGTGGGGGAGG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	19114217	19114218	+	IGR	INS	-	T	T	rs112358246		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19114217_19114218insT								COQ7 (22867 upstream) : ITPRIPL2 (11036 downstream)																							ttttcttttcattttttttttt	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	22635896	22635896	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22635896delC								LOC653786 (47710 upstream) : HS3ST2 (189964 downstream)																							CATCATCACTCCCATCCTCGG	0.493													4	2	---	---	---	---	
USP31	57478	broad.mit.edu	37	16	23142008	23142010	+	Intron	DEL	ATG	-	-	rs145088671		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23142008_23142010delATG	uc002dll.2	-							NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)		cagaaattacatgatatcctagg	0.163													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	23399062	23399062	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23399062delA								SCNN1B (6443 upstream) : COG7 (754 downstream)																							accttgtctcaaaaaaaaaaa	0.224													4	2	---	---	---	---	
HS3ST4	9951	broad.mit.edu	37	16	26051981	26051981	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26051981delG	uc002dof.2	+							NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		gaacacttgtggggtgttcat	0.070													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26812514	26812514	+	IGR	DEL	G	-	-	rs35110536		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26812514delG								HS3ST4 (663506 upstream) : C16orf82 (265705 downstream)																							atatgCATCTGGGGGGGGGGA	0.075													4	2	---	---	---	---	
GSG1L	146395	broad.mit.edu	37	16	27972350	27972351	+	Intron	DEL	AC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27972350_27972351delAC	uc002doz.2	-						GSG1L_uc010bya.1_Intron	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1							integral to membrane				ovary(1)	1						CTGTacacagacacacacacac	0.386													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	28526375	28526375	+	Intron	DEL	A	-	-	rs67085259		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28526375delA	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		actccgtctgaaaaaaaaaaa	0.229													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	28936813	28936813	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28936813delC	uc010vct.1	-						RABEP2_uc002drq.2_5'Flank|RABEP2_uc010vdf.1_5'Flank|RABEP2_uc010byn.2_5'Flank|RABEP2_uc002drr.2_5'Flank					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		TATGCCTCCTCCGGGACACCG	0.687													4	2	---	---	---	---	
SRCAP	10847	broad.mit.edu	37	16	30740100	30740101	+	Intron	DEL	AG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30740100_30740101delAG	uc002dze.1	+						SRCAP_uc002dzf.2_Intron|SRCAP_uc002dzg.1_Intron	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein						interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			AACATAAAAAAGAAAGTTATTT	0.297													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	31399207	31399208	+	IGR	INS	-	T	T	rs35220383		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31399207_31399208insT								ITGAX (4889 upstream) : ITGAD (5425 downstream)																							tcatatggtaAttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32469950	32469950	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32469950delC								HERC2P4 (306076 upstream) : TP53TG3B (214891 downstream)																							CCTACAGAGTCCAGCagaggc	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32475773	32475774	+	IGR	INS	-	T	T	rs143744140	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32475773_32475774insT								HERC2P4 (311899 upstream) : TP53TG3B (209067 downstream)																							aatcatgtgagtttttttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32534578	32534578	+	IGR	DEL	A	-	-	rs112534567		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32534578delA								HERC2P4 (370704 upstream) : TP53TG3B (150263 downstream)																							ctggtgaatcaaaaaaaagta	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32541508	32541509	+	IGR	INS	-	A	A	rs149668782	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32541508_32541509insA								HERC2P4 (377634 upstream) : TP53TG3B (143332 downstream)																							ccagaatggaggaaaaaaaaag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32546122	32546123	+	IGR	INS	-	A	A	rs149439922		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32546122_32546123insA								HERC2P4 (382248 upstream) : TP53TG3B (138718 downstream)																							ttgcagaatggaaaaaactgtg	0.000													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32548384	32548384	+	IGR	DEL	G	-	-	rs112617757		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32548384delG								HERC2P4 (384510 upstream) : TP53TG3B (136457 downstream)																							ttgagaaaaaggtttgtgatg	0.060													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32555998	32555998	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32555998delA								HERC2P4 (392124 upstream) : TP53TG3B (128843 downstream)																							aacagtttggaaaaactgttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32830087	32830088	+	IGR	INS	-	TAT	TAT			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32830087_32830088insTAT								TP53TG3B (141209 upstream) : SLC6A10P (58709 downstream)																							cattctgcacatattattatta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32841066	32841066	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32841066delC								TP53TG3B (152188 upstream) : SLC6A10P (47731 downstream)																							ttaatttgggctaatcaatat	0.025													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33324369	33324369	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33324369delT								SLC6A10P (427906 upstream) : MIR1826 (641139 downstream)																							tttgaatgtgttccccaaagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33411805	33411805	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33411805delA								SLC6A10P (515342 upstream) : MIR1826 (553703 downstream)																							ggctggtctcaaaccctgggt	0.010													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33574791	33574792	+	IGR	INS	-	A	A	rs79560360		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33574791_33574792insA								SLC6A10P (678328 upstream) : MIR1826 (390716 downstream)																							gaccttgacgcaaaaaaaaaaa	0.134													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33920886	33920886	+	IGR	DEL	C	-	-	rs79580814		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33920886delC								None (None upstream) : MIR1826 (44622 downstream)																							ttttatttttcgatatttcct	0.055													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33994203	33994203	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33994203delT								MIR1826 (28611 upstream) : UBE2MP1 (409599 downstream)																							ttctgtctagttttttatgga	0.000													2	4	---	---	---	---	
ABCC12	94160	broad.mit.edu	37	16	48167439	48167439	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48167439delA	uc002efc.1	-						ABCC12_uc002eey.1_Intron|ABCC12_uc002eez.1_Intron|ABCC12_uc002efa.1_Intron|ABCC12_uc002efb.1_Intron|ABCC12_uc002efd.1_Intron|ABCC12_uc002efe.1_Intron	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				cctgtctcagaaaaaaaaaaa	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	52467921	52467922	+	IGR	DEL	CA	-	-	rs35817696		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52467921_52467922delCA								None (None upstream) : TOX3 (3996 downstream)																							CAGTTGCCACcacacacacaca	0.356													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	53051110	53051110	+	IGR	DEL	A	-	-	rs137909305		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53051110delA								TOX3 (469396 upstream) : CHD9 (37835 downstream)																							ctgtcgccacaaaaaaaaaaa	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	53081057	53081058	+	IGR	DEL	CA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53081057_53081058delCA								TOX3 (499343 upstream) : CHD9 (7887 downstream)																							catgcacacgcacacacacaca	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55303476	55303477	+	IGR	INS	-	T	T	rs143995926	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55303476_55303477insT								IRX5 (335083 upstream) : IRX6 (54994 downstream)																							ccatctacacatttacttatct	0.000													4	4	---	---	---	---	
B3GNT9	84752	broad.mit.edu	37	16	67187838	67187839	+	5'Flank	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67187838_67187839insT	uc002erf.2	-							NM_033309	NP_171608	Q6UX72	B3GN9_HUMAN	UDP-GlcNAc:betaGal						protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity				0						CACAACTTCTCTTTttttttct	0.099													4	2	---	---	---	---	
PSKH1	5681	broad.mit.edu	37	16	67928476	67928476	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67928476delA	uc002euv.2	+						PSKH1_uc010cet.2_Intron	NM_006742	NP_006733	P11801	KPSH1_HUMAN	protein serine kinase H1							endoplasmic reticulum membrane|Golgi apparatus|microtubule organizing center|nuclear speck|plasma membrane	ATP binding|protein serine/threonine kinase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0044)|Epithelial(162;0.0197)|all cancers(182;0.128)		ACTTCCTAGGAAAAAAATCTA	0.443													4	2	---	---	---	---	
WWP2	11060	broad.mit.edu	37	16	69886876	69886876	+	Intron	DEL	G	-	-	rs79015278		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69886876delG	uc002exu.1	+						WWP2_uc002ext.2_Intron|WWP2_uc002exv.1_Intron|WWP2_uc010vlm.1_Intron	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase						entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						gccagtccctgGCTgtaggag	0.010													2	5	---	---	---	---	
PDPR	55066	broad.mit.edu	37	16	70189219	70189221	+	Intron	DEL	TTG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70189219_70189221delTTG	uc002eyf.1	+						CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Intron|PDPR_uc002eyg.1_Intron|PDPR_uc002eyh.2_Intron|PDPR_uc010vls.1_Intron	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		agtttcgttcttgttgtccaggc	0.074													4	3	---	---	---	---	
AARS	16	broad.mit.edu	37	16	70306036	70306036	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70306036delA	uc002eyn.1	-						AARS_uc010vlu.1_5'Flank	NM_001605	NP_001596	P49588	SYAC_HUMAN	alanyl-tRNA synthetase						alanyl-tRNA aminoacylation|tRNA processing	cytosol|soluble fraction	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			pancreas(1)	1		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)	L-Alanine(DB00160)	ctcaaaaaagaaaaaaaaaaa	0.259													5	3	---	---	---	---	
AARS	16	broad.mit.edu	37	16	70309660	70309662	+	Intron	DEL	CAA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70309660_70309662delCAA	uc002eyn.1	-							NM_001605	NP_001596	P49588	SYAC_HUMAN	alanyl-tRNA synthetase						alanyl-tRNA aminoacylation|tRNA processing	cytosol|soluble fraction	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			pancreas(1)	1		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)	L-Alanine(DB00160)	agcgagactccaacaacaacaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	70479864	70479864	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70479864delT								ST3GAL2 (6873 upstream) : FUK (8634 downstream)																							ttcctccttcttttttttttt	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	72607050	72607051	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72607050_72607051insT								PMFBP1 (400701 upstream) : ZFHX3 (209737 downstream)																							AACACCAACACttttttttttt	0.054													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	74407695	74407695	+	IGR	DEL	T	-	-	rs11305054		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74407695delT								LOC283922 (5542 upstream) : CLEC18B (34836 downstream)																							GAGAACAATCttttttttttt	0.289													7	4	---	---	---	---	
CNTNAP4	85445	broad.mit.edu	37	16	76482606	76482606	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76482606delT	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						GAAGGGAACCTTTTTTTTTTT	0.393													3	4	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81730396	81730397	+	Intron	INS	-	A	A	rs151182692	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81730396_81730397insA	uc002fgp.2	+						CMIP_uc002fgq.1_Intron|CMIP_uc010vnq.1_Intron|CMIP_uc002fgr.1_Intron|CMIP_uc010vnr.1_3'UTR	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						AACACAGTGCTGATCATGAAgg	0.351													1	7	---	---	---	---	
MPHOSPH6	10200	broad.mit.edu	37	16	82194575	82194576	+	Intron	INS	-	AGA	AGA	rs142804783	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82194575_82194576insAGA	uc002fgw.2	-							NM_005792	NP_005783	Q99547	MPH6_HUMAN	M-phase phosphoprotein 6						M phase of mitotic cell cycle|maturation of 5.8S rRNA	cytoplasm|nucleolus	protein binding|RNA binding				0						atccttatctcagaagaaggga	0.000													3	4	---	---	---	---	
LRRC50	123872	broad.mit.edu	37	16	84193579	84193579	+	Intron	DEL	T	-	-	rs11292642		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84193579delT	uc002fhl.3	+						LRRC50_uc010vnw.1_Intron	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN	leucine rich repeat containing 50						axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0						TATTCATAGATTTTTTTatat	0.154									Kartagener_syndrome				2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	84664826	84664827	+	IGR	INS	-	GA	GA	rs146839835	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84664826_84664827insGA								COTL1 (13157 upstream) : KLHL36 (17304 downstream)																							ACTACATGCTGAAGGAGAAAGT	0.366													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85416589	85416596	+	IGR	DEL	ACACATGT	-	-	rs111488042		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85416589_85416596delACACATGT								FAM92B (270475 upstream) : KIAA0182 (228433 downstream)																							gctcacacgcacacatgtgcacatacaa	0.115													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85444687	85444687	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85444687delC								FAM92B (298573 upstream) : KIAA0182 (200342 downstream)																							CACTCAGGGTCCCCCGGATAA	0.572													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85992656	85992657	+	IGR	INS	-	A	A	rs112203199	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85992656_85992657insA								IRF8 (36447 upstream) : LOC732275 (372799 downstream)																							tggctctcctgaaaaaaaaaag	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86000591	86000591	+	IGR	DEL	C	-	-	rs113870242		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86000591delC								IRF8 (44382 upstream) : LOC732275 (364865 downstream)																							ccttactcctcctttacttct	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86498226	86498228	+	IGR	DEL	TGA	-	-	rs141606079		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86498226_86498228delTGA								LOC732275 (118941 upstream) : FOXF1 (45905 downstream)																							gtagtgatggtgatgatgatgtt	0.064													4	4	---	---	---	---	
ZCCHC14	23174	broad.mit.edu	37	16	87479774	87479774	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87479774delA	uc002fjz.1	-						ZCCHC14_uc002fka.1_Intron	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14						cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			upper_aerodigestive_tract(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0285)		actccgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SLC7A5	8140	broad.mit.edu	37	16	87890614	87890615	+	Intron	INS	-	T	T	rs144527729	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87890614_87890615insT	uc002fkm.2	-							NM_003486	NP_003477	Q01650	LAT1_HUMAN	solute carrier family 7 (cationic amino acid						blood coagulation|cell differentiation|cellular amino acid metabolic process|ion transport|leukocyte migration|nervous system development	apical plasma membrane|cytosol|integral to membrane	neutral amino acid transmembrane transporter activity|peptide antigen binding				0				BRCA - Breast invasive adenocarcinoma(80;0.049)		GTCACCGCCCCGGGCTCCAGAA	0.480													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	632787	632788	+	IGR	INS	-	AC	AC	rs139173775	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:632787_632788insAC								VPS53 (14691 upstream) : FAM57A (3059 downstream)																							gatacacacaaacacacacaca	0.000													4	2	---	---	---	---	
PAFAH1B1	5048	broad.mit.edu	37	17	2515504	2515505	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2515504_2515505insT	uc002fuw.3	+						PAFAH1B1_uc010ckb.1_Intron	NM_000430	NP_000421	P43034	LIS1_HUMAN	platelet-activating factor acetylhydrolase,						acrosome assembly|actin cytoskeleton organization|adult locomotory behavior|brain morphogenesis|corpus callosum morphogenesis|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|hippocampus development|layer formation in cerebral cortex|learning or memory|lipid catabolic process|microtubule organizing center organization|mitotic prometaphase|neuroblast proliferation|neuromuscular process controlling balance|neuron migration|platelet activating factor metabolic process|regulation of Rho GTPase activity|retrograde axon cargo transport|synaptic transmission|vesicle transport along microtubule	astral microtubule|cell cortex|centrosome|cytosol|kinetochore|motile primary cilium|nuclear membrane|perinuclear region of cytoplasm	dynactin binding|heparin binding|microtubule binding|phospholipase binding|phosphoprotein binding|protein homodimerization activity			skin(1)	1						GAAAATGGCACttttttttttt	0.139													3	3	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2906192	2906193	+	Intron	DEL	GT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2906192_2906193delGT	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						GCGTGCTTGGGTGTGTGTGTGT	0.366													3	3	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11860886	11860886	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11860886delA	uc002gne.2	+						DNAH9_uc010coo.2_Intron|DNAH9_uc002gnf.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		agaatgggagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	12331568	12331569	+	IGR	INS	-	TTTG	TTTG	rs149033068	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12331568_12331569insTTTG								MAP2K4 (284518 upstream) : MYOCD (237638 downstream)																							agccCAgtttttttgtttgttt	0.030													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	13814231	13814231	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13814231delG								HS3ST3A1 (308987 upstream) : CDRT15P (113584 downstream)																							aatatgatttggctgtgtccc	0.000													4	2	---	---	---	---	
CCDC144NL	339184	broad.mit.edu	37	17	20770155	20770156	+	Intron	INS	-	TCT	TCT			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20770155_20770156insTCT	uc002gyf.2	-						uc002gyg.1_5'Flank|uc002gyh.1_5'Flank	NM_001004306	NP_001004306	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family,												0						AAAGTCCAACCCCTCCTGGCAA	0.579													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21535096	21535097	+	IGR	INS	-	TC	TC	rs141245861		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21535096_21535097insTC								C17orf51 (57365 upstream) : FAM27L (290273 downstream)																							ttgtttttcttttttttttttt	0.079													5	3	---	---	---	---	
KSR1	8844	broad.mit.edu	37	17	25850411	25850412	+	Intron	INS	-	A	A	rs11429386		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25850411_25850412insA	uc010crg.2	+						KSR1_uc002gzj.1_Intron	NM_014238	NP_055053	Q8IVT5	KSR1_HUMAN	kinase suppressor of ras						Ras protein signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		TCTGTAAGGTTAAAAAAAAAAA	0.228													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	29997937	29997938	+	IGR	INS	-	AC	AC	rs144140231		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29997937_29997938insAC								MIR365-2 (95397 upstream) : C17orf79 (180947 downstream)																							cccactgtctgaagccccagtg	0.000													4	2	---	---	---	---	
RHOT1	55288	broad.mit.edu	37	17	30477376	30477376	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30477376delT	uc002hgz.2	+						RHOT1_uc002hgw.2_Intron|RHOT1_uc002hgy.2_Intron|RHOT1_uc002hha.2_Intron|RHOT1_uc010csv.2_Intron|RHOT1_uc002hgx.2_Intron|RHOT1_uc010wby.1_Intron|RHOT1_uc002hhb.2_Intron|RHOT1_uc002hgv.2_Intron	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN	ras homolog gene family, member T1 isoform 3						apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				GCTAATGAACTTTTTTTTTTT	0.313													4	2	---	---	---	---	
CCL1	6346	broad.mit.edu	37	17	32691047	32691048	+	5'Flank	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32691047_32691048insT	uc002hid.1	-							NM_002981	NP_002972	P22362	CCL1_HUMAN	small inducible cytokine A1 precursor						cellular calcium ion homeostasis|chemotaxis|immune response|signal transduction|viral reproduction	extracellular space	chemokine activity				0		Ovarian(249;0.0443)|Breast(31;0.133)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)|BRCA - Breast invasive adenocarcinoma(366;0.155)		ttccctttttgttttttttttt	0.213													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	33034883	33034883	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33034883delT								TMEM132E (68547 upstream) : CCT6B (220057 downstream)																							ctgtgtgttgtattcccccat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	41706786	41706786	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41706786delA								ETV4 (83024 upstream) : MEOX1 (10981 downstream)																							actccatctcaaaaaaaaaaa	0.199													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44329581	44329581	+	IGR	DEL	T	-	-	rs67074547		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44329581delT								KIAA1267 (26864 upstream) : ARL17B (34282 downstream)																							GATTCATTGAttttttttttc	0.139													2	4	---	---	---	---	
PHB	5245	broad.mit.edu	37	17	47490875	47490875	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47490875delT	uc002iox.1	-							NM_002634	NP_002625	P35232	PHB_HUMAN	prohibitin						cellular response to interleukin-6|DNA replication|glucocorticoid receptor signaling pathway|histone deacetylation|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|progesterone receptor signaling pathway|regulation of apoptosis	integral to plasma membrane|mitochondrial inner membrane|nucleoplasm	histone deacetylase binding|transcription regulatory region DNA binding				0	all_cancers(4;2.62e-14)|Breast(4;4.21e-29)|all_epithelial(4;6.9e-18)		Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)			ttttctttccttttttttttt	0.119													4	2	---	---	---	---	
ACSF2	80221	broad.mit.edu	37	17	48539289	48539290	+	Intron	DEL	GT	-	-	rs10574483		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48539289_48539290delGT	uc002iqu.2	+						ACSF2_uc010wml.1_Intron|ACSF2_uc010wmm.1_Intron|ACSF2_uc010wmn.1_Intron|ACSF2_uc010wmo.1_Intron	NM_025149	NP_079425	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2 precursor						fatty acid metabolic process	mitochondrion	ATP binding|ligase activity				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CAGGGCAGAGgtgtgtgtgtgt	0.480													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	51637391	51637392	+	IGR	INS	-	A	A	rs112573014		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51637391_51637392insA								None (None upstream) : KIF2B (262847 downstream)																							tcatcacacagaaaaaaaaaaa	0.000													3	4	---	---	---	---	
TOM1L1	10040	broad.mit.edu	37	17	52976460	52976460	+	5'Flank	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52976460delA	uc002iud.2	+						TOM1L1_uc002iub.2_5'Flank|TOM1L1_uc002iuc.2_5'Flank|TOM1L1_uc010dca.1_5'Flank|TOM1L1_uc010wnb.1_5'Flank|TOM1L1_uc010wnc.1_5'Flank|TOM1L1_uc010dbz.2_5'Flank|TOM1L1_uc010wnd.1_5'Flank	NM_005486	NP_005477	O75674	TM1L1_HUMAN	target of myb1-like 1						intracellular protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	cytosol|endosome membrane|Golgi stack|lysosome	SH3 domain binding|ubiquitin binding			ovary(1)	1						AGaaaaaaacaaaaaaaaaaa	0.348													3	3	---	---	---	---	
TRIM37	4591	broad.mit.edu	37	17	57071160	57071161	+	Intron	DEL	AT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57071160_57071161delAT	uc002iwy.3	-							NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein							perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					attaaccaggatatgtggggga	0.000									Mulibrey_Nanism				1	6	---	---	---	---	
MARCH10	162333	broad.mit.edu	37	17	60858363	60858363	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60858363delG	uc010ddr.2	-						MARCH10_uc002jag.3_Intron|MARCH10_uc010dds.2_Intron|MARCH10_uc002jah.2_Intron	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190								ligase activity|zinc ion binding				0						GCCGGTGCCTGGGAAGGAGGG	0.522													4	2	---	---	---	---	
LIMD2	80774	broad.mit.edu	37	17	61776765	61776765	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61776765delG	uc002jbj.3	-						LIMD2_uc002jbk.3_Intron|LIMD2_uc002jbl.3_Intron	NM_030576	NP_085053	Q9BT23	LIMD2_HUMAN	LIM domain containing 2								zinc ion binding				0						CCTGCAGGGTGGGGGGTGTTG	0.662													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62670657	62670659	+	IGR	DEL	CAA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62670657_62670659delCAA								SMURF2 (12271 upstream) : LOC146880 (75122 downstream)																							tgttctaagccaACAACAACAAC	0.167													4	2	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64048903	64048903	+	Intron	DEL	A	-	-	rs34526677		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64048903delA	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			TCTTCCATTTAAAAAAAAATG	0.154													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68605007	68605007	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68605007delT								KCNJ2 (428826 upstream) : None (None downstream)																							GAATATATGCTTTTTTATTCC	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70426043	70426043	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70426043delG	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																		ATCCTACAGTGGGGAGTAGGT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72054755	72054758	+	IGR	DEL	GAGT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72054755_72054758delGAGT								C17orf54 (230079 upstream) : RPL38 (145037 downstream)																							CACAGGAGAAGAGTGAGTGAGTGA	0.515													3	4	---	---	---	---	
CD300A	11314	broad.mit.edu	37	17	72461562	72461563	+	5'Flank	INS	-	GA	GA	rs147176541	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72461562_72461563insGA	uc002jkv.2	+						CD300A_uc002jkw.2_5'Flank|CD300A_uc010dfr.2_5'Flank|CD300A_uc010dfs.2_5'Flank	NM_007261	NP_009192	Q9UGN4	CLM8_HUMAN	leukocyte membrane antigen						cell adhesion	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2						tgtgtgtgtgtgtgtatgtgca	0.000													4	3	---	---	---	---	
UNC13D	201294	broad.mit.edu	37	17	73834303	73834303	+	Intron	DEL	T	-	-	rs77246839		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73834303delT	uc002jpp.2	-						UNC13D_uc010wsk.1_Intron|UNC13D_uc002jpq.1_Intron|UNC13D_uc010dgq.1_Intron	NM_199242	NP_954712	Q70J99	UN13D_HUMAN	unc-13 homolog D						positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding			upper_aerodigestive_tract(1)|skin(1)	2			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			GTCCCAtctcttttttttttt	0.308									Familial_Hemophagocytic_Lymphohistiocytosis				5	3	---	---	---	---	
SEC14L1	6397	broad.mit.edu	37	17	75155950	75155951	+	Intron	INS	-	ACCC	ACCC	rs151215690	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75155950_75155951insACCC	uc002jto.2	+						SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_Intron|SEC14L1_uc002jtm.2_Intron	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						GCTGAGTGGTGACCCACTTAAA	0.391													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75606488	75606488	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75606488delT								SEPT9 (109812 upstream) : FLJ45079 (268621 downstream)																							gtttgccttatttgaacaccg	0.000													4	2	---	---	---	---	
TNRC6C	57690	broad.mit.edu	37	17	76037312	76037312	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76037312delG	uc002jud.2	+						TNRC6C_uc002juf.2_Intron	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GCGTGTGAGTGGTAGCCCGGC	0.522													4	2	---	---	---	---	
PGS1	9489	broad.mit.edu	37	17	76385068	76385076	+	Intron	DEL	AAGTTGAAC	-	-	rs151188335		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76385068_76385076delAAGTTGAAC	uc002jvm.2	+						PGS1_uc010wtt.1_Intron	NM_024419	NP_077733	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						phospholipid biosynthetic process	endoplasmic reticulum|mitochondrion	ATP binding|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity				0			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			GTTGAGGGTTAAGTTGAACAAGTTGAACT	0.368													4	2	---	---	---	---	
NPLOC4	55666	broad.mit.edu	37	17	79527909	79527909	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79527909delT	uc002kat.3	-						NPLOC4_uc002kar.2_RNA|NPLOC4_uc010dic.2_Intron|NPLOC4_uc002kas.2_Intron	NM_017921	NP_060391	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4						cellular membrane fusion|ER-associated protein catabolic process|Golgi organization	cytosol|endoplasmic reticulum|nuclear outer membrane-endoplasmic reticulum membrane network|nucleus	zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			cattgtcgcgtttttttcatt	0.000													4	2	---	---	---	---	
GCGR	2642	broad.mit.edu	37	17	79767618	79767619	+	Intron	DEL	TC	-	-	rs13306386	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79767618_79767619delTC	uc010wuw.1	+						GCGR_uc010wuv.1_Intron|GCGR_uc010wux.1_Intron	NM_000160	NP_000151	P47871	GLR_HUMAN	glucagon receptor precursor						cellular response to glucagon stimulus|energy reserve metabolic process|regulation of blood pressure|response to nutrient	integral to membrane|plasma membrane	glucagon receptor activity				0					Glucagon recombinant(DB00040)	tgcctgcctgtctgtctgtctg	0.243													2	4	---	---	---	---	
NOTUM	147111	broad.mit.edu	37	17	79911164	79911165	+	Intron	INS	-	G	G	rs78951919		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79911164_79911165insG	uc010wvg.1	-							NM_178493	NP_848588	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog precursor							extracellular region	hydrolase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			AAACCGGGGGAGGGGGTCACAT	0.490													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	79975474	79975474	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79975474delC								ASPSCR1 (194 upstream) : STRA13 (1106 downstream)																							ATTTACACTTCCTCCAAGGAG	0.557													4	2	---	---	---	---	
RAB40B	10966	broad.mit.edu	37	17	80629081	80629082	+	Intron	INS	-	AC	AC			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80629081_80629082insAC	uc002kft.2	-						RAB40B_uc002kfs.2_Intron	NM_006822	NP_006813	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			central_nervous_system(1)	1	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			CCGTAACTCTAACACACACTCA	0.396													3	4	---	---	---	---	
B3GNTL1	146712	broad.mit.edu	37	17	80984842	80984842	+	Intron	DEL	A	-	-	rs112485580		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80984842delA	uc002kgg.1	-						B3GNTL1_uc002kgf.1_Intron	NM_001009905	NP_001009905	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			AGAGCGGGGCAGGGAGCCTGC	0.647													5	3	---	---	---	---	
TGIF1	7050	broad.mit.edu	37	18	3452223	3452223	+	Frame_Shift_Del	DEL	T	-	-	rs11571510		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3452223delT	uc002klz.2	+	1	633	c.246delT	c.(244-246)CCTfs	p.P82fs	TGIF1_uc002klu.2_Intron|TGIF1_uc002klv.2_Intron|TGIF1_uc002klx.2_Intron|TGIF1_uc002klw.2_Intron|TGIF1_uc010dkm.1_Intron|TGIF1_uc002kly.2_Intron|TGIF1_uc002kma.2_Intron|TGIF1_uc002kmb.2_5'Flank	NM_170695	NP_733796	Q15583	TGIF1_HUMAN	TG-interacting factor isoform a	82					negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				GCGCCCCCCCTCCTCCACCGG	0.766													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	4957114	4957114	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4957114delG								DLGAP1 (501848 upstream) : LOC642597 (186558 downstream)																							tagaaaacctggagaagatgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	5208514	5208514	+	IGR	DEL	C	-	-	rs59101133		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5208514delC								LOC642597 (11259 upstream) : C18orf18 (28210 downstream)																							AAGAACAGTTCTTTAATTCAG	0.383													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	7125988	7125988	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7125988delT								LAMA1 (8175 upstream) : LRRC30 (105149 downstream)																							gtgcccagccttttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10449398	10449398	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10449398delA								VAPA (489381 upstream) : APCDD1 (5227 downstream)																							AAACACATCTAAATCAATTTT	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11249185	11249186	+	IGR	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11249185_11249186delTC								FAM38B (547206 upstream) : GNAL (439950 downstream)																							TTCTCTCTTTTCTCTCTCTCTC	0.450													4	2	---	---	---	---	
GNAL	2774	broad.mit.edu	37	18	11877630	11877630	+	Intron	DEL	A	-	-	rs11320240		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11877630delA	uc010dkz.2	+						GNAL_uc002kqc.2_Intron|GNAL_uc002kqd.2_Intron|GNAL_uc010wzt.1_Intron	NM_001142339	NP_001135811	P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						CCCAAGGGCGATGTTCCCGGT	0.458													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	13657550	13657551	+	IGR	DEL	AA	-	-	rs71174177		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13657550_13657551delAA								C18orf1 (4797 upstream) : C18orf19 (5799 downstream)																							gctgactaagaaaatccctaag	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	13948470	13948470	+	IGR	DEL	T	-	-	rs112540393		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13948470delT								MC2R (32935 upstream) : ZNF519 (127519 downstream)																							TGCACAGTACTTTTTTTCCCC	0.358													5	3	---	---	---	---	
ANKRD30B	374860	broad.mit.edu	37	18	14755017	14755017	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14755017delT	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											ovary(1)|skin(1)	2						ATGGTAGTTCTTTTTTTTTAC	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15407196	15407197	+	IGR	DEL	CA	-	-	rs150221454		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15407196_15407197delCA								LOC644669 (81278 upstream) : None (None downstream)																							gttcatctctcagagttaaaca	0.000													4	3	---	---	---	---	
CABLES1	91768	broad.mit.edu	37	18	20813379	20813379	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20813379delG	uc002kuc.2	+						C18orf45_uc010xaq.1_Intron|CABLES1_uc002kub.2_Intron|CABLES1_uc002kud.2_Intron	NM_001100619	NP_001094089	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1 isoform 2						blood coagulation|cell cycle|cell division|regulation of cell cycle|regulation of cell division	cytosol|nucleus	cyclin-dependent protein kinase regulator activity|protein binding			breast(1)	1	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ctaccgtcctggtgaccttgg	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22569548	22569549	+	IGR	INS	-	AAAG	AAAG	rs147748857	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22569548_22569549insAAAG								HRH4 (509628 upstream) : ZNF521 (72339 downstream)																							aagagaagagaaaagagagaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22635146	22635147	+	IGR	DEL	AA	-	-	rs33981324		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22635146_22635147delAA								HRH4 (575226 upstream) : ZNF521 (6741 downstream)																							aaaacaaaacaaaaaaaaaAAC	0.168													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	42054586	42054586	+	Intron	DEL	A	-	-	rs144166048		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42054586delA	uc002lax.3	-											Homo sapiens cDNA clone IMAGE:5265929.																		GAAGGAAAAGAAAAAAACATT	0.368													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	43338664	43338664	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43338664delT								SLC14A1 (6180 upstream) : SIGLEC15 (66881 downstream)																							ctgcctcccctttggttccta	0.015													4	2	---	---	---	---	
ZBTB7C	201501	broad.mit.edu	37	18	45921746	45921747	+	Intron	INS	-	TG	TG	rs149447084	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45921746_45921747insTG	uc010dnw.2	-						ZBTB7C_uc010don.1_Intron|ZBTB7C_uc010doo.1_Intron|ZBTB7C_uc010dop.1_Intron|ZBTB7C_uc010doq.1_Intron|ZBTB7C_uc010dor.1_Intron|ZBTB7C_uc010dos.1_Intron|ZBTB7C_uc010dot.1_Intron|ZBTB7C_uc010dou.1_Intron|ZBTB7C_uc010dom.1_Intron	NM_001039360	NP_001034449	A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C							intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						ttctattcaaatgtgtgtgtgt	0.134													4	2	---	---	---	---	
MYO5B	4645	broad.mit.edu	37	18	47352665	47352666	+	3'UTR	INS	-	A	A	rs149289525	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47352665_47352666insA	uc002leb.2	-	40					MYO5B_uc002ldz.2_3'UTR|MYO5B_uc002lea.2_3'UTR	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		GCAGTAGGTACAAAAAATAATG	0.347													6	3	---	---	---	---	
MRO	83876	broad.mit.edu	37	18	48322938	48322939	+	3'UTR	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48322938_48322939delTG	uc002lew.3	-	8					MRO_uc010xdn.1_3'UTR|MRO_uc010dpa.2_3'UTR|MRO_uc010dpb.2_3'UTR|MRO_uc010dpc.2_3'UTR|MRO_uc002lex.3_3'UTR	NM_031939	NP_114145	Q9BYG7	MSTRO_HUMAN	maestro isoform a							nucleolus	binding				0		Colorectal(6;0.0596)		Colorectal(21;0.082)		ACACGTGAAATGTGTGTGTGTG	0.495													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	49375415	49375415	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49375415delT								MEX3C (651725 upstream) : DCC (491156 downstream)																							ttttcATCAATTTTTTTTTTT	0.169													4	2	---	---	---	---	
TCF4	6925	broad.mit.edu	37	18	53092747	53092748	+	Intron	INS	-	A	A	rs59503204		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53092747_53092748insA	uc002lfz.2	-						TCF4_uc002lfy.2_Intron|TCF4_uc010xdx.1_Intron|TCF4_uc010dph.1_Intron|TCF4_uc010xdy.1_Intron|TCF4_uc002lga.2_Intron|TCF4_uc010dpi.2_Intron|TCF4_uc002lgc.3_Intron	NM_003199	NP_003190	P15884	ITF2_HUMAN	transcription factor 4 isoform b						positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		TGAAGTCAAGGAAAAAAAAAAA	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	53960304	53960305	+	IGR	INS	-	A	A	rs79280810		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53960304_53960305insA								TCF4 (657119 upstream) : TXNL1 (309750 downstream)																							gattccgtctcaaaaaaaaaaa	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	55569514	55569514	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55569514delC								ATP8B1 (170475 upstream) : NEDD4L (142105 downstream)																							ggcaaaatcacaattactttt	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	59358703	59358703	+	IGR	DEL	A	-	-	rs34676832		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59358703delA								CDH20 (136338 upstream) : RNF152 (123601 downstream)																							actccatctcaaaaaaaaaaa	0.159													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	59621677	59621677	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59621677delA								RNF152 (61373 upstream) : PIGN (89783 downstream)																							gagagaccagaaaagcatgcc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	62296675	62296678	+	IGR	DEL	TGCC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62296675_62296678delTGCC								C18orf20 (480415 upstream) : None (None downstream)																							CAtgcctgcttgcctgcctgcctg	0.181													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	62786605	62786605	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62786605delT								C18orf20 (970345 upstream) : CDH7 (630883 downstream)																							CCACTAAGGATTAGTGCTGGA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	66111983	66111984	+	IGR	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66111983_66111984delTG								DSEL (928016 upstream) : TMX3 (228943 downstream)																							ATGAAGTATCTGTGAGGAATCT	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68757239	68757239	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68757239delT								SOCS6 (759805 upstream) : None (None downstream)																							cttctggggcttttatggttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	69456807	69456808	+	IGR	DEL	GC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:69456807_69456808delGC								None (None upstream) : CBLN2 (747107 downstream)																							gaacatgtaggcgcacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	73332681	73332682	+	IGR	INS	-	GG	GG	rs143370946	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73332681_73332682insGG								C18orf62 (193092 upstream) : ZNF516 (738937 downstream)																							TTATCCCTTGCGgtgtgtgtgt	0.426													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77290977	77290977	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77290977delG								NFATC1 (1655 upstream) : CTDP1 (148824 downstream)																							GCCCTGGCAAGGGCATCTCGT	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	80841	80842	+	IGR	DEL	CT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:80841_80842delCT								FAM138F (3151 upstream) : OR4F17 (26304 downstream)																							cccctgctgcctctttctgaac	0.000													4	4	---	---	---	---	
HMHA1	23526	broad.mit.edu	37	19	1085528	1085529	+	Intron	INS	-	T	T	rs147365366	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1085528_1085529insT	uc002lqz.1	+						HMHA1_uc010xgd.1_Intron|HMHA1_uc010xge.1_Intron|HMHA1_uc002lra.1_Intron|HMHA1_uc002lrb.1_Intron|HMHA1_uc002lrc.1_Intron|HMHA1_uc002lrd.1_Intron|HMHA1_uc010dsd.1_Intron	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		cctgtctctccccatctctcct	0.054													4	2	---	---	---	---	
SPPL2B	56928	broad.mit.edu	37	19	2349081	2349082	+	Intron	INS	-	A	A	rs142396912	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2349081_2349082insA	uc002lvs.2	+						SPPL2B_uc002lvr.2_Intron	NM_152988	NP_694533	Q8TCT7	PSL1_HUMAN	signal peptide peptidase-like 2B isoform 2							Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCTCCACACACACTCGCGTT	0.530													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	5576516	5576517	+	IGR	INS	-	T	T	rs147507953	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5576516_5576517insT								PLAC2 (8511 upstream) : SAFB2 (10494 downstream)																							tatcaagcccattttTTTTAAC	0.158													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8252108	8252109	+	IGR	DEL	AG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8252108_8252109delAG								FBN3 (39727 upstream) : LASS4 (22108 downstream)																							cctgggtgacagagagagagag	0.040													4	3	---	---	---	---	
CARM1	10498	broad.mit.edu	37	19	11023800	11023800	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11023800delG	uc002mpz.2	+						CARM1_uc010dxn.2_Intron|CARM1_uc002mqa.2_Intron	NM_199141	NP_954592	Q86X55	CARM1_HUMAN	coactivator-associated arginine						cellular lipid metabolic process|histone H3-R2 methylation|interspecies interaction between organisms|pathogenesis|positive regulation of fat cell differentiation|regulation of estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleoplasm	beta-catenin binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-R17 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein-arginine omega-N asymmetric methyltransferase activity|transcription regulatory region DNA binding				0						ctttttttttggggggggtct	0.308													5	3	---	---	---	---	
CCDC151	115948	broad.mit.edu	37	19	11543622	11543622	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11543622delT	uc002mrs.2	-						CCDC151_uc002mrr.2_5'Flank|CCDC151_uc010dxz.2_Intron|PRKCSH_uc002mrt.2_5'Flank|PRKCSH_uc002mru.2_5'Flank|PRKCSH_uc010xlz.1_5'Flank|PRKCSH_uc010dya.2_5'Flank|PRKCSH_uc002mrv.1_5'Flank|PRKCSH_uc010dyb.2_5'Flank	NM_145045	NP_659482	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151											ovary(1)	1						AAGATTACCCttttttttttt	0.050													4	2	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13510249	13510249	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13510249delA	uc010dze.2	-						CACNA1A_uc002mwy.3_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	agagaaaaggaaaaaaaaaaa	0.328													2	4	---	---	---	---	
MYO9B	4650	broad.mit.edu	37	19	17288095	17288096	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17288095_17288096insT	uc010eak.2	+						MYO9B_uc002nfi.2_Intron|MYO9B_uc002nfj.1_Intron	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1						actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						TTGTTTGTTGGTTTTTTTTTTT	0.292													4	2	---	---	---	---	
FAM125A	93343	broad.mit.edu	37	19	17534170	17534170	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17534170delA	uc002ngo.1	+						FAM125A_uc002ngp.1_Intron|FAM125A_uc002ngq.1_Intron	NM_138401	NP_612410	Q96EY5	F125A_HUMAN	family with sequence similarity 125, member A						protein transport	late endosome membrane|microtubule organizing center|nucleus	SH3 domain binding				0						ctccgtccccaaaaaaaaaaa	0.264													6	3	---	---	---	---	
JUND	3727	broad.mit.edu	37	19	18393626	18393629	+	5'Flank	DEL	TCTG	-	-	rs41507248		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18393626_18393629delTCTG	uc002nip.2	-							NM_005354	NP_005345	P17535	JUND_HUMAN	jun D proto-oncogene						regulation of transcription from RNA polymerase II promoter	chromatin|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0						GCTCCCCACCTCTGTCTGAATGGA	0.348													3	3	---	---	---	---	
SSBP4	170463	broad.mit.edu	37	19	18531661	18531661	+	Intron	DEL	A	-	-	rs34523547		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18531661delA	uc002niy.2	+						SSBP4_uc010ebp.2_Intron|SSBP4_uc002niz.2_Intron	NM_032627	NP_116016	Q9BWG4	SSBP4_HUMAN	single stranded DNA binding protein 4 isoform a							nucleus	single-stranded DNA binding				0						attccatctcaaaaaaaaaaa	0.214													0	6	---	---	---	---	
GDF1	2657	broad.mit.edu	37	19	18984651	18984652	+	Intron	DEL	AA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18984651_18984652delAA	uc002nki.1	-							NM_021267	NP_067090	P27539	GDF1_HUMAN	LAG1 homolog, ceramide synthase 1 isoform 1						growth	extracellular space	cytokine activity|growth factor activity				0						ctctgtctcgaaaaaaaaaaaa	0.248													4	2	---	---	---	---	
ZNF493	284443	broad.mit.edu	37	19	21578399	21578399	+	5'Flank	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21578399delC	uc002npx.2	+						ZNF493_uc002npu.2_5'Flank|ZNF493_uc002npw.2_5'Flank|ZNF493_uc002npy.2_5'Flank	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CGGAACAGCACAGAGACTTTG	0.488													4	2	---	---	---	---	
ZNF492	57615	broad.mit.edu	37	19	22822967	22822968	+	Intron	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22822967_22822968insT	uc002nqw.3	+							NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				ttcatgtgtgattttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27887282	27887282	+	IGR	DEL	G	-	-	rs35684483		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27887282delG								None (None upstream) : LOC148189 (394120 downstream)																							taatgagaatgcttctgtcta	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28949997	28949997	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28949997delA	uc002nsa.1	-											Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																		tgtgtgaaataaatgtgtatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31182327	31182328	+	IGR	INS	-	AAC	AAC	rs78202814		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31182327_31182328insAAC								ZNF536 (133362 upstream) : DKFZp566F0947 (458455 downstream)																							CCTCAACTGTTAATCAAATTGG	0.540													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31758554	31758554	+	IGR	DEL	T	-	-	rs71335124		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31758554delT								DKFZp566F0947 (117245 upstream) : TSHZ3 (7299 downstream)																							AATAAGCCCATTTTTTTTTTC	0.512													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32351905	32351906	+	IGR	INS	-	A	A	rs35574477		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32351905_32351906insA								TSHZ3 (511715 upstream) : ZNF507 (484608 downstream)																							tccgtccccccaaaaaaaaaaa	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	33676738	33676739	+	IGR	DEL	TC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33676738_33676739delTC								WDR88 (10037 upstream) : LRP3 (8860 downstream)																							tgtgtgtCTTTCTCTCTCTCTC	0.426													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34537845	34537846	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34537845_34537846insA								KCTD15 (231180 upstream) : LSM14A (125506 downstream)																							gactctgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
LOC100128675	100128675	broad.mit.edu	37	19	35596492	35596494	+	Intron	DEL	CAT	-	-	rs143642353		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35596492_35596494delCAT	uc010xsi.1	-						LOC100128675_uc002nxu.2_Intron	NR_024562				SubName: Full=cDNA FLJ57934;												0						ccaccatcaccatcatcatcacc	0.000													3	7	---	---	---	---	
ZFP14	57677	broad.mit.edu	37	19	36862888	36862889	+	Intron	INS	-	GGAG	GGAG	rs139062759	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36862888_36862889insGGAG	uc010eex.1	-							NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN	zinc finger protein 14-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)					gaaggagggatggagggaggga	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	37173874	37173875	+	IGR	DEL	TG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37173874_37173875delTG								ZNF461 (16135 upstream) : ZNF567 (4655 downstream)																							TCTCTCTCTTtgtgtgtgtgtg	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	37748716	37748716	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37748716delA	uc002ofv.2	+											Homo sapiens, clone IMAGE:5247201, mRNA.																		actctgtctcaaaaaaaaaaa	0.144													2	4	---	---	---	---	
SIPA1L3	23094	broad.mit.edu	37	19	38450458	38450459	+	Intron	DEL	TT	-	-	rs148219120		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38450458_38450459delTT	uc002ohk.2	+							NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			aaaaactttctttttttttttt	0.000													4	2	---	---	---	---	
ACTN4	81	broad.mit.edu	37	19	39141262	39141262	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39141262delA	uc002oja.1	+						ACTN4_uc010egc.1_Intron	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4						platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CTTTCCTGTTATGGGGTAGGG	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	39509709	39509710	+	IGR	DEL	AA	-	-	rs139126823		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39509709_39509710delAA								FBXO17 (43329 upstream) : FBXO27 (4954 downstream)																							actctatcacaaaaaaaaaaaa	0.000													5	3	---	---	---	---	
PAK4	10298	broad.mit.edu	37	19	39616694	39616694	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39616694delG	uc002okj.1	+						PAK4_uc002okl.1_Intron|PAK4_uc002okn.1_Intron|PAK4_uc002okm.1_Intron|PAK4_uc002oko.1_Intron|PAK4_uc002okp.1_Intron	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	p21-activated kinase 4 isoform 1						cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			CCGAGGGGTCGGGGGTTAACG	0.672													4	2	---	---	---	---	
PSG8	440533	broad.mit.edu	37	19	43266666	43266666	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43266666delG	uc002ouo.2	-						PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc002oui.2_Intron|PSG8_uc002ouh.2_Intron|PSG8_uc010ein.2_Intron|PSG8_uc002ouj.3_Intron|PSG8_uc002ouk.3_Intron|PSG8_uc002oul.3_Intron|PSG8_uc002oum.3_Intron|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Intron	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform							extracellular region					0		Prostate(69;0.00899)				AAGAGGTTTTGGATCATTCAT	0.488													17	9	---	---	---	---	
DHDH	27294	broad.mit.edu	37	19	49445243	49445246	+	Intron	DEL	GTGT	-	-	rs34195564		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49445243_49445246delGTGT	uc002ple.1	+							NM_014475	NP_055290	Q9UQ10	DHDH_HUMAN	dimeric dihydrodiol dehydrogenase						carbohydrate metabolic process		binding|D-xylose 1-dehydrogenase (NADP+) activity|electron carrier activity|NAD(P)+ transhydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		ACTGTACTTCgtgtgtgtgtgtgt	0.025													4	2	---	---	---	---	
LRRC4B	94030	broad.mit.edu	37	19	51039395	51039395	+	Intron	DEL	T	-	-	rs72159791		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51039395delT	uc002pss.2	-							NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor							cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		tttaccttccttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	51090660	51090677	+	IGR	DEL	CACACACATGCATGCACA	-	-	rs11273646		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51090660_51090677delCACACACATGCATGCACA								LRRC4B (19358 upstream) : SNAR-F (17543 downstream)																							cacacacatgcacacacatgcatgcacacacacacatg	0.170													5	3	---	---	---	---	
KLK14	43847	broad.mit.edu	37	19	51586227	51586228	+	Intron	INS	-	T	T	rs78707495		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51586227_51586228insT	uc002pvs.1	-							NM_022046	NP_071329	Q9P0G3	KLK14_HUMAN	kallikrein 14 preproprotein						epidermis morphogenesis|fertilization|negative regulation of G-protein coupled receptor protein signaling pathway|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis|seminal clot liquefaction	extracellular space	serine-type endopeptidase activity			skin(1)	1		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00422)		TGCTTCTGACATTTTTTTTTTT	0.535													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	51933351	51933352	+	IGR	DEL	TT	-	-	rs34572302		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51933351_51933352delTT								SIGLEC10 (11900 upstream) : SIGLEC8 (20750 downstream)																							aagttcccactttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	52096721	52096721	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52096721delG	uc002pxd.1	-											SubName: Full=cDNA FLJ30403 fis, clone BRACE2008480; SubName: Full=HCG2008157;																		GGTAGTGAGTGGGGTGCAGGG	0.547													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	52688225	52688225	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52688225delG								ZNF836 (13329 upstream) : PPP2R1A (4966 downstream)																							ttttttttttgagatggagtt	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54180011	54180011	+	5'Flank	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54180011delT	uc010ydz.1	+						MIR515-1_hsa-mir-515-1|MI0003144_5'Flank					DM004867																		CCAATGGGGATTTTTTTTTTC	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54888107	54888108	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54888107_54888108insA								LAIR1 (5943 upstream) : TTYH1 (38527 downstream)																							gactccatctcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
ZNF444	55311	broad.mit.edu	37	19	56653838	56653838	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56653838delT	uc002qmm.2	+						ZNF444_uc002qmn.1_Intron	NM_018337	NP_060807	Q8N0Y2	ZN444_HUMAN	zinc finger protein 444						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0531)		gtctggagactttttttttgg	0.090													3	3	---	---	---	---	
ZSCAN5A	79149	broad.mit.edu	37	19	56754157	56754158	+	Intron	INS	-	A	A	rs139162940	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56754157_56754158insA	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						tttctctcttttttttttgaga	0.153													4	2	---	---	---	---	
ZNF835	90485	broad.mit.edu	37	19	57185700	57185700	+	5'Flank	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57185700delA	uc010ygo.1	-						ZNF835_uc010ygn.1_5'Flank	NM_001005850	NP_001005850			zinc finger protein 835											pancreas(3)|skin(1)	4						ATAGAATGGGAAAAAAAATgc	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	57545759	57545759	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57545759delA								MIMT1 (185837 upstream) : USP29 (85750 downstream)																							AAAATCCGTTAAAAATACACA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	57774452	57774452	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57774452delT								ZNF805 (347 upstream) : ZNF460 (16967 downstream)																							CTTTTGCCTCTTTCGGAGTAG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	57812318	57812319	+	IGR	DEL	AG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57812318_57812319delAG								ZNF460 (6882 upstream) : ZNF543 (19558 downstream)																							tttgtgagacagagtgtcactc	0.000													5	4	---	---	---	---	
A1BG	1	broad.mit.edu	37	19	58861774	58861774	+	Frame_Shift_Del	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58861774delC	uc002qsd.3	-	6	1216	c.1154delG	c.(1153-1155)GGCfs	p.G385fs	NCRNA00181_uc002qse.2_Intron|A1BG_uc002qsf.1_RNA|NCRNA00181_uc002qsg.2_5'Flank	NM_130786	NP_570602	P04217	A1BG_HUMAN	alpha 1B-glycoprotein precursor	385	Ig-like V-type 4.					extracellular region					0		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		GGGCGCGGAGCCCCCGAAAGG	0.701													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	315168	315169	+	IGR	INS	-	A	A	rs144678518	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:315168_315169insA								SOX12 (4303 upstream) : NRSN2 (12201 downstream)																							AGAGTGAGGTGAAGGAAAGGAC	0.307													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	804138	804138	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:804138delA								C20orf54 (54910 upstream) : FAM110A (10218 downstream)																							CTTCCCCAGCAAAATCCCATC	0.602													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	3436812	3436812	+	IGR	DEL	T	-	-	rs11475646		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3436812delT								C20orf194 (48225 upstream) : ATRN (14853 downstream)																							GCTTATTTGATTTGCGGAAGG	0.239													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	4635002	4635003	+	IGR	DEL	GG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4635002_4635003delGG								ADRA1D (405343 upstream) : PRNP (31794 downstream)																							ctgattccatggggaaggaaca	0.020													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	6584958	6584958	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6584958delG								FERMT1 (480767 upstream) : BMP2 (163787 downstream)																							GGGAAAGTGTGGCAGTATGAG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	13828928	13828929	+	IGR	INS	-	G	G	rs57801329		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13828928_13828929insG								C20orf7 (31056 upstream) : SEL1L2 (1123 downstream)																							aaagaagagaagagaaggagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	21860844	21860844	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21860844delA								PAX1 (164224 upstream) : LOC284788 (520127 downstream)																							tttattgtttaaaaaaaaaac	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	24816883	24816884	+	IGR	INS	-	ACACAT	ACACAT	rs138306448	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24816883_24816884insACACAT								TMEM90B (169716 upstream) : CST7 (112982 downstream)																							accctccacacacccaccctcc	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26316424	26316425	+	IGR	INS	-	A	A	rs148839755	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26316424_26316425insA								MIR663 (127510 upstream) : None (None downstream)																							ctctttttgttgaatctgtaag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29422533	29422534	+	IGR	DEL	AA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29422533_29422534delAA								None (None upstream) : FRG1B (189345 downstream)																							CTGGAGACATAAATAGAGGAAG	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29519592	29519592	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29519592delG								None (None upstream) : FRG1B (92287 downstream)																							cgaggggtgtggggggggcct	0.000													4	3	---	---	---	---	
CTNNBL1	56259	broad.mit.edu	37	20	36415483	36415483	+	Intron	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36415483delT	uc010zvw.1	+						CTNNBL1_uc002xhh.2_Intron|CTNNBL1_uc002xhi.2_Intron|CTNNBL1_uc002xhj.2_Intron	NM_030877	NP_110517	Q8WYA6	CTBL1_HUMAN	beta catenin-like 1						apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding			ovary(2)	2		Myeloproliferative disorder(115;0.00878)				TGGTTGTGGATTTTTTTTTTT	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37298372	37298373	+	IGR	DEL	AG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37298372_37298373delAG								ADIG (81268 upstream) : SLC32A1 (54732 downstream)																							aaagaaagaaagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	40524000	40524000	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40524000delT								CHD6 (276867 upstream) : PTPRT (177393 downstream)																							CAGTTCCTGAttttttttttt	0.443													4	2	---	---	---	---	
ZNF334	55713	broad.mit.edu	37	20	45132384	45132384	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45132384delA	uc002xsc.2	-						ZNF334_uc002xsa.2_Intron|ZNF334_uc002xsb.2_Intron|ZNF334_uc002xsd.2_Intron|ZNF334_uc010ghl.2_Intron	NM_018102	NP_060572	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)				tttgcatgccaggcaccttgt	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46003855	46003855	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46003855delA								ZMYND8 (18381 upstream) : NCOA3 (126802 downstream)																							actctgtctcaaaaaaaaaaa	0.090													4	2	---	---	---	---	
SULF2	55959	broad.mit.edu	37	20	46347288	46347289	+	Intron	INS	-	CT	CT			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46347288_46347289insCT	uc002xto.2	-						SULF2_uc002xtr.2_Intron|SULF2_uc002xtq.2_Intron|SULF2_uc010ghv.1_Intron	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor						bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						atgtttggagactctcacagtc	0.134													4	2	---	---	---	---	
PTPN1	5770	broad.mit.edu	37	20	49127139	49127139	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49127139delC	uc002xvl.2	+						PTPN1_uc010zys.1_Intron	NM_002827	NP_002818	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type						blood coagulation|interferon-gamma-mediated signaling pathway|negative regulation of insulin receptor signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytosol|endoplasmic reticulum membrane	protein tyrosine phosphatase activity|zinc ion binding				0		Lung NSC(126;0.163)			Clodronate(DB00720)|Tiludronate(DB01133)	TGCGGGAGCGCCCCGGAGCGT	0.667													4	2	---	---	---	---	
ATP9A	10079	broad.mit.edu	37	20	50252401	50252404	+	Intron	DEL	AGGG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50252401_50252404delAGGG	uc002xwg.1	-						ATP9A_uc010gih.1_Intron|ATP9A_uc002xwf.1_Intron	NM_006045	NP_006036	O75110	ATP9A_HUMAN	ATPase, class II, type 9A						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4						ggaaggaggaagggagggagggag	0.157													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	50988307	50988307	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50988307delT								ZFP64 (179783 upstream) : TSHZ2 (600570 downstream)																							atgccttcccttagggtaggc	0.045													4	2	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	51910687	51910688	+	Intron	INS	-	GGGCTGGATCTT	GGGCTGGATCTT	rs141535368	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51910687_51910688insGGGCTGGATCTT	uc002xwo.2	+							NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			TGAGCTAGGAGGGGCTGgatct	0.158													7	4	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	52086378	52086381	+	Intron	DEL	AGGG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52086378_52086381delAGGG	uc002xwo.2	+						uc002xwp.1_Intron	NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			agagggaggaagggagggagggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56521018	56521019	+	IGR	DEL	CG	-	-	rs112930413		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56521018_56521019delCG								PMEPA1 (234477 upstream) : C20orf85 (204964 downstream)																							gaggccaggccgcgtgacaacc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56525081	56525085	+	IGR	DEL	AAAAA	-	-	rs67904054	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56525081_56525085delAAAAA								PMEPA1 (238540 upstream) : C20orf85 (200898 downstream)																							aacaaaaaacaaaaaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	59767378	59767379	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59767378_59767379insT								MIR646 (883753 upstream) : CDH4 (60180 downstream)																							ttattttttCCTTTTTTTTTTA	0.223													4	2	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	59904501	59904502	+	Intron	INS	-	T	T	rs11086734		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59904501_59904502insT	uc002ybn.1	+							NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TCATGGTCCCCCGTGGGTCTGG	0.584													4	5	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	59976448	59976449	+	Intron	INS	-	T	T	rs72540398	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59976448_59976449insT	uc002ybn.1	+							NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TTTTTTTGTCAGACAAAAAGAA	0.406													4	2	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60071457	60071458	+	Intron	INS	-	A	A	rs79795654		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60071457_60071458insA	uc002ybn.1	+							NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			taccctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	61680505	61680511	+	Intron	DEL	CTTCCTC	-	-	rs13045107	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61680505_61680511delCTTCCTC	uc002yec.1	+											Homo sapiens cDNA FLJ46471 fis, clone THYMU3023394.																		tcctcctcctcttcctccctcctcttc	0.039													4	2	---	---	---	---	
ZBTB46	140685	broad.mit.edu	37	20	62452249	62452249	+	Intron	DEL	T	-	-	rs112667175		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62452249delT	uc002ygu.2	-						uc002ygw.2_Intron	NM_025224		Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)|ovary(1)	2	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					gcatggctaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9573204	9573205	+	IGR	INS	-	GT	GT	rs138924544	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9573204_9573205insGT								None (None upstream) : None (None downstream)																							tgcgtgtgtgcgtgtgtgtgtg	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9575794	9575794	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9575794delA								None (None upstream) : None (None downstream)																							GGCAAAAAACAAAAAAACCAA	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9588129	9588130	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9588129_9588130insA								None (None upstream) : None (None downstream)																							atttaaaaaTTAAAAAAAAAAA	0.173													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9837780	9837780	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9837780delT								None (None upstream) : None (None downstream)																							TTAGAACAAATTATTTGAGca	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9845623	9845630	+	IGR	DEL	CTCCTGAG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9845623_9845630delCTCCTGAG								None (None upstream) : None (None downstream)																							gaataaaagcctcctgaggcctcaccag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9854128	9854129	+	IGR	INS	-	G	G			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9854128_9854129insG								None (None upstream) : None (None downstream)																							tcaacctcctcacactgaattt	0.025													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9878732	9878733	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9878732_9878733insT								None (None upstream) : None (None downstream)																							cagtggcgtggttttttttctc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10557843	10557844	+	Intron	INS	-	AT	AT			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10557843_10557844insAT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		attgaagacagataagcagatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10597055	10597056	+	Intron	DEL	GC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10597055_10597056delGC	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		acacgcacgtgcgcgcgcgcgc	0.104													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10697922	10697923	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10697922_10697923insT								None (None upstream) : TPTE (208820 downstream)																							ctttgtgagggttggattcatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10786167	10786171	+	IGR	DEL	GGAAT	-	-	rs28970962		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10786167_10786171delGGAAT								None (None upstream) : TPTE (120572 downstream)																							ggacacgaaaggaatggaatggaat	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10789791	10789791	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10789791delG								None (None upstream) : TPTE (116952 downstream)																							cgaatagaatggacttgagtg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11155723	11155725	+	IGR	DEL	TAT	-	-	rs139704350		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11155723_11155725delTAT								BAGE (56786 upstream) : None (None downstream)																							aattgtaatatattatttccagt	0.049													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14359936	14359939	+	IGR	DEL	TCAG	-	-	rs113039060		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14359936_14359939delTCAG								None (None upstream) : C21orf99 (50548 downstream)																							tcaaagccgctcagtcaaaaaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	16021495	16021495	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16021495delA								SAMSN1 (65772 upstream) : NRIP1 (312061 downstream)																							tcacaagaacaaaaaacccaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	18815068	18815069	+	Intron	INS	-	A	A	rs148126758	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18815068_18815069insA	uc011abz.1	+						uc002ykg.1_Intron					Homo sapiens cDNA clone IMAGE:40146531.																		CCTTTAGACTGAAAAAAAAAAT	0.337													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	20888498	20888498	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20888498delA								None (None upstream) : None (None downstream)																							cacaccattcaaaaaggctat	0.000													4	2	---	---	---	---	
NCRNA00158	54072	broad.mit.edu	37	21	26795041	26795044	+	Intron	DEL	TCTC	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26795041_26795044delTCTC	uc002ylk.2	-						NCRNA00158_uc010glg.2_Intron	NR_024027				Homo sapiens C21orf42 protein mRNA, complete cds, alternatively spliced.												0						TCCCTTTGCTTCTCTCTAAGTTTT	0.382													3	3	---	---	---	---	
APP	351	broad.mit.edu	37	21	27445796	27445797	+	Intron	INS	-	A	A	rs147410190	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27445796_27445797insA	uc002ylz.2	-						APP_uc010glk.2_Intron|APP_uc002yma.2_Intron|APP_uc011ach.1_Intron|APP_uc002ymb.2_Intron|APP_uc010glj.2_Intron|APP_uc011aci.1_Intron|APP_uc011acj.1_Intron	NM_000484	NP_000475	P05067	A4_HUMAN	amyloid beta A4 protein isoform a precursor						adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		Breast(209;0.00295)				AGATGCCTGATAACAGGTGACT	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	29719829	29719829	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29719829delC								C21orf94 (324301 upstream) : NCRNA00161 (191811 downstream)																							cttcctccctccctcccttcc	0.095													2	6	---	---	---	---	
GRIK1	2897	broad.mit.edu	37	21	31093920	31093921	+	Intron	INS	-	A	A	rs140389060		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31093920_31093921insA	uc002yno.1	-						GRIK1_uc002ynn.2_Intron|GRIK1_uc011acs.1_Intron|GRIK1_uc011act.1_Intron|GRIK1_uc010glq.1_Intron|GRIK1_uc002ynr.2_Intron	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1						central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	GAATACATACCAAAAAAAAAAA	0.322													4	3	---	---	---	---	
TIAM1	7074	broad.mit.edu	37	21	32589522	32589523	+	Intron	INS	-	A	A	rs113271826		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32589522_32589523insA	uc002yow.1	-						TIAM1_uc011adk.1_Intron|TIAM1_uc011adl.1_Intron|TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						actctgtctccaaaaaaaaaaa	0.223													6	3	---	---	---	---	
KCNJ6	3763	broad.mit.edu	37	21	39084769	39084770	+	Intron	INS	-	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39084769_39084770insC	uc011aej.1	-						KCNJ6_uc002ywo.2_Intron	NM_002240	NP_002231	P48051	IRK6_HUMAN	potassium inwardly-rectifying channel J6						synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1					Halothane(DB01159)	cccctcctcctctctccctcct	0.158													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	41041849	41041849	+	IGR	DEL	T	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41041849delT								B3GALT5 (7034 upstream) : IGSF5 (75485 downstream)																							CTTCTGTCACTTTTTTTTTTC	0.498													4	2	---	---	---	---	
UMODL1	89766	broad.mit.edu	37	21	43502834	43502834	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43502834delC	uc002zaf.1	+						UMODL1_uc002zad.1_Intron|UMODL1_uc002zae.1_Intron|UMODL1_uc002zag.1_Intron|UMODL1_uc010gow.1_5'Flank|UMODL1_uc002zai.1_5'Flank|UMODL1_uc010gox.1_5'Flank|UMODL1_uc010goy.1_5'Flank|UMODL1_uc002zaj.1_5'Flank|UMODL1_uc010goz.1_5'Flank	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor							cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						CCCACCTCTGCCGTCTTGGCA	0.637													4	2	---	---	---	---	
CECR7	100130418	broad.mit.edu	37	22	17524105	17524106	+	Intron	INS	-	A	A	rs79392405		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17524105_17524106insA	uc002zlx.1	+							NR_015352				Homo sapiens cDNA FLJ40726 fis, clone TKIDN1000164.												0						aacaaacaaacaaaaaaaaact	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17791159	17791160	+	IGR	INS	-	T	T	rs149611553	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17791159_17791160insT								CECR1 (88421 upstream) : CECR2 (49679 downstream)																							GGGCTCCTGTCttttttttttg	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20679374	20679374	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20679374delG								RIMBP3 (217588 upstream) : ZNF74 (69105 downstream)																							gactgagggaggtggatagct	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	23773377	23773377	+	IGR	DEL	A	-	-	rs142271022		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23773377delA								ZDHHC8P1 (28578 upstream) : IGLL1 (141938 downstream)																							tctttctttgaagagtattgg	0.000													4	2	---	---	---	---	
CABIN1	23523	broad.mit.edu	37	22	24557360	24557360	+	Intron	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24557360delG	uc002zzi.1	+						CABIN1_uc002zzj.1_Intron|CABIN1_uc002zzl.1_Intron|CABIN1_uc002zzm.1_Intron	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1						cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						GGAATCAAGTGGGGCAAATCT	0.607													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	25377055	25377056	+	IGR	INS	-	TT	TT	rs55654024		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25377055_25377056insTT								TMEM211 (41741 upstream) : KIAA1671 (46885 downstream)																							gtgtgtgtgtgtttttactgta	0.124													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	26542137	26542137	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26542137delC								MYO18B (115130 upstream) : SEZ6L (23343 downstream)																							ACTGCCCTGTCCTTTACTACC	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27298753	27298753	+	IGR	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27298753delC								MIAT (183804 upstream) : MN1 (845513 downstream)																							ctctctctttccccccccctc	0.025													4	2	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	32914443	32914444	+	Intron	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32914443_32914444insA	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron|SYN3_uc011amc.1_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						gtgaaaaactgaaaaccgtata	0.059													4	2	---	---	---	---	
LARGE	9215	broad.mit.edu	37	22	34311034	34311035	+	Intron	INS	-	AGAGAGAC	AGAGAGAC			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34311034_34311035insAGAGAGAC	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				cacacacagagagagagagaga	0.262													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35929754	35929759	+	IGR	DEL	TGATGG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35929754_35929759delTGATGG								MCM5 (109260 upstream) : RASD2 (7593 downstream)																							atgatggtgatgatggtgatggtgat	0.000													3	4	---	---	---	---	
PHF21B	112885	broad.mit.edu	37	22	45380039	45380040	+	Intron	INS	-	ACA	ACA	rs111775801		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45380039_45380040insACA	uc003bfn.2	-						PHF21B_uc003bfm.2_Intron|PHF21B_uc011aqk.1_Intron|PHF21B_uc011aql.1_Intron|PHF21B_uc011aqm.1_Intron	NM_138415	NP_612424	Q96EK2	PF21B_HUMAN	PHD finger protein 21B isoform 1								zinc ion binding			ovary(2)|skin(1)	3		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		tcaccaccatcaccaccatcat	0.000													4	2	---	---	---	---	
FBLN1	2192	broad.mit.edu	37	22	45991734	45991735	+	Intron	INS	-	T	T	rs78836488	by1000genomes	TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45991734_45991735insT	uc003bgj.1	+						FBLN1_uc003bgk.1_5'Flank	NM_006486	NP_006477	P23142	FBLN1_HUMAN	fibulin 1 isoform D						interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		AGGTTGCTGGGGttttttttgt	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49153040	49153042	+	IGR	DEL	AGA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49153040_49153042delAGA								FAM19A5 (5298 upstream) : C22orf34 (655134 downstream)																							AAggaggaggagaagggaggagg	0.069													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	372859	372860	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:372859_372860insA								PPP2R3B (25232 upstream) : SHOX (212219 downstream)																							gactccgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	418355	418356	+	IGR	INS	-	AATCATCT	AATCATCT			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:418355_418356insAATCATCT								PPP2R3B (70728 upstream) : SHOX (166723 downstream)																							tatcaattatcatctatatcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	491241	491242	+	IGR	INS	-	AT	AT			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:491241_491242insAT								PPP2R3B (143614 upstream) : SHOX (93837 downstream)																							AGTCCTTATGCATGTTAtgtgt	0.064													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	509936	509937	+	IGR	INS	-	ATCC	ATCC			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:509936_509937insATCC								PPP2R3B (162309 upstream) : SHOX (75142 downstream)																							cccatctatatatccatccatc	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	527593	527593	+	IGR	DEL	G	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:527593delG								PPP2R3B (179966 upstream) : SHOX (57486 downstream)																							ataagtaggtgggtggatggt	0.109													9	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	818517	818521	+	IGR	DEL	AAGAG	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:818517_818521delAAGAG								SHOX (198372 upstream) : CRLF2 (496366 downstream)																							aagaaaagaaaagagaagagaagag	0.161													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1219053	1219053	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1219053delA								SHOX (598908 upstream) : CRLF2 (95834 downstream)																							agaaagaaagaaaagaaataa	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1264112	1264112	+	IGR	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1264112delA								SHOX (643967 upstream) : CRLF2 (50775 downstream)																							aacagaacagaacagaGAAAA	0.025													1	5	---	---	---	---	
CSF2RA	1438	broad.mit.edu	37	X	1396011	1396012	+	Intron	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1396011_1396012insA	uc010nct.2	+						CSF2RA_uc011mhb.1_Intron|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Intron|CSF2RA_uc004cpo.2_Intron|CSF2RA_uc010ncu.2_Intron|CSF2RA_uc011mhc.1_Intron|CSF2RA_uc004cpp.2_Intron	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain							extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	aaataaaGCTTACGCAGTAGCT	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1689142	1689143	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1689142_1689143insA								P2RY8 (33105 upstream) : SFRS17A (21343 downstream)																							ACAAGACTCACAAAAAAATGGA	0.074													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1854089	1854091	+	IGR	DEL	CCT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1854089_1854091delCCT								ASMT (92116 upstream) : DHRSX (283466 downstream)																							ccttcccttccctcctcctcctc	0.005													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2132525	2132534	+	IGR	DEL	AAAAAGAAAA	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2132525_2132534delAAAAAGAAAA								ASMT (370552 upstream) : DHRSX (5023 downstream)																							aaagcaaaagaaaaagaaaagaaagaaaaa	0.000													5	5	---	---	---	---	
DHRSX	207063	broad.mit.edu	37	X	2149856	2149857	+	Intron	INS	-	C	C			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2149856_2149857insC	uc004cqf.3	-							NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				ctctctcccttcctcttccttt	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2592096	2592121	+	IGR	DEL	GATCCTGCCCTCCCTGTCATCTCGGT	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2592096_2592121delGATCCTGCCCTCCCTGTCATCTCGGT								DHRSX (173081 upstream) : CD99 (17107 downstream)																							TGACTGATACGATCCTGCCCTCCCTGTCATCTCGGTGATCCCTTCT	0.500													7	4	---	---	---	---	
CD99	4267	broad.mit.edu	37	X	2610709	2610710	+	Intron	INS	-	TCCT	TCCT			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2610709_2610710insTCCT	uc004cqm.2	+						CD99_uc010nda.2_Intron|CD99_uc004cqn.2_Intron|CD99_uc004cqo.2_Intron	NM_002414	NP_002405	P14209	CD99_HUMAN	CD99 antigen isoform a precursor						cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1						CTTCCTAAATGTCCTTCTTGCG	0.520													4	2	---	---	---	---	
XG	7499	broad.mit.edu	37	X	2669151	2669151	+	5'Flank	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2669151delA	uc011mhg.1	+						XG_uc010ndb.2_5'Flank|XG_uc004cqp.2_5'Flank	NM_175569	NP_780778	P55808	XG_HUMAN	XG glycoprotein isoform 1 precursor							integral to membrane|plasma membrane				ovary(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				actctgtctcaaaaaaaaaaa	0.179													1	6	---	---	---	---	
PDHA1	5160	broad.mit.edu	37	X	19363864	19363864	+	Intron	DEL	C	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19363864delC	uc004czg.3	+						PDHA1_uc004czh.3_Intron|PDHA1_uc011mjc.1_Intron|PDHA1_uc011mjd.1_Intron|PDHA1_uc010nfk.2_Intron	NM_000284	NP_000275	P08559	ODPA_HUMAN	pyruvate dehydrogenase E1 alpha 1 precursor						glycolysis|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	protein binding|pyruvate dehydrogenase (acetyl-transferring) activity			ovary(1)	1	Hepatocellular(33;0.183)				NADH(DB00157)	TTTGCAGGGTCCCCCCCCCCC	0.468													3	3	---	---	---	---	
RBM10	8241	broad.mit.edu	37	X	47036114	47036115	+	Intron	DEL	TC	-	-	rs71692336		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47036114_47036115delTC	uc004dhf.2	+						RBM10_uc004dhe.1_Intron|RBM10_uc004dhg.2_Intron|RBM10_uc004dhh.2_Intron|RBM10_uc010nhq.2_Intron|RBM10_uc004dhi.2_Intron	NM_005676	NP_005667	P98175	RBM10_HUMAN	RNA binding motif protein 10 isoform 1						mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						tctccctctgtctctctctctc	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61815611	61815612	+	IGR	INS	-	A	A			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61815611_61815612insA								None (None upstream) : SPIN4 (751496 downstream)																							gaaatatcttcatataaaaact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	145784569	145784570	+	IGR	INS	-	T	T			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:145784569_145784570insT								MIR891A (675179 upstream) : CXorf51 (106732 downstream)																							ttgattttgccttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9960972	9960973	+	IGR	DEL	CA	-	-	rs71233051		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9960972_9960973delCA								TTTY22 (310118 upstream) : None (None downstream)																							CCTTTCTGCTCACCGCCTCTGC	0.485													8	4	---	---	---	---	
KDM5D	8284	broad.mit.edu	37	Y	21894634	21894634	+	Intron	DEL	A	-	-			TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:21894634delA	uc004fug.2	-						KDM5D_uc011naz.1_Intron|KDM5D_uc010nwy.2_Intron|KDM5D_uc011nba.1_Intron|KDM5D_uc004fuh.2_Intron	NM_004653	NP_004644	Q9BY66	KDM5D_HUMAN	jumonji, AT rich interactive domain 1D isoform						chromatin modification|spermatogenesis	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1					Vitamin C(DB00126)	TCAATCTACCAAAAAAAAAAA	0.358													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58981331	58981340	+	IGR	DEL	CACTCCACTT	-	-	rs78709354		TCGA-18-3406-01	TCGA-18-3406-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58981331_58981340delCACTCCACTT								None (None upstream) : None (None downstream)																							cattccactccactccacttcactccactc	0.000													6	6	---	---	---	---	
