Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MIB2	142678	broad.mit.edu	37	1	1562240	1562240	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1562240G>T	uc001agg.2	+	10	1402	c.1275G>T	c.(1273-1275)GTG>GTT	p.V425V	MIB2_uc001agh.2_Silent_p.V411V|MIB2_uc001agi.2_Silent_p.V421V|MIB2_uc001agj.2_Silent_p.V266V|MIB2_uc001agk.2_Silent_p.V360V|MIB2_uc001agl.1_Silent_p.V381V|MIB2_uc001agm.2_Silent_p.V302V|MIB2_uc010nyq.1_Silent_p.V381V|MIB2_uc009vkh.2_Silent_p.V231V|MIB2_uc001agn.2_Silent_p.V57V|MIB2_uc001ago.2_5'Flank	NM_080875	NP_543151	Q96AX9	MIB2_HUMAN	mindbomb homolog 2	425					Notch signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade	endosome	actin binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TCGGGAAGGTGGTGAAAGTGT	0.711													3	6	---	---	---	---	PASS
ARHGEF16	27237	broad.mit.edu	37	1	3389665	3389665	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3389665G>A	uc001akg.3	+	7	1294	c.1046G>A	c.(1045-1047)CGG>CAG	p.R349Q	ARHGEF16_uc001aki.2_Missense_Mutation_p.R61Q|ARHGEF16_uc001akj.2_Missense_Mutation_p.R61Q|ARHGEF16_uc009vli.1_Missense_Mutation_p.R53Q|ARHGEF16_uc010nzh.1_Missense_Mutation_p.R53Q	NM_014448	NP_055263	Q5VV41	ARHGG_HUMAN	Rho guanine exchange factor 16	349	DH.|Required for RHOG activation and mediates interaction with EPHA2.				activation of Cdc42 GTPase activity|activation of Rac GTPase activity|apoptosis|cell chemotaxis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|small GTPase mediated signal transduction	cytosol	PDZ domain binding|receptor tyrosine kinase binding|Rho GTPase binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		CTGGAGCAGCGGCACAAGGCC	0.627													20	11	---	---	---	---	PASS
TAS1R1	80835	broad.mit.edu	37	1	6636553	6636553	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6636553A>T	uc001ant.2	+	4	1339	c.1339A>T	c.(1339-1341)AGT>TGT	p.S447C	TAS1R1_uc001anu.2_Missense_Mutation_p.S193C|TAS1R1_uc001anv.2_Missense_Mutation_p.S193C|TAS1R1_uc001anw.2_Intron	NM_138697	NP_619642	Q7RTX1	TS1R1_HUMAN	sweet taste receptor T1r isoform b	447	Extracellular (Potential).				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		AGATCCCCTCAGTAGCTATAA	0.468													46	74	---	---	---	---	PASS
SLC45A1	50651	broad.mit.edu	37	1	8398050	8398050	+	Nonsense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8398050C>G	uc001apb.2	+	6	1772	c.1772C>G	c.(1771-1773)TCA>TGA	p.S591*	SLC45A1_uc001apc.2_Nonsense_Mutation_p.S289*	NM_001080397	NP_001073866	Q9Y2W3	S45A1_HUMAN	DNB5	591	Helical; (Potential).				carbohydrate transport	integral to membrane	symporter activity			central_nervous_system(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GCCTTCTACTCAGGTACCCGC	0.577													5	26	---	---	---	---	PASS
GRHL3	57822	broad.mit.edu	37	1	24663009	24663009	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24663009C>A	uc001biy.2	+	4	365	c.319C>A	c.(319-321)CCC>ACC	p.P107T	GRHL3_uc001bix.2_Missense_Mutation_p.P102T|GRHL3_uc001biz.2_Missense_Mutation_p.P9T	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform	102					regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		GGACCTCACTCCCCTTGAAAG	0.502													21	82	---	---	---	---	PASS
BSDC1	55108	broad.mit.edu	37	1	32841982	32841982	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32841982G>A	uc001bvh.3	-	9	1084	c.1037C>T	c.(1036-1038)CCA>CTA	p.P346L	BSDC1_uc010ohg.1_Missense_Mutation_p.P363L|BSDC1_uc010ohh.1_Missense_Mutation_p.P290L|BSDC1_uc010ohi.1_Missense_Mutation_p.P251L|BSDC1_uc001bvg.3_RNA|BSDC1_uc001bvj.2_Missense_Mutation_p.P242L|BSDC1_uc001bvi.2_Missense_Mutation_p.P363L	NM_018045	NP_060515	Q9NW68	BSDC1_HUMAN	BSD domain containing 1 isoform b	346							protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CCTGGGCTCTGGGCCGCCGGT	0.622													11	29	---	---	---	---	PASS
TRIM62	55223	broad.mit.edu	37	1	33625491	33625491	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33625491G>T	uc001bxb.2	-	3	1197	c.559C>A	c.(559-561)CGG>AGG	p.R187R		NM_018207	NP_060677	Q9BVG3	TRI62_HUMAN	tripartite motif-containing 62	187	Potential.					intracellular	zinc ion binding				0		Myeloproliferative disorder(586;0.0393)				CGCAGCAGCCGGTGCAGCCGC	0.652													3	14	---	---	---	---	PASS
SNIP1	79753	broad.mit.edu	37	1	38003387	38003387	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38003387C>A	uc001cbi.2	-	4	1226	c.1153G>T	c.(1153-1155)GAG>TAG	p.E385*	SNIP1_uc010oid.1_RNA	NM_024700	NP_078976	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein	385	Poly-Glu.				production of miRNAs involved in gene silencing by miRNA	nucleus	protein binding			upper_aerodigestive_tract(1)|lung(1)	2		Myeloproliferative disorder(586;0.0393)				TCCTCATCCTCGTCATCTTTC	0.423													5	86	---	---	---	---	PASS
STIL	6491	broad.mit.edu	37	1	47717492	47717492	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47717492C>G	uc001crc.1	-	17	3335	c.3180G>C	c.(3178-3180)TTG>TTC	p.L1060F	TAL1_uc001crb.1_Intron|STIL_uc010omn.1_Missense_Mutation_p.L1014F|STIL_uc010omo.1_Missense_Mutation_p.L1043F|STIL_uc001crd.1_Missense_Mutation_p.L1061F|STIL_uc001cre.1_Missense_Mutation_p.L1060F	NM_003035	NP_003026	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus isoform 2	1060					cell proliferation|multicellular organismal development	centrosome|cytosol				lung(2)|skin(1)	3		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				CCTCCATGCTCAAATCCACAC	0.428													15	63	---	---	---	---	PASS
CMPK1	51727	broad.mit.edu	37	1	47838719	47838719	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47838719C>G	uc001cri.2	+	3	560	c.411C>G	c.(409-411)AAC>AAG	p.N137K	CMPK1_uc010omp.1_Missense_Mutation_p.N88K|CMPK1_uc010omq.1_RNA	NM_016308	NP_057392	P30085	KCY_HUMAN	UMP-CMP kinase 1 isoform a	105					nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleus	ATP binding|cytidylate kinase activity|nucleoside phosphate kinase activity|uridine kinase activity			ovary(1)	1					Gemcitabine(DB00441)	AAGGATGGAACAAGACCATGG	0.388													25	28	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52803487	52803487	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52803487G>C	uc001cto.2	+	16	3886	c.3714G>C	c.(3712-3714)TTG>TTC	p.L1238F	ZFYVE9_uc001ctp.2_Missense_Mutation_p.L1179F	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	1238					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						TGGATTCCTTGAGGCAGGCAC	0.517													3	44	---	---	---	---	PASS
CDCP2	200008	broad.mit.edu	37	1	54610191	54610191	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54610191G>C	uc001cwv.1	-	2	1223	c.375C>G	c.(373-375)TTC>TTG	p.F125L		NM_201546	NP_963840	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2 precursor	125	CUB 1.					extracellular region				ovary(1)	1						TGTCCGAGTGGAAGATGACAG	0.552													8	27	---	---	---	---	PASS
ZZZ3	26009	broad.mit.edu	37	1	78098484	78098484	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78098484C>A	uc001dhq.2	-	5	1032	c.556G>T	c.(556-558)GGG>TGG	p.G186W	ZZZ3_uc001dhr.2_Intron|ZZZ3_uc009wbz.1_Missense_Mutation_p.G186W|ZZZ3_uc001dhp.2_Missense_Mutation_p.G186W	NM_015534	NP_056349	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	186					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|large_intestine(1)	5						TTAAGTGGCCCTTCCTCACTG	0.398													22	85	---	---	---	---	PASS
PTGFR	5737	broad.mit.edu	37	1	78958457	78958457	+	Missense_Mutation	SNP	T	A	A	rs115647706	byFrequency	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78958457T>A	uc001din.2	+	2	295	c.29T>A	c.(28-30)GTG>GAG	p.V10E	PTGFR_uc001dim.2_Missense_Mutation_p.V10E	NM_000959	NP_000950	P43088	PF2R_HUMAN	prostaglandin F receptor isoform a precursor	10	Extracellular (Potential).				parturition	extracellular region|integral to plasma membrane	prostaglandin F receptor activity			ovary(3)|breast(2)|skin(1)	6				Colorectal(170;0.248)	Bimatoprost(DB00905)|Latanoprost(DB00654)|Travoprost(DB00287)	AAACAGCTAGTGTCTCCTGCA	0.448													7	29	---	---	---	---	PASS
WDR63	126820	broad.mit.edu	37	1	85573813	85573813	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85573813C>G	uc001dkt.2	+	15	1842	c.1651C>G	c.(1651-1653)CCA>GCA	p.P551A	WDR63_uc009wcl.2_Missense_Mutation_p.P512A	NM_145172	NP_660155	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	551										upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		TTTTGATGTACCATCTACTTT	0.373													7	41	---	---	---	---	PASS
SYDE2	84144	broad.mit.edu	37	1	85655743	85655743	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85655743C>A	uc009wcm.2	-	2	1487	c.1438G>T	c.(1438-1440)GCA>TCA	p.A480S	SYDE2_uc001dku.3_Missense_Mutation_p.A480S	NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2	480					activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|central_nervous_system(1)	2				all cancers(265;0.0126)|Epithelial(280;0.0336)		TTTTTACCTGCAAAAGGAGAT	0.328													46	53	---	---	---	---	PASS
PKN2	5586	broad.mit.edu	37	1	89279297	89279297	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89279297G>T	uc001dmn.2	+	16	2502	c.2160G>T	c.(2158-2160)TTG>TTT	p.L720F	PKN2_uc010osp.1_Missense_Mutation_p.L704F|PKN2_uc010osq.1_Missense_Mutation_p.L563F|PKN2_uc009wcv.2_Missense_Mutation_p.L672F|PKN2_uc010osr.1_Missense_Mutation_p.L385F	NM_006256	NP_006247	Q16513	PKN2_HUMAN	protein kinase N2	720	Protein kinase.				signal transduction	cytoplasm	ATP binding|histone deacetylase binding|protein kinase C activity			large_intestine(1)|lung(1)|skin(1)	3		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		ATCCCTTTTTGGTGAACCTTT	0.338													5	83	---	---	---	---	PASS
ABCD3	5825	broad.mit.edu	37	1	94982602	94982602	+	Intron	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94982602C>A	uc001dqn.3	+						ABCD3_uc010oto.1_Intron|ABCD3_uc010otp.1_Intron|ABCD3_uc009wdr.2_Intron|ABCD3_uc001dqo.3_Intron	NM_002858	NP_002849	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D, member 3						peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		CCCTTCTTTCCCATAGTACTA	0.353													6	97	---	---	---	---	PASS
PTPN22	26191	broad.mit.edu	37	1	114380790	114380790	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114380790T>C	uc001eds.2	-	13	1362	c.1232A>G	c.(1231-1233)AAG>AGG	p.K411R	PTPN22_uc009wgq.2_Missense_Mutation_p.K356R|PTPN22_uc010owo.1_Missense_Mutation_p.K167R|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Missense_Mutation_p.K411R|PTPN22_uc009wgs.2_Missense_Mutation_p.K284R|PTPN22_uc001edu.2_Missense_Mutation_p.K411R	NM_015967	NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type	411					negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACTTTGATGCTTCTGAAGAGG	0.378													27	30	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118554983	118554983	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118554983G>T	uc001ehk.2	-	30	4368	c.4300C>A	c.(4300-4302)CGA>AGA	p.R1434R		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1434						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTGTCTTCTCGAGTTGTCATA	0.388													4	47	---	---	---	---	PASS
C1orf54	79630	broad.mit.edu	37	1	150248195	150248195	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150248195C>T	uc001eud.2	+	3	214	c.176C>T	c.(175-177)TCA>TTA	p.S59L	C1orf54_uc001euc.2_Missense_Mutation_p.S59L|C1orf54_uc001eue.2_Missense_Mutation_p.S59L|C1orf54_uc001euf.2_Missense_Mutation_p.S59L|C1orf54_uc001eug.2_Missense_Mutation_p.S59L	NM_024579	NP_078855	Q8WWF1	CA054_HUMAN	hypothetical protein LOC79630 precursor	59						extracellular region					0	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			ATATTTGAGTCAGAGGACAGG	0.284													4	24	---	---	---	---	PASS
PRPF3	9129	broad.mit.edu	37	1	150305169	150305169	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150305169G>T	uc001eum.3	+	5	600	c.438G>T	c.(436-438)ATG>ATT	p.M146I	PRPF3_uc009wlp.2_RNA|PRPF3_uc010pca.1_Missense_Mutation_p.M105I|PRPF3_uc010pcb.1_Missense_Mutation_p.M97I|PRPF3_uc009wlq.1_5'Flank	NM_004698	NP_004689	O43395	PRPF3_HUMAN	PRP3 pre-mRNA processing factor 3 homolog	146					nuclear mRNA splicing, via spliceosome	Cajal body|cytoplasm|nuclear speck|spliceosomal complex	protein binding			ovary(1)	1	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		AACAGATGATGGAGGCAGCAA	0.418													15	72	---	---	---	---	PASS
UBAP2L	9898	broad.mit.edu	37	1	154229595	154229595	+	Silent	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154229595C>T	uc001fep.3	+	19	2381	c.2214C>T	c.(2212-2214)ACC>ACT	p.T738T	UBAP2L_uc009wot.2_Silent_p.T738T|UBAP2L_uc010pek.1_Silent_p.T730T|UBAP2L_uc010pel.1_Silent_p.T748T|UBAP2L_uc010pen.1_Silent_p.T652T|UBAP2L_uc001feq.2_5'UTR|UBAP2L_uc001fer.2_5'UTR	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like isoform a	738					binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CTTTTTCCACCACATCCAGCA	0.537													23	23	---	---	---	---	PASS
PBXIP1	57326	broad.mit.edu	37	1	154924402	154924402	+	Intron	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154924402G>C	uc001ffr.2	-						PBXIP1_uc001ffs.2_Intron|PBXIP1_uc010pep.1_Intron|PBXIP1_uc009woy.1_Intron	NM_020524	NP_065385	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein						cell differentiation|multicellular organismal development|negative regulation of transcription, DNA-dependent	cytosol|microtubule|nucleus	protein binding|transcription corepressor activity			large_intestine(1)	1	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CAGGCTCTGGGAGGAGAAGTG	0.612													12	22	---	---	---	---	PASS
ETV3L	440695	broad.mit.edu	37	1	157062453	157062453	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157062453C>A	uc001fqq.1	-	5	1359	c.1074G>T	c.(1072-1074)TTG>TTT	p.L358F		NM_001004341	NP_001004341	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	358						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Hepatocellular(266;0.158)	Prostate(1639;0.184)				AAGGAGGATCCAAGGGCCACA	0.572													12	37	---	---	---	---	PASS
KIRREL	55243	broad.mit.edu	37	1	158057941	158057941	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158057941C>A	uc001frn.3	+	7	1317	c.913C>A	c.(913-915)CAC>AAC	p.H305N	KIRREL_uc010pib.1_Missense_Mutation_p.H205N|KIRREL_uc009wsq.2_Missense_Mutation_p.H141N|KIRREL_uc001fro.3_Missense_Mutation_p.H103N	NM_018240	NP_060710	Q96J84	KIRR1_HUMAN	kin of IRRE like precursor	305	Extracellular (Potential).					integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)					AGTAAATGTCCACTGTGAGTA	0.532											OREG0013906	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	75	---	---	---	---	PASS
APOA2	336	broad.mit.edu	37	1	161192260	161192260	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161192260C>A	uc001fzc.1	-	4	296	c.238G>T	c.(238-240)GGA>TGA	p.G80*	APOA2_uc001fzb.1_RNA	NM_001643	NP_001634	P02652	APOA2_HUMAN	apolipoprotein A-II preproprotein	80					cholesterol efflux|cholesterol homeostasis|diacylglycerol catabolic process|high-density lipoprotein particle assembly|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|interspecies interaction between organisms|lipoprotein metabolic process|low-density lipoprotein particle remodeling|negative regulation of cholesterol import|negative regulation of cholesterol transporter activity|negative regulation of cytokine secretion involved in immune response|negative regulation of lipase activity|negative regulation of lipid catabolic process|negative regulation of very-low-density lipoprotein particle remodeling|phosphatidylcholine biosynthetic process|phospholipid catabolic process|phospholipid efflux|positive regulation of cholesterol esterification|positive regulation of interleukin-8 biosynthetic process|positive regulation of lipid catabolic process|protein folding|regulation of protein stability|response to glucose stimulus|reverse cholesterol transport|triglyceride metabolic process|triglyceride-rich lipoprotein particle remodeling	chylomicron|endoplasmic reticulum lumen|spherical high-density lipoprotein particle|very-low-density lipoprotein particle	apolipoprotein receptor binding|cholesterol binding|high-density lipoprotein particle receptor binding|lipase inhibitor activity|phosphatidylcholine binding|phosphatidylcholine-sterol O-acyltransferase activator activity|protein heterodimerization activity|protein homodimerization activity			skin(1)	1	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			AGTTCCGTTCCAGCCTTCTTG	0.502													6	150	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176564494	176564494	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564494A>G	uc001gkz.2	+	3	2918	c.1754A>G	c.(1753-1755)AAC>AGC	p.N585S	PAPPA2_uc001gky.1_Missense_Mutation_p.N585S|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	585	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						GTGCTTGTGAACTGTGAGCCC	0.602													18	50	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176668281	176668281	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176668281G>T	uc001gkz.2	+	8	3956	c.2792G>T	c.(2791-2793)TGG>TTG	p.W931L	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	931					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TTACAGGCCTGGAGCCCTGAG	0.562													5	48	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176903486	176903486	+	Intron	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176903486G>C	uc001glc.2	-						ASTN1_uc001glb.1_Intron|ASTN1_uc001gld.1_Intron	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1						cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GCTATGGAGAGGCATCACCCA	0.517													4	32	---	---	---	---	PASS
RNASEL	6041	broad.mit.edu	37	1	182554630	182554630	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182554630C>A	uc001gpj.1	-	1	1479	c.1312G>T	c.(1312-1314)GAG>TAG	p.E438*	RNASEL_uc009wxz.1_Nonsense_Mutation_p.E438*|RNASEL_uc001gpk.2_Nonsense_Mutation_p.E438*|RNASEL_uc009wya.1_Nonsense_Mutation_p.E438*	NM_021133	NP_066956	Q05823	RN5A_HUMAN	ribonuclease L	438	Protein kinase.|C6-type; atypical.				mRNA processing|response to virus|type I interferon-mediated signaling pathway	mitochondrion	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|metal ion binding|protein kinase activity|RNA binding			ovary(4)|stomach(1)	5						AGAGTCTGCTCACAGAGGGTG	0.488									Hereditary_Prostate_Cancer				20	21	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204948542	204948542	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204948542C>A	uc001hbj.2	+	19	2359	c.2031C>A	c.(2029-2031)GAC>GAA	p.D677E	NFASC_uc010pra.1_Missense_Mutation_p.D673E|NFASC_uc001hbi.2_Missense_Mutation_p.D673E|NFASC_uc010prb.1_Missense_Mutation_p.D688E|NFASC_uc010prc.1_Missense_Mutation_p.D244E|NFASC_uc001hbk.1_Missense_Mutation_p.D483E|NFASC_uc001hbl.1_5'Flank	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor	677	Extracellular (Potential).|Fibronectin type-III 1.				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TCTGGCATGACCATTCCAAGT	0.547													18	30	---	---	---	---	PASS
RBBP5	5929	broad.mit.edu	37	1	205064080	205064080	+	Silent	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205064080G>C	uc001hbu.1	-	13	1639	c.1509C>G	c.(1507-1509)CTC>CTG	p.L503L	RBBP5_uc010prd.1_Silent_p.L538L|RBBP5_uc001hbv.1_Intron|RBBP5_uc010pre.1_Silent_p.L370L	NM_005057	NP_005048	Q15291	RBBP5_HUMAN	retinoblastoma binding protein 5	503					histone H3-K4 methylation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription, DNA-dependent	MLL1 complex|Set1C/COMPASS complex	methylated histone residue binding|transcription regulatory region DNA binding			lung(1)	1	Breast(84;0.0505)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			CCCCTTTGTAGAGTTTCGGTT	0.493													29	43	---	---	---	---	PASS
C1orf65	164127	broad.mit.edu	37	1	223568618	223568618	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223568618C>G	uc001hoa.2	+	1	1904	c.1801C>G	c.(1801-1803)CCC>GCC	p.P601A		NM_152610	NP_689823	Q8N715	CA065_HUMAN	hypothetical protein LOC164127	601										central_nervous_system(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0704)		GAGAGCGCCTCCCAACAGCTC	0.577													17	17	---	---	---	---	PASS
URB2	9816	broad.mit.edu	37	1	229772214	229772214	+	Silent	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229772214T>C	uc001hts.1	+	4	1990	c.1854T>C	c.(1852-1854)GCT>GCC	p.A618A	URB2_uc009xfd.1_Silent_p.A618A	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	618						nucleolus				central_nervous_system(2)|ovary(1)	3						AGGTGGACGCTATGTTCAGTT	0.562													64	68	---	---	---	---	PASS
WDR35	57539	broad.mit.edu	37	2	20137518	20137518	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20137518G>T	uc002rdi.2	-	20	2394	c.2286C>A	c.(2284-2286)CTC>CTA	p.L762L	WDR35_uc002rdj.2_Silent_p.L751L|WDR35_uc010ext.2_RNA|WDR35_uc002rdh.2_Silent_p.L327L|WDR35_uc002rdk.3_Silent_p.L327L	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	762										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTCCATCTCGAGATACGTTC	0.423													4	83	---	---	---	---	PASS
UBXN2A	165324	broad.mit.edu	37	2	24222688	24222688	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24222688T>A	uc010exy.2	+	8	1199	c.731T>A	c.(730-732)ATT>AAT	p.I244N	UBXN2A_uc002rem.2_RNA|UBXN2A_uc002ren.2_Missense_Mutation_p.I244N|UBXN2A_uc010ykj.1_Missense_Mutation_p.I191N	NM_181713	NP_859064	P68543	UBX2A_HUMAN	UBX domain containing 4	244	UBX.										0						GCTGTCATCATTCAGAGACTC	0.418													10	52	---	---	---	---	PASS
C2orf56	55471	broad.mit.edu	37	2	37474646	37474646	+	Silent	SNP	A	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37474646A>T	uc002rqa.3	+	9	1059	c.984A>T	c.(982-984)ACA>ACT	p.T328T	C2orf56_uc010ynj.1_RNA|C2orf56_uc002rqc.3_Silent_p.T230T|C2orf56_uc010ynk.1_Silent_p.T257T|C2orf56_uc010ynl.1_Silent_p.T301T|C2orf56_uc010fah.2_RNA	NM_144736	NP_653337	Q7L592	MIDA_HUMAN	hypothetical protein LOC55471 isoform 1	328					mitochondrial respiratory chain complex I assembly	mitochondrion	enzyme binding|methyltransferase activity			central_nervous_system(1)	1		all_hematologic(82;0.21)				CCCCAGGAACAGCAGATCTAA	0.388													17	43	---	---	---	---	PASS
EHBP1	23301	broad.mit.edu	37	2	63272647	63272647	+	3'UTR	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63272647G>A	uc002sby.2	+	25					EHBP1_uc010fcp.2_3'UTR|EHBP1_uc002sbz.2_3'UTR|EHBP1_uc002scb.2_3'UTR|LOC100132215_uc002scc.3_Intron	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			CATCAGATCAGAAAGAATCTC	0.398									Hereditary_Prostate_Cancer				4	17	---	---	---	---	PASS
LRRTM1	347730	broad.mit.edu	37	2	80530055	80530055	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80530055G>T	uc002sok.1	-	2	1160	c.890C>A	c.(889-891)CCC>CAC	p.P297H	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	297	LRR 9.|Lumenal (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						GAGGATCCGGGGCTCGATGTA	0.622										HNSCC(69;0.2)			6	24	---	---	---	---	PASS
TMEM131	23505	broad.mit.edu	37	2	98375392	98375392	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98375392C>A	uc002syh.3	-	40	5560	c.5331G>T	c.(5329-5331)TGG>TGT	p.W1777C	TMEM131_uc002syg.2_Missense_Mutation_p.W157C	NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	1777	Ser-rich.					integral to membrane				ovary(4)|central_nervous_system(2)	6						AACTGGCTGGCCAGGAAGGAC	0.617													5	6	---	---	---	---	PASS
TMEM131	23505	broad.mit.edu	37	2	98375393	98375393	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98375393C>A	uc002syh.3	-	40	5559	c.5330G>T	c.(5329-5331)TGG>TTG	p.W1777L	TMEM131_uc002syg.2_Missense_Mutation_p.W157L	NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	1777	Ser-rich.					integral to membrane				ovary(4)|central_nervous_system(2)	6						ACTGGCTGGCCAGGAAGGACT	0.617													6	8	---	---	---	---	PASS
MIR128-1	406915	broad.mit.edu	37	2	136422968	136422968	+	RNA	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136422968G>C	hsa-mir-128-1|MI0000447	+			c.2G>C			R3HDM1_uc002tuo.2_Intron|R3HDM1_uc010fni.2_Intron|R3HDM1_uc002tup.2_Intron|R3HDM1_uc010zbh.1_Intron|uc010zbi.1_RNA																	0						CCTTGTTCCTGAGCTGTTGGA	0.403													5	52	---	---	---	---	PASS
MIR128-1	406915	broad.mit.edu	37	2	136423002	136423002	+	RNA	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136423002G>C	hsa-mir-128-1|MI0000447	+			c.36G>C			R3HDM1_uc002tuo.2_Intron|R3HDM1_uc010fni.2_Intron|R3HDM1_uc002tup.2_Intron|R3HDM1_uc010zbh.1_Intron|uc010zbi.1_RNA																	0						CACTGTCTGAGAGGTTTACAT	0.408													6	48	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141299491	141299491	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141299491T>A	uc002tvj.1	-	44	8216	c.7244A>T	c.(7243-7245)GAC>GTC	p.D2415V		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2415	Extracellular (Potential).|LDL-receptor class B 26.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TATATAATTGTCATAAACAGC	0.358										TSP Lung(27;0.18)			9	28	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179495591	179495591	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179495591G>C	uc010zfg.1	-	187	36614	c.36390C>G	c.(36388-36390)ATC>ATG	p.I12130M	TTN_uc010zfh.1_Missense_Mutation_p.I5825M|TTN_uc010zfi.1_Missense_Mutation_p.I5758M|TTN_uc010zfj.1_Missense_Mutation_p.I5633M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13057							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATCTTCAGAGATTTCGGTTT	0.493													19	90	---	---	---	---	PASS
FAM171B	165215	broad.mit.edu	37	2	187627145	187627145	+	Silent	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187627145G>C	uc002ups.2	+	8	2188	c.2076G>C	c.(2074-2076)CTG>CTC	p.L692L	FAM171B_uc002upr.1_Silent_p.L659L|FAM171B_uc002upt.2_Silent_p.L161L	NM_177454	NP_803237	Q6P995	F171B_HUMAN	KIAA1946	692	Cytoplasmic (Potential).					integral to membrane	DNA binding			ovary(6)|breast(3)|central_nervous_system(1)	10						TTATAGACCTGAAAAAGGGCA	0.507													9	35	---	---	---	---	PASS
ASNSD1	54529	broad.mit.edu	37	2	190530930	190530930	+	Silent	SNP	A	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190530930A>G	uc002uqt.2	+	4	506	c.72A>G	c.(70-72)CTA>CTG	p.L24L		NM_019048	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	24	Glutamine amidotransferase type-2.				asparagine biosynthetic process|glutamine metabolic process		asparagine synthase (glutamine-hydrolyzing) activity			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			AGGACTTACTATATAATCTTA	0.358													21	53	---	---	---	---	PASS
ANKAR	150709	broad.mit.edu	37	2	190569878	190569878	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190569878A>G	uc002uqw.1	+	7	1625	c.1625A>G	c.(1624-1626)TAT>TGT	p.Y542C	ANKAR_uc002uqu.2_RNA	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	613	ANK 3.					integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			GCCGCTTTCTATGACAACGTT	0.413													25	62	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196756523	196756523	+	Silent	SNP	T	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196756523T>G	uc002utj.3	-	31	5003	c.4902A>C	c.(4900-4902)CTA>CTC	p.L1634L		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1634	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TTTCTTCCATTAGCCCCTTAA	0.239													7	10	---	---	---	---	PASS
CCDC150	284992	broad.mit.edu	37	2	197530317	197530317	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197530317G>T	uc002utp.1	+	6	807	c.672G>T	c.(670-672)AAG>AAT	p.K224N	CCDC150_uc002uto.1_Missense_Mutation_p.K224N|CCDC150_uc010zgq.1_Intron|CCDC150_uc010zgr.1_Intron|CCDC150_uc010zgs.1_Intron	NM_001080539	NP_001074008	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	224	Potential.										0						CTCAGGAGAAGTACCTTAGGG	0.403													14	23	---	---	---	---	PASS
CRYGA	1418	broad.mit.edu	37	2	209027951	209027951	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209027951G>T	uc002vcq.3	-	2	246	c.229C>A	c.(229-231)CAA>AAA	p.Q77K		NM_014617	NP_055432	P11844	CRGA_HUMAN	crystallin, gamma A	77	Beta/gamma crystallin 'Greek key' 2.				visual perception		structural constituent of eye lens				0				Epithelial(149;0.067)|LUSC - Lung squamous cell carcinoma(261;0.0708)|Lung(261;0.135)		CGGCAGGATTGGACCGAGTCG	0.498													20	32	---	---	---	---	PASS
CRYGA	1418	broad.mit.edu	37	2	209027952	209027952	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209027952G>T	uc002vcq.3	-	2	245	c.228C>A	c.(226-228)GTC>GTA	p.V76V		NM_014617	NP_055432	P11844	CRGA_HUMAN	crystallin, gamma A	76	Beta/gamma crystallin 'Greek key' 2.				visual perception		structural constituent of eye lens				0				Epithelial(149;0.067)|LUSC - Lung squamous cell carcinoma(261;0.0708)|Lung(261;0.135)		GGCAGGATTGGACCGAGTCGC	0.502													20	32	---	---	---	---	PASS
TUBA4A	7277	broad.mit.edu	37	2	220115571	220115571	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220115571C>A	uc002vkt.1	-	4	908	c.850G>T	c.(850-852)GAG>TAG	p.E284*	TUBA4A_uc010zkz.1_Nonsense_Mutation_p.E269*|TUBA4B_uc002vku.2_5'Flank|TUBA4B_uc002vkv.1_5'Flank	NM_006000	NP_005991	P68366	TBA4A_HUMAN	tubulin, alpha 4a	284					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|platelet activation|platelet degranulation|protein polymerization	cytosol|extracellular region|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)	3		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GACAGCTGCTCGTGGTATGCC	0.582													4	81	---	---	---	---	PASS
MOGAT1	116255	broad.mit.edu	37	2	223559869	223559869	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223559869C>A	uc010fws.1	+	5	763	c.715C>A	c.(715-717)CCT>ACT	p.P239T	MOGAT1_uc010fwt.1_Missense_Mutation_p.P199T	NM_058165	NP_477513	Q96PD6	MOGT1_HUMAN	monoacylglycerol O-acyltransferase 1	239					glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			breast(1)	1		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;2.06e-07)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0105)		AACTGACAACCCTGAAGGATC	0.423													8	22	---	---	---	---	PASS
ING5	84289	broad.mit.edu	37	2	242662685	242662685	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242662685T>C	uc002wcd.2	+	7	704	c.679T>C	c.(679-681)TGG>CGG	p.W227R		NM_032329	NP_115705	Q8WYH8	ING5_HUMAN	inhibitor of growth family, member 5	227	PHD-type.				DNA replication|histone H3 acetylation|negative regulation of cell proliferation|negative regulation of growth|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.16e-33)|all cancers(36;4.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		CAAAGGAAAATGGTGAGTGTG	0.552													38	108	---	---	---	---	PASS
NEU4	129807	broad.mit.edu	37	2	242755806	242755806	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242755806A>G	uc010fzr.2	+	2	211	c.125A>G	c.(124-126)CAG>CGG	p.Q42R	NEU4_uc002wcl.2_RNA|NEU4_uc002wcm.2_Missense_Mutation_p.Q42R|NEU4_uc002wcn.1_Missense_Mutation_p.Q54R|NEU4_uc002wco.1_Missense_Mutation_p.Q42R|NEU4_uc002wcp.1_Missense_Mutation_p.Q54R	NM_080741	NP_542779	Q8WWR8	NEUR4_HUMAN	sialidase 4	42						lysosomal lumen|organelle inner membrane	exo-alpha-sialidase activity|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		TTTGTGGAGCAGCGGCTCAGC	0.741													3	5	---	---	---	---	PASS
EFHB	151651	broad.mit.edu	37	3	19924172	19924172	+	Missense_Mutation	SNP	C	T	T	rs149572350	byFrequency	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19924172C>T	uc003cbl.3	-	12	2394	c.2198G>A	c.(2197-2199)CGA>CAA	p.R733Q	EFHB_uc003cbm.2_Missense_Mutation_p.R603Q	NM_144715	NP_653316	Q8N7U6	EFHB_HUMAN	EF hand domain family, member B	733					signal transduction	proteinaceous extracellular matrix	calcium ion binding				0						GCGACGAATTCGGGGAGCAGG	0.403													15	14	---	---	---	---	PASS
TRANK1	9881	broad.mit.edu	37	3	36898233	36898233	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36898233G>T	uc003cgj.2	-	3	1500	c.1198C>A	c.(1198-1200)CGC>AGC	p.R400S		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	950					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						ACATAGCAGCGAGGTATACGC	0.498													5	126	---	---	---	---	PASS
TWF2	11344	broad.mit.edu	37	3	52265552	52265552	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52265552G>C	uc003ddd.2	-	4	437	c.286C>G	c.(286-288)CGG>GGG	p.R96G	TLR9_uc003ddb.2_5'Flank|TLR9_uc003ddc.1_5'Flank|TWF2_uc010hmc.2_Missense_Mutation_p.R96G	NM_007284	NP_009215	Q6IBS0	TWF2_HUMAN	twinfilin-like protein	96	ADF-H 1.					cytoskeleton|perinuclear region of cytoplasm	actin binding|ATP binding			stomach(1)|ovary(1)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ATCTTCAGCCGCACCTGAAGG	0.607											OREG0015610	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	29	---	---	---	---	PASS
TNNC1	7134	broad.mit.edu	37	3	52485756	52485756	+	Intron	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52485756T>C	uc003deb.2	-							NM_003280	NP_003271	P63316	TNNC1_HUMAN	troponin C, slow						cardiac muscle contraction|muscle filament sliding|regulation of ATPase activity|regulation of muscle filament sliding speed|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin filament binding|calcium ion binding|calcium-dependent protein binding|protein homodimerization activity|troponin I binding|troponin T binding				0				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00175)|KIRC - Kidney renal clear cell carcinoma(197;0.00198)|OV - Ovarian serous cystadenocarcinoma(275;0.0525)	Bepridil(DB01244)|Dihydroxyaluminium(DB01375)|Levosimendan(DB00922)	GGTCACGTGCTCACTTGTCAA	0.557													17	8	---	---	---	---	PASS
OR5AC2	81050	broad.mit.edu	37	3	97806719	97806719	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97806719G>T	uc011bgs.1	+	1	703	c.703G>T	c.(703-705)GGC>TGC	p.G235C		NM_054106	NP_473447	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC,	235	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						GTCTGAAAAGGGCAGAAGCAA	0.398													22	19	---	---	---	---	PASS
DCBLD2	131566	broad.mit.edu	37	3	98518583	98518583	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98518583G>T	uc003dtd.2	-	16	2324	c.1961C>A	c.(1960-1962)CCT>CAT	p.P654H	DCBLD2_uc003dte.2_Missense_Mutation_p.P668H	NM_080927	NP_563615	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	654	Cytoplasmic (Potential).				cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane				ovary(2)|central_nervous_system(1)	3						TGAGTTGTAAGGATCTAGGTC	0.468													5	72	---	---	---	---	PASS
BTLA	151888	broad.mit.edu	37	3	112198390	112198390	+	Silent	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112198390C>G	uc003dza.3	-	2	518	c.315G>C	c.(313-315)GTG>GTC	p.V105V	BTLA_uc003dzb.3_Silent_p.V105V	NM_181780	NP_861445	Q7Z6A9	BTLA_HUMAN	B and T lymphocyte associated isoform 1	105	Ig-like V-type.|Extracellular (Potential).			V -> M (in Ref. 1; AAP44003).	T cell costimulation		receptor activity				0		Acute lymphoblastic leukemia(4;1.34e-07)|all_hematologic(4;0.000361)				CATTAGGAAGCACTGGTTCAA	0.373													58	103	---	---	---	---	PASS
SIDT1	54847	broad.mit.edu	37	3	113304014	113304014	+	Intron	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113304014C>T	uc003eak.2	+						SIDT1_uc011bif.1_Intron|SIDT1_uc003eaj.1_Intron|SIDT1_uc011big.1_Intron	NM_017699	NP_060169	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1 precursor							integral to membrane				ovary(3)|pancreas(1)|skin(1)	5						AGTTGTTTCTCTCCCTTCAGA	0.438													10	111	---	---	---	---	PASS
ATP6V1A	523	broad.mit.edu	37	3	113524215	113524215	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113524215A>G	uc003eao.2	+	14	1670	c.1604A>G	c.(1603-1605)TAC>TGC	p.Y535C	ATP6V1A_uc011bik.1_Missense_Mutation_p.Y502C	NM_001690	NP_001681	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit A	535					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			ovary(2)|skin(1)	3						TGCCCATTCTACAAGACAGTA	0.363													21	35	---	---	---	---	PASS
IQCB1	9657	broad.mit.edu	37	3	121489331	121489331	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121489331T>C	uc010hre.1	-	15	1873	c.1658A>G	c.(1657-1659)CAT>CGT	p.H553R	IQCB1_uc003eek.2_Missense_Mutation_p.H420R|IQCB1_uc010hrf.1_RNA	NM_001023570	NP_001018864	Q15051	IQCB1_HUMAN	IQ motif containing B1 isoform a	553					cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding				0				GBM - Glioblastoma multiforme(114;0.0983)		GGTTGTGAGATGGGCCTGCTT	0.502													42	72	---	---	---	---	PASS
HEG1	57493	broad.mit.edu	37	3	124738345	124738345	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124738345C>A	uc003ehs.3	-	5	1417	c.1349G>T	c.(1348-1350)AGA>ATA	p.R450I	HEG1_uc011bke.1_Missense_Mutation_p.R450I	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN	HEG homolog 1 precursor	450	Extracellular (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(2)	2						CTCTCCACCTCTCATGGGTGC	0.507													7	250	---	---	---	---	PASS
MCM2	4171	broad.mit.edu	37	3	127327220	127327220	+	Intron	SNP	C	A	A	rs143438377	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127327220C>A	uc003ejp.2	+						MCM2_uc011bkm.1_Intron|MCM2_uc010hsl.2_Intron|MCM2_uc011bkn.1_Intron	NM_004526	NP_004517	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding			ovary(3)|skin(1)	4						GTGTGTCCCTCGCAGACCATC	0.577													7	266	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130305389	130305389	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130305389C>T	uc010htl.2	+	10	4041	c.4010C>T	c.(4009-4011)GCT>GTT	p.A1337V	COL6A6_uc003eni.3_5'UTR	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	1337	VWFA 7.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						GATGGACCTGCTGATTCAAGT	0.448													78	115	---	---	---	---	PASS
ESYT3	83850	broad.mit.edu	37	3	138189849	138189849	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138189849C>T	uc003esk.2	+	17	1947	c.1721C>T	c.(1720-1722)TCC>TTC	p.S574F	ESYT3_uc010hug.2_RNA	NM_031913	NP_114119	A0FGR9	ESYT3_HUMAN	family with sequence similarity 62 (C2 domain	574						integral to membrane|plasma membrane					0						AGCCTCATCTCCATGAGGCTG	0.597													11	67	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155208639	155208639	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155208639C>G	uc011bok.1	-	18	2567	c.2290G>C	c.(2290-2292)GAA>CAA	p.E764Q	PLCH1_uc011boj.1_Missense_Mutation_p.E764Q|PLCH1_uc011bol.1_Missense_Mutation_p.E746Q	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	764	C2.				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			ATTTCAACTTCAACAAAAGGG	0.299													11	39	---	---	---	---	PASS
PLD1	5337	broad.mit.edu	37	3	171377037	171377037	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171377037C>T	uc003fhs.2	-	21	2511	c.2395G>A	c.(2395-2397)GAT>AAT	p.D799N	PLD1_uc003fht.2_Missense_Mutation_p.D761N|PLD1_uc003fhu.3_Missense_Mutation_p.D93N|PLD1_uc003fhv.1_Missense_Mutation_p.D124N	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a	799	Catalytic.				cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GCAATGGCATCGCCTATCTTG	0.388													24	229	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			5	38	---	---	---	---	PASS
MAP3K13	9175	broad.mit.edu	37	3	185181425	185181425	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185181425C>A	uc010hyf.2	+	9	1632	c.1366C>A	c.(1366-1368)CGA>AGA	p.R456R	MAP3K13_uc011brt.1_Silent_p.R249R|MAP3K13_uc011bru.1_Silent_p.R312R|MAP3K13_uc003fpi.2_Silent_p.R456R|MAP3K13_uc010hyg.2_Silent_p.R146R	NM_004721	NP_004712	O43283	M3K13_HUMAN	mitogen-activated protein kinase kinase kinase	456					activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			ovary(2)|skin(1)	3	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			AGAACTGATTCGAAGGCGCAG	0.468													4	103	---	---	---	---	PASS
LSG1	55341	broad.mit.edu	37	3	194379714	194379714	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194379714C>G	uc003fui.2	-	7	1046	c.731G>C	c.(730-732)GGA>GCA	p.G244A		NM_018385	NP_060855	Q9H089	LSG1_HUMAN	large subunit GTPase 1	244					nuclear export|protein transport	Cajal body|endoplasmic reticulum	GTP binding|hydrolase activity				0	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		GGGAATGGCTCCGGCCAAAGC	0.463													47	153	---	---	---	---	PASS
WDR53	348793	broad.mit.edu	37	3	196281625	196281625	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196281625C>A	uc003fwt.2	-	4	1005	c.534G>T	c.(532-534)CAG>CAT	p.Q178H		NM_182627	NP_872433	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53	178										breast(1)|skin(1)	2	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		TTTCATCCTCCTGTAAATTTG	0.428													6	187	---	---	---	---	PASS
LRCH3	84859	broad.mit.edu	37	3	197592992	197592992	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197592992C>G	uc011bul.1	+	17	1780	c.1775C>G	c.(1774-1776)TCC>TGC	p.S592C	LRCH3_uc003fyj.1_Missense_Mutation_p.S592C|LRCH3_uc011bum.1_Missense_Mutation_p.S540C|LRCH3_uc011bun.1_Missense_Mutation_p.S438C|LRCH3_uc003fyk.2_Missense_Mutation_p.S187C	NM_032773	NP_116162	Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH)	592						extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		GTTCATCATTCCCCTGCATAT	0.368													25	50	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3208226	3208226	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3208226C>G	uc011bvq.1	+	44	5873	c.5728C>G	c.(5728-5730)CAG>GAG	p.Q1910E		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	1908					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TCCTTAGTGTCAGAACCTCCA	0.423													13	63	---	---	---	---	PASS
JAKMIP1	152789	broad.mit.edu	37	4	6043916	6043916	+	Silent	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6043916G>A	uc010idb.1	-	17	2553	c.2067C>T	c.(2065-2067)ACC>ACT	p.T689T	JAKMIP1_uc010idc.1_Silent_p.T504T|JAKMIP1_uc010idd.1_Intron	NM_001099433	NP_001092903	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						GCATCTTCTGGGTCAGGGCGG	0.557													28	38	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13601318	13601318	+	Silent	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13601318C>G	uc003gmz.1	-	10	7323	c.7206G>C	c.(7204-7206)GTG>GTC	p.V2402V	BOD1L_uc010idr.1_Silent_p.V1739V	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	2402							DNA binding			ovary(5)|breast(1)	6						CCTCGGTGCTCACTGCCAACA	0.587													5	120	---	---	---	---	PASS
LAP3	51056	broad.mit.edu	37	4	17590574	17590574	+	Silent	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17590574T>C	uc003gph.1	+	7	999	c.837T>C	c.(835-837)TTT>TTC	p.F279F		NM_015907	NP_056991	P28838	AMPL_HUMAN	leucine aminopeptidase 3	279					proteolysis	nucleus	aminopeptidase activity|magnesium ion binding|manganese ion binding|metalloexopeptidase activity|zinc ion binding				0						CCCTGGTGTTTGTTGGGAAAG	0.433													27	40	---	---	---	---	PASS
TBC1D19	55296	broad.mit.edu	37	4	26667970	26667970	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26667970G>T	uc003gsf.3	+	9	877	c.607G>T	c.(607-609)GAA>TAA	p.E203*	TBC1D19_uc010iew.2_Nonsense_Mutation_p.E203*|TBC1D19_uc011bxu.1_Nonsense_Mutation_p.E138*	NM_018317	NP_060787	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	203						intracellular	Rab GTPase activator activity			breast(1)	1		Breast(46;0.0503)				ATGCTTTGTGGAACTTGGCTT	0.343													12	54	---	---	---	---	PASS
GNPDA2	132789	broad.mit.edu	37	4	44705119	44705119	+	Silent	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44705119G>A	uc003gwy.2	-	7	967	c.810C>T	c.(808-810)TTC>TTT	p.F270F	GNPDA2_uc010iga.2_Silent_p.F236F|GNPDA2_uc011bzb.1_Silent_p.F200F	NM_138335	NP_612208	Q8TDQ7	GNPI2_HUMAN	glucosamine-6-phosphate deaminase 2	270					N-acetylglucosamine metabolic process	cytoplasm	glucosamine-6-phosphate deaminase activity|hydrolase activity			ovary(1)	1						CTTTCATACTGAATAGTGGAT	0.323													10	32	---	---	---	---	PASS
CLOCK	9575	broad.mit.edu	37	4	56316315	56316315	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56316315A>C	uc003haz.1	-	17	2217	c.1291T>G	c.(1291-1293)TCT>GCT	p.S431A	CLOCK_uc003hba.1_Missense_Mutation_p.S431A|CLOCK_uc010igu.1_5'Flank	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	431					circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			GAAGAGGCAGAAGGGGTTGGG	0.458													25	52	---	---	---	---	PASS
REST	5978	broad.mit.edu	37	4	57797217	57797217	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57797217G>T	uc003hch.2	+	4	2540	c.2193G>T	c.(2191-2193)ATG>ATT	p.M731I	REST_uc003hci.2_Missense_Mutation_p.M731I|REST_uc010ihf.2_Missense_Mutation_p.M405I	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	731	Pro-rich.				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)					CTGTTCAGATGGAGCTGTCTC	0.562													8	326	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66270172	66270172	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66270172G>T	uc003hcy.2	-	8	1903	c.1710C>A	c.(1708-1710)AGC>AGA	p.S570R	EPHA5_uc003hcx.2_Missense_Mutation_p.S502R|EPHA5_uc003hcz.2_Missense_Mutation_p.S570R|EPHA5_uc011cah.1_Missense_Mutation_p.S571R|EPHA5_uc011cai.1_Missense_Mutation_p.S571R|EPHA5_uc003hda.2_Missense_Mutation_p.S571R	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	570	Extracellular (Potential).				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						CAGGAATCTGGCTTTGATCGC	0.438										TSP Lung(17;0.13)			25	32	---	---	---	---	PASS
ALB	213	broad.mit.edu	37	4	74279238	74279238	+	Silent	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74279238C>T	uc003hgs.3	+	8	1018	c.945C>T	c.(943-945)GCC>GCT	p.A315A	ALB_uc003hgw.3_Silent_p.A123A|ALB_uc011cbe.1_5'UTR|ALB_uc003hgt.3_Silent_p.A315A|ALB_uc010iii.2_Silent_p.A200A|ALB_uc003hgu.3_Silent_p.A165A|ALB_uc003hgv.3_5'UTR|ALB_uc011cbf.1_Silent_p.A205A|ALB_uc010iij.2_RNA|ALB_uc003hgx.3_5'UTR	NM_000477	NP_000468	P02768	ALBU_HUMAN	albumin preproprotein	315	Albumin 2.				bile acid and bile salt transport|bile acid metabolic process|cellular response to starvation|hemolysis by symbiont of host erythrocytes|lipoprotein metabolic process|maintenance of mitochondrion location|negative regulation of apoptosis|platelet activation|platelet degranulation|sodium-independent organic anion transport|transmembrane transport	extracellular space|platelet alpha granule lumen|protein complex	antioxidant activity|chaperone binding|copper ion binding|DNA binding|drug binding|fatty acid binding|pyridoxal phosphate binding|toxin binding			ovary(3)|skin(3)	6	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		Acenocoumarol(DB01418)|Acitretin(DB00459)|Alfentanil(DB00802)|Aluminium(DB01370)|Auranofin(DB00995)|Bismuth(DB01402)|Captopril(DB01197)|Carboplatin(DB00958)|Cefalotin(DB00456)|Cefazolin(DB01327)|Cefonicid(DB01328)|Cefoperazone(DB01329)|Chlorpheniramine(DB01114)|Chlorpromazine(DB00477)|Ciprofloxacin(DB00537)|Clonazepam(DB01068)|Cloxacillin(DB01147)|Cytarabine(DB00987)|Dantrolene(DB01219)|Diclofenac(DB00586)|Diflunisal(DB00861)|Digitoxin(DB01396)|Estrone(DB00655)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Flurbiprofen(DB00712)|Gadobenate Dimeglumine(DB00743)|Gatifloxacin(DB01044)|Gliclazide(DB01120)|Halothane(DB01159)|Human Serum Albumin(DB00062)|Hyaluronidase(DB00070)|Ibuprofen(DB01050)|Insulin-detemir(DB01307)|Insulin-glargine(DB01308)|Iodipamide(DB04711)|Ketoprofen(DB01009)|Levamisole(DB00848)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Mefenamic acid(DB00784)|Mephenytoin(DB00532)|Methotrexate(DB00563)|Nortriptyline(DB00540)|Oxazepam(DB00842)|Paclitaxel(DB01229)|Phenprocoumon(DB00946)|Probenecid(DB01032)|Propofol(DB00818)|Pyridoxine(DB00165)|Salicyclic acid(DB00936)|Saquinavir(DB01232)|Serum albumin(DB00096)|Serum albumin iodonated(DB00064)|Sodium lauryl sulfate(DB00815)|Sucralfate(DB00364)|Sulfamethizole(DB00576)|Sulindac(DB00605)|Suprofen(DB00870)|Testosterone(DB00624)|Xanthophyll(DB00137)	ACTGCATTGCCGAAGTGGAAA	0.418													4	105	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85758247	85758247	+	Intron	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85758247G>A	uc003hpd.2	-						WDFY3_uc003hpf.2_Intron	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CGGTTTTCTGGAAAACAAGCC	0.358													6	8	---	---	---	---	PASS
TSPAN5	10098	broad.mit.edu	37	4	99408000	99408000	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99408000G>T	uc003hub.2	-	3	518	c.168C>A	c.(166-168)CTC>CTA	p.L56L	TSPAN5_uc011cdz.1_5'UTR	NM_005723	NP_005714	P62079	TSN5_HUMAN	transmembrane 4 superfamily member 9	56	Extracellular (Potential).					integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		CAAAGCCGCCGAGATCGGTGA	0.512													5	129	---	---	---	---	PASS
TACR3	6870	broad.mit.edu	37	4	104640772	104640772	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104640772C>A	uc003hxe.1	-	1	204	c.61G>T	c.(61-63)GCC>TCC	p.A21S		NM_001059	NP_001050	P29371	NK3R_HUMAN	tachykinin receptor 3	21	Extracellular (Potential).					integral to plasma membrane	tachykinin receptor activity			ovary(3)|lung(2)|breast(1)|skin(1)	7		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		AGGTTCACGGCGTCTGCACCC	0.677													7	18	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114257120	114257120	+	Silent	SNP	A	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114257120A>T	uc003ibe.3	+	30	3598	c.3498A>T	c.(3496-3498)CCA>CCT	p.P1166P	ANK2_uc003ibd.3_Silent_p.P1157P|ANK2_uc003ibf.3_Silent_p.P1166P|ANK2_uc011cgc.1_Silent_p.P342P|ANK2_uc003ibg.3_Silent_p.P161P|ANK2_uc003ibc.2_Silent_p.P1142P|ANK2_uc011cgb.1_Silent_p.P1181P	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	1133					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TGATTGGCCCAGAAGGAGGTG	0.567													28	48	---	---	---	---	PASS
PRDM5	11107	broad.mit.edu	37	4	121828652	121828652	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121828652T>C	uc003idn.2	-	2	404	c.154A>G	c.(154-156)ATG>GTG	p.M52V	PRDM5_uc003ido.2_Missense_Mutation_p.M52V|PRDM5_uc010ine.2_Missense_Mutation_p.M52V|PRDM5_uc010inf.2_Missense_Mutation_p.M52V|PRDM5_uc003idp.1_Missense_Mutation_p.M52V	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	52	SET.				histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						CTGTAATCCATATTTTCATCC	0.333													24	50	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123156042	123156042	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123156042C>G	uc003ieh.2	+	25	3483	c.3438C>G	c.(3436-3438)TTC>TTG	p.F1146L	KIAA1109_uc003iei.1_Missense_Mutation_p.F899L|KIAA1109_uc010ins.1_Missense_Mutation_p.F489L	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	1146					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						TAGATTTCTTCAAACTTGAAG	0.443													8	66	---	---	---	---	PASS
PHF17	79960	broad.mit.edu	37	4	129767537	129767537	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129767537G>T	uc003igk.2	+	4	426	c.146G>T	c.(145-147)AGG>ATG	p.R49M	PHF17_uc003igj.2_Missense_Mutation_p.R49M|PHF17_uc003igl.2_Missense_Mutation_p.R49M|PHF17_uc011cgy.1_Missense_Mutation_p.R49M|PHF17_uc003igm.2_Missense_Mutation_p.R49M	NM_199320	NP_955352	Q6IE81	JADE1_HUMAN	PHD finger protein 17 long isoform	49					apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding				0						CAGGTGTTTAGGACAGACCTG	0.468													6	113	---	---	---	---	PASS
TBC1D9	23158	broad.mit.edu	37	4	141592024	141592024	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141592024G>C	uc010ioj.2	-	7	1388	c.1116C>G	c.(1114-1116)ATC>ATG	p.I372M		NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	372						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TTCGGGTGCTGATGGATAAGG	0.433													27	125	---	---	---	---	PASS
FHDC1	85462	broad.mit.edu	37	4	153893693	153893693	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153893693G>T	uc003inf.2	+	10	1458	c.1383G>T	c.(1381-1383)AAG>AAT	p.K461N		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	461	FH2.				actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					AAGCAGTTAAGGTACATCTGG	0.383													6	100	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160267955	160267955	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160267955G>T	uc003iqg.3	+	19	3344	c.3034G>T	c.(3034-3036)GGT>TGT	p.G1012C		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	1012					cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		TAAGAATCCTGGTGACAAAAA	0.458													6	162	---	---	---	---	PASS
NEK1	4750	broad.mit.edu	37	4	170428227	170428227	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170428227C>A	uc003isb.1	-	21	2376	c.1884G>T	c.(1882-1884)AAG>AAT	p.K628N	NEK1_uc003isc.1_Missense_Mutation_p.K584N|NEK1_uc003isd.1_Missense_Mutation_p.K656N|NEK1_uc003ise.1_Missense_Mutation_p.K612N|NEK1_uc003isf.1_Missense_Mutation_p.K559N	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	628					cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		CATAAGCCTCCTTTCTCTTTC	0.358													16	18	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183245358	183245358	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183245358G>A	uc003ivd.1	+	1	222	c.185G>A	c.(184-186)AGA>AAA	p.R62K	ODZ3_uc010irv.1_Missense_Mutation_p.R62K	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	62	Cytoplasmic (Potential).|Teneurin N-terminal.				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		TACGGCAACAGAGTGAAGGAT	0.473													4	73	---	---	---	---	PASS
ZDHHC11	79844	broad.mit.edu	37	5	837482	837482	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:837482G>T	uc011cma.1	-	6	1282	c.898C>A	c.(898-900)CAG>AAG	p.Q300K	ZDHHC11_uc003jbj.2_RNA|ZDHHC11_uc010itd.1_RNA	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	300						integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GGTGGTACCTGGAGAACTCCT	0.483													6	134	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	22078737	22078737	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22078737C>A	uc010iuc.2	-	2	507	c.49G>T	c.(49-51)GGA>TGA	p.G17*	CDH12_uc011cno.1_Nonsense_Mutation_p.G17*|CDH12_uc003jgk.2_Nonsense_Mutation_p.G17*	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	17					adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						AGGAGACCTCCATCAAACAGA	0.453										HNSCC(59;0.17)			6	145	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	31983569	31983569	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31983569A>G	uc003jhl.2	+	3	1173	c.785A>G	c.(784-786)CAT>CGT	p.H262R	PDZD2_uc003jhm.2_Missense_Mutation_p.H262R|PDZD2_uc011cnx.1_Missense_Mutation_p.H88R	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	262					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						GGAAACGGCCATGTCTTTCAG	0.557													37	52	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32088214	32088214	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32088214G>A	uc003jhl.2	+	20	5048	c.4660G>A	c.(4660-4662)GAT>AAT	p.D1554N	PDZD2_uc003jhm.2_Missense_Mutation_p.D1554N	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	1554					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CATGTATGGCGATGCTGAGGA	0.542													20	50	---	---	---	---	PASS
UGT3A1	133688	broad.mit.edu	37	5	35955849	35955849	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35955849A>T	uc003jjv.1	-	6	1350	c.1193T>A	c.(1192-1194)ATG>AAG	p.M398K	UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Missense_Mutation_p.M398K|UGT3A1_uc011cor.1_Missense_Mutation_p.M364K	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	398	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TACTCGGACCATGTTTCCATG	0.478													38	59	---	---	---	---	PASS
NUP155	9631	broad.mit.edu	37	5	37350302	37350302	+	Silent	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37350302G>A	uc003jku.1	-	7	907	c.789C>T	c.(787-789)TTC>TTT	p.F263F	NUP155_uc003jkt.1_Silent_p.F204F|NUP155_uc010iuz.1_Silent_p.F263F	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1	263					carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AAGGAACAAGGAAAGAAAGTG	0.358													10	73	---	---	---	---	PASS
C9	735	broad.mit.edu	37	5	39316013	39316013	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39316013G>T	uc003jlv.3	-	6	823	c.734C>A	c.(733-735)CCC>CAC	p.P245H		NM_001737	NP_001728	P02748	CO9_HUMAN	complement component 9 precursor	245	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex					0	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			TGTTTCAGTGGGTGTAAATTT	0.333													5	64	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262343	45262343	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262343G>T	uc003jok.2	-	8	2378	c.2353C>A	c.(2353-2355)CCA>ACA	p.P785T		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	785	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GCGGAGAGTGGCCTGACTTCC	0.627													9	28	---	---	---	---	PASS
CCDC125	202243	broad.mit.edu	37	5	68616126	68616126	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68616126C>T	uc003jvv.1	-	1	285	c.242G>A	c.(241-243)AGC>AAC	p.S81N	CCDC125_uc003jvx.1_Missense_Mutation_p.S81N|CCDC125_uc003jvy.1_RNA|CCDC125_uc003jvw.2_5'UTR|CCDC125_uc003jvz.1_Missense_Mutation_p.S81N	NM_176816	NP_789786	Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	81						cytoplasm					0		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		ATCTTGCTGGCTCTTATGCTT	0.408													66	47	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70856009	70856009	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70856009C>G	uc003kbp.1	+	37	7704	c.7441C>G	c.(7441-7443)CCT>GCT	p.P2481A	BDP1_uc003kbq.1_RNA|BDP1_uc003kbr.1_RNA	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	2481					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TGATGCTGCTCCTAAGTCTCA	0.403													10	25	---	---	---	---	PASS
MCC	4163	broad.mit.edu	37	5	112363013	112363013	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112363013C>G	uc003kqj.3	-	17	3006	c.2476G>C	c.(2476-2478)GAA>CAA	p.E826Q	MCC_uc003kqk.3_RNA|MCC_uc003kql.3_Missense_Mutation_p.E1016Q	NM_002387	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 2	826					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		AGCGAAGTTTCATTGGTGTGT	0.532													13	28	---	---	---	---	PASS
FEM1C	56929	broad.mit.edu	37	5	114879045	114879045	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114879045G>C	uc003krb.1	-	2	708	c.146C>G	c.(145-147)GCC>GGC	p.A49G		NM_020177	NP_064562	Q96JP0	FEM1C_HUMAN	feminization 1 homolog a	49	ANK 2.					cytoplasm				breast(2)|ovary(1)	3		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		CCCATACCTGGCGGCCATCAA	0.507													17	6	---	---	---	---	PASS
AFAP1L1	134265	broad.mit.edu	37	5	148700003	148700003	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148700003G>A	uc003lqh.2	+	14	1806	c.1675G>A	c.(1675-1677)GAT>AAT	p.D559N	AFAP1L1_uc010jgy.2_Missense_Mutation_p.D559N|AFAP1L1_uc003lqi.1_Missense_Mutation_p.D174N	NM_152406	NP_689619	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	559							protein binding			breast(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTCTATGATGATGTTCCTTA	0.428													11	21	---	---	---	---	PASS
GABRA6	2559	broad.mit.edu	37	5	161116178	161116178	+	Intron	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161116178G>A	uc003lyu.2	+						GABRA6_uc003lyv.2_5'Flank	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ACCATGAGGTGAGGTTTCTCC	0.363										TCGA Ovarian(5;0.080)			19	12	---	---	---	---	PASS
GRM6	2916	broad.mit.edu	37	5	178413281	178413281	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178413281G>T	uc003mjr.2	-	8	2153	c.1974C>A	c.(1972-1974)GGC>GGA	p.G658G	GRM6_uc003mjq.2_5'Flank|GRM6_uc010jla.1_Silent_p.G241G|GRM6_uc003mjs.1_Silent_p.G278G	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	658	Helical; Name=3; (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		TCGTGCCCAGGCCCAGGAAGA	0.637													7	3	---	---	---	---	PASS
ZNF192	7745	broad.mit.edu	37	6	28116249	28116249	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28116249C>G	uc003nkn.1	+	2	248	c.64C>G	c.(64-66)CTT>GTT	p.L22V	ZNF192_uc010jqx.1_Missense_Mutation_p.L22V|ZNF192_uc010jqy.1_Translation_Start_Site|ZNF192_uc011dkz.1_Translation_Start_Site	NM_006298	NP_006289	Q15776	ZN192_HUMAN	zinc finger protein 192	22					viral reproduction	cytoplasm|nucleolus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TGAAGAGGATCTTGTAATCGT	0.502													13	57	---	---	---	---	PASS
GPX5	2880	broad.mit.edu	37	6	28499635	28499635	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28499635G>C	uc003nll.2	+	3	324	c.322G>C	c.(322-324)GAA>CAA	p.E108Q	GPX5_uc003nlm.2_Intron|GPX5_uc003nln.2_Intron	NM_001509	NP_001500	O75715	GPX5_HUMAN	glutathione peroxidase 5 isoform 1 precursor	108					lipid metabolic process|response to oxidative stress	extracellular region	glutathione peroxidase activity			skin(1)	1					Glutathione(DB00143)	TGGAAAGCAAGAACCAGGAGA	0.488													42	156	---	---	---	---	PASS
HLA-B	3106	broad.mit.edu	37	6	31322940	31322940	+	Missense_Mutation	SNP	G	T	T	rs9264619		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31322940G>T	uc003nth.2	-	5	1010	c.956C>A	c.(955-957)GCA>GAA	p.A319E	HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_5'Flank|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_RNA|HLA-B_uc003ntf.2_Intron|HLA-B_uc003ntg.1_Missense_Mutation_p.A198E|HLA-B_uc003nti.1_Intron	NM_005514	NP_005505	P01889	1B07_HUMAN	major histocompatibility complex, class I, B	319	Helical; (Potential).				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0						GACCACAACTGCTAGGACAGC	0.607									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				23	54	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38854590	38854590	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38854590G>C	uc003ooe.1	+	55	8232	c.7632G>C	c.(7630-7632)CAG>CAC	p.Q2544H		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TTGTGCGACAGATGATGGAAA	0.378													18	56	---	---	---	---	PASS
C6orf153	88745	broad.mit.edu	37	6	42996841	42996841	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42996841C>A	uc003otp.1	+	7	663	c.655C>A	c.(655-657)CAG>AAG	p.Q219K		NM_033112	NP_149103	Q96EU6	RRP36_HUMAN	hypothetical protein LOC88745	219					ribosomal small subunit biogenesis|rRNA processing	nucleolus					0			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TGAGCAGCGCCAGTTGGCACT	0.483													7	222	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72975123	72975123	+	Silent	SNP	A	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72975123A>G	uc003pga.2	+	21	3302	c.3225A>G	c.(3223-3225)AAA>AAG	p.K1075K	RIMS1_uc011dyb.1_Intron|RIMS1_uc003pgc.2_Intron|RIMS1_uc010kaq.2_Intron|RIMS1_uc011dyc.1_Intron|RIMS1_uc010kar.2_Intron|RIMS1_uc011dyd.1_Intron|RIMS1_uc003pgf.2_Intron|RIMS1_uc003pgg.2_Intron|RIMS1_uc003pgi.2_Intron|RIMS1_uc003pgh.2_Intron|RIMS1_uc003pgd.2_Intron|RIMS1_uc003pge.2_Intron|RIMS1_uc011dye.1_Intron|RIMS1_uc011dyf.1_Intron|RIMS1_uc010kas.1_Intron	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1075					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CTAAGACCAAATCAGTGACTA	0.289													27	28	---	---	---	---	PASS
FILIP1	27145	broad.mit.edu	37	6	76023089	76023089	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76023089G>C	uc003pia.2	-	5	2832	c.2459C>G	c.(2458-2460)CCA>CGA	p.P820R	FILIP1_uc003phy.1_Missense_Mutation_p.P820R|FILIP1_uc003phz.2_Missense_Mutation_p.P721R|FILIP1_uc010kbe.2_Missense_Mutation_p.P823R|FILIP1_uc003pib.1_Missense_Mutation_p.P572R	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	820										skin(3)|ovary(1)	4						GAATACAGCTGGCGTTTCTTC	0.463													5	133	---	---	---	---	PASS
IBTK	25998	broad.mit.edu	37	6	82882108	82882108	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82882108C>A	uc003pjl.1	-	28	4446	c.3919G>T	c.(3919-3921)GCT>TCT	p.A1307S	IBTK_uc011dyu.1_Missense_Mutation_p.A258S|IBTK_uc011dyv.1_Missense_Mutation_p.A1292S|IBTK_uc011dyw.1_Missense_Mutation_p.A1106S|IBTK_uc010kbi.1_Missense_Mutation_p.A1001S	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	1307					negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		TGAATCAGAGCCAACGGTTTT	0.373													5	31	---	---	---	---	PASS
IBTK	25998	broad.mit.edu	37	6	82882109	82882109	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82882109C>A	uc003pjl.1	-	28	4445	c.3918G>T	c.(3916-3918)TTG>TTT	p.L1306F	IBTK_uc011dyu.1_Missense_Mutation_p.L257F|IBTK_uc011dyv.1_Missense_Mutation_p.L1291F|IBTK_uc011dyw.1_Missense_Mutation_p.L1105F|IBTK_uc010kbi.1_Missense_Mutation_p.L1000F	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	1306					negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		GAATCAGAGCCAACGGTTTTT	0.368													5	30	---	---	---	---	PASS
IBTK	25998	broad.mit.edu	37	6	82922461	82922461	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82922461T>C	uc003pjl.1	-	13	2781	c.2254A>G	c.(2254-2256)AAC>GAC	p.N752D	IBTK_uc011dyv.1_Missense_Mutation_p.N752D|IBTK_uc011dyw.1_Missense_Mutation_p.N551D|IBTK_uc010kbi.1_Missense_Mutation_p.N446D|IBTK_uc003pjm.2_Missense_Mutation_p.N752D	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	752					negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		TTACCAGTGTTCTTGGCAATA	0.299													6	32	---	---	---	---	PASS
QRSL1	55278	broad.mit.edu	37	6	107111000	107111000	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107111000G>C	uc003prm.2	+	10	1422	c.1306G>C	c.(1306-1308)GAG>CAG	p.E436Q		NM_018292	NP_060762	Q9H0R6	QRSL1_HUMAN	glutaminyl-tRNA synthase	436					translation		ATP binding|carbon-nitrogen ligase activity, with glutamine as amido-N-donor				0	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;0.00768)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.248)	Epithelial(6;0.000334)|all cancers(7;0.00157)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0152)	BRCA - Breast invasive adenocarcinoma(108;0.118)|all cancers(137;0.167)|Epithelial(106;0.176)		GTTCATCAAAGAGGACAACAG	0.413													13	29	---	---	---	---	PASS
SESN1	27244	broad.mit.edu	37	6	109308743	109308743	+	3'UTR	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109308743G>T	uc003pst.3	-	10					SESN1_uc003psu.2_3'UTR	NM_014454	NP_055269	Q9Y6P5	SESN1_HUMAN	sestrin 1						cell cycle arrest|negative regulation of cell proliferation|response to DNA damage stimulus	nucleus				ovary(1)	1		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		ATGAAGGAAAGGCATCAGGTC	0.403													6	59	---	---	---	---	PASS
RFX6	222546	broad.mit.edu	37	6	117232210	117232210	+	Intron	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117232210C>G	uc003pxm.2	+							NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6						glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						GACAAGGTATCAATTACAGAT	0.393													15	44	---	---	---	---	PASS
MAN1A1	4121	broad.mit.edu	37	6	119515060	119515060	+	Intron	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119515060G>T	uc003pym.1	-							NM_005907	NP_005898	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1						post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum|ER-Golgi intermediate compartment|Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		TACATGATCTGGAAAGAGAGG	0.398													5	44	---	---	---	---	PASS
FAM54A	113115	broad.mit.edu	37	6	136560824	136560824	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136560824G>C	uc010kgp.1	-	6	1039	c.649C>G	c.(649-651)CAG>GAG	p.Q217E	FAM54A_uc003qgt.1_Missense_Mutation_p.Q217E|FAM54A_uc003qgu.1_Missense_Mutation_p.Q174E	NM_001099286	NP_001092756	Q6P444	FA54A_HUMAN	DUF729 domain containing 1	217	Pro-rich.									skin(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00228)|OV - Ovarian serous cystadenocarcinoma(155;0.00504)		GATGAAAACTgaggaggaagt	0.408													7	29	---	---	---	---	PASS
NUP43	348995	broad.mit.edu	37	6	150067096	150067096	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150067096C>A	uc003qmz.2	-	2	280	c.223G>T	c.(223-225)GGT>TGT	p.G75C	NUP43_uc011eee.1_RNA|NUP43_uc011eef.1_Missense_Mutation_p.G75C	NM_198887	NP_942590	Q8NFH3	NUP43_HUMAN	nucleoporin 43kDa	75	WD 2.				carbohydrate metabolic process|cell division|chromosome segregation|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	protein binding			upper_aerodigestive_tract(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;4.71e-13)|GBM - Glioblastoma multiforme(68;0.101)		ATTACATCACCATGGTGTCTG	0.353													84	74	---	---	---	---	PASS
C6orf211	79624	broad.mit.edu	37	6	151773689	151773689	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151773689C>A	uc003qok.1	+	1	268	c.9C>A	c.(7-9)GTC>GTA	p.V3V	C6orf211_uc011ees.1_5'UTR|RMND1_uc003qoi.2_5'Flank	NM_024573	NP_078849	Q9H993	CF211_HUMAN	hypothetical protein LOC79624	3							protein binding				0			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		TGATGGCTGTCGTCCCGGCGT	0.632													15	67	---	---	---	---	PASS
MYCT1	80177	broad.mit.edu	37	6	153042995	153042995	+	Silent	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153042995G>A	uc003qpd.3	+	2	323	c.315G>A	c.(313-315)CAG>CAA	p.Q105Q	MYCT1_uc010kjc.1_Intron|MYCT1_uc003qpc.3_Silent_p.Q105Q	NM_025107	NP_079383	Q8N699	MYCT1_HUMAN	myc target 1	105	Bipartite nuclear localization signal (Potential).					nucleus				ovary(1)	1		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		CCATCTCACAGTGGAGTTCAA	0.507													82	54	---	---	---	---	PASS
SLC22A1	6580	broad.mit.edu	37	6	160553335	160553335	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160553335C>A	uc003qtc.2	+	3	692	c.587C>A	c.(586-588)TCG>TAG	p.S196*	SLC22A1_uc003qtd.2_Nonsense_Mutation_p.S196*	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a	196	Helical; (Potential).					basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		ATGGCCTTCTCGCCCAACTAC	0.577													5	155	---	---	---	---	PASS
AMZ1	155185	broad.mit.edu	37	7	2740387	2740387	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2740387T>C	uc003smr.1	+	2	663	c.302T>C	c.(301-303)ATA>ACA	p.I101T	AMZ1_uc003sms.1_Missense_Mutation_p.I101T|AMZ1_uc011jwa.1_5'Flank	NM_133463	NP_597720	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	101							metallopeptidase activity|zinc ion binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		CTACAGCCGATAGGTACGGGA	0.632													14	19	---	---	---	---	PASS
MRPL32	64983	broad.mit.edu	37	7	42972006	42972006	+	Silent	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42972006C>G	uc003tia.2	+	1	68	c.21C>G	c.(19-21)GTC>GTG	p.V7V	C7orf25_uc010kxr.2_5'Flank|PSMA2_uc003thy.2_5'Flank|PSMA2_uc010kxt.2_5'Flank|PSMA2_uc003thz.1_5'Flank|MRPL32_uc003tib.2_RNA|MRPL32_uc003tic.2_5'UTR	NM_031903	NP_114109	Q9BYC8	RM32_HUMAN	mitochondrial ribosomal protein L32 precursor	7					translation	large ribosomal subunit|mitochondrial ribosome	structural constituent of ribosome				0						CCATGCTGGTCTTGGTGGTTT	0.652													15	19	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88963091	88963091	+	Silent	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88963091C>T	uc011khi.1	+	4	1333	c.795C>T	c.(793-795)TGC>TGT	p.C265C		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	265						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AGTGCAAGTGCTGCAGGTTTG	0.368										HNSCC(36;0.09)			19	19	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98506544	98506544	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98506544G>C	uc003upp.2	+	14	1518	c.1309G>C	c.(1309-1311)GAG>CAG	p.E437Q	TRRAP_uc011kis.1_Missense_Mutation_p.E437Q|TRRAP_uc003upr.2_Missense_Mutation_p.E129Q	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	437					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GAGCGAGCAGGAGAGTGGCAA	0.542													3	31	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103629586	103629586	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103629586T>G	uc003vca.2	-	1	378	c.218A>C	c.(217-219)GAA>GCA	p.E73A	RELN_uc010liz.2_Missense_Mutation_p.E73A	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	73	Reelin.				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACCATGGTATTCTTGTCCCGG	0.642													20	23	---	---	---	---	PASS
LAMB4	22798	broad.mit.edu	37	7	107706244	107706244	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107706244G>T	uc010ljo.1	-	21	2883	c.2799C>A	c.(2797-2799)AGC>AGA	p.S933R	LAMB4_uc003vey.2_Missense_Mutation_p.S933R|LAMB4_uc010ljp.1_5'Flank	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	933	Laminin EGF-like 9.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						TTACATCTGAGCTCCACAGAT	0.418													20	66	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119915186	119915186	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119915186C>T	uc003vjj.1	+	1	1465	c.500C>T	c.(499-501)GCA>GTA	p.A167V		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	167	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					ACCATGACTGCAAGGCAGAGG	0.607													13	37	---	---	---	---	PASS
C7orf45	136263	broad.mit.edu	37	7	129855864	129855864	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129855864C>T	uc003vpp.2	+	3	336	c.289C>T	c.(289-291)CCC>TCC	p.P97S		NM_145268	NP_660311	Q8WWF3	CG045_HUMAN	hypothetical protein LOC136263	97						integral to membrane					0	Melanoma(18;0.0435)					TGCCTGGGATCCCTCACAAAC	0.428													32	50	---	---	---	---	PASS
TSGA13	114960	broad.mit.edu	37	7	130353950	130353950	+	Missense_Mutation	SNP	C	A	A	rs149212840		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130353950C>A	uc003vqi.2	-	8	1189	c.732G>T	c.(730-732)TTG>TTT	p.L244F	COPG2_uc003vqh.1_5'Flank|TSGA13_uc003vqj.2_Missense_Mutation_p.L244F	NM_052933	NP_443165	Q96PP4	TSG13_HUMAN	testis specific, 13	244										ovary(2)	2	Melanoma(18;0.0435)					GCATGTCTTCCAAGAGCGATG	0.582													5	54	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142224031	142224031	+	Intron	SNP	A	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142224031A>C	uc011krp.1	+						uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron|uc003vyi.2_Missense_Mutation_p.S46A					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		GCATGGCCAGAAATAGGATCA	0.483													22	29	---	---	---	---	PASS
AMAC1L2	83650	broad.mit.edu	37	8	11189484	11189484	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11189484T>C	uc003wtp.1	+	1	990	c.869T>C	c.(868-870)GTG>GCG	p.V290A		NM_054028	NP_473369	Q96KT7	AMCL2_HUMAN	acyl-malonyl condensing enzyme	290	DUF6 2.|Helical; (Potential).					integral to membrane					0			STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)		CATTCCGAGGTGGTTGTGGCC	0.577													7	53	---	---	---	---	PASS
PSD3	23362	broad.mit.edu	37	8	18730071	18730071	+	Silent	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18730071G>A	uc003wza.2	-	3	406	c.303C>T	c.(301-303)CAC>CAT	p.H101H		NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN	ADP-ribosylation factor guanine nucleotide	101					regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		CGAGCCCAGAGTGGCAGCCAG	0.522													11	15	---	---	---	---	PASS
XPO7	23039	broad.mit.edu	37	8	21856683	21856683	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21856683C>A	uc003xaa.3	+	23	2612	c.2510C>A	c.(2509-2511)TCC>TAC	p.S837Y	XPO7_uc010lti.2_Missense_Mutation_p.S846Y|XPO7_uc010ltk.2_Missense_Mutation_p.S838Y	NM_015024	NP_055839	Q9UIA9	XPO7_HUMAN	exportin 7 isoform b	837					mRNA transport|protein export from nucleus|transmembrane transport	cytoplasm|nuclear pore	nuclear export signal receptor activity|protein transporter activity			ovary(1)|kidney(1)|breast(1)|central_nervous_system(1)|pancreas(1)	5				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		ATCTGCTTCTCCATGCTGAAG	0.502													8	304	---	---	---	---	PASS
SLC25A37	51312	broad.mit.edu	37	8	23423786	23423786	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23423786G>C	uc003xdo.2	+	2	529	c.376G>C	c.(376-378)GAA>CAA	p.E126Q	SLC25A37_uc003xdn.1_Missense_Mutation_p.E126Q|SLC25A37_uc003xdp.2_RNA|SLC25A37_uc010ltz.2_RNA|SLC25A37_uc003xdq.2_5'Flank	NM_016612	NP_057696	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25, member 37	126	Solcar 1.				ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		TGCCTGCTATGAAAACATGAA	0.488													17	64	---	---	---	---	PASS
SCARA5	286133	broad.mit.edu	37	8	27737097	27737097	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27737097C>G	uc003xgj.2	-	8	1780	c.1340G>C	c.(1339-1341)CGA>CCA	p.R447P	SCARA5_uc010luz.2_Missense_Mutation_p.R222P	NM_173833	NP_776194	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	447	SRCR.|Extracellular (Potential).				cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity			central_nervous_system(1)|skin(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		TTGCCCGAATCGAGCTGTGCG	0.527													10	65	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55539799	55539799	+	Silent	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55539799T>C	uc003xsd.1	+	4	3505	c.3357T>C	c.(3355-3357)TCT>TCC	p.S1119S	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1119					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CCTTTCATTCTGCAATATGTA	0.423													14	33	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61749418	61749418	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61749418C>A	uc003xue.2	+	17	4509	c.4032C>A	c.(4030-4032)CTC>CTA	p.L1344L		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1344	Helicase C-terminal.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GAGGCAACCTCCGCCAGGCAG	0.498													7	167	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77618478	77618478	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77618478C>T	uc003yav.2	+	2	2542	c.2155C>T	c.(2155-2157)CAG>TAG	p.Q719*	ZFHX4_uc003yat.1_Nonsense_Mutation_p.Q719*|ZFHX4_uc003yau.1_Nonsense_Mutation_p.Q719*|ZFHX4_uc003yaw.1_Nonsense_Mutation_p.Q719*	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	719	C2H2-type 3.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TATTCATATGCAGTCGGACAA	0.517										HNSCC(33;0.089)			19	36	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89086966	89086966	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89086966C>G	uc003yeb.3	-	7	1371	c.1089G>C	c.(1087-1089)CAG>CAC	p.Q363H	MMP16_uc003yec.2_Missense_Mutation_p.Q363H	NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	363	Extracellular (Potential).|Hemopexin-like 1.				collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						GCCAAAACCACTGGTCCTGCA	0.493													51	90	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103299702	103299702	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103299702C>G	uc003ykr.1	-	37	4949	c.4916G>C	c.(4915-4917)CGC>CCC	p.R1639P	UBR5_uc003yks.1_Missense_Mutation_p.R1639P	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	1639					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			AACGCTTCTGCGCCCACTAGC	0.443													25	40	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	105235977	105235977	+	Intron	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105235977C>T	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GAGGCACTGGCCGGCTACTTT	0.632										HNSCC(12;0.0054)			9	9	---	---	---	---	PASS
EIF3E	3646	broad.mit.edu	37	8	109215290	109215290	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109215290C>A	uc003ymu.2	-	12	1249	c.1221G>T	c.(1219-1221)AAG>AAT	p.K407N	EIF3E_uc003ymt.2_Missense_Mutation_p.K358N|EIF3E_uc003ymv.2_Missense_Mutation_p.K314N	NM_001568	NP_001559	P60228	EIF3E_HUMAN	eukaryotic translation initiation factor 3,	407	Sufficient for interaction with MCM7.				negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			GGCTTTTGGTCTTTTCAATCA	0.388													34	48	---	---	---	---	PASS
WDR67	93594	broad.mit.edu	37	8	124146370	124146370	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124146370G>T	uc003ypp.1	+	17	2513	c.2423G>T	c.(2422-2424)CGA>CTA	p.R808L	WDR67_uc011lig.1_Intron|WDR67_uc011lih.1_Missense_Mutation_p.R698L|WDR67_uc003ypq.1_RNA|WDR67_uc003yps.1_Missense_Mutation_p.R442L|WDR67_uc003ypt.1_Missense_Mutation_p.R265L|WDR67_uc003ypu.1_Missense_Mutation_p.R265L	NM_145647	NP_663622	Q96DN5	WDR67_HUMAN	WD repeat domain 67 isoform 1	808	Potential.					centrosome	Rab GTPase activator activity			skin(1)	1	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			ATGAGAGATCGAGAAATTGCT	0.328													6	134	---	---	---	---	PASS
CYP11B2	1585	broad.mit.edu	37	8	143995723	143995723	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143995723A>G	uc003yxk.1	-	5	914	c.911T>C	c.(910-912)ATC>ACC	p.I304T		NM_000498	NP_000489	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B,	304					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity				0	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Candesartan(DB00796)|Metyrapone(DB01011)	GTTGGCCTTGATGGCTTCTAG	0.587									Familial_Hyperaldosteronism_type_I				16	26	---	---	---	---	PASS
PARP10	84875	broad.mit.edu	37	8	145058587	145058587	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145058587G>A	uc003zal.3	-	6	1579	c.1471C>T	c.(1471-1473)CAG>TAG	p.Q491*	PARP10_uc003zak.3_Nonsense_Mutation_p.Q197*|PARP10_uc011lku.1_Nonsense_Mutation_p.Q503*|PARP10_uc011lkv.1_RNA|PARP10_uc003zam.2_Nonsense_Mutation_p.Q491*	NM_032789	NP_116178	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	491						Golgi apparatus|nucleolus	NAD+ ADP-ribosyltransferase activity|nucleotide binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)|pancreas(1)	6	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAGGAAGCCTGGGCTCCACAG	0.602													8	17	---	---	---	---	PASS
MFSD3	113655	broad.mit.edu	37	8	145736173	145736173	+	Intron	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145736173C>A	uc003zdi.1	+							NM_138431	NP_612440	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane				central_nervous_system(2)	2	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TTCTGCCCTCCCAGGGTCAGC	0.637													5	37	---	---	---	---	PASS
GLDC	2731	broad.mit.edu	37	9	6604779	6604779	+	Silent	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6604779C>T	uc003zkc.2	-	7	1060	c.867G>A	c.(865-867)CTG>CTA	p.L289L		NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	289					glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	CACAGCAGGCCAGGCTCTAGA	0.502													89	53	---	---	---	---	PASS
HAUS6	54801	broad.mit.edu	37	9	19058888	19058888	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19058888G>T	uc003znk.2	-	16	2130	c.1877C>A	c.(1876-1878)CCT>CAT	p.P626H	HAUS6_uc011lmz.1_Missense_Mutation_p.P346H|HAUS6_uc003znl.1_Missense_Mutation_p.P490H	NM_017645	NP_060115	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	626					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2						GTGCAACACAGGTAATGATTC	0.363													5	21	---	---	---	---	PASS
SMU1	55234	broad.mit.edu	37	9	33053169	33053169	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33053169C>A	uc003zsf.1	-	10	1350	c.1242G>T	c.(1240-1242)GTG>GTT	p.V414V	SMU1_uc010mjo.1_Silent_p.V414V|SMU1_uc010mjp.1_Intron|SMU1_uc011lnu.1_Silent_p.V253V	NM_018225	NP_060695	Q2TAY7	SMU1_HUMAN	smu-1 suppressor of mec-8 and unc-52 homolog	414	WD 5.					cytoplasm|nucleus				ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)		TGTTGCACACCACAAAGTGCT	0.483													6	127	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73736162	73736162	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73736162G>T	uc004aid.2	-	1	353	c.109C>A	c.(109-111)CGA>AGA	p.R37R	TRPM3_uc004aic.2_Silent_p.R37R|TRPM3_uc010mor.2_Silent_p.R37R|TRPM3_uc004aii.2_Intron	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	37	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						TTTAGGGGTCGAGGAGCATCA	0.498													5	65	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79896842	79896842	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79896842G>T	uc004akr.2	+	28	3224	c.2964G>T	c.(2962-2964)AAG>AAT	p.K988N	VPS13A_uc004akp.3_Missense_Mutation_p.K988N|VPS13A_uc004akq.3_Missense_Mutation_p.K988N|VPS13A_uc004aks.2_Missense_Mutation_p.K988N	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	988					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						AATTGATTAAGGTATGAGTAG	0.259													13	2	---	---	---	---	PASS
IPPK	64768	broad.mit.edu	37	9	95400369	95400369	+	Missense_Mutation	SNP	C	T	T	rs148738677		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95400369C>T	uc004asl.1	-	9	1107	c.830G>A	c.(829-831)CGG>CAG	p.R277Q	IPPK_uc004ask.1_5'Flank	NM_022755	NP_073592	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	277					inositol or phosphatidylinositol phosphorylation	cytoplasm|nucleus	ATP binding|inositol pentakisphosphate 2-kinase activity			ovary(2)	2						GGTGCCTGCCCGGCCCTTGTC	0.682													7	4	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109685872	109685872	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109685872G>C	uc004bcz.2	+	2	497	c.208G>C	c.(208-210)GAA>CAA	p.E70Q	ZNF462_uc010mto.2_5'Flank|ZNF462_uc004bda.2_5'Flank	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	70					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						TGCCATTGCAGAAGATTTATC	0.403													7	57	---	---	---	---	PASS
DAB2IP	153090	broad.mit.edu	37	9	124545804	124545804	+	Intron	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124545804T>C	uc004bln.2	+						DAB2IP_uc004blp.2_Intron	NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform						activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2						TGATTTTTTTTCCTTTCACAG	0.468													19	51	---	---	---	---	PASS
FNBP1	23048	broad.mit.edu	37	9	132689609	132689609	+	Silent	SNP	C	T	T	rs41279170		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132689609C>T	uc004byw.1	-	8	873	c.654G>A	c.(652-654)GAG>GAA	p.E218E	FNBP1_uc011mbv.1_Silent_p.E218E|FNBP1_uc011mbw.1_Silent_p.E218E|FNBP1_uc004bza.2_Silent_p.E218E|FNBP1_uc004byz.1_Silent_p.E218E|FNBP1_uc004byx.1_Silent_p.E139E|FNBP1_uc004byy.1_Silent_p.E139E	NM_015033	NP_055848	Q96RU3	FNBP1_HUMAN	formin binding protein 1	218	Interaction with microtubules (By similarity).|Self-association, lipid-binding and induction of membrane tubulation.				endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|lysosome|plasma membrane	identical protein binding|lipid binding				0		Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		TTTCCTCCATCTCTTGTATTT	0.393			T	MLL	AML								38	137	---	---	---	---	PASS
C9orf171	389799	broad.mit.edu	37	9	135357713	135357713	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135357713C>A	uc004cbn.2	+	2	260	c.212C>A	c.(211-213)TCG>TAG	p.S71*	C9orf171_uc004cbo.2_Intron	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799	71										ovary(4)|large_intestine(1)	5						GGCCCGGCCTCGGTGGGAACC	0.522													4	35	---	---	---	---	PASS
FCN1	2219	broad.mit.edu	37	9	137802992	137802992	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137802992G>T	uc004cfi.2	-	8	812	c.720C>A	c.(718-720)GTC>GTA	p.V240V		NM_002003	NP_001994	O00602	FCN1_HUMAN	ficolin 1 precursor	240	Fibrinogen C-terminal.				opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|receptor binding|sugar binding			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		CACTGCCCCCGACAAAGGCTC	0.468													5	150	---	---	---	---	PASS
NET1	10276	broad.mit.edu	37	10	5494346	5494346	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5494346G>C	uc001iia.2	+	5	527	c.389G>C	c.(388-390)AGA>ACA	p.R130T	NET1_uc010qar.1_5'UTR|NET1_uc001iib.2_Missense_Mutation_p.R76T|NET1_uc010qas.1_5'UTR	NM_001047160	NP_001040625	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming gene 1 isoform	130					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell growth|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	Rho guanyl-nucleotide exchange factor activity			breast(1)	1						GGTGACCACAGATCCCCAGCC	0.428													5	16	---	---	---	---	PASS
PRKCQ	5588	broad.mit.edu	37	10	6549443	6549443	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6549443G>C	uc001ijj.1	-	4	409	c.334C>G	c.(334-336)CAA>GAA	p.Q112E	PRKCQ_uc009xim.1_Missense_Mutation_p.Q112E|PRKCQ_uc001iji.1_Missense_Mutation_p.Q145E|PRKCQ_uc009xin.1_Missense_Mutation_p.Q76E|PRKCQ_uc010qax.1_Intron	NM_006257	NP_006248	Q04759	KPCT_HUMAN	protein kinase C, theta	112	C2.				axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6						ATTCGGCCTTGAGGTTTCAGC	0.478													37	117	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25888200	25888200	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25888200G>T	uc001isj.2	+	11	3705	c.3645G>T	c.(3643-3645)GTG>GTT	p.V1215V	GPR158_uc001isk.2_Silent_p.V590V	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	1215	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						GTTTTAAAGTGTAGCATCTCC	0.418													12	32	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29821624	29821624	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29821624G>T	uc001iut.1	-	8	2425	c.1672C>A	c.(1672-1674)CAG>AAG	p.Q558K	SVIL_uc001iuu.1_Intron|SVIL_uc009xld.1_Missense_Mutation_p.Q558K	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	558					cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				TTCAAGGCCTGGAGCTGAGGG	0.572													5	70	---	---	---	---	PASS
ZEB1	6935	broad.mit.edu	37	10	31812972	31812972	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31812972G>C	uc001ivs.3	+	8	2776	c.2713G>C	c.(2713-2715)GCT>CCT	p.A905P	ZEB1_uc001ivr.3_Missense_Mutation_p.A687P|ZEB1_uc010qee.1_Missense_Mutation_p.A687P|ZEB1_uc010qef.1_Missense_Mutation_p.A687P|ZEB1_uc009xlk.1_Missense_Mutation_p.A687P|ZEB1_uc001ivt.3_Missense_Mutation_p.A687P|ZEB1_uc001ivu.3_Missense_Mutation_p.A906P|ZEB1_uc001ivv.3_Missense_Mutation_p.A885P|ZEB1_uc010qeh.1_Missense_Mutation_p.A838P|ZEB1_uc009xlp.2_Missense_Mutation_p.A889P	NM_030751	NP_110378	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b	905	C2H2-type 5.		A -> T (in FECD6).		cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)				TGGAATGTATGCTTGTGATTT	0.368													10	51	---	---	---	---	PASS
RPP30	10556	broad.mit.edu	37	10	92660332	92660332	+	Missense_Mutation	SNP	A	G	G	rs139597628		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92660332A>G	uc009xtx.2	+	11	738	c.703A>G	c.(703-705)AGA>GGA	p.R235G	RPP30_uc001khd.2_Missense_Mutation_p.R235G	NM_006413	NP_006404	P78346	RPP30_HUMAN	ribonuclease P/MRP 30kDa subunit isoform b	235					tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity				0						TACAGAAACTAGAAAAACTGC	0.383													84	50	---	---	---	---	PASS
LGI1	9211	broad.mit.edu	37	10	95557020	95557020	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95557020G>T	uc001kjc.3	+	8	1470	c.1134G>T	c.(1132-1134)AGG>AGT	p.R378S	LGI1_uc010qnv.1_Missense_Mutation_p.R330S|LGI1_uc001kjd.3_Intron|LGI1_uc009xui.2_RNA|LGI1_uc001kje.2_Intron	NM_005097	NP_005088	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1 precursor	378	EAR 4.				axon guidance|cell proliferation|positive regulation of cell growth|positive regulation of synaptic transmission	cell junction|extracellular space|synapse	receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4		Colorectal(252;0.124)				CGTGGTACAGGGACACTGATG	0.418													5	36	---	---	---	---	PASS
PLCE1	51196	broad.mit.edu	37	10	95931253	95931253	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95931253G>T	uc001kjk.2	+	4	2443	c.1809G>T	c.(1807-1809)GAG>GAT	p.E603D	PLCE1_uc010qnx.1_Missense_Mutation_p.E603D|PLCE1_uc001kjm.2_Missense_Mutation_p.E295D	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	603	Ras-GEF.				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				GGTTTAATGAGGTAAGAAGCC	0.453													17	16	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115350345	115350345	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115350345G>A	uc001laj.2	-	40	5112	c.4948C>T	c.(4948-4950)CAG>TAG	p.Q1650*	NRAP_uc009xyb.2_Nonsense_Mutation_p.Q403*|NRAP_uc001lak.2_Nonsense_Mutation_p.Q1615*|NRAP_uc001lal.3_Nonsense_Mutation_p.Q1650*	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	1650	Nebulin 44.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		ACATCACTCTGCAGCTGGTGG	0.622													5	18	---	---	---	---	PASS
TDRD1	56165	broad.mit.edu	37	10	115970710	115970710	+	Silent	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115970710T>C	uc001lbg.1	+	13	1797	c.1644T>C	c.(1642-1644)TGT>TGC	p.C548C	TDRD1_uc001lbf.2_Silent_p.C539C|TDRD1_uc001lbh.1_Silent_p.C539C|TDRD1_uc001lbi.1_Silent_p.C539C|TDRD1_uc010qsc.1_Silent_p.C209C|TDRD1_uc001lbj.2_Silent_p.C257C	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	548	Tudor 2.				DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GTGATATATGTTGTGCTCAGT	0.353													9	41	---	---	---	---	PASS
GLRX3	10539	broad.mit.edu	37	10	131958268	131958268	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131958268G>A	uc001lkm.1	+	3	233	c.211G>A	c.(211-213)GAA>AAA	p.E71K	GLRX3_uc001lkn.1_Missense_Mutation_p.E71K|GLRX3_uc001lko.2_RNA	NM_006541	NP_006532	O76003	GLRX3_HUMAN	glutaredoxin 3	71	Thioredoxin.				cell redox homeostasis|negative regulation of cardiac muscle hypertrophy|regulation of the force of heart contraction	cell cortex	electron carrier activity|iron-sulfur cluster binding|metal ion binding|protein disulfide oxidoreductase activity				0		all_cancers(35;9.59e-07)|all_epithelial(44;1.48e-06)|Lung NSC(174;0.00566)|all_lung(145;0.00949)|Colorectal(57;0.142)|all_neural(114;0.16)|Breast(234;0.173)|Glioma(114;0.222)		OV - Ovarian serous cystadenocarcinoma(35;0.00218)		GTTGGAAGCTGAAGGTGTTCC	0.318													8	36	---	---	---	---	PASS
OR52E6	390078	broad.mit.edu	37	11	5862792	5862792	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5862792C>A	uc010qzq.1	-	1	336	c.336G>T	c.(334-336)ATG>ATT	p.M112I	TRIM5_uc001mbq.1_Intron	NM_001005167	NP_001005167	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E,	112	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CGATGCTCTCCATGACAGTGA	0.448													6	135	---	---	---	---	PASS
SPTY2D1	144108	broad.mit.edu	37	11	18637425	18637425	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18637425G>T	uc001moy.2	-	3	612	c.396C>A	c.(394-396)CTC>CTA	p.L132L	SPTY2D1_uc010rdi.1_Silent_p.L132L	NM_194285	NP_919261	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1	132	Potential.									breast(1)	1						GATTGTACTCGAGGAATTCAT	0.473													6	91	---	---	---	---	PASS
EHF	26298	broad.mit.edu	37	11	34680224	34680224	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34680224A>G	uc001mvr.1	+	8	863	c.752A>G	c.(751-753)AAA>AGA	p.K251R	EHF_uc009yke.1_Missense_Mutation_p.K228R|EHF_uc009ykf.1_Missense_Mutation_p.K254R	NM_012153	NP_036285	Q9NZC4	EHF_HUMAN	ets homologous factor	251	ETS.				cell proliferation|epithelial cell differentiation|multicellular organismal development|positive regulation of transcription, DNA-dependent		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(20;0.117)	Epithelial(1;0.055)|all cancers(1;0.137)|STAD - Stomach adenocarcinoma(6;0.235)			CTATGGGGTAAAAAGAAGAAC	0.453													33	49	---	---	---	---	PASS
PRR5L	79899	broad.mit.edu	37	11	36472839	36472839	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36472839C>A	uc001mwo.3	+	8	1055	c.666C>A	c.(664-666)CTC>CTA	p.L222L	PRR5L_uc001mwp.2_Silent_p.L222L|PRR5L_uc009ykk.2_Silent_p.L94L|PRR5L_uc010rfc.1_Intron	NM_001160167	NP_001153639	Q6MZQ0	PRR5L_HUMAN	protor-2 isoform a	222										ovary(1)	1						CTCCTTTCCTCGGCATCAGCG	0.542													5	84	---	---	---	---	PASS
MADD	8567	broad.mit.edu	37	11	47311834	47311834	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47311834C>A	uc001ner.1	+	19	3329	c.3138C>A	c.(3136-3138)ACC>ACA	p.T1046T	MADD_uc001neq.2_Silent_p.T1026T|MADD_uc001nev.1_Silent_p.T983T|MADD_uc001nes.1_Silent_p.T1003T|MADD_uc001net.1_Silent_p.T1046T|MADD_uc009yln.1_Silent_p.T983T|MADD_uc001neu.1_Silent_p.T983T|MADD_uc001nex.2_Silent_p.T1046T|MADD_uc001nez.2_Silent_p.T983T|MADD_uc001new.2_Silent_p.T1026T|MADD_uc009ylo.2_5'Flank	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing	1046					activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)		TTGCCCAGACCCACTACTATA	0.532													5	29	---	---	---	---	PASS
AGBL2	79841	broad.mit.edu	37	11	47726218	47726218	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47726218C>T	uc001ngg.2	-	6	563	c.463G>A	c.(463-465)GAA>AAA	p.E155K	AGBL2_uc010rhq.1_Missense_Mutation_p.E117K|AGBL2_uc001ngh.1_Missense_Mutation_p.E99K	NM_024783	NP_079059	Q5U5Z8	CBPC2_HUMAN	carboxypeptidase 2, cytosolic	155					proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2						GGGTTTACTTCATCCAACTCA	0.443													17	70	---	---	---	---	PASS
OR4C46	119749	broad.mit.edu	37	11	51515752	51515752	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51515752G>T	uc010ric.1	+	1	471	c.471G>T	c.(469-471)CAG>CAT	p.Q157H		NM_001004703	NP_001004703	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C,	157	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CAACCATACAGATCCTCTTCA	0.473													18	58	---	---	---	---	PASS
OR5M11	219487	broad.mit.edu	37	11	56310527	56310527	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56310527C>A	uc010rjl.1	-	1	207	c.207G>T	c.(205-207)GTG>GTT	p.V69V		NM_001005245	NP_001005245	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGCACAAATCCACAAAGGCTA	0.453													48	93	---	---	---	---	PASS
DAK	26007	broad.mit.edu	37	11	61111756	61111756	+	Intron	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61111756G>T	uc001nre.2	+						DDB1_uc010rlf.1_5'Flank|DAK_uc009ynm.1_Intron	NM_015533	NP_056348	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2						glycerol metabolic process	cytosol	ATP binding|FAD-AMP lyase (cyclizing) activity|glycerone kinase activity|metal ion binding				0						GTTGGTGCCAGGGACTTTGCC	0.542													5	24	---	---	---	---	PASS
SCGB2A1	4246	broad.mit.edu	37	11	61976227	61976227	+	Missense_Mutation	SNP	G	A	A	rs143379489	byFrequency	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61976227G>A	uc001nta.2	+	1	88	c.24G>A	c.(22-24)ATG>ATA	p.M8I		NM_002407	NP_002398	O75556	SG2A1_HUMAN	secretoglobin, family 2A, member 1 precursor	8						extracellular region	androgen binding				0						TGGTCCTCATGCTGGCGGCCC	0.602													34	55	---	---	---	---	PASS
PYGM	5837	broad.mit.edu	37	11	64518818	64518818	+	Missense_Mutation	SNP	G	C	C	rs114073621	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64518818G>C	uc001oax.3	-	16	2765	c.1948C>G	c.(1948-1950)CGA>GGA	p.R650G	PYGM_uc001oay.3_Missense_Mutation_p.R562G	NM_005609	NP_005600	P11217	PYGM_HUMAN	muscle glycogen phosphorylase isoform 1	650					glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding			ovary(2)	2					Pyridoxal Phosphate(DB00114)	AGTGAGACTCGGTAGTTCTCC	0.577													14	23	---	---	---	---	PASS
MEN1	4221	broad.mit.edu	37	11	64572546	64572546	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64572546G>T	uc001obj.2	-	9	1398	c.1325C>A	c.(1324-1326)GCC>GAC	p.A442D	MAP4K2_uc001obh.2_5'Flank|MAP4K2_uc001obi.2_5'Flank|MAP4K2_uc010rnp.1_5'Flank|MEN1_uc001obk.2_Missense_Mutation_p.A442D|MEN1_uc001obl.2_Missense_Mutation_p.A402D|MEN1_uc001obm.2_Missense_Mutation_p.A437D|MEN1_uc001obn.2_Missense_Mutation_p.A442D|MEN1_uc001obo.2_Missense_Mutation_p.A442D|MEN1_uc001obp.2_Missense_Mutation_p.A437D|MEN1_uc001obq.2_Missense_Mutation_p.A442D|MEN1_uc001obr.2_Missense_Mutation_p.A442D	NM_130800	NP_570712	O00255	MEN1_HUMAN	menin isoform 1	442					DNA repair|histone lysine methylation|MAPKKK cascade|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of JNK cascade|negative regulation of osteoblast differentiation|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of telomerase activity|negative regulation of transcription from RNA polymerase II promoter|osteoblast development|positive regulation of protein binding|positive regulation of transforming growth factor beta receptor signaling pathway|response to gamma radiation|response to UV|transcription, DNA-dependent	chromatin|cleavage furrow|cytosol|histone methyltransferase complex|nuclear matrix|soluble fraction	double-stranded DNA binding|four-way junction DNA binding|protein binding, bridging|protein N-terminus binding|R-SMAD binding|transcription regulatory region DNA binding|Y-form DNA binding	p.Q442*(1)		parathyroid(105)|pancreas(64)|gastrointestinal_tract_(site_indeterminate)(15)|small_intestine(13)|lung(9)|pituitary(7)|NS(7)|adrenal_gland(5)|soft_tissue(4)|central_nervous_system(4)|thymus(2)|stomach(1)|retroperitoneum(1)|skin(1)	238						AAGAAAGGTGGCCCAGCCCAC	0.622			D|Mis|N|F|S		parathyroid tumors|Pancreatic neuroendocrine tumors	parathyroid adenoma|pituitary adenoma|pancreatic islet cell|carcinoid			Hyperparathyroidism_Familial_Isolated|Multiple_Endocrine_Neoplasia_type_1				4	36	---	---	---	---	PASS
SYT12	91683	broad.mit.edu	37	11	66816119	66816119	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66816119A>G	uc009yrl.2	+	8	1387	c.1157A>G	c.(1156-1158)CAT>CGT	p.H386R	SYT12_uc001oju.2_Missense_Mutation_p.H386R	NM_177963	NP_808878	Q8IV01	SYT12_HUMAN	synaptotagmin XII	386	C2 2.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane				ovary(1)	1						AACGTGGGCCATGTCATCATT	0.642													13	22	---	---	---	---	PASS
NDUFV1	4723	broad.mit.edu	37	11	67379866	67379866	+	Silent	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67379866G>A	uc001omj.2	+	10	1485	c.1332G>A	c.(1330-1332)CCG>CCA	p.P444P	NDUFV1_uc010rpv.1_Silent_p.P343P|NDUFV1_uc001oml.2_Silent_p.P437P|NDUFV1_uc001omk.3_Silent_p.P435P|NDUFV1_uc010rpw.1_Silent_p.P153P	NM_007103	NP_009034	P49821	NDUV1_HUMAN	NADH dehydrogenase ubiquinone flavoprotein 1	444					mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|FMN binding|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity			skin(1)	1					NADH(DB00157)	ACTTTCGGCCGGAGCTCGAGG	0.647													4	5	---	---	---	---	PASS
ANO1	55107	broad.mit.edu	37	11	69957845	69957845	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69957845G>A	uc001opj.2	+	7	1137	c.832G>A	c.(832-834)GCG>ACG	p.A278T	ANO1_uc001opk.1_Missense_Mutation_p.A250T|ANO1_uc001opl.1_RNA|ANO1_uc010rqk.1_Missense_Mutation_p.A13T	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	278	Cytoplasmic (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						TGGTGTGTACGCGGCTGCATA	0.562													43	774	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70224135	70224135	+	Splice_Site	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70224135G>T	uc001opo.2	+	26	3583	c.3385_splice	c.e26-1	p.D1129_splice	PPFIA1_uc001opn.1_Splice_Site_p.D1129_splice|PPFIA1_uc001opp.2_Splice_Site|PPFIA1_uc001opr.2_Splice_Site_p.D268_splice|PPFIA1_uc001ops.2_Splice_Site_p.D168_splice|uc001opt.1_Intron	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b						cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TAATTTACCAGGATGATGATA	0.378													9	448	---	---	---	---	PASS
PICALM	8301	broad.mit.edu	37	11	85701343	85701343	+	Nonsense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85701343G>C	uc001pbm.2	-	13	1644	c.1358C>G	c.(1357-1359)TCA>TGA	p.S453*	PICALM_uc001pbl.2_Intron|PICALM_uc001pbn.2_Nonsense_Mutation_p.S446*|PICALM_uc010rtl.1_Intron|PICALM_uc010rtk.1_Intron|PICALM_uc001pbo.1_Nonsense_Mutation_p.S85*	NM_007166	NP_009097	Q13492	PICAL_HUMAN	phosphatidylinositol-binding clathrin assembly	453					clathrin coat assembly|endosome transport|negative regulation of receptor-mediated endocytosis|positive regulation of transcription, DNA-dependent|receptor internalization|regulation of protein localization	clathrin coat|clathrin-coated vesicle|coated pit|Golgi apparatus|nucleus|postsynaptic membrane|presynaptic membrane	1-phosphatidylinositol binding|clathrin heavy chain binding			urinary_tract(1)|ovary(1)	2		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				AGATACATCTGAAGAAATGGA	0.363			T	MLLT10|MLL	TALL|AML|								14	66	---	---	---	---	PASS
EED	8726	broad.mit.edu	37	11	85977186	85977186	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85977186G>T	uc001pbp.2	+	8	1245	c.788G>T	c.(787-789)TGG>TTG	p.W263L	EED_uc010rtm.1_Missense_Mutation_p.W263L|EED_uc001pbq.2_Missense_Mutation_p.W263L|EED_uc001pbr.2_Missense_Mutation_p.W263L|EED_uc001pbs.2_Intron|EED_uc010rtn.1_RNA	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a	263	Interaction with EZH2 (By similarity).|WD 4.|Required for interaction with the matrix protein MA of HIV-1.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				CTTAAACTTTGGAGGATCAAT	0.289													5	79	---	---	---	---	PASS
TRIM49	57093	broad.mit.edu	37	11	89531505	89531505	+	Silent	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89531505C>T	uc001pdb.2	-	8	1481	c.1152G>A	c.(1150-1152)AAG>AAA	p.K384K		NM_020358	NP_065091	P0CI25	TRI49_HUMAN	ring finger protein 18	384	B30.2/SPRY.					intracellular	zinc ion binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GAATGTCATTCTTAACACACC	0.428													8	78	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105732836	105732836	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105732836G>T	uc001pix.2	+	5	1020	c.574G>T	c.(574-576)GTC>TTC	p.V192F	GRIA4_uc001piu.1_Missense_Mutation_p.V192F|GRIA4_uc001piw.2_Missense_Mutation_p.V192F|GRIA4_uc001piv.2_Missense_Mutation_p.V192F|GRIA4_uc009yxk.1_Missense_Mutation_p.V192F	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	192	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	TTTTAATGATGTCAGCTATAG	0.368													13	28	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108383320	108383320	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108383320C>G	uc001pkk.2	-	6	3025	c.2914G>C	c.(2914-2916)GGA>CGA	p.G972R	EXPH5_uc010rvy.1_Missense_Mutation_p.G784R|EXPH5_uc010rvz.1_Missense_Mutation_p.G816R|EXPH5_uc010rwa.1_Missense_Mutation_p.G896R	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	972					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTTCCTTTTCCTCTTTCATTC	0.393													19	70	---	---	---	---	PASS
POU2AF1	5450	broad.mit.edu	37	11	111228206	111228206	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111228206C>G	uc001plg.3	-	4	675	c.420G>C	c.(418-420)TTG>TTC	p.L140F		NM_006235	NP_006226	Q16633	OBF1_HUMAN	POU class 2 associating factor 1	140					humoral immune response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			kidney(1)	1		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)		AGGCATAGGTCAACACTGAGG	0.572			T	BCL6	NHL								7	33	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118344238	118344238	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118344238C>A	uc001pta.2	+	3	2387	c.2364C>A	c.(2362-2364)GCC>GCA	p.A788A	MLL_uc001ptb.2_Silent_p.A788A|MLL_uc001psz.1_Silent_p.A821A|MLL_uc001ptd.1_Intron	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	788					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		GTCCTCTTGCCACTAGTGCCT	0.473			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								5	97	---	---	---	---	PASS
OR10G8	219869	broad.mit.edu	37	11	123900835	123900835	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123900835G>C	uc001pzp.1	+	1	506	c.506G>C	c.(505-507)GGA>GCA	p.G169A		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	169	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CCCTACTGTGGACCCAACTGG	0.532													46	93	---	---	---	---	PASS
ACAD8	27034	broad.mit.edu	37	11	134130962	134130962	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134130962C>T	uc001qhk.2	+	7	791	c.730C>T	c.(730-732)CGA>TGA	p.R244*	ACAD8_uc010sco.1_3'UTR|ACAD8_uc010scp.1_RNA|ACAD8_uc010scq.1_Nonsense_Mutation_p.R167*|ACAD8_uc001qhl.2_Nonsense_Mutation_p.R117*|ACAD8_uc010scr.1_3'UTR|ACAD8_uc009zde.1_3'UTR	NM_014384	NP_055199	Q9UKU7	ACAD8_HUMAN	acyl-Coenzyme A dehydrogenase family, member 8	244					branched chain family amino acid catabolic process|lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding				0	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)		CCAGCCAACACGAGCTGTGAT	0.612													4	10	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	22046974	22046974	+	Silent	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22046974G>C	uc001rfi.1	-	12	1814	c.1794C>G	c.(1792-1794)GCC>GCG	p.A598A	ABCC9_uc001rfh.2_Silent_p.A598A|ABCC9_uc001rfj.1_Silent_p.A598A	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	598	Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	ACCTTATGATGGCTTTGACTG	0.323													17	47	---	---	---	---	PASS
KIAA0528	9847	broad.mit.edu	37	12	22678604	22678604	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22678604C>G	uc001rfq.2	-	5	613	c.385G>C	c.(385-387)GAC>CAC	p.D129H	KIAA0528_uc010sir.1_5'UTR|KIAA0528_uc010sis.1_Missense_Mutation_p.D129H|KIAA0528_uc010sit.1_Missense_Mutation_p.D129H|KIAA0528_uc010siu.1_Missense_Mutation_p.D129H|KIAA0528_uc001rfr.2_Missense_Mutation_p.D129H|KIAA0528_uc009ziy.1_Missense_Mutation_p.D129H	NM_014802	NP_055617	Q86YS7	K0528_HUMAN	hypothetical protein LOC9847	129							protein binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						TTGAAGAGGTCTACTTTGACA	0.294													19	134	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26709212	26709212	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26709212G>T	uc001rhg.2	-	36	5335	c.4918C>A	c.(4918-4920)CCT>ACT	p.P1640T		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	1640	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					CTTCCCTCAGGGAACAGCAGT	0.483													6	110	---	---	---	---	PASS
YAF2	10138	broad.mit.edu	37	12	42554480	42554480	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42554480C>T	uc001rmv.2	-	4	522	c.454G>A	c.(454-456)GGC>AGC	p.G152S	YAF2_uc001rmw.2_Missense_Mutation_p.G176S|YAF2_uc010sko.1_Missense_Mutation_p.G143S|YAF2_uc010skp.1_Missense_Mutation_p.G110S	NM_005748	NP_005739	Q8IY57	YAF2_HUMAN	YY1 associated factor 2	152					negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|zinc ion binding				0	all_cancers(12;0.000425)	Lung NSC(34;0.0402)|all_lung(34;0.057)		GBM - Glioblastoma multiforme(48;0.0514)		GAGCTAGAGCCGCTTTGACTG	0.428													14	24	---	---	---	---	PASS
LMBR1L	55716	broad.mit.edu	37	12	49495909	49495909	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49495909C>A	uc001rth.3	-	11	1266	c.924G>T	c.(922-924)GTG>GTT	p.V308V	LMBR1L_uc001rtg.3_Silent_p.V303V|LMBR1L_uc001rti.3_Silent_p.V308V|LMBR1L_uc001rtj.1_Silent_p.V152V|LMBR1L_uc009zld.1_Silent_p.V181V	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor	308	Helical; (Potential).				endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						CTACCGTCAGCACCAGCAAGC	0.597													18	42	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53455039	53455039	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53455039C>G	uc001sbp.2	+	20	3484	c.3349C>G	c.(3349-3351)CAA>GAA	p.Q1117E	TENC1_uc001sbl.2_Missense_Mutation_p.Q993E|TENC1_uc001sbn.2_Missense_Mutation_p.Q1127E|TENC1_uc001sbq.2_Missense_Mutation_p.Q515E|TENC1_uc001sbr.2_RNA|TENC1_uc009zmr.2_Missense_Mutation_p.Q612E|TENC1_uc001sbs.2_5'Flank	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase	1117	Pro-rich.				intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding			ovary(1)|pancreas(1)	2						TAATGTCCCCCAAACCCCAGG	0.597													15	57	---	---	---	---	PASS
MAP3K12	7786	broad.mit.edu	37	12	53881050	53881050	+	Silent	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53881050C>T	uc001sdm.1	-	2	224	c.126G>A	c.(124-126)CTG>CTA	p.L42L	MAP3K12_uc001sdn.1_Silent_p.L42L	NM_006301	NP_006292	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase	42					histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			lung(2)|ovary(1)|breast(1)|skin(1)	5						GGGTAGGCGTCAGGTCCTTCT	0.627													9	72	---	---	---	---	PASS
DPY19L2	283417	broad.mit.edu	37	12	63974449	63974449	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63974449G>T	uc001srp.1	-	19	2074	c.1893C>A	c.(1891-1893)ACC>ACA	p.T631T	DPY19L2_uc010sso.1_Silent_p.T78T	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2	631					multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		CACCTGATGTGGTACTGTATT	0.313													5	78	---	---	---	---	PASS
DYRK2	8445	broad.mit.edu	37	12	68051497	68051497	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68051497G>T	uc001str.3	+	3	1212	c.810G>T	c.(808-810)CTG>CTT	p.L270L	DYRK2_uc001sts.3_Silent_p.L197L	NM_006482	NP_006473	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	270	Protein kinase.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|positive regulation of glycogen biosynthetic process|smoothened signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|manganese ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(1)|central_nervous_system(1)	4			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		TCCGAATCCTGGAACACCTGC	0.527													6	87	---	---	---	---	PASS
RAB3IP	117177	broad.mit.edu	37	12	70150363	70150363	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70150363C>A	uc001svp.2	+	3	925	c.478C>A	c.(478-480)CGT>AGT	p.R160S	RAB3IP_uc001svl.1_Missense_Mutation_p.R144S|RAB3IP_uc001svm.2_Missense_Mutation_p.R144S|RAB3IP_uc001svn.2_Missense_Mutation_p.R144S|RAB3IP_uc001svo.2_RNA|RAB3IP_uc001svq.2_Missense_Mutation_p.R160S|RAB3IP_uc001svr.2_RNA|RAB3IP_uc001svs.2_RNA	NM_175623	NP_783322	Q96QF0	RAB3I_HUMAN	RAB3A interacting protein isoform alpha 2	160					cilium assembly|Golgi to plasma membrane transport|protein localization to organelle|protein transport	actin cortical patch|centrosome|cytosol|lamellipodium|microtubule basal body|nucleus	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			TAGTCTGTCTCGTTTACGAAG	0.393													4	113	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78511809	78511809	+	Silent	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78511809G>A	uc001syp.2	+	14	2945	c.2772G>A	c.(2770-2772)CTG>CTA	p.L924L	NAV3_uc001syo.2_Silent_p.L924L|NAV3_uc010sub.1_Silent_p.L424L|NAV3_uc009zsf.2_5'UTR	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	924				L -> V (in Ref. 3; AAM73757).		nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CTTTATAGCTGAGGACAGATT	0.368										HNSCC(70;0.22)			26	154	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88484529	88484529	+	Silent	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88484529G>C	uc001tar.2	-	30	3893	c.3549C>G	c.(3547-3549)CTC>CTG	p.L1183L	CEP290_uc001taq.2_Silent_p.L243L	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	1183	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						GTTGCATTCTGAGGGACTCTA	0.383													3	6	---	---	---	---	PASS
GIT2	9815	broad.mit.edu	37	12	110376235	110376235	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110376235G>T	uc001tps.2	-	18	2118	c.1953C>A	c.(1951-1953)ACC>ACA	p.T651T	TCHP_uc001tpo.1_Intron|GIT2_uc001tpr.2_Silent_p.T191T|GIT2_uc001tpq.2_Silent_p.T621T|GIT2_uc001tpv.2_Silent_p.T573T|GIT2_uc001tpu.2_Silent_p.T571T|GIT2_uc001tpt.2_Silent_p.T523T|GIT2_uc010sxu.1_Silent_p.T559T	NM_057169	NP_476510	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting	651					regulation of ARF GTPase activity|regulation of G-protein coupled receptor protein signaling pathway	nucleoplasm	ARF GTPase activator activity|protein binding|zinc ion binding			central_nervous_system(1)	1						GTATGTTTTTGGTGATCTGTT	0.512													6	104	---	---	---	---	PASS
TPCN1	53373	broad.mit.edu	37	12	113704132	113704132	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113704132G>T	uc001tuw.2	+	4	682	c.385G>T	c.(385-387)GCC>TCC	p.A129S	TPCN1_uc001tux.2_Missense_Mutation_p.A201S|TPCN1_uc010syt.1_Missense_Mutation_p.A61S	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	129	Helical; Name=S1 of repeat I; (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3						CGAGGCCCCCGCCGTCCCCGC	0.642													67	84	---	---	---	---	PASS
PLA2G1B	5319	broad.mit.edu	37	12	120760126	120760126	+	Intron	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120760126G>A	uc001tyd.2	-						PLA2G1B_uc009zwx.2_Intron	NM_000928	NP_000919	P04054	PA21B_HUMAN	phospholipase A2 group IB precursor						actin filament organization|activation of MAPK activity|activation of phospholipase A2 activity|arachidonic acid secretion|cellular response to insulin stimulus|glucose transport|interleukin-8 production|leukotriene biosynthetic process|multicellular organismal lipid catabolic process|neutrophil chemotaxis|neutrophil mediated immunity|phosphatidylcholine metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of DNA replication|positive regulation of immune response|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein secretion|positive regulation of transcription from RNA polymerase II promoter	extracellular space	bile acid binding|calcium ion binding|calcium-dependent phospholipase A2 activity|cell surface binding|receptor binding			skin(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTTGCCTGGAGAGGGATGAAA	0.483													36	81	---	---	---	---	PASS
C12orf43	64897	broad.mit.edu	37	12	121444121	121444121	+	Intron	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121444121C>G	uc001tzh.1	-						C12orf43_uc009zxa.1_Intron|C12orf43_uc010szo.1_Intron|C12orf43_uc010szp.1_Intron|C12orf43_uc001tzi.1_Intron	NM_022895	NP_075046	Q96C57	CL043_HUMAN	hypothetical protein LOC64897												0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TATAACCACTCACCATCATCC	0.274													9	60	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124267811	124267811	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124267811G>T	uc001uft.3	+	7	841	c.816G>T	c.(814-816)CAG>CAT	p.Q272H		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	272	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AGACACCTCAGGTAGTTTGTG	0.532													5	52	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124840062	124840062	+	Silent	SNP	T	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124840062T>A	uc010tba.1	-	24	3438	c.3321A>T	c.(3319-3321)CCA>CCT	p.P1107P	NCOR2_uc010tay.1_Silent_p.P1106P|NCOR2_uc010taz.1_Silent_p.P1090P|NCOR2_uc010tbb.1_Silent_p.P1099P|NCOR2_uc010tbc.1_Silent_p.P1089P|NCOR2_uc001ugj.1_Silent_p.P1107P	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	1107					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		AGATGGTGGGTGGGCGCGGCA	0.647													9	14	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39265581	39265581	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39265581G>C	uc001uwv.2	+	1	4409	c.4100G>C	c.(4099-4101)GGC>GCC	p.G1367A		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	1367	Extracellular (Potential).|CSPG 9.				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ATCACACTGGGCATGAATTTT	0.393													26	14	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77669539	77669539	+	Missense_Mutation	SNP	C	A	A	rs141165449		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77669539C>A	uc001vkf.2	-	59	10130	c.10039G>T	c.(10039-10041)GAT>TAT	p.D3347Y	MYCBP2_uc010aev.2_Missense_Mutation_p.D2751Y|MYCBP2_uc001vke.2_5'Flank	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	3347					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		ACAGGAAGATCCTCAGAAATG	0.428													22	5	---	---	---	---	PASS
PCID2	55795	broad.mit.edu	37	13	113832545	113832545	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113832545C>G	uc010tju.1	-	14	1248	c.1167G>C	c.(1165-1167)CAG>CAC	p.Q389H	PCID2_uc001vtb.2_Missense_Mutation_p.Q222H|PCID2_uc010tjv.1_Missense_Mutation_p.Q389H|PCID2_uc010tjw.1_Missense_Mutation_p.Q389H|PCID2_uc001vte.2_Missense_Mutation_p.Q282H|PCID2_uc001vtd.2_Missense_Mutation_p.Q282H|PCID2_uc001vtf.2_Missense_Mutation_p.Q282H	NM_001127203	NP_001120675	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	389					negative regulation of apoptosis|negative regulation of cysteine-type endopeptidase activity|positive regulation of mitotic cell cycle spindle assembly checkpoint|positive regulation of transcription, DNA-dependent|regulation of mRNA stability|spleen development		protein binding				0	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			GAAATGGGTTCTGCTTGCTGA	0.527													17	25	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22309855	22309855	+	Intron	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22309855G>C	uc010tmf.1	+						uc001wbw.2_Intron|uc010tmg.1_Intron|uc001wbx.2_Missense_Mutation_p.G80A|uc001wby.2_RNA					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		AATGAAGATGGAAGGTTTACA	0.468													8	129	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71524297	71524297	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71524297G>T	uc001xmo.2	+	26	5154	c.4708G>T	c.(4708-4710)GGT>TGT	p.G1570C	PCNX_uc010are.1_Missense_Mutation_p.G1459C|PCNX_uc010arf.1_Intron	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1570						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CAGCCTCTGTGGTGATTTGCT	0.388													6	182	---	---	---	---	PASS
MLH3	27030	broad.mit.edu	37	14	75485636	75485636	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75485636G>C	uc001xrd.1	-	12	4354	c.4138C>G	c.(4138-4140)CTT>GTT	p.L1380V	MLH3_uc001xre.1_Missense_Mutation_p.L1356V	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN	mutL homolog 3 isoform 1	1380					mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)		GCTTCAATAAGGCGGCAACTT	0.453								MMR					11	34	---	---	---	---	PASS
MOAP1	64112	broad.mit.edu	37	14	93650307	93650307	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93650307T>C	uc001ybj.2	-	3	651	c.281A>G	c.(280-282)AAG>AGG	p.K94R	C14orf109_uc001ybk.3_5'Flank|C14orf109_uc010auo.2_5'Flank	NM_022151	NP_071434	Q96BY2	MOAP1_HUMAN	modulator of apoptosis 1	94					activation of caspase activity|apoptotic nuclear change	cytoplasm	protein homodimerization activity			skin(2)|ovary(1)	3		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.178)|all cancers(159;0.2)|COAD - Colon adenocarcinoma(157;0.204)		gtcagggggcttaaagatcac	0.000													20	40	---	---	---	---	PASS
BDKRB2	624	broad.mit.edu	37	14	96707262	96707262	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96707262G>T	uc010avm.1	+	3	793	c.597G>T	c.(595-597)AAG>AAT	p.K199N	BDKRB2_uc010avl.1_3'UTR|BDKRB2_uc010twu.1_Missense_Mutation_p.K172N|BDKRB2_uc001yfg.2_Missense_Mutation_p.K199N	NM_000623	NP_000614	P30411	BKRB2_HUMAN	bradykinin receptor B2	199	Extracellular (Potential).				arachidonic acid secretion|elevation of cytosolic calcium ion concentration|transmembrane receptor protein tyrosine kinase signaling pathway	endosome|integral to plasma membrane	bradykinin receptor activity|phosphatidylinositol phospholipase C activity|protease binding|protein heterodimerization activity|type 1 angiotensin receptor binding			ovary(3)|breast(1)|kidney(1)	5		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)		GGACCATGAAGGAGTACAGCG	0.597													5	35	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105405270	105405270	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105405270G>T	uc010axc.1	-	7	16638	c.16518C>A	c.(16516-16518)ATC>ATA	p.I5506I	AHNAK2_uc001ypx.2_Silent_p.I5406I	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5506						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTGACGTGGGGATCTCTGATT	0.453													4	19	---	---	---	---	PASS
TTBK2	146057	broad.mit.edu	37	15	43075606	43075606	+	Intron	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43075606G>T	uc001zqo.2	-						TTBK2_uc010bcy.2_Intron|TTBK2_uc001zqp.2_Intron|TTBK2_uc010bcz.1_Intron	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2						cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		ttgtttataaggtactcatac	0.194													6	184	---	---	---	---	PASS
DUOX2	50506	broad.mit.edu	37	15	45402619	45402619	+	Intron	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45402619C>A	uc010bea.2	-						DUOX2_uc001zun.2_Intron	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor						cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GCCAACCCCTCCCTCACCTCA	0.572													15	14	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50226290	50226290	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50226290C>G	uc001zxu.2	-	15	1519	c.1377G>C	c.(1375-1377)ATG>ATC	p.M459I	ATP8B4_uc010ber.2_Missense_Mutation_p.M332I|ATP8B4_uc010ufd.1_Missense_Mutation_p.M332I|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	459	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TGGGATCACCCATTTTAATGG	0.408													34	54	---	---	---	---	PASS
USP8	9101	broad.mit.edu	37	15	50757333	50757333	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50757333C>G	uc001zym.3	+	8	1131	c.631C>G	c.(631-633)CAG>GAG	p.Q211E	USP8_uc001zyk.1_Translation_Start_Site|USP8_uc001zyl.3_Missense_Mutation_p.Q211E|USP8_uc001zyn.3_Missense_Mutation_p.Q211E|USP8_uc010ufh.1_Missense_Mutation_p.Q134E|USP8_uc010bev.1_Intron	NM_001128611	NP_001122083	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	211	Rhodanese.				cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GCAGGATTATCAGGATTCCTG	0.383													14	57	---	---	---	---	PASS
KIAA1370	56204	broad.mit.edu	37	15	52902292	52902292	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52902292C>T	uc002acg.3	-	6	972	c.819G>A	c.(817-819)TGG>TGA	p.W273*	KIAA1370_uc002ach.3_RNA|KIAA1370_uc010bfg.1_Nonsense_Mutation_p.W185*|KIAA1370_uc010ugf.1_Nonsense_Mutation_p.W280*	NM_019600	NP_062546	Q32MH5	K1370_HUMAN	hypothetical protein LOC56204	273											0				all cancers(107;0.0803)		GTGCCATGGTCCAAGTTTGTT	0.408													19	35	---	---	---	---	PASS
CGNL1	84952	broad.mit.edu	37	15	57730732	57730732	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57730732A>G	uc002aeg.2	+	2	611	c.535A>G	c.(535-537)ACA>GCA	p.T179A	CGNL1_uc010bfw.2_Missense_Mutation_p.T179A	NM_032866	NP_116255	Q0VF96	CGNL1_HUMAN	cingulin-like 1	179	Head.					myosin complex|tight junction	motor activity			skin(6)|ovary(4)|central_nervous_system(1)	11				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		AAAAACGTTGACAGAAGAAGG	0.458													57	101	---	---	---	---	PASS
SNX1	6642	broad.mit.edu	37	15	64422135	64422135	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64422135C>A	uc002amv.2	+	9	864	c.828C>A	c.(826-828)ACC>ACA	p.T276T	SNX1_uc010bgv.2_5'UTR|SNX1_uc010uio.1_Silent_p.T276T|SNX1_uc002amw.2_Silent_p.T276T|SNX1_uc002amx.2_Silent_p.T211T|SNX1_uc002amy.2_Silent_p.T205T|SNX1_uc010bgw.2_Silent_p.T178T	NM_003099	NP_003090	Q13596	SNX1_HUMAN	sorting nexin 1 isoform a	276					cell communication|early endosome to Golgi transport|endocytosis|intracellular protein transport	early endosome membrane|Golgi apparatus	phosphatidylinositol binding|protein binding|protein transporter activity				0						CCGTGGGTACCCAGACATTGA	0.468													6	91	---	---	---	---	PASS
DENND4A	10260	broad.mit.edu	37	15	66010252	66010252	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66010252C>T	uc002aph.2	-	13	2049	c.1671G>A	c.(1669-1671)ATG>ATA	p.M557I	DENND4A_uc002api.2_Missense_Mutation_p.M557I|DENND4A_uc002apj.3_Missense_Mutation_p.M557I|DENND4A_uc010ujj.1_Missense_Mutation_p.M557I	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2	557					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						CCAAATCTATCATGTGCAACC	0.383													4	13	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85401092	85401092	+	Silent	SNP	C	A	A	rs114823113	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85401092C>A	uc002ble.2	+	6	3896	c.3729C>A	c.(3727-3729)ACC>ACA	p.T1243T		NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1243					heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCCGCCTCACCGGCCTCCTGG	0.687													4	19	---	---	---	---	PASS
SPATA8	145946	broad.mit.edu	37	15	97328309	97328309	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97328309A>G	uc002bue.2	+	3	490	c.280A>G	c.(280-282)AGG>GGG	p.R94G	uc010urp.1_5'Flank|uc002bud.1_5'Flank	NM_173499	NP_775770	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8	94										ovary(1)|skin(1)	2	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			GAAGATAAACAGGAGAAGTGT	0.453													36	47	---	---	---	---	PASS
OR4F15	390649	broad.mit.edu	37	15	102358897	102358897	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102358897G>T	uc010uts.1	+	1	508	c.508G>T	c.(508-510)GGT>TGT	p.G170C		NM_001001674	NP_001001674	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F,	170	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			ACCTTTTTGTGGTCCTAATAT	0.423													7	135	---	---	---	---	PASS
WDR90	197335	broad.mit.edu	37	16	711941	711941	+	Silent	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:711941G>C	uc002cii.1	+	32	3969	c.3915G>C	c.(3913-3915)TCG>TCC	p.S1305S	WDR90_uc002cij.1_Intron|WDR90_uc002cik.1_Silent_p.S832S|WDR90_uc002cil.1_RNA|WDR90_uc002cim.1_Silent_p.S479S|WDR90_uc002cin.1_5'UTR	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	1305	WD 15.									ovary(1)	1		Hepatocellular(780;0.0218)				AGCTGACCTCGCTCTGCTACG	0.662													32	14	---	---	---	---	PASS
ABAT	18	broad.mit.edu	37	16	8868838	8868838	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8868838C>T	uc002czc.3	+	13	1212	c.1046C>T	c.(1045-1047)CCA>CTA	p.P349L	ABAT_uc002czd.3_Missense_Mutation_p.P349L|ABAT_uc010buh.2_Missense_Mutation_p.P291L|ABAT_uc010bui.2_Missense_Mutation_p.P349L	NM_020686	NP_065737	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase precursor	349					behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	CTGGATGACCCAGCAGACGTG	0.597													14	26	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	10031952	10031952	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10031952T>C	uc002czo.3	-	3	1419	c.871A>G	c.(871-873)AGA>GGA	p.R291G	GRIN2A_uc010uym.1_Missense_Mutation_p.R291G|GRIN2A_uc010uyn.1_Missense_Mutation_p.R134G|GRIN2A_uc002czr.3_Missense_Mutation_p.R291G	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	291	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TCCCTCACTCTCGCCTCCAGG	0.567													16	8	---	---	---	---	PASS
ABCC6	368	broad.mit.edu	37	16	16302587	16302587	+	Silent	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16302587C>G	uc002den.3	-	7	829	c.792G>C	c.(790-792)CGG>CGC	p.R264R	ABCC6_uc010bvo.2_RNA|ABCC6_uc010uzz.1_Silent_p.R276R	NM_001171	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C, member 6	264	Cytoplasmic (By similarity).				response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		CCACTTACCTCCGGGCTGCAC	0.398													18	46	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18847327	18847327	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18847327T>C	uc002dfm.2	-	48	8348	c.7985A>G	c.(7984-7986)GAA>GGA	p.E2662G	SMG1_uc010bwb.2_Missense_Mutation_p.E2522G|SMG1_uc010bwa.2_Missense_Mutation_p.E1393G	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	2662					DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						CTTCCACTGTTCAATTCGATG	0.473													8	4	---	---	---	---	PASS
GPRC5B	51704	broad.mit.edu	37	16	19883784	19883784	+	Silent	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19883784G>T	uc002dgt.2	-	2	492	c.384C>A	c.(382-384)CTC>CTA	p.L128L	GPRC5B_uc010vav.1_Silent_p.L154L	NM_016235	NP_057319	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, family C, group 5,	128	Helical; Name=3; (Potential).							p.L128F(1)		lung(1)|breast(1)|skin(1)	3						GGACGCCCCAGAGGAAGCGGC	0.662													4	9	---	---	---	---	PASS
CCDC113	29070	broad.mit.edu	37	16	58293772	58293772	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58293772G>C	uc002ene.2	+	5	640	c.561G>C	c.(559-561)GAG>GAC	p.E187D	CCDC113_uc010vid.1_Missense_Mutation_p.E133D	NM_014157	NP_054876	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113 isoform 1	187	Potential.					protein complex					0						ATATGAAGGAGAAATTACGTT	0.348													10	23	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61891136	61891136	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61891136G>A	uc002eog.1	-	4	806	c.554C>T	c.(553-555)TCT>TTT	p.S185F	CDH8_uc002eoh.2_5'UTR	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	185	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GTTAGTGACAGATGTACCTAA	0.353													11	25	---	---	---	---	PASS
CKLF	51192	broad.mit.edu	37	16	66592182	66592182	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66592182C>G	uc002eow.2	+	2	315	c.168C>G	c.(166-168)ATC>ATG	p.I56M	CKLF_uc002eox.1_Missense_Mutation_p.I56M|CKLF_uc002eot.2_Missense_Mutation_p.I56M|CKLF_uc002eou.2_Intron|CKLF_uc002eov.2_Intron	NM_016951	NP_058647	Q9UBR5	CKLF_HUMAN	chemokine-like factor isoform a	56	Helical; (Potential).|MARVEL.				cell proliferation|lymphocyte chemotaxis|macrophage chemotaxis|neutrophil chemotaxis|secretion by cell	extracellular space|integral to membrane	chemokine activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0689)|Epithelial(162;0.217)		TCACCGTTATCTTATTTTTCA	0.338													33	51	---	---	---	---	PASS
SLC7A6OS	84138	broad.mit.edu	37	16	68338045	68338045	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68338045G>T	uc002evw.1	-	3	581	c.562C>A	c.(562-564)CAG>AAG	p.Q188K		NM_032178	NP_115554	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite	188					protein transport	cytoplasm|nucleus				ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)		TGTTCTTCCTGGCGCCTGACT	0.493													5	84	---	---	---	---	PASS
CALB2	794	broad.mit.edu	37	16	71417890	71417890	+	Silent	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71417890G>A	uc002faa.3	+	7	565	c.495G>A	c.(493-495)TTG>TTA	p.L165L	CALB2_uc010vme.1_RNA|CALB2_uc002fac.3_Silent_p.L165L	NM_001740	NP_001731	P22676	CALB2_HUMAN	calbindin 2 isoform 1	165	4 (Probable).|EF-hand 4.						calcium ion binding				0		Ovarian(137;0.125)				TGTTTGACTTGAACGGGGATG	0.532													51	19	---	---	---	---	PASS
ACSF3	197322	broad.mit.edu	37	16	89212336	89212336	+	Intron	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89212336C>G	uc002fmp.2	+						ACSF3_uc010cig.1_Intron|ACSF3_uc010cih.1_Intron|ACSF3_uc002fmq.1_Intron|ACSF3_uc010cii.1_Intron|ACSF3_uc002fmr.1_Intron	NM_174917	NP_777577	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3 precursor						fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)		AACTGTTCTTCTATCCGCAGA	0.587													11	28	---	---	---	---	PASS
SPATA22	84690	broad.mit.edu	37	17	3352127	3352127	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3352127C>A	uc002fvm.2	-	6	883	c.646G>T	c.(646-648)GAT>TAT	p.D216Y	SPATA22_uc010vrg.1_Missense_Mutation_p.D200Y|SPATA22_uc010vrf.1_Missense_Mutation_p.D216Y|SPATA22_uc002fvn.2_Missense_Mutation_p.D216Y|SPATA22_uc002fvo.2_Missense_Mutation_p.D216Y|SPATA22_uc002fvp.2_Missense_Mutation_p.D216Y|SPATA22_uc010ckf.2_Missense_Mutation_p.D173Y	NM_032598	NP_115987	Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	216											0						TCTGGAATATCATCCAACATT	0.303													36	16	---	---	---	---	PASS
AMAC1L3	643664	broad.mit.edu	37	17	7386172	7386172	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7386172T>C	uc010cmj.1	+	2	984	c.869T>C	c.(868-870)GTG>GCG	p.V290A	ZBTB4_uc002ghd.3_Intron|POLR2A_uc002ghe.2_5'Flank|POLR2A_uc002ghf.3_5'Flank	NM_001102614	NP_001096084	P0C7Q6	AMCL3_HUMAN	acyl-malonyl condensing enzyme 1-like 3	290	DUF6 2.|Helical; (Potential).					integral to membrane					0		Prostate(122;0.173)				CATTCCGAGGTGGTGGTGGCC	0.592													15	94	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578212	7578212	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578212G>C	uc002gim.2	-	6	831	c.637C>G	c.(637-639)CGA>GGA	p.R213G	TP53_uc002gig.1_Missense_Mutation_p.R213G|TP53_uc002gih.2_Missense_Mutation_p.R213G|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R81G|TP53_uc010cng.1_Missense_Mutation_p.R81G|TP53_uc002gii.1_Missense_Mutation_p.R81G|TP53_uc010cnh.1_Missense_Mutation_p.R213G|TP53_uc010cni.1_Missense_Mutation_p.R213G|TP53_uc002gij.2_Missense_Mutation_p.R213G|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.R120G|TP53_uc002gio.2_Missense_Mutation_p.R81G|TP53_uc010vug.1_Missense_Mutation_p.R174G	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	213	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R213*(186)|p.R213L(25)|p.R213Q(22)|p.R213fs*34(10)|p.0?(7)|p.R213P(5)|p.R81*(2)|p.R120*(2)|p.R213G(2)|p.K164_P219del(1)|p.D208_V216delDRNTFRHSV(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R213*33(1)|p.D208fs*1(1)|p.R213>L(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ACACTATGTCGAAAAGTGTTT	0.532		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			10	11	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10309369	10309369	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10309369C>A	uc002gmm.2	-	21	2516	c.2421G>T	c.(2419-2421)ATG>ATT	p.M807I	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	807	IQ.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						TCCTTTGCAACATCTTCTGAT	0.358									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				22	19	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11738145	11738145	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11738145G>A	uc002gne.2	+	49	9505	c.9437G>A	c.(9436-9438)TGT>TAT	p.C3146Y	DNAH9_uc010coo.2_Missense_Mutation_p.C2440Y	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	3146	Stalk (By similarity).|Potential.				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAGAAGGACTGTGAGGAGGAC	0.547													15	13	---	---	---	---	PASS
ALDH3A1	218	broad.mit.edu	37	17	19646725	19646725	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19646725C>A	uc010cqu.2	-	2	544	c.214G>T	c.(214-216)GAG>TAG	p.E72*	ALDH3A1_uc010vzd.1_Nonsense_Mutation_p.E72*|ALDH3A1_uc002gwj.2_Nonsense_Mutation_p.E72*|ALDH3A1_uc010cqv.2_Nonsense_Mutation_p.E72*|ALDH3A1_uc002gwk.2_5'UTR|ALDH3A1_uc002gwl.1_5'UTR	NM_001135168	NP_001128640	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3A1	72					cellular aldehyde metabolic process	cytosol|endoplasmic reticulum	alcohol dehydrogenase (NADP+) activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase			ovary(1)|pancreas(1)	2	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)	NADH(DB00157)	ATCATGTACTCGATCTCCTCT	0.607													5	95	---	---	---	---	PASS
TAOK1	57551	broad.mit.edu	37	17	27809300	27809300	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27809300G>C	uc002hdz.1	+	8	843	c.649G>C	c.(649-651)GAA>CAA	p.E217Q	TAOK1_uc010wbe.1_Missense_Mutation_p.E217Q|TAOK1_uc010wbf.1_Missense_Mutation_p.E217Q|TAOK1_uc002heb.1_Missense_Mutation_p.E43Q	NM_020791	NP_065842	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	217	Protein kinase.				mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)			AACATGTATTGAACTAGGTAA	0.323													20	107	---	---	---	---	PASS
SLFN12	55106	broad.mit.edu	37	17	33749131	33749131	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33749131C>A	uc002hji.3	-	2	1294	c.917G>T	c.(916-918)AGA>ATA	p.R306I	SLFN12_uc002hjj.3_Missense_Mutation_p.R306I|SLFN12_uc010cts.2_Missense_Mutation_p.R306I	NM_018042	NP_060512	Q8IYM2	SLN12_HUMAN	schlafen family member 12	306							ATP binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GCGCTCCACTCTGAGTGCACA	0.433													5	42	---	---	---	---	PASS
GGNBP2	79893	broad.mit.edu	37	17	34942339	34942339	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34942339C>T	uc002hnb.2	+	11	1685	c.1436C>T	c.(1435-1437)TCT>TTT	p.S479F	GGNBP2_uc002hna.2_3'UTR|GGNBP2_uc002hnc.1_Missense_Mutation_p.S308F	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403	479					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GAAACAGGTTCTCGGGAGGGT	0.423													20	27	---	---	---	---	PASS
PNMT	5409	broad.mit.edu	37	17	37826627	37826627	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37826627G>T	uc002hsi.1	+	3	1056	c.834G>T	c.(832-834)CAG>CAT	p.Q278H		NM_002686	NP_002677	P11086	PNMT_HUMAN	phenylethanolamine N-methyltransferase	278					catecholamine biosynthetic process|hormone biosynthetic process	cytosol	phenylethanolamine N-methyltransferase activity			ovary(1)	1	all_cancers(6;6.59e-85)|all_epithelial(6;2.89e-103)|Breast(7;1.05e-86)|Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;3.87e-45)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CCTGGGCTCAGAAGGTTGGGC	0.562													3	5	---	---	---	---	PASS
CNTNAP1	8506	broad.mit.edu	37	17	40842122	40842122	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40842122C>A	uc002iay.2	+	12	1968	c.1752C>A	c.(1750-1752)TCC>TCA	p.S584S	CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor	584	Extracellular (Potential).|Fibrinogen C-terminal.				axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		ATAAGGAATCCTGTGAGGCTT	0.383													6	115	---	---	---	---	PASS
MAP3K14	9020	broad.mit.edu	37	17	43350976	43350976	+	Splice_Site	SNP	T	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43350976T>A	uc002iiw.1	-	10	1662	c.1553_splice	c.e10-1	p.A518_splice	MAP3K14_uc002iiu.1_Silent_p.A47A|MAP3K14_uc010daj.1_Splice_Site|MAP3K14_uc002iiv.1_Splice_Site_p.A102_splice	NM_003954	NP_003945	Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase						cellular response to mechanical stimulus|I-kappaB kinase/NF-kappaB cascade|immune response|positive regulation of I-kappaB kinase/NF-kappaB cascade|T cell costimulation	cytosol	ATP binding|MAP kinase kinase kinase activity|NF-kappaB-inducing kinase activity|protein binding			central_nervous_system(3)|breast(2)|lung(1)|ovary(1)|stomach(1)	8						CGTTGTCAGCTGCCAGGCCGC	0.617													7	13	---	---	---	---	PASS
CCDC47	57003	broad.mit.edu	37	17	61824274	61824274	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61824274C>G	uc002jbs.3	-	13	1755	c.1419G>C	c.(1417-1419)ATG>ATC	p.M473I	CCDC47_uc010ddx.2_Missense_Mutation_p.M473I	NM_020198	NP_064583	Q96A33	CCD47_HUMAN	coiled-coil domain containing 47 precursor	473	Potential.					integral to membrane	protein binding				0						GTTTCATTTTCATTTGCTTCT	0.413													15	43	---	---	---	---	PASS
QRICH2	84074	broad.mit.edu	37	17	74287975	74287975	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74287975C>A	uc002jrd.1	-	4	2515	c.2335G>T	c.(2335-2337)GGT>TGT	p.G779C	QRICH2_uc010wsz.1_Missense_Mutation_p.G705C|QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	779							protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						AAATATGCACCAGGTTGTACC	0.498													6	138	---	---	---	---	PASS
NDC80	10403	broad.mit.edu	37	18	2595474	2595474	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2595474C>A	uc002kli.2	+	11	1257	c.1075C>A	c.(1075-1077)CAG>AAG	p.Q359K		NM_006101	NP_006092	O14777	NDC80_HUMAN	kinetochore associated 2	359	Interaction with the N-terminus of CDCA1.|Potential.|Interaction with NEK2 and ZWINT.|Interaction with SMC1A.				attachment of spindle microtubules to kinetochore|cell division|establishment of mitotic spindle orientation|mitotic prometaphase|mitotic sister chromatid segregation|mitotic spindle organization|phosphatidylinositol-mediated signaling	condensed nuclear chromosome outer kinetochore|cytosol|Ndc80 complex	protein binding			ovary(1)	1						CATTGACAACCAGAAGTACTC	0.333													5	70	---	---	---	---	PASS
SMCHD1	23347	broad.mit.edu	37	18	2740761	2740761	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2740761C>G	uc002klm.3	+	28	3764	c.3575C>G	c.(3574-3576)TCT>TGT	p.S1192C	SMCHD1_uc002klk.3_RNA|SMCHD1_uc002kll.3_RNA	NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible	1192					chromosome organization		ATP binding				0						AGTTCTTTATCTTCTTTGTCA	0.303													16	43	---	---	---	---	PASS
TMEM200C	645369	broad.mit.edu	37	18	5891948	5891948	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5891948C>T	uc002kmx.1	-	1	156	c.115G>A	c.(115-117)GTG>ATG	p.V39M		NM_001080209	NP_001073678	A6NKL6	T200C_HUMAN	transmembrane protein 200C	39						integral to membrane					0						ACCACCACCACGTCGTTCTTG	0.607													8	24	---	---	---	---	PASS
OSBPL1A	114876	broad.mit.edu	37	18	21819282	21819282	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21819282G>A	uc002kve.2	-	16	1520	c.1346C>T	c.(1345-1347)ACG>ATG	p.T449M	OSBPL1A_uc002kvd.2_Translation_Start_Site|OSBPL1A_uc010xbc.1_Missense_Mutation_p.T67M|OSBPL1A_uc002kvf.3_Missense_Mutation_p.T229M	NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN	oxysterol-binding protein-like 1A isoform B	449	Potential.				cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					AGTGGCCAGCGTCTCCAGTGC	0.443													6	28	---	---	---	---	PASS
RNF125	54941	broad.mit.edu	37	18	29617122	29617122	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29617122T>C	uc002kxf.1	+	2	590	c.208T>C	c.(208-210)TGG>CGG	p.W70R		NM_017831	NP_060301	Q96EQ8	RN125_HUMAN	ring finger protein 125	70	RING-type.				negative regulation of type I interferon production	intracellular	ligase activity|zinc ion binding				0						GAACAACAAGTGGACCTGTCC	0.438													86	98	---	---	---	---	PASS
MAPRE2	10982	broad.mit.edu	37	18	32621631	32621631	+	Intron	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32621631G>A	uc002kyg.2	+						MAPRE2_uc010xcb.1_Intron|MAPRE2_uc010xcc.1_Intron|MAPRE2_uc002kyf.2_Intron|MAPRE2_uc002kyh.2_Intron|MAPRE2_uc010xcd.1_5'UTR	NM_014268	NP_055083	Q15555	MARE2_HUMAN	microtubule-associated protein, RP/EB family,						cell division|cell proliferation|mitosis|signal transduction	cytoplasm|microtubule	microtubule binding			ovary(1)	1						TACAGGTAATGGGGCTGGCAC	0.597													8	16	---	---	---	---	PASS
TCEB3C	162699	broad.mit.edu	37	18	44555280	44555280	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44555280G>T	uc010xdb.1	-	1	1170	c.934C>A	c.(934-936)CCT>ACT	p.P312T	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_145653	NP_663628	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide	312	Activation domain (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	DNA binding				0						CTGCGTCCAGGGAAAGCAGCT	0.652													11	385	---	---	---	---	PASS
ZADH2	284273	broad.mit.edu	37	18	72914002	72914002	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72914002C>A	uc002llx.2	-	2	771	c.503G>T	c.(502-504)GGA>GTA	p.G168V	ZADH2_uc010dqv.2_Missense_Mutation_p.G45V	NM_175907	NP_787103	Q8N4Q0	ZADH2_HUMAN	zinc binding alcohol dehydrogenase domain	168						peroxisome	oxidoreductase activity|zinc ion binding				0		Esophageal squamous(42;0.131)|Prostate(75;0.155)		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)		CGACAGTCCTCCGAGCTCTTT	0.532													10	370	---	---	---	---	PASS
MED16	10025	broad.mit.edu	37	19	871601	871601	+	Intron	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:871601G>C	uc002lqd.1	-						MED16_uc010drw.1_Intron|MED16_uc002lqe.2_Intron|MED16_uc002lqf.2_Intron	NM_005481	NP_005472	Q9Y2X0	MED16_HUMAN	mediator complex subunit 16						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	receptor activity|thyroid hormone receptor binding|thyroid hormone receptor coactivator activity|vitamin D receptor binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAGCAAACAGGTGCCTGGAA	0.333													10	40	---	---	---	---	PASS
SLC39A3	29985	broad.mit.edu	37	19	2733429	2733429	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2733429T>C	uc002lwg.2	-	3	519	c.265A>G	c.(265-267)ACC>GCC	p.T89A	SLC39A3_uc010xgy.1_Missense_Mutation_p.T89A	NM_144564	NP_653165	Q9BRY0	S39A3_HUMAN	solute carrier family 39 (zinc transporter),	89	Helical; (Potential).					integral to membrane|plasma membrane	zinc ion transmembrane transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGAGGATGGTTTCGGCCAGC	0.612													28	46	---	---	---	---	PASS
FUT3	2525	broad.mit.edu	37	19	5844194	5844194	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5844194C>A	uc002mdk.2	-	2	754	c.657G>T	c.(655-657)GTG>GTT	p.V219V	FUT3_uc002mdm.2_Silent_p.V219V|FUT3_uc002mdj.2_Silent_p.V219V|FUT3_uc002mdl.2_Silent_p.V219V	NM_001097641	NP_001091110	P21217	FUT3_HUMAN	fucosyltransferase 3	219	Lumenal (Potential).				protein glycosylation	Golgi cisterna membrane|integral to membrane|membrane fraction	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity				0						CGTACACGTCCACCTTGAGAT	0.627													5	68	---	---	---	---	PASS
RFX2	5990	broad.mit.edu	37	19	6040087	6040087	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6040087G>C	uc002meb.2	-	5	695	c.426C>G	c.(424-426)AGC>AGG	p.S142R	RFX2_uc002mec.2_Missense_Mutation_p.S142R|RFX2_uc010xiy.1_Missense_Mutation_p.S97R	NM_000635	NP_000626	P48378	RFX2_HUMAN	regulatory factor X2 isoform a	142					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			breast(4)|ovary(1)|skin(1)	6						AGACGATGGGGCTCCCCCCGA	0.697													5	22	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9091388	9091388	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9091388C>G	uc002mkp.2	-	1	631	c.427G>C	c.(427-429)GAA>CAA	p.E143Q		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	143	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTAGATGCTTCTTTGGTAAAA	0.488													9	74	---	---	---	---	PASS
PIN1	5300	broad.mit.edu	37	19	9959761	9959761	+	Intron	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9959761C>G	uc002mml.1	+						PIN1_uc002mmm.1_Intron|PIN1_uc002mmn.1_Intron	NM_006221	NP_006212	Q13526	PIN1_HUMAN	protein (peptidyl-prolyl cis/trans isomerase)						cell cycle|negative regulation of cell motility|negative regulation of ERK1 and ERK2 cascade|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of type I interferon production|positive regulation of Rho GTPase activity|positive regulation of ubiquitin-protein ligase activity|protein folding|regulation of mitosis|regulation of pathway-restricted SMAD protein phosphorylation	nucleoplasm	GTPase activating protein binding|mitogen-activated protein kinase kinase binding|peptidyl-prolyl cis-trans isomerase activity|phosphoserine binding|phosphothreonine binding			skin(1)	1						CCTCCTGGCTCCCAGGTCAGA	0.677													4	17	---	---	---	---	PASS
RDH8	50700	broad.mit.edu	37	19	10131451	10131451	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10131451C>T	uc002mmr.2	+	4	758	c.509C>T	c.(508-510)GCT>GTT	p.A170V		NM_015725	NP_056540	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	170	Helical; (Potential).				estrogen biosynthetic process|response to stimulus|visual perception	cytoplasm|integral to plasma membrane	binding|estradiol 17-beta-dehydrogenase activity|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity			ovary(3)|pancreas(1)	4			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	GAAAGCCTCGCTATCCAGCTG	0.577													13	13	---	---	---	---	PASS
DNM2	1785	broad.mit.edu	37	19	10886589	10886589	+	Intron	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10886589C>T	uc002mps.1	+						DNM2_uc010dxk.2_Intron|DNM2_uc002mpt.1_Intron|DNM2_uc002mpv.1_Intron|DNM2_uc002mpu.1_Intron|DNM2_uc010dxl.1_Intron	NM_001005361	NP_001005361	P50570	DYN2_HUMAN	dynamin 2 isoform 2						G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding			central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			CAAGGTAACCCTGAGCCTAGG	0.607													19	17	---	---	---	---	PASS
MPV17L2	84769	broad.mit.edu	37	19	18305764	18305764	+	Intron	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18305764G>T	uc002nid.2	+						MPV17L2_uc010ebj.2_Intron	NM_032683	NP_116072	Q567V2	M17L2_HUMAN	MPV17 mitochondrial membrane protein-like 2							integral to membrane					0						gcctctccccgcAGGCAGACT	0.473													20	27	---	---	---	---	PASS
ZNF98	148198	broad.mit.edu	37	19	22575630	22575630	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22575630T>C	uc002nqt.2	-	4	529	c.407A>G	c.(406-408)AAA>AGA	p.K136R		NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98	136					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				GTAACATTCTTTGTGCACCTT	0.294													8	32	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23545174	23545174	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23545174C>T	uc002nre.2	-	4	720	c.607G>A	c.(607-609)GTT>ATT	p.V203I	ZNF91_uc010xrj.1_Missense_Mutation_p.V171I	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	203						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				GTAATATAAACGCATTTATGT	0.318													6	50	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31769798	31769798	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31769798G>T	uc002nsy.3	-	2	966	c.901C>A	c.(901-903)CAA>AAA	p.Q301K		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	301					negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					GGCACTTTTTGGTAGTGTTTT	0.537													6	79	---	---	---	---	PASS
ZNF585A	199704	broad.mit.edu	37	19	37642521	37642521	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37642521C>A	uc002ofo.1	-	5	2511	c.2280G>T	c.(2278-2280)GTG>GTT	p.V760V	ZNF585A_uc002ofm.1_Silent_p.V705V|ZNF585A_uc002ofn.1_Silent_p.V705V	NM_199126	NP_954577	Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	760	C2H2-type 22.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGACGCTGAACACTGATTTCT	0.483													21	81	---	---	---	---	PASS
FBXO27	126433	broad.mit.edu	37	19	39521752	39521752	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39521752C>G	uc002okh.2	-	4	571	c.489G>C	c.(487-489)AAG>AAC	p.K163N		NM_178820	NP_849142	Q8NI29	FBX27_HUMAN	F-box protein 27	163	FBA.				protein catabolic process	SCF ubiquitin ligase complex	glycoprotein binding			ovary(1)	1	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			AGACCTGCTTCTTGCAACACC	0.532													34	159	---	---	---	---	PASS
EXOSC5	56915	broad.mit.edu	37	19	41903110	41903110	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41903110C>T	uc002oqo.2	-	1	147	c.124G>A	c.(124-126)GAT>AAT	p.D42N	CYP2F1_uc010xvw.1_Intron|BCKDHA_uc002oqm.3_Intron|BCKDHA_uc002oqp.1_5'Flank|BCKDHA_uc002oqq.2_5'Flank|BCKDHA_uc002oqr.2_5'Flank|BCKDHA_uc010xvz.1_5'Flank	NM_020158	NP_064543	Q9NQT4	EXOS5_HUMAN	exosome component Rrp46	42					DNA deamination|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5'-exoribonuclease activity|protein binding|RNA binding				0						GCAGAGCCATCTGGCCGCGAC	0.587													37	161	---	---	---	---	PASS
CEACAM3	1084	broad.mit.edu	37	19	42314027	42314027	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42314027G>T	uc002orn.1	+	4	643	c.567G>T	c.(565-567)AAG>AAT	p.K189N	CEACAM3_uc010eia.1_Intron|CEACAM3_uc002oro.1_RNA	NM_001815	NP_001806	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion	189	Cytoplasmic (Potential).					integral to membrane				skin(1)	1						GTGACCTCAAGGAGCAGCAGC	0.592													10	394	---	---	---	---	PASS
GSK3A	2931	broad.mit.edu	37	19	42740845	42740845	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42740845C>A	uc002otb.1	-	4	698	c.579G>T	c.(577-579)CTG>CTT	p.L193L	GSK3A_uc002ota.1_Silent_p.L111L|GSK3A_uc002otc.2_RNA	NM_019884	NP_063937	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	193	Protein kinase.				insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of insulin receptor signaling pathway|negative regulation of transferase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process	beta-catenin destruction complex|cytosol	ATP binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|tau-protein kinase activity			ovary(2)|lung(2)	4		Prostate(69;0.00682)				ATTCCAGCACCAGATTTAGGT	0.557													6	142	---	---	---	---	PASS
PSG8	440533	broad.mit.edu	37	19	43262247	43262247	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43262247C>A	uc002ouo.2	-	3	714	c.616G>T	c.(616-618)GGT>TGT	p.G206C	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_Missense_Mutation_p.G45C|PSG8_uc002ouh.2_Missense_Mutation_p.G206C|PSG8_uc010ein.2_Missense_Mutation_p.G84C|PSG8_uc002ouj.3_Intron|PSG8_uc002ouk.3_Missense_Mutation_p.G45C|PSG8_uc002oul.3_Missense_Mutation_p.G206C|PSG8_uc002oum.3_Intron|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Intron	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	206	Ig-like C2-type 1.					extracellular region					0		Prostate(69;0.00899)				TTTGTGACACCCAATAGAAAG	0.522													11	541	---	---	---	---	PASS
ZNF235	9310	broad.mit.edu	37	19	44793188	44793188	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44793188G>T	uc002oza.3	-	5	503	c.400C>A	c.(400-402)CCC>ACC	p.P134T	ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF235_uc002ozb.3_Missense_Mutation_p.P130T|ZNF235_uc010xwx.1_Missense_Mutation_p.P48T	NM_004234	NP_004225	Q14590	ZN235_HUMAN	zinc finger protein 93 homolog	134					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)	3		Prostate(69;0.0352)|all_neural(266;0.116)				TGGTGCTTGGGGAACTGAGAG	0.458													8	191	---	---	---	---	PASS
ZNF229	7772	broad.mit.edu	37	19	44932748	44932748	+	Silent	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44932748G>A	uc002oze.1	-	6	2642	c.2208C>T	c.(2206-2208)GGC>GGT	p.G736G	ZNF229_uc010ejk.1_Silent_p.G390G|ZNF229_uc010ejl.1_Silent_p.G730G	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	736					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				ATGGCTTCTCGCCAGTGTGCA	0.488													20	48	---	---	---	---	PASS
ZNF229	7772	broad.mit.edu	37	19	44932971	44932971	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44932971C>T	uc002oze.1	-	6	2419	c.1985G>A	c.(1984-1986)GGA>GAA	p.G662E	ZNF229_uc010ejk.1_Missense_Mutation_p.G316E|ZNF229_uc010ejl.1_Missense_Mutation_p.G656E	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	662	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				AAAGCCCTTTCCGCACTCTTG	0.493													31	161	---	---	---	---	PASS
IGFL2	147920	broad.mit.edu	37	19	46664046	46664046	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46664046C>A	uc010xxv.1	+	3	285	c.249C>A	c.(247-249)TCC>TCA	p.S83S	IGFL2_uc002peb.2_Silent_p.S94S	NM_001135113	NP_001128585	Q6UWQ7	IGFL2_HUMAN	IGF-like family member 2 isoform b	83						extracellular region	protein binding				0		Ovarian(192;0.0908)|all_neural(266;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)		GTCTTGATTCCTTTGGCCTCA	0.527													8	373	---	---	---	---	PASS
BCAT2	587	broad.mit.edu	37	19	49310325	49310325	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49310325C>A	uc002pkr.2	-	2	68	c.31G>T	c.(31-33)GCA>TCA	p.A11S	BCAT2_uc002pkp.2_5'UTR|BCAT2_uc002pkq.3_5'UTR|BCAT2_uc002pks.2_5'UTR|BCAT2_uc002pkt.2_Intron|BCAT2_uc010emh.1_Missense_Mutation_p.A11S|BCAT2_uc010emi.1_Intron|BCAT2_uc002pku.1_5'UTR|BCAT2_uc010emj.1_RNA	NM_001190	NP_001181	O15382	BCAT2_HUMAN	branched chain aminotransferase 2, mitochondrial	11						mitochondrial matrix	L-isoleucine transaminase activity|L-leucine transaminase activity|L-valine transaminase activity			ovary(1)	1		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Glutamic Acid(DB00142)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|Pyridoxal Phosphate(DB00114)	AGCTTTCGTGCCCAGATCTGG	0.587													12	15	---	---	---	---	PASS
TULP2	7288	broad.mit.edu	37	19	49398264	49398264	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49398264G>T	uc002pkz.2	-	6	656	c.505C>A	c.(505-507)CAA>AAA	p.Q169K		NM_003323	NP_003314	O00295	TULP2_HUMAN	tubby like protein 2	169					visual perception	cytoplasm|extracellular region				ovary(1)|kidney(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		CCAGGTCGTTGGTGGGCTTGC	0.488													4	23	---	---	---	---	PASS
NUCB1	4924	broad.mit.edu	37	19	49416395	49416395	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49416395A>T	uc002plb.3	+	6	680	c.608A>T	c.(607-609)GAG>GTG	p.E203V	NUCB1_uc002pla.2_Missense_Mutation_p.E203V|NUCB1_uc002plc.2_Missense_Mutation_p.E203V	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor	203	Potential.|Potential.					ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		AAGGAGGCGGAGAGGAAGCTG	0.572													24	14	---	---	---	---	PASS
CACNG7	59284	broad.mit.edu	37	19	54416243	54416243	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54416243C>T	uc002qcr.1	+	1	173	c.158C>T	c.(157-159)GCC>GTC	p.A53V	CACNG7_uc010era.1_Missense_Mutation_p.A53V	NM_031896	NP_114102	P62955	CCG7_HUMAN	voltage-dependent calcium channel gamma-7	53					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(1)	1	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		GTCAAGATGGCCCTGCACGCC	0.592													5	35	---	---	---	---	PASS
LENG9	94059	broad.mit.edu	37	19	54973455	54973455	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54973455G>C	uc010yez.1	-	1	1440	c.1321C>G	c.(1321-1323)CCA>GCA	p.P441A		NM_198988	NP_945339	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	441					RNA metabolic process	intracellular	catalytic activity|nucleic acid binding|zinc ion binding				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)		AGCTGCCCTGGAGACTGTAGT	0.642													15	45	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56423991	56423991	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56423991G>T	uc010ygg.1	-	5	1217	c.1192C>A	c.(1192-1194)CAC>AAC	p.H398N		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	398	NACHT.						ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TCATCAAAGTGTCTCATGAAA	0.448													43	48	---	---	---	---	PASS
ZFP28	140612	broad.mit.edu	37	19	57066051	57066051	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57066051G>A	uc002qnj.2	+	8	1968	c.1897G>A	c.(1897-1899)GCC>ACC	p.A633T	uc002qnk.1_Intron	NM_020828	NP_065879	Q8NHY6	ZFP28_HUMAN	zinc finger protein 28	633	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		TTCTCAGCTTGCCACTCATCA	0.453													39	98	---	---	---	---	PASS
ZNF543	125919	broad.mit.edu	37	19	57839995	57839995	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57839995C>A	uc002qoi.1	+	4	1510	c.1165C>A	c.(1165-1167)CAC>AAC	p.H389N		NM_213598	NP_998763	Q08ER8	ZN543_HUMAN	zinc finger protein 543	389	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)|pancreas(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CTACATTATCCACACTGGGGA	0.502													5	68	---	---	---	---	PASS
RBCK1	10616	broad.mit.edu	37	20	409639	409639	+	Silent	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:409639G>A	uc002wdp.3	+	11	2046	c.1353G>A	c.(1351-1353)CAG>CAA	p.Q451Q	RBCK1_uc002wdq.3_Silent_p.Q409Q|RBCK1_uc010fzy.2_RNA|RBCK1_uc002wdr.3_Silent_p.Q281Q	NM_031229	NP_112506	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing	451	IBR-type 2.				interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				CCCAGTGCCAGATCGTGGTAC	0.701													7	24	---	---	---	---	PASS
C20orf194	25943	broad.mit.edu	37	20	3268434	3268434	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3268434C>A	uc002wii.2	-	27	2381	c.2330G>T	c.(2329-2331)TGG>TTG	p.W777L	C20orf194_uc002wij.3_Missense_Mutation_p.W516L|C20orf194_uc002wik.2_Missense_Mutation_p.W451L	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943	777											0						ATACACCATCCATCTGGAAAG	0.507													5	91	---	---	---	---	PASS
MACROD2	140733	broad.mit.edu	37	20	13982995	13982995	+	Silent	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13982995C>T	uc002wou.2	+	2	372	c.108C>T	c.(106-108)CCC>CCT	p.P36P	MACROD2_uc002wot.2_Silent_p.P36P|MACROD2_uc002wos.2_RNA	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1	36											0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				ACTATATTCCCCTGAACAGCA	0.368													35	43	---	---	---	---	PASS
NINL	22981	broad.mit.edu	37	20	25462703	25462703	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25462703C>G	uc002wux.1	-	14	1785	c.1711G>C	c.(1711-1713)GAG>CAG	p.E571Q	NINL_uc010gdn.1_Missense_Mutation_p.E571Q|NINL_uc010gdo.1_Missense_Mutation_p.E354Q	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like	571	Potential.				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						CCTTCCAGCTCAGCTTGCAGC	0.687													9	31	---	---	---	---	PASS
TRPC4AP	26133	broad.mit.edu	37	20	33593519	33593519	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33593519C>G	uc002xbk.2	-	16	1949	c.1915G>C	c.(1915-1917)GAA>CAA	p.E639Q	TRPC4AP_uc002xbj.2_RNA|TRPC4AP_uc010zuq.1_Missense_Mutation_p.E230Q|TRPC4AP_uc002xbl.2_Missense_Mutation_p.E631Q|TRPC4AP_uc010zur.1_Missense_Mutation_p.E600Q	NM_015638	NP_056453	Q8TEL6	TP4AP_HUMAN	TRPC4-associated protein isoform a	639					protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)			ACCTGGTTTTCAAATCGGTCC	0.517													60	84	---	---	---	---	PASS
TRPC4AP	26133	broad.mit.edu	37	20	33593586	33593586	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33593586C>G	uc002xbk.2	-	16	1882	c.1848G>C	c.(1846-1848)CAG>CAC	p.Q616H	TRPC4AP_uc002xbj.2_RNA|TRPC4AP_uc010zuq.1_Missense_Mutation_p.Q207H|TRPC4AP_uc002xbl.2_Missense_Mutation_p.Q608H|TRPC4AP_uc010zur.1_Missense_Mutation_p.Q577H	NM_015638	NP_056453	Q8TEL6	TP4AP_HUMAN	TRPC4-associated protein isoform a	616					protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)			AGCTGTTGATCTGCTTCAGGA	0.522													42	73	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10942775	10942775	+	Splice_Site	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10942775C>A	uc002yip.1	-	13	1035	c.667_splice	c.e13-1	p.V223_splice	TPTE_uc002yis.1_Splice_Site|TPTE_uc002yiq.1_Splice_Site_p.V205_splice|TPTE_uc002yir.1_Splice_Site_p.V185_splice|TPTE_uc010gkv.1_Splice_Site_p.V85_splice	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTTCTGAAACCTGACAGTTTA	0.348													8	380	---	---	---	---	PASS
DONSON	29980	broad.mit.edu	37	21	34956954	34956954	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34956954C>T	uc002ysk.2	-	4	794	c.727G>A	c.(727-729)GGA>AGA	p.G243R	DONSON_uc002ysn.1_Missense_Mutation_p.G126R|DONSON_uc002ysi.1_Missense_Mutation_p.G3R|DONSON_uc002ysj.2_5'UTR|DONSON_uc002ysl.2_5'UTR|DONSON_uc010gme.2_Missense_Mutation_p.G216R|DONSON_uc002ysm.2_Missense_Mutation_p.G243R	NM_017613	NP_060083	Q9NYP3	DONS_HUMAN	downstream neighbor of SON	243					multicellular organismal development	nucleus				ovary(1)|central_nervous_system(1)	2						CTTGTCTTTCCAGCCATTTTT	0.428													4	37	---	---	---	---	PASS
TTC3	7267	broad.mit.edu	37	21	38459592	38459592	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38459592C>A	uc002yvz.2	+	2	140	c.35C>A	c.(34-36)GCG>GAG	p.A12E	TTC3_uc011aee.1_Intron|TTC3_uc002ywa.2_Missense_Mutation_p.A12E|TTC3_uc002ywb.2_Missense_Mutation_p.A12E|TTC3_uc010gnf.2_5'UTR|TTC3_uc011aed.1_Intron|TTC3_uc010gne.1_Missense_Mutation_p.A12E	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	12					protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				TTCACTGTGGCGGATTATGCC	0.403													6	114	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40572204	40572204	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40572204C>A	uc002yxk.1	-	39	4833	c.4694G>T	c.(4693-4695)GGG>GTG	p.G1565V	BRWD1_uc010goc.1_Missense_Mutation_p.G208V|BRWD1_uc002yxl.2_Missense_Mutation_p.G1565V	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1565					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TCTGGATAGCCCACTGCGTGA	0.438													6	107	---	---	---	---	PASS
SNAP29	9342	broad.mit.edu	37	22	21224807	21224807	+	Silent	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21224807C>A	uc011ahw.1	+	2	527	c.420C>A	c.(418-420)TCC>TCA	p.S140S		NM_004782	NP_004773	O95721	SNP29_HUMAN	synaptosomal-associated protein 29	140					cellular membrane fusion|exocytosis|protein transport|vesicle targeting	cell junction|cytoplasm|nucleus|synapse|synaptosome	SNAP receptor activity				0	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)			CCCTCACCTCCCAGCCCAACA	0.488													4	18	---	---	---	---	PASS
AP1B1	162	broad.mit.edu	37	22	29727776	29727776	+	Silent	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29727776C>T	uc003afj.2	-	18	2623	c.2439G>A	c.(2437-2439)CAG>CAA	p.Q813Q	AP1B1_uc003afi.2_Silent_p.Q806Q|AP1B1_uc003afk.2_Silent_p.Q806Q|AP1B1_uc003afl.2_Silent_p.Q786Q|AP1B1_uc003afh.2_Silent_p.Q10Q|AP1B1_uc011ako.1_Silent_p.Q366Q	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit	813					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						CGGAACCCACCTGGAGGTTGT	0.627													8	23	---	---	---	---	PASS
PES1	23481	broad.mit.edu	37	22	30975749	30975749	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30975749C>T	uc003aij.1	-	12	1417	c.1343G>A	c.(1342-1344)GGA>GAA	p.G448E	PES1_uc003aik.1_Missense_Mutation_p.G443E|PES1_uc003ail.1_Missense_Mutation_p.G431E|PES1_uc003aim.1_Missense_Mutation_p.G448E|PES1_uc003ain.1_Missense_Mutation_p.G309E|PES1_uc003aio.1_Missense_Mutation_p.G309E	NM_014303	NP_055118	O00541	PESC_HUMAN	pescadillo homolog 1, containing BRCT domain	448					cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	chromosome|nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						TGGGTCCTCTCCCCGCTGCAG	0.617													10	33	---	---	---	---	PASS
PES1	23481	broad.mit.edu	37	22	30975750	30975750	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30975750C>T	uc003aij.1	-	12	1416	c.1342G>A	c.(1342-1344)GGA>AGA	p.G448R	PES1_uc003aik.1_Missense_Mutation_p.G443R|PES1_uc003ail.1_Missense_Mutation_p.G431R|PES1_uc003aim.1_Missense_Mutation_p.G448R|PES1_uc003ain.1_Missense_Mutation_p.G309R|PES1_uc003aio.1_Missense_Mutation_p.G309R	NM_014303	NP_055118	O00541	PESC_HUMAN	pescadillo homolog 1, containing BRCT domain	448					cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	chromosome|nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						GGGTCCTCTCCCCGCTGCAGA	0.622													10	33	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38121252	38121252	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38121252C>T	uc003atr.2	+	7	2960	c.2689C>T	c.(2689-2691)CCC>TCC	p.P897S	TRIOBP_uc003atu.2_Missense_Mutation_p.P725S|TRIOBP_uc003atq.1_Missense_Mutation_p.P897S|TRIOBP_uc003ats.1_Missense_Mutation_p.P725S	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	897					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GAATTCATCTCCCCATCGTAC	0.547													43	110	---	---	---	---	PASS
SEPT3	55964	broad.mit.edu	37	22	42383754	42383754	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42383754C>A	uc003bbr.3	+	5	680	c.542C>A	c.(541-543)ACA>AAA	p.T181K	WBP2NL_uc011ape.1_Intron|SEPT3_uc003bbs.3_Missense_Mutation_p.T181K|SEPT3_uc010gyr.2_Missense_Mutation_p.T117K|SEPT3_uc011apj.1_Missense_Mutation_p.T117K|SEPT3_uc010gys.2_5'UTR	NM_145733	NP_663786	Q9UH03	SEPT3_HUMAN	septin 3 isoform A	181					cell cycle|cytokinesis	cell junction|septin complex	GTP binding				0						ATCTCTCCCACAGGACACTCG	0.517													5	26	---	---	---	---	PASS
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45198006	45198006	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45198006G>T	uc003bfd.2	+	9	1163	c.891G>T	c.(889-891)ATG>ATT	p.M297I	PRR5-ARHGAP8_uc003bfc.2_Missense_Mutation_p.M174I|PRR5-ARHGAP8_uc011aqi.1_Missense_Mutation_p.M165I|PRR5-ARHGAP8_uc011aqj.1_Missense_Mutation_p.M79I|ARHGAP8_uc003bfi.2_Missense_Mutation_p.M43I|ARHGAP8_uc010gzv.2_Missense_Mutation_p.M43I|ARHGAP8_uc003bfj.2_Missense_Mutation_p.M43I|ARHGAP8_uc003bfk.2_Missense_Mutation_p.M43I|ARHGAP8_uc003bfl.2_Intron|PRR5-ARHGAP8_uc003bfg.1_Missense_Mutation_p.M79I	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2						GCTGCCGGATGCCACCCTCCC	0.582													27	26	---	---	---	---	PASS
FAM116B	414918	broad.mit.edu	37	22	50754502	50754502	+	Silent	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50754502G>A	uc011aru.1	-	9	726	c.654C>T	c.(652-654)TCC>TCT	p.S218S	FAM116B_uc011arv.1_Silent_p.S218S	NM_001001794	NP_001001794	Q8NEG7	F116B_HUMAN	family with sequence similarity 116, member B	218											0		all_cancers(38;4.34e-09)|all_epithelial(38;3.03e-08)|all_lung(38;0.00141)|Breast(42;0.00387)|Lung NSC(38;0.0199)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGTCCACCCTGGATGGGATGC	0.622													19	64	---	---	---	---	PASS
REPS2	9185	broad.mit.edu	37	X	17043189	17043189	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17043189C>A	uc004cxv.1	+	4	725	c.554C>A	c.(553-555)ACA>AAA	p.T185K	REPS2_uc004cxw.1_Missense_Mutation_p.T184K|REPS2_uc011miw.1_Missense_Mutation_p.T44K	NM_004726	NP_004717	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	185					epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding			skin(2)|central_nervous_system(1)	3	Hepatocellular(33;0.183)					AAGCAGGAAACACAGTCTCCC	0.572													13	30	---	---	---	---	PASS
PDHA1	5160	broad.mit.edu	37	X	19368220	19368220	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19368220G>T	uc004czg.3	+	3	428	c.283G>T	c.(283-285)GAT>TAT	p.D95Y	PDHA1_uc004czh.3_Missense_Mutation_p.D130Y|PDHA1_uc011mjc.1_Missense_Mutation_p.D92Y|PDHA1_uc011mjd.1_Missense_Mutation_p.D92Y|PDHA1_uc010nfk.2_Missense_Mutation_p.D92Y	NM_000284	NP_000275	P08559	ODPA_HUMAN	pyruvate dehydrogenase E1 alpha 1 precursor	95					glycolysis|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	protein binding|pyruvate dehydrogenase (acetyl-transferring) activity			ovary(1)	1	Hepatocellular(33;0.183)				NADH(DB00157)	TCACTTGTGTGATGGTCAGGT	0.423													47	13	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34149721	34149721	+	Silent	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34149721C>T	uc004ddg.2	-	1	708	c.675G>A	c.(673-675)CCG>CCA	p.P225P		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	225	Pro-rich.							p.P225P(1)		ovary(4)|central_nervous_system(1)	5						CAGGAGGCTCCGGGCGGAGAC	0.657													18	4	---	---	---	---	PASS
TBX22	50945	broad.mit.edu	37	X	79277758	79277758	+	Intron	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79277758C>T	uc010nmg.1	+						TBX22_uc004edi.1_Intron|TBX22_uc004edj.1_5'UTR	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN	T-box 22 isoform 1						multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						ATCCCTTCACCCCCTCCAGGG	0.587													8	3	---	---	---	---	PASS
SERPINA7	6906	broad.mit.edu	37	X	105280577	105280577	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105280577A>T	uc004eme.1	-	1	489	c.473T>A	c.(472-474)GTC>GAC	p.V158D	SERPINA7_uc010npd.2_Missense_Mutation_p.V158D|SERPINA7_uc010npe.1_Missense_Mutation_p.V158D	NM_000354	NP_000345	P05543	THBG_HUMAN	serine (or cysteine) proteinase inhibitor, clade	158					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity				0					Levothyroxine(DB00451)|Liothyronine(DB00279)	GGTAGAAAAGACTTCAGTCTC	0.438													77	23	---	---	---	---	PASS
GUCY2F	2986	broad.mit.edu	37	X	108635314	108635314	+	Silent	SNP	G	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108635314G>C	uc004eod.3	-	14	2883	c.2607C>G	c.(2605-2607)CTC>CTG	p.L869L	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	869	Cytoplasmic (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						AGCCCTTTTTGAGAGATTCAG	0.463													10	22	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111025218	111025218	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111025218C>G	uc004epl.1	-	8	2964	c.2045G>C	c.(2044-2046)TGC>TCC	p.C682S	TRPC5_uc004epm.1_Missense_Mutation_p.C682S	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	682	Cytoplasmic (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						TCTTTTGGGGCAGAAGGTGTT	0.403													56	22	---	---	---	---	PASS
RBMX2	51634	broad.mit.edu	37	X	129545364	129545364	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129545364C>T	uc004evt.2	+	5	410	c.346C>T	c.(346-348)CGG>TGG	p.R116W		NM_016024	NP_057108	Q9Y388	RBMX2_HUMAN	RNA binding motif protein, X-linked 2	116							nucleotide binding|RNA binding			breast(3)|ovary(1)	4						GTCTAACTATCGGGCTCCTAA	0.488													11	45	---	---	---	---	PASS
MAGEA10	4109	broad.mit.edu	37	X	151303874	151303874	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151303874C>A	uc004ffk.2	-	5	627	c.219G>T	c.(217-219)GAG>GAT	p.E73D	MAGEA10_uc004ffl.2_Missense_Mutation_p.E73D	NM_001011543	NP_001011543	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	73											0	Acute lymphoblastic leukemia(192;6.56e-05)					CAGCAGAAACCTCCTCTGGGG	0.388													5	66	---	---	---	---	PASS
AVPR2	554	broad.mit.edu	37	X	153171522	153171522	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153171522G>T	uc004fjh.3	+	2	633	c.562G>T	c.(562-564)GGG>TGG	p.G188W	AVPR2_uc004fjg.3_5'UTR|AVPR2_uc004fji.2_Missense_Mutation_p.G188W	NM_000054	NP_000045	P30518	V2R_HUMAN	arginine vasopressin receptor 2 isoform 1	188	Extracellular (Potential).				activation of adenylate cyclase activity|excretion|G-protein signaling, coupled to cAMP nucleotide second messenger|hemostasis|positive regulation of gene expression|transmembrane transport|water transport	endoplasmic reticulum|endosome|Golgi apparatus|integral to plasma membrane	vasopressin receptor activity			breast(1)	1	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Terlipressin(DB02638)|Vasopressin(DB00067)	AGGTGGCAGCGGGGTCACTGA	0.637													4	20	---	---	---	---	PASS
RPL10	6134	broad.mit.edu	37	X	153628656	153628656	+	Intron	SNP	C	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153628656C>T	uc004fkm.2	+						uc010nuv.1_5'Flank|RPL10_uc004fko.2_Intron|RPL10_uc004fkn.1_Intron|RPL10_uc004fkp.1_3'UTR|RPL10_uc004fkq.1_Intron|RPL10_uc004fkr.1_Intron|SNORA70_uc010nux.1_RNA	NM_006013	NP_006004	P27635	RL10_HUMAN	ribosomal protein L10						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|endoplasmic reticulum	structural constituent of ribosome				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TTCCTTTCCTCATGGGGACCC	0.572													18	22	---	---	---	---	PASS
DNASE1L1	1774	broad.mit.edu	37	X	153631373	153631373	+	Silent	SNP	G	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153631373G>A	uc004fks.1	-	7	875	c.684C>T	c.(682-684)CGC>CGT	p.R228R	RPL10_uc004fkq.1_Intron|RPL10_uc004fkr.1_Intron|DNASE1L1_uc004fkt.1_Silent_p.R228R|DNASE1L1_uc004fku.1_Silent_p.R228R|DNASE1L1_uc004fkv.1_Silent_p.R228R|DNASE1L1_uc004fkw.1_Silent_p.R228R	NM_006730	NP_006721	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1 precursor	228					DNA catabolic process	endoplasmic reticulum	DNA binding|endodeoxyribonuclease activity, producing 5'-phosphomonoesters				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCAGCACGACGCGGTCATAGG	0.647													10	15	---	---	---	---	PASS
SCNN1D	6339	broad.mit.edu	37	1	1219143	1219143	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1219143delC	uc001adu.1	+						SCNN1D_uc001adt.1_Intron|SCNN1D_uc001adw.2_Intron|SCNN1D_uc001adx.2_Intron|SCNN1D_uc001adv.2_Intron	NM_002978	NP_002969			sodium channel, nonvoltage-gated 1, delta												0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		TCCTCCCCCTCCCTCCACAGG	0.458													4	2	---	---	---	---	
CDK11B	984	broad.mit.edu	37	1	1600092	1600093	+	Intron	DEL	TG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1600092_1600093delTG	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc009vkl.1_Intron|SLC35E2B_uc001ahe.3_Intron|SLC35E2B_uc001ahf.3_Intron|SLC35E2B_uc001ahg.3_Intron|SLC35E2B_uc001ahh.3_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						CTGTTTTTTTTGTTTGTTTGTT	0.317													4	2	---	---	---	---	
MEGF6	1953	broad.mit.edu	37	1	3508231	3508232	+	Intron	INS	-	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3508231_3508232insG	uc001akl.2	-							NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor							extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		AGGGACCTGATGGGGGCGCCAG	0.649													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	5817955	5817956	+	IGR	DEL	CA	-	-	rs115909991	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5817955_5817956delCA								AJAP1 (974105 upstream) : NPHP4 (104914 downstream)																							GGATCTCTCTcacacacacaca	0.252													3	5	---	---	---	---	
RERE	473	broad.mit.edu	37	1	8657559	8657560	+	Intron	INS	-	AA	AA			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8657559_8657560insAA	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc001aph.1_Intron	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CAATGAGAAGGAAAAAATATAT	0.307													4	2	---	---	---	---	
UBE4B	10277	broad.mit.edu	37	1	10093947	10093947	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10093947delT	uc001aqs.3	+						UBE4B_uc001aqr.3_Intron|UBE4B_uc010oai.1_Intron|UBE4B_uc010oaj.1_Intron	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1						apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TCTTTCTTCATTCTGAACTCC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	11480768	11480768	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11480768delT								UBIAD1 (132278 upstream) : PTCHD2 (58527 downstream)																							gaatgcctgcttacagtccca	0.000													4	2	---	---	---	---	
PAX7	5081	broad.mit.edu	37	1	18962315	18962318	+	Intron	DEL	TGTG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18962315_18962318delTGTG	uc001bay.2	+						PAX7_uc001baz.2_Intron|PAX7_uc010oct.1_Intron	NM_002584	NP_002575	P23759	PAX7_HUMAN	paired box 7 isoform 1						anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		tgtgtgtgtatgtgtgtgtgtgtg	0.456			T	FOXO1A	alveolar rhabdomyosarcoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	25034692	25034693	+	IGR	DEL	AA	-	-	rs34458040		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25034692_25034693delAA								SRRM1 (34921 upstream) : CLIC4 (37067 downstream)																							tcatccccccaaaaaaaaaaaa	0.218													4	2	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34278509	34278510	+	Intron	INS	-	T	T	rs139934790	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34278509_34278510insT	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CTGGACATAGGTTTTTTTCCCC	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	34789507	34789508	+	IGR	INS	-	T	T	rs71029034		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34789507_34789508insT								C1orf94 (104778 upstream) : MIR552 (345692 downstream)																							tccttccttcctccttccttcc	0.025													4	4	---	---	---	---	
RNF220	55182	broad.mit.edu	37	1	45023237	45023238	+	Intron	INS	-	TTCA	TTCA	rs142044059	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45023237_45023238insTTCA	uc001clv.1	+						RNF220_uc001clw.1_Intron|RNF220_uc010okx.1_Intron|RNF220_uc010oky.1_Intron	NM_018150	NP_060620	Q5VTB9	RN220_HUMAN	ring finger protein 220						protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						ATattcactcgttcattcattc	0.223													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	45284516	45284519	+	IGR	DEL	AAAC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45284516_45284519delAAAC								BTBD19 (4715 upstream) : PTCH2 (3569 downstream)																							tccctctcaaaaacaaacaaacaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	46837816	46837816	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46837816delT								NSUN4 (7126 upstream) : FAAH (22123 downstream)																							ctttttactgttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	46936542	46936543	+	IGR	DEL	TG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46936542_46936543delTG								FAAH (57022 upstream) : DMBX1 (36125 downstream)																							ATGTGGTCTCTGTGCTCAGGtt	0.287													2	5	---	---	---	---	
AGBL4	84871	broad.mit.edu	37	1	50408996	50408996	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50408996delG	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		agcagcatgtgaagtactgca	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	56537502	56537503	+	IGR	INS	-	AAC	AAC	rs146761105	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56537502_56537503insAAC								USP24 (856740 upstream) : PPAP2B (422930 downstream)																							ACAAATAAACAaacaacaacaa	0.084													3	3	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58312951	58312952	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58312951_58312952insA	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						atcacaggaggaaaaaaaaaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	59096307	59096308	+	IGR	DEL	AC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59096307_59096308delAC								TACSTD2 (53141 upstream) : MYSM1 (29282 downstream)																							tttttCCCTTACACTTTAAAAA	0.371													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	61178252	61178253	+	Intron	INS	-	A	A	rs146980354	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61178252_61178253insA	uc001czt.1	-											Homo sapiens cDNA FLJ39874 fis, clone SPLEN2015815.																		cacaggcaaccaaaaaaaatgg	0.000													4	2	---	---	---	---	
CACHD1	57685	broad.mit.edu	37	1	65074505	65074506	+	Intron	DEL	AG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65074505_65074506delAG	uc001dbo.1	+						CACHD1_uc001dbp.1_Intron|CACHD1_uc001dbq.1_Intron	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN	cache domain containing 1						calcium ion transport	integral to membrane				ovary(2)	2						TGATCCCTAAAGAGAGTTTATT	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	65438933	65438934	+	IGR	DEL	AA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65438933_65438934delAA								JAK1 (6314 upstream) : MIR101-1 (85183 downstream)																							aaggagaaagaaagagagaaag	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	68543172	68543172	+	Intron	DEL	G	-	-	rs111418275		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68543172delG	uc001deb.1	+						uc001dec.1_Intron					Homo sapiens cDNA FLJ38762 fis, clone KIDNE2013801.																		tatgtttccaggggggattat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	73567869	73567870	+	IGR	INS	-	AAC	AAC	rs148237922	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73567869_73567870insAAC								NEGR1 (819464 upstream) : LRRIQ3 (923834 downstream)																							tctgtctcaataacaacaacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	77715628	77715628	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77715628delG								PIGK (30496 upstream) : AK5 (32114 downstream)																							taatgatataggggacagtac	0.000													4	2	---	---	---	---	
TTLL7	79739	broad.mit.edu	37	1	84355735	84355748	+	Intron	DEL	AGAACTTCAAGGAT	-	-	rs71826512		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84355735_84355748delAGAACTTCAAGGAT	uc001djc.2	-						TTLL7_uc001djb.2_Intron|TTLL7_uc001djd.2_Intron|TTLL7_uc001dje.2_Intron|TTLL7_uc001djf.2_Intron|TTLL7_uc001djg.2_Intron	NM_024686	NP_078962	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7						cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity			ovary(1)	1				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		CGACTGCAGAAGAACTTCAAGGATATTGGTTTGT	0.388													2	4	---	---	---	---	
LPAR3	23566	broad.mit.edu	37	1	85355930	85355930	+	Intron	DEL	C	-	-	rs11344934		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85355930delC	uc009wcj.1	-							NM_012152	NP_036284	Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3						G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				lung(3)|ovary(2)	5						AGGCCCATGGCCAGGAAAAGA	0.448													4	2	---	---	---	---	
BRDT	676	broad.mit.edu	37	1	92457970	92457970	+	Intron	DEL	A	-	-	rs150514940		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92457970delA	uc001dok.3	+						BRDT_uc001dol.3_Intron|BRDT_uc010osz.1_Intron|BRDT_uc009wdf.2_Intron|BRDT_uc010ota.1_Intron|BRDT_uc010otb.1_Intron|BRDT_uc001dom.3_Intron	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		GAAGAGAGGCAAAAAAAAAAA	0.328													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	95420402	95420402	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95420402delC								CNN3 (27667 upstream) : ALG14 (27877 downstream)																							TTTGCTTCTTCCACTGCCTTT	0.383													4	2	---	---	---	---	
COL11A1	1301	broad.mit.edu	37	1	103463929	103463929	+	Intron	DEL	A	-	-	rs72228945		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103463929delA	uc001dul.2	-						COL11A1_uc001duk.2_Intron|COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCTTATAGAGaaaaaaaaaat	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	105890959	105890959	+	IGR	DEL	A	-	-	rs34373029		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:105890959delA								None (None upstream) : None (None downstream)																							gccatctatgacaatcccata	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	111036164	111036165	+	IGR	INS	-	T	T	rs142056482		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111036164_111036165insT								CYMP (2273 upstream) : KCNA10 (23674 downstream)																							Attttcttttcttttttttttt	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	118083469	118083469	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118083469delA								MAN1A2 (15149 upstream) : FAM46C (65135 downstream)																							TGGAAATGTTACAGGGATCCT	0.567													4	2	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120542540	120542541	+	Intron	INS	-	AGAA	AGAA	rs67531532		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120542540_120542541insAGAA	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		gagaaagagagagaaagaaaga	0.000			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142614233	142614233	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142614233delT								None (None upstream) : None (None downstream)																							tatctttccatttttttggtg	0.000													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142642170	142642170	+	Intron	DEL	A	-	-	rs113636242		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142642170delA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		ACTTTCAGGTAGAATTGGGGT	0.423													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143394172	143394173	+	IGR	INS	-	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143394172_143394173insC								None (None upstream) : LOC100286793 (253466 downstream)																							CCTACTTCAAACCTCAGACTTC	0.371													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	144014553	144014554	+	Intron	DEL	CT	-	-	rs61213304		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144014553_144014554delCT	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																		cacacacacactcacactcaca	0.015													3	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144529132	144529133	+	Intron	INS	-	G	G	rs75901853		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144529132_144529133insG	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						tatatttttttgagatgggatc	0.000													3	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144852877	144852877	+	Intron	DEL	T	-	-	rs71909310		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144852877delT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAACAGCCTGTTTGTAGGAAG	0.443			T	PDGFRB	MPD								5	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145057890	145057891	+	Intron	DEL	TG	-	-	rs72434786		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145057890_145057891delTG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						gagtggagactgtgccactgcg	0.064													3	5	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145117798	145117799	+	Intron	DEL	AT	-	-	rs71811407		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145117798_145117799delAT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						TTGTAGATACATTTCTATCTAA	0.322													3	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145190622	145190623	+	Intron	INS	-	T	T	rs143031337	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145190622_145190623insT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						cacagtttttgtttttgtttgt	0.000													6	3	---	---	---	---	
CHD1L	9557	broad.mit.edu	37	1	146755000	146755001	+	Intron	DEL	CT	-	-	rs71663972		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146755000_146755001delCT	uc001epm.3	+						uc001epp.2_Intron|CHD1L_uc001epn.3_Intron|CHD1L_uc010ozo.1_Intron|CHD1L_uc009wjg.2_Intron|CHD1L_uc009wjh.2_Intron|CHD1L_uc010ozp.1_Intron|CHD1L_uc001epo.3_Intron|CHD1L_uc010ozq.1_Intron|CHD1L_uc009wji.2_Intron	NM_004284	NP_004275	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein						chromatin remodeling|DNA repair	cytoplasm|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(3)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.0487)					TGCTTTCATACTCTCTAGGGAA	0.302													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148845956	148845956	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148845956delG								NBPF16 (87645 upstream) : LOC645166 (82330 downstream)																							TGGCATGCAAGGGGTTGAGTT	0.259													5	3	---	---	---	---	
LOC645166	645166	broad.mit.edu	37	1	148940156	148940156	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148940156delG	uc010pbc.1	+						LOC645166_uc010pbd.1_Intron|LOC645166_uc009wkw.1_Intron	NR_027355				Homo sapiens cDNA, FLJ18771.												0						aaaaaaaaaagaaaagttggc	0.000													4	2	---	---	---	---	
RPRD2	23248	broad.mit.edu	37	1	150394651	150394652	+	Intron	DEL	AC	-	-	rs66493922		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150394651_150394652delAC	uc009wlr.2	+						RPRD2_uc010pcc.1_Intron|RPRD2_uc001eup.3_Intron	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing								protein binding			ovary(1)	1						aaacacacatacacacacacac	0.000													1	9	---	---	---	---	
BNIPL	149428	broad.mit.edu	37	1	151017255	151017255	+	Intron	DEL	T	-	-	rs112736066		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151017255delT	uc001ewl.2	+						BNIPL_uc009wmi.2_Intron|BNIPL_uc009wmj.2_Intron	NM_138278	NP_612122	Q7Z465	BNIPL_HUMAN	BCL2/adenovirus E1B 19kD interacting protein						apoptosis|induction of apoptosis|negative regulation of cell proliferation|regulation of growth rate	cytosol|nucleus	identical protein binding				0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCTTCTCAGGTTTTTTTTTTT	0.274													2	4	---	---	---	---	
TDRKH	11022	broad.mit.edu	37	1	151762013	151762013	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151762013delG	uc009wnb.1	-						TDRKH_uc001eyy.2_Intron|TDRKH_uc001ezb.3_Intron|TDRKH_uc001ezc.3_Intron|TDRKH_uc001eza.3_Intron|TDRKH_uc001ezd.3_Intron|TDRKH_uc010pdn.1_Intron|uc001eze.2_5'Flank	NM_006862	NP_006853	Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing isoform a								RNA binding			ovary(1)|pancreas(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGAGGAATGTGGTTAGATAAT	0.358													4	2	---	---	---	---	
S100A10	6281	broad.mit.edu	37	1	151959503	151959504	+	Intron	INS	-	T	T	rs33977517		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151959503_151959504insT	uc001ezl.2	-							NM_002966	NP_002957	P60903	S10AA_HUMAN	S100 calcium binding protein A10						signal transduction		calcium ion binding|receptor binding				0	Melanoma(130;0.0648)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			CAGTGTTCCTCttttttttttt	0.158													4	2	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154686656	154686658	+	Intron	DEL	GTG	-	-	rs138099065		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154686656_154686658delGTG	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			tgtgtggtgtgtggtgtgtgtgt	0.000													4	2	---	---	---	---	
GON4L	54856	broad.mit.edu	37	1	155785777	155785777	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155785777delA	uc001flz.2	-						GON4L_uc001fly.1_Intron|GON4L_uc009wrh.1_Intron|GON4L_uc001fma.1_Intron|GON4L_uc001fmc.2_Intron|GON4L_uc001fmd.3_Intron|GON4L_uc009wri.2_5'UTR|GON4L_uc001fme.2_Intron|GON4L_uc001fmf.2_Intron	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a						regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AGCAGGGCAGAAAAAAAAAAA	0.348													5	3	---	---	---	---	
VANGL2	57216	broad.mit.edu	37	1	160376527	160376527	+	Intron	DEL	T	-	-	rs113737311		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160376527delT	uc001fwb.1	+						VANGL2_uc001fwc.1_Intron	NM_020335	NP_065068	Q9ULK5	VANG2_HUMAN	vang-like 2						apical protein localization|heart looping|nonmotile primary cilium assembly	apical plasma membrane|integral to membrane				ovary(1)	1	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGGGTTCTGGttttttttttt	0.274													4	2	---	---	---	---	
DCAF6	55827	broad.mit.edu	37	1	167978617	167978628	+	Intron	DEL	CTTCCTTCCTTT	-	-	rs144514807	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167978617_167978628delCTTCCTTCCTTT	uc001gew.2	+						DCAF6_uc001gev.2_Intron|DCAF6_uc001gex.2_Intron|DCAF6_uc010plk.1_Intron|DCAF6_uc001gey.2_Intron	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b						positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						tccttccttccttccttcctttctttctttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	171099424	171099424	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171099424delT								FMO3 (12467 upstream) : FMO6P (7455 downstream)																							tcttcacaaatttaagaatac	0.000													4	2	---	---	---	---	
PDC	5132	broad.mit.edu	37	1	186413733	186413734	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186413733_186413734insT	uc001gsa.2	-						PDC_uc001grz.2_Intron	NM_002597	NP_002588	P20941	PHOS_HUMAN	phosducin isoform a						G-protein coupled receptor protein signaling pathway|phototransduction|visual perception	actin cytoskeleton|cytosol|nucleus|photoreceptor inner segment|photoreceptor outer segment	phospholipase inhibitor activity			skin(1)	1		Breast(1374;1.53e-05)		KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.0129)		tacttttgctcttttttttctg	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	187310368	187310369	+	IGR	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187310368_187310369insA								PLA2G4A (352263 upstream) : None (None downstream)																							gaagagacagcaaagggggatg	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	190006060	190006060	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190006060delT								None (None upstream) : FAM5C (60737 downstream)																							ATATTCATGGTTTTTGCCCTT	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	193386722	193386722	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193386722delT								CDC73 (162782 upstream) : None (None downstream)																							tctttctttcttttttttttt	0.204													4	2	---	---	---	---	
DENND1B	163486	broad.mit.edu	37	1	197712607	197712607	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197712607delT	uc001guf.3	-						DENND1B_uc010ppe.1_Intron|DENND1B_uc010ppf.1_Intron|DENND1B_uc001gue.3_Intron	NM_144977	NP_659414	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 2							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						agttgtaatcttttttttggt	0.000													4	2	---	---	---	---	
FMOD	2331	broad.mit.edu	37	1	203216899	203216899	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203216899delT	uc010pqi.1	-						CHIT1_uc001gzm.1_Intron	NM_002023		Q06828	FMOD_HUMAN	fibromodulin precursor						transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)			tgtatgtgtatttttttttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	204386000	204386003	+	IGR	DEL	AAGG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204386000_204386003delAAGG								PPP1R15B (5056 upstream) : PIK3C2B (5756 downstream)																							aaggaaaggaaaggaagggaggga	0.000													5	5	---	---	---	---	
LRRN2	10446	broad.mit.edu	37	1	204596084	204596084	+	Intron	DEL	T	-	-	rs74642032		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204596084delT	uc001hbe.1	-						MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Intron|LRRN2_uc009xbf.1_Intron|MDM4_uc001hbc.2_Intron	NM_006338	NP_006329	O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2 precursor						cell adhesion	integral to membrane	receptor activity			central_nervous_system(2)	2	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			tttctttttcttttttttttt	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	205189737	205189737	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205189737delC								DSTYK (9010 upstream) : TMCC2 (7354 downstream)																							TTGGGTATGTCCCAGAGCCAT	0.438													4	2	---	---	---	---	
MFSD4	148808	broad.mit.edu	37	1	205561497	205561497	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205561497delT	uc001hcv.3	+						MFSD4_uc010prk.1_Intron|MFSD4_uc010prl.1_Intron|MFSD4_uc010prm.1_Intron|MFSD4_uc009xbn.2_Intron	NM_181644	NP_857595	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane				skin(2)|central_nervous_system(1)	3	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			CTCTGTGCTCTTTTTTTTTTT	0.343													4	2	---	---	---	---	
NUCKS1	64710	broad.mit.edu	37	1	205705089	205705089	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205705089delG	uc001hdb.2	-							NM_022731	NP_073568	Q9H1E3	NUCKS_HUMAN	nuclear casein kinase and cyclin-dependent							nucleus					0	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			ttttttttttggagacagggt	0.124													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	206670258	206670259	+	IGR	INS	-	GGAA	GGAA	rs138076360	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206670258_206670259insGGAA								IKBKE (36 upstream) : RASSF5 (10620 downstream)																							CTGCAAGGCAGGGCTCTCAGCT	0.564													4	2	---	---	---	---	
TRAF3IP3	80342	broad.mit.edu	37	1	209943754	209943755	+	Intron	DEL	GT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209943754_209943755delGT	uc001hho.2	+						TRAF3IP3_uc001hhl.2_Intron|TRAF3IP3_uc001hhm.1_Intron|TRAF3IP3_uc001hhn.2_Intron|TRAF3IP3_uc009xcr.2_Intron	NM_025228	NP_079504	Q9Y228	T3JAM_HUMAN	TRAF3-interacting JNK-activating modulator							integral to membrane	protein binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.045)		gcaggtggaggtgtgtgtgtgc	0.025													4	2	---	---	---	---	
TRAF3IP3	80342	broad.mit.edu	37	1	209944168	209944169	+	Intron	DEL	GT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209944168_209944169delGT	uc001hho.2	+						TRAF3IP3_uc001hhl.2_Intron|TRAF3IP3_uc001hhm.1_Intron|TRAF3IP3_uc001hhn.2_Intron|TRAF3IP3_uc009xcr.2_Intron	NM_025228	NP_079504	Q9Y228	T3JAM_HUMAN	TRAF3-interacting JNK-activating modulator							integral to membrane	protein binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.045)		gcaggtggaggtgtgtgtctat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	211891840	211891841	+	IGR	INS	-	T	T	rs144644659	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211891840_211891841insT								NEK2 (42873 upstream) : LPGAT1 (24959 downstream)																							tctatacagtatagggccctgt	0.005													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	212682561	212682562	+	IGR	INS	-	T	T	rs113026681		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212682561_212682562insT								NENF (62842 upstream) : ATF3 (56135 downstream)																							tggtgtgaaccttttttttttt	0.005													1	5	---	---	---	---	
PROX1	5629	broad.mit.edu	37	1	214166192	214166192	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214166192delA	uc001hkh.2	+						PROX1_uc001hkg.1_Intron	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1						aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		TAGAGCACTTAACCACTTTAT	0.358													4	2	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	217032815	217032815	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217032815delT	uc001hky.1	-						ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	cagatagtccttttcaagtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	218436102	218436102	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218436102delA								SPATA17 (395600 upstream) : RRP15 (22527 downstream)																							CTTTCCGTTCAGGTCCAGGAT	0.398													5	5	---	---	---	---	
MOSC2	54996	broad.mit.edu	37	1	220937438	220937439	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220937438_220937439insT	uc001hmq.2	+						MOSC2_uc001hmr.2_Intron|MOSC2_uc009xdx.2_Intron	NM_017898	NP_060368	Q969Z3	MOSC2_HUMAN	MOCO sulphurase C-terminal domain containing 2							mitochondrial outer membrane|peroxisome	molybdenum ion binding|oxidoreductase activity|pyridoxal phosphate binding				0				GBM - Glioblastoma multiforme(131;0.00499)|all cancers(67;0.204)		ATGTGCCCTAAttttttttttt	0.208													4	2	---	---	---	---	
CAPN2	824	broad.mit.edu	37	1	223913084	223913085	+	Intron	INS	-	A	A	rs80334583		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223913084_223913085insA	uc001hob.3	+						CAPN2_uc010puy.1_Intron	NM_001748	NP_001739	P17655	CAN2_HUMAN	calpain 2 isoform 1						proteolysis	cytoplasm|plasma membrane				lung(3)|breast(1)|skin(1)	5				GBM - Glioblastoma multiforme(131;0.109)		gacttcatctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
WNT9A	7483	broad.mit.edu	37	1	228120172	228120172	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228120172delT	uc001hri.2	-							NM_003395	NP_003386	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family,						anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|cornea development in camera-type eye|embryonic arm morphogenesis|embryonic skeletal joint morphogenesis|endoderm development|iris morphogenesis|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|neuron differentiation|positive regulation of smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding|signal transducer activity			central_nervous_system(1)|pancreas(1)	2		Prostate(94;0.0405)				ggaatcaacattttccaaact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	236068797	236068798	+	IGR	INS	-	A	A	rs139681266	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236068797_236068798insA								LYST (21857 upstream) : NID1 (70343 downstream)																							aatatacgtggaaaaaaaaaca	0.064													4	2	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237611085	237611085	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237611085delT	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ctctctctcctccctcctttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	238431721	238431722	+	IGR	DEL	TT	-	-	rs35844222		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238431721_238431722delTT								LOC100130331 (340104 upstream) : LOC339535 (211964 downstream)																							AATAATACACTTTAACATATAT	0.218													4	3	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240348474	240348474	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240348474delT	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			ctcctacacctttccccttct	0.109													4	4	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245719648	245719650	+	Intron	DEL	CCT	-	-	rs140323177		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245719648_245719650delCCT	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron|KIF26B_uc001ibg.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			ctccttcctccctcctcctcctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	245899087	245899087	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245899087delA								KIF26B (32659 upstream) : SMYD3 (13558 downstream)																							aggctagattaaaaaaaaaaa	0.010													4	2	---	---	---	---	
MYT1L	23040	broad.mit.edu	37	2	2043175	2043175	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2043175delA	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron|MYT1L_uc002qxf.1_Intron	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		acccactttcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
RNF144A	9781	broad.mit.edu	37	2	7075203	7075204	+	Intron	INS	-	A	A	rs142354976	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7075203_7075204insA	uc002qys.2	+						RNF144A_uc002qyt.2_Intron|RNF144A_uc002qyu.2_Intron	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144							Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		tcccttgagacatatgccatca	0.000													5	3	---	---	---	---	
C2orf48	348738	broad.mit.edu	37	2	10310640	10310641	+	Intron	DEL	GA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10310640_10310641delGA	uc002rai.1	+							NM_182626	NP_872432	Q96LS8	CB048_HUMAN	hypothetical protein LOC348738												0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)		CCTGTCAGGCGAGAGAGAGAGA	0.584													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	13574586	13574586	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13574586delC								TRIB2 (691730 upstream) : None (None downstream)																							cctctcctctcctctctcctc	0.114													4	2	---	---	---	---	
ADCY3	109	broad.mit.edu	37	2	25104122	25104123	+	Intron	INS	-	CCGAG	CCGAG	rs146501534	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25104122_25104123insCCGAG	uc002rfs.3	-						ADCY3_uc010ykm.1_Intron	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GCCAAAGCCATCCCAGCCCAGA	0.530													3	3	---	---	---	---	
PLB1	151056	broad.mit.edu	37	2	28817460	28817461	+	Intron	DEL	TG	-	-	rs146887368		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28817460_28817461delTG	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rmc.2_3'UTR	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					TGATCAAGACTGTGAAGGTTCT	0.609											OREG0014524	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
GALNT14	79623	broad.mit.edu	37	2	31161174	31161175	+	Intron	INS	-	ACAC	ACAC	rs145917296	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31161174_31161175insACAC	uc002rnr.2	-						GALNT14_uc002rnq.2_Intron|GALNT14_uc002rns.2_Intron|GALNT14_uc010ymr.1_Intron|GALNT14_uc010ezo.1_Intron|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN	N-acetylgalactosaminyltransferase 14							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					acatacaccctacacacacaca	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	37964030	37964031	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37964030_37964031insT								CDC42EP3 (64704 upstream) : FAM82A1 (188431 downstream)																							acttacaatcaggcaaaaggca	0.000													4	2	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54192240	54192241	+	Intron	DEL	AC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54192240_54192241delAC	uc002rxp.2	-						PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			acacacacagacacacacacac	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65162876	65162878	+	IGR	DEL	ATC	-	-	rs148764827		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65162876_65162878delATC								SERTAD2 (281830 upstream) : SLC1A4 (52701 downstream)																							gcttagagttatcatatgatata	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67262128	67262128	+	IGR	DEL	T	-	-	rs67101466		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67262128delT								MEIS1 (462238 upstream) : ETAA1 (362314 downstream)																							GGTTTGGGGGTTAGGAGGGCA	0.299													4	3	---	---	---	---	
PROKR1	10887	broad.mit.edu	37	2	68858650	68858651	+	Intron	DEL	CA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68858650_68858651delCA	uc002ses.2	+									Q8TCW9	PKR1_HUMAN	Homo sapiens mRNA for GPR73, complete cds.							integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(1)	1						ACATTacacgcacacacacaca	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	70367231	70367231	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70367231delC								LOC100133985 (14783 upstream) : C2orf42 (9788 downstream)																							cagggtttcaccatgttggcc	0.100													4	2	---	---	---	---	
DYSF	8291	broad.mit.edu	37	2	71708825	71708826	+	Intron	INS	-	ATCC	ATCC	rs75288288	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71708825_71708826insATCC	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						GGTCTTcatctatccatccatc	0.248													4	2	---	---	---	---	
EXOC6B	23233	broad.mit.edu	37	2	72417865	72417865	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72417865delA	uc010fep.2	-							NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						tttgtcatgtaatggtgtatc	0.070													4	2	---	---	---	---	
CCDC142	84865	broad.mit.edu	37	2	74708732	74708734	+	Intron	DEL	ATG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74708732_74708734delATG	uc002slr.2	-						TTC31_uc002sls.2_5'Flank|TTC31_uc010yrv.1_5'Flank|TTC31_uc002slt.2_5'Flank|TTC31_uc002slu.2_5'Flank|CCDC142_uc002slo.2_Intron|CCDC142_uc002slq.2_Intron|CCDC142_uc002slp.2_Intron	NM_032779	NP_116168	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142											central_nervous_system(1)	1						TGCCCACTCAATGATGAGGCAAG	0.537													8	7	---	---	---	---	
GNLY	10578	broad.mit.edu	37	2	85918617	85918617	+	5'Flank	DEL	A	-	-	rs111739895		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85918617delA	uc002sql.3	+						GNLY_uc010fgp.2_5'Flank|GNLY_uc010ysx.1_5'Flank	NM_006433	NP_006424	P22749	GNLY_HUMAN	granulysin isoform NKG5						cellular defense response|defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space					0						gatccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87070221	87070222	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87070221_87070222insT	uc002srs.3	+						CD8B_uc002srw.2_Intron|CD8B_uc002srx.2_Intron|CD8B_uc002sry.2_Intron|CD8B_uc010fgt.2_Intron|CD8B_uc002srz.2_Intron|CD8B_uc002ssa.2_Intron			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						AAGGAACtttcttttttttttt	0.173													4	2	---	---	---	---	
SMYD1	150572	broad.mit.edu	37	2	88399350	88399368	+	Intron	DEL	TTTCCTCTGGCTTCTCCCC	-	-	rs60237277		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88399350_88399368delTTTCCTCTGGCTTCTCCCC	uc002ssr.2	+						SMYD1_uc002ssq.1_Intron|SMYD1_uc002sss.2_Intron	NM_198274	NP_938015	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						tttggctccttttcctctggcttctcccctttcctctgg	0.096													4	2	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91810712	91810713	+	Intron	INS	-	T	T	rs139062859	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91810712_91810713insT	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						TAAATACAAAGTTTTTTTTAAC	0.252													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91863383	91863383	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91863383delA								LOC654342 (15408 upstream) : GGT8P (99985 downstream)																							aataaaaattaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91910308	91910309	+	IGR	INS	-	AC	AC			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91910308_91910309insAC								LOC654342 (62333 upstream) : GGT8P (53059 downstream)																							AGTacatacatacacacacaca	0.228													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92267303	92267303	+	IGR	DEL	G	-	-	rs113640567		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92267303delG								FKSG73 (136809 upstream) : None (None downstream)																							agttttaataggttttatatt	0.000													4	3	---	---	---	---	
EIF5B	9669	broad.mit.edu	37	2	99991401	99991402	+	Intron	DEL	TC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99991401_99991402delTC	uc002tab.2	+							NM_015904	NP_056988	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B						regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			ovary(2)|pancreas(1)	3						ctggattgcttctcttgactgt	0.000													4	2	---	---	---	---	
CHST10	9486	broad.mit.edu	37	2	101034835	101034836	+	5'Flank	INS	-	AC	AC	rs150758242	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101034835_101034836insAC	uc002tam.2	-							NM_004854	NP_004845	O43529	CHSTA_HUMAN	HNK-1 sulfotransferase						carbohydrate biosynthetic process|cell adhesion	Golgi membrane|integral to membrane|membrane fraction				ovary(1)	1						CGTGTATGTATacacacacaca	0.248													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	102218925	102218925	+	IGR	DEL	T	-	-	rs72382439		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102218925delT								RFX8 (127760 upstream) : MAP4K4 (95563 downstream)																							CCGTATATAGttttttttttt	0.214													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	104120639	104120639	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104120639delA								TMEM182 (686503 upstream) : LOC150568 (930166 downstream)																							tgaccgaaacaaaaggagaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	105327596	105327596	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105327596delC								LOC150568 (198382 upstream) : POU3F3 (144373 downstream)																							attcacctttcgatggacact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106166222	106166222	+	IGR	DEL	A	-	-	rs111357786		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106166222delA								FHL2 (110992 upstream) : NCK2 (195132 downstream)																							aaaacaactcaaaaaaaaaaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106656524	106656524	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106656524delG								NCK2 (145798 upstream) : C2orf40 (25589 downstream)																							GTGTGACAGAGAAGGATGTGT	0.443													4	2	---	---	---	---	
LIMS1	3987	broad.mit.edu	37	2	109159598	109159599	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109159598_109159599insA	uc002tef.2	+							NM_004987	NP_004978	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1						cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding				0						AAGTCTTTTAGAAATTTCActg	0.183													4	2	---	---	---	---	
GLI2	2736	broad.mit.edu	37	2	121643650	121643651	+	Intron	DEL	TG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121643650_121643651delTG	uc010flp.2	+						GLI2_uc010yyu.1_Intron|GLI2_uc002tmp.1_Intron|GLI2_uc010fln.1_Intron|GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Intron|GLI2_uc010flo.1_Intron|GLI2_uc002tmw.1_Intron	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				AAAGTAAATTtgtgtgtgtgtg	0.124													4	2	---	---	---	---	
MAP3K2	10746	broad.mit.edu	37	2	128090708	128090708	+	Intron	DEL	A	-	-	rs68151374		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128090708delA	uc002toj.1	-						MAP3K2_uc010flz.1_Intron	NM_006609	NP_006600	Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|cellular response to mechanical stimulus	nucleus	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein kinase binding			lung(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)		atgctgtctcaaaaaaaaaaa	0.179													4	2	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	132982492	132982493	+	Intron	INS	-	TA	TA			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132982492_132982493insTA	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						aaacactctttgcagaatctgg	0.000													4	2	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133006842	133006842	+	Intron	DEL	G	-	-	rs57689419		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133006842delG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						atgtctctcagaaagcttctg	0.000													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	138664158	138664183	+	IGR	DEL	AATACTTGGAGCCCTGGGTAGCTTTC	-	-	rs140831997	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138664158_138664183delAATACTTGGAGCCCTGGGTAGCTTTC								THSD7B (228871 upstream) : HNMT (57407 downstream)																							TGTGTCTGTGAATACTTGGAGCCCTGGGTAGCTTTCAACATTGGAC	0.465													4	2	---	---	---	---	
GTDC1	79712	broad.mit.edu	37	2	144738904	144738905	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144738904_144738905insT	uc002tvp.2	-						GTDC1_uc002tvo.2_Intron|GTDC1_uc002tvq.2_Intron|GTDC1_uc002tvr.2_Intron|GTDC1_uc010fnn.2_Intron|GTDC1_uc002tvs.2_Intron|GTDC1_uc010fno.2_Intron	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1						biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)		GAAGAACCATGTTTTTTTTTTT	0.277													4	2	---	---	---	---	
RND3	390	broad.mit.edu	37	2	151343663	151343664	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151343663_151343664insT	uc002txe.2	-						RND3_uc002txf.2_Intron|RND3_uc002txg.2_Intron|RND3_uc010zbv.1_Intron|RND3_uc010zbw.1_5'Flank	NM_005168	NP_005159	P61587	RND3_HUMAN	ras homolog gene family, member E precursor						actin cytoskeleton organization|cell adhesion|small GTPase mediated signal transduction	Golgi membrane	GTP binding|GTPase activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.106)		CCGAGAAAGACttttttttttc	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	151405547	151405547	+	IGR	DEL	T	-	-	rs75795441		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151405547delT								RND3 (61367 upstream) : RBM43 (699182 downstream)																							ATGCCATTCCTTTTTTTTTTT	0.363													4	2	---	---	---	---	
NEB	4703	broad.mit.edu	37	2	152485418	152485420	+	Intron	DEL	AAG	-	-	rs147925807		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152485418_152485420delAAG	uc010fnx.2	-							NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		AACAAaagaaaagaagaagaaga	0.182													2	4	---	---	---	---	
CACNB4	785	broad.mit.edu	37	2	152913410	152913413	+	Intron	DEL	ACAA	-	-	rs35963039		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152913410_152913413delACAA	uc002tya.2	-						CACNB4_uc002txz.2_Intron|CACNB4_uc010fnz.2_Intron	NM_000726	NP_000717	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4						axon guidance|membrane depolarization|synaptic transmission	cytosol|internal side of plasma membrane|plasma membrane|synapse|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.156)	Verapamil(DB00661)	ccttacttttacaaacatagacct	0.025													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	153089545	153089545	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153089545delA								STAM2 (57039 upstream) : FMNL2 (102206 downstream)																							agacaaacacaaaaataaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	168791919	168791920	+	IGR	DEL	AG	-	-	rs67225149		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168791919_168791920delAG								B3GALT1 (64553 upstream) : STK39 (18611 downstream)																							aaggaaagaaagagagagagag	0.010													4	2	---	---	---	---	
UBE2E3	10477	broad.mit.edu	37	2	181861839	181861839	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181861839delT	uc002unq.1	+						UBE2E3_uc002unr.1_Intron|UBE2E3_uc010fri.1_Intron	NM_182678	NP_872619	Q969T4	UB2E3_HUMAN	ubiquitin-conjugating enzyme E2E 3						protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|regulation of growth	cytoplasm|nucleolus	ATP binding|protein binding|ubiquitin-protein ligase activity			ovary(1)	1						CAAACTACACTTTTTTTTTTT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	192613530	192613531	+	IGR	INS	-	GTTTTGTTTTGTTTT	GTTTTGTTTTGTTTT	rs140853367	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192613530_192613531insGTTTTGTTTTGTTTT								OBFC2A (60283 upstream) : SDPR (85510 downstream)																							CACTCCTTCTAgttttgttttg	0.267													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	196974004	196974005	+	IGR	DEL	GT	-	-	rs113040233		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196974004_196974005delGT								DNAH7 (40468 upstream) : STK17B (24303 downstream)																							TCCTAGACTGgtgtgtgtgtgt	0.282													4	3	---	---	---	---	
ABI2	10152	broad.mit.edu	37	2	204221572	204221572	+	Intron	DEL	T	-	-	rs34891904		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204221572delT	uc002vaa.2	+						ABI2_uc010zig.1_Intron|ABI2_uc002uzz.2_Intron|ABI2_uc010zih.1_Intron|ABI2_uc010zii.1_Intron|ABI2_uc010zij.1_Intron	NM_005759	NP_005750	Q9NYB9	ABI2_HUMAN	abl interactor 2						actin polymerization or depolymerization|cell migration|peptidyl-tyrosine phosphorylation	cytoskeleton|cytosol|filopodium|lamellipodium	cytoskeletal adaptor activity|DNA binding|kinase binding|proline-rich region binding|SH3 domain binding|ubiquitin protein ligase binding				0						TTTTACACAATTTTTTTTTTT	0.224													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	204844524	204844524	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204844524delA								ICOS (18228 upstream) : PARD3B (565992 downstream)																							tctgaaaactaaaaaaaaaaa	0.000													3	3	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	205603522	205603522	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205603522delT	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		caacatctgattttttttctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	217895240	217895240	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217895240delG								TNP1 (170458 upstream) : DIRC3 (253508 downstream)																							TGAAGCAACAGGACAGATTTG	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	220663996	220663996	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220663996delG								SLC4A3 (157295 upstream) : None (None downstream)																							ACTTTTTTTTGGTGGCCGAGG	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	223190237	223190238	+	IGR	DEL	AG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223190237_223190238delAG								CCDC140 (20301 upstream) : SGPP2 (99084 downstream)																							gcaggcaggcagagagagagag	0.010													4	3	---	---	---	---	
PDE6D	5147	broad.mit.edu	37	2	232639304	232639304	+	Intron	DEL	T	-	-	rs141853180		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232639304delT	uc002vse.1	-						PDE6D_uc002vsf.1_Intron	NM_002601	NP_002592	O43924	PDE6D_HUMAN	phosphodiesterase 6D						regulation of GTP catabolic process|response to stimulus|visual perception		3',5'-cyclic-nucleotide phosphodiesterase activity|GTPase inhibitor activity|protein binding				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.142)		Epithelial(121;2.19e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00145)|LUSC - Lung squamous cell carcinoma(224;0.0125)|Lung(119;0.0154)		GAATATTATCttttttttttt	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	238229502	238229502	+	IGR	DEL	C	-	-	rs116614067	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238229502delC								COPS8 (222015 upstream) : COL6A3 (3153 downstream)																							GCACAGGCAGCGGCAAAGCTC	0.582													4	2	---	---	---	---	
LRRFIP1	9208	broad.mit.edu	37	2	238552379	238552382	+	Intron	DEL	ATGA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238552379_238552382delATGA	uc002vxc.2	+							NM_001137550	NP_001131022	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting						negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|cytoskeleton|nucleus	DNA binding|double-stranded RNA binding|protein binding			breast(3)	3		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		acaggaacagatgaatgaatgaat	0.333													2	4	---	---	---	---	
ESPNL	339768	broad.mit.edu	37	2	239041043	239041043	+	3'UTR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239041043delG	uc002vxq.3	+	9					ESPNL_uc010fyw.2_3'UTR	NM_194312	NP_919288	Q6ZVH7	ESPNL_HUMAN	espin-like											pancreas(1)	1		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		GACCAGCCCTGGCCTAGTCGT	0.687													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239365445	239365446	+	IGR	INS	-	AGG	AGG	rs143079877	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239365445_239365446insAGG								ASB1 (4555 upstream) : TWIST2 (391227 downstream)																							catgggtgttcaggatgctgag	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239656702	239656705	+	IGR	DEL	ACAC	-	-	rs144776366		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239656702_239656705delACAC								ASB1 (295812 upstream) : TWIST2 (99968 downstream)																							acatgcacagacacacacacatat	0.172													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	242456185	242456186	+	IGR	DEL	AC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242456185_242456186delAC								STK25 (7225 upstream) : BOK (42006 downstream)																							cacacacccaacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	79839	79839	+	IGR	DEL	T	-	-	rs143027947		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:79839delT								None (None upstream) : CHL1 (158811 downstream)																							ttagtGTGTGTTTTTTTTGTT	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	8169845	8169845	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8169845delA								GRM7 (386627 upstream) : LMCD1 (373666 downstream)																							CATCTTCTGTAAGGAGTAACC	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	8858816	8858816	+	IGR	DEL	A	-	-	rs76702617		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8858816delA								OXTR (47516 upstream) : RAD18 (62745 downstream)																							GGAGCCCAGCAAAAAGGGAAG	0.488													4	2	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10087286	10087286	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10087286delT	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		GTAAttttccttttttttttt	0.124			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	2	---	---	---	---	
IRAK2	3656	broad.mit.edu	37	3	10255911	10255912	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10255911_10255912insT	uc003bve.1	+							NM_001570	NP_001561	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2						activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8						ccgtgcctgacttttttttctt	0.000													4	2	---	---	---	---	
RAF1	5894	broad.mit.edu	37	3	12625747	12625748	+	3'UTR	INS	-	C	C	rs1051208	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12625747_12625748insC	uc003bxf.3	-	17					RAF1_uc011aut.1_3'UTR|RAF1_uc011auu.1_3'UTR	NM_002880	NP_002871	P04049	RAF1_HUMAN	v-raf-1 murine leukemia viral oncogene homolog						activation of MAPKK activity|apoptosis|axon guidance|cell proliferation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of peptidyl-serine phosphorylation|Ras protein signal transduction|synaptic transmission	cytosol|mitochondrial outer membrane|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity		ESRP1/RAF1(4)|SRGAP3/RAF1(4)	central_nervous_system(4)|prostate(4)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|liver(1)|ovary(1)	14					Sorafenib(DB00398)	ATCCACTTGCGCATCTACAGAA	0.554			T	SRGAP3	pilocytic astrocytoma				Noonan_syndrome				0	9	---	---	---	---	
THRB	7068	broad.mit.edu	37	3	24270128	24270128	+	Intron	DEL	A	-	-	rs138385171		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24270128delA	uc003ccx.3	-						THRB_uc010hfe.2_Intron|THRB_uc003ccy.3_Intron|THRB_uc003ccz.3_Intron|THRB_uc003cdc.2_Intron|THRB_uc003cdd.2_Intron|THRB_uc003cde.1_Intron	NM_001128176	NP_001121648	P10828	THB_HUMAN	thyroid hormone receptor, beta						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription corepressor activity|zinc ion binding			skin(2)|pancreas(1)	3					Levothyroxine(DB00451)|Liothyronine(DB00279)	tgtctcaaagaaaaaaaaaaa	0.129													2	4	---	---	---	---	
EOMES	8320	broad.mit.edu	37	3	27759323	27759323	+	Intron	DEL	A	-	-	rs34777083		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27759323delA	uc003cdx.2	-						EOMES_uc003cdy.3_Intron|EOMES_uc010hfn.2_Intron|EOMES_uc011axc.1_Intron	NM_005442	NP_005433	O95936	EOMES_HUMAN	eomesodermin						CD8-positive, alpha-beta T cell differentiation involved in immune response|cell differentiation involved in embryonic placenta development|endoderm formation|mesoderm formation|mesodermal to mesenchymal transition involved in gastrulation|positive regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|breast(1)	4						AGAAACACTTAAAAAAAAAAA	0.413													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	30511849	30511849	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30511849delA								RBMS3 (465230 upstream) : TGFBR2 (136145 downstream)																							AGTGATTGGTAAATATATGAT	0.294													4	2	---	---	---	---	
CMTM8	152189	broad.mit.edu	37	3	32302662	32302662	+	Intron	DEL	A	-	-	rs112115640		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32302662delA	uc003cex.2	+						CMTM8_uc010hfu.2_Intron	NM_178868	NP_849199	Q8IZV2	CKLF8_HUMAN	CKLF-like MARVEL transmembrane domain containing						chemotaxis	extracellular space|integral to membrane	cytokine activity				0						tgtccatctcaaaaaaaaaaa	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	39283460	39283461	+	IGR	DEL	GA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39283460_39283461delGA								XIRP1 (49383 upstream) : CX3CR1 (21525 downstream)																							gagagagggcgagagagagaga	0.000													4	2	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54877007	54877007	+	Intron	DEL	T	-	-	rs145158032		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54877007delT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		TGAGTGTAGCttttttttttt	0.184													5	3	---	---	---	---	
ATXN7	6314	broad.mit.edu	37	3	63885768	63885770	+	Intron	DEL	CAA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63885768_63885770delCAA	uc003dlw.3	+						ATXN7_uc003dlv.2_Intron|ATXN7_uc010hnv.2_Intron|ATXN7_uc010hnu.1_Intron	NM_000333	NP_000324	O15265	ATX7_HUMAN	ataxin 7 isoform a						cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		aaaaaacaagcaacaacaacaac	0.133													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	67941565	67941566	+	Intron	INS	-	AC	AC	rs10629405		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67941565_67941566insAC	uc003dnc.2	+											Homo sapiens mRNA; cDNA DKFZp686F1220 (from clone DKFZp686F1220).																		caataATAGATacacacacaca	0.064													4	3	---	---	---	---	
FRMD4B	23150	broad.mit.edu	37	3	69245689	69245690	+	Intron	INS	-	AAAAC	AAAAC	rs144990660	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69245689_69245690insAAAAC	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnu.2_Intron|FRMD4B_uc011bga.1_Intron	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CTTCAGACCAAAAAACAAAACA	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	70260817	70260818	+	IGR	INS	-	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70260817_70260818insG								MITF (243331 upstream) : FOXP1 (743919 downstream)																							cccttccctttcccttcccttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	71686020	71686020	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71686020delC								FOXP1 (52880 upstream) : EIF4E3 (42422 downstream)																							GCAAATCATGCAAAACTCAAC	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	83111036	83111036	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83111036delT								None (None upstream) : None (None downstream)																							gtcaaaaccatttgacaaatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	95712627	95712628	+	IGR	INS	-	A	A	rs142171650	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95712627_95712628insA								LOC255025 (817548 upstream) : EPHA6 (820797 downstream)																							TAGCTGAACATAAAAAAAAACA	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	107848510	107848510	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107848510delA								CD47 (38575 upstream) : IFT57 (31150 downstream)																							GTAATAGGGGAAAAACACAGG	0.264													5	3	---	---	---	---	
LSAMP	4045	broad.mit.edu	37	3	115558085	115558086	+	Intron	INS	-	TTCC	TTCC	rs28708454		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115558085_115558086insTTCC	uc003ebt.2	-						LSAMP_uc011bis.1_Intron	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		cccttccttctttccttccttc	0.114													5	3	---	---	---	---	
LSAMP	4045	broad.mit.edu	37	3	116163562	116163563	+	Intron	DEL	AC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116163562_116163563delAC	uc003ebt.2	-						LSAMP_uc011bis.1_Intron|LSAMP_uc010hqq.1_RNA	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		TAAAACAGGGacacacacacac	0.317													4	2	---	---	---	---	
PDIA5	10954	broad.mit.edu	37	3	122791759	122791760	+	Intron	INS	-	TGTGTGTG	TGTGTGTG	rs146511240	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122791759_122791760insTGTGTGTG	uc003egc.1	+						PDIA5_uc003egd.1_Intron	NM_006810	NP_006801	Q14554	PDIA5_HUMAN	protein disulfide isomerase A5 precursor						cell redox homeostasis|glycerol ether metabolic process|protein folding|response to stress	endoplasmic reticulum lumen	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0427)		ACCTCTCCTTCtgtgtgtgtgt	0.411													4	2	---	---	---	---	
ROPN1	54763	broad.mit.edu	37	3	123695285	123695286	+	Intron	INS	-	CA	CA	rs139704654	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123695285_123695286insCA	uc003eha.2	-							NM_017578	NP_060048	Q9HAT0	ROP1A_HUMAN	ropporin						signal transduction		cAMP-dependent protein kinase regulator activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.148)		ATGAAGAGGCTCACAGCCTCTC	0.465													3	3	---	---	---	---	
ABTB1	80325	broad.mit.edu	37	3	127397160	127397161	+	Intron	INS	-	GTGC	GTGC	rs139016470	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127397160_127397161insGTGC	uc003ejt.2	+						ABTB1_uc003ejr.2_Intron|ABTB1_uc003ejs.2_Intron|ABTB1_uc003eju.2_Intron|ABTB1_uc010hsm.2_Intron	NM_172027	NP_742024	Q969K4	ABTB1_HUMAN	ankyrin repeat and BTB (POZ) domain containing 1							cytoplasm|nucleolus|plasma membrane	translation elongation factor activity				0						AGTGTGTGTGTGCGTGCGCGTG	0.569													4	2	---	---	---	---	
RUVBL1	8607	broad.mit.edu	37	3	127866965	127866965	+	Intron	DEL	T	-	-	rs113586064		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127866965delT	uc003ekf.2	-							NM_003707	NP_003698	Q9Y265	RUVB1_HUMAN	RuvB-like 1						cell division|CenH3-containing nucleosome assembly at centromere|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|mitosis|regulation of growth|regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription, DNA-dependent	Golgi apparatus|Ino80 complex|membrane|microtubule organizing center|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|DNA helicase activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.181)		cataaagggcttttttttttt	0.000													4	2	---	---	---	---	
NEK11	79858	broad.mit.edu	37	3	130784392	130784392	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130784392delG	uc003eny.2	+						NEK11_uc003enx.2_Intron|NEK11_uc003eoa.2_Intron|NEK11_uc003enz.2_Intron|NEK11_uc010htn.2_Intron|NEK11_uc011blk.1_Intron|NEK11_uc011bll.1_Intron|NEK11_uc003enw.1_Intron|NEK11_uc011blm.1_Intron	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1						cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						ctggaatattggctcttttag	0.000													4	2	---	---	---	---	
NEK11	79858	broad.mit.edu	37	3	130945286	130945287	+	Intron	INS	-	G	G	rs137869423	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130945286_130945287insG	uc003eny.2	+						NEK11_uc003eoa.2_Intron|NEK11_uc003enz.2_Intron|NEK11_uc010htn.2_Intron|NEK11_uc011blk.1_Intron|NEK11_uc011bll.1_Intron	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1						cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						cccatcactgatgagtggataa	0.000													4	2	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131305083	131305083	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131305083delC	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						ACAGTGAACTCCAGAGTAAGA	0.269													4	2	---	---	---	---	
CEP63	80254	broad.mit.edu	37	3	134222956	134222956	+	Intron	DEL	T	-	-	rs138695656		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134222956delT	uc003eqo.1	+						CEP63_uc003eql.1_Intron|CEP63_uc003eqm.2_Intron|CEP63_uc003eqn.1_Intron	NM_025180	NP_079456	Q96MT8	CEP63_HUMAN	centrosomal protein 63 isoform a						cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding			ovary(1)	1						tctctctctcttttttttttt	0.000													4	3	---	---	---	---	
EPHB1	2047	broad.mit.edu	37	3	134512680	134512681	+	5'Flank	INS	-	GGGGC	GGGGC	rs146987905	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134512680_134512681insGGGGC	uc003eqt.2	+						EPHB1_uc010htz.1_5'Flank|EPHB1_uc011bly.1_5'Flank	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						AGGGGAGGGGAGGAGGAAGGCA	0.554													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137186107	137186108	+	IGR	DEL	CA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137186107_137186108delCA								IL20RB (456187 upstream) : SOX14 (297471 downstream)																							TGCGTGcacgcacacacacaca	0.342													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137606013	137606013	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137606013delA								SOX14 (121617 upstream) : CLDN18 (111645 downstream)																							atcatgagtgaactcccattc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137840020	137840020	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137840020delT								DZIP1L (5569 upstream) : A4GNT (2540 downstream)																							aacatgtatcttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	139051132	139051132	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139051132delC								PISRT1 (98768 upstream) : MRPS22 (11666 downstream)																							ctcagggagaccaaggtggct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	139510154	139510154	+	IGR	DEL	G	-	-	rs79198315		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139510154delG								NMNAT3 (113314 upstream) : CLSTN2 (143873 downstream)																							ATACCATAAAGGGGAATCACA	0.249													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	142623534	142623534	+	IGR	DEL	T	-	-	rs62905361		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142623534delT								PCOLCE2 (15600 upstream) : PAQR9 (44472 downstream)																							AGATTCCTGGTGACAGCAAGA	0.358													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	142828043	142828043	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142828043delA								SR140 (48476 upstream) : CHST2 (10625 downstream)																							actccatctcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	142852189	142852190	+	IGR	DEL	AC	-	-	rs56856482		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142852189_142852190delAC								CHST2 (10379 upstream) : SLC9A9 (131875 downstream)																							GTATCTGGGGacacacacacac	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	143609637	143609637	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143609637delT								SLC9A9 (42291 upstream) : C3orf58 (81003 downstream)																							GTAAAAGGCATTTTTTTTTTT	0.229													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	145569631	145569631	+	IGR	DEL	A	-	-	rs5853242		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145569631delA								None (None upstream) : PLOD2 (217597 downstream)																							accccgtctcaaaaaaaaaaa	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	146478584	146478584	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146478584delG								PLSCR5 (154581 upstream) : ZIC4 (625253 downstream)																							aaacagagaagggggggtgac	0.000													2	4	---	---	---	---	
CPB1	1360	broad.mit.edu	37	3	148551745	148551746	+	Intron	INS	-	AT	AT	rs149307299	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148551745_148551746insAT	uc003ewl.2	+							NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			CCACAGTGTCAATATACCCATT	0.342													3	3	---	---	---	---	
CPB1	1360	broad.mit.edu	37	3	148558100	148558101	+	Intron	INS	-	AGAT	AGAT	rs140702627	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148558100_148558101insAGAT	uc003ewl.2	+							NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			aGAAAGACCAAAGATAGGTTTT	0.262													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148669911	148669912	+	IGR	DEL	GT	-	-	rs66484229		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148669911_148669912delGT								CPA3 (55041 upstream) : GYG1 (39463 downstream)																							gtatgtgtgcgtgtgtgtgtgt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	151409839	151409840	+	IGR	INS	-	TA	TA	rs142967110	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151409839_151409840insTA								IGSF10 (233342 upstream) : AADACL2 (41864 downstream)																							CCTACTTTATGATTTTTCCTGT	0.228													4	2	---	---	---	---	
SGEF	26084	broad.mit.edu	37	3	153858758	153858759	+	Intron	INS	-	T	T	rs144338310	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153858758_153858759insT	uc011bog.1	+						SGEF_uc011boh.1_Intron	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine						regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			CTTCCATCCTAttttttttttg	0.198													4	2	---	---	---	---	
VEPH1	79674	broad.mit.edu	37	3	157133419	157133420	+	Intron	INS	-	T	T	rs143512291	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157133419_157133420insT	uc003fbj.1	-						VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1							plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			GTCACTTGCCCTTTTTTGTATA	0.139													4	3	---	---	---	---	
PPM1L	151742	broad.mit.edu	37	3	160778040	160778040	+	Intron	DEL	G	-	-	rs67346292		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160778040delG	uc003fdr.2	+						PPM1L_uc003fds.2_Intron|PPM1L_uc003fdt.2_Intron|PPM1L_uc010hwf.2_Intron	NM_139245	NP_640338	Q5SGD2	PPM1L_HUMAN	protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			ccaatgtcaaggacaggagaa	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161122645	161122645	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161122645delT								C3orf57 (32774 upstream) : OTOL1 (91951 downstream)																							ATATTTCTGATTTTTTTTTTC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	164146966	164146966	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164146966delC								MIR720 (87728 upstream) : SI (549721 downstream)																							cttcatgatgcccaccttctt	0.000													4	3	---	---	---	---	
SI	6476	broad.mit.edu	37	3	164755956	164755956	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164755956delT	uc003fei.2	-							NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TTTAGGAGAATTTTTTTTTTC	0.249										HNSCC(35;0.089)			4	2	---	---	---	---	
TNIK	23043	broad.mit.edu	37	3	170979314	170979328	+	Intron	DEL	TGGATGGATGGATGA	-	-	rs11268683		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170979314_170979328delTGGATGGATGGATGA	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			GTTTGTtggttggatggatggatgatggatggatg	0.279													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	172338316	172338316	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172338316delA								TNFSF10 (97047 upstream) : NCEH1 (10120 downstream)																							caacaacaacaaAAAAAAAAC	0.164													4	2	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173242021	173242021	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173242021delT	uc003fio.1	+							NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			cggcctcatataatttctttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180493333	180493335	+	Intron	DEL	GCA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180493333_180493335delGCA	uc003fko.2	-											Homo sapiens mRNA; cDNA DKFZp434A128 (from clone DKFZp434A128).																		gtcttacatggcagcagcaagag	0.000													4	2	---	---	---	---	
SOX2	6657	broad.mit.edu	37	3	181432199	181432199	+	3'UTR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181432199delA	uc003fkx.2	+	1					SOX2OT_uc003fkv.2_Intron|SOX2OT_uc003fkw.3_Intron	NM_003106	NP_003097	P48431	SOX2_HUMAN	sex-determining region Y-box 2						cell cycle arrest|chromatin organization|eye development|glial cell fate commitment|inner ear development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell proliferation|negative regulation of neuron differentiation|osteoblast differentiation|pituitary gland development|positive regulation of MAPKKK cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of caspase activity|response to growth factor stimulus|response to wounding|somatic stem cell maintenance	cytosol|transcription factor complex	miRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0	all_cancers(143;1.22e-16)|Ovarian(172;0.0283)		all cancers(12;1.82e-48)|Epithelial(37;9.85e-40)|OV - Ovarian serous cystadenocarcinoma(80;7.37e-23)|Lung(8;2.01e-21)|GBM - Glioblastoma multiforme(1;2.13e-08)			TGAGATAAATAAATTTTTGAA	0.289			A		NSCLC|oesophageal squamous carcinoma		MICROPHTHALMIA AND ESOPHAGEAL ATRESIA SYNDROME						4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181693924	181693924	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181693924delA	uc003fky.2	+											Homo sapiens cDNA clone IMAGE:5296886.																		GACTACCTTTAAAAAAAAAAA	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182408476	182408477	+	IGR	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182408476_182408477insA								SOX2OT (949473 upstream) : ATP11B (102814 downstream)																							ctggggatatgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182649685	182649685	+	IGR	DEL	A	-	-	rs74706045		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182649685delA								ATP11B (10266 upstream) : DCUN1D1 (10874 downstream)																							tgtctctattaaaaaaaaaaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186204359	186204360	+	Intron	INS	-	G	G	rs111354223		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186204359_186204360insG	uc003fqd.1	-											Homo sapiens cDNA FLJ32735 fis, clone TESTI2001229.																		gaaggaaggaaggacagactac	0.000													2	4	---	---	---	---	
AHSG	197	broad.mit.edu	37	3	186331721	186331721	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186331721delT	uc003fqk.3	+						AHSG_uc003fqj.2_Intron|AHSG_uc003fql.3_Intron|AHSG_uc003fqm.3_Intron|AHSG_uc010hyp.2_Intron	NM_001622	NP_001613	P02765	FETUA_HUMAN	alpha-2-HS-glycoprotein						acute-phase response|negative regulation of bone mineralization|negative regulation of insulin receptor signaling pathway|pinocytosis|positive regulation of phagocytosis|regulation of inflammatory response|skeletal system development	extracellular space	cysteine-type endopeptidase inhibitor activity|protein binding				0	all_cancers(143;3.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.27e-20)	GBM - Glioblastoma multiforme(93;0.0463)		tgtttttgtcttttttttttt	0.229													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189295726	189295729	+	IGR	DEL	TTCC	-	-	rs148151112		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189295726_189295729delTTCC								TPRG1 (254456 upstream) : TP63 (53487 downstream)																							cttccttcttttccttccttcctt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	192698321	192698321	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192698321delA								C3orf59 (62371 upstream) : HRASLS (260597 downstream)																							tggtgaatttaccatctagtg	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193920603	193920604	+	IGR	INS	-	CA	CA	rs141002776	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193920603_193920604insCA								HES1 (64207 upstream) : LOC100131551 (96820 downstream)																							agttgcacactcacacacaggc	0.079													3	5	---	---	---	---	
LSG1	55341	broad.mit.edu	37	3	194374244	194374245	+	Intron	INS	-	A	A	rs112813003		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194374244_194374245insA	uc003fui.2	-							NM_018385	NP_060855	Q9H089	LSG1_HUMAN	large subunit GTPase 1						nuclear export|protein transport	Cajal body|endoplasmic reticulum	GTP binding|hydrolase activity				0	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		ctctgtctcacaaaaaaaaaaa	0.223													3	3	---	---	---	---	
MUC20	200958	broad.mit.edu	37	3	195448898	195448899	+	Intron	INS	-	AA	AA	rs148812630		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195448898_195448899insAA	uc010hzo.2	+						MUC20_uc010hzp.2_5'Flank	NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L						protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		aactatgtttcaaaaaaaaaaa	0.064													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195470354	195470355	+	IGR	DEL	AA	-	-	rs35731635		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195470354_195470355delAA								MUC20 (5815 upstream) : MUC4 (3285 downstream)																							actccatctcaaaaaaaaaaaa	0.000													6	3	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195487360	195487360	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195487360delG	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ctaggaTGGAGTGGAGGGGGC	0.353													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195962122	195962123	+	RNA	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195962122_195962123insA	uc003fwf.1	-	1		c.2663_2664insT								Homo sapiens full length insert cDNA clone ZD56D02.																		GTGCAGCCTCCAAAAAAAAATC	0.495													4	2	---	---	---	---	
PAK2	5062	broad.mit.edu	37	3	196538211	196538211	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196538211delC	uc003fwy.3	+							NM_002577	NP_002568	Q13177	PAK2_HUMAN	p21-activated kinase 2						axon guidance|cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of apoptosis|regulation of defense response to virus by virus|regulation of growth|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|nucleus|perinuclear region of cytoplasm|plasma membrane	ATP binding|identical protein binding|protein kinase binding|protein serine/threonine kinase activity|protein tyrosine kinase activator activity			ovary(1)|lung(1)	2	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		tccctcccttccctcccttcc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	197186388	197186389	+	IGR	INS	-	G	G	rs149540272		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197186388_197186389insG								DLG1 (160245 upstream) : BDH1 (50266 downstream)																							tgtggtcgggagggatgCAGTT	0.262													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	37976	37976	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37976delC								None (None upstream) : ZNF595 (15251 downstream)																							aggtcctgtactttttttggt	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3593298	3593299	+	IGR	INS	-	T	T	rs139891284	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3593298_3593299insT								LRPAP1 (59074 upstream) : ADRA2C (174776 downstream)																							GTGAAGCTATGTTCTTTGTACT	0.188													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3595617	3595618	+	IGR	DEL	TG	-	-	rs72255472		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3595617_3595618delTG								LRPAP1 (61393 upstream) : ADRA2C (172457 downstream)																							tgcacatatttgtgtgtggggt	0.005													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3600621	3600623	+	IGR	DEL	AGC	-	-	rs71960441		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3600621_3600623delAGC								LRPAP1 (66397 upstream) : ADRA2C (167452 downstream)																							tgtgcatgtgagcagatgtgcat	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	4893265	4893266	+	IGR	INS	-	GG	GG			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4893265_4893266insGG								MSX1 (27607 upstream) : CYTL1 (123050 downstream)																							TCTTCTTCCTAGGgtgtgtgtg	0.272													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9611387	9611388	+	IGR	INS	-	CACA	CACA	rs138067248	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9611387_9611388insCACA								MIR548I2 (53450 upstream) : DRD5 (171870 downstream)																							ttggaaaCCACcacacacacac	0.168													4	2	---	---	---	---	
CLNK	116449	broad.mit.edu	37	4	10620845	10620845	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10620845delC	uc003gmo.3	-						CLNK_uc003gmp.2_Intron	NM_052964	NP_443196	Q7Z7G1	CLNK_HUMAN	mast cell immunoreceptor signal transducer						immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity			ovary(1)	1						GCTAACAATGCCTAGCTATCT	0.453													4	2	---	---	---	---	
CLNK	116449	broad.mit.edu	37	4	10629936	10629937	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10629936_10629937insT	uc003gmo.3	-						CLNK_uc003gmp.2_Intron	NM_052964	NP_443196	Q7Z7G1	CLNK_HUMAN	mast cell immunoreceptor signal transducer						immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity			ovary(1)	1						AGTTAGACTTGTTTTTTTTTTT	0.213													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	12611558	12611558	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12611558delA								None (None upstream) : HSP90AB2P (723479 downstream)																							GCTCTGGCATAAAAAAAAAAG	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13678286	13678287	+	Intron	DEL	AC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13678286_13678287delAC	uc003gna.1	+											Homo sapiens cDNA FLJ34570 fis, clone KIDNE2008072.																		atacatacagacacacacacac	0.030													2	4	---	---	---	---	
CC2D2A	57545	broad.mit.edu	37	4	15501552	15501554	+	Intron	DEL	GGA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15501552_15501554delGGA	uc010idv.2	+						CC2D2A_uc003gnx.2_Intron|CC2D2A_uc003gnu.2_Intron|CC2D2A_uc003gnv.2_Intron	NM_001080522	NP_001073991	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A isoform						cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3						TAGAACCTGGGGAGGAGGAAACG	0.350													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	18416812	18416812	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18416812delA								LCORL (393427 upstream) : None (None downstream)																							actccgtctcaaaaaaaaaaa	0.234													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	20011711	20011711	+	IGR	DEL	T	-	-	rs35556130		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20011711delT								None (None upstream) : SLIT2 (243524 downstream)																							ttcaaaacaatttttggctca	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	29774304	29774305	+	IGR	DEL	TG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29774304_29774305delTG								None (None upstream) : PCDH7 (947732 downstream)																							CTGgtgtgtatgtgtgtgtgtg	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31538050	31538053	+	IGR	DEL	TGTC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31538050_31538053delTGTC								PCDH7 (389629 upstream) : None (None downstream)																							tgtgtgtgtgtgtctctatttcat	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38566876	38566877	+	IGR	INS	-	GT	GT	rs145558328	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38566876_38566877insGT								TBC1D1 (426083 upstream) : FLJ13197 (47445 downstream)																							TGGTTTGAAAAgtgtgtgtgtg	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	45010116	45010117	+	IGR	DEL	TG	-	-	rs139131989	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45010116_45010117delTG								GNPDA2 (281504 upstream) : None (None downstream)																							ttcttttttctgtgtgtgtgtg	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	45234363	45234363	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45234363delT								GNPDA2 (505751 upstream) : GABRG1 (803426 downstream)																							AATGTCTGTGTTTTTTTTTTG	0.368													4	2	---	---	---	---	
ATP10D	57205	broad.mit.edu	37	4	47532464	47532467	+	Intron	DEL	TTTG	-	-	rs116399117		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47532464_47532467delTTTG	uc003gxk.1	+						ATP10D_uc003gxj.3_Intron	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D						ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						tgttgttctttttgtttgtttgtt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	48912313	48912313	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48912313delC								OCIAD2 (3498 upstream) : CWH43 (75952 downstream)																							cccttcccttcccttccttcc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49217676	49217677	+	IGR	INS	-	C	C	rs146012723	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49217676_49217677insC								CWH43 (153583 upstream) : None (None downstream)																							TTTTCCTTCCACCCaaccccct	0.109													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49264237	49264237	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49264237delT								CWH43 (200144 upstream) : None (None downstream)																							acccagctaattttttttttt	0.020													3	3	---	---	---	---	
DCUN1D4	23142	broad.mit.edu	37	4	52721161	52721161	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52721161delG	uc003gze.2	+						DCUN1D4_uc003gzf.2_Intron|DCUN1D4_uc011bzn.1_Intron|DCUN1D4_uc003gzg.2_Intron|DCUN1D4_uc003gzh.2_Intron|DCUN1D4_uc011bzo.1_Intron	NM_001040402	NP_001035492	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain											ovary(2)	2			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			gaaatgctctggtcccaagca	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53231933	53231934	+	IGR	INS	-	AC	AC	rs146049713	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53231933_53231934insAC								SPATA18 (268476 upstream) : USP46 (225195 downstream)																							gaaaatgtgatacacacacaca	0.000													3	3	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	55144391	55144400	+	Intron	DEL	AAAAAAAAAA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55144391_55144400delAAAAAAAAAA	uc003han.3	+						PDGFRA_uc003haa.2_Intron|PDGFRA_uc010igq.1_Intron|PDGFRA_uc003ham.2_Intron|PDGFRA_uc003hao.1_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	GCTCTTTATTaaaaaaaaaaaaaaaaaaaa	0.338			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57763567	57763568	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57763567_57763568insT								SPINK2 (75674 upstream) : REST (10474 downstream)																							tatgcccagccttttttttttg	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	61005362	61005366	+	IGR	DEL	TTTTC	-	-	rs77936644		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61005362_61005366delTTTTC								None (None upstream) : None (None downstream)																							ttttttttttttttcccctgcattc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	61231219	61231219	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61231219delA								None (None upstream) : LPHN3 (835755 downstream)																							AGCAAATTTGAAAAAAAAAAA	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	61659482	61659483	+	IGR	INS	-	CTT	CTT	rs10647531		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61659482_61659483insCTT								None (None upstream) : LPHN3 (407491 downstream)																							TCACCACAATCCTCCTAAATTT	0.351													5	3	---	---	---	---	
C4orf40	401137	broad.mit.edu	37	4	71015422	71015423	+	5'Flank	INS	-	A	A	rs138401309	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71015422_71015423insA	uc003hfa.3	+							NM_214711	NP_999876	Q6MZM9	CD040_HUMAN	hypothetical protein LOC401137 precursor							extracellular region					0						aggaaaaaaagaaaaaaaaatg	0.109													4	2	---	---	---	---	
SHROOM3	57619	broad.mit.edu	37	4	77479132	77479132	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77479132delC	uc011cbx.1	+							NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein						apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			TTCCTTGTGTCCAGAGAGTGC	0.473													4	2	---	---	---	---	
WDFY3	23001	broad.mit.edu	37	4	85662469	85662470	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85662469_85662470insT	uc003hpd.2	-							NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TCTCTATTCAGttttttttttt	0.218													4	2	---	---	---	---	
AFF1	4299	broad.mit.edu	37	4	87990239	87990240	+	Intron	INS	-	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87990239_87990240insC	uc003hqj.3	+						AFF1_uc003hqh.1_Intron|AFF1_uc011ccy.1_Intron|AFF1_uc011ccz.1_Intron|AFF1_uc003hqk.3_Intron|AFF1_uc011cda.1_Intron	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia							nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		CTTTTCTTTTGCCCCCCTGTGT	0.465													3	3	---	---	---	---	
FAM190A	401145	broad.mit.edu	37	4	92471076	92471077	+	Intron	INS	-	T	T	rs141299177		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:92471076_92471077insT	uc003hsv.3	+							NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2						gtcattgctgcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	93115491	93115492	+	IGR	INS	-	A	A	rs151166524	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93115491_93115492insA								FAM190A (592122 upstream) : GRID2 (110058 downstream)																							gaaataatgagaaaaaaagaag	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	95332244	95332245	+	IGR	INS	-	AAGG	AAGG	rs141921585	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95332244_95332245insAAGG								HPGDS (68217 upstream) : PDLIM5 (40793 downstream)																							aaagaaagaaaaaggaaggaag	0.074													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	114691334	114691335	+	IGR	DEL	GT	-	-	rs35829001		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114691334_114691335delGT								CAMK2D (8251 upstream) : ARSJ (130105 downstream)																							CTATAAGTTGgtgtgtgtgtgt	0.139													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	118810053	118810054	+	IGR	INS	-	A	A	rs78392193		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118810053_118810054insA								TRAM1L1 (803317 upstream) : NDST3 (144719 downstream)																							GCAGAAAAATGAAAAAAAAAAG	0.356													4	2	---	---	---	---	
KIAA1109	84162	broad.mit.edu	37	4	123101195	123101200	+	Intron	DEL	ACACAT	-	-	rs71780430	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123101195_123101200delACACAT	uc003ieh.2	+							NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein						regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						acacacacacacacatacacacacac	0.325													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	128796467	128796467	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128796467delT								HSPA4L (41945 upstream) : PLK4 (5578 downstream)																							gtattcattattttttttgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	129435935	129435936	+	Intron	INS	-	C	C	rs143543070	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129435935_129435936insC	uc003igh.1	+											Homo sapiens cDNA FLJ36097 fis, clone TESTI2020956.																		ttggttctccttttccgtcttc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	131201705	131201705	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131201705delA								None (None upstream) : None (None downstream)																							aaaaaacaacaaaaaaaaaaa	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	131751608	131751611	+	IGR	DEL	TTGT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131751608_131751611delTTGT								None (None upstream) : None (None downstream)																							AGTTCTGTTGTTGTTTGTTTGTTT	0.240													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	134431972	134431972	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134431972delA								PCDH10 (319241 upstream) : PABPC4L (685519 downstream)																							aatttacaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	135458738	135458739	+	IGR	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:135458738_135458739insA								PABPC4L (335835 upstream) : None (None downstream)																							gaaactccctcaaaaaaaactg	0.000													4	2	---	---	---	---	
SCOC	60592	broad.mit.edu	37	4	141230268	141230268	+	Intron	DEL	A	-	-	rs79868532	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141230268delA	uc003iib.2	+						uc003iic.1_Intron	NM_032547	NP_115936	Q9UIL1	SCOC_HUMAN	short coiled-coil protein isoform 4							Golgi apparatus|nucleus	protein binding				0	all_hematologic(180;0.162)					cattgagcataagagctgaaa	0.284													4	2	---	---	---	---	
SCOC	60592	broad.mit.edu	37	4	141235284	141235284	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141235284delG	uc003iib.2	+						uc003iic.1_Intron	NM_032547	NP_115936	Q9UIL1	SCOC_HUMAN	short coiled-coil protein isoform 4							Golgi apparatus|nucleus	protein binding				0	all_hematologic(180;0.162)					aaaaaaaaaagaaTGCATATG	0.189													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	146506393	146506394	+	IGR	INS	-	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146506393_146506394insC								SMAD1 (26070 upstream) : MMAA (34146 downstream)																							aaaaatacaaaaattagccagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	152818950	152818950	+	IGR	DEL	C	-	-	rs71596259		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152818950delC								PET112L (136804 upstream) : FBXW7 (423461 downstream)																							tattctctttcccgggtgaat	0.005													4	5	---	---	---	---	
ARFIP1	27236	broad.mit.edu	37	4	153730202	153730203	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153730202_153730203insA	uc003imz.2	+						ARFIP1_uc003inb.2_Intron|ARFIP1_uc003ina.2_Intron|ARFIP1_uc003inc.2_Intron|ARFIP1_uc011cij.1_Intron	NM_001025595	NP_001020766	P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1						intracellular protein transport|regulation of protein secretion	cytosol|Golgi membrane				ovary(1)	1	all_hematologic(180;0.093)					agacccgtctcaaaaaaaaaaT	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	156540641	156540641	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156540641delA								MAP9 (242519 upstream) : GUCY1A3 (47221 downstream)																							tcaaaaaaagaaaaaaaaaaa	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	157371868	157371869	+	IGR	INS	-	T	T	rs151325518	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157371868_157371869insT								CTSO (496820 upstream) : PDGFC (310895 downstream)																							cctcatatcccttttttttttc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	159346012	159346013	+	IGR	INS	-	CTT	CTT			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159346012_159346013insCTT								TMEM144 (169574 upstream) : RXFP1 (97034 downstream)																							ctccttcttgccttctcctcct	0.139													4	2	---	---	---	---	
DDX60L	91351	broad.mit.edu	37	4	169382822	169382823	+	Intron	INS	-	C	C	rs72529597	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169382822_169382823insC	uc003irq.3	-						DDX60L_uc003irr.1_Intron	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		AGAAATCAGGAAAAAAATGAGT	0.292													3	4	---	---	---	---	
PALLD	23022	broad.mit.edu	37	4	169791041	169791041	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169791041delC	uc011cjx.1	+						CBR4_uc011cjy.1_Intron|PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron|PALLD_uc003irw.2_Intron	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		tggtaaggtacccatatttag	0.179									Pancreatic_Cancer_Familial_Clustering_of				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	185497668	185497669	+	IGR	INS	-	T	T	rs111347723		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185497668_185497669insT								IRF2 (101942 upstream) : CASP3 (51183 downstream)																							tttttcttttcttttttttttt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	187010585	187010585	+	IGR	DEL	A	-	-	rs111878185		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187010585delA								TLR3 (4335 upstream) : FAM149A (54630 downstream)																							aaactctgtcaaaaaaaaaaa	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190545398	190545399	+	IGR	INS	-	ATT	ATT	rs35790619		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190545398_190545399insATT								None (None upstream) : FRG1 (316575 downstream)																							ttgtggaagacgttgtgatcac	0.119													4	4	---	---	---	---	
PLEKHG4B	153478	broad.mit.edu	37	5	173793	173796	+	Intron	DEL	TCAC	-	-	rs148689882		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173793_173796delTCAC	uc003jak.2	+							NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		TCACAAGCAGTCACTCACGAGCAG	0.574													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2255260	2255261	+	IGR	DEL	GC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2255260_2255261delGC								IRX4 (372380 upstream) : IRX2 (491020 downstream)																							ctgtgtgtgtgcacgtgtgtgt	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2581155	2581158	+	IGR	DEL	CCTT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2581155_2581158delCCTT								IRX4 (698275 upstream) : IRX2 (165123 downstream)																							tttctttcccccttccttccttcc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3212253	3212254	+	IGR	DEL	AT	-	-	rs149074484		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3212253_3212254delAT								C5orf38 (456741 upstream) : IRX1 (383914 downstream)																							gtatgtgcacatgtgtatgtgt	0.183													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3658278	3658279	+	IGR	DEL	TT	-	-	rs71604599		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3658278_3658279delTT								IRX1 (56762 upstream) : None (None downstream)																							tctctctgcgtttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4731682	4731682	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4731682delA								None (None upstream) : LOC340094 (302790 downstream)																							ccctgtctccaaaaaaaaaaa	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6816968	6816968	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6816968delT								PAPD7 (59807 upstream) : ADCY2 (579375 downstream)																							cattttgctattttttttttt	0.000													3	4	---	---	---	---	
ADCY2	108	broad.mit.edu	37	5	7433030	7433032	+	Intron	DEL	CTG	-	-	rs5865715		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7433030_7433032delCTG	uc003jdz.1	+							NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						gcttattgtactgcatgatgtac	0.123													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7857981	7857983	+	IGR	DEL	AGG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7857981_7857983delAGG								C5orf49 (6717 upstream) : FASTKD3 (1290 downstream)																							AAACTGCAGAAGGAGGAGCATCT	0.483													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10670197	10670198	+	IGR	INS	-	TGA	TGA	rs144059332	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10670197_10670198insTGA								ROPN1L (205060 upstream) : DAP (9145 downstream)																							gatggtgagagtgatgataatg	0.000													4	2	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11405691	11405692	+	Intron	DEL	AA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11405691_11405692delAA	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						ggactccgttaaaaaaaaaaag	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	13545406	13545406	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13545406delT								None (None upstream) : DNAH5 (145031 downstream)																							ATTTCAGCTATTTTATGAGTT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	15193254	15193255	+	IGR	INS	-	GT	GT	rs145070473	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15193254_15193255insGT								ANKH (321367 upstream) : FBXL7 (307050 downstream)																							tgtttgtgcacgtgtgtgtgtg	0.292													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	18106509	18106510	+	IGR	INS	-	TA	TA			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18106509_18106510insTA								BASP1 (829574 upstream) : None (None downstream)																							ttctctctctctctctctccct	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	18467601	18467602	+	IGR	INS	-	GT	GT	rs143159076	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18467601_18467602insGT								None (None upstream) : None (None downstream)																							CAGgtgtgtgcgtgtgtgtgtg	0.228													4	3	---	---	---	---	
CDH18	1016	broad.mit.edu	37	5	19865438	19865438	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19865438delA	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TTTCAACTTGAAAAGCTGCTT	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	36771141	36771141	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36771141delC								SLC1A3 (82707 upstream) : NIPBL (105720 downstream)																							ctggatccctccccacaacac	0.000													4	2	---	---	---	---	
EGFLAM	133584	broad.mit.edu	37	5	38438244	38438244	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38438244delT	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron|EGFLAM_uc003jle.1_Intron|EGFLAM_uc003jlf.1_Intron	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					aaaaaaaaaGTGGAAACTGGA	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	38655341	38655341	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38655341delT	uc003jlj.2	+											Homo sapiens cDNA clone IMAGE:4829282.																		AACGCACTGCTTTTTTTTTTT	0.274													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	40396941	40396941	+	IGR	DEL	A	-	-	rs11291962		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40396941delA								DAB2 (971606 upstream) : PTGER4 (283091 downstream)																							CTTAAACCCCAGTGAGTTCAG	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	40706791	40706791	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40706791delA								PTGER4 (12956 upstream) : TTC33 (4889 downstream)																							accaaaaaggaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	41640333	41640333	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41640333delA								PLCXD3 (129603 upstream) : OXCT1 (89835 downstream)																							ACTTAAACTCAAGGGACATGT	0.363													4	2	---	---	---	---	
ZNF131	7690	broad.mit.edu	37	5	43137678	43137679	+	Intron	INS	-	A	A	rs35143949		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43137678_43137679insA	uc011cpw.1	+						ZNF131_uc010ivl.1_Intron|ZNF131_uc003jnj.3_Intron|ZNF131_uc003jnk.2_Intron|ZNF131_uc003jnn.3_Intron|ZNF131_uc003jnl.1_Intron|ZNF131_uc010ivm.1_Intron	NM_003432	NP_003423	P52739	ZN131_HUMAN	zinc finger protein 131							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ggatggctatcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
MGC42105	167359	broad.mit.edu	37	5	43219831	43219831	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43219831delT	uc003jno.2	+							NM_153361	NP_699192	Q8IY84	NIM1_HUMAN	serine/threonine-protein kinase NIM1								ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|stomach(1)|large_intestine(1)|breast(1)	9						tgattgtgtcttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	43422291	43422292	+	IGR	DEL	GA	-	-	rs10552784		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43422291_43422292delGA								CCL28 (9803 upstream) : C5orf28 (22063 downstream)																							CAAGGGCAGTGAGAGAGAGAGA	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	46327667	46327667	+	IGR	DEL	G	-	-	rs62389944		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46327667delG								HCN1 (631447 upstream) : None (None downstream)																							gcacacatccgaaagaagttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	49440225	49440225	+	IGR	DEL	A	-	-	rs150430340		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49440225delA								None (None upstream) : EMB (251808 downstream)																							ctgctctatcaaaaaaaaagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	73576454	73576454	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73576454delA								RGNEF (339041 upstream) : ENC1 (346781 downstream)																							CACTTAGAAGAAAAAAAAAAA	0.428													3	3	---	---	---	---	
F2RL1	2150	broad.mit.edu	37	5	76127361	76127361	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76127361delT	uc003keo.2	+							NM_005242	NP_005233	P55085	PAR2_HUMAN	coagulation factor II (thrombin) receptor-like 1						blood coagulation|elevation of cytosolic calcium ion concentration|positive regulation of leukocyte chemotaxis|positive regulation of positive chemotaxis|regulation of blood coagulation	Golgi apparatus|integral to plasma membrane	receptor binding|thrombin receptor activity			central_nervous_system(1)	1		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;7.7e-51)|Epithelial(54;2.77e-45)|all cancers(79;3.47e-41)		CCTAAACTGAttttttttttt	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	77254947	77254947	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77254947delA								TBCA (182762 upstream) : AP3B1 (43204 downstream)																							GGGGTTTTACAAACCTAAGAA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	95047167	95047167	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95047167delA								SPATA9 (28453 upstream) : RHOBTB3 (6170 downstream)																							tcagaagtagaaaaagggaca	0.000													4	2	---	---	---	---	
CAST	831	broad.mit.edu	37	5	96054250	96054250	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96054250delA	uc003klz.1	+						CAST_uc003klt.2_Intron|CAST_uc003klu.2_Intron|CAST_uc003klv.2_Intron|CAST_uc003klw.2_Intron|CAST_uc003klx.2_Intron|CAST_uc003kly.2_Intron|CAST_uc011cuo.1_Intron|CAST_uc011cup.1_Intron|CAST_uc011cuq.1_Intron|CAST_uc011cur.1_Intron|CAST_uc011cus.1_Intron|CAST_uc003kma.1_Intron|CAST_uc011cut.1_Intron|CAST_uc003kmb.2_Intron|CAST_uc003kmc.2_Intron|CAST_uc003kmd.2_Intron|CAST_uc003kme.2_Intron|CAST_uc003kmf.2_Intron	NM_001042443	NP_001035908	P20810	ICAL_HUMAN	calpastatin isoform i								calcium-dependent cysteine-type endopeptidase inhibitor activity|protein binding			central_nervous_system(3)|ovary(1)|kidney(1)	5		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		cctaaaagttaaaaaaaaaaa	0.219													4	2	---	---	---	---	
ERAP2	64167	broad.mit.edu	37	5	96219739	96219742	+	Intron	DEL	TATC	-	-	rs146256833		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96219739_96219742delTATC	uc003kmq.2	+						uc003kmo.1_Intron|ERAP2_uc003kmt.2_Intron|ERAP2_uc003kmr.2_Intron|ERAP2_uc003kms.2_Intron|ERAP2_uc003kmu.2_Intron	NM_022350	NP_071745	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2						antigen processing and presentation of endogenous peptide antigen via MHC class I|proteolysis|regulation of blood pressure	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding				0		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		AATTTGTTTTtatctatctatcta	0.245													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	96921707	96921707	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96921707delA								RIOK2 (402702 upstream) : None (None downstream)																							TAGCATATAGAATTTGGAGAT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	99296309	99296309	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99296309delA								None (None upstream) : LOC100133050 (418900 downstream)																							agtggtttgtagttctccttt	0.000													4	2	---	---	---	---	
C5orf13	9315	broad.mit.edu	37	5	111058801	111058801	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111058801delG	uc003kpk.2	-									Q16612	NP311_HUMAN	Homo sapiens cDNA FLJ55239 complete cds, moderately similar to Neuronal protein 3.1.							cytoplasm				skin(1)	1		all_cancers(142;0.00597)|all_epithelial(76;0.000144)|Prostate(80;0.0115)|Colorectal(10;0.0446)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;5.45e-09)|Epithelial(69;2e-08)|all cancers(49;1.9e-06)|COAD - Colon adenocarcinoma(37;0.0514)|Colorectal(14;0.0629)		ACCTCTGACCGGGAGTCTGGA	0.527													4	2	---	---	---	---	
SNX24	28966	broad.mit.edu	37	5	122239161	122239162	+	Intron	DEL	GC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122239161_122239162delGC	uc011cwo.1	+						SNX24_uc003ktf.2_Intron|SNX24_uc010jcy.2_Intron	NM_014035	NP_054754	Q9Y343	SNX24_HUMAN	SBBI31 protein						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0		Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000654)|Epithelial(69;0.0016)|all cancers(49;0.0139)		accaacttttgcactgtgtttt	0.050													4	2	---	---	---	---	
SEC24A	10802	broad.mit.edu	37	5	134039743	134039746	+	Intron	DEL	TTTA	-	-	rs113262946		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134039743_134039746delTTTA	uc003kzs.2	+						SEC24A_uc011cxu.1_Intron	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AATTGCTGTTtttatttatttatt	0.147													4	2	---	---	---	---	
CXCL14	9547	broad.mit.edu	37	5	134908732	134908732	+	Intron	DEL	A	-	-	rs111277613		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134908732delA	uc003lay.2	-							NM_004887	NP_004878	O95715	CXL14_HUMAN	small inducible cytokine B14 precursor						cell-cell signaling|chemotaxis|immune response|signal transduction	extracellular space|Golgi apparatus	chemokine activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AATTTTCAGGAAAAAAAAAAG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	144273019	144273019	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:144273019delC								KCTD16 (416075 upstream) : PRELID2 (865563 downstream)																							caaagactttcccagacaaaa	0.000													1	5	---	---	---	---	
SLC36A2	153201	broad.mit.edu	37	5	150719738	150719739	+	Intron	INS	-	GAGGAGGA	GAGGAGGA	rs143313685	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150719738_150719739insGAGGAGGA	uc003lty.2	-						GM2A_uc011dcs.1_Intron|SLC36A2_uc003ltz.2_Intron|SLC36A2_uc003lua.2_Intron|SLC36A2_uc010jhv.2_Intron|SLC36A2_uc011dct.1_Intron	NM_181776	NP_861441	Q495M3	S36A2_HUMAN	solute carrier family 36, member 2						cellular nitrogen compound metabolic process	cytoplasm|integral to membrane|plasma membrane	glycine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ggaaggaggaggaggaggaaga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172204703	172204703	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172204703delT								DUSP1 (6500 upstream) : ERGIC1 (56520 downstream)																							CTGTTGACTCTTTTTTTTTTC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	361558	361559	+	IGR	INS	-	C	C	rs72551075		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:361558_361559insC								DUSP22 (10205 upstream) : IRF4 (30193 downstream)																							CCAGCTGTGTGCGTACCCCCAC	0.520													6	3	---	---	---	---	
GMDS	2762	broad.mit.edu	37	6	1980571	1980571	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1980571delA	uc003mtq.2	-							NM_001500	NP_001491	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase						'de novo' GDP-L-fucose biosynthetic process|GDP-mannose metabolic process|leukocyte cell-cell adhesion		coenzyme binding|GDP-mannose 4,6-dehydratase activity			central_nervous_system(1)	1	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		caaaataaagaaatgaaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	4436786	4436787	+	IGR	DEL	CA	-	-	rs151174865		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4436786_4436787delCA								PECI (300955 upstream) : CDYL (269606 downstream)																							CCATGAAAAGcacacacacaca	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	5927868	5927868	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5927868delT								FARS2 (156052 upstream) : NRN1 (70367 downstream)																							tctttctttcttttttttttt	0.000													3	3	---	---	---	---	
RREB1	6239	broad.mit.edu	37	6	7235815	7235815	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7235815delG	uc003mxc.2	+						RREB1_uc003mxb.2_Intron|RREB1_uc010jnx.2_Intron	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN	ras responsive element binding protein 1 isoform						multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				tgggattttaggcgtgagcca	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	19816339	19816340	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19816339_19816340insT								None (None upstream) : ID4 (21277 downstream)																							GTTTATGTGCCttttttttttt	0.198													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	37114762	37114762	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37114762delT								FGD2 (117917 upstream) : PIM1 (23160 downstream)																							ccaggctttgttgcagtggca	0.095													4	2	---	---	---	---	
ZFAND3	60685	broad.mit.edu	37	6	37864442	37864443	+	Intron	INS	-	TG	TG			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37864442_37864443insTG	uc003onx.2	+							NM_021943	NP_068762	Q9H8U3	ZFAN3_HUMAN	zinc finger, AN1-type domain 3								DNA binding|zinc ion binding			ovary(1)	1						gccttcTGTTTtgtgtgtgtgt	0.005													1	6	---	---	---	---	
CAPN11	11131	broad.mit.edu	37	6	44149212	44149215	+	Intron	DEL	ACAG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44149212_44149215delACAG	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			acactcacatacagacacaaccac	0.191													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	47046718	47046718	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47046718delA								GPR110 (36636 upstream) : TNFRSF21 (152551 downstream)																							accctgtctcaaaaaaaaaaa	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	48457820	48457821	+	IGR	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48457820_48457821insA								C6orf138 (378877 upstream) : MUT (941173 downstream)																							gtcaccTTGACAAAAAAAAGGC	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	49565451	49565452	+	IGR	DEL	TG	-	-	rs10572893		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49565451_49565452delTG								C6orf141 (35826 upstream) : RHAG (7441 downstream)																							CCTAGAtgtttgtgtgtgtgtg	0.262													3	3	---	---	---	---	
FAM83B	222584	broad.mit.edu	37	6	54735463	54735463	+	Frame_Shift_Del	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54735463delG	uc003pck.2	+	2	535	c.419delG	c.(418-420)CGGfs	p.R140fs		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	140								p.R140R(1)		ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					GAAACTATTCGGAAGATGATA	0.358													42	22	---	---	---	---	
BEND6	221336	broad.mit.edu	37	6	56889536	56889537	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56889536_56889537insT	uc010kab.2	+						BEND6_uc003pdi.3_Intron	NM_152731	NP_689944	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6												0						gtacctggatatttagctcttc	0.000													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57369333	57369334	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57369333_57369334insA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGTGATCTGTTATACTTGTCTA	0.287													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57384216	57384216	+	Intron	DEL	A	-	-	rs112288407		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57384216delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		atcaggagacagggtttttga	0.000													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57387177	57387178	+	Intron	INS	-	T	T	rs145242761		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57387177_57387178insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTGTTTATGACTGGCAGAGATT	0.361													3	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57389262	57389262	+	Intron	DEL	G	-	-	rs5876591		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57389262delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGAGGGAAAAGTTCCTCAGGT	0.284													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57394864	57394865	+	Intron	INS	-	C	C	rs112404107		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57394864_57394865insC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		gagacaactttccccccgagtt	0.000													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57469140	57469141	+	Intron	INS	-	ACAC	ACAC	rs112377419		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57469140_57469141insACAC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ggatttcatttacacgttatac	0.000													5	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57488322	57488323	+	Intron	INS	-	T	T	rs146963883		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57488322_57488323insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		attcccatcactttttttttga	0.000													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57497090	57497091	+	Intron	INS	-	A	A	rs150929002	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57497090_57497091insA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TATAGATTTGCAGCAGATTTTA	0.307													3	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57497599	57497600	+	Intron	DEL	AA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57497599_57497600delAA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GTTTGTCAGTAATTATTTGCAA	0.272													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57513815	57513816	+	IGR	INS	-	TAAAT	TAAAT	rs145501425		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57513815_57513816insTAAAT								PRIM2 (440 upstream) : GUSBL2 (732343 downstream)																							AATAGATTTGGTAAATTAATTA	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57517065	57517065	+	IGR	DEL	A	-	-	rs67005360		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57517065delA								PRIM2 (3690 upstream) : GUSBL2 (729094 downstream)																							ACATTTTTTTAAGAGATCTTA	0.348													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57526351	57526352	+	IGR	INS	-	C	C	rs143043663		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57526351_57526352insC								PRIM2 (12976 upstream) : GUSBL2 (719807 downstream)																							caattgtagtataaaagcccca	0.050													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57563533	57563534	+	IGR	INS	-	TC	TC	rs149258860		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57563533_57563534insTC								PRIM2 (50158 upstream) : GUSBL2 (682625 downstream)																							cttggttctcttctccttaatc	0.050													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	71022631	71022632	+	IGR	DEL	CA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71022631_71022632delCA								COL9A1 (9845 upstream) : FAM135A (100475 downstream)																							catgcacatgcacacacacaca	0.168													3	3	---	---	---	---	
SMAP1	60682	broad.mit.edu	37	6	71424807	71424808	+	Intron	DEL	TT	-	-	rs71538436		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71424807_71424808delTT	uc003pfr.2	+						SMAP1_uc011dxy.1_Intron|SMAP1_uc003pfs.2_Intron|SMAP1_uc010kao.2_Intron|SMAP1_uc010kap.2_Intron	NM_001044305	NP_001037770	Q8IYB5	SMAP1_HUMAN	stromal membrane-associated GTPase-activating						regulation of ARF GTPase activity	plasma membrane	ARF GTPase activator activity|zinc ion binding				0						ttttttttcctttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	77193361	77193361	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77193361delA								IMPG1 (411026 upstream) : HTR1B (978587 downstream)																							cgaatgagagaaaatatttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	77371726	77371726	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77371726delT								IMPG1 (589391 upstream) : HTR1B (800222 downstream)																							GAAAATGTTATTTTTTTTCTT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	80048905	80048906	+	IGR	INS	-	CT	CT	rs149727639	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80048905_80048906insCT								HMGN3 (104450 upstream) : LCA5 (145803 downstream)																							agtctatggtactgttatggta	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	81971470	81971472	+	IGR	DEL	GAA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81971470_81971472delGAA								BCKDHB (915483 upstream) : FAM46A (483976 downstream)																							agaagaagaggaagaagaagaag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	83274435	83274436	+	IGR	DEL	AG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83274435_83274436delAG								TPBG (197821 upstream) : UBE2CBP (327750 downstream)																							tcttgaaaaaagaaaccatatt	0.000													4	2	---	---	---	---	
GRIK2	2898	broad.mit.edu	37	6	102074239	102074239	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102074239delT	uc003pqp.3	+						GRIK2_uc003pqn.2_Intron|GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	TTGACAGACCTTTATCTCCTC	0.453													151	122	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	110833876	110833877	+	IGR	INS	-	AAGAAGA	AAGAAGA	rs71665334		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110833876_110833877insAAGAAGA								SLC22A16 (36032 upstream) : CDK19 (97304 downstream)																							agaacaagaacaagaagaaaga	0.000													4	3	---	---	---	---	
HS3ST5	222537	broad.mit.edu	37	6	114559066	114559066	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114559066delA	uc003pwh.3	-						uc003pwf.2_Intron	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		AATAAAATATAAGCACTGTCA	0.264													4	2	---	---	---	---	
ZUFSP	221302	broad.mit.edu	37	6	116966747	116966747	+	Intron	DEL	A	-	-	rs72120510		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116966747delA	uc003pxf.1	-							NM_145062	NP_659499	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain							intracellular	zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		ccctgtctccaaaaaaaaaaa	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	121920540	121920540	+	IGR	DEL	T	-	-	rs71761068		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121920540delT								GJA1 (149668 upstream) : HSF2 (800156 downstream)																							Ctttcttttcttttttttttt	0.139													4	2	---	---	---	---	
PKIB	5570	broad.mit.edu	37	6	122912364	122912365	+	Intron	DEL	CC	-	-	rs2566836	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122912364_122912365delCC	uc003pyz.2	+							NM_181794	NP_861459	Q9C010	IPKB_HUMAN	cAMP-dependent protein kinase inhibitor beta								cAMP-dependent protein kinase inhibitor activity				0				GBM - Glioblastoma multiforme(226;0.164)		cacacacacaccccccacatac	0.287													3	3	---	---	---	---	
HEY2	23493	broad.mit.edu	37	6	126076110	126076110	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126076110delC	uc003qad.2	+						HEY2_uc011ebr.1_Intron	NM_012259	NP_036391	Q9UBP5	HEY2_HUMAN	hairy/enhancer-of-split related with YRPW motif						negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription initiation from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|Notch signaling pathway|smooth muscle cell differentiation|transcription, DNA-dependent	transcriptional repressor complex	histone deacetylase binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		tccttctcctcctctgtcttc	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	126899266	126899267	+	Intron	INS	-	AGAG	AGAG	rs71541288		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126899266_126899267insAGAG	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																		AAGGCAGAATAAGATTGTGGTA	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	128863152	128863152	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128863152delG								PTPRK (21282 upstream) : LAMA2 (341134 downstream)																							catccctcctggctcttttcc	0.000													4	2	---	---	---	---	
ARHGAP18	93663	broad.mit.edu	37	6	130028379	130028380	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130028379_130028380insA	uc003qbr.2	-						ARHGAP18_uc011ebw.1_Intron	NM_033515	NP_277050	Q8N392	RHG18_HUMAN	Rho GTPase activating protein 18						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			ovary(2)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		actccatctcgaaaaaaaaaag	0.114													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	138065547	138065548	+	IGR	DEL	CA	-	-	rs77584271		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138065547_138065548delCA								OLIG3 (250016 upstream) : TNFAIP3 (123033 downstream)																							TCTCCCAGTGcacacacacaca	0.198													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	139721483	139721484	+	IGR	INS	-	C	C	rs147529657	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139721483_139721484insC								CITED2 (25698 upstream) : None (None downstream)																							CATTAGTAGTTTGGCTCTGTCA	0.366													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	144160847	144160848	+	IGR	INS	-	T	T	rs112053889		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144160847_144160848insT								PHACTR2 (8526 upstream) : LTV1 (3660 downstream)																							acatcaagggattttttttttt	0.000													3	3	---	---	---	---	
SF3B5	83443	broad.mit.edu	37	6	144417027	144417028	+	5'Flank	INS	-	TTGT	TTGT	rs137982186	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144417027_144417028insTTGT	uc003qkr.1	-							NM_031287	NP_112577	Q9BWJ5	SF3B5_HUMAN	SF3b10						nuclear mRNA splicing, via spliceosome	nucleoplasm|U12-type spliceosomal complex					0				OV - Ovarian serous cystadenocarcinoma(155;1.68e-06)|GBM - Glioblastoma multiforme(68;0.0638)		GTCGCGTTCTGttgtttgtttg	0.302													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	147515543	147515543	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147515543delT	uc003qlt.1	-						uc003qlu.1_Intron					Homo sapiens cDNA FLJ34275 fis, clone FEBRA2003454.																		ctaaaacttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	148324750	148324750	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148324750delG								SAMD5 (433593 upstream) : SASH1 (338979 downstream)																							aataaactttggggacttggg	0.000													4	2	---	---	---	---	
TAB2	23118	broad.mit.edu	37	6	149546016	149546016	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149546016delT	uc011eec.1	+							NM_015093	NP_055908	Q9NYJ8	TAB2_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding				0						TACATACACATTTTTTAGAAA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	150189257	150189257	+	Intron	DEL	T	-	-	rs5880857		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150189257delT	uc003qni.1	+											Homo sapiens low density lipoprotein receptor-related protein 11, mRNA (cDNA clone IMAGE:4072521), partial cds.																		atctgacacattatagaagtt	0.254													1	6	---	---	---	---	
RAET1E	135250	broad.mit.edu	37	6	150209850	150209850	+	Intron	DEL	A	-	-	rs11316635		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150209850delA	uc003qnl.1	-						uc003qni.1_Intron|RAET1E_uc003qnj.2_Intron|RAET1E_uc003qnk.1_Intron|RAET1E_uc010kih.1_Intron	NM_139165	NP_631904	Q8TD07	N2DL4_HUMAN	retinoic acid early transcript 1E precursor						antigen processing and presentation|immune response|regulation of immune response	integral to membrane|MHC class I protein complex	protein binding				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		CCTGTCACATAAAAAAAAAAA	0.338													15	13	---	---	---	---	
MTHFD1L	25902	broad.mit.edu	37	6	151288254	151288254	+	Intron	DEL	A	-	-	rs66540648		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151288254delA	uc003qob.2	+						MTHFD1L_uc011een.1_Intron|MTHFD1L_uc011eeo.1_Intron|MTHFD1L_uc003qoc.2_Intron	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		TCCTGCCCCCACCTGCATCCT	0.517													2	5	---	---	---	---	
ESR1	2099	broad.mit.edu	37	6	152179717	152179717	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152179717delT	uc003qom.3	+						ESR1_uc010kin.2_Intron|ESR1_uc010kio.2_Intron|ESR1_uc010kip.2_Intron|ESR1_uc003qon.3_Intron|ESR1_uc003qoo.3_Intron|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	TCCGTTCCTGTTTTTTTTTTT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	153815859	153815859	+	IGR	DEL	T	-	-	rs71742930		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153815859delT								RGS17 (363470 upstream) : OPRM1 (515777 downstream)																							ccctgctaggtttttttataa	0.000													2	5	---	---	---	---	
OPRM1	4988	broad.mit.edu	37	6	154470733	154470734	+	Intron	DEL	GT	-	-	rs147344114		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154470733_154470734delGT	uc003qpt.1	+							NM_001008503	NP_001008503	P35372	OPRM_HUMAN	opioid receptor, mu 1 isoform MOR-1O						behavior|negative regulation of cell proliferation|sensory perception	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	mu-opioid receptor activity|protein binding			ovary(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tramadol(DB00193)	attctggatcgtgtgtgtgtgt	0.000													4	3	---	---	---	---	
CNKSR3	154043	broad.mit.edu	37	6	154806670	154806670	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154806670delA	uc003qpy.2	-							NM_173515	NP_775786	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3						negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		TAAGTTTTTTATTTAACACCT	0.373													4	2	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157251049	157251049	+	Intron	DEL	T	-	-	rs112842693		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157251049delT	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TCTTAAATTCTTTTTTTTTTT	0.403													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	157691675	157691677	+	IGR	DEL	CAC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157691675_157691677delCAC								ARID1B (161274 upstream) : C6orf35 (18378 downstream)																							caaacaccatcaccaccaccacc	0.020													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	158153166	158153166	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158153166delG								ZDHHC14 (58190 upstream) : SNX9 (91128 downstream)																							GAGGCAGGGAGGGCGGCCCCT	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	159332809	159332809	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159332809delT								OSTCL (54145 upstream) : RSPH3 (65459 downstream)																							TTGGAAGTTCTAGAAGTCATG	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	159820688	159820689	+	IGR	INS	-	T	T	rs141084287	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159820688_159820689insT								FNDC1 (127549 upstream) : SOD2 (279462 downstream)																							ATTAATGAAAATTTTATATTTG	0.366													3	3	---	---	---	---	
IGF2R	3482	broad.mit.edu	37	6	160505746	160505746	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160505746delG	uc003qta.2	+							NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor						receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		TCCCAGCCCCGGAGCCCTTCT	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	160528363	160528363	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160528363delA								IGF2R (782 upstream) : SLC22A1 (14500 downstream)																							GCTGGATGGCAAAAAGGCATG	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	163817773	163817780	+	IGR	DEL	TGTGTGTG	-	-	rs72201407	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163817773_163817780delTGTGTGTG								LOC285796 (72279 upstream) : QKI (17895 downstream)																							CAAAGCTGATtgtgtgtgtgtgtgtgtg	0.337													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164374761	164374761	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164374761delT								QKI (379869 upstream) : None (None downstream)																							ACTCTTGAGATTTTTTTGAAG	0.353													1	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	166661364	166661365	+	IGR	INS	-	A	A	rs145790632	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166661364_166661365insA								T (79233 upstream) : PRR18 (57803 downstream)																							AGTAGACATACAAAAATATTCC	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	166805540	166805541	+	IGR	INS	-	T	T	rs141068922		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166805540_166805541insT								BRP44L (9054 upstream) : RPS6KA2 (17313 downstream)																							ttggggtgtaattttttttttt	0.000													2	5	---	---	---	---	
RNASET2	8635	broad.mit.edu	37	6	167354231	167354231	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167354231delT	uc003qve.2	-						RNASET2_uc003qvh.2_Intron|RNASET2_uc003qvf.2_Intron|RNASET2_uc003qvg.2_Intron|RNASET2_uc003qvi.1_Intron	NM_003730	NP_003721	O00584	RNT2_HUMAN	ribonuclease T2 precursor						RNA catabolic process	extracellular region	ribonuclease T2 activity|RNA binding				0		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;1.53e-19)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00665)		GGACTGGACCTTTTTTTTTTA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	167877055	167877068	+	IGR	DEL	CAGCAAAGGCCAGA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167877055_167877068delCAGCAAAGGCCAGA								TCP10 (79057 upstream) : C6orf123 (308153 downstream)																							gtgaaagtatcagcaaaggccagacctctgttag	0.173													2	4	---	---	---	---	
HGC6.3	100128124	broad.mit.edu	37	6	168376961	168376962	+	Frame_Shift_Ins	INS	-	GT	GT			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168376961_168376962insGT	uc010kks.1	-	1	658_659	c.371_372insAC	c.(370-372)ACTfs	p.T124fs		NM_001129895	NP_001123367	Q9UM08	Q9UM08_HUMAN	hypothetical protein LOC100128124	124											0						TTACCCCTGCAGTGTGTTGGGA	0.634													4	2	---	---	---	---	
SMOC2	64094	broad.mit.edu	37	6	168850722	168850724	+	Intron	DEL	AGG	-	-	rs149142143		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168850722_168850724delAGG	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CTTATCTATCAGGAGgaggagga	0.330													5	4	---	---	---	---	
FAM20C	56975	broad.mit.edu	37	7	297870	297871	+	Intron	INS	-	G	G			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:297870_297871insG	uc003sip.2	+						FAM20C_uc011jvn.1_Intron	NM_020223	NP_064608	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C							extracellular region					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		ATGCTGGAGATGGGCTGGGTGG	0.683													4	2	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	945869	945869	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:945869delG	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						aaaggagaaagggagaaagga	0.000													4	3	---	---	---	---	
USP42	84132	broad.mit.edu	37	7	6184962	6184962	+	Intron	DEL	A	-	-	rs72151157		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6184962delA	uc011jwo.1	+						USP42_uc011jwn.1_Intron|USP42_uc010kth.1_Intron|USP42_uc011jwp.1_Intron|USP42_uc011jwq.1_Intron|USP42_uc011jwr.1_Intron	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42						cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		acgccatctcaaaaaaaaaaa	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	10963322	10963323	+	IGR	DEL	AC	-	-	rs36095837		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10963322_10963323delAC								None (None upstream) : NDUFA4 (9492 downstream)																							acacacacatacacacacacac	0.277													7	4	---	---	---	---	
ITGB8	3696	broad.mit.edu	37	7	20399300	20399301	+	Intron	DEL	GT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20399300_20399301delGT	uc003suu.2	+						ITGB8_uc011jyh.1_Intron|ITGB8_uc003sut.2_Intron	NM_002214	NP_002205	P26012	ITB8_HUMAN	integrin, beta 8 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3						AGGAGAGAGAGTGTGTGTGTGT	0.411													4	2	---	---	---	---	
AVL9	23080	broad.mit.edu	37	7	32979977	32979978	+	Intron	INS	-	AAG	AAG	rs140498671	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32979977_32979978insAAG	uc011kai.1	+						RP9P_uc003tdc.2_Intron|RP9P_uc003tdd.2_Intron|RP9P_uc011kaj.1_Intron|RP9P_uc003tdf.1_Intron	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						aaaagaagaacaagaagaagaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	35325730	35325730	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35325730delT								TBX20 (32488 upstream) : HERPUD2 (346542 downstream)																							GTAAAATCACTGCTACCAAGA	0.383													4	2	---	---	---	---	
ANLN	54443	broad.mit.edu	37	7	36453603	36453603	+	Intron	DEL	A	-	-	rs35961056		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36453603delA	uc003tff.2	+						ANLN_uc011kaz.1_Intron|ANLN_uc003tfg.2_Intron|ANLN_uc010kxe.2_Intron	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein						cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						actccgtctcaaaaaaaaaaa	0.159													4	2	---	---	---	---	
AOAH	313	broad.mit.edu	37	7	36749009	36749009	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36749009delT	uc003tfh.3	-						AOAH_uc010kxf.2_Intron|AOAH_uc011kba.1_Intron	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						gtatagttgcttttactgaag	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	38208725	38208726	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38208725_38208726insT								EPDR1 (217186 upstream) : STARD3NL (9207 downstream)																							AGCAGTATGTATTCCTATGTCA	0.347													4	2	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38565045	38565046	+	Intron	INS	-	GT	GT	rs60206516		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38565045_38565046insGT	uc003tgu.2	-						AMPH_uc003tgv.2_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						ctcatttgtgcgtgtgtgtgtg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	38961022	38961022	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38961022delA								VPS41 (12222 upstream) : POU6F2 (85386 downstream)																							actgtgtcttaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	46681556	46681557	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46681556_46681557insT								IGFBP3 (720685 upstream) : TNS3 (633196 downstream)																							ttctttttttattttttttgtc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56260631	56260631	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56260631delG								PSPH (76541 upstream) : DKFZp434L192 (303285 downstream)																							CTCATTACCTGCTGTTCTGAC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61064901	61064901	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61064901delG								None (None upstream) : None (None downstream)																							ACAGTGAGAAGATTGGATGCG	0.259													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61804274	61804274	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61804274delC								None (None upstream) : LOC643955 (947398 downstream)																							TAAATACTATCATTTTTCACT	0.284													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62749496	62749497	+	IGR	INS	-	AAAC	AAAC	rs148384827	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62749496_62749497insAAAC								None (None upstream) : LOC643955 (2175 downstream)																							actccatttcaaaacaaacaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65626888	65626888	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65626888delG								CRCP (7337 upstream) : TPST1 (43371 downstream)																							agaccagcctgggaaacatgg	0.040													4	2	---	---	---	---	
STAG3L1	54441	broad.mit.edu	37	7	75005472	75005473	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75005472_75005473insT	uc011kfw.1	+						STAG3L1_uc003ucx.2_Intron			P0CL83	ST3L1_HUMAN	Synthetic construct DNA, clone: pF1KB7389, Homo sapiens STAG3L1 gene for stromal antigen 3-like 1, without stop codon, in Flexi system.							nucleus	binding				0						ttttttttttcttttttttttt	0.243													1	5	---	---	---	---	
SRCRB4D	136853	broad.mit.edu	37	7	76023195	76023195	+	Frame_Shift_Del	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76023195delG	uc003ufb.2	-	8	1321	c.973delC	c.(973-975)CGGfs	p.R325fs	SRCRB4D_uc003ufa.2_5'Flank	NM_080744	NP_542782	Q8WTU2	SRB4D_HUMAN	scavenger receptor cysteine rich domain	325						extracellular region|membrane	scavenger receptor activity			pancreas(1)	1						GCTGTCTCCCGGGAAGGCTGG	0.682													4	2	---	---	---	---	
PTPN12	5782	broad.mit.edu	37	7	77239211	77239212	+	Intron	INS	-	A	A	rs144037026	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77239211_77239212insA	uc003ugh.2	+						PTPN12_uc011kgp.1_Intron|PTPN12_uc011kgq.1_Intron|PTPN12_uc010lds.2_Intron	NM_002835	NP_002826	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type							soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding			ovary(1)|breast(1)|pancreas(1)	3						aaaaaaacaacaaaaaaaaaaC	0.153													4	4	---	---	---	---	
MAGI2	9863	broad.mit.edu	37	7	79020017	79020017	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79020017delA	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				AGTTCCGTGCAATCCCCTCTT	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	82113361	82113361	+	IGR	DEL	T	-	-	rs147403248		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82113361delT								CACNA2D1 (40330 upstream) : PCLO (269960 downstream)																							CTCTCttttcttttttttttc	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	95970362	95970362	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95970362delT								SLC25A13 (18903 upstream) : SHFM1 (331875 downstream)																							CCAATTATGCTTTTTTTTGTC	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	97704331	97704331	+	IGR	DEL	T	-	-	rs79359417		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97704331delT								OCM2 (84915 upstream) : LMTK2 (31866 downstream)																							CTACAATGCCttttttttttt	0.189													4	2	---	---	---	---	
PTCD1	26024	broad.mit.edu	37	7	99043036	99043036	+	Intron	DEL	A	-	-	rs72467113		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99043036delA	uc011kiw.1	-						CPSF4_uc003uqi.2_Intron|CPSF4_uc003uqj.2_Intron|CPSF4_uc003uqk.2_Intron|CPSF4_uc011kix.1_Intron	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1											ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			actctatctcaaaaaaaaaaa	0.184													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100263419	100263419	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100263419delC	uc003uwa.1	+											Homo sapiens cDNA FLJ30705 fis, clone FCBBF2001116.																		TGGTGAGCCACCATTCCtaac	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100615378	100615378	+	IGR	DEL	C	-	-	rs33957279		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100615378delC								ACHE (120839 upstream) : MUC12 (32697 downstream)																							GATCCAGAGACCCCCTGCCCT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	108924554	108924555	+	IGR	INS	-	T	T	rs145429891	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108924554_108924555insT								C7orf66 (399917 upstream) : EIF3IP1 (674729 downstream)																							ggagttgtttgtttttcttgta	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	109716508	109716508	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109716508delT								EIF3IP1 (116238 upstream) : IMMP2L (586602 downstream)																							aatattgttatttttaccttc	0.000													4	2	---	---	---	---	
IMMP2L	83943	broad.mit.edu	37	7	110931317	110931317	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110931317delA	uc003vfq.1	-						IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron	NM_032549	NP_115938	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane protease-like						protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		AAGCCTTTGCAGAAGACCAGT	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	112824308	112824309	+	IGR	DEL	GA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112824308_112824309delGA								LOC401397 (65671 upstream) : PPP1R3A (692573 downstream)																							gagctgagaggagagagagaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	114368923	114368923	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114368923delT								FOXP2 (37831 upstream) : MDFIC (193286 downstream)																							ttccttcctcttttttttttg	0.000													4	2	---	---	---	---	
CTTNBP2	83992	broad.mit.edu	37	7	117360240	117360241	+	Intron	DEL	TC	-	-	rs141823382		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117360240_117360241delTC	uc003vjf.2	-							NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2											ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TCATCTCCCTTCTCTCTCTTTA	0.297													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	117528034	117528035	+	IGR	DEL	TG	-	-	rs113396693		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117528034_117528035delTG								CTTNBP2 (14473 upstream) : NAA38 (296051 downstream)																							ATTGTTTTATtgtgtgtgtgtg	0.208													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	121829827	121829828	+	IGR	INS	-	A	A	rs56345211		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121829827_121829828insA								AASS (45483 upstream) : FEZF1 (111621 downstream)																							ccctgtcacagaaaaaaaaaag	0.139													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	132373464	132373465	+	Intron	INS	-	T	T	rs34171781		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132373464_132373465insT	uc003vrd.1	+											Homo sapiens cDNA FLJ40288 fis, clone TESTI2028098.																		AGGAACTCATCTTTTTTTTTTT	0.455													3	3	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151973974	151973975	+	Intron	INS	-	A	A	rs142048410		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151973974_151973975insA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GTAAGAAAAGGAAAAAAGTAAC	0.257			N		medulloblastoma								6	3	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152080128	152080128	+	Intron	DEL	G	-	-	rs6971428	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152080128delG	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CCTAAGCTAAGAAAAATACAA	0.254			N		medulloblastoma								4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152103179	152103179	+	Intron	DEL	T	-	-	rs5888468		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152103179delT	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GACAAAATAGTTTTTAAAAAA	0.199			N		medulloblastoma								5	3	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152104372	152104373	+	Intron	INS	-	A	A	rs11428134		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152104372_152104373insA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TAAGAAACATTAAAAAATAACG	0.327			N		medulloblastoma								6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155128171	155128171	+	IGR	DEL	G	-	-	rs78957141		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155128171delG								INSIG1 (26229 upstream) : EN2 (122653 downstream)																							ATTACCCTCAGTCCTCATTGA	0.478													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155163874	155163877	+	IGR	DEL	AGTT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155163874_155163877delAGTT								INSIG1 (61932 upstream) : EN2 (86947 downstream)																							CCCACCTGAAAGTTAGTCATTGTT	0.544													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158133506	158133507	+	Intron	DEL	AT	-	-	rs67196684		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158133506_158133507delAT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ACACCCACACATGTCACTCACA	0.525													6	3	---	---	---	---	
MYOM2	9172	broad.mit.edu	37	8	2010186	2010186	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2010186delT	uc003wpx.3	+						MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2						muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TGAAGGCCAGTAGAGGACCCA	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2184360	2184361	+	IGR	DEL	AT	-	-	rs72077330		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2184360_2184361delAT								MYOM2 (90981 upstream) : CSMD1 (608515 downstream)																							atgttcacacatatgcaacact	0.040													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2214925	2214926	+	IGR	INS	-	T	T	rs79159657		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2214925_2214926insT								MYOM2 (121546 upstream) : CSMD1 (577950 downstream)																							TTTTAAGTGACTTTTTTTTTAA	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2652853	2652853	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2652853delG								MYOM2 (559474 upstream) : CSMD1 (140023 downstream)																							GTCATACTACGGGAACAGCGG	0.532													5	7	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	4472138	4472139	+	Intron	DEL	CA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4472138_4472139delCA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGAGTATGACcacacacacacg	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	5681937	5681938	+	IGR	INS	-	GC	GC	rs139651422	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5681937_5681938insGC								CSMD1 (829609 upstream) : MCPH1 (582183 downstream)																							atgaggtcttttggccaagtta	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	6966463	6966463	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6966463delA								DEFA5 (52204 upstream) : LOC349196 (151679 downstream)																							ATTGCTTTGTAAAAAAAACAA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	11620078	11620079	+	3'UTR	DEL	AC	-	-	rs34839711		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11620078_11620079delAC	uc003wud.1	+	1										SubName: Full=C8orf49 protein; SubName: Full=Chromosome 8 open reading frame 49;																		acacacacagacacacacacac	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20996967	20996968	+	IGR	DEL	GT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20996967_20996968delGT								LZTS1 (884164 upstream) : GFRA2 (552562 downstream)																							CCAGCACTGAGTGTGTGTGTGT	0.510													3	3	---	---	---	---	
NRG1	3084	broad.mit.edu	37	8	32050820	32050821	+	Intron	INS	-	TG	TG	rs142841681	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32050820_32050821insTG	uc003xip.2	+							NM_013962	NP_039256	Q02297	NRG1_HUMAN	neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TTTTCTACCTTtgtgtgtgtgt	0.332													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	33190735	33190735	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33190735delA								NRG1 (568177 upstream) : FUT10 (37611 downstream)																							ggacttaagcaaaaggatcag	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	33495401	33495401	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33495401delG								DUSP26 (37962 upstream) : None (None downstream)																							AGTAGAATCTGGGCTTAAAGG	0.413													4	2	---	---	---	---	
UNC5D	137970	broad.mit.edu	37	8	35498446	35498447	+	Intron	DEL	CT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35498446_35498447delCT	uc003xjr.1	+						UNC5D_uc003xjs.1_Intron	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		tcctcctctcctctctctctct	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	36135725	36135725	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36135725delT								UNC5D (483545 upstream) : KCNU1 (506117 downstream)																							CTGGAATATCTTTGATGGTGT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	40354806	40354811	+	IGR	DEL	GGAGAG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40354806_40354811delGGAGAG								C8orf4 (341985 upstream) : ZMAT4 (33305 downstream)																							agagggaaatggagagggagagggag	0.019													3	3	---	---	---	---	
NKX6-3	157848	broad.mit.edu	37	8	41503854	41503857	+	3'UTR	DEL	AAAG	-	-	rs5891165		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41503854_41503857delAAAG	uc003xoa.2	-	2					NKX6-3_uc010lxa.1_3'UTR	NM_152568	NP_689781	A6NJ46	NKX63_HUMAN	NK6 homeobox 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(28;0.00541)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Esophageal squamous(32;0.0844)|Hepatocellular(245;0.154)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCCCTCATCCAAAGAAAGACTCAG	0.475													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	52055007	52055008	+	IGR	DEL	CT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52055007_52055008delCT								SNTG1 (349580 upstream) : PXDNL (177136 downstream)																							ccagatatcactctctctctct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	52135892	52135892	+	IGR	DEL	A	-	-	rs35790664		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52135892delA								SNTG1 (430465 upstream) : PXDNL (96252 downstream)																							GTATAAAAGCAATGTTTAATA	0.299													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58807008	58807009	+	IGR	DEL	CA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58807008_58807009delCA								C8orf71 (609720 upstream) : FAM110B (100104 downstream)																							ttccTGTCATcacacacacaca	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	63073781	63073781	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63073781delG								ASPH (446582 upstream) : NKAIN3 (87720 downstream)																							tgaaaaagtaggagttccgag	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	65984587	65984587	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65984587delC								CYP7B1 (273239 upstream) : ARMC1 (530485 downstream)																							gataacaaaaccagacaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	66494596	66494598	+	IGR	DEL	GGA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66494596_66494598delGGA								CYP7B1 (783248 upstream) : ARMC1 (20474 downstream)																							agaagaagagggaggaggaggag	0.000													4	7	---	---	---	---	
C8orf34	116328	broad.mit.edu	37	8	69697045	69697046	+	Intron	INS	-	TA	TA			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69697045_69697046insTA	uc010lyz.2	+						C8orf34_uc003xyb.2_Intron	NM_052958	NP_443190	Q49A92	CH034_HUMAN	hypothetical protein LOC116328						signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			gtatgtgtgtgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	72340012	72340012	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72340012delG	uc003xyw.2	-											Homo sapiens cDNA clone IMAGE:5264099.																		cccagcacttggggaggctga	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	72570917	72570918	+	IGR	DEL	CA	-	-	rs140915116	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72570917_72570918delCA								EYA1 (296450 upstream) : MSC (182859 downstream)																							cgcgcgcgcgcacacacacaca	0.000													3	3	---	---	---	---	
LOC100192378	100192378	broad.mit.edu	37	8	77573330	77573331	+	Intron	DEL	AG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77573330_77573331delAG	uc003yas.3	-							NR_024360				Homo sapiens cDNA clone IMAGE:4811567.												0						accaaggactagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	86447427	86447427	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86447427delG								CA2 (53706 upstream) : REXO1L1 (121137 downstream)																							GTCCCAGGGagggctgcgaga	0.070													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	89437263	89437264	+	IGR	INS	-	T	T	rs139332860	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89437263_89437264insT								MMP16 (97546 upstream) : None (None downstream)																							gtgagtcaggctgagcggggga	0.020													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	93617582	93617582	+	IGR	DEL	A	-	-	rs35030122		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93617582delA								RUNX1T1 (509876 upstream) : C8orf83 (278283 downstream)																							TAATCATAGCAAAAAAAAAAA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	95615711	95615711	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95615711delA								KIAA1429 (50023 upstream) : ESRP1 (37653 downstream)																							ttgtgtctccaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	97412299	97412300	+	IGR	INS	-	T	T	rs146180130		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97412299_97412300insT								PTDSS1 (65525 upstream) : SDC2 (93582 downstream)																							AATGTAGTCAAttttttttttt	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	102029259	102029260	+	IGR	DEL	GT	-	-	rs72266577		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102029259_102029260delGT								YWHAZ (63636 upstream) : ZNF706 (180008 downstream)																							GCAGAGCAAAgtgtgtgtgtgt	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	105858702	105858702	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105858702delT								LRP12 (257482 upstream) : ZFPM2 (472445 downstream)																							tttaatagcgttttttttttt	0.005													4	2	---	---	---	---	
ZFPM2	23414	broad.mit.edu	37	8	106529935	106529935	+	Intron	DEL	C	-	-	rs61552974		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106529935delC	uc003ymd.2	+							NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			cacacacacaccacacacaca	0.000													4	2	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110488262	110488262	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110488262delC	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			tggatgttttccatcttatac	0.020										HNSCC(38;0.096)			2	4	---	---	---	---	
EBAG9	9166	broad.mit.edu	37	8	110567214	110567215	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110567214_110567215insT	uc003ynf.2	+						EBAG9_uc010mcn.1_Intron|EBAG9_uc003yng.2_Intron	NM_198120	NP_936056	O00559	RCAS1_HUMAN	estrogen receptor binding site associated						apoptosis|regulation of cell growth	focal adhesion|Golgi membrane|integral to membrane|soluble fraction	apoptotic protease activator activity				0			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)			AAGCCTATTTCttttttttttt	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	112552098	112552098	+	IGR	DEL	T	-	-	rs67259966		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:112552098delT								None (None upstream) : CSMD3 (683063 downstream)																							atcttcatactttttttttta	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	114778603	114778603	+	IGR	DEL	A	-	-	rs144044544		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114778603delA								CSMD3 (329361 upstream) : None (None downstream)																							AAGACATTACAAAAAAATTGT	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	114942650	114942651	+	IGR	DEL	TT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114942650_114942651delTT								CSMD3 (493408 upstream) : None (None downstream)																							ATGATGGGACTTTTTAATGTCA	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	119820747	119820747	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119820747delA								SAMD12 (186513 upstream) : TNFRSF11B (115050 downstream)																							GGAAGAAGGCAAAAGGAGACC	0.199													4	2	---	---	---	---	
ADCY8	114	broad.mit.edu	37	8	131859134	131859134	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131859134delT	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			ttcccttccctttccttcctt	0.080										HNSCC(32;0.087)			6	3	---	---	---	---	
TMEM71	137835	broad.mit.edu	37	8	133745732	133745732	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133745732delG	uc003ytp.2	-						TMEM71_uc003ytm.1_Intron|TMEM71_uc003ytn.2_Intron|TMEM71_uc003yto.2_Intron	NM_144649	NP_653250	Q6P5X7	TMM71_HUMAN	transmembrane protein 71 isoform 1							integral to membrane				ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			CTTCACCTGTGGTTCCCCTCA	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	136721496	136721497	+	IGR	DEL	AG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136721496_136721497delAG								KHDRBS3 (61650 upstream) : None (None downstream)																							CCACAGTGGTAGAGAGAGTAGA	0.515													3	4	---	---	---	---	
MAFA	389692	broad.mit.edu	37	8	144511954	144511956	+	In_Frame_Del	DEL	TGG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144511954_144511956delTGG	uc003yyc.1	-	1	621_623	c.621_623delCCA	c.(619-624)CACCAT>CAT	p.207_208HH>H		NM_201589	NP_963883	Q8NHW3	MAFA_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene	207_208	His-rich.				insulin secretion|nitric oxide mediated signal transduction|response to glucose stimulus	nucleus	protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			CGCGCCGCCAtggtggtggtggt	0.581										HNSCC(29;0.082)			7	4	---	---	---	---	
ZC3H3	23144	broad.mit.edu	37	8	144553652	144553652	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144553652delC	uc003yyd.2	-							NM_015117	NP_055932	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3						mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding			skin(1)	1	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			GCTTTGGGGACACAGAACAAG	0.677													4	2	---	---	---	---	
SLC39A4	55630	broad.mit.edu	37	8	145638883	145638883	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145638883delC	uc003zcq.2	-						SLC39A4_uc003zcm.1_Intron|SLC39A4_uc003zcn.2_Intron|SLC39A4_uc003zco.2_Intron|SLC39A4_uc003zcp.2_Intron	NM_130849	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter),							cytoplasmic membrane-bounded vesicle|integral to membrane|recycling endosome membrane	zinc ion transmembrane transporter activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			TCCGGGGTCGCCCCCTGGGCT	0.706													4	2	---	---	---	---	
COMMD5	28991	broad.mit.edu	37	8	146073802	146073802	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146073802delA	uc003zel.1	-							NM_014066		Q9GZQ3	COMD5_HUMAN	COMM domain containing 5							nucleus	protein binding			ovary(1)	1	all_cancers(97;1.14e-11)|all_epithelial(106;7.74e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			gaattgcttgaacctgggagg	0.045													4	2	---	---	---	---	
KANK1	23189	broad.mit.edu	37	9	709611	709611	+	Intron	DEL	T	-	-	rs138789777		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:709611delT	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgo.1_Intron|KANK1_uc003zgp.1_Intron|KANK1_uc003zgq.2_Intron|KANK1_uc003zgr.1_Intron|KANK1_uc003zgs.1_Intron	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		CTTTCATGTCttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	781989	781990	+	IGR	DEL	CC	-	-	rs139345505		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:781989_781990delCC								KANK1 (35885 upstream) : DMRT1 (59700 downstream)																							ttaaagaagacccctcaaaagc	0.000													6	3	---	---	---	---	
DMRT1	1761	broad.mit.edu	37	9	916373	916374	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:916373_916374insT	uc003zgv.2	+							NM_021951	NP_068770	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor						cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		CCTTAATTTGCttttttttttt	0.223													6	3	---	---	---	---	
RCL1	10171	broad.mit.edu	37	9	4805400	4805401	+	Intron	INS	-	GAAGGG	GAAGGG	rs138657753	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4805400_4805401insGAAGGG	uc003zis.2	+						RCL1_uc003zit.2_Intron|RCL1_uc010mhk.1_Intron	NM_005772	NP_005763	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1						ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		aagaagaaggagaaGGGGAAGG	0.158													4	3	---	---	---	---	
KDM4C	23081	broad.mit.edu	37	9	6781821	6781821	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6781821delT	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc010mhw.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron|KDM4C_uc010mhv.2_Intron	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						ttataaataattttttttttt	0.000													4	2	---	---	---	---	
KDM4C	23081	broad.mit.edu	37	9	6995353	6995354	+	Intron	DEL	AC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6995353_6995354delAC	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron|KDM4C_uc011lml.1_Intron	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						acaggcacagacacacacacac	0.243													4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	9167329	9167330	+	Intron	DEL	TG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9167329_9167330delTG	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ATATGGGGTTtgtgtgtgtgtg	0.277										TSP Lung(15;0.13)			4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	9349757	9349758	+	Intron	INS	-	T	T	rs145376225	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9349757_9349758insT	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CCCATCACATGTTTTTTTTTTG	0.342										TSP Lung(15;0.13)			4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	9591225	9591226	+	Intron	INS	-	C	C	rs142817401	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9591225_9591226insC	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		tgagagggaggaacctgccatt	0.000										TSP Lung(15;0.13)			3	7	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	9820960	9820961	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9820960_9820961insT	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		tgctttggctattttttggttc	0.000										TSP Lung(15;0.13)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	11499893	11499893	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11499893delA								PTPRD (887170 upstream) : None (None downstream)																							TCATTCCCACAAAAAAAAAAT	0.299													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	12365178	12365179	+	IGR	INS	-	GT	GT	rs147097576	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12365178_12365179insGT								None (None upstream) : TYRP1 (328207 downstream)																							ATGTGTGCACGgtgtgtgtgtg	0.297													6	3	---	---	---	---	
LOC554202	554202	broad.mit.edu	37	9	21504261	21504262	+	Intron	DEL	TG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21504261_21504262delTG	uc003zpe.2	-						LOC554202_uc003zpf.2_Intron	NR_027054				Homo sapiens cDNA FLJ42400 fis, clone ASTRO2003581.												0						cgtgtgtgtctgtgtgtgtgtg	0.272													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	29854792	29854792	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29854792delC								MIR873 (965839 upstream) : None (None downstream)																							AGTATCTTTACCAGTTAGTTT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	32718414	32718414	+	IGR	DEL	C	-	-	rs71504294		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32718414delC								TAF1L (82747 upstream) : TMEM215 (65083 downstream)																							AAAGCTCCCACCCCCCCTTCT	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	37608993	37608993	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37608993delA								TOMM5 (16357 upstream) : FRMPD1 (42059 downstream)																							ttggatgtttaataggcatct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	43139562	43139563	+	IGR	INS	-	T	T	rs139291916		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43139562_43139563insT								AQP7P3 (246427 upstream) : LOC642929 (976 downstream)																							ttgccctgtggttttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	46846126	46846126	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:46846126delG								KGFLP1 (97741 upstream) : None (None downstream)																							CATGGTTCTAGGGGTTTCTGC	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66690137	66690137	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66690137delA	uc004aej.2	-											Homo sapiens cDNA clone IMAGE:4668947, partial cds.																		agtccatctcaaaaaaaaaaa	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66826408	66826409	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66826408_66826409insT								LOC442421 (323381 upstream) : AQP7P1 (427858 downstream)																							ttatcttcacataaaaaccaga	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66857195	66857196	+	IGR	INS	-	AC	AC	rs138890222		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66857195_66857196insAC								LOC442421 (354168 upstream) : AQP7P1 (397071 downstream)																							gcagttttgaaactctttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67340073	67340073	+	IGR	DEL	G	-	-	rs79998190		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67340073delG								AQP7P1 (50581 upstream) : FAM27B (452857 downstream)																							GGGGAGTGGAGCCTGGGCctg	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67791244	67791244	+	5'Flank	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67791244delG	uc004aes.1	+											Homo sapiens cDNA FLJ36039 fis, clone TESTI2017311.																		aagagagaatgggagacacac	0.065													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67830796	67830797	+	IGR	DEL	CA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67830796_67830797delCA								FAM27B (36607 upstream) : None (None downstream)																							gactccatctcacacacacaca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68375418	68375419	+	IGR	INS	-	AC	AC	rs138387266		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68375418_68375419insAC								FAM27B (581229 upstream) : MIR1299 (626820 downstream)																							aaaacaaacaaaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68506314	68506315	+	IGR	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68506314_68506315insA								FAM27B (712125 upstream) : MIR1299 (495924 downstream)																							ATAACAGTAAGAAAAAATCAGT	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68989138	68989141	+	IGR	DEL	CCCT	-	-	rs138958079		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68989138_68989141delCCCT								None (None upstream) : MIR1299 (13098 downstream)																							gaagtgccagccctacagtgggtg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69957671	69957672	+	IGR	INS	-	A	A	rs112996117		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69957671_69957672insA								LOC100133920 (292722 upstream) : FOXD4L5 (218037 downstream)																							acttcttcgagatgtgtgcgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	84722045	84722045	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84722045delG								FLJ46321 (111875 upstream) : RASEF (875272 downstream)																							ttagagtgatggagatttcca	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	88017778	88017779	+	IGR	INS	-	TAC	TAC	rs149205642	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88017778_88017779insTAC								NTRK2 (379273 upstream) : AGTPBP1 (143676 downstream)																							AGGCTGAAAGGTACTGTCTGGA	0.510													4	3	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94335423	94335423	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94335423delA	uc004ari.1	-							NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						GAGAAGGAGGAAGGAGGCACA	0.478													4	2	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94494467	94494467	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94494467delG	uc004arj.1	-						ROR2_uc004ari.1_Intron|ROR2_uc004ark.2_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						TGGCGGAGGTGGCCCGTTCCC	0.597													4	2	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94598821	94598822	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94598821_94598822insA	uc004arj.1	-						ROR2_uc004ari.1_Intron|ROR2_uc004ark.2_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						gattccatctcaaaaaaaaaaa	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	103159544	103159544	+	IGR	DEL	T	-	-	rs112981473		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103159544delT								TEX10 (44285 upstream) : C9orf30 (30098 downstream)																							ctttctttccttttttttttt	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	106797318	106797318	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106797318delC								None (None upstream) : SMC2 (59223 downstream)																							ctcaacagttcaccattgctt	0.015													4	2	---	---	---	---	
TLR4	7099	broad.mit.edu	37	9	120475852	120475852	+	Frame_Shift_Del	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120475852delT	uc004bjz.2	+	3	1737	c.1446delT	c.(1444-1446)TCTfs	p.S482fs	TLR4_uc004bka.2_Frame_Shift_Del_p.S442fs|TLR4_uc004bkb.2_Frame_Shift_Del_p.S282fs	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	482	LRR 15.|Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						CTGGCAATTCTTTCCAGGAAA	0.443													26	34	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	2886454	2886455	+	IGR	INS	-	G	G	rs141503382		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2886454_2886455insG								None (None upstream) : PFKP (223297 downstream)																							acacacacacacaGCAGCAAAT	0.282													3	3	---	---	---	---	
FBXO18	84893	broad.mit.edu	37	10	5958667	5958668	+	Intron	INS	-	AG	AG	rs137889600	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5958667_5958668insAG	uc001iis.2	+						FBXO18_uc001iir.2_Intron|FBXO18_uc009xig.2_Intron|FBXO18_uc001iit.2_Intron	NM_178150	NP_835363	Q8NFZ0	FBX18_HUMAN	F-box only protein, helicase, 18 isoform 2						DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(2)|skin(1)	3						GATGGGGGAACGGGAAGTGTTA	0.515													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	11810139	11810140	+	IGR	DEL	CC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11810139_11810140delCC								ECHDC3 (4075 upstream) : C10orf47 (55257 downstream)																							aagatggaatcccagggtcagc	0.000													4	2	---	---	---	---	
CACNB2	783	broad.mit.edu	37	10	18622797	18622798	+	Intron	INS	-	T	T	rs149961596	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18622797_18622798insT	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	AAAATTCTGCCTTTTTTTTTGT	0.391													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19864413	19864414	+	Intron	DEL	CA	-	-	rs140949490		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19864413_19864414delCA	uc010qcq.1	+											SubName: Full=cDNA FLJ60310;																		GGCCATGGTTcacacacacaca	0.342													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	20742233	20742234	+	IGR	INS	-	T	T	rs148364389	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20742233_20742234insT								PLXDC2 (173118 upstream) : NEBL (326671 downstream)																							aaaagaccacatttttcttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	23056503	23056504	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23056503_23056504insT								PIP4K2A (53000 upstream) : ARMC3 (160450 downstream)																							cattatccaacttttctaagcc	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	23464872	23464873	+	IGR	DEL	GG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23464872_23464873delGG								MSRB2 (53931 upstream) : PTF1A (16587 downstream)																							TAAGGAAGATGGGTGTGTGTCT	0.381													4	2	---	---	---	---	
ARHGAP21	57584	broad.mit.edu	37	10	24904878	24904879	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24904878_24904879insT	uc001isb.2	-						ARHGAP21_uc010qdb.1_Intron|ARHGAP21_uc009xkl.1_Intron|ARHGAP21_uc010qdc.1_Intron	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21						signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						atatttttgtatttttttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	29096245	29096245	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29096245delA								BAMBI (124377 upstream) : LYZL1 (481745 downstream)																							CCTGCTTCCTAAAACACATTC	0.413													4	2	---	---	---	---	
LOC387647	387647	broad.mit.edu	37	10	29710953	29710953	+	RNA	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29710953delG	uc001ium.2	+	3		c.1720delG			LOC387647_uc001iuo.1_Intron|LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|LOC387647_uc001iun.2_RNA					Homo sapiens cDNA FLJ31518 fis, clone NT2RI2000064.												0						ACACCAAAGTGGGAGACATTC	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	33175719	33175719	+	IGR	DEL	A	-	-	rs35866295		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33175719delA								C10orf68 (3928 upstream) : ITGB1 (13529 downstream)																							aataaacattaaaaaaaaaAT	0.015													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34302513	34302514	+	IGR	DEL	TC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34302513_34302514delTC								NRP1 (678507 upstream) : PARD3 (97584 downstream)																							cctctgtctttctctctctctc	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	35113141	35113142	+	IGR	DEL	GT	-	-	rs139696621		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35113141_35113142delGT								PARD3 (9218 upstream) : CUL2 (185666 downstream)																							gagtgcacacgtgtgtgtgtgt	0.366													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	36165786	36165787	+	IGR	INS	-	TG	TG	rs150654346	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36165786_36165787insTG								FZD8 (235424 upstream) : None (None downstream)																							tatgtacatactgtgtgtgtgt	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	44464690	44464690	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44464690delG								HNRNPA3P1 (178825 upstream) : CXCL12 (400917 downstream)																							CCTCTCTGTCGGAACCTCTGT	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	45741012	45741013	+	IGR	INS	-	T	T	rs71515338		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45741012_45741013insT								LOC100133308 (90968 upstream) : OR13A1 (57089 downstream)																							ttctttctttcttttttttttt	0.089													3	3	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47035929	47035930	+	Intron	INS	-	CA	CA	rs143198470		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47035929_47035930insCA	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						ccataaatatccacacacacac	0.109													9	5	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47059046	47059047	+	Intron	DEL	CA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47059046_47059047delCA	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						atcacacaaccacacacactac	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	49203109	49203109	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49203109delA								FRMPD2L1 (339477 upstream) : FRMPD2 (161499 downstream)																							actctgtctcaaaacaaaaac	0.000													4	2	---	---	---	---	
HERC4	26091	broad.mit.edu	37	10	69771076	69771076	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69771076delA	uc001jng.3	-						HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron|HERC4_uc001jnj.2_Intron	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN	hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3						tgttcttaacagtaactggaa	0.000													4	2	---	---	---	---	
HK1	3098	broad.mit.edu	37	10	71089772	71089772	+	Intron	DEL	C	-	-	rs71893748		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71089772delC	uc001jpl.3	+						HK1_uc009xqc.1_Intron|HK1_uc001jpg.3_Intron|HK1_uc001jph.3_Intron|HK1_uc001jpi.3_Intron|HK1_uc001jpj.3_Intron|HK1_uc001jpk.3_Intron|HK1_uc009xqd.2_Intron	NM_000188	NP_000179	P19367	HXK1_HUMAN	hexokinase 1 isoform HKI						glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity			ovary(1)	1						TAAAAGAGGACCCCCCAGGAG	0.488													4	6	---	---	---	---	
COL13A1	1305	broad.mit.edu	37	10	71664662	71664662	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71664662delT	uc001jpr.1	+						COL13A1_uc001jqj.1_Intron|COL13A1_uc001jps.1_Intron|COL13A1_uc001jpt.1_Intron|COL13A1_uc001jpu.1_Intron|COL13A1_uc001jpv.1_Intron|COL13A1_uc001jpx.1_Intron|COL13A1_uc001jpw.1_Intron|COL13A1_uc001jpy.1_Intron|COL13A1_uc001jpz.1_Intron|COL13A1_uc001jqa.1_Intron|COL13A1_uc001jqc.1_Intron|COL13A1_uc001jqb.1_Intron|COL13A1_uc001jql.2_Intron|COL13A1_uc001jqd.1_Intron|COL13A1_uc001jqe.1_Intron|COL13A1_uc001jqf.1_Intron|COL13A1_uc001jqg.1_Intron|COL13A1_uc001jqh.1_Intron|COL13A1_uc001jqi.1_Intron|COL13A1_uc010qjf.1_Intron|COL13A1_uc001jqk.1_Intron	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1						cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	ttcttttttcttttttttttt	0.468													4	2	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73333902	73333902	+	Intron	DEL	G	-	-	rs138884148	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73333902delG	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc009xql.2_Intron	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CTGCTGCCCCGGGGCCCCCAC	0.652													5	3	---	---	---	---	
USP54	159195	broad.mit.edu	37	10	75342148	75342148	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75342148delT	uc010qkl.1	-							NM_152586	NP_689799	Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54						ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)					GGAGAAGGACttttttttttt	0.204													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	78422105	78422106	+	IGR	DEL	TA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78422105_78422106delTA								C10orf11 (104981 upstream) : KCNMA1 (207253 downstream)																							aagtaaaaggtataaggatggc	0.000													4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	79286580	79286581	+	Intron	DEL	CT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79286580_79286581delCT	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	tttccttctcctctctctctct	0.208													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	82095304	82095304	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82095304delT								MAT1A (45870 upstream) : DYDC1 (560 downstream)																							tctttttttcttttttttttc	0.229													4	2	---	---	---	---	
TCTN3	26123	broad.mit.edu	37	10	97442251	97442251	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97442251delA	uc001klb.3	-						TCTN3_uc001kla.3_Intron|TCTN3_uc010qoi.1_Intron	NM_015631	NP_056446	Q6NUS6	TECT3_HUMAN	tectonic 3 isoform a precursor						apoptosis	integral to membrane					0		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		actccatctcaaaaaaaaaaa	0.169													4	2	---	---	---	---	
RBM20	282996	broad.mit.edu	37	10	112498158	112498158	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112498158delA	uc001kzf.2	+							NM_001134363	NP_001127835	Q5T481	RBM20_HUMAN	RNA binding motif protein 20							nucleus	nucleotide binding|RNA binding|zinc ion binding				0						aaatgttgataacatgttccc	0.000													4	2	---	---	---	---	
RBM20	282996	broad.mit.edu	37	10	112588426	112588434	+	Intron	DEL	CTATTATTC	-	-	rs141649578		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112588426_112588434delCTATTATTC	uc001kzf.2	+							NM_001134363	NP_001127835	Q5T481	RBM20_HUMAN	RNA binding motif protein 20							nucleus	nucleotide binding|RNA binding|zinc ion binding				0						ACTTACAgcactattattcctatttcaca	0.201													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	113005145	113005145	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113005145delA								ADRA2A (164485 upstream) : GPAM (904477 downstream)																							actgcatctcaaaaaaaaaaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	113520703	113520703	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113520703delC								ADRA2A (680043 upstream) : GPAM (388919 downstream)																							CCTGACATCGCCCCAGCCCTT	0.423													4	2	---	---	---	---	
C10orf118	55088	broad.mit.edu	37	10	115889918	115889918	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115889918delA	uc001lbb.1	-						C10orf118_uc009xyd.1_Intron|C10orf118_uc001lbc.1_Intron|C10orf118_uc009xye.1_RNA	NM_018017	NP_060487	Q7Z3E2	CJ118_HUMAN	CTCL tumor antigen L14-2											ovary(2)	2		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		AGTCAAGTACAAAATATACAG	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	116176828	116176829	+	IGR	INS	-	T	T	rs143657201	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116176828_116176829insT								AFAP1L2 (12313 upstream) : ABLIM1 (14041 downstream)																							ttcccttttcctttttttttga	0.213													4	2	---	---	---	---	
HSPA12A	259217	broad.mit.edu	37	10	118459007	118459008	+	Intron	INS	-	A	A	rs137872299	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118459007_118459008insA	uc001lct.2	-						HSPA12A_uc001lcu.2_Intron	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A								ATP binding			ovary(1)	1				all cancers(201;0.0158)		CTGCCAGGGGGAAAAAAATCAC	0.520													4	2	---	---	---	---	
GRK5	2869	broad.mit.edu	37	10	121051439	121051441	+	Intron	DEL	CTT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121051439_121051441delCTT	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		cttcttcctccttcttttcctcc	0.034													4	4	---	---	---	---	
STK32C	282974	broad.mit.edu	37	10	134052286	134052287	+	Intron	DEL	CA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134052286_134052287delCA	uc001lle.1	-						STK32C_uc001lld.1_Intron|STK32C_uc010quu.1_Intron|STK32C_uc009ybc.1_Intron|STK32C_uc009ybd.1_Intron|STK32C_uc001llc.1_Intron	NM_173575	NP_775846	Q86UX6	ST32C_HUMAN	serine/threonine kinase 32C								ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|breast(1)	5		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		GCAATGCATGcacacacacaca	0.084													4	2	---	---	---	---	
KNDC1	85442	broad.mit.edu	37	10	134990708	134990709	+	Intron	DEL	TA	-	-	rs144965031		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134990708_134990709delTA	uc001llz.1	+						KNDC1_uc001lma.1_Intron	NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		gtgtatgtagtatagtgtgtgt	0.094													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	341166	341166	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:341166delA								IFITM3 (20252 upstream) : B4GALNT4 (28629 downstream)																							aaggaaagggaagggaagaag	0.020													4	2	---	---	---	---	
DENND5A	23258	broad.mit.edu	37	11	9166336	9166336	+	Intron	DEL	A	-	-	rs112911509		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9166336delA	uc001mhl.2	-						DENND5A_uc001mhk.2_Intron|DENND5A_uc010rbw.1_Intron	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1											liver(1)	1						actccgtctcaaaaaaaaaaa	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13633920	13633921	+	IGR	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13633920_13633921insA								PTH (116353 upstream) : FAR1 (56285 downstream)																							acagagagattaaaaaactaga	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13764032	13764032	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13764032delC								FAR1 (10141 upstream) : SPON1 (219882 downstream)																							CTTTCAACTGCAAATATCTAG	0.383													4	2	---	---	---	---	
SPON1	10418	broad.mit.edu	37	11	14101781	14101782	+	Intron	INS	-	T	T	rs11432678		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14101781_14101782insT	uc001mle.2	+							NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		TAttttttttcttttttttttt	0.163													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15560389	15560390	+	IGR	INS	-	A	A	rs147428944	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15560389_15560390insA								INSC (291637 upstream) : SOX6 (427606 downstream)																							caccttttattgcctcttcctt	0.000													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15965749	15965750	+	IGR	DEL	AC	-	-	rs72135790		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15965749_15965750delAC								INSC (696997 upstream) : SOX6 (22246 downstream)																							acacacgcaaacacacacacac	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	25522447	25522447	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25522447delG								LUZP2 (418265 upstream) : ANO3 (688382 downstream)																							ccagttgatcgaatttcctac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	26062718	26062719	+	IGR	INS	-	TTTT	TTTT	rs144526513	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26062718_26062719insTTTT								LUZP2 (958536 upstream) : ANO3 (148110 downstream)																							AGCCAAAATTCTTTTTTATTTT	0.292													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	28506659	28506660	+	IGR	INS	-	AC	AC	rs138231320	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28506659_28506660insAC								METT5D1 (151605 upstream) : None (None downstream)																							AATGAAGTTTTacacacacaca	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	35030280	35030280	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35030280delA								PDHX (12606 upstream) : CD44 (130137 downstream)																							CCCGAGGAACAAAATCCTTCA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	42128054	42128054	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42128054delA								LRRC4C (646731 upstream) : None (None downstream)																							ACAAACAAACAAAAAAAAAAC	0.030													4	2	---	---	---	---	
CRY2	1408	broad.mit.edu	37	11	45875197	45875197	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45875197delC	uc010rgn.1	+						CRY2_uc009ykw.2_Intron	NM_021117	NP_066940	Q49AN0	CRY2_HUMAN	cryptochrome 2 (photolyase-like) isoform 1						DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	blue light photoreceptor activity|damaged DNA binding|DNA photolyase activity|nucleotide binding|protein binding|single-stranded DNA binding			central_nervous_system(1)	1						AGATGGAGGACCCTGTGTCCT	0.512													1	5	---	---	---	---	
DGKZ	8525	broad.mit.edu	37	11	46372628	46372628	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46372628delG	uc001nch.1	+						DGKZ_uc010rgq.1_Intron|DGKZ_uc001ncj.1_Intron|DGKZ_uc010rgr.1_Intron|DGKZ_uc001nck.1_Intron|DGKZ_uc001ncl.2_Intron|DGKZ_uc001ncm.2_Intron|DGKZ_uc009yky.1_Intron|DGKZ_uc010rgs.1_Intron|DGKZ_uc001nci.1_Intron	NM_201532	NP_963290	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		AGCTTCTGTTGACCCTAAGGA	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48380171	48380172	+	IGR	INS	-	C	C	rs147925412	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48380171_48380172insC								OR4C45 (6172 upstream) : OR4A47 (130173 downstream)																							agcattttggtcaaagcattca	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48385440	48385440	+	IGR	DEL	A	-	-	rs67779764		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48385440delA								OR4C45 (11441 upstream) : OR4A47 (124905 downstream)																							GCTGCAGCAGAGAAAAATAAA	0.333													3	3	---	---	---	---	
MS4A15	219995	broad.mit.edu	37	11	60524959	60524959	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60524959delG	uc009ynf.1	+						MS4A15_uc001npx.2_Intron|MS4A15_uc001npy.2_Intron|MS4A15_uc009yng.1_Intron	NM_001098835	NP_001092305	Q8N5U1	M4A15_HUMAN	membrane-spanning 4-domains, subfamily A, member							integral to membrane	receptor activity			lung(1)	1						AAGAACAGGAGCCAACCAGGA	0.522													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	60788383	60788384	+	IGR	DEL	GT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60788383_60788384delGT								CD6 (537 upstream) : CD5 (81546 downstream)																							CATGTTCAGAgtgtgtgtgtgt	0.317													4	3	---	---	---	---	
SAC3D1	29901	broad.mit.edu	37	11	64810389	64810389	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64810389delC	uc001ocm.2	+						SAC3D1_uc010rnv.1_Intron	NM_013299	NP_037431			SAC3 domain containing 1												0						ttcactgcagcctcaacctcg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69714656	69714657	+	IGR	DEL	AG	-	-	rs71463652		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69714656_69714657delAG								FGF3 (80464 upstream) : ANO1 (209751 downstream)																							aaagaaagaaagagagagagag	0.000													9	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69840210	69840210	+	IGR	DEL	C	-	-	rs67219184		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69840210delC								FGF3 (206018 upstream) : ANO1 (84198 downstream)																							TTGTCGTTAACCCCCCCCCAC	0.448													3	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69860936	69860936	+	IGR	DEL	T	-	-	rs72178532		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69860936delT								FGF3 (226744 upstream) : ANO1 (63472 downstream)																							tttgtttttgttttttttttt	0.015													9	17	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69934629	69934630	+	Intron	INS	-	AAG	AAG	rs117809612		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69934629_69934630insAAG	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						aaaaaaaaaaaaaaaagaagaa	0.208													16	11	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69984612	69984613	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69984612_69984613insA	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						aagtccgtctcaaaaaaaaaaa	0.045													14	21	---	---	---	---	
FADD	8772	broad.mit.edu	37	11	70051249	70051249	+	Intron	DEL	C	-	-	rs34642886		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70051249delC	uc001opm.2	+							NM_003824	NP_003815	Q13158	FADD_HUMAN	Fas-associated via death domain						activation of caspase activity|activation of pro-apoptotic gene products|cellular response to mechanical stimulus|defense response to virus|induction of apoptosis via death domain receptors|innate immune response|interspecies interaction between organisms|necrotic cell death|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|signal transduction	cytosol	death receptor binding|identical protein binding			ovary(1)|lung(1)|pancreas(1)	3	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			gtcagagctgcgggagctggt	0.244													1	34	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	70074279	70074279	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70074279delA								FADD (20771 upstream) : PPFIA1 (42544 downstream)																							acattctgtcaaaaaaaaaaa	0.020													18	11	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70548430	70548431	+	Intron	INS	-	AAT	AAT			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70548430_70548431insAAT	uc001oqc.2	-							NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			accatcatcaccatcatcatca	0.000													20	19	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70863122	70863123	+	Intron	INS	-	A	A	rs67110332		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70863122_70863123insA	uc001oqc.2	-							NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			tcagatttgacaaaaaaaacgt	0.015													5	22	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70911878	70911879	+	Intron	DEL	AC	-	-	rs149478830		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70911878_70911879delAC	uc001oqc.2	-							NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CTCAATTAATacacacacacac	0.342													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	71137376	71137376	+	5'Flank	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71137376delT	uc001oqj.1	-											Homo sapiens cDNA FLJ42102 fis, clone TESOP2006746.																		gtcttttttcttttttttttt	0.000													2	6	---	---	---	---	
PDE2A	5138	broad.mit.edu	37	11	72295209	72295209	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72295209delT	uc010rrc.1	-						PDE2A_uc001oso.2_Intron|PDE2A_uc010rra.1_Intron|PDE2A_uc001osn.2_Intron|PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	CCCCGCCCCCTATCACCCCAC	0.637													3	5	---	---	---	---	
GDPD4	220032	broad.mit.edu	37	11	76968598	76968605	+	Intron	DEL	ACACACAC	-	-	rs71792354		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76968598_76968605delACACACAC	uc001oyf.2	-							NM_182833	NP_878253	Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding			skin(1)	1						tccctcTCCTacacacacacacacacac	0.231													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	87466231	87466234	+	IGR	DEL	TTCC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87466231_87466234delTTCC								TMEM135 (431663 upstream) : RAB38 (380197 downstream)																							ccttccttctttccttccttcctt	0.088													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	90743763	90743763	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90743763delA								MIR1261 (141393 upstream) : None (None downstream)																							cctcaaaagcaaatgcaacaa	0.000													4	2	---	---	---	---	
FAT3	120114	broad.mit.edu	37	11	92211788	92211788	+	Intron	DEL	T	-	-	rs111834951		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92211788delT	uc001pdj.3	+							NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATCTGATACAttttttttttt	0.189										TCGA Ovarian(4;0.039)			4	2	---	---	---	---	
MAML2	84441	broad.mit.edu	37	11	95801655	95801656	+	Intron	DEL	GA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95801655_95801656delGA	uc001pfw.1	-							NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gggagggagggagagagagaga	0.015			T	MECT1|CRTC3	salivary gland mucoepidermoid								4	2	---	---	---	---	
NPAT	4863	broad.mit.edu	37	11	108047621	108047621	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108047621delT	uc001pjz.3	-						NPAT_uc001pka.2_Intron	NM_002519	NP_002510	Q14207	NPAT_HUMAN	nuclear protein,  ataxia-telangiectasia locus						positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			ovary(2)	2		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		AAACAAGAACTTTTTTAGATA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	109248075	109248075	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109248075delA								DDX10 (436429 upstream) : C11orf87 (44800 downstream)																							CTGATGTTCCAAAATGTTGGC	0.418													4	2	---	---	---	---	
PPP2R1B	5519	broad.mit.edu	37	11	111639379	111639380	+	5'Flank	DEL	TG	-	-	rs145673167		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111639379_111639380delTG	uc001plx.1	-						PPP2R1B_uc001plw.1_5'Flank|PPP2R1B_uc010rwi.1_5'Flank|PPP2R1B_uc010rwj.1_5'Flank|PPP2R1B_uc010rwk.1_5'Flank|PPP2R1B_uc010rwl.1_5'Flank	NM_002716	NP_002707	P30154	2AAB_HUMAN	beta isoform of regulatory subunit A, protein								protein binding				0		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		ATTATtgtgttgtgtgtgtgtg	0.050													4	2	---	---	---	---	
ALG9	79796	broad.mit.edu	37	11	111737513	111737514	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111737513_111737514insA	uc001pmb.2	-						ALG9_uc001ply.2_Intron|ALG9_uc001plz.2_Intron|ALG9_uc010rwm.1_Intron|ALG9_uc010rwn.1_Intron|ALG9_uc010rwo.1_Intron|ALG9_uc009yyh.1_Intron	NM_001077690	NP_001071158	Q9H6U8	ALG9_HUMAN	asparagine-linked glycosylation 9 protein						dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			large_intestine(1)|ovary(1)	2		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		TTGACAAGTTCAAAAAAAAAAA	0.168													4	2	---	---	---	---	
RNF214	257160	broad.mit.edu	37	11	117132762	117132763	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117132762_117132763insT	uc001pqt.2	+						RNF214_uc001pqu.2_Intron|RNF214_uc010rxf.1_Intron	NM_207343	NP_997226	Q8ND24	RN214_HUMAN	ring finger protein 214								zinc ion binding				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		atttgTGTCTGTTTTTTTTTTT	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	119500212	119500212	+	IGR	DEL	G	-	-	rs36023939		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119500212delG								THY1 (205966 upstream) : PVRL1 (8596 downstream)																							GTTTAGAAAAGGTGTTTACAA	0.498													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	119612630	119612631	+	IGR	INS	-	CA	CA	rs148874633	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119612630_119612631insCA								PVRL1 (13195 upstream) : TRIM29 (369364 downstream)																							acacacagaggcacacacacac	0.000													3	3	---	---	---	---	
GRAMD1B	57476	broad.mit.edu	37	11	123456007	123456007	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123456007delA	uc001pyx.2	+						GRAMD1B_uc001pyw.2_Intron|GRAMD1B_uc010rzw.1_Intron|GRAMD1B_uc010rzx.1_Intron|GRAMD1B_uc009zbe.1_Intron	NM_020716	NP_065767	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B							integral to membrane				ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GGTTTAATGTAGGGACAGGGT	0.572													4	2	---	---	---	---	
ST3GAL4	6484	broad.mit.edu	37	11	126292191	126292192	+	Intron	INS	-	TG	TG	rs147169951	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126292191_126292192insTG	uc001qdx.1	+									Q11206	SIA4C_HUMAN	SubName: Full=cDNA FLJ11867 fis, clone HEMBA1006976, weakly similar to H.sapiens Gal-beta(1-3/1-4)GlcNAc alpha-2.3-sialyltransferase;						post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.138)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0767)		AGTGCACACTCtgtgtgtgtgt	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127763887	127763887	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127763887delA								KIRREL3 (890532 upstream) : ETS1 (564769 downstream)																							TTCTCCTAGTAAAAAAAAAAA	0.239													4	2	---	---	---	---	
ADIPOR2	79602	broad.mit.edu	37	12	1820780	1820789	+	Intron	DEL	CTCTCTCTCT	-	-	rs111351714		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1820780_1820789delCTCTCTCTCT	uc001qjm.2	+						ADIPOR2_uc001qjn.2_Intron	NM_024551	NP_078827	Q86V24	ADR2_HUMAN	adiponectin receptor 2						fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane	hormone binding|receptor activity				0	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)			ttgtctcttcctctctctctctctctctct	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	3986748	3986748	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3986748delA								PARP11 (4140 upstream) : CCND2 (396154 downstream)																							actccttctcaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	4371487	4371487	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4371487delG								PARP11 (388879 upstream) : CCND2 (11415 downstream)																							tgcccaggctggagtgcagtg	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5430926	5430926	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5430926delA								KCNA5 (274978 upstream) : NTF3 (110354 downstream)																							gtaacaaatgaaaaaaataga	0.000													4	2	---	---	---	---	
ANO2	57101	broad.mit.edu	37	12	5794963	5794971	+	Intron	DEL	ACAAAAAAC	-	-	rs113841270		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5794963_5794971delACAAAAAAC	uc001qnm.2	-							NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						acaaaacaaaacaaaaaacacaaaaaaca	0.244													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	6510411	6510412	+	IGR	INS	-	TTTG	TTTG	rs140092179	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6510411_6510412insTTTG								LTBR (9679 upstream) : LOC678655 (37755 downstream)																							ATCAGTTAGTAtttgtttgttt	0.188													4	2	---	---	---	---	
C1S	716	broad.mit.edu	37	12	7169575	7169575	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7169575delA	uc001qsj.2	+						C1S_uc001qsk.2_Intron|C1S_uc001qsl.2_Intron|C1S_uc009zfr.2_Intron|C1S_uc009zfs.2_Intron	NM_201442	NP_958850	P09871	C1S_HUMAN	complement component 1, s subcomponent						complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	aacctgtctcaaaaaaaaaaa	0.219													4	3	---	---	---	---	
CLEC2D	29121	broad.mit.edu	37	12	9829640	9829640	+	Intron	DEL	T	-	-	rs150139812		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9829640delT	uc001qwg.1	+						CLEC2D_uc001qwf.1_Intron|CLEC2D_uc009zgs.1_Intron|CLEC2D_uc001qwh.1_Intron|CLEC2D_uc009zgt.1_Intron	NM_013269	NP_037401	Q9UHP7	CLC2D_HUMAN	osteoclast inhibitory lectin isoform 1						cell surface receptor linked signaling pathway	cell surface|endoplasmic reticulum|integral to plasma membrane|membrane fraction	sugar binding|transmembrane receptor activity				0						gccttatccattttttttttt	0.000													2	4	---	---	---	---	
ETV6	2120	broad.mit.edu	37	12	12168600	12168600	+	Intron	DEL	A	-	-	rs11284210		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12168600delA	uc001raa.1	+							NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				GAAACTCAGGAAAAAAAAAAT	0.483			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								3	4	---	---	---	---	
PTPRO	5800	broad.mit.edu	37	12	15721362	15721363	+	Intron	INS	-	CAAAA	CAAAA	rs145362655	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15721362_15721363insCAAAA	uc001rcv.1	+						PTPRO_uc001rcw.1_Intron|PTPRO_uc001rcx.1_Intron|PTPRO_uc001rcy.1_Intron|PTPRO_uc001rcz.1_Intron|PTPRO_uc001rda.1_Intron	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				agactctgtctcaaaacaaaac	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	18380497	18380497	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18380497delT								RERGL (137383 upstream) : PIK3C2G (33977 downstream)																							gcagttgctctttagtgccca	0.000													4	2	---	---	---	---	
SOX5	6660	broad.mit.edu	37	12	24059307	24059307	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24059307delT	uc001rfw.2	-						SOX5_uc001rfx.2_Intron|SOX5_uc001rfy.2_Intron|SOX5_uc010siv.1_Intron|SOX5_uc010siw.1_Intron|SOX5_uc001rfz.1_Intron|SOX5_uc001rga.2_Intron	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						GGGTTTTGCCTTTCTGACAGC	0.353													4	2	---	---	---	---	
BCAT1	586	broad.mit.edu	37	12	24985305	24985306	+	Intron	INS	-	T	T	rs142310672	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24985305_24985306insT	uc001rgd.3	-						BCAT1_uc001rgc.2_Intron|BCAT1_uc010six.1_Intron|BCAT1_uc010siy.1_Intron|BCAT1_uc001rge.3_Intron	NM_005504	NP_005495	P54687	BCAT1_HUMAN	branched chain aminotransferase 1, cytosolic						branched chain family amino acid biosynthetic process|branched chain family amino acid catabolic process|cell proliferation|G1/S transition of mitotic cell cycle	cytosol	L-isoleucine transaminase activity|L-leucine transaminase activity|L-valine transaminase activity			lung(1)|breast(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Glutamic Acid(DB00142)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)|Pyridoxal Phosphate(DB00114)	TGTCCCAGTTATTTTTTTTGTA	0.248													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	25963674	25963674	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25963674delA								IFLTD1 (162186 upstream) : RASSF8 (148295 downstream)																							cagcagtgctaaaaataagta	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	26103432	26103433	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26103432_26103433insA	uc001rgu.1	-											Homo sapiens cDNA FLJ33498 fis, clone BRAMY2004183.																		actttgtctctaaaaaaaataa	0.000													4	2	---	---	---	---	
OVCH1	341350	broad.mit.edu	37	12	29614391	29614391	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29614391delA	uc001rix.1	-							NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor						proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					GATTAATGATAATTTAAAACA	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	33090333	33090334	+	IGR	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33090333_33090334insA								PKP2 (40553 upstream) : SYT10 (438014 downstream)																							gaccctgtctcaaaaaaaaaaa	0.074													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38197160	38197161	+	IGR	INS	-	C	C	rs144703101		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38197160_38197161insC								None (None upstream) : ALG10B (513396 downstream)																							ctagacagaaatttctgagaaa	0.000													4	2	---	---	---	---	
ADAMTS20	80070	broad.mit.edu	37	12	43916017	43916019	+	Intron	DEL	AGG	-	-	rs140674159		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43916017_43916019delAGG	uc010skx.1	-							NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with							proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ggcggcaggaaggagaagtgcaa	0.000													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	50564396	50564397	+	IGR	DEL	AC	-	-	rs140305164		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50564396_50564397delAC								LASS5 (3299 upstream) : LIMA1 (5168 downstream)																							acacatacatacacacacacac	0.149													4	2	---	---	---	---	
KRT83	3889	broad.mit.edu	37	12	52708091	52708091	+	3'UTR	DEL	C	-	-	rs76317404		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52708091delC	uc001saf.2	-	9						NM_002282	NP_002273	P78385	KRT83_HUMAN	keratin 83						epidermis development	keratin filament	structural molecule activity			skin(1)	1	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CAAAGCAGGTCCCCAAGTTTA	0.562													4	7	---	---	---	---	
PIP4K2C	79837	broad.mit.edu	37	12	57988919	57988919	+	Frame_Shift_Del	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57988919delC	uc001sou.2	+	3	414	c.283delC	c.(283-285)CCCfs	p.P95fs	PIP4K2C_uc001sot.2_Frame_Shift_Del_p.P95fs|PIP4K2C_uc010srs.1_Intron|PIP4K2C_uc010srt.1_Frame_Shift_Del_p.P95fs	NM_001146258	NP_001139730	Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type	95	PIPK.					cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding			central_nervous_system(2)|lung(1)	3	Melanoma(17;0.122)					GGAAAATCTGCCCAGTCATTT	0.294													90	51	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	60664027	60664027	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60664027delA								SLC16A7 (488620 upstream) : None (None downstream)																							aaaggtttgtaaatgcaccaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	61696745	61696745	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61696745delA								None (None upstream) : FAM19A2 (405298 downstream)																							tctaaaaatgaaaaaaaaaaa	0.100													4	3	---	---	---	---	
TBC1D15	64786	broad.mit.edu	37	12	72290306	72290307	+	Intron	INS	-	A	A	rs148885326	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72290306_72290307insA	uc001swu.2	+						TBC1D15_uc009zrv.2_Intron|TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0						GATCTAGAAGTAAAAAACAAGA	0.327													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	75667038	75667038	+	IGR	DEL	A	-	-	rs35407521		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75667038delA								KCNC2 (63527 upstream) : CAPS2 (2722 downstream)																							ATAATCAGGGAAAAAAAAAAG	0.313													2	5	---	---	---	---	
GLIPR1	11010	broad.mit.edu	37	12	75884363	75884363	+	Intron	DEL	C	-	-	rs11319731		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75884363delC	uc001sxs.2	+						GLIPR1_uc009zsb.1_Intron	NM_006851	NP_006842	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1 precursor						cellular lipid metabolic process	extracellular region|integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3						AAAACAACAACAAAAAAAAAC	0.279													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76030193	76030196	+	IGR	DEL	CTTT	-	-	rs147347934		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76030193_76030196delCTTT								KRR1 (124775 upstream) : PHLDA1 (389032 downstream)																							cctgattggcctttctgcttccag	0.000													3	5	---	---	---	---	
ZDHHC17	23390	broad.mit.edu	37	12	77192336	77192336	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77192336delA	uc001syk.1	+						ZDHHC17_uc001syi.1_Intron|ZDHHC17_uc001syj.2_Intron	NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14						lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						gcaaaaaaagaaaaaAAAAAA	0.025													4	2	---	---	---	---	
SYT1	6857	broad.mit.edu	37	12	79325186	79325189	+	Intron	DEL	AGGA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79325186_79325189delAGGA	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						gggaggagagaggaaggaaggaag	0.034													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80790449	80790449	+	IGR	DEL	C	-	-	rs11360668		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80790449delC								PPP1R12A (461214 upstream) : PTPRQ (47677 downstream)																							ggtctcaccgccccccccaat	0.065													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	86342873	86342873	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86342873delT								NTS (66110 upstream) : MGAT4C (30166 downstream)																							tattttgttgttgttgttgtt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	93635481	93635482	+	IGR	DEL	AC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93635481_93635482delAC								EEA1 (312374 upstream) : NUDT4 (136219 downstream)																							CTCCCTCTCAacacacacacac	0.213													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	95810959	95810960	+	IGR	DEL	CA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95810959_95810960delCA								MIR331 (108670 upstream) : METAP2 (56862 downstream)																							ACAGTAAAAGCACACACACACA	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	98179589	98179590	+	IGR	INS	-	T	T	rs143299965	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98179589_98179590insT								RMST (220796 upstream) : LOC100128191 (727163 downstream)																							taaacaacagatttttttttgt	0.000													2	6	---	---	---	---	
APAF1	317	broad.mit.edu	37	12	99084985	99084985	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99084985delA	uc001tfz.2	+						APAF1_uc001tfy.2_Intron|APAF1_uc001tga.2_Intron|APAF1_uc001tgb.2_Intron|APAF1_uc001tgc.2_Intron|APAF1_uc009zto.2_Intron	NM_181861	NP_863651	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1 isoform						activation of caspase activity by cytochrome c|defense response|induction of apoptosis by intracellular signals|nervous system development	cytosol|Golgi apparatus|nucleus	ATP binding|caspase activator activity|protein binding			ovary(2)|lung(1)	3					Adenosine triphosphate(DB00171)	ctccgtcttgaaaaaaaaaga	0.000													4	2	---	---	---	---	
IGF1	3479	broad.mit.edu	37	12	102797241	102797242	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102797241_102797242insT	uc001tjm.2	-						IGF1_uc001tjn.2_Intron|IGF1_uc001tjo.2_Intron	NM_001111283	NP_001104753	P05019	IGF1_HUMAN	insulin-like growth factor 1 isoform 1						anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2						GATAGTGAGGGttttttttttt	0.193													6	3	---	---	---	---	
PAH	5053	broad.mit.edu	37	12	103283181	103283184	+	Intron	DEL	ATAG	-	-	rs138536418		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103283181_103283184delATAG	uc001tjq.1	-						PAH_uc010swc.1_Intron	NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase						catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	CCCAGACAACatagatagatagat	0.206													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	103526664	103526665	+	IGR	DEL	CT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103526664_103526665delCT								ASCL1 (172377 upstream) : C12orf42 (104705 downstream)																							gagccccaccctccccagtagc	0.000													4	2	---	---	---	---	
PPP1CC	5501	broad.mit.edu	37	12	111171282	111171282	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111171282delT	uc001tru.2	-							NM_002710	NP_002701	P36873	PP1G_HUMAN	protein phosphatase 1, catalytic subunit, gamma						cell division|glycogen metabolic process|mitotic prometaphase|triglyceride catabolic process	cleavage furrow|condensed chromosome kinetochore|cytosol|midbody|MLL5-L complex|nuclear speck|nucleolus|PTW/PP1 phosphatase complex	metal ion binding|protein binding|protein kinase binding|protein serine/threonine phosphatase activity			lung(2)|central_nervous_system(1)	3						TTGCTAACAATTTTTTTTTTT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	115391116	115391116	+	IGR	DEL	A	-	-	rs35030011		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115391116delA								TBX3 (269147 upstream) : None (None downstream)																							ACCCCCGACCAAAAAAAAAAA	0.498													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	115487471	115487471	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115487471delC								TBX3 (365502 upstream) : MED13L (908912 downstream)																							AAGCCATTATCCCTTATGGAA	0.358													4	2	---	---	---	---	
NOS1	4842	broad.mit.edu	37	12	117685829	117685830	+	Intron	DEL	CT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117685829_117685830delCT	uc001twm.1	-							NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal						multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	ctctagctccctctctctctct	0.000													4	2	---	---	---	---	
DYNLL1	8655	broad.mit.edu	37	12	120932769	120932769	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120932769delT	uc001tyj.2	+						uc001tyk.1_Intron|DYNLL1_uc001tyl.2_5'Flank|DYNLL1_uc001tym.2_5'Flank	NM_001037494	NP_001032583	P63167	DYL1_HUMAN	dynein light chain 1						actin cytoskeleton organization|activation of pro-apoptotic gene products|anatomical structure morphogenesis|female gamete generation|G2/M transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|microtubule-based process|negative regulation of phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transport	centrosome|cytoplasmic dynein complex|cytosol|microtubule|mitochondrion|nucleus|plasma membrane	motor activity|protein binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					gattcattgatcatttactat	0.154													4	2	---	---	---	---	
RNF10	9921	broad.mit.edu	37	12	121011389	121011389	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121011389delA	uc001typ.3	+						RNF10_uc010szk.1_Intron|RNF10_uc001tyq.3_Intron	NM_014868	NP_055683	Q8N5U6	RNF10_HUMAN	ring finger protein 10						negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					gtcatttatcaaaaaaaaaaa	0.025													3	3	---	---	---	---	
SPPL3	121665	broad.mit.edu	37	12	121228629	121228630	+	Intron	INS	-	T	T	rs35743748		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121228629_121228630insT	uc001tzd.2	-						SPPL3_uc009zwz.2_Intron	NM_139015	NP_620584	Q8TCT6	PSL4_HUMAN	signal peptide peptidase 3							integral to membrane	aspartic-type endopeptidase activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TATCTTGGCACttttttttttt	0.238													5	3	---	---	---	---	
CLIP1	6249	broad.mit.edu	37	12	122815311	122815312	+	Intron	INS	-	CA	CA	rs145493297	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122815311_122815312insCA	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc001ucj.1_Intron	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		cacgctcagctcattttttgta	0.000													3	3	---	---	---	---	
CLIP1	6249	broad.mit.edu	37	12	122850224	122850225	+	Intron	INS	-	A	A	rs150479919		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122850224_122850225insA	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc001ucj.1_5'Flank|CLIP1_uc010tae.1_Intron	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		CTGGGCTATTTAAAAAAAAAAA	0.252													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	123406209	123406210	+	IGR	DEL	AG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123406209_123406210delAG								VPS37B (25497 upstream) : ABCB9 (7330 downstream)																							ctgtaatcccagctactcggga	0.000													4	2	---	---	---	---	
NCOR2	9612	broad.mit.edu	37	12	124923424	124923425	+	Intron	INS	-	AC	AC	rs138222196		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124923424_124923425insAC	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gacagaggaagacagagaccca	0.084													6	4	---	---	---	---	
NCOR2	9612	broad.mit.edu	37	12	124923874	124923875	+	Intron	DEL	GA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124923874_124923875delGA	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gagacagagggagagacagaga	0.030													4	2	---	---	---	---	
TMEM132B	114795	broad.mit.edu	37	12	125923218	125923221	+	Intron	DEL	CTTC	-	-	rs148951500		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125923218_125923221delCTTC	uc001uhe.1	+							NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		cttcctccttcttccttccttcct	0.108													4	3	---	---	---	---	
TMEM132D	121256	broad.mit.edu	37	12	130353609	130353610	+	Intron	INS	-	T	T	rs35631209		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130353609_130353610insT	uc009zyl.1	-							NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TTTGCTTTGTGTTTTTTTTTTT	0.421													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	133047230	133047231	+	IGR	DEL	AC	-	-	rs146192364	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133047230_133047231delAC								GALNT9 (141325 upstream) : FBRSL1 (19926 downstream)																							atgcatatatacacacacacac	0.050													6	3	---	---	---	---	
FBRSL1	57666	broad.mit.edu	37	12	133112677	133112678	+	Intron	DEL	GT	-	-	rs142633034		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133112677_133112678delGT	uc001ukf.2	+							NM_001142641	NP_001136113	Q9HCM7	FBSL_HUMAN	fibrosin-like 1											central_nervous_system(2)	2						tgtgtacatggtgtgtgtgtgt	0.069													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	133786816	133786816	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133786816delG								ZNF268 (5086 upstream) : None (None downstream)																							TCGTCACTGTGGGTGTACCCT	0.517													4	2	---	---	---	---	
MTMR6	9107	broad.mit.edu	37	13	25816113	25816114	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25816113_25816114insA	uc001uqe.1	-							NM_004685	NP_004676	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6							cytoplasm|nuclear envelope	calcium-activated potassium channel activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			ovary(2)|skin(2)	4		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		actttaaaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	46463392	46463392	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46463392delA								SIAH3 (37546 upstream) : ZC3H13 (66413 downstream)																							ACTCTGCTGTAAGGAAAAGGC	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	59264420	59264420	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59264420delT								PCDH17 (961355 upstream) : DIAPH3 (975305 downstream)																							ttctgtcatattattgccaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	61705892	61705893	+	IGR	INS	-	T	T	rs145525774	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61705892_61705893insT								TDRD3 (557880 upstream) : PCDH20 (277928 downstream)																							atgctcaccaatttttttttta	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	64661925	64661928	+	IGR	DEL	AGGA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64661925_64661928delAGGA								OR7E156P (345224 upstream) : None (None downstream)																							gcaggaaggcaggaaggaaggaag	0.123													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	72563820	72563821	+	IGR	DEL	GT	-	-	rs149477805		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72563820_72563821delGT								DACH1 (122490 upstream) : C13orf37 (718674 downstream)																							GGGGCCTGTAGTGTGTGTGTGG	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	90607446	90607447	+	IGR	DEL	TG	-	-	rs145400498		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90607446_90607447delTG								None (None upstream) : MIR622 (275989 downstream)																							tgtgtgtctctgtgtgtgtgtg	0.000													4	2	---	---	---	---	
GPC6	10082	broad.mit.edu	37	13	94977307	94977307	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94977307delT	uc001vlt.2	+							NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				TGAACAGACATTTTAGGGATT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	104786238	104786238	+	IGR	DEL	A	-	-	rs67956059		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104786238delA								None (None upstream) : None (None downstream)																							CCTTCCACGGAAAAAAAAAAT	0.418													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	114026053	114026053	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114026053delC								GRTP1 (7590 upstream) : ADPRHL1 (50207 downstream)																							cctcctgagaccccctccctc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20091956	20091956	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20091956delT								P704P (71684 upstream) : OR4Q3 (123631 downstream)																							TCCTCTTTAAttttttttttt	0.189													4	3	---	---	---	---	
THTPA	79178	broad.mit.edu	37	14	23999628	23999628	+	Intron	DEL	A	-	-	rs35092523		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23999628delA	uc001wkb.3	+						uc001wkc.1_Intron|uc001wke.2_Intron			Q9BU02	THTPA_HUMAN	Homo sapiens thiamine triphosphatase mRNA, complete cds.						dephosphorylation|generation of precursor metabolites and energy|thiamine metabolic process	cytosol|nucleolus|soluble fraction	thiamin-triphosphatase activity				0	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00643)	Thiamine(DB00152)	tcattttattaagagtccagt	0.294													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	40798349	40798349	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40798349delC								FBXO33 (896645 upstream) : None (None downstream)																							caccctaacacaattaaaaga	0.000													3	3	---	---	---	---	
SIX4	51804	broad.mit.edu	37	14	61190954	61190954	+	5'Flank	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61190954delC	uc001xfc.2	-						SIX4_uc010app.1_Intron	NM_017420	NP_059116	Q9UIU6	SIX4_HUMAN	sine oculis homeobox homolog 4							nucleus				breast(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		GATCAGGTTTCCCCCCGGCCA	0.358													4	2	---	---	---	---	
ENTPD5	957	broad.mit.edu	37	14	74450954	74450954	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74450954delG	uc010tuo.1	-						ENTPD5_uc001xpi.2_Intron	NM_001249	NP_001240	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5						'de novo' posttranslational protein folding|ATP metabolic process|cell growth|cell proliferation|glycolysis|protein N-linked glycosylation|regulation of phosphatidylinositol 3-kinase cascade	endoplasmic reticulum lumen	guanosine-diphosphatase activity|uridine-diphosphatase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00394)		gaagaaaacaggagttagagt	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	89489093	89489093	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89489093delA								TTC8 (144759 upstream) : FOXN3 (133424 downstream)																							CACTGAAGAGAAAAAAAAAAG	0.284													4	2	---	---	---	---	
TTC7B	145567	broad.mit.edu	37	14	91233373	91233373	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91233373delA	uc001xyp.2	-							NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)				TTTATataccaaaaaaaaaaa	0.224													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97186138	97186139	+	IGR	DEL	GA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97186138_97186139delGA								PAPOLA (152692 upstream) : VRK1 (77545 downstream)																							CTTCTGAGTGGAGAGAGAGAGA	0.510													4	2	---	---	---	---	
JAG2	3714	broad.mit.edu	37	14	105630812	105630812	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105630812delC	uc001yqg.2	-						JAG2_uc001yqh.2_Intron	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor						auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GGGGGGTGGTCCCCAGTGTGC	0.612													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20417442	20417442	+	IGR	DEL	T	-	-	rs75977582		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20417442delT								None (None upstream) : GOLGA6L6 (319652 downstream)																							ttttttgtggttttttttttt	0.149													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20459807	20459808	+	IGR	INS	-	C	C	rs11248732		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20459807_20459808insC								None (None upstream) : GOLGA6L6 (277286 downstream)																							aaaaaaaaaaaaaCTCAATCCG	0.198													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22459417	22459418	+	IGR	DEL	AC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22459417_22459418delAC								OR4N3P (45032 upstream) : MIR1268 (53811 downstream)																							acacacacagacacacacacac	0.228													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	29945533	29945533	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29945533delG								FAM189A1 (82606 upstream) : TJP1 (46826 downstream)																							CTTGTTTCTTGCTTCTGTCTC	0.294													4	2	---	---	---	---	
OTUD7A	161725	broad.mit.edu	37	15	32030414	32030414	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32030414delG	uc001zfr.2	-						OTUD7A_uc001zfs.1_Intron|OTUD7A_uc010baa.1_Intron	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A							cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		ATGGGGGGATGGGGAGAGAGG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	38043627	38043628	+	IGR	INS	-	AGGA	AGGA			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38043627_38043628insAGGA								MEIS2 (650127 upstream) : TMCO5A (183199 downstream)																							gaaggaaaaagaggaaggaagg	0.074													3	3	---	---	---	---	
HAUS2	55142	broad.mit.edu	37	15	42847193	42847193	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42847193delT	uc001zqe.2	+						HAUS2_uc010udi.1_Intron|HAUS2_uc001zqf.2_Intron	NM_018097	NP_060567	Q9NVX0	HAUS2_HUMAN	centrosomal protein 27kDa isoform 1						cell division|centrosome organization|G2/M transition of mitotic cell cycle|mitosis|spindle assembly	centrosome|cytosol|HAUS complex|microtubule|spindle					0						gcctggctaattttttttttt	0.000													4	2	---	---	---	---	
CDAN1	146059	broad.mit.edu	37	15	43025476	43025477	+	Intron	INS	-	T	T	rs34650750		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43025476_43025477insT	uc001zql.2	-						CDAN1_uc001zqj.2_5'Flank|CDAN1_uc001zqk.2_Intron|CDAN1_uc010bcx.1_Intron	NM_138477	NP_612486	Q8IWY9	CDAN1_HUMAN	codanin 1							integral to membrane	protein binding			ovary(2)	2		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		CACCCACCACCttttttttttt	0.297													9	4	---	---	---	---	
UBR1	197131	broad.mit.edu	37	15	43368345	43368345	+	Intron	DEL	G	-	-	rs34147534		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43368345delG	uc001zqq.2	-						UBR1_uc010udk.1_Intron	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		actggttttcgtttttttttt	0.000													4	2	---	---	---	---	
FRMD5	84978	broad.mit.edu	37	15	44289394	44289394	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44289394delT	uc001ztl.2	-						FRMD5_uc001ztk.1_Intron|FRMD5_uc001ztm.2_Intron|FRMD5_uc001ztn.2_Intron	NM_032892	NP_116281	Q7Z6J6	FRMD5_HUMAN	FERM domain containing 5 isoform 2							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)		GATAAAGGCCTGAAGGGTAAC	0.418													4	2	---	---	---	---	
EIF3J	8669	broad.mit.edu	37	15	44851609	44851609	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44851609delA	uc001ztv.2	+						EIF3J_uc010ueg.1_Intron|EIF3J_uc001ztw.2_Intron	NM_003758	NP_003749	O75822	EIF3J_HUMAN	eukaryotic translation initiation factor 3,							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity				0		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45756124	45756128	+	Intron	DEL	CTCCA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45756124_45756128delCTCCA	uc001zvi.1	+											Homo sapiens cDNA FLJ32124 fis, clone PEBLM1000180.																		ccatcaccatctccacaccatcacc	0.078													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	46215153	46215153	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46215153delT								SQRDL (231675 upstream) : None (None downstream)																							ctgggctctcttttatttcca	0.070													4	2	---	---	---	---	
SHC4	399694	broad.mit.edu	37	15	49213108	49213108	+	Intron	DEL	T	-	-	rs36063586		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49213108delT	uc001zxb.1	-							NM_203349	NP_976224	Q6S5L8	SHC4_HUMAN	rai-like protein						intracellular signal transduction	cell junction|postsynaptic membrane				ovary(3)|pancreas(2)	5		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		atcgagactcttgtctctata	0.000													4	2	---	---	---	---	
MYO5A	4644	broad.mit.edu	37	15	52616939	52616939	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52616939delT	uc002aby.2	-						MYO5A_uc002abx.3_Intron|MYO5A_uc010ugd.1_Intron	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1						actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		CATTATATCATTTTTTTTTAA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	54084864	54084864	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54084864delA								WDR72 (33005 upstream) : UNC13C (220237 downstream)																							cctgtcttagaaaaaaaagaa	0.000													4	2	---	---	---	---	
RFX7	64864	broad.mit.edu	37	15	56416622	56416622	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56416622delA	uc010bfn.2	-							NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2						regulation of transcription, DNA-dependent	nucleus	DNA binding				0						tcagtctccgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CILP	8483	broad.mit.edu	37	15	65500261	65500261	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65500261delG	uc002aon.2	-							NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein						negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						tctcagaaaagctttactcct	0.015													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	66870736	66870736	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66870736delA								LCTL (12419 upstream) : SMAD6 (123938 downstream)																							atcctgtctcaaaaaaaaaaa	0.035													4	2	---	---	---	---	
PAQR5	54852	broad.mit.edu	37	15	69649593	69649594	+	Intron	INS	-	TGTTTGTT	TGTTTGTT	rs139703429	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69649593_69649594insTGTTTGTT	uc002arz.2	+						PAQR5_uc002asa.2_Intron	NM_017705	NP_060175	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V						cell differentiation|multicellular organismal development|oogenesis	integral to membrane	receptor activity|steroid binding			ovary(2)	2						cagtctcagggtgtttgtttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70519829	70519829	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70519829delG								TLE3 (129573 upstream) : UACA (427066 downstream)																							ctaagaaactggggactggga	0.149													4	2	---	---	---	---	
PARP6	56965	broad.mit.edu	37	15	72560099	72560099	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72560099delT	uc002auc.2	-						PARP6_uc002aua.2_5'Flank|PARP6_uc002aub.2_5'Flank|PARP6_uc002aud.3_Intron|PARP6_uc002auf.1_5'Flank|CELF6_uc010biv.1_Intron	NM_020214	NP_064599	Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6								NAD+ ADP-ribosyltransferase activity				0						atcaatacacttttttttttt	0.134													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	73185819	73185819	+	IGR	DEL	G	-	-	rs35966164		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73185819delG								ADPGK (109152 upstream) : NEO1 (159056 downstream)																							atgttatctcgggttcttcct	0.000													1	6	---	---	---	---	
C15orf27	123591	broad.mit.edu	37	15	76451986	76451986	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76451986delC	uc002bbq.2	+						C15orf27_uc010bkp.2_Intron|C15orf27_uc002bbr.2_Intron	NM_152335	NP_689548	Q2M3C6	CO027_HUMAN	hypothetical protein LOC123591							integral to membrane					0						CACCTAGAGTCCCCTGACTGT	0.537													4	2	---	---	---	---	
ETFA	2108	broad.mit.edu	37	15	76602167	76602167	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76602167delA	uc002bbt.2	-						ETFA_uc010bkq.1_Intron|ETFA_uc002bbu.1_Intron	NM_000126	NP_000117	P13804	ETFA_HUMAN	electron transfer flavoprotein, alpha						respiratory electron transport chain|transport	mitochondrial matrix	electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity				0						CAACCGGGAGAAAACATGTCC	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78177863	78177864	+	IGR	DEL	AC	-	-	rs71951797		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78177863_78177864delAC								LINGO1 (189388 upstream) : LOC645752 (28695 downstream)																							agagacacagacacacacacac	0.045													3	3	---	---	---	---	
CRABP1	1381	broad.mit.edu	37	15	78630554	78630555	+	5'Flank	DEL	TC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78630554_78630555delTC	uc002bdp.2	+							NM_004378	NP_004369	P29762	RABP1_HUMAN	cellular retinoic acid binding protein 1						multicellular organismal development|signal transduction	cytoplasm	retinal binding|retinol binding|transporter activity				0					Alitretinoin(DB00523)|Etretinate(DB00926)	GCTGAAGCCTTCTTAGGGAAGA	0.584													4	2	---	---	---	---	
EFTUD1	79631	broad.mit.edu	37	15	82490245	82490248	+	Intron	DEL	CCTG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82490245_82490248delCCTG	uc002bgt.1	-						EFTUD1_uc002bgu.1_Intron	NM_024580	NP_078856	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain						mature ribosome assembly		GTP binding|GTPase activity|ribosome binding|translation elongation factor activity			ovary(1)	1						tgcctgccaacctgcctgcctgcc	0.284													4	2	---	---	---	---	
WHAMM	123720	broad.mit.edu	37	15	83486821	83486822	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83486821_83486822delAG	uc002bje.2	+	4	1590_1591	c.1084_1085delAG	c.(1084-1086)AGAfs	p.R362fs		NM_001080435	NP_001073904	Q8TF30	WHAMM_HUMAN	WAS protein homolog associated with actin, golgi	362						cytoplasmic vesicle membrane|ER-Golgi intermediate compartment|Golgi apparatus	actin binding				0						AAATCACAAAAGAGCTGAAATT	0.317													5	5	---	---	---	---	
ADAMTSL3	57188	broad.mit.edu	37	15	84582288	84582289	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84582288_84582289insT	uc002bjz.3	+						ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			CTTTTTCTTTCTTTTTTTTTTG	0.302													4	2	---	---	---	---	
AKAP13	11214	broad.mit.edu	37	15	85994820	85994820	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85994820delT	uc002blv.1	+						AKAP13_uc002bls.2_Intron|AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						tctctcgacatttgctttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	89218413	89218413	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89218413delT								ISG20 (19534 upstream) : ACAN (128261 downstream)																							TTTAATGTGATTTTTTTTTCA	0.279													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	90369120	90369120	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90369120delC								ANPEP (11048 upstream) : AP3S2 (4712 downstream)																							ATCCTAAGGACCCTCACTCCT	0.418													4	2	---	---	---	---	
AP3S2	10239	broad.mit.edu	37	15	90393949	90393950	+	Intron	INS	-	T	T	rs147293608		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90393949_90393950insT	uc002boq.3	-						AP3S2_uc002bos.3_Intron|AP3S2_uc010bns.2_Intron|AP3S2_uc002bor.3_Intron|AP3S2_uc010bnt.2_Intron	NM_005829	NP_005820	P59780	AP3S2_HUMAN	adaptor-related protein complex 3, sigma 2						intracellular protein transport|vesicle-mediated transport	cytoplasmic vesicle membrane|Golgi apparatus|membrane coat	protein transporter activity				0	Lung NSC(78;0.0181)|all_lung(78;0.0384)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)			TGAtttttttcttttttttttt	0.193													3	3	---	---	---	---	
ZNF710	374655	broad.mit.edu	37	15	90595482	90595483	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90595482_90595483insT	uc002bov.1	+							NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			CCCCATGTGACTTTTTTTTGTC	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	97506953	97506953	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97506953delG								SPATA8 (178109 upstream) : LOC91948 (778893 downstream)																							cagctattcaggaggctgagg	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	97573125	97573125	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97573125delA								SPATA8 (244281 upstream) : LOC91948 (712721 downstream)																							agatattgagaaaaaaaaaag	0.000													4	2	---	---	---	---	
PGPEP1L	145814	broad.mit.edu	37	15	99519342	99519342	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99519342delG	uc002bum.2	-						PGPEP1L_uc010bop.2_Intron|PGPEP1L_uc002bun.2_Intron	NM_001102612	NP_001096082	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase 1-like protein						proteolysis		cysteine-type peptidase activity				0						gtgttagtgtgggacaatgga	0.000													4	2	---	---	---	---	
HS3ST6	64711	broad.mit.edu	37	16	1970684	1970685	+	5'Flank	INS	-	G	G	rs148459092	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1970684_1970685insG	uc002cnf.2	-							NM_001009606	NP_001009606	C9JH64	C9JH64_HUMAN	heparan sulfate (glucosamine)												0						GTGGAATGGACTGGGGACAGGG	0.589													3	5	---	---	---	---	
C16orf75	116028	broad.mit.edu	37	16	11348032	11348032	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11348032delG	uc002daq.1	+									Q96E14	RMI2_HUMAN	Homo sapiens cDNA FLJ41770 fis, clone IMR322007225.						DNA replication	nucleus	DNA binding				0						aattagggctggcacgcacaa	0.229			T	CIITA	PMBL|Hodgkin Lymphona|								2	5	---	---	---	---	
ITGAM	3684	broad.mit.edu	37	16	31343181	31343182	+	3'UTR	INS	-	GTGTGTGCGA	GTGTGTGCGA	rs142861575	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31343181_31343182insGTGTGTGCGA	uc002ebq.2	+	30					ITGAM_uc002ebr.2_3'UTR|ITGAM_uc010can.2_3'UTR	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						tgtgtatgtgcgtgtgtgcaag	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33048951	33048951	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33048951delT								SLC6A10P (152488 upstream) : MIR1826 (916557 downstream)																							tacaagtcaatggcttttagt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33538280	33538282	+	IGR	DEL	ATT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33538280_33538282delATT								SLC6A10P (641817 upstream) : MIR1826 (427226 downstream)																							TCAACAGCTCATTATTCCATTCT	0.394													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33862986	33862987	+	IGR	DEL	AA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33862986_33862987delAA								SLC6A10P (966523 upstream) : MIR1826 (102521 downstream)																							agtgtcttacaaaagtctagag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33920175	33920175	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33920175delG								None (None upstream) : MIR1826 (45333 downstream)																							aagtttctcaggatgtttctg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	47028583	47028584	+	IGR	INS	-	T	T	rs147647572		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47028583_47028584insT								DNAJA2 (20958 upstream) : NETO2 (86858 downstream)																							AAAGGAGTCAAttttttttttt	0.025													2	4	---	---	---	---	
ZNF423	23090	broad.mit.edu	37	16	49525277	49525277	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49525277delC	uc002efs.2	-						ZNF423_uc010vgn.1_Intron	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423						cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				GCTCGTCCCTCCCACTCAGTG	0.522													9	17	---	---	---	---	
CPNE2	221184	broad.mit.edu	37	16	57137568	57137568	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57137568delT	uc002eks.1	+						CPNE2_uc010cct.1_Intron	NM_152727	NP_689940	Q96FN4	CPNE2_HUMAN	copine II											central_nervous_system(1)|skin(1)	2		all_neural(199;0.224)				TCCCTGTGCCTGCCTCTCTCA	0.647													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	79884705	79884706	+	IGR	INS	-	ACAC	ACAC			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79884705_79884706insACAC								MAF (250083 upstream) : DYNLRB2 (690148 downstream)																							cctacacacctacacacacaca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86756960	86756963	+	5'Flank	DEL	GTGT	-	-	rs71865927		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86756960_86756963delGTGT	uc002fjs.2	-											Homo sapiens, clone IMAGE:5164933, mRNA.																		gtgcaggtgcgtgtgtgtgtgtgt	0.324													2	4	---	---	---	---	
ZZEF1	23140	broad.mit.edu	37	17	4035218	4035218	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4035218delC	uc002fxe.2	-						ZZEF1_uc002fxk.1_Intron	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1								calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						catgcatgggcaacgatggga	0.000													4	2	---	---	---	---	
CYTSB	92521	broad.mit.edu	37	17	20093707	20093708	+	Intron	INS	-	CTGCTGCC	CTGCTGCC	rs142894743	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20093707_20093708insCTGCTGCC	uc002gwq.2	+						CYTSB_uc010cqx.2_Intron|CYTSB_uc002gwr.2_Intron|CYTSB_uc002gws.2_Intron|CYTSB_uc002gwv.2_Intron|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gwt.2_Intron|CYTSB_uc002gwu.2_Intron	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b							nucleus					0						aagcaagactgctgctgccctg	0.064													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21227396	21227396	+	IGR	DEL	G	-	-	rs66676557		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21227396delG								MAP2K3 (8847 upstream) : KCNJ12 (52303 downstream)																							TGTAAGGGCCGTGGTTGATAC	0.542													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21349799	21349800	+	IGR	INS	-	T	T	rs149320743		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21349799_21349800insT								KCNJ12 (26620 upstream) : C17orf51 (81772 downstream)																							tgatattgagcttttttttcat	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25263209	25263210	+	IGR	INS	-	TGGAG	TGGAG			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25263209_25263210insTGGAG								None (None upstream) : WSB1 (357896 downstream)																							gtggagtggaatggagtggagt	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25318507	25318507	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25318507delC								None (None upstream) : WSB1 (302599 downstream)																							CTCAATGAAACCCATGTAAGA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	26308448	26308448	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26308448delA								NOS2 (88039 upstream) : NLK (61240 downstream)																							AGCTAAAATTAAAAAAAAAAT	0.129													3	8	---	---	---	---	
FLOT2	2319	broad.mit.edu	37	17	27220430	27220430	+	Intron	DEL	T	-	-	rs35445199		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27220430delT	uc002hdc.2	-							NM_004475	NP_004466	Q14254	FLOT2_HUMAN	flotillin 2						cell adhesion|epidermis development	cell surface|endocytic vesicle|endosome|membrane fraction					0	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;3.26e-06)|all cancers(11;1.76e-05)|BRCA - Breast invasive adenocarcinoma(11;0.00015)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			CTCCACCttcttttttttttt	0.299													4	2	---	---	---	---	
ANKRD13B	124930	broad.mit.edu	37	17	27936638	27936639	+	Intron	DEL	CA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27936638_27936639delCA	uc002hei.2	+						ANKRD13B_uc002heh.2_Intron|ANKRD13B_uc002hej.2_Intron|ANKRD13B_uc002hek.2_5'Flank	NM_152345	NP_689558	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B												0						cgtgcacacgcacacacacaca	0.158													6	3	---	---	---	---	
ATAD5	79915	broad.mit.edu	37	17	29159350	29159350	+	5'UTR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29159350delC	uc002hfs.1	+	1					ATAD5_uc002hft.1_5'Flank	NM_024857	NP_079133	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5						response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity			ovary(3)	3		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGACGGGATTCCGGGAAGCGG	0.662													21	12	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	32117796	32117796	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32117796delA	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	tctgactgataAAGATGATGA	0.129													4	2	---	---	---	---	
CCL18	6362	broad.mit.edu	37	17	34391266	34391266	+	5'Flank	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34391266delA	uc002hku.2	+							NM_002988	NP_002979	P55774	CCL18_HUMAN	small inducible cytokine A18 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|response to biotic stimulus|signal transduction	extracellular space	chemokine activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		tgactctcttaaaaggaaaaa	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	38364667	38364668	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38364667_38364668insT								RAPGEFL1 (12761 upstream) : WIPF2 (10906 downstream)																							ctcttgagccctttttttttcc	0.035													4	2	---	---	---	---	
PYY	5697	broad.mit.edu	37	17	42040875	42040876	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42040875_42040876insA	uc002ieq.2	-							NM_004160	NP_004151	P10082	PYY_HUMAN	peptide YY precursor						cell proliferation|cell-cell signaling|cellular component movement|cytoskeleton organization|digestion|G-protein coupled receptor protein signaling pathway	soluble fraction					0		Breast(137;0.00314)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.12)		aactccatctcaaaaaaaaaaa	0.000													1	6	---	---	---	---	
TMUB2	79089	broad.mit.edu	37	17	42267079	42267079	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42267079delA	uc002ifo.2	+						C17orf65_uc002ifn.2_5'Flank|TMUB2_uc002ifp.2_Intron|TMUB2_uc010wiu.1_Intron|TMUB2_uc002ifq.2_Intron|TMUB2_uc002ifr.2_Intron|TMUB2_uc002ifs.2_Intron|TMUB2_uc002ift.2_Intron|TMUB2_uc002ifu.2_Intron|TMUB2_uc002ifv.2_Intron|TMUB2_uc002ifw.1_3'UTR|TMUB2_uc002ifx.2_Intron|TMUB2_uc002ify.2_Intron	NM_001076674	NP_001070142	Q71RG4	TMUB2_HUMAN	transmembrane and ubiquitin-like domain							integral to membrane				lung(1)	1		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		TACCAAGGGCAGGTAGATACT	0.348													4	2	---	---	---	---	
CRHR1	1394	broad.mit.edu	37	17	43795677	43795682	+	Intron	DEL	CTTCTT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43795677_43795682delCTTCTT	uc002ijp.2	+						CRHR1_uc010wjx.1_Intron			P34998	CRFR1_HUMAN	SubName: Full=cDNA FLJ60308, highly similar to Corticotropin-releasing factor receptor 1;						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		cctctgcctccttcttcttcttctTT	0.034													4	2	---	---	---	---	
KIAA1267	284058	broad.mit.edu	37	17	44170851	44170852	+	Intron	DEL	AT	-	-	rs66483561		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44170851_44170852delAT	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				GGGAGGGGGAATATATATATAT	0.356													3	3	---	---	---	---	
KIAA1267	284058	broad.mit.edu	37	17	44244422	44244422	+	Intron	DEL	A	-	-	rs66866969		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44244422delA	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				aaaagaaaggaaaaaaaaaaa	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44325783	44325784	+	IGR	DEL	CT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44325783_44325784delCT								KIAA1267 (23066 upstream) : ARL17B (38079 downstream)																							ccgtcagcccctgttagctact	0.000													5	3	---	---	---	---	
DLX3	1747	broad.mit.edu	37	17	48072797	48072798	+	5'Flank	INS	-	AC	AC	rs10671429		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48072797_48072798insAC	uc002ipy.2	-							NM_005220	NP_005211	O60479	DLX3_HUMAN	distal-less homeobox 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGTTACTCAAAacacacacaca	0.307													4	5	---	---	---	---	
ACSF2	80221	broad.mit.edu	37	17	48504405	48504405	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48504405delA	uc002iqu.2	+						ACSF2_uc010wml.1_Intron|ACSF2_uc010wmm.1_Intron|ACSF2_uc010wmn.1_Intron|ACSF2_uc010wmo.1_Intron	NM_025149	NP_079425	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2 precursor						fatty acid metabolic process	mitochondrion	ATP binding|ligase activity				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GGCAAATGTGAAAGTGCTTGA	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	49478495	49478495	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49478495delA								UTP18 (103205 upstream) : CA10 (229180 downstream)																							cctttccttgaaaccagaccg	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	51517671	51517672	+	IGR	INS	-	AC	AC	rs141416568	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51517671_51517672insAC								None (None upstream) : KIF2B (382567 downstream)																							cacacacacatacacacacaca	0.312													3	3	---	---	---	---	
CLTC	1213	broad.mit.edu	37	17	57755743	57755744	+	Intron	INS	-	TT	TT	rs148887936	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57755743_57755744insTT	uc002ixq.1	+						CLTC_uc002ixp.2_Intron|CLTC_uc002ixr.1_Intron	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					ttgattcttgcttaaaccattc	0.000			T	ALK|TFE3	ALCL|renal 								3	3	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	59343059	59343060	+	Intron	INS	-	C	C	rs146759763	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59343059_59343060insC	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron|BCAS3_uc002izb.3_Intron|BCAS3_uc002izc.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			CATTCTTTTTTCCCCCCCATCA	0.391													4	2	---	---	---	---	
MRC2	9902	broad.mit.edu	37	17	60730601	60730601	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60730601delA	uc002jad.2	+						MRC2_uc002jac.2_Intron	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2						endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3						GGTCTAAGACAAAAGCCAGCA	0.607													4	2	---	---	---	---	
MARCH10	162333	broad.mit.edu	37	17	60878821	60878822	+	Intron	DEL	TT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60878821_60878822delTT	uc010ddr.2	-						MARCH10_uc002jag.3_Intron|MARCH10_uc010dds.2_Intron|MARCH10_uc002jah.2_Intron	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190								ligase activity|zinc ion binding				0						gctatccccgtttttttttttt	0.040													4	2	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	63656579	63656590	+	Intron	DEL	TCCTTCCTTCCT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63656579_63656590delTCCTTCCTTCCT	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron|CCDC46_uc002jfk.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			cttctctctctccttccttccttccttccttc	0.000													4	3	---	---	---	---	
OTOP3	347741	broad.mit.edu	37	17	72942565	72942566	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72942565_72942566insA	uc010wrr.1	+						OTOP3_uc010wrq.1_Intron	NM_178233	NP_839947	Q7RTS5	OTOP3_HUMAN	otopetrin 3							integral to membrane|intracellular	zinc ion binding			ovary(1)	1	all_lung(278;0.151)|Lung NSC(278;0.185)					CAATTCCTTTGAAAAAGAATGA	0.153													4	2	---	---	---	---	
GRB2	2885	broad.mit.edu	37	17	73397047	73397047	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73397047delT	uc002jnx.3	-						GRB2_uc002jny.3_Intron	NM_002086	NP_002077	P62993	GRB2_HUMAN	growth factor receptor-bound protein 2 isoform						axon guidance|blood coagulation|cell junction assembly|cell-cell signaling|cellular response to ionizing radiation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|receptor internalization|signal transduction in response to DNA damage|T cell costimulation	cytosol|Golgi apparatus	epidermal growth factor receptor binding|insulin receptor substrate binding|SH3/SH2 adaptor activity			ovary(3)	3	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	GATATATCAAttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	74591633	74591634	+	IGR	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74591633_74591634insA								ST6GALNAC2 (9488 upstream) : ST6GALNAC1 (29213 downstream)																							gactctgtctcaaaaaaaaaaa	0.163													4	2	---	---	---	---	
MFSD11	79157	broad.mit.edu	37	17	74759867	74759867	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74759867delA	uc002jta.2	+						MFSD11_uc002jtb.2_Intron|MFSD11_uc010dha.2_Intron|MFSD11_uc002jtc.2_Intron|MFSD11_uc002jtd.3_Intron|MFSD11_uc010dhb.2_Intron|MFSD11_uc002jte.2_Intron	NM_024311	NP_077287	O43934	MFS11_HUMAN	major facilitator superfamily domain containing							integral to membrane				ovary(1)	1						cacaaaacttaaaaaaaaaaa	0.000													3	3	---	---	---	---	
MGAT5B	146664	broad.mit.edu	37	17	74928139	74928140	+	Intron	INS	-	CTT	CTT			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74928139_74928140insCTT	uc002jti.2	+						MGAT5B_uc002jth.2_Intron	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN	N-acetylglucosaminyltranferase VB isoform 2							Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3						tctttctcctcctccttttttc	0.183													7	5	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77133320	77133321	+	Intron	DEL	CA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77133320_77133321delCA	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			CCTCTTCATGcacacacacaca	0.485													4	2	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77265698	77265698	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77265698delC	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			TCTCTGTTCTCCCCCTACCTG	0.592													4	6	---	---	---	---	
SGSH	6448	broad.mit.edu	37	17	78186993	78186993	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78186993delA	uc002jxz.3	-						SGSH_uc002jya.3_Intron|SGSH_uc002jxy.2_3'UTR|SGSH_uc010wue.1_Intron	NM_000199	NP_000190	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase precursor						proteoglycan metabolic process	lysosome	metal ion binding|N-sulfoglucosamine sulfohydrolase activity|sulfuric ester hydrolase activity			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			actcagtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
BAHCC1	57597	broad.mit.edu	37	17	79392611	79392612	+	Intron	INS	-	CGCA	CGCA	rs2864470		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79392611_79392612insCGCA	uc002kaf.2	+							NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1								DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			gtgtgtgtacgtgtgtgtgtgt	0.332													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	4049870	4049870	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4049870delC	uc010wyz.1	-						uc002kmm.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				actcatttatccatctgtcta	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	6504021	6504021	+	IGR	DEL	G	-	-	rs56137155		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6504021delG								L3MBTL4 (89111 upstream) : ARHGAP28 (284472 downstream)																							aaggaaggaaggaaggaagga	0.025													4	2	---	---	---	---	
LAMA1	284217	broad.mit.edu	37	18	7062265	7062285	+	Intron	DEL	AGTCAGGGAAGTCTTCCCTGA	-	-	rs77146134		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7062265_7062285delAGTCAGGGAAGTCTTCCCTGA	uc002knm.2	-						LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GAAGGCAGATAGTCAGGGAAGTCTTCCCTGAAGGTAAGAGA	0.538													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	8606407	8606407	+	IGR	DEL	T	-	-	rs11302144		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8606407delT								PTPRM (199549 upstream) : RAB12 (3028 downstream)																							AGGAGGGAGGTTTTTTTTTTT	0.348													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15208200	15208200	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15208200delT								ANKRD30B (355463 upstream) : LOC644669 (105355 downstream)																							gctttctttctttttttctcc	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15387937	15387937	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15387937delT								LOC644669 (62019 upstream) : None (None downstream)																							tgaaacactcttttgtagaat	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	28442214	28442215	+	IGR	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28442214_28442215insA								MIR302F (563288 upstream) : DSC3 (127838 downstream)																							GACTAAGAGTTGAAAAGACAGT	0.426													4	2	---	---	---	---	
CELF4	56853	broad.mit.edu	37	18	34905131	34905131	+	Intron	DEL	G	-	-	rs35330329		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34905131delG	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						CAACGGGGGAGTGAGGCCATT	0.617													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	38980751	38980751	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38980751delA								None (None upstream) : KC6 (79487 downstream)																							caaaaatactaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SETBP1	26040	broad.mit.edu	37	18	42641988	42641989	+	Intron	DEL	TG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42641988_42641989delTG	uc010dni.2	+							NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		tgtgcccatttgtgtgtgtgtg	0.366									Schinzel-Giedion_syndrome				4	2	---	---	---	---	
WDR7	23335	broad.mit.edu	37	18	54684644	54684647	+	Intron	DEL	TGTG	-	-	rs139161530		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54684644_54684647delTGTG	uc002lgk.1	+						WDR7_uc002lgl.1_Intron	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1											ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		AGCATCATGCtgtgtgtgtgtgtg	0.250													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	56678566	56678566	+	IGR	DEL	A	-	-	rs33951687		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56678566delA								ZNF532 (24863 upstream) : LOC390858 (24405 downstream)																							accccacctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68919874	68919875	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68919874_68919875insT								SOCS6 (922440 upstream) : None (None downstream)																							ctggcttcccctttgccttctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75066084	75066084	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75066084delT								GALR1 (83990 upstream) : None (None downstream)																							tctcgttgcgttttccctgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75807242	75807242	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75807242delA								GALR1 (825148 upstream) : SALL3 (933033 downstream)																							AGAGGTTAAGAAAATGTGACA	0.353													4	2	---	---	---	---	
TXNL4A	10907	broad.mit.edu	37	18	77786937	77786938	+	Intron	DEL	TG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77786937_77786938delTG	uc010drg.2	-							NM_006701	NP_006692	P83876	TXN4A_HUMAN	thioredoxin-like 4A						cell division|mitosis|spliceosome assembly	nucleoplasm|spliceosomal complex	protein binding				0		all_cancers(4;1.15e-12)|all_epithelial(4;8.61e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0646)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;7.36e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0249)		aacataatcttgtgaccaggaa	0.000													4	2	---	---	---	---	
MADCAM1	8174	broad.mit.edu	37	19	503752	503752	+	Intron	DEL	A	-	-	rs78574640		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:503752delA	uc002los.2	+						MADCAM1_uc002lot.2_Intron|MADCAM1_uc010drq.2_Intron	NM_130760	NP_570116	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion						cell adhesion|immune response|regulation of immune response|signal transduction	integral to membrane|membrane fraction|plasma membrane					0		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actcagtctcaaaaaaaaaaG	0.010													4	2	---	---	---	---	
SPPL2B	56928	broad.mit.edu	37	19	2325420	2325421	+	Intron	DEL	CT	-	-	rs148145895		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2325420_2325421delCT	uc010dsw.1	+						LSM7_uc002lvp.3_Intron			Q8TCT7	PSL1_HUMAN	SubName: Full=Putative uncharacterized protein ENSP00000371624;							Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTCTTACCCCTGTCATCTTTC	0.649													4	5	---	---	---	---	
NFIC	4782	broad.mit.edu	37	19	3441668	3441668	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3441668delA	uc010xhi.1	+						NFIC_uc002lxo.2_Intron|NFIC_uc010xhh.1_Intron|NFIC_uc002lxp.2_Intron|NFIC_uc010xhj.1_Intron	NM_205843	NP_995315	P08651	NFIC_HUMAN	nuclear factor I/C isoform 2						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		ggcccaagggaagggccagag	0.214													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	5523044	5523044	+	IGR	DEL	T	-	-	rs57193282		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5523044delT								ZNRF4 (66178 upstream) : PLAC2 (35136 downstream)																							cgctaccccctcatcgcctca	0.000													4	2	---	---	---	---	
FUT5	2527	broad.mit.edu	37	19	5903022	5903022	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5903022delA	uc010duo.2	-						NDUFA11_uc002mdp.1_Intron|NDUFA11_uc002mdq.1_Intron|NDUFA11_uc002mdr.1_Intron|VMAC_uc002mds.3_5'Flank	NM_002034	NP_002025	Q11128	FUT5_HUMAN	fucosyltransferase 5						L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						gctctgtctcaaaaaaaaaaa	0.229													4	2	---	---	---	---	
VAV1	7409	broad.mit.edu	37	19	6841489	6841490	+	Intron	INS	-	T	T	rs74174844		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6841489_6841490insT	uc002mfu.1	+						VAV1_uc010xjh.1_Intron|VAV1_uc010dva.1_Intron|VAV1_uc002mfv.1_Intron	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						tttttcttttcttttttttttt	0.000													3	3	---	---	---	---	
ARHGEF18	23370	broad.mit.edu	37	19	7454354	7454357	+	Intron	DEL	CTTC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7454354_7454357delCTTC	uc010xjm.1	+							NM_015318	NP_056133	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor 18						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)				CCTACATtttcttccttccttcct	0.025													5	6	---	---	---	---	
CLEC4G	339390	broad.mit.edu	37	19	7793912	7793912	+	3'UTR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7793912delA	uc002mhp.3	-	9						NM_198492	NP_940894	Q6UXB4	CLC4G_HUMAN	C-type lectin domain family 4, member G							integral to membrane	protein binding|sugar binding				0						AGTTTGGTGGAAAATGCGAGA	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7801459	7801462	+	IGR	DEL	TCTC	-	-	rs142046339		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7801459_7801462delTCTC								CLEC4G (4402 upstream) : CD209 (3419 downstream)																							tttctttatttctctctttctttc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7885001	7885002	+	IGR	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7885001_7885002insA								CLEC4GP1 (29103 upstream) : EVI5L (10159 downstream)																							agctgcatctcaaaaaaaaaaa	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8097249	8097249	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8097249delA								ELAVL1 (26720 upstream) : CCL25 (20397 downstream)																							TGCTAAAGGGAAAATGTGTCT	0.234													4	2	---	---	---	---	
LASS4	79603	broad.mit.edu	37	19	8294303	8294305	+	Intron	DEL	TTC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8294303_8294305delTTC	uc002mjg.2	+						LASS4_uc002mjh.2_Intron|LASS4_uc002mji.2_Intron|LASS4_uc010dvz.2_Intron	NM_024552	NP_078828	Q9HA82	CERS4_HUMAN	LAG1 homolog, ceramide synthase 4							endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(1)	1						ttcttcttttttcttcttcttct	0.138													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8583225	8583226	+	IGR	DEL	TG	-	-	rs61622018		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8583225_8583226delTG								ZNF414 (4177 upstream) : MYO1F (2773 downstream)																							TCTCTCTCTCtgtgtgtgtgtg	0.139													4	3	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	8964191	8964192	+	Intron	DEL	AC	-	-	rs75182570		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8964191_8964192delAC	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ctctctctctacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9157875	9157875	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9157875delA								MUC16 (65857 upstream) : OR1M1 (46046 downstream)																							ctctgcctccaaaagtgctag	0.144													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9195361	9195361	+	IGR	DEL	A	-	-	rs34788535		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9195361delA								MUC16 (103343 upstream) : OR1M1 (8560 downstream)																							cgtctcaaagaaaaaaaaatg	0.000													4	4	---	---	---	---	
SMARCA4	6597	broad.mit.edu	37	19	11090089	11090089	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11090089delT	uc002mqf.3	+						SMARCA4_uc010dxp.2_Intron|SMARCA4_uc010dxo.2_Intron|SMARCA4_uc002mqe.2_Intron	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				tgtgattgtcttttttttttt	0.000			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				4	2	---	---	---	---	
ECSIT	51295	broad.mit.edu	37	19	11618098	11618098	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11618098delT	uc002msb.2	-						ZNF653_uc002mrz.1_5'Flank|ECSIT_uc002msa.1_Intron|ECSIT_uc010dyc.1_Intron|ECSIT_uc010dyd.2_Intron|ECSIT_uc010xma.1_Intron	NM_016581	NP_057665	Q9BQ95	ECSIT_HUMAN	evolutionarily conserved signaling intermediate						innate immune response|regulation of oxidoreductase activity	mitochondrion	oxidoreductase activity, acting on NADH or NADPH|protein binding			ovary(1)	1						GGTTTTTGCCttttttttttt	0.303													4	3	---	---	---	---	
ZNF833	401898	broad.mit.edu	37	19	11765297	11765297	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11765297delT	uc002msl.3	+											Homo sapiens cDNA FLJ44800 fis, clone BRACE3041162, moderately similar to Homo sapiens zinc finger protein 14 (KOX 6) (ZNF14).												0						CTTTCAGTCCttttttttttt	0.209													4	2	---	---	---	---	
ZNF709	163051	broad.mit.edu	37	19	12610297	12610299	+	Intron	DEL	ACA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12610297_12610299delACA	uc002mtx.3	-						ZNF709_uc002mtw.3_Intron	NM_001145647	NP_001139119	Q8N972	ZN709_HUMAN	zinc finger protein 709 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						tccgtctcacacaacaacaacaa	0.074													4	2	---	---	---	---	
ZNF709	163051	broad.mit.edu	37	19	12625195	12625197	+	Intron	DEL	AAC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12625195_12625197delAAC	uc002mtx.3	-						ZNF709_uc002mtw.3_5'Flank	NM_001145647	NP_001139119	Q8N972	ZN709_HUMAN	zinc finger protein 709 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAGAAAAAAAAACAACAACAACA	0.379													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13695476	13695476	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13695476delG								CACNA1A (78202 upstream) : CCDC130 (147098 downstream)																							ctgtttttttgtttgcgtgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14425250	14425251	+	IGR	DEL	CT	-	-	rs113940897		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14425250_14425251delCT								LPHN1 (108253 upstream) : CD97 (66962 downstream)																							ggcactcacactcacagtctca	0.188													4	2	---	---	---	---	
MYO9B	4650	broad.mit.edu	37	19	17263975	17263976	+	Intron	INS	-	GTTT	GTTT	rs148024728	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17263975_17263976insGTTT	uc010eak.2	+						MYO9B_uc002nfi.2_Intron|MYO9B_uc002nfj.1_Intron	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1						actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						GGGTTTTTTTGgtttgtttgtt	0.059													2	4	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17714028	17714029	+	3'UTR	INS	-	AC	AC	rs143510015	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17714028_17714029insAC	uc002nhd.2	-	43						NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						GGGAACCCTAAACACACACACA	0.396													4	2	---	---	---	---	
MAST3	23031	broad.mit.edu	37	19	18237186	18237187	+	Intron	DEL	CC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18237186_18237187delCC	uc002nhz.3	+							NM_015016	NP_055831	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase								ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			large_intestine(2)|ovary(2)|stomach(1)	5						caggaggtgaccaggttgcaga	0.079													4	2	---	---	---	---	
ELL	8178	broad.mit.edu	37	19	18608937	18608938	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18608937_18608938insA	uc002njh.2	-						ELL_uc010ebq.2_Intron	NM_006532	NP_006523	P55199	ELL_HUMAN	elongation factor RNA polymerase II						positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding			lung(1)	1				GBM - Glioblastoma multiforme(1328;7.81e-07)		aacttggtctcaaaaaaaaaaa	0.000			T	MLL	AL								4	3	---	---	---	---	
ELL	8178	broad.mit.edu	37	19	18617460	18617460	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18617460delG	uc002njh.2	-						ELL_uc010ebq.2_Intron	NM_006532	NP_006523	P55199	ELL_HUMAN	elongation factor RNA polymerase II						positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding			lung(1)	1				GBM - Glioblastoma multiforme(1328;7.81e-07)		acttgagcccgggagccaagg	0.040			T	MLL	AL								4	2	---	---	---	---	
SF4	57794	broad.mit.edu	37	19	19397769	19397774	+	Intron	DEL	AACAAC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19397769_19397774delAACAAC	uc002nmh.2	-						SF4_uc002nmf.2_Intron|SF4_uc002nmg.2_Intron|SF4_uc002nmi.2_Intron|SF4_uc002nmj.2_Intron	NM_172231	NP_757386	Q8IWZ8	SUGP1_HUMAN	splicing factor 4						nuclear mRNA splicing, via spliceosome	nucleoplasm|spliceosomal complex	RNA binding				0						aaaaaaGCAAaacaacaacaacaaca	0.010													5	3	---	---	---	---	
PBX4	80714	broad.mit.edu	37	19	19705539	19705539	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19705539delT	uc002nmy.2	-						PBX4_uc010xqz.1_Intron|PBX4_uc010xra.1_Intron	NM_025245	NP_079521	Q9BYU1	PBX4_HUMAN	pre-B-cell leukemia homeobox 4								sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|ovary(1)	2						ATTAAAGTACttttttttttt	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	20848541	20848542	+	IGR	DEL	CC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20848541_20848542delCC								ZNF626 (4139 upstream) : ZNF85 (257538 downstream)																							CGGCGTCTCTCCCAGATTGTGC	0.554													4	2	---	---	---	---	
ZNF99	7652	broad.mit.edu	37	19	22940929	22940929	+	Frame_Shift_Del	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940929delT	uc010xrh.1	-	5	1509	c.1509delA	c.(1507-1509)AAAfs	p.K503fs		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ATTCTTCACATTTGTAGGGTT	0.373													51	47	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23466193	23466193	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23466193delA								ZNF99 (513409 upstream) : ZNF91 (55226 downstream)																							aactccatctaaaaaaaaaaa	0.224													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24150583	24150584	+	IGR	INS	-	G	G	rs143215541	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24150583_24150584insG								RPSAP58 (139666 upstream) : ZNF254 (65663 downstream)																							GGGTGGAAAGTGGAGGGCAGGA	0.485													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28719949	28719950	+	IGR	INS	-	A	A	rs146983116	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28719949_28719950insA								LOC148189 (435101 upstream) : LOC148145 (736090 downstream)																							gagagagaaaggagaaagagag	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30326571	30326572	+	IGR	INS	-	ATGGATGG	ATGGATGG	rs138916244	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30326571_30326572insATGGATGG								CCNE1 (11353 upstream) : C19orf2 (87979 downstream)																							atacctgctccatggatggatg	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30856140	30856141	+	IGR	DEL	CT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30856140_30856141delCT								C19orf2 (349529 upstream) : ZNF536 (7187 downstream)																							TAGGCATGTGctctctctctct	0.183													4	2	---	---	---	---	
ZNF536	9745	broad.mit.edu	37	19	31030032	31030033	+	Intron	INS	-	A	A	rs146597975	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31030032_31030033insA	uc002nsu.1	+						ZNF536_uc010edd.1_Intron	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					TGCACCCCCCCCACACACACAC	0.114													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31670636	31670638	+	IGR	DEL	GGT	-	-	rs139984397		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31670636_31670638delGGT								DKFZp566F0947 (29327 upstream) : TSHZ3 (95215 downstream)																							gatgatggtaggtggtggtggtg	0.015													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	33741151	33741152	+	IGR	INS	-	CACACCATG	CACACCATG			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33741151_33741152insCACACCATG								SLC7A10 (24395 upstream) : CEBPA (49690 downstream)																							tacataacacacaccacacaca	0.000													4	2	---	---	---	---	
PAK4	10298	broad.mit.edu	37	19	39614528	39614541	+	5'Flank	DEL	AAAGAAAGAAAGAA	-	-	rs112512175		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39614528_39614541delAAAGAAAGAAAGAA	uc002okj.1	+						PAK4_uc002okl.1_5'Flank|PAK4_uc002okn.1_5'Flank|PAK4_uc002okm.1_5'Flank|PAK4_uc002oko.1_5'Flank|PAK4_uc002okp.1_5'Flank	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	p21-activated kinase 4 isoform 1						cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			aaagaaagagaaagaaagaaagaaaaagaaagaa	0.000													3	3	---	---	---	---	
BLVRB	645	broad.mit.edu	37	19	40956750	40956753	+	Intron	DEL	TATC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40956750_40956753delTATC	uc002onw.2	-						BLVRB_uc010egw.1_Intron	NM_000713	NP_000704	P30043	BLVRB_HUMAN	biliverdin reductase B (flavin reductase						heme catabolic process	cytosol	biliverdin reductase activity|binding|flavin reductase activity				0			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		NADH(DB00157)|Riboflavin(DB00140)	ctggcctatgtatctatctatcta	0.000													4	2	---	---	---	---	
AXL	558	broad.mit.edu	37	19	41729614	41729614	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41729614delG	uc010ehj.2	+						CYP2F1_uc010xvw.1_Intron|AXL_uc010ehi.1_Intron|AXL_uc010ehk.2_Intron	NM_021913	NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase isoform 1							integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13						GAGTGACTCAGGCCCATGGCT	0.612													4	2	---	---	---	---	
RABAC1	10567	broad.mit.edu	37	19	42464698	42464698	+	5'Flank	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42464698delT	uc002osf.2	-							NM_006423	NP_006414	Q9UI14	PRAF1_HUMAN	Rab acceptor 1							cell junction|Golgi apparatus|integral to membrane|synaptic vesicle	identical protein binding				0						CCAGGTGACCTTTtttttttt	0.254													4	2	---	---	---	---	
ZFP112	7771	broad.mit.edu	37	19	44888849	44888850	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44888849_44888850insA	uc010xwz.1	-							NM_013380	NP_037512	Q9UJU3	ZF112_HUMAN	zinc finger protein 228 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)	5						GTTTTTGAAGGAAAAAAAAAAC	0.193													4	2	---	---	---	---	
ERCC1	2067	broad.mit.edu	37	19	45934936	45934936	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45934936delA	uc002pbu.1	-									P07992	ERCC1_HUMAN	SubName: Full=cDNA FLJ34720 fis, clone MESAN2005724, highly similar to DNA EXCISION REPAIR PROTEIN ERCC-1;						mitotic recombination|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|response to oxidative stress|transcription-coupled nucleotide-excision repair	cytoplasm|nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair complex	damaged DNA binding|endonuclease activity|protein C-terminus binding|protein domain specific binding|single-stranded DNA binding			ovary(2)	2		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		actccatctcaaaaaaaaaaa	0.000								NER					4	2	---	---	---	---	
OPA3	80207	broad.mit.edu	37	19	46052745	46052746	+	3'UTR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46052745_46052746insT	uc002pck.3	-	2					OPA3_uc002pcj.3_Intron|OPA3_uc010xxk.1_3'UTR	NM_025136	NP_079412	Q9H6K4	OPA3_HUMAN	OPA3 protein isoform b						response to stimulus|visual perception	mitochondrion					0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00778)|GBM - Glioblastoma multiforme(486;0.0976)|Epithelial(262;0.242)		TCCCACCTCTGttttttttttt	0.292													5	3	---	---	---	---	
NOVA2	4858	broad.mit.edu	37	19	46450728	46450729	+	Intron	INS	-	T	T	rs5828256		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46450728_46450729insT	uc002pdv.2	-							NM_002516	NP_002507	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2							nucleus	RNA binding				0		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		AAGCACCCTAGttttttttttt	0.218													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	46921741	46921742	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46921741_46921742insT								CCDC8 (4822 upstream) : PNMAL1 (48007 downstream)																							ttctgtttttgttttttttttt	0.035													6	3	---	---	---	---	
TRPM4	54795	broad.mit.edu	37	19	49700760	49700761	+	Intron	INS	-	TATG	TATG	rs55936806		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49700760_49700761insTATG	uc002pmw.2	+						TRPM4_uc010emu.2_Intron|TRPM4_uc010yak.1_Intron|TRPM4_uc002pmx.2_Intron|TRPM4_uc010emv.2_Intron|TRPM4_uc010yal.1_Intron|TRPM4_uc002pmy.2_Intron	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,						dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		ttccttccttccttccttcctt	0.248													2	4	---	---	---	---	
CPT1C	126129	broad.mit.edu	37	19	50215900	50215900	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50215900delA	uc002ppj.2	+						CPT1C_uc002ppi.2_Intron|CPT1C_uc002ppk.2_Intron|CPT1C_uc010eng.2_Intron|CPT1C_uc010enh.2_Intron|CPT1C_uc010eni.1_Intron	NM_152359	NP_689572	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C isoform 2						fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		ATTTACGGGTAAAAAAAAAGC	0.587													4	2	---	---	---	---	
MYBPC2	4606	broad.mit.edu	37	19	50951805	50951806	+	Intron	INS	-	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50951805_50951806insC	uc002psf.2	+							NM_004533	NP_004524	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type						cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		agctcactgcaacctccgcctc	0.000													4	2	---	---	---	---	
ZNF331	55422	broad.mit.edu	37	19	54025511	54025511	+	Intron	DEL	T	-	-	rs35369285		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54025511delT	uc002qbx.1	+						ZNF331_uc002qbw.1_Intron|ZNF331_uc002qby.1_Intron|ZNF331_uc002qbz.1_Intron	NM_018555	NP_061025	Q9NQX6	ZN331_HUMAN	zinc finger protein 331						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)	6				GBM - Glioblastoma multiforme(134;0.00555)		tctttctttgttttttttttt	0.189			T	?	follicular thyroid adenoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	57169623	57169623	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57169623delA								ZNF71 (34081 upstream) : ZNF835 (5332 downstream)																							accttgtctcaaaaaaaaaaa	0.209													4	2	---	---	---	---	
ZNF587	84914	broad.mit.edu	37	19	58347040	58347040	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58347040delT	uc002qqb.2	+						uc002qqh.1_Intron|ZNF587_uc010yhh.1_Intron|ZNF587_uc002qqi.1_Intron|uc010yhj.1_Intron|ZNF587_uc002qqj.1_Intron	NM_032828	NP_116217	Q96SQ5	ZN587_HUMAN	zinc finger protein 587						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		accctaggggttttggcctta	0.000													4	2	---	---	---	---	
C20orf194	25943	broad.mit.edu	37	20	3237583	3237583	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3237583delT	uc002wii.2	-						C20orf194_uc002wij.3_Intron|C20orf194_uc002wik.2_Intron	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943												0						gaggctggggtgggcagtgac	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	4622959	4622959	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4622959delA								ADRA1D (393300 upstream) : PRNP (43838 downstream)																							ttacaaattgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	7250347	7250347	+	IGR	DEL	C	-	-	rs67826784		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7250347delC								BMP2 (489437 upstream) : HAO1 (613284 downstream)																							CTGGGTCCAGCCCAAACGCCC	0.552													2	4	---	---	---	---	
PLCB4	5332	broad.mit.edu	37	20	9269345	9269345	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9269345delC	uc002wnf.2	+						PLCB4_uc010gbw.1_Intron|PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						GGAGGGATGGCCACATGTGGA	0.448													4	2	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15519119	15519119	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15519119delA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				aagtcagaacaaaaggtggag	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	18767289	18767289	+	IGR	DEL	C	-	-	rs149612216	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18767289delC								DTD1 (22731 upstream) : HSPC072 (1326 downstream)																							gggttacaggccccatgcaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	20909041	20909041	+	IGR	DEL	T	-	-	rs11347495		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20909041delT								RALGAPA2 (215775 upstream) : PLK1S1 (197583 downstream)																							aaagctcttgtttactaccta	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	22978239	22978240	+	IGR	INS	-	T	T	rs145931128	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22978239_22978240insT								FOXA2 (412138 upstream) : SSTR4 (37817 downstream)																							gGTTTAGATTATTTTTTATTAT	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23151157	23151158	+	IGR	INS	-	A	A	rs138819608	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23151157_23151158insA								CD93 (84180 upstream) : NXT1 (180215 downstream)																							ACAGCAAAGGCGACCTGGCTCT	0.530													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	24416222	24416229	+	IGR	DEL	TGTGTGTG	-	-	rs66472844		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24416222_24416229delTGTGTGTG								GGTLC1 (446806 upstream) : TMEM90B (33606 downstream)																							TATGCAtgtatgtgtgtgtgtgtgtgtg	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	24431366	24431366	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24431366delA								GGTLC1 (461950 upstream) : TMEM90B (18469 downstream)																							TCAGCTGCTGAAAAATGTCCC	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25628987	25628988	+	Intron	DEL	TT	-	-	rs112546855		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25628987_25628988delTT	uc002wuz.2	+											Homo sapiens zinc finger protein 337, mRNA (cDNA clone IMAGE:4826085).																		ATGTGTCTCCtttttttttttt	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26251028	26251029	+	IGR	INS	-	A	A	rs151085511	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26251028_26251029insA								MIR663 (62114 upstream) : None (None downstream)																							acctgggaagcagagtttgcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26264313	26264313	+	IGR	DEL	T	-	-	rs62199939		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26264313delT								MIR663 (75399 upstream) : None (None downstream)																							aacttctttgtgatgtttgca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29435526	29435541	+	IGR	DEL	TCTTGTAGCGCCATTG	-	-	rs141857281		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29435526_29435541delTCTTGTAGCGCCATTG								None (None upstream) : FRG1B (176338 downstream)																							aacttttttttcttgtagcgccattgtctggctttg	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29490144	29490144	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29490144delT								None (None upstream) : FRG1B (121735 downstream)																							tcttgttttgtttttttgaga	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29492833	29492833	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29492833delA								None (None upstream) : FRG1B (119046 downstream)																							GACTCTGCCTAAAAAAaaaaa	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29589676	29589677	+	IGR	DEL	TT	-	-	rs73620373		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29589676_29589677delTT								None (None upstream) : FRG1B (22202 downstream)																							ctgtttcctctttttttttatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29604550	29604553	+	IGR	DEL	AAAC	-	-	rs77273072		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29604550_29604553delAAAC								None (None upstream) : FRG1B (7326 downstream)																							caaatgagttaaacaaaaatctta	0.010													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29914113	29914114	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29914113_29914114insT								DEFB116 (17725 upstream) : DEFB118 (42314 downstream)																							aggcaggagaatggcgtgaacc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31342066	31342067	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31342066_31342067insT								COMMD7 (10252 upstream) : DNMT3B (8124 downstream)																							tttcttttttcttttttttttt	0.025													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31818936	31818936	+	IGR	DEL	A	-	-	rs140775761		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31818936delA								C20orf71 (3379 upstream) : PLUNC (4866 downstream)																							gagacagagcaagactaagaa	0.000													7	11	---	---	---	---	
ITCH	83737	broad.mit.edu	37	20	32965677	32965677	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32965677delA	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6						accctgtctcaaaaaaaaaaa	0.134													3	5	---	---	---	---	
PIGU	128869	broad.mit.edu	37	20	33155607	33155608	+	Intron	DEL	CT	-	-	rs137859705		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33155607_33155608delCT	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron	NM_080476	NP_536724	Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0						CTCCTTCCTCctctctctctct	0.381													9	5	---	---	---	---	
BPI	671	broad.mit.edu	37	20	36933970	36933970	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36933970delT	uc002xib.2	+							NM_001725	NP_001716	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein						defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)				CCACTGCACATTTTTTTTTCC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54026329	54026330	+	IGR	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54026329_54026330insA								DOK5 (758620 upstream) : CBLN4 (546167 downstream)																							aacacactgctaaaaaaaaaat	0.025													4	2	---	---	---	---	
RBM38	55544	broad.mit.edu	37	20	55973306	55973307	+	Intron	DEL	GT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55973306_55973307delGT	uc010zzj.1	+						RBM38_uc010zzk.1_Intron	NM_017495	NP_059965	Q9H0Z9	RBM38_HUMAN	RNA-binding region containing protein 1 isoform						3'-UTR-mediated mRNA stabilization|cell cycle|cell cycle arrest|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mRNA processing|negative regulation of cell proliferation|regulation of RNA splicing|RNA splicing	cytosol|cytosol|nucleus|nucleus	mRNA 3'-UTR binding|mRNA binding|nucleotide binding|RNA binding				0	Lung NSC(12;0.00242)|all_lung(29;0.00767)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.55e-12)|Epithelial(14;9.49e-09)|all cancers(14;5.01e-08)			AGGTGATGGCgtgtgtgtgtgt	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57968351	57968352	+	IGR	INS	-	TCCA	TCCA	rs141405403	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57968351_57968352insTCCA								EDN3 (67305 upstream) : PHACTR3 (184212 downstream)																							tcatcctttcttccatccatcc	0.064													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58143142	58143143	+	IGR	INS	-	GTGTGA	GTGTGA			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58143142_58143143insGTGTGA								EDN3 (242096 upstream) : PHACTR3 (9421 downstream)																							CTGTACATTGCGTGTGAGTGTG	0.332													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58889721	58889722	+	Intron	INS	-	CCTC	CCTC			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58889721_58889722insCCTC	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																		ctcccatccatccatcctccca	0.000													4	2	---	---	---	---	
UCKL1	54963	broad.mit.edu	37	20	62579986	62579986	+	Intron	DEL	A	-	-	rs73916673		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62579986delA	uc010gkn.2	-						UCKL1_uc011abm.1_Intron|UCKL1_uc011abn.1_Intron|UCKL1_uc011abo.1_Intron	NM_017859	NP_060329	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1						interspecies interaction between organisms	endoplasmic reticulum|nucleus	ATP binding|phosphotransferase activity, alcohol group as acceptor|protein binding|uridine kinase activity				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					tgtgagagggaaggggcgtgt	0.075													11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9442827	9442831	+	IGR	DEL	ATGAA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9442827_9442831delATGAA								None (None upstream) : None (None downstream)																							aaatggaatgatgaaatgaaatgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9581764	9581764	+	IGR	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9581764delC								None (None upstream) : None (None downstream)																							aagagtcaagcccacttactt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9588130	9588130	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9588130delA								None (None upstream) : None (None downstream)																							tttaaaaaTTAAAAAAAAAAA	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9674424	9674424	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9674424delA								None (None upstream) : None (None downstream)																							gtctgtgaacaaaattttgta	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9828810	9828810	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9828810delG								None (None upstream) : None (None downstream)																							AGGGTTGAAAGGATGCTGCCG	0.264													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10748589	10748590	+	IGR	INS	-	CA	CA			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10748589_10748590insCA								None (None upstream) : TPTE (158153 downstream)																							ggaaatatcttcacataaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10809982	10809986	+	IGR	DEL	GTGGA	-	-	rs111895153		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10809982_10809986delGTGGA								None (None upstream) : TPTE (96757 downstream)																							gtgaagtggtgtggagtggagtgga	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10826832	10826833	+	IGR	INS	-	AATGG	AATGG	rs78495047		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10826832_10826833insAATGG								None (None upstream) : TPTE (79910 downstream)																							gaatggaaagaaatggaatgga	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10846993	10846994	+	IGR	INS	-	GAATG	GAATG	rs139660702		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10846993_10846994insGAATG								None (None upstream) : TPTE (59749 downstream)																							tgaatggaatagaatggaatgg	0.000													4	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11045983	11045983	+	Intron	DEL	A	-	-	rs111961463		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11045983delA	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTCAAGTATCAAAACATTTAT	0.244													3	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11053060	11053061	+	Intron	DEL	AA	-	-	rs77480017		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11053060_11053061delAA	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCTCATTATTAAGAGAGTACTA	0.277													4	5	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11093095	11093095	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11093095delA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GTTACCATGCAAAAAAATATA	0.328													9	11	---	---	---	---	
CHODL	140578	broad.mit.edu	37	21	19302302	19302302	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19302302delT	uc002ykt.2	+						CHODL_uc002ykr.2_Intron|CHODL_uc002yks.2_Intron|CHODL_uc002yku.2_Intron			Q9H9P2	CHODL_HUMAN	RecName: Full=Chondrolectin; AltName: Full=Transmembrane protein MT75; Flags: Precursor;						muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		tacagccaccttgcttctgcc	0.000													4	2	---	---	---	---	
CHODL	140578	broad.mit.edu	37	21	19633166	19633167	+	Intron	INS	-	C	C	rs8126777		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19633166_19633167insC	uc002ykv.2	+						CHODL_uc002ykr.2_Intron|CHODL_uc002yks.2_Intron|CHODL_uc002ykt.2_Intron|CHODL_uc002yku.2_Intron	NM_024944	NP_079220	Q9H9P2	CHODL_HUMAN	chondrolectin precursor						muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		aacaacaacaaaaaaacaccac	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	26074357	26074358	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26074357_26074358insT								None (None upstream) : NCRNA00158 (683776 downstream)																							TTCAGATGTCATTTTTCCTTTC	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	32424056	32424057	+	IGR	INS	-	CAA	CAA	rs148933946	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32424056_32424057insCAA								KRTAP19-8 (13261 upstream) : TIAM1 (66679 downstream)																							CTGGAACGGCGCAACAGTGAGA	0.396													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	33183005	33183005	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33183005delT								SFRS15 (78574 upstream) : HUNK (62623 downstream)																							TTACGGGGCCTTTATAAATTC	0.393													4	2	---	---	---	---	
HUNK	30811	broad.mit.edu	37	21	33288991	33288992	+	Intron	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33288991_33288992insT	uc002yph.2	+							NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase						multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						ctctctctttcttttttttttt	0.233													3	4	---	---	---	---	
C21orf63	59271	broad.mit.edu	37	21	33865276	33865277	+	Intron	DEL	TG	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33865276_33865277delTG	uc002ypr.1	+						C21orf63_uc002yps.1_Intron|C21orf63_uc010glw.1_Intron|C21orf63_uc002ypt.1_Intron|C21orf63_uc002ypu.1_Intron|C21orf63_uc011adq.1_5'Flank	NM_058187	NP_478067	P58658	CU063_HUMAN	hypothetical protein LOC59271 precursor							integral to membrane	sugar binding			ovary(2)|pancreas(1)	3						acaaaatTGATGTGTGTGTGTG	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	33928184	33928184	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33928184delT								C21orf63 (40487 upstream) : TCP10L (18968 downstream)																							TTCATCTGACttttttttttt	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	37404098	37404099	+	IGR	DEL	CA	-	-	rs148463620	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37404098_37404099delCA								RUNX1 (47051 upstream) : SETD4 (2741 downstream)																							GGGACACTGGCATGTGTTGTGT	0.599													4	2	---	---	---	---	
SETD4	54093	broad.mit.edu	37	21	37443156	37443157	+	Intron	INS	-	G	G	rs149577480		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37443156_37443157insG	uc002yva.2	-						uc011aea.1_Intron|CBR1_uc010gmx.1_Intron|CBR1_uc002yvb.1_Intron|CBR1_uc010gmy.1_Intron			Q9NVD3	SETD4_HUMAN	SubName: Full=Putative uncharacterized protein SETD4;											large_intestine(1)|ovary(1)	2						actaagtttttttttttttttt	0.124													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	37989831	37989832	+	IGR	INS	-	AAG	AAG	rs144416082	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37989831_37989832insAAG								CLDN14 (40964 upstream) : SIM2 (82159 downstream)																							caccatcatcaaagaccaaagg	0.000													4	2	---	---	---	---	
TTC3	7267	broad.mit.edu	37	21	38561385	38561386	+	Intron	INS	-	T	T	rs149562416	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38561385_38561386insT	uc002yvz.2	+						TTC3_uc002ywa.2_Intron|TTC3_uc002ywb.2_Intron|TTC3_uc010gnf.2_Intron|TTC3_uc002ywc.2_Intron	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				ATGCAGTAAAATTTGGAATGAA	0.337													3	4	---	---	---	---	
ERG	2078	broad.mit.edu	37	21	40009741	40009742	+	Intron	DEL	GT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40009741_40009742delGT	uc010gnw.2	-						ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron|ERG_uc002yxc.3_Intron|ERG_uc010gnz.2_Intron	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				CTTTTTCtgcgtgtgtgtgtgt	0.307													4	2	---	---	---	---	
PRDM15	63977	broad.mit.edu	37	21	43301793	43301793	+	5'Flank	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43301793delA	uc002yzq.1	-						PRDM15_uc002yzo.2_5'Flank|PRDM15_uc002yzp.2_5'Flank|PRDM15_uc002yzr.1_5'Flank	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						tgatatctgcaaacgtgacag	0.040													4	2	---	---	---	---	
SIK1	150094	broad.mit.edu	37	21	44836509	44836510	+	3'UTR	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44836509_44836510insA	uc002zdf.2	-	14						NM_173354	NP_775490	P57059	SIK1_HUMAN	salt-inducible kinase 1						anoikis|cell cycle|cell differentiation|intracellular protein kinase cascade|multicellular organismal development|regulation of cell differentiation|regulation of mitotic cell cycle	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(2)|testis(2)|ovary(1)|central_nervous_system(1)|skin(1)	7						AAACACCTAACGTATTGCTTAT	0.391													8	7	---	---	---	---	
PDXK	8566	broad.mit.edu	37	21	45154175	45154176	+	Intron	DEL	AG	-	-	rs3216365	byFrequency	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45154175_45154176delAG	uc002zdm.3	+						PDXK_uc010gpj.2_Intron|PDXK_uc002zdn.3_Intron|PDXK_uc002zdo.2_Intron|PDXK_uc002zdp.2_Intron	NM_003681	NP_003672	O00764	PDXK_HUMAN	pyridoxal kinase						cell proliferation|pyridoxal 5'-phosphate salvage	cytosol	ATP binding|lithium ion binding|magnesium ion binding|potassium ion binding|protein homodimerization activity|pyridoxal kinase activity|pyridoxal phosphate binding|sodium ion binding|zinc ion binding				0				Colorectal(79;0.109)|READ - Rectum adenocarcinoma(84;0.161)|STAD - Stomach adenocarcinoma(101;0.18)	Pyridoxal(DB00147)|Pyridoxine(DB00165)	ACAGCATATCAGGGTGTAGGCC	0.347													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	47431628	47431635	+	IGR	DEL	GTGTGTGC	-	-	rs111559956		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47431628_47431635delGTGTGTGC								COL6A1 (6665 upstream) : COL6A2 (86398 downstream)																							gtgtgtgcatgtgtgtgcgtgtgcacgt	0.284													4	2	---	---	---	---	
PCNT	5116	broad.mit.edu	37	21	47754119	47754119	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47754119delA	uc002zji.3	+						PCNT_uc002zjj.2_Intron|PCNT_uc010gqk.1_5'Flank	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin						cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					actccgtctcaaaaaaaaaaa	0.184													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16856390	16856390	+	IGR	DEL	A	-	-	rs144198221	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16856390delA								OR11H1 (406586 upstream) : CCT8L2 (215258 downstream)																							ggaatggaatagaatggaatc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17375815	17375816	+	IGR	INS	-	A	A	rs145883088		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17375815_17375816insA								HSFYL1 (65590 upstream) : GAB4 (67013 downstream)																							acgcagaagctaaaaaaaaagt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17388694	17388696	+	IGR	DEL	TTA	-	-	rs140889738		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17388694_17388696delTTA								HSFYL1 (78469 upstream) : GAB4 (54133 downstream)																							CCCATTCTTTTTATTATTAttat	0.232													3	3	---	---	---	---	
C22orf25	128989	broad.mit.edu	37	22	20040821	20040822	+	Intron	INS	-	G	G	rs140158388	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20040821_20040822insG	uc010grw.1	+						C22orf25_uc002zrb.1_Intron|C22orf25_uc002zrc.1_Intron|C22orf25_uc002zrd.1_Intron|C22orf25_uc002zre.2_Intron|C22orf25_uc010grx.2_Intron|C22orf25_uc011ahe.1_Intron|C22orf25_uc011ahf.1_Intron|C22orf25_uc011ahg.1_Intron|C22orf25_uc002zrg.2_Intron|C22orf25_uc011ahh.1_Intron|C22orf25_uc002zrf.2_Intron|C22orf25_uc011ahi.1_Intron|C22orf25_uc010gry.1_Intron|C22orf25_uc002zrh.1_Intron	NM_152906	NP_690870	Q6ICL3	CV025_HUMAN	hypothetical protein LOC128989												0	Colorectal(54;0.0533)					GGCTGACTCTTGCGGCAGTCAT	0.535													4	2	---	---	---	---	
AP1B1	162	broad.mit.edu	37	22	29754404	29754404	+	Intron	DEL	C	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29754404delC	uc003afj.2	-						AP1B1_uc003afi.2_Intron|AP1B1_uc003afk.2_Intron|AP1B1_uc003afl.2_Intron	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						ACCAGGCCATCCCAGGCACGT	0.289													4	2	---	---	---	---	
LARGE	9215	broad.mit.edu	37	22	33680569	33680570	+	Intron	INS	-	T	T	rs112371598		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33680569_33680570insT	uc003and.3	-						LARGE_uc011amd.1_Intron|LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				TGGCATGAGGCttttttttttt	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34921766	34921768	+	IGR	DEL	ATG	-	-	rs75100654		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34921766_34921768delATG								LARGE (603182 upstream) : ISX (540361 downstream)																							TCTCTCTGTCATGATTCTTCTTT	0.433													3	4	---	---	---	---	
TOM1	10043	broad.mit.edu	37	22	35727266	35727266	+	Intron	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35727266delT	uc003ann.2	+						TOM1_uc011ami.1_Intron|TOM1_uc011amj.1_Intron|TOM1_uc003ans.2_Intron|TOM1_uc011amk.1_Intron|TOM1_uc003anp.2_Intron|TOM1_uc011aml.1_Intron|TOM1_uc003ano.2_Intron|TOM1_uc003anq.2_Intron|TOM1_uc003anr.2_Intron	NM_005488	NP_005479	O60784	TOM1_HUMAN	target of myb1 isoform 1						endocytosis|endosome transport|intracellular protein transport	cytosol|early endosome|membrane	protein binding			ovary(1)	1						ttttcttttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	38404552	38404552	+	IGR	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38404552delA								POLR2F (20211 upstream) : PICK1 (48710 downstream)																							actctgtctcaaaaaaaaaaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	38585016	38585025	+	IGR	DEL	ATAGGGATAA	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38585016_38585025delATAGGGATAA								PLA2G6 (7180 upstream) : MAFF (12914 downstream)																							agaggaatggatagggataatgagggatgg	0.133													4	3	---	---	---	---	
MAFF	23764	broad.mit.edu	37	22	38607534	38607535	+	Intron	INS	-	G	G	rs143706930	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38607534_38607535insG	uc011anp.1	+						MAFF_uc003avc.2_Intron|MAFF_uc011anq.1_Intron|MAFF_uc011anr.1_Intron|MAFF_uc003avd.2_5'Flank	NM_001161572	NP_001155044	Q9ULX9	MAFF_HUMAN	transcription factor MAFF isoform a						blood coagulation|parturition|transcription from RNA polymerase II promoter	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Melanoma(58;0.045)					gcccggccactggggatcactt	0.000													4	2	---	---	---	---	
KDELR3	11015	broad.mit.edu	37	22	38871486	38871486	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38871486delA	uc003avv.2	+						KDELR3_uc003avu.2_Intron	NM_006855	NP_006846	O43731	ERD23_HUMAN	KDEL receptor 3 isoform a						protein retention in ER lumen|protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|integral to membrane	ER retention sequence binding|receptor activity			ovary(2)	2	Melanoma(58;0.0286)					ccgtctcaagaaaaaaaaaaT	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39484675	39484676	+	IGR	INS	-	CA	CA	rs147117871	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39484675_39484676insCA								APOBEC3G (928 upstream) : APOBEC3H (8614 downstream)																							caacacacgtgcacacacacac	0.198													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39707320	39707321	+	IGR	INS	-	T	T			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39707320_39707321insT								PDGFB (66363 upstream) : RPL3 (1567 downstream)																							ACCTGGATGACttttttttttt	0.292													4	2	---	---	---	---	
SREBF2	6721	broad.mit.edu	37	22	42238995	42238995	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42238995delA	uc003bbi.2	+						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron	NM_004599	NP_004590	Q12772	SRBP2_HUMAN	sterol regulatory element-binding transcription						cholesterol metabolic process	ER to Golgi transport vesicle membrane|Golgi membrane|nucleus|SREBP-SCAP-Insig complex	protein C-terminus binding			breast(2)|ovary(1)|central_nervous_system(1)	4						cgtccgtctcaaaaaaaaaaa	0.025													4	2	---	---	---	---	
SCUBE1	80274	broad.mit.edu	37	22	43735870	43735871	+	Intron	INS	-	CT	CT	rs150926848	by1000genomes	TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43735870_43735871insCT	uc003bdt.1	-						SCUBE1_uc003bdu.1_Intron	NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				TACTCTCCTCACTATCCCCCCA	0.569													6	4	---	---	---	---	
MAPK12	6300	broad.mit.edu	37	22	50701756	50701756	+	5'Flank	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50701756delT	uc003bkm.1	-						MAPK12_uc003bkn.2_5'Flank|MAPK12_uc003bko.2_5'Flank|MAPK12_uc003bkl.1_5'Flank|MAPK12_uc003bkq.2_5'Flank|MAPK12_uc010haw.2_5'Flank	NM_002969	NP_002960	P53778	MK12_HUMAN	mitogen-activated protein kinase 12						cell cycle arrest|DNA damage induced protein phosphorylation|muscle organ development|myoblast differentiation|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|Ras protein signal transduction	mitochondrion|nucleoplasm	ATP binding|magnesium ion binding|MAP kinase activity|protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGGCAGACCCTTGCTCCTTGA	0.592													4	2	---	---	---	---	
SAPS2	9701	broad.mit.edu	37	22	50836004	50836005	+	Intron	INS	-	CC	CC	rs67483305		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50836004_50836005insCC	uc003blb.1	+						SAPS2_uc003bky.1_Intron|SAPS2_uc003bkz.1_Intron|SAPS2_uc003blc.2_Intron|SAPS2_uc003bla.1_Intron	NM_014678	NP_055493	O75170	PP6R2_HUMAN	SAPS domain family, member 2							cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)		AGCCCTGTCATCTCTGAGTTTT	0.441													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	414038	414038	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:414038delT								PPP2R3B (66411 upstream) : SHOX (171041 downstream)																							ACttttctggttttttttttt	0.229													3	4	---	---	---	---	
P2RY8	286530	broad.mit.edu	37	X	1633641	1633642	+	Intron	INS	-	C	C			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1633641_1633642insC	uc004cpz.2	-							NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ttccttcccttccttcccttcc	0.000			T	CRLF2	B-ALL|Downs associated ALL								4	2	---	---	---	---	
NHS	4810	broad.mit.edu	37	X	17676681	17676681	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17676681delG	uc004cxx.2	+						NHS_uc011mix.1_Intron|NHS_uc004cxy.2_Intron|NHS_uc004cxz.2_Intron	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1							nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					CAGCACCTTTGAGATATCCAT	0.398													4	2	---	---	---	---	
OTC	5009	broad.mit.edu	37	X	38254795	38254795	+	Intron	DEL	A	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38254795delA	uc004def.3	+							NM_000531	NP_000522	P00480	OTC_HUMAN	ornithine carbamoyltransferase precursor						arginine biosynthetic process|urea cycle	mitochondrial matrix|ornithine carbamoyltransferase complex	ornithine carbamoyltransferase activity			ovary(1)|breast(1)	2					L-Citrulline(DB00155)|L-Ornithine(DB00129)	ATTTACACATAAAACGCTTCT	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61767024	61767024	+	IGR	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61767024delG								None (None upstream) : SPIN4 (800084 downstream)																							catttggaaagctttgaggcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61826233	61826233	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61826233delT								None (None upstream) : SPIN4 (740875 downstream)																							cagaaactactttgtgatatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61863884	61863884	+	IGR	DEL	T	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61863884delT								None (None upstream) : SPIN4 (703224 downstream)																							tgaaactctctttttgtagaa	0.000													3	4	---	---	---	---	
PCDH11X	27328	broad.mit.edu	37	X	91715976	91715976	+	Intron	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91715976delG	uc004efk.1	+						PCDH11X_uc004efl.1_Intron|PCDH11X_uc004efo.1_Intron|PCDH11X_uc010nmv.1_Intron|PCDH11X_uc004efm.1_Intron|PCDH11X_uc004efn.1_Intron	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						GGTACCCTTTGGGGAGCAGGA	0.338													4	13	---	---	---	---	
TSPAN6	7105	broad.mit.edu	37	X	99887402	99887403	+	Intron	INS	-	A	A			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99887402_99887403insA	uc004ega.1	-						TSPAN6_uc010nna.1_Intron	NM_003270	NP_003261	O43657	TSN6_HUMAN	transmembrane 4 superfamily member 6						positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	signal transducer activity			ovary(1)	1						gactccatctcaaaaaaaaaaa	0.158													5	3	---	---	---	---	
FAM127C	441518	broad.mit.edu	37	X	134156672	134156672	+	5'Flank	DEL	G	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134156672delG	uc004eyc.1	-							NM_001078173	NP_001071641	Q17RB0	F127C_HUMAN	family with sequence similarity 127, member C												0	Acute lymphoblastic leukemia(192;0.000127)					TAGTGCGCCAGGGGGTCCCGG	0.667													4	2	---	---	---	---	
TSPY1	7258	broad.mit.edu	37	Y	9340733	9340736	+	Intron	DEL	ACAC	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9340733_9340736delACAC	uc010nwp.1	+									Q01534	TSPY1_HUMAN	RecName: Full=Testis-specific Y-encoded protein 1; AltName: Full=Cancer/testis antigen 78;          Short=CT78;						cell differentiation|cell proliferation|gonadal mesoderm development|nucleosome assembly|spermatogenesis	cytoplasm|nucleus	identical protein binding				0						aaagaaacaaacacacacacacac	0.088													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9952201	9952204	+	IGR	DEL	AATT	-	-			TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9952201_9952204delAATT								TTTY22 (301347 upstream) : None (None downstream)																							acctagaggaaattaattcttaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58970661	58970662	+	IGR	INS	-	T	T	rs141723260		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58970661_58970662insT								None (None upstream) : None (None downstream)																							ttccccattgctttgtcaggtt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59032177	59032177	+	IGR	DEL	A	-	-	rs146386891		TCGA-18-3410-01	TCGA-18-3410-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59032177delA								None (None upstream) : None (None downstream)																							caagagtttgagggtgtagtg	0.040													4	2	---	---	---	---	
