Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TAS1R1	80835	broad.mit.edu	37	1	6634893	6634893	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6634893G>T	uc001ant.2	+	3	701	c.701G>T	c.(700-702)GGT>GTT	p.G234V	TAS1R1_uc001anu.2_Intron|TAS1R1_uc001anv.2_Intron|TAS1R1_uc001anw.2_Missense_Mutation_p.G234V	NM_138697	NP_619642	Q7RTX1	TS1R1_HUMAN	sweet taste receptor T1r isoform b	234	Extracellular (Potential).				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		CAGGCCACTGGTCAGGGGATC	0.617													7	59	---	---	---	---	PASS
HNRNPR	10236	broad.mit.edu	37	1	23637423	23637423	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23637423C>A	uc001bgr.3	-	11	1585	c.1426G>T	c.(1426-1428)GGT>TGT	p.G476C	HNRNPR_uc001bgo.2_Missense_Mutation_p.G86C|HNRNPR_uc001bgp.3_Missense_Mutation_p.G479C|HNRNPR_uc009vqk.2_Missense_Mutation_p.G378C|HNRNPR_uc001bgs.3_Missense_Mutation_p.G375C|HNRNPR_uc010odw.1_Missense_Mutation_p.G438C|HNRNPR_uc010odx.1_Missense_Mutation_p.G316C|HNRNPR_uc009vql.2_Missense_Mutation_p.G337C	NM_005826	NP_005817	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R	476	2.|3 X 11 AA approximate repeats of D-D-Y-Y- G-Y-D-Y-H-D-Y.|RNA-binding RGG-box.					catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		TAATCATAACCATAGTAATCA	0.403													6	120	---	---	---	---	PASS
CATSPER4	378807	broad.mit.edu	37	1	26524831	26524831	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26524831C>A	uc010oez.1	+	6	733	c.733C>A	c.(733-735)CAG>AAG	p.Q245K	CATSPER4_uc010oey.1_Missense_Mutation_p.Q67K|CATSPER4_uc009vsf.2_RNA	NM_198137	NP_937770	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	245	Extracellular (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		CAAGCATTTCCAGAACATACA	0.532													7	202	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27057765	27057765	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27057765C>A	uc001bmv.1	+	3	1846	c.1473C>A	c.(1471-1473)TCC>TCA	p.S491S	ARID1A_uc001bmt.1_Silent_p.S491S|ARID1A_uc001bmu.1_Silent_p.S491S|ARID1A_uc001bmw.1_Silent_p.S108S	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	491					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AACCACCGTCCCAGACCCCTC	0.602			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								8	243	---	---	---	---	PASS
SESN2	83667	broad.mit.edu	37	1	28600545	28600545	+	Intron	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28600545C>T	uc001bps.2	+							NM_031459	NP_113647	P58004	SESN2_HUMAN	sestrin 2						cell cycle arrest	cytoplasm|nucleus				skin(3)|ovary(2)|pancreas(1)|lung(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		TCTTTCTGGTCCTCAGCTGAC	0.557													31	55	---	---	---	---	PASS
PUM1	9698	broad.mit.edu	37	1	31465245	31465245	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31465245G>C	uc001bsi.1	-	7	1263	c.1150C>G	c.(1150-1152)CAA>GAA	p.Q384E	PUM1_uc001bsf.1_Missense_Mutation_p.Q45E|PUM1_uc001bsg.1_Missense_Mutation_p.Q196E|PUM1_uc001bsh.1_Missense_Mutation_p.Q384E|PUM1_uc001bsj.1_Missense_Mutation_p.Q384E|PUM1_uc010oga.1_Missense_Mutation_p.Q288E|PUM1_uc001bsk.1_Missense_Mutation_p.Q420E|PUM1_uc010ogb.1_Missense_Mutation_p.Q324E	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	384					cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		ACCTGTTGTTGAGAATTGTAG	0.512													24	74	---	---	---	---	PASS
PUM1	9698	broad.mit.edu	37	1	31465307	31465307	+	Nonsense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31465307G>C	uc001bsi.1	-	7	1201	c.1088C>G	c.(1087-1089)TCA>TGA	p.S363*	PUM1_uc001bsf.1_Nonsense_Mutation_p.S24*|PUM1_uc001bsg.1_Nonsense_Mutation_p.S175*|PUM1_uc001bsh.1_Nonsense_Mutation_p.S363*|PUM1_uc001bsj.1_Nonsense_Mutation_p.S363*|PUM1_uc010oga.1_Nonsense_Mutation_p.S267*|PUM1_uc001bsk.1_Nonsense_Mutation_p.S399*|PUM1_uc010ogb.1_Nonsense_Mutation_p.S303*	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	363					cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		CTGCGTGCCTGAATAATCAAA	0.517													37	114	---	---	---	---	PASS
BAI2	576	broad.mit.edu	37	1	32221657	32221657	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32221657C>T	uc001btn.2	-	4	1135	c.781G>A	c.(781-783)GAG>AAG	p.E261K	BAI2_uc010ogp.1_Missense_Mutation_p.E249K|BAI2_uc010ogq.1_Missense_Mutation_p.E261K|BAI2_uc001bto.2_Missense_Mutation_p.E261K|BAI2_uc001btq.1_Missense_Mutation_p.E249K|BAI2_uc010ogr.1_Missense_Mutation_p.E249K	NM_001703	NP_001694	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	261	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(5)|breast(4)|ovary(2)|central_nervous_system(1)|skin(1)	13		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		AAATCGGCCTCAGCAGGTGGG	0.672													17	36	---	---	---	---	PASS
PHC2	1912	broad.mit.edu	37	1	33820487	33820487	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33820487G>C	uc001bxg.1	-	7	1398	c.1344C>G	c.(1342-1344)TTC>TTG	p.F448L	PHC2_uc001bxh.1_Missense_Mutation_p.F419L|PHC2_uc009vuh.1_Missense_Mutation_p.F448L	NM_198040	NP_932157	Q8IXK0	PHC2_HUMAN	polyhomeotic-like 2 isoform a	448					multicellular organismal development	PcG protein complex	DNA binding|identical protein binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AAGTGTGCTGGAACCTGCGTT	0.617													8	28	---	---	---	---	PASS
DLGAP3	58512	broad.mit.edu	37	1	35334288	35334288	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35334288C>G	uc001byc.2	-	7	2403	c.2403G>C	c.(2401-2403)ATG>ATC	p.M801I		NM_001080418	NP_001073887	O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated	801					cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)				CTGCCCGCAGCATCTTGATGA	0.657													9	25	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39917952	39917952	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39917952G>T	uc010oiu.1	+	51	16003	c.15872G>T	c.(15871-15873)AGC>ATC	p.S5291I	MACF1_uc010ois.1_Missense_Mutation_p.S4789I	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAGGAACTGAGCACTCGCTGG	0.512													57	149	---	---	---	---	PASS
SMAP2	64744	broad.mit.edu	37	1	40872518	40872518	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40872518C>A	uc001cfj.2	+	2	279	c.214C>A	c.(214-216)CAG>AAG	p.Q72K	SMAP2_uc010ojh.1_Missense_Mutation_p.Q72K|SMAP2_uc001cfk.2_Missense_Mutation_p.Q42K|SMAP2_uc010oji.1_5'UTR	NM_022733	NP_073570	Q8WU79	SMAP2_HUMAN	small ArfGAP2	72	Arf-GAP.				regulation of ARF GTPase activity	cytoplasm|nucleus	ARF GTPase activator activity|zinc ion binding				0	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)			TAACCTCGACCAGTGGACTCA	0.453													5	77	---	---	---	---	PASS
SMAP2	64744	broad.mit.edu	37	1	40879887	40879887	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40879887G>A	uc001cfj.2	+	6	611	c.546G>A	c.(544-546)GCG>GCA	p.A182A	SMAP2_uc010ojh.1_Silent_p.A182A|SMAP2_uc001cfk.2_Silent_p.A152A|SMAP2_uc010oji.1_Silent_p.A99A|SMAP2_uc010ojj.1_5'UTR	NM_022733	NP_073570	Q8WU79	SMAP2_HUMAN	small ArfGAP2	182	Interaction with clathrin heavy chains (By similarity).				regulation of ARF GTPase activity	cytoplasm|nucleus	ARF GTPase activator activity|zinc ion binding				0	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)			AATCCACAGCGCCTGTCATGG	0.423													20	39	---	---	---	---	PASS
MAST2	23139	broad.mit.edu	37	1	46494545	46494545	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46494545G>T	uc001cov.2	+	18	2441	c.2158G>T	c.(2158-2160)GTG>TTG	p.V720L	MAST2_uc001cow.2_Missense_Mutation_p.V720L|MAST2_uc001coy.1_Missense_Mutation_p.V394L|MAST2_uc001coz.1_Missense_Mutation_p.V605L|MAST2_uc001cpa.2_RNA	NM_015112	NP_055927	Q6P0Q8	MAST2_HUMAN	microtubule associated serine/threonine kinase	720	Protein kinase.				regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|stomach(2)|breast(1)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					TGAGTTCCTGGTGGGCTGCGT	0.577													57	144	---	---	---	---	PASS
LRRC41	10489	broad.mit.edu	37	1	46763281	46763281	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46763281C>G	uc001cpn.2	-	3	355	c.311G>C	c.(310-312)CGC>CCC	p.R104P	LRRC41_uc010omb.1_Missense_Mutation_p.R104P|LRRC41_uc001cpo.1_Missense_Mutation_p.R104P	NM_006369	NP_006360	Q15345	LRC41_HUMAN	MUF1 protein	104										ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(166;0.155)					CCAGAGTCGGCGCCAGATGGC	0.463													18	50	---	---	---	---	PASS
C1orf87	127795	broad.mit.edu	37	1	60503689	60503689	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60503689C>T	uc001czs.1	-	6	930	c.838G>A	c.(838-840)GAG>AAG	p.E280K		NM_152377	NP_689590	Q8N0U7	CA087_HUMAN	hypothetical protein LOC127795	280							calcium ion binding			ovary(1)|breast(1)	2						CCATGACTCTCAGTTTTTCTC	0.328													10	24	---	---	---	---	PASS
LEPR	3953	broad.mit.edu	37	1	66102686	66102686	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66102686C>T	uc001dci.2	+	20	3688	c.3486C>T	c.(3484-3486)GAC>GAT	p.D1162D	LEPR_uc009waq.2_3'UTR	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1	1162	Cytoplasmic (Potential).				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AGATGTGTGACCTAACTGTGT	0.343													18	61	---	---	---	---	PASS
SERBP1	26135	broad.mit.edu	37	1	67895690	67895690	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67895690G>A	uc001ddv.2	-	1	434	c.294C>T	c.(292-294)CCC>CCT	p.P98P	SERBP1_uc001ddx.2_Silent_p.P98P|SERBP1_uc001ddy.2_Silent_p.P98P|SERBP1_uc001ddw.2_Silent_p.P98P	NM_001018067	NP_001018077	Q8NC51	PAIRB_HUMAN	SERPINE1 mRNA binding protein 1 isoform 1	98					regulation of mRNA stability	nucleus|perinuclear region of cytoplasm	mRNA 3'-UTR binding|protein binding			skin(1)	1						TAAGCGCCACGGGCGGCTGCG	0.622													27	88	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	75009592	75009592	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75009592T>C	uc001dgf.1	+	25	2485	c.2434T>C	c.(2434-2436)TAT>CAT	p.Y812H	TNNI3K_uc001dge.1_Missense_Mutation_p.Y913H	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	812						cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						TGATGCAGGCTATGTATCCGA	0.438													9	47	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	75009669	75009669	+	3'UTR	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75009669G>C	uc001dgf.1	+	25					TNNI3K_uc001dge.1_3'UTR	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b							cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						GCAGCTGACAGCATTCGGCGT	0.453													7	37	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75139208	75139208	+	5'UTR	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75139208G>A	uc001dgg.2	-	1						NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254											ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						GCTCATTTTTGCAGGATCCCT	0.677													5	20	---	---	---	---	PASS
RABGGTB	5876	broad.mit.edu	37	1	76259838	76259838	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76259838G>T	uc001dgy.1	+	8	846	c.775G>T	c.(775-777)GAT>TAT	p.D259Y	MSH4_uc001dhd.1_5'Flank|RABGGTB_uc009wbt.1_RNA|RABGGTB_uc001dha.1_Missense_Mutation_p.D213Y|RABGGTB_uc001dhc.1_RNA	NM_004582	NP_004573	P53611	PGTB2_HUMAN	RAB geranylgeranyltransferase, beta subunit	259					protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity			ovary(1)	1						TCATTGGATTGATAGAGAGAA	0.408													27	86	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79403931	79403931	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79403931G>A	uc001diq.3	-	5	586	c.430C>T	c.(430-432)CAA>TAA	p.Q144*		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	144	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TAGACTTCTTGTAGCAAAGCC	0.308													6	16	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79403932	79403932	+	Silent	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79403932T>A	uc001diq.3	-	5	585	c.429A>T	c.(427-429)CTA>CTT	p.L143L		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	143	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		AGACTTCTTGTAGCAAAGCCA	0.308													6	16	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86437076	86437076	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86437076C>A	uc001dlj.2	-	21	2407	c.2365G>T	c.(2365-2367)GGA>TGA	p.G789*	COL24A1_uc010osd.1_Nonsense_Mutation_p.G89*|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	789	Collagen-like 4.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		CCAAGGAGTCCCTATAAAAGC	0.378													6	23	---	---	---	---	PASS
BTBD8	284697	broad.mit.edu	37	1	92612763	92612763	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92612763A>G	uc001doo.2	+	8	1224	c.957A>G	c.(955-957)ATA>ATG	p.I319M	BTBD8_uc010otc.1_RNA	NM_183242	NP_899065	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8	319						nucleus				ovary(1)	1		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		TGACGTCTATACTAGAATGCC	0.323													21	64	---	---	---	---	PASS
CCDC18	343099	broad.mit.edu	37	1	93704969	93704969	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93704969C>A	uc001dpq.2	+	20	3228	c.3060C>A	c.(3058-3060)CTC>CTA	p.L1020L	CCDC18_uc009wdl.1_Silent_p.L537L	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	901	Potential.			L -> F (in Ref. 1; BAC86410).						ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		CAATGCACCTCTCTCAATTAG	0.353													5	80	---	---	---	---	PASS
SLC35A3	23443	broad.mit.edu	37	1	100477020	100477020	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100477020G>C	uc001dsp.1	+	5	762	c.565G>C	c.(565-567)GCT>CCT	p.A189P	SLC35A3_uc001dsq.1_Missense_Mutation_p.A189P|SLC35A3_uc009wdy.1_Missense_Mutation_p.A189P|SLC35A3_uc001dsr.1_Missense_Mutation_p.A231P|SLC35A3_uc001dss.1_Missense_Mutation_p.A108P	NM_012243	NP_036375	Q9Y2D2	S35A3_HUMAN	solute carrier family 35 member 3A	189	Helical; (Potential).				UDP-N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	sugar:hydrogen symporter activity|UDP-N-acetylglucosamine transmembrane transporter activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.124)|all cancers(265;0.198)|Lung(183;0.199)		AAGTGGCTTTGCTGGGGTTTA	0.353													17	60	---	---	---	---	PASS
OLFM3	118427	broad.mit.edu	37	1	102270020	102270020	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102270020A>C	uc001duf.2	-	6	1282	c.1211T>G	c.(1210-1212)CTG>CGG	p.L404R	OLFM3_uc001dug.2_Missense_Mutation_p.L384R|OLFM3_uc001duh.2_RNA|OLFM3_uc001dui.2_RNA|OLFM3_uc001duj.2_Missense_Mutation_p.L309R|OLFM3_uc001due.2_RNA	NM_058170	NP_477518	Q96PB7	NOE3_HUMAN	olfactomedin 3	404	Olfactomedin-like.					extracellular region				ovary(2)|skin(1)	3		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		GGTGACATACAGTGTCCCACA	0.463													26	71	---	---	---	---	PASS
AKNAD1	254268	broad.mit.edu	37	1	109394803	109394803	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109394803T>C	uc001dwa.2	-	2	753	c.484A>G	c.(484-486)AAA>GAA	p.K162E	AKNAD1_uc010ovb.1_Intron|AKNAD1_uc001dwb.2_RNA	NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN	hypothetical protein LOC254268	162										ovary(3)	3						GTTTGTTCTTTTGGCCAAGAA	0.408													4	50	---	---	---	---	PASS
KCNA3	3738	broad.mit.edu	37	1	111215804	111215804	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111215804G>A	uc001dzv.1	-	1	1852	c.1628C>T	c.(1627-1629)CCC>CTC	p.P543L		NM_002232	NP_002223	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related	543						voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(4)|pancreas(1)	5		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGGGTCTGGGGGAAAGCGCT	0.478													25	74	---	---	---	---	PASS
FAM46C	54855	broad.mit.edu	37	1	118166109	118166109	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118166109C>A	uc001ehe.2	+	2	818	c.619C>A	c.(619-621)CAC>AAC	p.H207N		NM_017709	NP_060179	Q5VWP2	FA46C_HUMAN	hypothetical protein LOC54855	207											0	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)		TGAGCACTTCCACCCCACCGT	0.478										Multiple Myeloma(3;1.13e-06)			6	91	---	---	---	---	PASS
UBAP2L	9898	broad.mit.edu	37	1	154221798	154221798	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154221798C>T	uc001fep.3	+	12	1265	c.1098C>T	c.(1096-1098)TTC>TTT	p.F366F	UBAP2L_uc009wot.2_Silent_p.F366F|UBAP2L_uc010pek.1_Silent_p.F358F|UBAP2L_uc010pel.1_Silent_p.F376F|UBAP2L_uc010pen.1_Silent_p.F280F	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like isoform a	366					binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGGAGCAATTCAAGACTGCCC	0.527													27	70	---	---	---	---	PASS
GBA	2629	broad.mit.edu	37	1	155208008	155208008	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155208008G>A	uc001fjh.2	-	6	828	c.678C>T	c.(676-678)ACC>ACT	p.T226T	RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Silent_p.T113T|GBA_uc010pfx.1_Silent_p.T177T|GBA_uc001fji.2_Silent_p.T226T|GBA_uc001fjj.2_Silent_p.T226T|GBA_uc001fjk.2_Silent_p.T226T|GBA_uc001fjl.2_Silent_p.T226T|GBA_uc010pfy.1_Silent_p.T139T|GBA_uc009wqk.1_Silent_p.T139T	NM_000157	NP_000148	P04062	GLCM_HUMAN	glucocerebrosidase precursor	226					carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding			ovary(1)|skin(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)	CCGCTCCATTGGTCTTGAGCC	0.567									Gaucher_disease_type_I				11	19	---	---	---	---	PASS
SMG5	23381	broad.mit.edu	37	1	156223228	156223228	+	Intron	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156223228C>A	uc001foc.3	-						SMG5_uc009wrv.2_Intron	NM_015327	NP_056142	Q9UPR3	SMG5_HUMAN	SMG5 homolog nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding			ovary(2)|skin(2)|pancreas(1)	5	Hepatocellular(266;0.158)					CACTTGGGTCCTGATTTCCTA	0.532													5	40	---	---	---	---	PASS
SMG5	23381	broad.mit.edu	37	1	156223290	156223290	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156223290C>T	uc001foc.3	-	17	2601	c.2452G>A	c.(2452-2454)GAA>AAA	p.E818K	SMG5_uc009wrv.2_Missense_Mutation_p.E303K	NM_015327	NP_056142	Q9UPR3	SMG5_HUMAN	SMG5 homolog nonsense mediated mRNA decay	818	Potential.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding			ovary(2)|skin(2)|pancreas(1)	5	Hepatocellular(266;0.158)					CGACGAGCTTCCTCCTGTGCC	0.502													7	58	---	---	---	---	PASS
ARHGEF11	9826	broad.mit.edu	37	1	156931483	156931483	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156931483G>T	uc001fqo.2	-	13	2145	c.1105C>A	c.(1105-1107)CTG>ATG	p.L369M	ARHGEF11_uc001fqn.2_Missense_Mutation_p.L409M	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	369	RGSL.				actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TTTTTCTCCAGGAAAATATTC	0.418													15	41	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158609764	158609764	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158609764G>A	uc001fst.1	-	34	4970	c.4771C>T	c.(4771-4773)CAT>TAT	p.H1591Y		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1591	Spectrin 15.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TCAAGCAGATGATCCCAATGT	0.488													29	59	---	---	---	---	PASS
OR6K2	81448	broad.mit.edu	37	1	158669494	158669494	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158669494G>A	uc001fsu.1	-	1	949	c.949C>T	c.(949-951)CCA>TCA	p.P317S		NM_001005279	NP_001005279	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K,	317	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					GAGGTCCCTGGTCTTACGGAA	0.373													23	44	---	---	---	---	PASS
OR10J1	26476	broad.mit.edu	37	1	159410499	159410499	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159410499G>T	uc010piv.1	+	1	951	c.951G>T	c.(949-951)GGG>GGT	p.G317G	uc001fts.3_Intron	NM_012351	NP_036483	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J,	317	Cytoplasmic (Potential).				sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0429)					CTGTTGGTGGGAAGTTTTCCT	0.488													23	53	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	177030384	177030384	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177030384C>A	uc001glc.2	-	2	513	c.301G>T	c.(301-303)GAG>TAG	p.E101*	ASTN1_uc001glb.1_Nonsense_Mutation_p.E101*|ASTN1_uc001gld.1_Nonsense_Mutation_p.E101*|ASTN1_uc009wwx.1_Nonsense_Mutation_p.E101*	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	101					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GGGATATCCTCTGTGTTCCCT	0.488													6	136	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	180068043	180068043	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180068043G>C	uc001gnt.2	+	37	9495	c.9112G>C	c.(9112-9114)GAG>CAG	p.E3038Q	CEP350_uc009wxl.2_Missense_Mutation_p.E3037Q|CEP350_uc001gnv.2_Missense_Mutation_p.E1173Q|CEP350_uc001gnw.1_Missense_Mutation_p.E795Q|CEP350_uc001gnx.1_Missense_Mutation_p.E795Q	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	3038						centrosome|nucleus|spindle				ovary(4)	4						TCTTAAAAAGGAGCCAAACCA	0.378													10	44	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186283765	186283765	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186283765C>G	uc001grv.2	-	50	7329	c.7032G>C	c.(7030-7032)CAG>CAC	p.Q2344H		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	2344					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		ATTCACCTCTCTGTCTGTTAA	0.353			T	NTRK1	papillary thyroid								8	33	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067764	190067764	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067764T>G	uc001gse.1	-	8	1917	c.1685A>C	c.(1684-1686)AAC>ACC	p.N562T	FAM5C_uc010pot.1_Missense_Mutation_p.N460T	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	562						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					CAAGGTGCTGTTTTTAGTTAA	0.458													31	59	---	---	---	---	PASS
CFHR5	81494	broad.mit.edu	37	1	196952178	196952178	+	Silent	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196952178A>G	uc001gts.3	+	2	350	c.222A>G	c.(220-222)GAA>GAG	p.E74E		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor	74	Sushi 1.				complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						CATGCACAGAAGAAGGATGGT	0.413													17	63	---	---	---	---	PASS
PPFIA4	8497	broad.mit.edu	37	1	203013100	203013100	+	Silent	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203013100A>G	uc009xaj.2	+	8	819	c.819A>G	c.(817-819)GAA>GAG	p.E273E	PPFIA4_uc010pqf.1_5'Flank			O75335	LIPA4_HUMAN	SubName: Full=Liprin alpha4;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						CCCGCCATGAACGGTCACTGC	0.627													5	22	---	---	---	---	PASS
MDM4	4194	broad.mit.edu	37	1	204507405	204507405	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204507405C>A	uc001hba.2	+	7	642	c.480C>A	c.(478-480)ACC>ACA	p.T160T	MDM4_uc001hbd.1_RNA|MDM4_uc010pqw.1_RNA|MDM4_uc010pqx.1_Silent_p.T33T|MDM4_uc001hay.1_Silent_p.T160T|MDM4_uc001hbb.2_Silent_p.T33T|MDM4_uc010pqy.1_Intron|MDM4_uc001hbc.2_RNA|MDM4_uc009xbe.1_RNA	NM_002393	NP_002384	O15151	MDM4_HUMAN	mouse double minute 4 homolog	160					apoptosis|cell proliferation|cellular response to hypoxia|G0 to G1 transition|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of protein catabolic process|negative regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization	nucleus	enzyme binding|zinc ion binding	p.T160S(1)		upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)			CACTGCCTACCTCAGAGCATA	0.398			A		GBM|bladder|retinoblastoma								8	177	---	---	---	---	PASS
CNTN2	6900	broad.mit.edu	37	1	205039002	205039002	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205039002G>A	uc001hbr.2	+	18	2513	c.2244G>A	c.(2242-2244)CTG>CTA	p.L748L	CNTN2_uc001hbq.1_Silent_p.L639L|CNTN2_uc001hbs.2_Silent_p.L536L	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	748	Fibronectin type-III 2.				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GCTACCTGCTGTCCTTCCGCA	0.662													33	68	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207785045	207785045	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207785045C>A	uc001hfy.2	+	30	5109	c.4969C>A	c.(4969-4971)CTG>ATG	p.L1657M	CR1_uc001hfx.2_Missense_Mutation_p.L2107M	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	1657	Sushi 26.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						TCCAGAAATCCTGCATGGTGA	0.507													6	134	---	---	---	---	PASS
LAMB3	3914	broad.mit.edu	37	1	209811999	209811999	+	Intron	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209811999G>T	uc001hhg.2	-						LAMB3_uc009xco.2_Intron|LAMB3_uc001hhh.2_Intron|LAMB3_uc010psl.1_Intron|LAMB3_uc009xcp.1_Intron	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor						cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TGCCACTGTGGGAGAGGGAGA	0.547													4	21	---	---	---	---	PASS
ITPKB	3707	broad.mit.edu	37	1	226835066	226835066	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226835066G>T	uc010pvo.1	-	4	2388	c.2048C>A	c.(2047-2049)GCT>GAT	p.A683D		NM_002221	NP_002212	P27987	IP3KB_HUMAN	1D-myo-inositol-trisphosphate 3-kinase B	683							ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity			ovary(4)|central_nervous_system(1)	5		Prostate(94;0.0773)				GCCATTGGCAGCTGCCTTGAA	0.612													3	6	---	---	---	---	PASS
ABCB10	23456	broad.mit.edu	37	1	229667459	229667459	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229667459C>T	uc001htp.3	-	7	1402	c.1359G>A	c.(1357-1359)TCG>TCA	p.S453S		NM_012089	NP_036221	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B, member 10	453	Mitochondrial intermembrane (Potential).|ABC transmembrane type-1.|Mitochondrial matrix (Potential).					integral to mitochondrial membrane|mitochondrial inner membrane	ATP binding|oligopeptide-transporting ATPase activity			breast(2)	2	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				TCATCAGCTCCGAGTAGAAAG	0.547													17	35	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236881277	236881277	+	Intron	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236881277G>T	uc001hyf.2	+						ACTN2_uc001hyg.2_Intron|ACTN2_uc009xgi.1_Intron	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2						focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TCTCAGGTTGGTGTTATATAT	0.448													12	24	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947823	237947823	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947823G>T	uc001hyl.1	+	90	12931	c.12811G>T	c.(12811-12813)GTA>TTA	p.V4271L	RYR2_uc010pya.1_Missense_Mutation_p.V686L	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4271					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GATGAAAAAAGTAAAAAAGAT	0.478													6	29	---	---	---	---	PASS
CNST	163882	broad.mit.edu	37	1	246811036	246811036	+	Silent	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246811036T>C	uc001ibp.2	+	9	1911	c.1533T>C	c.(1531-1533)TGT>TGC	p.C511C	CNST_uc001ibo.3_Silent_p.C511C	NM_152609	NP_689822	Q6PJW8	CNST_HUMAN	hypothetical protein LOC163882 isoform 1	511					positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding				0						ATGTGCTCTGTGGAAATAATC	0.453													26	73	---	---	---	---	PASS
C1orf150	148823	broad.mit.edu	37	1	247737551	247737551	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247737551T>A	uc001idf.2	+	5	320	c.275T>A	c.(274-276)ATT>AAT	p.I92N	C1orf150_uc009xgw.2_RNA|C1orf150_uc001ida.3_RNA|C1orf150_uc001idb.3_RNA|C1orf150_uc009xgx.2_RNA	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	hypothetical protein LOC148823	92											0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)			TATGAGAACATTGACTCCCTC	0.463													23	42	---	---	---	---	PASS
ASAP2	8853	broad.mit.edu	37	2	9528581	9528581	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9528581C>T	uc002qzh.2	+	22	2629	c.2289C>T	c.(2287-2289)TAC>TAT	p.Y763Y	ASAP2_uc002qzi.2_Silent_p.Y763Y	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH	763					regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0						ATGAGACTTACGGAGCCCTCC	0.592													10	45	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11752682	11752682	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11752682T>G	uc002rbk.1	+	19	3368	c.3068T>G	c.(3067-3069)CTG>CGG	p.L1023R	GREB1_uc002rbp.1_Missense_Mutation_p.L21R	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1023						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CTGGAGGGTCTGCCTTGCATC	0.557													52	44	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15564444	15564444	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15564444G>T	uc002rcc.1	-	23	2598	c.2572C>A	c.(2572-2574)CGG>AGG	p.R858R	NBAS_uc010exl.1_Silent_p.R50R|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	858										ovary(2)|liver(1)|skin(1)	4						CTCACCTGCCGAGCATAATGC	0.517													4	68	---	---	---	---	PASS
FAM49A	81553	broad.mit.edu	37	2	16742721	16742721	+	Intron	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16742721C>T	uc010exm.1	-						FAM49A_uc002rck.1_Intron	NM_030797	NP_110424	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A							intracellular					0	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			CCCAGGGACTCACGTGCATGT	0.468													8	64	---	---	---	---	PASS
GEN1	348654	broad.mit.edu	37	2	17953948	17953948	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17953948G>A	uc002rct.2	+	8	923	c.850G>A	c.(850-852)GAT>AAT	p.D284N	SMC6_uc010exo.2_Intron|GEN1_uc010yjs.1_Missense_Mutation_p.D284N|GEN1_uc002rcu.2_Missense_Mutation_p.D284N	NM_182625	NP_872431	Q17RS7	GEN_HUMAN	Gen homolog 1, endonuclease	284					DNA repair	nucleus	DNA binding|endonuclease activity|metal ion binding			breast(5)|kidney(1)|central_nervous_system(1)|skin(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					ATGTAAAAGTGATAAATATTG	0.343								Homologous_recombination					14	48	---	---	---	---	PASS
C2orf44	80304	broad.mit.edu	37	2	24261180	24261180	+	Silent	SNP	T	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24261180T>G	uc002rep.2	-	2	1316	c.1185A>C	c.(1183-1185)ACA>ACC	p.T395T	C2orf44_uc010eya.2_Silent_p.T395T	NM_025203	NP_079479	Q9H6R7	CB044_HUMAN	hypothetical protein LOC80304 isoform 1	395							protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATAGTTGGTCTGTCAAGAAAC	0.343													55	86	---	---	---	---	PASS
TP53I3	9540	broad.mit.edu	37	2	24307204	24307204	+	Intron	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24307204G>T	uc002rey.1	-						LOC375190_uc002rew.2_Intron|TP53I3_uc002rex.1_5'Flank|TP53I3_uc002rez.1_5'UTR|TP53I3_uc010ykk.1_5'UTR	NM_147184	NP_671713	Q53FA7	QORX_HUMAN	tumor protein p53 inducible protein 3						induction of apoptosis by oxidative stress|NADP metabolic process		NADPH binding|NADPH:quinone reductase activity|protein homodimerization activity|quinone binding|zinc ion binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATATTGTCTGAGGACAcagg	0.358											OREG0014492	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	23	---	---	---	---	PASS
EIF2B4	8890	broad.mit.edu	37	2	27591276	27591276	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27591276G>A	uc002rkb.2	-	6	696	c.553C>T	c.(553-555)CAG>TAG	p.Q185*	EIF2B4_uc002rjz.2_Nonsense_Mutation_p.Q205*|EIF2B4_uc002rka.2_Nonsense_Mutation_p.Q170*|EIF2B4_uc002rkc.2_Nonsense_Mutation_p.Q184*|EIF2B4_uc002rkd.2_5'UTR|EIF2B4_uc002rke.2_Nonsense_Mutation_p.Q154*|EIF2B4_uc002rkf.1_3'UTR|SNX17_uc010ylj.1_5'Flank|SNX17_uc002rkg.1_5'Flank|SNX17_uc010ylk.1_5'Flank|SNX17_uc010eza.1_5'Flank|SNX17_uc002rki.1_5'Flank|SNX17_uc002rkh.1_5'Flank|SNX17_uc010yll.1_5'Flank|SNX17_uc010ylm.1_5'Flank|SNX17_uc010yln.1_5'Flank|SNX17_uc010ylo.1_5'Flank|SNX17_uc010ylp.1_5'Flank|SNX17_uc010ylq.1_5'Flank	NM_001034116	NP_001029288	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B,	185					myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	translation initiation factor activity|translation initiation factor binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCTGTACTGGGGTAGGTGA	0.413													29	35	---	---	---	---	PASS
RBKS	64080	broad.mit.edu	37	2	28050574	28050574	+	Nonsense_Mutation	SNP	C	A	A	rs141229815		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28050574C>A	uc002rlo.1	-	7	666	c.655G>T	c.(655-657)GAG>TAG	p.E219*	RBKS_uc010ezi.1_Nonsense_Mutation_p.E152*|RBKS_uc010ymg.1_Nonsense_Mutation_p.E219*	NM_022128	NP_071411	Q9H477	RBSK_HUMAN	ribokinase	219					D-ribose metabolic process		ATP binding|ribokinase activity			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)					AATGCAGCCTCCCCAGCATCT	0.488													12	54	---	---	---	---	PASS
WDR43	23160	broad.mit.edu	37	2	29165192	29165192	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29165192G>T	uc002rmo.2	+	16	1781	c.1749G>T	c.(1747-1749)GAG>GAT	p.E583D		NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43	583						nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					CAGCATCAGAGAAGACAAAGG	0.443													5	73	---	---	---	---	PASS
YPEL5	51646	broad.mit.edu	37	2	30381650	30381650	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30381650C>T	uc002rna.3	+	5	868	c.307C>T	c.(307-309)CGT>TGT	p.R103C	YPEL5_uc002rnb.3_Missense_Mutation_p.R103C|YPEL5_uc002rnc.3_Missense_Mutation_p.R103C|YPEL5_uc002rmz.3_Missense_Mutation_p.R103C|YPEL5_uc010ezn.2_RNA|YPEL5_uc002rnd.2_Missense_Mutation_p.R103C	NM_001127401	NP_001120873	P62699	YPEL5_HUMAN	yippee-like 5	103							peptide-methionine-(S)-S-oxide reductase activity				0	Acute lymphoblastic leukemia(172;0.155)					GATCCTGGAACGTGCTCTAGT	0.473													20	88	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32740388	32740388	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32740388C>G	uc010ezu.2	+	55	11034	c.10900C>G	c.(10900-10902)CTT>GTT	p.L3634V		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	3634					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TTTGCCTTCTCTTCTTGTGAG	0.443													25	63	---	---	---	---	PASS
STRN	6801	broad.mit.edu	37	2	37126694	37126694	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37126694C>G	uc002rpn.2	-	6	776	c.767G>C	c.(766-768)AGA>ACA	p.R256T	STRN_uc010ezx.2_Missense_Mutation_p.R256T	NM_003162	NP_003153	O43815	STRN_HUMAN	striatin, calmodulin binding protein	256					dendrite development|locomotory behavior|negative regulation of cell proliferation|tight junction assembly|Wnt receptor signaling pathway	cytoplasm|dendritic spine|neuronal cell body|postsynaptic density|postsynaptic membrane|tight junction	armadillo repeat domain binding|calmodulin binding|estrogen receptor binding|protein complex binding|protein phosphatase 2A binding			skin(1)	1		Ovarian(717;0.0129)|all_hematologic(82;0.21)				GCTTTTCTCTCTTCCATCAAC	0.338													11	52	---	---	---	---	PASS
PEX13	5194	broad.mit.edu	37	2	61258923	61258923	+	Silent	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61258923C>G	uc002sau.3	+	2	545	c.462C>G	c.(460-462)GTC>GTG	p.V154V		NM_002618	NP_002609	Q92968	PEX13_HUMAN	peroxisomal biogenesis factor 13	154	Targeting to peroxisomes.|Lumenal (Potential).				cerebral cortex cell migration|fatty acid alpha-oxidation|locomotory behavior|microtubule-based peroxisome localization|neuron migration|protein import into peroxisome matrix, docking|suckling behavior	integral to peroxisomal membrane|membrane fraction	protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)			TTTCAGCTGTCTATAACAGTT	0.398													58	93	---	---	---	---	PASS
ZNF638	27332	broad.mit.edu	37	2	71577240	71577240	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71577240G>T	uc002shx.2	+	2	1475	c.1156G>T	c.(1156-1158)GGT>TGT	p.G386C	ZNF638_uc010fec.2_Missense_Mutation_p.G492C|ZNF638_uc010yqw.1_Intron|ZNF638_uc002shw.2_Missense_Mutation_p.G386C|ZNF638_uc002shy.2_Missense_Mutation_p.G386C|ZNF638_uc002shz.2_Missense_Mutation_p.G386C|ZNF638_uc002sia.2_Missense_Mutation_p.G386C|ZNF638_uc002sib.1_Missense_Mutation_p.G386C	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638	386					RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						GTCTCCCTTTGGTATTGTGAA	0.408													6	111	---	---	---	---	PASS
WDR54	84058	broad.mit.edu	37	2	74652685	74652685	+	Intron	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74652685C>G	uc002slb.2	+							NM_032118	NP_115494	Q9H977	WDR54_HUMAN	WD repeat domain 54												0						GACGAGCCCTCTGCTCCCCCA	0.592													29	110	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80646729	80646729	+	Intron	SNP	A	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80646729A>T	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						TGGTAGAGGTAAGTGTGGAGG	0.423													20	39	---	---	---	---	PASS
IMMT	10989	broad.mit.edu	37	2	86371396	86371396	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86371396C>G	uc002sqz.3	-	15	2660	c.2272G>C	c.(2272-2274)GAG>CAG	p.E758Q	IMMT_uc002sqy.3_Missense_Mutation_p.E499Q|IMMT_uc002srb.3_Missense_Mutation_p.E747Q|IMMT_uc002sra.3_Missense_Mutation_p.E757Q|IMMT_uc010ytd.1_Missense_Mutation_p.E746Q|IMMT_uc010yte.1_Missense_Mutation_p.E711Q	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1	758	Mitochondrial intermembrane (Potential).			E -> D (in Ref. 3; CAG33074).		integral to mitochondrial inner membrane	protein binding			skin(1)	1						AAACCTCACTCTGGCTGCACC	0.473													20	49	---	---	---	---	PASS
IMMT	10989	broad.mit.edu	37	2	86371740	86371740	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86371740C>T	uc002sqz.3	-	15	2316	c.1928G>A	c.(1927-1929)CGA>CAA	p.R643Q	IMMT_uc002sqy.3_Missense_Mutation_p.R384Q|IMMT_uc002srb.3_Missense_Mutation_p.R632Q|IMMT_uc002sra.3_Missense_Mutation_p.R642Q|IMMT_uc010ytd.1_Missense_Mutation_p.R631Q|IMMT_uc010yte.1_Missense_Mutation_p.R596Q	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1	643	Mitochondrial intermembrane (Potential).					integral to mitochondrial inner membrane	protein binding			skin(1)	1						TGCTACCCTTCGGGCCAGTTT	0.512													28	128	---	---	---	---	PASS
ITPRIPL1	150771	broad.mit.edu	37	2	96993213	96993213	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96993213G>A	uc002svx.2	+	3	1179	c.844G>A	c.(844-846)GTG>ATG	p.V282M	ITPRIPL1_uc010yuk.1_Missense_Mutation_p.V274M|ITPRIPL1_uc002svy.2_Missense_Mutation_p.V290M|ITPRIPL1_uc010yul.1_Missense_Mutation_p.V274M	NM_001008949	NP_001008949	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-triphosphate receptor interacting	282	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(2)|ovary(1)	3						CCTAGGGGACGTGCTGTGCCT	0.612													11	11	---	---	---	---	PASS
CKAP2L	150468	broad.mit.edu	37	2	113509924	113509924	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113509924C>A	uc002tie.2	-	5	1601	c.1522G>T	c.(1522-1524)GAG>TAG	p.E508*	CKAP2L_uc002tif.2_Nonsense_Mutation_p.E97*|CKAP2L_uc010yxp.1_Nonsense_Mutation_p.E343*|CKAP2L_uc010yxq.1_Nonsense_Mutation_p.E343*	NM_152515	NP_689728	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	508						centrosome					0						TTTTCTTCCTCTTCTTTTTCA	0.353													5	114	---	---	---	---	PASS
PCDP1	200373	broad.mit.edu	37	2	120388460	120388460	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120388460G>A	uc002tmb.2	+	20	2191	c.1099G>A	c.(1099-1101)GAT>AAT	p.D367N	PCDP1_uc010yyq.1_Missense_Mutation_p.D497N	NM_001029996	NP_001025167	Q4G0U5	PCDP1_HUMAN	primary ciliary dyskinesia protein 1	653						cilium	calmodulin binding				0	Colorectal(110;0.196)					TCTAGATTATGATCCTCTGTA	0.443													43	98	---	---	---	---	PASS
CFC1B	653275	broad.mit.edu	37	2	131356251	131356251	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131356251C>A	uc002tro.1	-	3	602	c.211G>T	c.(211-213)GAG>TAG	p.E71*		NM_001079530	NP_001072998	P0CG36	CFC1B_HUMAN	cripto, FRL-1, cryptic family 1B	71					gastrulation	extracellular region					0	Colorectal(110;0.1)					AGCGGCTCCTCCGGCCCCCAG	0.622													4	20	---	---	---	---	PASS
ZRANB3	84083	broad.mit.edu	37	2	135975078	135975078	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135975078C>T	uc002tum.2	-	17	2569	c.2452G>A	c.(2452-2454)GAA>AAA	p.E818K	ZRANB3_uc002tuk.2_Missense_Mutation_p.E361K|ZRANB3_uc002tul.2_Missense_Mutation_p.E816K	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	818						intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)		GTGATCTCTTCCAAAGCAAGA	0.343													10	33	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141739765	141739765	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141739765C>A	uc002tvj.1	-	18	3823	c.2851G>T	c.(2851-2853)GAC>TAC	p.D951Y	LRP1B_uc010fnl.1_Missense_Mutation_p.D133Y	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	951	Extracellular (Potential).|LDL-receptor class A 5.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCACCACAGTCGTCTTCCCTG	0.443										TSP Lung(27;0.18)			24	49	---	---	---	---	PASS
NR4A2	4929	broad.mit.edu	37	2	157182288	157182288	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157182288C>G	uc002tyz.3	-	8	2187	c.1765G>C	c.(1765-1767)GAC>CAC	p.D589H	NR4A2_uc002tyx.3_Missense_Mutation_p.D526H|NR4A2_uc010zcf.1_Missense_Mutation_p.D589H	NM_006186	NP_006177	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	589					cellular response to extracellular stimulus|dopaminergic neuron differentiation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus	nucleoplasm	sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						AAAAGTTTGTCAATTATTGCT	0.478													21	57	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179593231	179593231	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179593231C>T	uc010zfg.1	-	63	15914	c.15690G>A	c.(15688-15690)GTG>GTA	p.V5230V	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.V1891V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6157							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAAACCTAGCACTCTTAAGT	0.398													14	33	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179634819	179634819	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179634819T>A	uc010zfg.1	-	36	8833	c.8609A>T	c.(8608-8610)CAA>CTA	p.Q2870L	TTN_uc010zfh.1_Missense_Mutation_p.Q2824L|TTN_uc010zfi.1_Missense_Mutation_p.Q2824L|TTN_uc010zfj.1_Missense_Mutation_p.Q2824L|TTN_uc002unb.2_Missense_Mutation_p.Q2870L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2870							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCATTCCAATTGCCCGACCAC	0.473													22	58	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179647559	179647559	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179647559C>T	uc010zfg.1	-	18	3298	c.3074G>A	c.(3073-3075)AGC>AAC	p.S1025N	TTN_uc010zfh.1_Missense_Mutation_p.S979N|TTN_uc010zfi.1_Missense_Mutation_p.S979N|TTN_uc010zfj.1_Missense_Mutation_p.S979N|TTN_uc002unb.2_Missense_Mutation_p.S1025N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1025							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAGGATGTGCTGACGGTTCC	0.502													11	22	---	---	---	---	PASS
MFSD6	54842	broad.mit.edu	37	2	191353382	191353382	+	Splice_Site	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191353382G>T	uc002urz.2	+	5	1955	c.1631_splice	c.e5-1	p.G544_splice	MFSD6_uc010zge.1_Splice_Site_p.G6_splice	NM_017694	NP_060164	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane				ovary(2)	2						TTCCTCTCCAGGAGTGACACA	0.488													5	73	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210559200	210559200	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210559200T>C	uc002vde.1	+	7	2554	c.2306T>C	c.(2305-2307)ATA>ACA	p.I769T	MAP2_uc002vdc.1_Missense_Mutation_p.I769T|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.I765T	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	769					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	GAAGAACAGATAGAGAAAGTA	0.438													17	44	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211469956	211469956	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211469956T>A	uc002vee.3	+	17	2099	c.1967T>A	c.(1966-1968)ATG>AAG	p.M656K	CPS1_uc010fur.2_Missense_Mutation_p.M662K|CPS1_uc010fus.2_Missense_Mutation_p.M205K	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	656	ATP-grasp 1.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		GTTGATGCCATGGGTGTTCAC	0.398													17	47	---	---	---	---	PASS
TNS1	7145	broad.mit.edu	37	2	218683462	218683462	+	Missense_Mutation	SNP	G	T	T	rs149785174	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218683462G>T	uc002vgt.2	-	24	3679	c.3281C>A	c.(3280-3282)CCG>CAG	p.P1094Q	TNS1_uc002vgr.2_Missense_Mutation_p.P1081Q|TNS1_uc002vgs.2_Missense_Mutation_p.P1073Q|TNS1_uc010zjv.1_Missense_Mutation_p.P1073Q	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	1094	Ser-rich.					cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CTCTCCCGACGGGAAACTCCC	0.627													4	20	---	---	---	---	PASS
CXCR2	3579	broad.mit.edu	37	2	218999763	218999763	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218999763G>A	uc002vgz.1	+	4	464	c.239G>A	c.(238-240)CGC>CAC	p.R80H	CXCR2_uc002vha.1_Missense_Mutation_p.R80H|CXCR2_uc002vhb.1_Missense_Mutation_p.R80H	NM_001557	NP_001548	P25025	CXCR2_HUMAN	interleukin 8 receptor beta	80	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular defense response|dendritic cell chemotaxis|inflammatory response|neutrophil activation|neutrophil chemotaxis|positive regulation of cell proliferation	cell surface|integral to plasma membrane|mast cell granule	interleukin-8 receptor activity			lung(1)|breast(1)	2						AGGGTCGGCCGCTCCGTCACT	0.542													42	80	---	---	---	---	PASS
TTLL4	9654	broad.mit.edu	37	2	219603028	219603028	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219603028C>A	uc002viy.2	+	3	999	c.629C>A	c.(628-630)TCT>TAT	p.S210Y	TTLL4_uc010zkl.1_Missense_Mutation_p.S45Y|TTLL4_uc010fvx.2_Missense_Mutation_p.S210Y	NM_014640	NP_055455	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	210					protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity			ovary(2)|skin(1)	3		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		TCTCCACTCTCTTCCTCCTAT	0.527													5	81	---	---	---	---	PASS
EPHA4	2043	broad.mit.edu	37	2	222428692	222428692	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222428692C>A	uc002vmq.2	-	3	624	c.582G>T	c.(580-582)CTG>CTT	p.L194L	EPHA4_uc002vmr.2_Silent_p.L194L|EPHA4_uc010zlm.1_Silent_p.L135L|EPHA4_uc010zln.1_Silent_p.L194L	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor	194	Cys-rich.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GGACTGATACCAGGGCGATGC	0.522													5	83	---	---	---	---	PASS
PAX3	5077	broad.mit.edu	37	2	223086078	223086078	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223086078C>A	uc010fwo.2	-	6	1187	c.821G>T	c.(820-822)TGG>TTG	p.W274L	PAX3_uc002vmt.1_Missense_Mutation_p.W274L|PAX3_uc002vmy.1_Missense_Mutation_p.W273L|PAX3_uc002vmv.1_Missense_Mutation_p.W274L|PAX3_uc002vmw.1_Missense_Mutation_p.W274L|PAX3_uc002vmx.1_Missense_Mutation_p.W274L	NM_181457	NP_852122	P23760	PAX3_HUMAN	paired box 3 isoform PAX3	274	Homeobox.				apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTGCTTCCTCCATCTTGCACG	0.448			T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						7	116	---	---	---	---	PASS
COL4A3	1285	broad.mit.edu	37	2	228135633	228135633	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228135633G>T	uc002vom.1	+	25	1885	c.1723G>T	c.(1723-1725)GGA>TGA	p.G575*	COL4A3_uc002von.1_Nonsense_Mutation_p.G575*|COL4A3_uc002voo.1_Nonsense_Mutation_p.G575*|COL4A3_uc002vop.1_Nonsense_Mutation_p.G575*|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	575	Triple-helical region.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		TGGAACTCCGGGAGTGAAAGG	0.498													5	43	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230638891	230638891	+	Silent	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230638891T>A	uc002vpw.1	-	37	5500	c.5391A>T	c.(5389-5391)CCA>CCT	p.P1797P	TRIP12_uc002vpx.1_Silent_p.P1845P|TRIP12_uc002vpy.1_Silent_p.P1527P	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1797					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TGGGAAACCCTGGCAGAGTGA	0.408													31	63	---	---	---	---	PASS
CHRNG	1146	broad.mit.edu	37	2	233404757	233404757	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233404757C>A	uc002vsx.1	+	2	132	c.111C>A	c.(109-111)TAC>TAA	p.Y37*	CHRNG_uc010fyd.2_Nonsense_Mutation_p.Y37*|CHRNG_uc010fye.1_Nonsense_Mutation_p.Y37*	NM_005199	NP_005190	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma	37	Extracellular (Potential).				muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)		TGCAAAACTACGACCCCAACC	0.617													6	30	---	---	---	---	PASS
FARP2	9855	broad.mit.edu	37	2	242432870	242432870	+	Intron	SNP	A	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242432870A>T	uc002wbi.1	+							NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GTAATTTTGCAGGAGGCAGCC	0.507													8	29	---	---	---	---	PASS
TATDN2	9797	broad.mit.edu	37	3	10311830	10311830	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10311830G>T	uc003bvg.2	+	4	1545	c.964G>T	c.(964-966)GTG>TTG	p.V322L	TATDN2_uc003bvf.2_Missense_Mutation_p.V322L|TATDN2_uc011atr.1_Missense_Mutation_p.V322L|TATDN2_uc011ats.1_RNA|TATDN2_uc011att.1_RNA	NM_014760	NP_055575	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	322						nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding			pancreas(2)	2						AGATAGGGAGGTGGTGATGGA	0.507													20	54	---	---	---	---	PASS
SYN2	6854	broad.mit.edu	37	3	12224840	12224840	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12224840G>T	uc003bwm.2	+	15	1501	c.1337G>T	c.(1336-1338)AGC>ATC	p.S446I	SYN2_uc003bwl.1_Missense_Mutation_p.S446I|SYN2_uc003bwn.2_Missense_Mutation_p.S120I	NM_133625	NP_598328	Q92777	SYN2_HUMAN	synapsin II isoform IIa	446					neurotransmitter secretion	synaptic vesicle	ATP binding|ligase activity			ovary(1)|central_nervous_system(1)	2						CCGGACTCAAGCAAGACCCCA	0.458													7	36	---	---	---	---	PASS
NUP210	23225	broad.mit.edu	37	3	13395089	13395089	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13395089C>A	uc003bxv.1	-	18	2676	c.2593G>T	c.(2593-2595)GAG>TAG	p.E865*	NUP210_uc003bxw.2_Nonsense_Mutation_p.E41*|NUP210_uc003bxx.2_Nonsense_Mutation_p.E537*	NM_024923	NP_079199	Q8TEM1	PO210_HUMAN	nucleoporin 210 precursor	865	Lumenal (Probable).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11	all_neural(104;0.187)					AGGTGGGACTCCTGGTAGCCA	0.587													9	17	---	---	---	---	PASS
ITGA9	3680	broad.mit.edu	37	3	37778403	37778403	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37778403C>T	uc003chd.2	+	20	2216	c.2163C>T	c.(2161-2163)TTC>TTT	p.F721F		NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor	721	Extracellular (Potential).				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		AGTATGAATTCAGCGTGATCT	0.433													8	31	---	---	---	---	PASS
ZNF197	10168	broad.mit.edu	37	3	44670938	44670938	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44670938A>T	uc003cnm.2	+	2	498	c.292A>T	c.(292-294)ATT>TTT	p.I98F	ZNF197_uc003cnn.2_Missense_Mutation_p.I98F|ZNF197_uc003cno.2_RNA|ZNF197_uc003cnp.2_Missense_Mutation_p.I98F	NM_006991	NP_008922	O14709	ZN197_HUMAN	zinc finger protein 197 isoform 1	98	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|skin(1)	4				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		GCCTGGGGAGATTCGGACCTG	0.592													23	52	---	---	---	---	PASS
LARS2	23395	broad.mit.edu	37	3	45588986	45588986	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45588986G>T	uc003cop.1	+	22	2861	c.2676G>T	c.(2674-2676)CCG>CCT	p.P892P	LARS2_uc010hit.1_Silent_p.P849P	NM_015340	NP_056155	Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	892					leucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|leucine-tRNA ligase activity			upper_aerodigestive_tract(1)|ovary(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	TCCTTTCCCCGAGAACTGCCC	0.557													4	104	---	---	---	---	PASS
PTPN23	25930	broad.mit.edu	37	3	47452148	47452148	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47452148C>T	uc003crf.1	+	20	2956	c.2860C>T	c.(2860-2862)CAG>TAG	p.Q954*	PTPN23_uc011baw.1_Nonsense_Mutation_p.Q919*|PTPN23_uc011bax.1_Intron|PTPN23_uc011bay.1_Nonsense_Mutation_p.Q824*	NM_015466	NP_056281	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type	954	6 X 2 AA approximate tandem repeats of P- Q.|1.|Pro-rich.|His.				cilium morphogenesis	cilium|cytoplasmic membrane-bounded vesicle|microtubule basal body	protein tyrosine phosphatase activity			breast(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GATTGGgccccagccccagcc	0.507													5	12	---	---	---	---	PASS
ARIH2	10425	broad.mit.edu	37	3	49006060	49006060	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49006060G>T	uc003cvb.2	+	7	944	c.632G>T	c.(631-633)AGG>ATG	p.R211M	ARIH2_uc003cvc.2_Missense_Mutation_p.R211M|ARIH2_uc003cvf.2_Missense_Mutation_p.R129M|ARIH2_uc010hkl.2_Missense_Mutation_p.R211M	NM_006321	NP_006312	O95376	ARI2_HUMAN	ariadne homolog 2	211	IBR-type.				developmental cell growth|hemopoietic stem cell proliferation|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		GAGAAATACAGGCGCTACCTC	0.443													7	167	---	---	---	---	PASS
MST1R	4486	broad.mit.edu	37	3	49935084	49935084	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49935084C>G	uc003cxy.3	-	6	2179	c.1915G>C	c.(1915-1917)GAG>CAG	p.E639Q	MST1R_uc011bdd.1_Missense_Mutation_p.E639Q|MST1R_uc011bdc.1_5'Flank	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	639	IPT/TIG 1.|Extracellular (Potential).				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		AGTTCACACTCAAACTCCTCT	0.607													12	37	---	---	---	---	PASS
SFMBT1	51460	broad.mit.edu	37	3	52966255	52966255	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52966255C>A	uc003dgf.2	-	7	1092	c.523G>T	c.(523-525)GAC>TAC	p.D175Y	SFMBT1_uc010hmr.2_Missense_Mutation_p.D122Y|SFMBT1_uc003dgg.2_Missense_Mutation_p.D175Y|SFMBT1_uc003dgh.2_Missense_Mutation_p.D175Y	NM_001005159	NP_001005159	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	175	MBT 2.				regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		CTTAAAGAGTCCTGGAAAGCT	0.398													22	46	---	---	---	---	PASS
ARHGEF3	50650	broad.mit.edu	37	3	56779335	56779335	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56779335G>T	uc003dig.2	-	7	937	c.768C>A	c.(766-768)CTC>CTA	p.L256L	ARHGEF3_uc011bew.1_Silent_p.L256L|ARHGEF3_uc003dih.2_Silent_p.L288L|ARHGEF3_uc011bev.1_Silent_p.L227L|ARHGEF3_uc003dif.2_Silent_p.L262L|ARHGEF3_uc010hmy.1_Silent_p.L54L|ARHGEF3_uc003dii.2_Silent_p.L256L	NM_019555	NP_062455	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor 3 isoform	256	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		TTGGAATATCGAGGAAATTCC	0.468													5	218	---	---	---	---	PASS
PTPRG	5793	broad.mit.edu	37	3	62216897	62216897	+	Splice_Site	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62216897A>G	uc003dlb.2	+	14	3008	c.2289_splice	c.e14-2	p.R763_splice	PTPRG_uc003dlc.2_Intron|PTPRG_uc011bfi.1_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		TTGTCCATTTAGAGGGTGTAA	0.473													4	21	---	---	---	---	PASS
PRICKLE2	166336	broad.mit.edu	37	3	64085478	64085478	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64085478G>T	uc003dmf.2	-	8	2370	c.1784C>A	c.(1783-1785)TCG>TAG	p.S595*		NM_198859	NP_942559	Q7Z3G6	PRIC2_HUMAN	prickle-like 2	595						cytoplasm|nuclear membrane	zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		CTGCATGGACGAGTTAAGAGT	0.552													5	144	---	---	---	---	PASS
LRIG1	26018	broad.mit.edu	37	3	66430866	66430866	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66430866C>T	uc003dmx.2	-	19	3117	c.3103G>A	c.(3103-3105)GAG>AAG	p.E1035K	SLC25A26_uc011bft.1_RNA|LRIG1_uc011bfu.1_Missense_Mutation_p.E655K|LRIG1_uc003dmw.2_Missense_Mutation_p.E701K|LRIG1_uc010hnz.2_Missense_Mutation_p.E751K|LRIG1_uc010hoa.2_Missense_Mutation_p.E1012K	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like	1035	Cytoplasmic (Potential).					integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		GGCTGTAGCTCTGTGGAGTCC	0.532													50	102	---	---	---	---	PASS
FOXP1	27086	broad.mit.edu	37	3	71015079	71015079	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71015079C>T	uc003dol.2	-	16	2174	c.1851G>A	c.(1849-1851)GAG>GAA	p.E617E	FOXP1_uc003dom.2_Silent_p.E541E|FOXP1_uc003don.2_RNA|FOXP1_uc003doo.2_Silent_p.E616E|FOXP1_uc003dop.2_Silent_p.E617E|FOXP1_uc003doq.1_Intron|FOXP1_uc003doi.2_Silent_p.E517E|FOXP1_uc003doj.2_Silent_p.E517E|FOXP1_uc003dok.2_Silent_p.E430E	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN	forkhead box P1 isoform 1	617					cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		TGCTGTCACTCTCGTTGCTGT	0.532			T	PAX5	ALL								40	89	---	---	---	---	PASS
ARL6	84100	broad.mit.edu	37	3	97506911	97506911	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97506911G>T	uc003drv.2	+	7	740	c.427G>T	c.(427-429)GTG>TTG	p.V143L	ARL6_uc003drw.2_RNA|ARL6_uc003dru.2_Missense_Mutation_p.V143L|ARL6_uc010hoy.2_Missense_Mutation_p.V143L	NM_177976	NP_816931	Q9H0F7	ARL6_HUMAN	ADP-ribosylation factor-like 6	143					cilium assembly|determination of left/right symmetry|melanosome transport|protein polymerization|protein targeting to membrane|small GTPase mediated signal transduction|visual perception|Wnt receptor signaling pathway	axonemal microtubule|cilium axoneme|cilium membrane|membrane coat|microtubule basal body	GTP binding|metal ion binding|phospholipid binding|protein binding				0		Lung NSC(201;0.0193)|Prostate(884;0.174)		LUSC - Lung squamous cell carcinoma(29;0.0118)|Lung(72;0.0189)		ATCTGTAAAAGTGTCTCAGTT	0.303									Bardet-Biedl_syndrome				23	33	---	---	---	---	PASS
OR5H15	403274	broad.mit.edu	37	3	97887902	97887902	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97887902A>T	uc011bgu.1	+	1	359	c.359A>T	c.(358-360)TAT>TTT	p.Y120F		NM_001005515	NP_001005515	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H,	120	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						ACAATGGCATATGATCGCTAT	0.378													22	99	---	---	---	---	PASS
LNP1	348801	broad.mit.edu	37	3	100170718	100170718	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100170718C>A	uc003dtx.3	+	3	1592	c.312C>A	c.(310-312)TCC>TCA	p.S104S	LNP1_uc003dty.3_RNA|LNP1_uc011bhb.1_RNA	NM_001085451	NP_001078920	A1A4G5	LNP1_HUMAN	leukemia NUP98 fusion partner 1	104											0						AAGGAAGATCCCATTCCAAAA	0.428													6	122	---	---	---	---	PASS
DPPA4	55211	broad.mit.edu	37	3	109047782	109047782	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109047782G>T	uc003dxq.3	-	6	888	c.833C>A	c.(832-834)CCC>CAC	p.P278H	DPPA4_uc011bho.1_Silent_p.T179T	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	278						nucleus	protein binding			upper_aerodigestive_tract(1)	1						AAGGTGCGGGGGTGGAAAATT	0.473													18	25	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113122773	113122773	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113122773G>A	uc003eae.1	-	9	1142	c.1096C>T	c.(1096-1098)CAC>TAC	p.H366Y		NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2	366	WD 4.									central_nervous_system(1)	1						GGACCATTGTGACATGACTTG	0.478													38	158	---	---	---	---	PASS
ARHGAP31	57514	broad.mit.edu	37	3	119134028	119134028	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119134028C>T	uc003ecj.3	+	12	3784	c.3252C>T	c.(3250-3252)CAC>CAT	p.H1084H		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	1084					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						CTGGAGAGCACCCCGCAAAGT	0.572													7	230	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124397067	124397067	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124397067G>T	uc003ehg.2	+	50	7351	c.7224G>T	c.(7222-7224)ATG>ATT	p.M2408I	KALRN_uc003ehk.2_Missense_Mutation_p.M711I	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	2407					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						CTCTACGCATGAGAAAGCGGG	0.493													6	153	---	---	---	---	PASS
CCDC37	348807	broad.mit.edu	37	3	126132997	126132997	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126132997A>G	uc003eiu.1	+	4	299	c.200A>G	c.(199-201)GAT>GGT	p.D67G	CCDC37_uc010hsg.1_Missense_Mutation_p.D67G	NM_182628	NP_872434	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	67										ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.166)		TTGCTCAGAGATCAGGAGCGG	0.562													91	161	---	---	---	---	PASS
RAB43	339122	broad.mit.edu	37	3	128852967	128852967	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128852967C>T	uc003elo.1	-	9	824	c.613G>A	c.(613-615)GAG>AAG	p.E205K	ISY1_uc010hsz.1_Intron|ISY1_uc003elp.1_Missense_Mutation_p.E205K|ISY1_uc010hta.1_Missense_Mutation_p.E227K	NM_020701	NP_065752	Q86YS6	RAB43_HUMAN	ISY1 splicing factor homolog	Error:Variant_position_missing_in_Q86YS6_after_alignment					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1						tcttcctcctcctcttcctTT	0.448													21	66	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	150876568	150876568	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150876568G>T	uc003eyp.2	+	6	857	c.819G>T	c.(817-819)TTG>TTT	p.L273F	MED12L_uc011bnz.1_Missense_Mutation_p.L273F|MED12L_uc003eym.1_Missense_Mutation_p.L273F|MED12L_uc003eyn.2_Missense_Mutation_p.L273F|MED12L_uc003eyo.2_Missense_Mutation_p.L273F	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	273					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTAAACTCTTGCTACCACTAA	0.388													18	34	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164773014	164773014	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164773014G>T	uc003fei.2	-	13	1542	c.1480C>A	c.(1480-1482)CAT>AAT	p.H494N		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	494	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	ACTTCTTGATGGAAAATACTG	0.348										HNSCC(35;0.089)			22	73	---	---	---	---	PASS
GHSR	2693	broad.mit.edu	37	3	172163133	172163133	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172163133C>T	uc003fib.1	-	2	919	c.919G>A	c.(919-921)GTG>ATG	p.V307M		NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a	307	Helical; Name=7; (Potential).				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			ACAAAGGACACGAGGTTGCAG	0.507													27	93	---	---	---	---	PASS
YEATS2	55689	broad.mit.edu	37	3	183476656	183476656	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183476656C>A	uc003fly.2	+	13	1754	c.1559C>A	c.(1558-1560)CCT>CAT	p.P520H		NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	520					histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TCAGGAAGTCCTACAAACAAG	0.383													6	137	---	---	---	---	PASS
HTR3C	170572	broad.mit.edu	37	3	183776363	183776363	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183776363G>C	uc003fmk.2	+	6	742	c.708G>C	c.(706-708)CAG>CAC	p.Q236H		NM_130770	NP_570126	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine receptor 3 subunit C	236	Extracellular (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			TATATGACCAGATCATGTTTT	0.502													27	76	---	---	---	---	PASS
EIF4G1	1981	broad.mit.edu	37	3	184045615	184045615	+	Intron	SNP	C	G	G	rs112760871		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184045615C>G	uc003fnp.2	+						EIF4G1_uc003fnt.2_Intron|EIF4G1_uc003fnq.2_Intron|EIF4G1_uc003fnr.2_Intron|EIF4G1_uc010hxx.2_Intron|EIF4G1_uc003fns.2_Intron|EIF4G1_uc010hxy.2_Intron|EIF4G1_uc003fnv.3_Intron|EIF4G1_uc003fnu.3_Intron|EIF4G1_uc003fnw.2_Intron|EIF4G1_uc003fnx.2_Intron|EIF4G1_uc003fny.3_Intron|EIF4G1_uc003foa.2_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4						insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGCACCCCTCAGGAGGCAGT	0.617													8	36	---	---	---	---	PASS
ATP13A4	84239	broad.mit.edu	37	3	193207607	193207607	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193207607C>A	uc003ftd.2	-	7	758	c.650G>T	c.(649-651)TGG>TTG	p.W217L	ATP13A4_uc003fte.1_Missense_Mutation_p.W217L|ATP13A4_uc011bsr.1_5'UTR	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	217	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TTCACTAAACCACAAACAGAC	0.353													5	117	---	---	---	---	PASS
HAUS3	79441	broad.mit.edu	37	4	2241768	2241768	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2241768G>A	uc003ges.1	-	2	1136	c.906C>T	c.(904-906)AGC>AGT	p.S302S	POLN_uc011bvi.1_Intron|HAUS3_uc011bvj.1_Silent_p.S302S|HAUS3_uc003get.1_Silent_p.S302S	NM_024511	NP_078787	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	302					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle				large_intestine(2)|breast(2)	4						TGCTTACCTTGCTGGTTAGGC	0.353													19	43	---	---	---	---	PASS
FAM193A	8603	broad.mit.edu	37	4	2673998	2673998	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2673998C>A	uc010icl.2	+	11	1708	c.1357C>A	c.(1357-1359)CCT>ACT	p.P453T	FAM193A_uc010ick.2_Missense_Mutation_p.P653T|FAM193A_uc003gfd.2_Missense_Mutation_p.P453T|FAM193A_uc011bvm.1_Missense_Mutation_p.P475T|FAM193A_uc011bvn.1_Missense_Mutation_p.P453T|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Missense_Mutation_p.P307T	NM_003704	NP_003695	P78312	F193A_HUMAN	hypothetical protein LOC8603	453										ovary(3)	3						GCACCTTTACCCTCACATCCA	0.567													6	53	---	---	---	---	PASS
STK32B	55351	broad.mit.edu	37	4	5448438	5448438	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5448438G>A	uc003gih.1	+	7	665	c.601G>A	c.(601-603)GGA>AGA	p.G201R	STK32B_uc010ida.1_Missense_Mutation_p.G154R	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B	201	Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						CAGAGGCCCCGGATACTCGTA	0.577													16	41	---	---	---	---	PASS
KCNIP4	80333	broad.mit.edu	37	4	20751284	20751284	+	Splice_Site	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20751284C>T	uc003gqe.2	-	4	462	c.378_splice	c.e4+1	p.E126_splice	KCNIP4_uc003gqf.1_Splice_Site_p.E122_splice|KCNIP4_uc003gqg.1_Splice_Site_p.E81_splice|KCNIP4_uc003gqh.1_Splice_Site_p.E118_splice|KCNIP4_uc003gqi.1_Splice_Site_p.E81_splice|PACRGL_uc003gpu.2_Intron|PACRGL_uc003gpx.3_Intron|PACRGL_uc003gpw.2_Intron|KCNIP4_uc010iel.2_Splice_Site_p.E123_splice|KCNIP4_uc003gqd.3_Splice_Site_p.E106_splice	NM_147182	NP_671711	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				CCAGAGCTTACCTCGAAACTC	0.353													5	18	---	---	---	---	PASS
GPR125	166647	broad.mit.edu	37	4	22449131	22449131	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22449131G>C	uc003gqm.1	-	5	742	c.477C>G	c.(475-477)AAC>AAG	p.N159K	GPR125_uc010ieo.1_Missense_Mutation_p.N33K|GPR125_uc003gqo.2_Missense_Mutation_p.N159K	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor	159	Extracellular (Potential).|LRR 4.				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				TCCCCGAAAGGTTTCTGAAAG	0.264													9	33	---	---	---	---	PASS
PCDH7	5099	broad.mit.edu	37	4	30724912	30724912	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30724912C>G	uc003gsk.1	+	1	2876	c.1868C>G	c.(1867-1869)ACT>AGT	p.T623S	PCDH7_uc011bxw.1_Missense_Mutation_p.T576S|PCDH7_uc011bxx.1_Missense_Mutation_p.T623S	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	623	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						CAGGGCAGCACTACGGTGATT	0.488													18	48	---	---	---	---	PASS
ARAP2	116984	broad.mit.edu	37	4	36149163	36149163	+	Intron	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36149163C>T	uc003gsq.1	-							NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH						regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						AAGAAAAAAGCTCTTACTTAG	0.368													20	29	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47597740	47597740	+	Nonstop_Mutation	SNP	A	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47597740A>T	uc003gxm.2	-	22	3220	c.3127T>A	c.(3127-3129)TAA>AAA	p.*1043K	CORIN_uc011bzf.1_Nonstop_Mutation_p.*904K|CORIN_uc011bzg.1_Nonstop_Mutation_p.*976K	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin	1043					peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						CCTTATAATTAGTTTAGGAGA	0.413													15	55	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55970835	55970835	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55970835G>T	uc003has.2	-	13	2264	c.1962C>A	c.(1960-1962)TGC>TGA	p.C654*	KDR_uc003hat.1_Nonsense_Mutation_p.C654*|KDR_uc011bzx.1_Nonsense_Mutation_p.C654*	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	654	Ig-like C2-type 6.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	GCCTGACCACGCAATGTCTTT	0.463			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			5	8	---	---	---	---	PASS
CLOCK	9575	broad.mit.edu	37	4	56308750	56308750	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56308750G>C	uc003haz.1	-	22	2880	c.1954C>G	c.(1954-1956)CAG>GAG	p.Q652E	CLOCK_uc003hba.1_Missense_Mutation_p.Q652E|CLOCK_uc010igu.1_RNA	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	652					circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity	p.Q652K(1)		central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			CTCTGTGTCTGACTGGGTAGA	0.403													14	34	---	---	---	---	PASS
C4orf35	85438	broad.mit.edu	37	4	71201572	71201572	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71201572C>A	uc003hff.2	+	1	902	c.816C>A	c.(814-816)ACC>ACA	p.T272T		NM_033122	NP_149113	Q96KC9	CABS1_HUMAN	testis development protein NYD-SP26	272						flagellum	calcium ion binding				0		all_hematologic(202;0.196)				AACTCACTACCTCTGCTGAAA	0.408													6	75	---	---	---	---	PASS
PARM1	25849	broad.mit.edu	37	4	75938085	75938085	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75938085C>A	uc003hih.1	+	2	734	c.494C>A	c.(493-495)CCA>CAA	p.P165Q		NM_015393	NP_056208	Q6UWI2	PARM1_HUMAN	prostatic androgen-repressed message-1	165	Extracellular (Potential).				positive regulation of telomerase activity	early endosome|endosome membrane|Golgi membrane|integral to membrane|late endosome|plasma membrane				ovary(1)	1						TCAACCTCACCACCTGAGGTC	0.592													8	272	---	---	---	---	PASS
G3BP2	9908	broad.mit.edu	37	4	76570869	76570869	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76570869C>A	uc003hir.2	-	12	1359	c.1194G>T	c.(1192-1194)GGG>GGT	p.G398G	G3BP2_uc003his.2_Silent_p.G398G|G3BP2_uc003hit.2_Silent_p.G365G	NM_012297	NP_036429	Q9UN86	G3BP2_HUMAN	Ras-GTPase activating protein SH3 domain-binding	398	RRM.				cytoplasmic sequestering of NF-kappaB|mRNA transport|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	GTPase activator activity|nucleotide binding|receptor signaling complex scaffold activity|RNA binding			breast(2)|central_nervous_system(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AACGTACTTCCCCTCGAAACA	0.403													8	27	---	---	---	---	PASS
PLA2G12A	81579	broad.mit.edu	37	4	110635635	110635635	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110635635C>A	uc003hzp.2	-	4	745	c.468G>T	c.(466-468)GTG>GTT	p.V156V	PLA2G12A_uc010img.2_Silent_p.V154V	NM_030821	NP_110448	Q9BZM1	PG12A_HUMAN	phospholipase A2, group XIIA precursor	156					lipid catabolic process|phospholipid metabolic process	extracellular region	calcium ion binding|calcium-dependent phospholipase A2 activity				0				OV - Ovarian serous cystadenocarcinoma(123;0.000268)		ACAAGAGCTCCACTGTTGTTT	0.408													7	123	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113510836	113510836	+	Intron	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113510836C>A	uc003iau.2	-						C4orf21_uc003iav.2_5'Flank|C4orf21_uc003iaw.2_Missense_Mutation_p.K1057N	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like							integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		AAAACTTCATCTTAAATGAAT	0.348													18	50	---	---	---	---	PASS
CAMK2D	817	broad.mit.edu	37	4	114378622	114378622	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114378622G>A	uc003ibi.2	-	17	2161	c.1302C>T	c.(1300-1302)CTC>CTT	p.L434L	CAMK2D_uc003ibj.2_Silent_p.L434L|CAMK2D_uc003ibk.2_Silent_p.L434L|CAMK2D_uc003ibo.3_Silent_p.L468L|CAMK2D_uc003ibm.2_Silent_p.L448L|CAMK2D_uc003ibn.2_Silent_p.L445L|CAMK2D_uc003ibl.2_Silent_p.L434L	NM_001221	NP_001212	Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II	434					interferon-gamma-mediated signaling pathway|regulation of cell growth|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)	1		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		TGTACTGTGTGAGCCTAATAT	0.463													33	85	---	---	---	---	PASS
GAB1	2549	broad.mit.edu	37	4	144387363	144387363	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144387363C>A	uc003ije.2	+	9	2270	c.1911C>A	c.(1909-1911)TCC>TCA	p.S637S	GAB1_uc003ijd.2_Silent_p.S667S|GAB1_uc011chq.1_Silent_p.S534S	NM_002039	NP_002030	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1 isoform b	637					cell proliferation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			breast(2)|lung(1)|skin(1)	4	all_hematologic(180;0.158)					CTGGGAAATCCACACCACCAC	0.413													5	72	---	---	---	---	PASS
PRMT10	90826	broad.mit.edu	37	4	148605110	148605110	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148605110C>A	uc003ilc.2	-	1	171	c.29G>T	c.(28-30)CGA>CTA	p.R10L	PRMT10_uc003ild.2_5'UTR	NM_138364	NP_612373	Q6P2P2	ANM10_HUMAN	protein arginine methyltransferase 10	10						cytoplasm	binding|protein methyltransferase activity			ovary(1)|central_nervous_system(1)	2						CCCGGCGTCTCGGCGGGACCT	0.607													6	11	---	---	---	---	PASS
SH3D19	152503	broad.mit.edu	37	4	152095916	152095916	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152095916C>A	uc010ipl.1	-	7	1690	c.600G>T	c.(598-600)TTG>TTT	p.L200F	SH3D19_uc003imc.2_Missense_Mutation_p.L200F|SH3D19_uc003ime.2_Missense_Mutation_p.L200F|SH3D19_uc010ipm.2_Missense_Mutation_p.L200F	NM_001009555	NP_001009555	Q5HYK7	SH319_HUMAN	SH3 domain containing 19 isoform a	200	Pro-rich.				cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding			ovary(1)|skin(1)	2	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				CGATGTCCACCAAGGGCTTGC	0.552													8	204	---	---	---	---	PASS
FAM198B	51313	broad.mit.edu	37	4	159052033	159052033	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159052033C>A	uc003ipp.3	-	4	1709	c.1257G>T	c.(1255-1257)AAG>AAT	p.K419N	FAM198B_uc003ipq.3_Missense_Mutation_p.K427N|FAM198B_uc003ipr.3_Missense_Mutation_p.K419N	NM_016613	NP_057697	Q6UWH4	F198B_HUMAN	hypothetical protein LOC51313 isoform 2	419	Extracellular (Potential).					Golgi membrane|integral to membrane					0						TTGGGTCATGCTTTCGCTGGA	0.423													10	49	---	---	---	---	PASS
C4orf46	201725	broad.mit.edu	37	4	159592877	159592877	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159592877G>C	uc003iqa.2	-	1	326	c.77C>G	c.(76-78)TCT>TGT	p.S26C	C4orf46_uc010iqp.1_Intron|ETFDH_uc010iqq.2_5'Flank|ETFDH_uc003iqb.2_5'Flank|ETFDH_uc011cjg.1_5'Flank|ETFDH_uc010iqr.2_5'Flank	NM_001008393	NP_001008394	Q504U0	CD046_HUMAN	hypothetical protein LOC201725	26										skin(1)	1						AGATGCTGCAGAGGCGTCTGA	0.667													6	7	---	---	---	---	PASS
KIAA1712	80817	broad.mit.edu	37	4	175231093	175231093	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175231093G>T	uc003itr.2	+	8	1185	c.771G>T	c.(769-771)AGG>AGT	p.R257S	KIAA1712_uc010iro.2_Missense_Mutation_p.R257S|KIAA1712_uc003its.2_RNA	NM_001040157	NP_001035247	Q9C0F1	CEP44_HUMAN	HBV PreS1-transactivated protein 3 isoform a	257	Potential.					centrosome|midbody|spindle pole					0		Prostate(90;0.00276)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;4.06e-18)|Epithelial(43;1.18e-15)|OV - Ovarian serous cystadenocarcinoma(60;4.65e-09)|GBM - Glioblastoma multiforme(59;0.00098)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0949)		TAGAGAAAAGGTTAGACTGTT	0.353													11	31	---	---	---	---	PASS
SORBS2	8470	broad.mit.edu	37	4	186573889	186573889	+	Intron	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186573889T>A	uc003iyl.2	-						SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Intron|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cky.1_Intron|SORBS2_uc003iyp.2_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Intron|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Intron|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		CTGTCTGTAATGAAGAGAGCG	0.438													30	52	---	---	---	---	PASS
ANKH	56172	broad.mit.edu	37	5	14711350	14711350	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14711350C>A	uc003jfm.3	-	12	1766	c.1435G>T	c.(1435-1437)GAG>TAG	p.E479*	ANKH_uc003jfl.3_Nonsense_Mutation_p.E192*	NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein	479	Cytoplasmic (Potential).				locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						GTCACCTCCTCTGTCGGAGGC	0.537													6	149	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	5	37815749	37815749	+	IGR	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37815749G>A								WDR70 (62977 upstream) : GDNF (5 downstream)																							CTCTGGAGCCGGAGTCAGATA	0.453													16	62	---	---	---	---	PASS
ERBB2IP	55914	broad.mit.edu	37	5	65324181	65324181	+	Intron	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65324181C>G	uc003juk.1	+						ERBB2IP_uc003juh.1_Intron|ERBB2IP_uc003jui.1_Intron|ERBB2IP_uc003juj.1_Intron|ERBB2IP_uc011cqx.1_Intron|ERBB2IP_uc011cqy.1_Intron|ERBB2IP_uc011cqz.1_Intron|ERBB2IP_uc010iwx.1_Intron|ERBB2IP_uc003jul.1_Intron	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2						basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		GGTGGGCATTCTGATTTTATA	0.343													4	17	---	---	---	---	PASS
MAST4	375449	broad.mit.edu	37	5	66460893	66460893	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66460893C>A	uc003jut.1	+	28	5387	c.5319C>A	c.(5317-5319)TCC>TCA	p.S1773S	MAST4_uc003juw.2_Silent_p.S1701S|MAST4_uc003jux.2_5'Flank	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	1965						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CTGAAGCTTCCCCCTCAAGGG	0.642													4	10	---	---	---	---	PASS
LYSMD3	116068	broad.mit.edu	37	5	89814629	89814629	+	3'UTR	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89814629C>T	uc003kjr.2	-	3					LYSMD3_uc010jaz.1_Silent_p.*151*|LYSMD3_uc003kjs.1_3'UTR	NM_198273	NP_938014	Q7Z3D4	LYSM3_HUMAN	LysM, putative peptidoglycan-binding, domain						cell wall macromolecule catabolic process	integral to membrane					0		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-31)|Epithelial(54;5.22e-26)|all cancers(79;2.42e-22)		TGATTATGAGCTAATTGCTAT	0.373													24	42	---	---	---	---	PASS
FER	2241	broad.mit.edu	37	5	108290449	108290449	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108290449T>G	uc003kop.1	+	12	1733	c.1349T>G	c.(1348-1350)ATC>AGC	p.I450S	FER_uc011cvf.1_RNA|FER_uc011cvg.1_Missense_Mutation_p.I275S	NM_005246	NP_005237	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	450					intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		ATGATCTCCATCAGTGAGAAG	0.318													3	14	---	---	---	---	PASS
PJA2	9867	broad.mit.edu	37	5	108714608	108714608	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108714608G>A	uc003kos.3	-	4	800	c.580C>T	c.(580-582)CAG>TAG	p.Q194*		NM_014819	NP_055634	O43164	PJA2_HUMAN	praja 2, RING-H2 motif containing	194					long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		AATGATTCCTGGTATCTACTA	0.418													19	53	---	---	---	---	PASS
YTHDC2	64848	broad.mit.edu	37	5	112899572	112899572	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112899572A>G	uc003kqn.2	+	20	2642	c.2459A>G	c.(2458-2460)GAT>GGT	p.D820G		NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	820							ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		GATGCAATGGATACATGGGAA	0.363													23	55	---	---	---	---	PASS
AQPEP	206338	broad.mit.edu	37	5	115351326	115351326	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115351326T>C	uc003kro.2	+	18	2784	c.2620T>C	c.(2620-2622)TAT>CAT	p.Y874H	AQPEP_uc003krp.2_RNA|AQPEP_uc003krq.2_RNA|AQPEP_uc003krr.2_RNA|AQPEP_uc003krs.2_RNA	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin	874	Lumenal (Potential).				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0						CTTTTGCAGATATATGGAGTA	0.328													7	17	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127597470	127597470	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127597470G>T	uc003kuu.2	-	64	8761	c.8322C>A	c.(8320-8322)GAC>GAA	p.D2774E		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	2774					bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TCTGCCTGCTGTCTTTCTTAG	0.463													12	61	---	---	---	---	PASS
TGFBI	7045	broad.mit.edu	37	5	135388688	135388688	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135388688G>A	uc003lbf.3	+	8	1167	c.1006G>A	c.(1006-1008)GAG>AAG	p.E336K	TGFBI_uc003lbg.3_Missense_Mutation_p.E69K|TGFBI_uc003lbh.3_Missense_Mutation_p.E162K|TGFBI_uc011cyb.1_Missense_Mutation_p.E162K|TGFBI_uc010jed.2_Missense_Mutation_p.E69K	NM_000358	NP_000349	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	336	FAS1 2.				angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding			breast(3)|ovary(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CACGACACTGGAGGTGGGCTG	0.552													23	29	---	---	---	---	PASS
KDM3B	51780	broad.mit.edu	37	5	137761207	137761207	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137761207G>C	uc003lcy.1	+	17	4547	c.4347G>C	c.(4345-4347)AGG>AGC	p.R1449S	KDM3B_uc010jew.1_Missense_Mutation_p.R1105S|KDM3B_uc011cys.1_Missense_Mutation_p.R481S	NM_016604	NP_057688	Q7LBC6	KDM3B_HUMAN	jumonji domain containing 1B	1449					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11						TGAACTGCAGGAACTGTGCTA	0.443													23	66	---	---	---	---	PASS
PCDHGA6	56109	broad.mit.edu	37	5	140756102	140756102	+	Intron	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140756102G>T	uc003ljy.1	+						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Nonsense_Mutation_p.E818*	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAAGCGGGAAGAGTAATCTGA	0.458													18	35	---	---	---	---	PASS
CYFIP2	26999	broad.mit.edu	37	5	156731318	156731318	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156731318G>T	uc003lwq.2	+	10	877	c.739G>T	c.(739-741)GAT>TAT	p.D247Y	CYFIP2_uc011ddn.1_Missense_Mutation_p.D221Y|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Missense_Mutation_p.D247Y|CYFIP2_uc003lws.2_Missense_Mutation_p.D247Y|CYFIP2_uc003lwt.2_Missense_Mutation_p.D125Y|CYFIP2_uc011ddp.1_Intron|CYFIP2_uc003lwp.2_Missense_Mutation_p.D125Y	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2	247					apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CATCTGTGTGGATTACTACGA	0.532													20	48	---	---	---	---	PASS
ADRA1B	147	broad.mit.edu	37	5	159398990	159398990	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159398990A>C	uc003lxt.1	+	2	1227	c.1054A>C	c.(1054-1056)AGC>CGC	p.S352R		NM_000679	NP_000670	P35368	ADA1B_HUMAN	alpha-1B-adrenergic receptor	352	Cytoplasmic (By similarity).				cell proliferation|cell-cell signaling|G-protein signaling, coupled to cAMP nucleotide second messenger|intracellular protein kinase cascade	integral to plasma membrane	alpha1-adrenergic receptor activity			lung(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alfuzosin(DB00346)|Bethanidine(DB00217)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Guanfacine(DB01018)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Midodrine(DB00211)|Modafinil(DB00745)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Olanzapine(DB00334)|Phendimetrazine(DB01579)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)|Trazodone(DB00656)	CCCATGCTCCAGCAAGGAGTT	0.488													9	26	---	---	---	---	PASS
GABRG2	2566	broad.mit.edu	37	5	161495049	161495049	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161495049C>A	uc003lyz.3	+	1	402	c.44C>A	c.(43-45)TCG>TAG	p.S15*	GABRG2_uc010jjc.2_Nonsense_Mutation_p.S15*|GABRG2_uc003lyy.3_Nonsense_Mutation_p.S15*|GABRG2_uc011dej.1_5'UTR	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	15					gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		TCAGTCTACTCGACTCCTGTA	0.468													4	73	---	---	---	---	PASS
PANK3	79646	broad.mit.edu	37	5	167995926	167995926	+	Nonsense_Mutation	SNP	C	A	A	rs71603869		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167995926C>A	uc003lzz.1	-	2	406	c.106G>T	c.(106-108)GAG>TAG	p.E36*		NM_024594	NP_078870	Q9H999	PANK3_HUMAN	pantothenate kinase 3	36					coenzyme A biosynthetic process	cytoplasm|nucleus	ATP binding|pantothenate kinase activity			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		TGCTCTTCCTCTGCTGTGATA	0.408													5	75	---	---	---	---	PASS
RANBP17	64901	broad.mit.edu	37	5	170337973	170337973	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170337973G>A	uc003mba.2	+	7	611	c.595G>A	c.(595-597)GTG>ATG	p.V199M	RANBP17_uc003max.1_RNA|RANBP17_uc003may.1_RNA|RANBP17_uc003maz.1_RNA|RANBP17_uc010jjr.1_RNA|RANBP17_uc003maw.2_3'UTR|RANBP17_uc011dew.1_Missense_Mutation_p.V199M	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	199				V -> A (in Ref. 3; BAB55427).	mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTTTTTTCAGGTGTTTGCCAA	0.308			T	TRD@	ALL								16	48	---	---	---	---	PASS
HMP19	51617	broad.mit.edu	37	5	173534370	173534370	+	Silent	SNP	C	G	G	rs11557147		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173534370C>G	uc003mcx.2	+	5	523	c.378C>G	c.(376-378)CCC>CCG	p.P126P	HMP19_uc011dfh.1_Missense_Mutation_p.P30R	NM_015980	NP_057064	Q9Y328	NSG2_HUMAN	HMP19 protein	126	Lumenal (Potential).				dopamine receptor signaling pathway	cytoplasmic vesicle membrane|Golgi cisterna membrane|integral to membrane|multivesicular body membrane	dopamine receptor binding			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00925)|all_lung(126;0.0148)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CCCAGGACCCCAATTCCAGAA	0.592													17	37	---	---	---	---	PASS
SFXN1	94081	broad.mit.edu	37	5	174919163	174919163	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174919163C>G	uc003mda.2	+	2	195	c.57C>G	c.(55-57)AGC>AGG	p.S19R	SFXN1_uc003mdb.1_5'UTR	NM_022754	NP_073591	Q9H9B4	SFXN1_HUMAN	sideroflexin 1	19					iron ion homeostasis	integral to membrane	cation transmembrane transporter activity|protein binding			ovary(1)	1	all_cancers(89;0.00922)|Renal(175;0.000269)|Lung NSC(126;0.00515)|all_lung(126;0.00873)	Medulloblastoma(196;0.0399)|all_neural(177;0.0663)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GGGATCAAAGCACTTTCATTG	0.448													15	34	---	---	---	---	PASS
ZNF454	285676	broad.mit.edu	37	5	178391831	178391831	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178391831C>T	uc003mjo.1	+	5	697	c.426C>T	c.(424-426)CTC>CTT	p.L142L	ZNF454_uc010jkz.1_Silent_p.L142L	NM_182594	NP_872400	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	142					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		GAGTGGTACTCACTCACCCCA	0.488													12	36	---	---	---	---	PASS
CDKAL1	54901	broad.mit.edu	37	6	20546619	20546619	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20546619T>C	uc003ndc.1	+	3	212	c.38T>C	c.(37-39)ATC>ACC	p.I13T	CDKAL1_uc003ndd.1_Missense_Mutation_p.I13T|CDKAL1_uc003nde.1_5'UTR|CDKAL1_uc010jpo.1_Missense_Mutation_p.I13T|CDKAL1_uc003ndb.1_Missense_Mutation_p.I13T	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein	13					RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			CTGGATGACATCGAAGATATC	0.358													56	46	---	---	---	---	PASS
HIST1H2BM	8342	broad.mit.edu	37	6	27783015	27783015	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27783015C>G	uc003njo.2	+	1	194	c.194C>G	c.(193-195)TCC>TGC	p.S65C	HIST1H2AJ_uc003njn.1_5'Flank	NM_003521	NP_003512	Q99879	H2B1M_HUMAN	histone cluster 1, H2bm	65					nucleosome assembly	nucleosome|nucleus	DNA binding			large_intestine(1)	1						ATCATGAACTCCTTCGTCAAC	0.567													64	76	---	---	---	---	PASS
GPX5	2880	broad.mit.edu	37	6	28493833	28493833	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28493833C>A	uc003nll.2	+	1	45	c.43C>A	c.(43-45)CTA>ATA	p.L15I	GPX5_uc003nlm.2_Missense_Mutation_p.L15I|GPX5_uc003nln.2_5'Flank	NM_001509	NP_001500	O75715	GPX5_HUMAN	glutathione peroxidase 5 isoform 1 precursor	15					lipid metabolic process|response to oxidative stress	extracellular region	glutathione peroxidase activity			skin(1)	1					Glutathione(DB00143)	TCCCCTTCTCCTAGCCTGCTT	0.507													7	238	---	---	---	---	PASS
HLA-A	3105	broad.mit.edu	37	6	29911087	29911087	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29911087C>A	uc003nol.2	+	3	386	c.386C>A	c.(385-387)TCG>TAG	p.S129*	HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_RNA|HLA-A_uc010jrq.2_Nonsense_Mutation_p.S8*|HLA-A_uc003nok.2_Nonsense_Mutation_p.S8*|HLA-A_uc003non.2_Nonsense_Mutation_p.S129*|HLA-A_uc003noo.2_Nonsense_Mutation_p.S129*|HLA-A_uc010jrr.2_Nonsense_Mutation_p.S129*|HLA-A_uc003nom.2_Nonsense_Mutation_p.S8*|HLA-A_uc010klp.2_Nonsense_Mutation_p.S101*|HLA-A_uc011dmc.1_Nonsense_Mutation_p.S8*|HLA-A_uc011dmd.1_Nonsense_Mutation_p.S8*	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A	129	Extracellular (Potential).|Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						GACGTGGGGTCGGACGGGCGC	0.687									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			11	5	---	---	---	---	PASS
MUC21	394263	broad.mit.edu	37	6	30954993	30954993	+	Silent	SNP	C	T	T	rs55809174		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30954993C>T	uc003nsh.2	+	2	1292	c.1041C>T	c.(1039-1041)AAC>AAT	p.N347N	MUC21_uc003nsi.1_RNA	NM_001010909	NP_001010909	Q5SSG8	MUC21_HUMAN	mucin 21 precursor	347	Ser-rich.|28 X 15 AA approximate tandem repeats.|22.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(1)|skin(1)	2						CAGCCACCAACTCTGAGTCCA	0.627													6	157	---	---	---	---	PASS
APOM	55937	broad.mit.edu	37	6	31624395	31624395	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31624395C>A	uc003nvl.2	+	2	334	c.261C>A	c.(259-261)ACC>ACA	p.T87T	APOM_uc003nvk.2_Silent_p.T15T	NM_019101	NP_061974	O95445	APOM_HUMAN	apolipoprotein M	87					cholesterol efflux|high-density lipoprotein particle assembly|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|negative regulation of plasma lipoprotein particle oxidation|reverse cholesterol transport	discoidal high-density lipoprotein particle|integral to plasma membrane|low-density lipoprotein particle|spherical high-density lipoprotein particle|very-low-density lipoprotein particle	binding|lipid transporter activity				0						TTCGTGCTACCATCCGCATGT	0.542													5	75	---	---	---	---	PASS
HLA-DQA1	3117	broad.mit.edu	37	6	32610020	32610020	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32610020G>T	uc003obr.2	+	3	656	c.603G>T	c.(601-603)CTG>CTT	p.L201L	HLA-DQA1_uc003obs.2_RNA|HLA-DQA1_uc003obt.1_Silent_p.L201L|HLA-DQA1_uc003obu.2_5'Flank	NM_002122	NP_002113	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ	200	Ig-like C1-type.|Alpha-2.|Extracellular (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0						AGCCTCTTCTGAAACACTGGG	0.428													11	19	---	---	---	---	PASS
HLA-DQA2	3118	broad.mit.edu	37	6	32713839	32713839	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32713839G>T	uc003obx.2	+	3	661	c.603G>T	c.(601-603)CTG>CTT	p.L201L		NM_020056	NP_064440	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ	201	Alpha-2.|Extracellular (Potential).|Ig-like C1-type.				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AGCCTCTTCTGAAACACTGGG	0.498													16	104	---	---	---	---	PASS
HLA-DOB	3112	broad.mit.edu	37	6	32781028	32781028	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32781028C>A	uc003oca.2	-	6	884	c.787G>T	c.(787-789)GTC>TTC	p.V263F		NM_002120	NP_002111	P13765	DOB_HUMAN	major histocompatibility complex, class II, DO	263	Cytoplasmic (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endosome membrane|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1						GCTCTTGAGACCTGGAGGCAC	0.572													42	39	---	---	---	---	PASS
PSMB8	5696	broad.mit.edu	37	6	32808780	32808780	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32808780C>A	uc003oce.2	-	6	830	c.787G>T	c.(787-789)GAT>TAT	p.D263Y	TAP2_uc011dqf.1_5'Flank|TAP2_uc003ocb.1_5'Flank|TAP2_uc003occ.2_5'Flank|TAP2_uc003ocd.2_5'Flank|PSMB8_uc003ocf.2_Missense_Mutation_p.D259Y	NM_148919	NP_683720	P28062	PSB8_HUMAN	proteasome beta 8 subunit isoform E2 proprotein	263					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|type I interferon-mediated signaling pathway|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity			skin(1)	1						TCACTGACATCTGTACTTTCT	0.512													30	29	---	---	---	---	PASS
PGK2	5232	broad.mit.edu	37	6	49754273	49754273	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49754273C>A	uc003ozu.2	-	1	735	c.628G>T	c.(628-630)GCT>TCT	p.A210S		NM_138733	NP_620061	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	210					glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			ovary(1)	1	Lung NSC(77;0.0402)					CCAAGTATAGCCAGAAAGGGT	0.433													18	51	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56334983	56334983	+	Silent	SNP	A	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56334983A>C	uc003pdf.2	-	90	16090	c.16062T>G	c.(16060-16062)CTT>CTG	p.L5354L	DST_uc003pcz.3_Silent_p.L5176L|DST_uc011dxj.1_Silent_p.L5205L|DST_uc011dxk.1_Silent_p.L5216L|DST_uc003pcy.3_Silent_p.L4850L|DST_uc003pcw.3_5'Flank|DST_uc003pcx.3_5'Flank	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	7262	EF-hand 2.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TATTTGGGTGAAGGGCTGCTA	0.413													8	17	---	---	---	---	PASS
EYS	346007	broad.mit.edu	37	6	66200483	66200483	+	Intron	SNP	T	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66200483T>G	uc011dxu.1	-						EYS_uc003peq.2_Intron|EYS_uc003per.1_Intron	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						TATGCATTTTTTACCTGAAAA	0.274													5	11	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69653726	69653726	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69653726C>T	uc003pev.3	+	6	1483	c.1035C>T	c.(1033-1035)CAC>CAT	p.H345H	BAI3_uc010kak.2_Silent_p.H345H	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	345	Extracellular (Potential).|TSP type-1 2.				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				TTACAGTACACGGAGTATGGG	0.373													14	56	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72957822	72957822	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72957822C>T	uc003pga.2	+	12	2310	c.2233C>T	c.(2233-2235)CAA>TAA	p.Q745*	RIMS1_uc011dyb.1_Nonsense_Mutation_p.Q371*|RIMS1_uc003pgc.2_Nonsense_Mutation_p.Q371*|RIMS1_uc010kaq.2_Nonsense_Mutation_p.Q219*|RIMS1_uc011dyc.1_Nonsense_Mutation_p.Q219*|RIMS1_uc010kar.2_Nonsense_Mutation_p.Q138*|RIMS1_uc011dyd.1_Nonsense_Mutation_p.Q204*|RIMS1_uc003pgf.2_5'Flank|RIMS1_uc003pgg.2_5'Flank|RIMS1_uc003pgi.2_5'Flank|RIMS1_uc003pgh.2_5'Flank|RIMS1_uc003pgd.2_5'Flank|RIMS1_uc003pge.2_5'Flank|RIMS1_uc003pgb.3_Nonsense_Mutation_p.Q371*|RIMS1_uc010kas.1_Nonsense_Mutation_p.Q204*	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	745	C2 1.				calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CTTACCAGGGCAACTTTCTGT	0.408													24	47	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79672829	79672829	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79672829G>T	uc003pir.2	-	30	3746	c.3520C>A	c.(3520-3522)CAG>AAG	p.Q1174K	PHIP_uc003piq.2_Missense_Mutation_p.Q198K|PHIP_uc011dyp.1_Missense_Mutation_p.Q1173K|PHIP_uc003pio.3_Missense_Mutation_p.Q60K	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1174					insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		GTCATCAACTGGTTTATTCCT	0.378													6	156	---	---	---	---	PASS
DOPEY1	23033	broad.mit.edu	37	6	83861601	83861601	+	Splice_Site	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83861601G>T	uc003pjs.1	+	29	6165	c.5905_splice	c.e29-1	p.D1969_splice	DOPEY1_uc011dyy.1_Splice_Site_p.D1960_splice|DOPEY1_uc010kbl.1_Splice_Site_p.D1960_splice|DOPEY1_uc003pjt.2_Splice_Site	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1						protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TATTTTTTTAGGATGTAACTC	0.353													5	61	---	---	---	---	PASS
ORC3L	23595	broad.mit.edu	37	6	88362927	88362927	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88362927G>C	uc003pmh.2	+	14	1520	c.1476G>C	c.(1474-1476)AAG>AAC	p.K492N	ORC3L_uc011dzl.1_Missense_Mutation_p.K492N|ORC3L_uc011dzm.1_Missense_Mutation_p.K492N|ORC3L_uc011dzn.1_RNA|ORC3L_uc003pmg.2_Missense_Mutation_p.K492N|ORC3L_uc003pmi.2_Missense_Mutation_p.K454N|ORC3L_uc011dzo.1_Missense_Mutation_p.K349N|ORC3L_uc011dzp.1_Missense_Mutation_p.K349N	NM_012381	NP_036513	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3 isoform 2	492					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)		GCACAGCTAAGAGAATAGAGG	0.408													16	72	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90387321	90387321	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90387321G>T	uc003pnn.1	-	76	12623	c.12507C>A	c.(12505-12507)TCC>TCA	p.S4169S		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	4169					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGCTGACGATGGACAATGCGC	0.438													5	57	---	---	---	---	PASS
PRDM1	639	broad.mit.edu	37	6	106547368	106547368	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106547368G>C	uc003prd.2	+	4	839	c.605G>C	c.(604-606)CGG>CCG	p.R202P	PRDM1_uc003pre.2_Missense_Mutation_p.R68P	NM_001198	NP_001189	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain isoform	202	SET.				negative regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(54)|ovary(1)|skin(1)	56	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		TGGTATTGTCGGGACTTTGCA	0.453			D|N|Mis|F|S		DLBCL								13	31	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152746534	152746534	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152746534G>T	uc010kiw.2	-	39	5851	c.5249C>A	c.(5248-5250)CCA>CAA	p.P1750Q	SYNE1_uc003qot.3_Missense_Mutation_p.P1757Q|SYNE1_uc003qou.3_Missense_Mutation_p.P1750Q|SYNE1_uc010kjb.1_Missense_Mutation_p.P1733Q	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1750	Spectrin 2.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AATGATCTGTGGTAAATCTCT	0.313										HNSCC(10;0.0054)			4	41	---	---	---	---	PASS
MAP3K4	4216	broad.mit.edu	37	6	161507647	161507647	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161507647C>T	uc003qtn.2	+	9	2646	c.2504C>T	c.(2503-2505)TCA>TTA	p.S835L	MAP3K4_uc010kkc.1_Missense_Mutation_p.S835L|MAP3K4_uc003qto.2_Missense_Mutation_p.S835L|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.S288L	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	835					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TTCAGGCTTTCAGCCCCAGTT	0.358													13	29	---	---	---	---	PASS
TNRC18	84629	broad.mit.edu	37	7	5352184	5352184	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5352184C>A	uc003soi.3	-	27	8687	c.8338G>T	c.(8338-8340)GCC>TCC	p.A2780S		NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2780							DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGCAGGAAGGCGGCGATCTTG	0.711													4	13	---	---	---	---	PASS
MIOS	54468	broad.mit.edu	37	7	7636041	7636041	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7636041C>A	uc003srf.2	+	11	2658	c.2350C>A	c.(2350-2352)CGA>AGA	p.R784R	MIOS_uc003srg.2_Silent_p.R319R|MIOS_uc010ktq.2_Silent_p.R179R	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog	784											0						ACCACTTCCTCGATGTGCGCT	0.413													4	85	---	---	---	---	PASS
HOXA13	3209	broad.mit.edu	37	7	27237878	27237878	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27237878C>A	uc003szb.1	-	2	1135	c.1106G>T	c.(1105-1107)TGG>TTG	p.W369L	uc003szc.1_5'Flank	NM_000522	NP_000513	P31271	HXA13_HUMAN	homeobox A13	369	Homeobox.				skeletal system development	nucleus	sequence-specific DNA binding			breast(1)	1						GTTCTGGAACCAGATTGTGAC	0.423			T	NUP98	AML								6	93	---	---	---	---	PASS
CCM2	83605	broad.mit.edu	37	7	45115438	45115438	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45115438G>T	uc003tmo.2	+	10	1263	c.1117G>T	c.(1117-1119)GGC>TGC	p.G373C	CCM2_uc003tmn.2_RNA|CCM2_uc003tmp.2_Missense_Mutation_p.G315C|CCM2_uc003tmq.2_RNA|CCM2_uc003tmr.2_Missense_Mutation_p.G282C|CCM2_uc003tms.2_Missense_Mutation_p.G394C	NM_031443	NP_113631	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2 isoform 2	373					endothelial tube morphogenesis|integrin-mediated signaling pathway|stress-activated MAPK cascade|vasculogenesis	cytoplasm	protein binding				0						GGAGACCATTGGCGTGAAGGA	0.602									Familial_Cerebral_Cavernous_Angioma				4	26	---	---	---	---	PASS
CLIP2	7461	broad.mit.edu	37	7	73803542	73803542	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73803542C>T	uc003uam.2	+	13	3000	c.2673C>T	c.(2671-2673)GCC>GCT	p.A891A	CLIP2_uc003uan.2_Silent_p.A856A	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	891	Potential.					microtubule associated complex				skin(3)	3						CCCATGACGCCTCGGGCCAGC	0.677													3	15	---	---	---	---	PASS
GTF2IRD1	9569	broad.mit.edu	37	7	73929890	73929890	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73929890C>T	uc003uaq.2	+	4	778	c.385C>T	c.(385-387)CGG>TGG	p.R129W	GTF2IRD1_uc010lbq.2_Missense_Mutation_p.R161W|GTF2IRD1_uc003uap.2_Missense_Mutation_p.R129W|GTF2IRD1_uc003uar.1_Missense_Mutation_p.R129W	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1	129	GTF2I-like 1.					nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						GTACCTTCTGCGGAAGATGGT	0.602													8	23	---	---	---	---	PASS
DTX2	113878	broad.mit.edu	37	7	76112361	76112361	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76112361G>C	uc003uff.3	+	5	1361	c.805G>C	c.(805-807)GCA>CCA	p.A269P	DTX2_uc011kgk.1_Missense_Mutation_p.A178P|DTX2_uc003ufg.3_Missense_Mutation_p.A269P|DTX2_uc003ufh.3_Missense_Mutation_p.A269P|DTX2_uc003ufj.3_Missense_Mutation_p.A269P	NM_020892	NP_065943	Q86UW9	DTX2_HUMAN	deltex 2 isoform a	269					Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding			ovary(1)|skin(1)	2						CGCCTGGGGCGCAGCTCCTCC	0.672													14	43	---	---	---	---	PASS
HGF	3082	broad.mit.edu	37	7	81388038	81388038	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81388038C>T	uc003uhl.2	-	3	502	c.337G>A	c.(337-339)GGC>AGC	p.G113S	HGF_uc003uhm.2_Missense_Mutation_p.G113S|HGF_uc003uhn.1_Missense_Mutation_p.G113S|HGF_uc003uho.1_Missense_Mutation_p.G113S|HGF_uc003uhp.2_Missense_Mutation_p.G113S	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	113	PAN.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						AATTCATGGCCAAATTCTTTT	0.323													10	43	---	---	---	---	PASS
CASD1	64921	broad.mit.edu	37	7	94178901	94178901	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94178901A>T	uc003uni.3	+	14	1997	c.1770A>T	c.(1768-1770)AAA>AAT	p.K590N	CASD1_uc003unj.3_Missense_Mutation_p.K590N	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor	590						integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TTGAACTGAAAGGGAATGTAT	0.333													27	110	---	---	---	---	PASS
LMTK2	22853	broad.mit.edu	37	7	97800947	97800947	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97800947C>T	uc003upd.1	+	7	1045	c.752C>T	c.(751-753)GCG>GTG	p.A251V		NM_014916	NP_055731	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2 precursor	251	Protein kinase.				early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					GAGGTCGCCGCGGGGCTGGCC	0.672													20	22	---	---	---	---	PASS
TFEC	22797	broad.mit.edu	37	7	115594691	115594691	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115594691C>T	uc003vhj.1	-	5	572	c.388G>A	c.(388-390)GAC>AAC	p.D130N	TFEC_uc003vhk.1_Missense_Mutation_p.D101N|TFEC_uc003vhl.3_Missense_Mutation_p.D101N|TFEC_uc011kmw.1_Missense_Mutation_p.D220N	NM_012252	NP_036384	O14948	TFEC_HUMAN	transcription factor EC isoform a	130	Basic motif.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)			GCTCTAGTGTCAGTTTCTGAT	0.318													6	34	---	---	---	---	PASS
TSPAN33	340348	broad.mit.edu	37	7	128806698	128806698	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128806698G>T	uc003vop.1	+	6	768	c.539G>T	c.(538-540)CGA>CTA	p.R180L	TSPAN33_uc003voq.1_Missense_Mutation_p.R12L	NM_178562	NP_848657	Q86UF1	TSN33_HUMAN	tetraspanin 33	180	Extracellular (Potential).					integral to membrane				ovary(1)	1						AACCCCAGTCGAGAGCGCTGC	0.527													7	283	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131883284	131883284	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131883284C>A	uc003vra.3	-	13	2927	c.2698G>T	c.(2698-2700)GAG>TAG	p.E900*		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	900	IPT/TIG 1.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						GGGCTGCACTCCACGCCAGCA	0.577													25	30	---	---	---	---	PASS
TTC26	79989	broad.mit.edu	37	7	138819449	138819449	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138819449G>A	uc003vus.2	+	2	166	c.52G>A	c.(52-54)GAC>AAC	p.D18N	TTC26_uc003vuq.2_Missense_Mutation_p.D18N|TTC26_uc011kqm.1_Missense_Mutation_p.D18N|TTC26_uc003vur.3_Missense_Mutation_p.D18N|TTC26_uc011kqn.1_Missense_Mutation_p.D18N|TTC26_uc011kqo.1_Missense_Mutation_p.D18N|TTC26_uc011kqp.1_5'UTR|TTC26_uc003vut.2_5'UTR|TTC26_uc011kqq.1_Missense_Mutation_p.D18N	NM_024926	NP_079202	A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26 isoform 1	18							binding			ovary(1)	1						ACAGCACACTGACAAAAGAAA	0.413													29	41	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146471480	146471480	+	Intron	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146471480C>A	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GGAGGTAAGCCAAATTTTGAT	0.393										HNSCC(39;0.1)			7	30	---	---	---	---	PASS
ACTR3B	57180	broad.mit.edu	37	7	152517413	152517413	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152517413C>G	uc003wle.1	+	7	687	c.570C>G	c.(568-570)ATC>ATG	p.I190M	ACTR3B_uc003wlf.1_Missense_Mutation_p.I190M|ACTR3B_uc003wlg.1_Missense_Mutation_p.I102M|ACTR3B_uc011kvp.1_Missense_Mutation_p.I102M	NM_020445	NP_065178	Q9P1U1	ARP3B_HUMAN	actin-related protein 3-beta isoform 1	190					regulation of actin filament polymerization	cell projection|cytoplasm|cytoskeleton	actin binding|ATP binding				0		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		GAAGCTGCATCAAACACATCC	0.502													14	24	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3216692	3216692	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3216692G>T	uc011kwk.1	-	21	3679	c.3289C>A	c.(3289-3291)CCT>ACT	p.P1097T	CSMD1_uc011kwj.1_Missense_Mutation_p.P489T|CSMD1_uc003wqe.2_Missense_Mutation_p.P253T	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1097	Sushi 6.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTTGGCAGAGGTGCACTCCAC	0.587													16	32	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3889546	3889546	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3889546C>G	uc011kwk.1	-	4	881	c.491G>C	c.(490-492)GGA>GCA	p.G164A		NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	164	Extracellular (Potential).|Sushi 1.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GATTTTGTCTCCTATGTTGAA	0.488													15	27	---	---	---	---	PASS
LETM2	137994	broad.mit.edu	37	8	38257911	38257911	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38257911C>A	uc003xlm.1	+	5	797	c.626C>A	c.(625-627)TCA>TAA	p.S209*	LETM2_uc011lbn.1_Nonsense_Mutation_p.S53*|LETM2_uc003xll.1_Nonsense_Mutation_p.S161*|LETM2_uc003xln.1_Nonsense_Mutation_p.S53*|LETM2_uc003xlo.1_Nonsense_Mutation_p.S53*	NM_144652	NP_653253	Q2VYF4	LETM2_HUMAN	leucine zipper-EF-hand containing transmembrane	256	LETM1.|Mitochondrial matrix (Potential).					integral to membrane|mitochondrial inner membrane					0	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)			ACACAGCTCTCATCCTACGTG	0.453													11	466	---	---	---	---	PASS
NSMAF	8439	broad.mit.edu	37	8	59514692	59514692	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59514692C>A	uc003xtt.2	-	14	1264	c.1050G>T	c.(1048-1050)TTG>TTT	p.L350F	NSMAF_uc011lee.1_Missense_Mutation_p.L381F|NSMAF_uc003xtu.2_Missense_Mutation_p.L350F	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation	350	BEACH.				ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				CTGGATTTGACAAATCTATAA	0.368													23	62	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61765798	61765798	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61765798G>A	uc003xue.2	+	31	6991	c.6514G>A	c.(6514-6516)GAA>AAA	p.E2172K		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2172	Glu-rich.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GGAACAAGCCGAAGGCAAAGT	0.498													7	30	---	---	---	---	PASS
C8orf34	116328	broad.mit.edu	37	8	69688634	69688634	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69688634G>T	uc010lyz.2	+	11	1196	c.1147G>T	c.(1147-1149)GGA>TGA	p.G383*	C8orf34_uc003xyb.2_Nonsense_Mutation_p.G358*	NM_052958	NP_443190	Q49A92	CH034_HUMAN	hypothetical protein LOC116328	383					signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			TTACTTCTAGGGAGAAGCCTC	0.398													5	80	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87660080	87660080	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87660080G>T	uc003ydx.2	-	8	985	c.939C>A	c.(937-939)TGC>TGA	p.C313*	CNGB3_uc010maj.2_Nonsense_Mutation_p.C175*	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	313	Helical; Name=H3; (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						AGAAGAGGTAGCAAATATCAA	0.313													28	45	---	---	---	---	PASS
SLC26A7	115111	broad.mit.edu	37	8	92330528	92330528	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92330528A>G	uc003yex.2	+	6	840	c.562A>G	c.(562-564)ACC>GCC	p.T188A	SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Missense_Mutation_p.T188A|SLC26A7_uc003yfa.2_Missense_Mutation_p.T188A	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a	188	Extracellular (Potential).					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			TGGGGCTGCCACCCATGTGGT	0.468													39	64	---	---	---	---	PASS
LRP12	29967	broad.mit.edu	37	8	105509802	105509802	+	Missense_Mutation	SNP	G	C	C	rs138841847		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105509802G>C	uc003yma.2	-	5	1073	c.978C>G	c.(976-978)CAC>CAG	p.H326Q	LRP12_uc003ymb.2_Missense_Mutation_p.H307Q|LRP12_uc003ylz.2_5'Flank	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	low density lipoprotein-related protein 12	326	Extracellular (Potential).|CUB 2.				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GCAAAAGCTTGTGTGGATTCT	0.373													26	42	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113237101	113237101	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113237101C>T	uc003ynu.2	-	71	11182	c.11023G>A	c.(11023-11025)GCA>ACA	p.A3675T	CSMD3_uc003yns.2_Missense_Mutation_p.A2877T|CSMD3_uc003ynt.2_Missense_Mutation_p.A3635T|CSMD3_uc011lhx.1_Missense_Mutation_p.A3506T	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3675	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TCAAAAGCTGCTTGGCCATTG	0.408										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			27	129	---	---	---	---	PASS
DENND3	22898	broad.mit.edu	37	8	142161912	142161912	+	Silent	SNP	C	A	A	rs142459324	byFrequency	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142161912C>A	uc003yvy.2	+	7	1088	c.810C>A	c.(808-810)CTC>CTA	p.L270L	DENND3_uc010mep.2_Silent_p.L283L	NM_014957	NP_055772	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	270	DENN.									ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			GCTGCCATCTCGACCACTTCG	0.552													5	123	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144998324	144998324	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144998324C>A	uc003zaf.1	-	31	6354	c.6184G>T	c.(6184-6186)GAG>TAG	p.E2062*	PLEC_uc003zab.1_Nonsense_Mutation_p.E1925*|PLEC_uc003zac.1_Nonsense_Mutation_p.E1929*|PLEC_uc003zad.2_Nonsense_Mutation_p.E1925*|PLEC_uc003zae.1_Nonsense_Mutation_p.E1893*|PLEC_uc003zag.1_Nonsense_Mutation_p.E1903*|PLEC_uc003zah.2_Nonsense_Mutation_p.E1911*|PLEC_uc003zaj.2_Nonsense_Mutation_p.E1952*	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2062	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						AGGATCTCCTCCTCCACCTGC	0.701													5	5	---	---	---	---	PASS
SLC39A4	55630	broad.mit.edu	37	8	145638176	145638176	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145638176G>A	uc003zcq.2	-	11	1882	c.1782C>T	c.(1780-1782)ACC>ACT	p.T594T	SLC39A4_uc003zcm.1_Silent_p.T96T|SLC39A4_uc003zcn.2_Silent_p.T96T|SLC39A4_uc003zco.2_Silent_p.T318T|SLC39A4_uc003zcp.2_Silent_p.T569T	NM_130849	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter),	594	Helical; Name=5; (Potential).					cytoplasmic membrane-bounded vesicle|integral to membrane|recycling endosome membrane	zinc ion transmembrane transporter activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			GGAACAGGCCGGTGGCCACTG	0.672													7	17	---	---	---	---	PASS
IFNA6	3443	broad.mit.edu	37	9	21350809	21350809	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21350809C>T	uc011lni.1	-	1	78	c.78G>A	c.(76-78)CTG>CTA	p.L26L		NM_021002	NP_066282	P05013	IFNA6_HUMAN	interferon, alpha 6 precursor	26					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		GGGTCTGAGGCAGATCACAGT	0.512													25	45	---	---	---	---	PASS
LINGO2	158038	broad.mit.edu	37	9	27949203	27949203	+	Silent	SNP	A	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27949203A>T	uc003zqu.1	-	2	1661	c.1467T>A	c.(1465-1467)GCT>GCA	p.A489A	LINGO2_uc010mjf.1_Silent_p.A489A|LINGO2_uc003zqv.1_Silent_p.A489A	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	489	Ig-like C2-type.|Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		TATCATTCCCAGCAGCATTGC	0.498													23	33	---	---	---	---	PASS
ACO1	48	broad.mit.edu	37	9	32448965	32448965	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32448965C>G	uc003zqw.3	+	20	2597	c.2442C>G	c.(2440-2442)ATC>ATG	p.I814M	ACO1_uc003zqx.3_Missense_Mutation_p.I814M|ACO1_uc003zqy.3_RNA	NM_002197	NP_002188	P21399	ACOC_HUMAN	aconitase 1	814					citrate metabolic process|response to iron(II) ion|tricarboxylic acid cycle	cytosol|endoplasmic reticulum|Golgi apparatus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron-responsive element binding|isocitrate hydro-lyase (cis-aconitate-forming) activity|metal ion binding|protein binding				0			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		TGGGTGTGATCCCACTTGAAT	0.483													18	32	---	---	---	---	PASS
DCAF10	79269	broad.mit.edu	37	9	37861493	37861493	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37861493G>A	uc004aao.2	+	7	1742	c.1668G>A	c.(1666-1668)CAG>CAA	p.Q556Q	DCAF10_uc010mlz.2_Silent_p.Q383Q|DCAF10_uc004aap.2_Silent_p.Q207Q	NM_024345	NP_077321	Q5QP82	DCA10_HUMAN	WD repeat domain 32	556	WD 7.					CUL4 RING ubiquitin ligase complex				central_nervous_system(1)	1						CTTTGTATCAGCCAAAGTTTT	0.383													4	80	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73225606	73225606	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73225606C>A	uc004aid.2	-	18	2794	c.2550G>T	c.(2548-2550)CAG>CAT	p.Q850H	TRPM3_uc004ahu.2_Missense_Mutation_p.Q680H|TRPM3_uc004ahv.2_Missense_Mutation_p.Q652H|TRPM3_uc004ahw.2_Missense_Mutation_p.Q722H|TRPM3_uc004ahx.2_Missense_Mutation_p.Q709H|TRPM3_uc004ahy.2_Missense_Mutation_p.Q712H|TRPM3_uc004ahz.2_Missense_Mutation_p.Q699H|TRPM3_uc004aia.2_Missense_Mutation_p.Q697H|TRPM3_uc004aib.2_Missense_Mutation_p.Q687H|TRPM3_uc004aic.2_Missense_Mutation_p.Q850H	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	875	Extracellular (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						GGTGCTTGCTCTGAACTTCCT	0.428													24	45	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79322116	79322116	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79322116C>A	uc010mpk.2	-	8	5198	c.5074G>T	c.(5074-5076)GTC>TTC	p.V1692F		NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	1692					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						TCACCACCGACACTGTCATCA	0.463													13	39	---	---	---	---	PASS
TLE4	7091	broad.mit.edu	37	9	82320816	82320816	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82320816G>T	uc004ald.2	+	10	1570	c.721G>T	c.(721-723)GAG>TAG	p.E241*	TLE4_uc004alc.2_Nonsense_Mutation_p.E248*|TLE4_uc010mpr.2_Nonsense_Mutation_p.E127*|TLE4_uc004ale.2_5'UTR|TLE4_uc011lsq.1_Nonsense_Mutation_p.E216*|TLE4_uc010mps.2_Intron|TLE4_uc004alf.2_Nonsense_Mutation_p.E187*	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4	Error:Variant_position_missing_in_O60756_after_alignment										lung(2)|ovary(1)|breast(1)|skin(1)	5						CAGCGATGGTGAGAAAAGTGA	0.413													5	112	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101810117	101810117	+	Missense_Mutation	SNP	G	T	T	rs138040776		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101810117G>T	uc004azb.1	+	27	2935	c.2729G>T	c.(2728-2730)CGA>CTA	p.R910L		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	910	Triple-helical region 5 (COL5).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				CTTCCCGGGCGACCTGTAGGT	0.542													40	51	---	---	---	---	PASS
EPB41L4B	54566	broad.mit.edu	37	9	111938886	111938886	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111938886C>T	uc004bdz.1	-	25	2873	c.2578G>A	c.(2578-2580)GTC>ATC	p.V860I		NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	860						cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3						ACTGTGGAGACGGTCTCTGTC	0.562													9	26	---	---	---	---	PASS
ZNF883	169834	broad.mit.edu	37	9	115760433	115760433	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115760433A>G	uc011lwy.1	-	5	1346	c.107T>C	c.(106-108)ATT>ACT	p.I36T		NM_001101338	NP_001094808	P0CG24	ZN883_HUMAN	hypothetical protein LOC169834	36					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTTTTCTCCAATATGTGTTTT	0.383													22	31	---	---	---	---	PASS
AKNA	80709	broad.mit.edu	37	9	117120298	117120298	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117120298G>A	uc004biq.3	-	11	2777	c.2642C>T	c.(2641-2643)GCA>GTA	p.A881V	AKNA_uc004bin.3_Missense_Mutation_p.A128V|AKNA_uc004bio.3_Missense_Mutation_p.A341V|AKNA_uc004bip.3_Missense_Mutation_p.A800V|AKNA_uc004bir.3_Missense_Mutation_p.A881V|AKNA_uc004bis.3_Missense_Mutation_p.A881V|AKNA_uc010mve.2_Missense_Mutation_p.A762V	NM_030767	NP_110394	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	881					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(2)	6						TTGGTGGGATGCTGCGGACTT	0.657													11	22	---	---	---	---	PASS
DBC1	1620	broad.mit.edu	37	9	121976190	121976190	+	Intron	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121976190T>A	uc004bkc.2	-						DBC1_uc004bkd.2_Missense_Mutation_p.E310V	NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor						cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						TGAGTGAGACTCTCTACCTGA	0.418													37	57	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137714873	137714873	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137714873C>A	uc004cfe.2	+	60	5020	c.4638C>A	c.(4636-4638)GGC>GGA	p.G1546G	uc004cff.2_Intron	NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	1546	Triple-helical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GTGCTAAGGGCTCCTCGGTAA	0.632													6	18	---	---	---	---	PASS
ZMYND11	10771	broad.mit.edu	37	10	293350	293350	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:293350C>G	uc010pzt.1	+	12	1599	c.1171C>G	c.(1171-1173)CAA>GAA	p.Q391E	ZMYND11_uc001ifk.2_Missense_Mutation_p.Q390E|ZMYND11_uc010pzu.1_Missense_Mutation_p.Q391E|ZMYND11_uc010pzv.1_Missense_Mutation_p.Q336E|ZMYND11_uc010pzw.1_Missense_Mutation_p.Q306E|ZMYND11_uc001ifm.2_Missense_Mutation_p.Q337E|ZMYND11_uc010pzx.1_Missense_Mutation_p.Q391E|ZMYND11_uc001ifn.2_Missense_Mutation_p.Q337E|ZMYND11_uc009xhg.2_Missense_Mutation_p.Q374E|ZMYND11_uc009xhh.2_Missense_Mutation_p.Q265E|ZMYND11_uc010pzy.1_Missense_Mutation_p.Q243E	NM_006624	NP_006615	Q15326	ZMY11_HUMAN	zinc finger, MYND domain containing 11 isoform	351					cell cycle|cell proliferation|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		AAAGGTCACTCAAGAACCAAG	0.428													15	39	---	---	---	---	PASS
GDI2	2665	broad.mit.edu	37	10	5827861	5827861	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5827861C>T	uc001iil.3	-	5	832	c.541G>A	c.(541-543)GTT>ATT	p.V181I	GDI2_uc001iim.3_Missense_Mutation_p.V136I|GDI2_uc009xid.2_Missense_Mutation_p.V185I	NM_001494	NP_001485	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2 isoform 1	181					protein transport|small GTPase mediated signal transduction	cell surface|cytosol|membrane	protein binding|Rab GDP-dissociation inhibitor activity				0						AAATCTATAACGTCTTGACCC	0.333													14	57	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16949629	16949629	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16949629C>T	uc001ioo.2	-	49	7635	c.7583G>A	c.(7582-7584)AGT>AAT	p.S2528N	CUBN_uc009xjq.1_Intron|CUBN_uc009xjr.1_Intron	NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	2528	CUB 18.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATTCACACTACTACACAGTTT	0.408													28	46	---	---	---	---	PASS
ACBD5	91452	broad.mit.edu	37	10	27497281	27497281	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27497281C>A	uc010qdp.1	-	10	1489	c.1298G>T	c.(1297-1299)CGA>CTA	p.R433L	ACBD5_uc010qdm.1_Missense_Mutation_p.R431L|ACBD5_uc010qdn.1_Missense_Mutation_p.R324L|ACBD5_uc010qdo.1_Missense_Mutation_p.R256L|ACBD5_uc001ito.2_Missense_Mutation_p.R398L|ACBD5_uc001itp.2_Missense_Mutation_p.R324L|ACBD5_uc001itq.2_Missense_Mutation_p.R324L|ACBD5_uc001itr.1_Missense_Mutation_p.R222L	NM_145698	NP_663736	Q5T8D3	ACBD5_HUMAN	acyl-Coenzyme A binding domain containing 5	442					transport	integral to membrane|peroxisomal membrane	fatty-acyl-CoA binding				0						GAGGCTGCCTCGGGACCCTCT	0.572													4	60	---	---	---	---	PASS
KIAA1462	57608	broad.mit.edu	37	10	30315269	30315269	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30315269G>A	uc001iux.2	-	2	3867	c.3808C>T	c.(3808-3810)CGG>TGG	p.R1270W	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Missense_Mutation_p.R1132W|KIAA1462_uc009xle.1_Missense_Mutation_p.R1270W	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	1270										ovary(4)	4						ACTCTCATCCGTGACACTGAG	0.577													9	38	---	---	---	---	PASS
PARD3	56288	broad.mit.edu	37	10	34408612	34408612	+	Missense_Mutation	SNP	C	G	G	rs12359558		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34408612C>G	uc010qej.1	-	24	3606	c.3606G>C	c.(3604-3606)CAG>CAC	p.Q1202H	PARD3_uc010qek.1_Missense_Mutation_p.Q1199H|PARD3_uc010qel.1_Missense_Mutation_p.Q1165H|PARD3_uc010qem.1_Missense_Mutation_p.Q1186H|PARD3_uc010qen.1_Missense_Mutation_p.Q1156H|PARD3_uc010qeo.1_Missense_Mutation_p.Q1119H|PARD3_uc010qep.1_Missense_Mutation_p.Q1112H|PARD3_uc010qeq.1_Missense_Mutation_p.Q1090H	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog	1202	Potential.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				GCCGCTGCATCTGCACCTCCA	0.637													4	5	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37440993	37440993	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37440993A>T	uc001iza.1	+	12	1582	c.1483A>T	c.(1483-1485)ATG>TTG	p.M495L		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	551						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						TATAGATCCGATGTTCCCACC	0.294													11	36	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37442554	37442554	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37442554C>G	uc001iza.1	+	13	1693	c.1594C>G	c.(1594-1596)CAA>GAA	p.Q532E		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	588						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						GGCTACACATCAAAAAGAAAT	0.313													21	163	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37478449	37478449	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37478449C>G	uc001iza.1	+	25	2407	c.2308C>G	c.(2308-2310)CAA>GAA	p.Q770E		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	826						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						GGCTACGCATCAAAAAGAAAT	0.299													7	13	---	---	---	---	PASS
WDFY4	57705	broad.mit.edu	37	10	50118308	50118308	+	Intron	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50118308G>A	uc001jha.3	+						LRRC18_uc001jhd.2_Intron	NM_020945	NP_065996	Q6ZS81	WDFY4_HUMAN	WDFY family member 4							integral to membrane	binding				0						CGTATTCTGGGGATGGAGACA	0.507													20	45	---	---	---	---	PASS
CDK1	983	broad.mit.edu	37	10	62544477	62544477	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62544477G>C	uc001jld.2	+	3	186	c.52G>C	c.(52-54)GTG>CTG	p.V18L	CDK1_uc010qii.1_Missense_Mutation_p.V18L|CDK1_uc001jle.2_RNA|CDK1_uc001jlf.2_Missense_Mutation_p.V18L|CDK1_uc001jlg.2_Missense_Mutation_p.V18L	NM_001786	NP_001777	P06493	CDK1_HUMAN	cell division cycle 2 isoform 1	18	ATP (By similarity).|Protein kinase.				activation of MAPK activity|activation of MAPKK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|axon guidance|cell division|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|mitosis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein localization to kinetochore|Ras protein signal transduction|regulation of transcription involved in G1/S phase of mitotic cell cycle|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|midbody|nucleoplasm|spindle microtubule	ATP binding|cyclin-dependent protein kinase activity|RNA polymerase II carboxy-terminal domain kinase activity			ovary(1)	1						CTATGGAGTTGTGTATAAGGG	0.338													26	67	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68280473	68280473	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68280473G>T	uc009xpn.1	-	11	1556	c.1433C>A	c.(1432-1434)ACC>AAC	p.T478N	CTNNA3_uc001jmw.2_Missense_Mutation_p.T478N|CTNNA3_uc001jmx.3_Missense_Mutation_p.T478N	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	478					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						CATTTCCATGGTGTTTTTGAC	0.338													19	67	---	---	---	---	PASS
HERC4	26091	broad.mit.edu	37	10	69700823	69700823	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69700823T>A	uc001jng.3	-	21	2712	c.2401A>T	c.(2401-2403)ATC>TTC	p.I801F	HERC4_uc009xpq.2_Missense_Mutation_p.I334F|HERC4_uc001jnf.3_RNA|HERC4_uc001jnh.3_Missense_Mutation_p.I793F|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Missense_Mutation_p.I537F	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN	hect domain and RLD 4 isoform a	801	HECT.				cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3						AAGCCACAGATAACACCAATC	0.294													27	78	---	---	---	---	PASS
STOX1	219736	broad.mit.edu	37	10	70644923	70644923	+	Silent	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70644923T>A	uc001jos.2	+	3	1458	c.1371T>A	c.(1369-1371)GCT>GCA	p.A457A	STOX1_uc001jor.2_Intron|STOX1_uc009xpy.2_Intron|STOX1_uc001joq.2_Silent_p.A347A	NM_001130161	NP_001123633	Q6ZVD7	STOX1_HUMAN	storkhead box 1 isoform a	457						cytoplasm|nucleolus	DNA binding			kidney(1)|skin(1)	2						AGCTCCCTGCTACACAGCCCA	0.473													45	100	---	---	---	---	PASS
NDST2	8509	broad.mit.edu	37	10	75562762	75562762	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75562762G>C	uc001jvk.2	-	13	3195	c.2391C>G	c.(2389-2391)ATC>ATG	p.I797M	NDST2_uc010qks.1_Missense_Mutation_p.I423M|NDST2_uc010qkt.1_Missense_Mutation_p.I674M|NDST2_uc001jvl.1_Missense_Mutation_p.I204M|NDST2_uc009xro.2_Missense_Mutation_p.I423M|NDST2_uc010qku.1_Missense_Mutation_p.I672M	NM_003635	NP_003626	P52849	NDST2_HUMAN	heparan glucosaminyl	797	Lumenal (Potential).|Heparan sulfate N-sulfotransferase 2.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			ovary(1)	1	Prostate(51;0.0112)					GAAAGGGTGTGATACCCAGGA	0.532													49	116	---	---	---	---	PASS
NRG3	10718	broad.mit.edu	37	10	84711279	84711279	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84711279G>A	uc001kco.2	+	5	1136	c.1109G>A	c.(1108-1110)GGA>GAA	p.G370E	NRG3_uc010qlz.1_Missense_Mutation_p.G369E|NRG3_uc001kcp.2_Missense_Mutation_p.G149E|NRG3_uc001kcq.2_Missense_Mutation_p.G20E|NRG3_uc001kcr.2_Missense_Mutation_p.G20E	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1	370	Helical; Note=Internal signal sequence; (Potential).				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		ATCATCTTTGGAATTGTCATC	0.378													30	54	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97174445	97174445	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97174445T>G	uc001kkp.2	-	7	661	c.616A>C	c.(616-618)ACT>CCT	p.T206P	SORBS1_uc001kkl.2_5'UTR|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Missense_Mutation_p.T206P|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_RNA|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Missense_Mutation_p.T174P|SORBS1_uc001kkw.2_Missense_Mutation_p.T206P|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Missense_Mutation_p.T404P|SORBS1_uc001kkx.1_Missense_Mutation_p.T174P	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3	206					focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TCATCTAGAGTCGGGAAGGTC	0.637													6	30	---	---	---	---	PASS
PI4K2A	55361	broad.mit.edu	37	10	99424748	99424748	+	Intron	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99424748C>T	uc001kog.1	+						PI4K2A_uc010qoy.1_Intron|PI4K2A_uc009xvw.1_Intron	NM_018425	NP_060895	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		GCATGTAAGTCTCCAGACAAT	0.343													7	26	---	---	---	---	PASS
C10orf76	79591	broad.mit.edu	37	10	103792914	103792914	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103792914G>A	uc009xwy.1	-	4	277	c.175C>T	c.(175-177)CTA>TTA	p.L59L	C10orf76_uc001kui.2_Silent_p.L59L	NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591	59						integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		TTGCCTTCTAGGTACTCTAAA	0.413													18	57	---	---	---	---	PASS
SMC3	9126	broad.mit.edu	37	10	112359487	112359487	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112359487G>T	uc001kze.2	+	21	2470	c.2344G>T	c.(2344-2346)GGA>TGA	p.G782*		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	782	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		AGCAGAACTGGGAACTGATTT	0.418													5	59	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	117226718	117226718	+	Nonsense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117226718C>G	uc001lcg.2	+	23	3838	c.3452C>G	c.(3451-3453)TCA>TGA	p.S1151*	ATRNL1_uc010qsm.1_Nonsense_Mutation_p.S280*|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	1151	Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ATTAATGCATCAAACAACTTT	0.294													6	25	---	---	---	---	PASS
FGFR2	2263	broad.mit.edu	37	10	123263411	123263411	+	Silent	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123263411C>G	uc010qtk.1	-	11	1979	c.1332G>C	c.(1330-1332)CTG>CTC	p.L444L	FGFR2_uc010qtg.1_Silent_p.L332L|FGFR2_uc010qth.1_Silent_p.L329L|FGFR2_uc010qti.1_Silent_p.L355L|FGFR2_uc010qtj.1_Silent_p.L445L|FGFR2_uc010qtl.1_Silent_p.L328L|FGFR2_uc010qtm.1_Silent_p.L327L|FGFR2_uc001lfl.3_Silent_p.L445L|FGFR2_uc001lfm.2_Silent_p.L356L|FGFR2_uc001lfg.3_Silent_p.L52L	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1	444	Cytoplasmic (Potential).				angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)	TTATCCTCACCAGCGGGGTGT	0.532		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				13	23	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124390741	124390741	+	Missense_Mutation	SNP	G	T	T	rs149958745	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124390741G>T	uc001lgk.1	+	46	6009	c.5903G>T	c.(5902-5904)CGA>CTA	p.R1968L	DMBT1_uc001lgl.1_Missense_Mutation_p.R1958L|DMBT1_uc001lgm.1_Missense_Mutation_p.R1340L|DMBT1_uc009xzz.1_Missense_Mutation_p.R1968L|DMBT1_uc010qtx.1_Missense_Mutation_p.R688L|DMBT1_uc009yab.1_Missense_Mutation_p.R671L|DMBT1_uc009yac.1_Missense_Mutation_p.R262L	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1968	SRCR 14.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGCCGGAACCGAGGCTGGTTC	0.547													5	153	---	---	---	---	PASS
ZRANB1	54764	broad.mit.edu	37	10	126631403	126631403	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126631403G>T	uc001lic.2	+	1	712	c.341G>T	c.(340-342)AGG>ATG	p.R114M	ZRANB1_uc010qug.1_Missense_Mutation_p.R140M	NM_017580	NP_060050	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	114					positive regulation of Wnt receptor signaling pathway|protein K63-linked deubiquitination|Wnt receptor signaling pathway	aggresome|centrosome|intermediate filament cytoskeleton|nucleolus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		CGTAGGACCAGGAGTCCTACA	0.433													7	82	---	---	---	---	PASS
LRRC27	80313	broad.mit.edu	37	10	134175004	134175004	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134175004G>T	uc010quw.1	+	9	1409	c.1214G>T	c.(1213-1215)AGG>ATG	p.R405M	LRRC27_uc001llg.2_RNA|LRRC27_uc001lli.2_Missense_Mutation_p.R405M|LRRC27_uc001llj.2_Missense_Mutation_p.R343M|LRRC27_uc001llk.3_Missense_Mutation_p.R278M	NM_030626	NP_085129	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27 isoform a	405										ovary(1)	1		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		ATAGATAACAGGAAAGTACCA	0.423													7	173	---	---	---	---	PASS
OR51M1	390059	broad.mit.edu	37	11	5410783	5410783	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5410783C>T	uc010qzc.1	+	1	155	c.155C>T	c.(154-156)TCA>TTA	p.S52L	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004756	NP_001004756	B2RNI9	B2RNI9_HUMAN	olfactory receptor, family 51, subfamily M,	52						integral to membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTTGCCATCTCAGGCAATTGT	0.453													27	63	---	---	---	---	PASS
OR51I1	390063	broad.mit.edu	37	11	5462289	5462289	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5462289G>T	uc010qze.1	-	1	456	c.456C>A	c.(454-456)ACC>ACA	p.T152T	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005288	NP_001005288	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I,	152	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGAAACTCTTGGTAAGGATGC	0.473													6	62	---	---	---	---	PASS
OR52N1	79473	broad.mit.edu	37	11	5809636	5809636	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5809636G>A	uc010qzo.1	-	1	411	c.411C>T	c.(409-411)ATC>ATT	p.I137I	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001913	NP_001001913	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N,	137	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		AATTAGTGAGGATGGTGGCAT	0.517													19	54	---	---	---	---	PASS
OR52W1	120787	broad.mit.edu	37	11	6221231	6221231	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6221231G>T	uc010qzz.1	+	1	778	c.778G>T	c.(778-780)GGT>TGT	p.G260C		NM_001005178	NP_001005178	Q6IF63	O52W1_HUMAN	olfactory receptor, family 52, subfamily W,	260	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTACATACCTGGTCTCTTCTC	0.542													8	353	---	---	---	---	PASS
OR10A4	283297	broad.mit.edu	37	11	6898702	6898702	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6898702T>A	uc010rat.1	+	1	824	c.824T>A	c.(823-825)CTG>CAG	p.L275Q		NM_207186	NP_997069	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A,	275	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AAGAAGCTGCTGTCACTCTCT	0.512													41	121	---	---	---	---	PASS
SWAP70	23075	broad.mit.edu	37	11	9715738	9715738	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9715738C>A	uc001mhw.2	+	2	244	c.145C>A	c.(145-147)CCA>ACA	p.P49T	SWAP70_uc001mhv.2_Missense_Mutation_p.P49T|SWAP70_uc001mhx.2_Missense_Mutation_p.P49T	NM_015055	NP_055870	Q9UH65	SWP70_HUMAN	SWAP-70 protein	49						cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		TCCTCATGACCCAGTTGCCCT	0.473													5	72	---	---	---	---	PASS
SWAP70	23075	broad.mit.edu	37	11	9759834	9759834	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9759834C>A	uc001mhw.2	+	8	1254	c.1155C>A	c.(1153-1155)GCC>GCA	p.A385A	SWAP70_uc001mhv.2_Silent_p.A385A|SWAP70_uc001mhx.2_Silent_p.A327A	NM_015055	NP_055870	Q9UH65	SWP70_HUMAN	SWAP-70 protein	385	Potential.			A -> S (in Ref. 7).		cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		AACTTCAGGCCAGGTTCAGCA	0.522													5	39	---	---	---	---	PASS
ABCC8	6833	broad.mit.edu	37	11	17430031	17430031	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17430031C>A	uc001mnc.2	-	23	2854	c.2728G>T	c.(2728-2730)GAG>TAG	p.E910*		NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	910	ABC transporter 1.|Cytoplasmic (By similarity).				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	AGGGTACCCTCCCTCTGGATG	0.547													6	86	---	---	---	---	PASS
USH1C	10083	broad.mit.edu	37	11	17554867	17554867	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17554867C>A	uc001mnf.2	-	2	148	c.39G>T	c.(37-39)GTG>GTT	p.V13V	USH1C_uc001mne.2_Silent_p.V13V|USH1C_uc009yhb.2_Silent_p.V13V|USH1C_uc001mng.2_RNA|USH1C_uc001mnd.2_5'UTR	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a	13					equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						TCAGAAAATCCACCTGGAAAA	0.532													17	58	---	---	---	---	PASS
E2F8	79733	broad.mit.edu	37	11	19246901	19246901	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19246901G>T	uc001mpm.2	-	12	2810	c.2288C>A	c.(2287-2289)CCA>CAA	p.P763Q	E2F8_uc009yhv.2_RNA|E2F8_uc001mpn.3_Missense_Mutation_p.P763Q	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8	763					cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						CTCTATTCTTGGAGACACAGG	0.532													6	130	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	30925135	30925135	+	RNA	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30925135C>T	uc001mss.1	-	10		c.1507G>A			uc009yjk.1_Silent_p.L916L|uc009yjj.1_RNA					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		CCCATAAAACCAAATCACGCA	0.423													11	24	---	---	---	---	PASS
FNBP4	23360	broad.mit.edu	37	11	47767661	47767661	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47767661C>G	uc009ylv.2	-	7	1345	c.1192G>C	c.(1192-1194)GAG>CAG	p.E398Q	FNBP4_uc001ngj.2_Missense_Mutation_p.E305Q|FNBP4_uc001ngl.2_RNA	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	398										ovary(1)	1						TCCTCTTCCTCCTCACTTTCT	0.388													41	114	---	---	---	---	PASS
OR5D16	390144	broad.mit.edu	37	11	55606318	55606318	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55606318T>A	uc010rio.1	+	1	91	c.91T>A	c.(91-93)TTT>ATT	p.F31I		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	31	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				TCCCCTCTTCTTTGTATTTCT	0.413													18	65	---	---	---	---	PASS
OR5D16	390144	broad.mit.edu	37	11	55606815	55606815	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55606815C>T	uc010rio.1	+	1	588	c.588C>T	c.(586-588)CTC>CTT	p.L196L		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	196	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				ACTCTTATCTCAGCCAGTTGC	0.383													11	67	---	---	---	---	PASS
OR5M10	390167	broad.mit.edu	37	11	56344480	56344480	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56344480T>A	uc001niz.1	-	1	718	c.718A>T	c.(718-720)ACG>TCG	p.T240S		NM_001004741	NP_001004741	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M,	240	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GAAGCACACGTAGAAAAGGCT	0.448													36	102	---	---	---	---	PASS
LRRC55	219527	broad.mit.edu	37	11	56949826	56949826	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56949826C>A	uc001njl.1	+	1	606	c.459C>A	c.(457-459)CTC>CTA	p.L153L		NM_001005210	NP_001005210	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	123	LRR 2.					integral to membrane					0						GCCTCTTCCTCCATGCCAAGC	0.577													4	20	---	---	---	---	PASS
OR1S1	219959	broad.mit.edu	37	11	57982933	57982933	+	Silent	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57982933G>C	uc010rkc.1	+	1	717	c.717G>C	c.(715-717)CTG>CTC	p.L239L		NM_001004458	NP_001004458	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S,	239	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1		Breast(21;0.0589)				GAGCTGTCCTGAGAGTATCTT	0.438													10	49	---	---	---	---	PASS
OR5B17	219965	broad.mit.edu	37	11	58126157	58126157	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58126157T>C	uc010rke.1	-	1	386	c.386A>G	c.(385-387)CAT>CGT	p.H129R		NM_001005489	NP_001005489	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B,	129	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GGTGGTATAATGTAGGGGGTT	0.448													17	50	---	---	---	---	PASS
VWCE	220001	broad.mit.edu	37	11	61026151	61026151	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61026151A>G	uc001nra.2	-	20	3143	c.2864T>C	c.(2863-2865)ATG>ACG	p.M955T	VWCE_uc001nrb.2_RNA	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	955						extracellular region	calcium ion binding			ovary(1)	1						ACCTCCTTACATGGTGGACTC	0.647													7	27	---	---	---	---	PASS
ROM1	6094	broad.mit.edu	37	11	62382190	62382190	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62382190C>A	uc001ntv.2	+	3	1476	c.935C>A	c.(934-936)CCC>CAC	p.P312H	EML3_uc001ntt.1_5'Flank|EML3_uc001ntu.1_5'Flank|EML3_uc010rly.1_5'Flank	NM_000327	NP_000318	Q03395	ROM1_HUMAN	retinal outer segment membrane protein 1	312	Cytoplasmic (Potential).				cell adhesion|visual perception	integral to plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						TATCTCTTTCCCAGTGGGCTG	0.607													5	60	---	---	---	---	PASS
METTL12	751071	broad.mit.edu	37	11	62433368	62433368	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62433368G>T	uc001nug.1	+	2	276	c.17G>T	c.(16-18)CGA>CTA	p.R6L	C11orf48_uc001nue.2_Intron|C11orf48_uc001nuf.2_Intron|METTL12_uc001nuh.2_5'UTR|METTL12_uc010rmc.1_RNA	NM_001043229	NP_001036694	A8MUP2	MTL12_HUMAN	methyltransferase like 12 precursor	6						mitochondrion	methyltransferase activity				0						GCGCTGCGTCGAATGCTCCAC	0.642													6	30	---	---	---	---	PASS
NUDT22	84304	broad.mit.edu	37	11	63997406	63997406	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63997406C>T	uc001nyp.3	+	6	1036	c.856C>T	c.(856-858)CAG>TAG	p.Q286*	NUDT22_uc009ype.2_Nonsense_Mutation_p.Q286*|NUDT22_uc001nyq.3_Nonsense_Mutation_p.Q253*|NUDT22_uc010rng.1_RNA|uc001nyr.1_3'UTR|DNAJC4_uc001nys.2_5'Flank|DNAJC4_uc001nyt.2_5'Flank|DNAJC4_uc001nyu.2_5'Flank	NM_032344	NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety	286							hydrolase activity				0						CAACCGGGTTCAGGGAAGTCC	0.567													5	30	---	---	---	---	PASS
EHBP1L1	254102	broad.mit.edu	37	11	65357998	65357998	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65357998G>C	uc001oeo.3	+	16	4483	c.4218G>C	c.(4216-4218)CAG>CAC	p.Q1406H		NM_001099409	NP_001092879	Q8N3D4	EH1L1_HUMAN	tangerin	1406	Potential.									central_nervous_system(1)	1						TGCTGATCCAGGAGTGGTTCA	0.647													12	27	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70200458	70200458	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70200458G>A	uc001opo.2	+	17	2413	c.2215G>A	c.(2215-2217)GAA>AAA	p.E739K	PPFIA1_uc001opn.1_Missense_Mutation_p.E739K|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	739					cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CATAAAGTGTGAAACCTCCCC	0.532													22	45	---	---	---	---	PASS
SHANK2	22941	broad.mit.edu	37	11	70507712	70507712	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70507712C>A	uc001oqc.2	-	13	2003	c.1925G>T	c.(1924-1926)CGA>CTA	p.R642L	SHANK2_uc010rqn.1_Missense_Mutation_p.R54L|SHANK2_uc001opz.2_Missense_Mutation_p.R54L|uc009ysn.1_Intron|SHANK2_uc010rqp.1_Missense_Mutation_p.R54L	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	263	PDZ.				intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TTTGGCCCCTCGAAGCACGAA	0.383													5	113	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85437117	85437117	+	Intron	SNP	G	A	A	rs114177971	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85437117G>A	uc010rth.1	-						SYTL2_uc010rtg.1_Intron|SYTL2_uc010rti.1_Intron|SYTL2_uc010rtj.1_Intron|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Missense_Mutation_p.T128M|SYTL2_uc001pbb.2_Missense_Mutation_p.T128M|SYTL2_uc001pbc.2_Missense_Mutation_p.T128M|SYTL2_uc010rtf.1_Intron	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		AATCCCTTCCGTATTCTTTTC	0.358													24	63	---	---	---	---	PASS
PICALM	8301	broad.mit.edu	37	11	85701351	85701351	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85701351G>A	uc001pbm.2	-	13	1636	c.1350C>T	c.(1348-1350)TCC>TCT	p.S450S	PICALM_uc001pbl.2_Intron|PICALM_uc001pbn.2_Silent_p.S443S|PICALM_uc010rtl.1_Intron|PICALM_uc010rtk.1_Intron|PICALM_uc001pbo.1_Silent_p.S82S	NM_007166	NP_009097	Q13492	PICAL_HUMAN	phosphatidylinositol-binding clathrin assembly	450					clathrin coat assembly|endosome transport|negative regulation of receptor-mediated endocytosis|positive regulation of transcription, DNA-dependent|receptor internalization|regulation of protein localization	clathrin coat|clathrin-coated vesicle|coated pit|Golgi apparatus|nucleus|postsynaptic membrane|presynaptic membrane	1-phosphatidylinositol binding|clathrin heavy chain binding			urinary_tract(1)|ovary(1)	2		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				CTGAAGAAATGGAAAGGTGAA	0.363			T	MLLT10|MLL	TALL|AML|								23	59	---	---	---	---	PASS
ZC3H12C	85463	broad.mit.edu	37	11	110036441	110036441	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110036441G>T	uc009yxw.2	+	6	2682	c.2631G>T	c.(2629-2631)GAG>GAT	p.E877D	ZC3H12C_uc010rwc.1_Missense_Mutation_p.E878D|ZC3H12C_uc010rwd.1_Missense_Mutation_p.E878D|ZC3H12C_uc001pkr.3_Missense_Mutation_p.E846D	NM_033390	NP_203748	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	877							endonuclease activity|nucleic acid binding|zinc ion binding				0		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		TTTTAGTGGAGAAATCCCAGC	0.453													5	8	---	---	---	---	PASS
DRD2	1813	broad.mit.edu	37	11	113288740	113288740	+	Intron	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113288740T>A	uc001pnz.2	-						DRD2_uc010rwv.1_Intron|DRD2_uc001poa.3_Intron|DRD2_uc001pob.3_Intron|DRD2_uc009yyr.1_Intron	NM_000795	NP_000786	P14416	DRD2_HUMAN	dopamine receptor D2 isoform long						activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding			pancreas(1)|skin(1)	2		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)	CCACCCTGGCTGGGCTCACCT	0.562													12	17	---	---	---	---	PASS
USP28	57646	broad.mit.edu	37	11	113704153	113704153	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113704153C>A	uc001poh.2	-	7	781	c.748G>T	c.(748-750)GAG>TAG	p.E250*	USP28_uc010rwy.1_Nonsense_Mutation_p.E125*|USP28_uc001poi.2_5'UTR|USP28_uc001poj.3_Nonsense_Mutation_p.E250*|USP28_uc010rwz.1_Nonsense_Mutation_p.E250*	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28	250					cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TGCTGTTCCTCAGATGATCGG	0.423													6	107	---	---	---	---	PASS
CEP164	22897	broad.mit.edu	37	11	117242073	117242073	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117242073C>A	uc001prc.2	+	9	1190	c.1043C>A	c.(1042-1044)CCA>CAA	p.P348Q	CEP164_uc001prb.2_Missense_Mutation_p.P348Q|CEP164_uc010rxk.1_Missense_Mutation_p.P322Q|CEP164_uc001prf.2_RNA|CEP164_uc009yzp.1_RNA	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	348					cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		AAGGAAGCACCAGAGGACACA	0.537													5	109	---	---	---	---	PASS
VSIG2	23584	broad.mit.edu	37	11	124617490	124617490	+	Nonsense_Mutation	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124617490T>A	uc001qas.2	-	7	1001	c.925A>T	c.(925-927)AGA>TGA	p.R309*		NM_014312	NP_055127	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	309	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		GACGAGGGTCTTTCCAGGAAC	0.557													13	42	---	---	---	---	PASS
JAM3	83700	broad.mit.edu	37	11	134014177	134014177	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134014177C>T	uc001qhb.1	+	4	457	c.433C>T	c.(433-435)CTG>TTG	p.L145L	JAM3_uc009zcz.1_Intron	NM_032801	NP_116190	Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3 precursor	100	Extracellular (Potential).|Ig-like V-type.				angiogenesis|blood coagulation|regulation of neutrophil chemotaxis	cell-cell contact zone|desmosome|extracellular space|integral to membrane	integrin binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		GAAGACATCCCTGAAGATCTG	0.458													19	50	---	---	---	---	PASS
RAD52	5893	broad.mit.edu	37	12	1025828	1025828	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1025828C>A	uc001qis.1	-	8	816	c.702G>T	c.(700-702)CCG>CCT	p.P234P	RAD52_uc001qit.1_RNA|RAD52_uc010sdt.1_Silent_p.P157P|RAD52_uc001qiu.1_Silent_p.P234P|RAD52_uc001qiv.1_RNA|RAD52_uc001qiw.1_RNA|RAD52_uc010sdu.1_Silent_p.P234P	NM_134424	NP_602296	P43351	RAD52_HUMAN	RAD52 homolog	234					DNA recombinase assembly|mitotic recombination|reciprocal meiotic recombination	nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)			CCTGGTCCGCCGGTATCACAG	0.647								Homologous_recombination					5	22	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6061676	6061676	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6061676T>C	uc001qnn.1	-	49	8246	c.7996A>G	c.(7996-7998)ACG>GCG	p.T2666A	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	2666					blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	TCCTGGAGCGTCTCATCACGC	0.502													14	21	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7635983	7635983	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7635983T>C	uc001qsz.3	-	12	3196	c.3068A>G	c.(3067-3069)GAC>GGC	p.D1023G	CD163_uc001qta.3_Missense_Mutation_p.D1023G|CD163_uc009zfw.2_Missense_Mutation_p.D1056G	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	1023	SRCR 9.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						CACTGCAGCGTCTTCCTTGTG	0.512													8	24	---	---	---	---	PASS
WBP11	51729	broad.mit.edu	37	12	14947471	14947471	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14947471C>A	uc001rci.2	-	7	882	c.721G>T	c.(721-723)GCC>TCC	p.A241S		NM_016312	NP_057396	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	241					mRNA processing|RNA splicing|rRNA processing	cytoplasm	single-stranded DNA binding|WW domain binding			ovary(1)|lung(1)	2						CACTTCTCACCAAGTTCAGGA	0.413													8	280	---	---	---	---	PASS
PTPRO	5800	broad.mit.edu	37	12	15704492	15704492	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15704492G>A	uc001rcv.1	+	15	2619	c.2445G>A	c.(2443-2445)GAG>GAA	p.E815E	PTPRO_uc001rcw.1_Silent_p.E815E|PTPRO_uc001rcx.1_Silent_p.E4E|PTPRO_uc001rcy.1_Silent_p.E4E|PTPRO_uc001rcz.1_Silent_p.E4E|PTPRO_uc001rda.1_Silent_p.E4E	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	815	Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				TAGTTACAGAGATGAATCCCA	0.398													35	85	---	---	---	---	PASS
STRAP	11171	broad.mit.edu	37	12	16052959	16052959	+	Silent	SNP	G	C	C	rs140559082	byFrequency	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16052959G>C	uc001rdc.3	+	8	1251	c.897G>C	c.(895-897)ACG>ACC	p.T299T	STRAP_uc010shw.1_Silent_p.T312T|STRAP_uc001rdd.3_Silent_p.T205T	NM_007178	NP_009109	Q9Y3F4	STRAP_HUMAN	serine/threonine kinase receptor associated	299	WD 7.				mRNA processing|RNA splicing	cell junction|mitochondrion|spliceosomal complex	identical protein binding			skin(1)	1		Hepatocellular(102;0.121)				TAGGAAAAACGTATGGCCTTT	0.333													15	41	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26572033	26572033	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26572033G>A	uc001rhg.2	-	50	7476	c.7059C>T	c.(7057-7059)GTC>GTT	p.V2353V	ITPR2_uc009zjg.1_Silent_p.V504V	NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	2353	Helical; (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					TGCAAACCAGGACATACGCCA	0.463													22	49	---	---	---	---	PASS
C12orf71	728858	broad.mit.edu	37	12	27235364	27235364	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27235364T>C	uc001rhq.2	-	1	92	c.53A>G	c.(52-54)AAT>AGT	p.N18S		NM_001080406	NP_001073875	A8MTZ7	CL071_HUMAN	hypothetical protein LOC728858	18											0						CAGGTTGGAATTGGATTTGGA	0.493													20	21	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40671774	40671774	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40671774T>C	uc001rmg.3	+	17	2147	c.2026T>C	c.(2026-2028)TTC>CTC	p.F676L	LRRK2_uc001rmh.1_Missense_Mutation_p.F298L	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	676					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CTTAGTAATATTCCATCAAAT	0.328													6	41	---	---	---	---	PASS
SLC38A4	55089	broad.mit.edu	37	12	47163091	47163091	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47163091T>C	uc001rpi.2	-	15	1819	c.1420A>G	c.(1420-1422)ATA>GTA	p.I474V	SLC38A4_uc001rpj.2_Missense_Mutation_p.I474V	NM_018018	NP_060488	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	474	Helical; (Potential).				cellular nitrogen compound metabolic process|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Lung SC(27;0.192)|Renal(347;0.236)					ATGTATTTTATAGTTGGCACA	0.423													31	69	---	---	---	---	PASS
FIGNL2	401720	broad.mit.edu	37	12	52216039	52216039	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52216039G>A	uc001rzc.2	-	1	170	c.159C>T	c.(157-159)GCC>GCT	p.A53A		NM_001013690	NP_001013712	A6NMB9	FIGL2_HUMAN	fidgetin-like 2	53							ATP binding|nucleoside-triphosphatase activity				0				BRCA - Breast invasive adenocarcinoma(357;0.135)		AGGCAGTGAGGGCTGAGATGT	0.642													3	9	---	---	---	---	PASS
SMARCC2	6601	broad.mit.edu	37	12	56575865	56575865	+	Splice_Site	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56575865T>A	uc001skb.2	-	8	739	c.633_splice	c.e8-1	p.S211_splice	SMARCC2_uc001skd.2_Splice_Site_p.S211_splice|SMARCC2_uc001ska.2_Splice_Site_p.S211_splice|SMARCC2_uc001skc.2_Splice_Site_p.S211_splice|SMARCC2_uc010sqf.1_Splice_Site_p.S100_splice	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			GTGTCGTAACTGCCATGGGAA	0.438													12	38	---	---	---	---	PASS
OS9	10956	broad.mit.edu	37	12	58089784	58089784	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58089784A>G	uc001spj.2	+	4	502	c.443A>G	c.(442-444)TAC>TGC	p.Y148C	OS9_uc010srx.1_Intron|OS9_uc001spk.2_Missense_Mutation_p.Y148C|OS9_uc001spl.2_Missense_Mutation_p.Y148C|OS9_uc001spm.2_Missense_Mutation_p.Y148C|OS9_uc001spn.2_Missense_Mutation_p.Y148C|OS9_uc010sry.1_Missense_Mutation_p.Y148C|OS9_uc010srz.1_Missense_Mutation_p.Y89C	NM_006812	NP_006803	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum	148	PRKCSH.				ER-associated protein catabolic process|protein retention in ER lumen|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to endoplasmic reticulum stress	endoplasmic reticulum lumen|Hrd1p ubiquitin ligase complex	glycoprotein binding|protein binding|sugar binding			ovary(1)	1	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			CTCGGCTACTACCAATCAGCC	0.522													15	58	---	---	---	---	PASS
FAM119B	25895	broad.mit.edu	37	12	58174329	58174329	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58174329A>T	uc001sqg.2	+	3	706	c.581A>T	c.(580-582)CAC>CTC	p.H194L	FAM119B_uc001sqf.2_3'UTR|FAM119B_uc009zqd.2_RNA|TSFM_uc001sqi.2_5'Flank|TSFM_uc010sse.1_5'Flank|TSFM_uc001sqh.2_5'Flank|TSFM_uc010ssf.1_5'Flank	NM_015433	NP_056248	Q96AZ1	MT21B_HUMAN	hypothetical protein LOC25895 isoform a	194						integral to membrane|intracellular	methyltransferase activity				0	all_cancers(7;9.07e-82)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					TTCTTTCAGCACCTCCTGCCC	0.562													7	20	---	---	---	---	PASS
AVIL	10677	broad.mit.edu	37	12	58200197	58200197	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58200197G>T	uc001sqj.1	-	13	1646	c.1617C>A	c.(1615-1617)TCC>TCA	p.S539S	AVIL_uc009zqe.1_Silent_p.S532S|AVIL_uc001sqk.1_Silent_p.S117S|AVIL_uc001sql.3_Silent_p.S516S	NM_006576	NP_006567	O75366	AVIL_HUMAN	advillin	539	Gelsolin-like 5.|Core (By similarity).				actin filament capping|cilium morphogenesis|cytoskeleton organization|positive regulation of neuron projection development	actin cytoskeleton|axon|cytoplasm	actin binding			central_nervous_system(1)	1	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					AGACATCATTGGAGTTTAGGG	0.542													5	63	---	---	---	---	PASS
SLC6A15	55117	broad.mit.edu	37	12	85285910	85285910	+	5'UTR	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85285910G>A	uc001szv.2	-	2					SLC6A15_uc010sul.1_Intron|SLC6A15_uc001szy.2_5'UTR	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN	solute carrier family 6, member 15 isoform 1						cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			pancreas(2)|ovary(1)	3						TGGAGAGTATGCGAAGtattt	0.343													22	53	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85439924	85439924	+	Intron	SNP	A	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85439924A>C	uc001tac.2	+						LRRIQ1_uc001tab.1_Intron|LRRIQ1_uc001taa.1_Intron|LRRIQ1_uc001tad.2_Intron	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1											ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		AGGTGGACTAAATTGCTCAAT	0.323													21	38	---	---	---	---	PASS
RASSF9	9182	broad.mit.edu	37	12	86199048	86199048	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86199048A>G	uc001taf.1	-	2	1079	c.740T>C	c.(739-741)CTA>CCA	p.L247P		NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family	247	Potential.				endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1						CTGCAAGTCTAGATTTTGCTC	0.398													31	76	---	---	---	---	PASS
C12orf63	374467	broad.mit.edu	37	12	97073530	97073530	+	Missense_Mutation	SNP	G	T	T	rs138249141		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97073530G>T	uc001tet.1	+	7	1069	c.991G>T	c.(991-993)GAT>TAT	p.D331Y		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	331										skin(6)|ovary(1)	7						ACAGACACAAGGTAAAATGCA	0.433													6	111	---	---	---	---	PASS
NEDD1	121441	broad.mit.edu	37	12	97311443	97311443	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97311443G>T	uc001teu.3	+	5	615	c.276G>T	c.(274-276)TTG>TTT	p.L92F	NEDD1_uc001tev.3_Missense_Mutation_p.L92F|NEDD1_uc010svc.1_Missense_Mutation_p.L3F|NEDD1_uc001tew.2_Missense_Mutation_p.L99F|NEDD1_uc001tex.2_Missense_Mutation_p.L3F	NM_152905	NP_690869	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally	92	WD 3.				cell division|G2/M transition of mitotic cell cycle|mitosis	cytosol					0						CTATGTATTTGGTAAGCGGAG	0.289													6	135	---	---	---	---	PASS
NFYB	4801	broad.mit.edu	37	12	104515090	104515090	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104515090C>A	uc001tkl.1	-	6	640	c.439G>T	c.(439-441)GGA>TGA	p.G147*	NFYB_uc001tkk.1_Nonsense_Mutation_p.G145*	NM_006166	NP_006157	P25208	NFYB_HUMAN	nuclear transcription factor Y, beta	147	C domain.					CCAAT-binding factor complex	repressing transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						CCCTTTTCTCCTTTCATAGCC	0.368													7	233	---	---	---	---	PASS
RBM19	9904	broad.mit.edu	37	12	114395692	114395692	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114395692C>A	uc009zwi.2	-	6	879	c.735G>T	c.(733-735)GAG>GAT	p.E245D	RBM19_uc001tvn.3_Missense_Mutation_p.E245D|RBM19_uc001tvm.2_Missense_Mutation_p.E245D	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	245					multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CGGAGGAATCCTCTTCCTCGG	0.577													30	86	---	---	---	---	PASS
KDM2B	84678	broad.mit.edu	37	12	121880003	121880003	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121880003C>G	uc001uat.2	-	19	3345	c.3241G>C	c.(3241-3243)GAC>CAC	p.D1081H	KDM2B_uc001uaq.2_Missense_Mutation_p.D521H|KDM2B_uc010szy.1_Missense_Mutation_p.D521H|KDM2B_uc001uar.2_Missense_Mutation_p.D672H|KDM2B_uc001uas.2_Missense_Mutation_p.D1012H|KDM2B_uc001uau.2_Intron|KDM2B_uc001uao.2_Missense_Mutation_p.D329H|KDM2B_uc010szx.1_Missense_Mutation_p.D329H|KDM2B_uc001uap.2_RNA	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	1081	F-box.				embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						ACACACAGGTCTTGGTGGCTG	0.652													3	18	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124335508	124335508	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124335508G>A	uc001uft.3	+	34	5847	c.5822G>A	c.(5821-5823)CGC>CAC	p.R1941H		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1941	AAA 1 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TACGCAGGCCGCACGGAGCTG	0.592													14	21	---	---	---	---	PASS
AACS	65985	broad.mit.edu	37	12	125609519	125609519	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125609519G>T	uc001uhc.2	+	12	1464	c.1258G>T	c.(1258-1260)GAG>TAG	p.E420*	AACS_uc001uhd.2_Nonsense_Mutation_p.E420*|AACS_uc009zyh.2_Intron|AACS_uc009zyi.2_Nonsense_Mutation_p.E18*	NM_023928	NP_076417	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	420					fatty acid metabolic process	cytosol	acetoacetate-CoA ligase activity|ATP binding			ovary(1)|liver(1)|central_nervous_system(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		CCAGAGCTACGAGTATGTCTA	0.582													5	70	---	---	---	---	PASS
GALNT9	50614	broad.mit.edu	37	12	132688051	132688051	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132688051G>A	uc001ukc.3	-	7	1378	c.1262C>T	c.(1261-1263)TCG>TTG	p.S421L	GALNT9_uc009zyr.2_Missense_Mutation_p.S195L|GALNT9_uc001ukb.2_Missense_Mutation_p.S278L|GALNT9_uc001uka.2_Missense_Mutation_p.S55L	NM_001122636	NP_001116108	Q9HCQ5	GALT9_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	421	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		GGGACTCACCGACATGGGGAT	0.682													8	18	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	28880836	28880836	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28880836G>T	uc001usb.3	-	29	4079	c.3794C>A	c.(3793-3795)CCC>CAC	p.P1265H	FLT1_uc010aap.2_Missense_Mutation_p.P270H|FLT1_uc010aaq.2_Missense_Mutation_p.P390H|FLT1_uc001usa.3_Missense_Mutation_p.P483H	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	1265	Cytoplasmic (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	CGAGGCCTTGGGTTTGCTGTC	0.527													18	17	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29599505	29599505	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29599505G>T	uc001usl.3	+	1	758	c.700G>T	c.(700-702)GCT>TCT	p.A234S		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	224						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						GCCAGACCACGCTGTCCCGGC	0.592													10	21	---	---	---	---	PASS
DACH1	1602	broad.mit.edu	37	13	72204798	72204798	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72204798G>A	uc010thn.1	-	4	1439	c.1016C>T	c.(1015-1017)GCT>GTT	p.A339V	DACH1_uc010tho.1_Missense_Mutation_p.A339V|DACH1_uc010thp.1_Intron	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN	dachshund homolog 1 isoform a	339	Interaction with SIX6 and HDAC3 (By similarity).				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		CATTGCTTcagcaatagctgc	0.254													21	26	---	---	---	---	PASS
OR4M1	441670	broad.mit.edu	37	14	20249223	20249223	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20249223A>T	uc010tku.1	+	1	742	c.742A>T	c.(742-744)ATT>TTT	p.I248F		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	248	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCACATTACCATTGTGGTGCT	0.438													30	195	---	---	---	---	PASS
OR11H6	122748	broad.mit.edu	37	14	20692525	20692525	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20692525C>T	uc010tlc.1	+	1	657	c.657C>T	c.(655-657)ACC>ACT	p.T219T		NM_001004480	NP_001004480	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H,	219	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		TCTGTTACACCTTCAACTCGA	0.507													8	25	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22573679	22573679	+	Intron	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22573679G>T	uc001wbw.2	+						uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdb.2_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TTGACTGTAAGTCCAGGGGTT	0.458													17	40	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22675454	22675454	+	Intron	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22675454C>A	uc001wbw.2	+						uc010aiv.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc001wdk.2_Missense_Mutation_p.L9I					SubName: Full=Alpha-chain C region; Flags: Fragment;																		GCAAGTACTCCTAGGGATATT	0.453													29	43	---	---	---	---	PASS
SLC7A8	23428	broad.mit.edu	37	14	23607195	23607195	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23607195G>A	uc001wiz.2	-	7	1677	c.951C>T	c.(949-951)ATC>ATT	p.I317I	SLC7A8_uc001wix.2_Silent_p.I114I|SLC7A8_uc010tnk.1_Silent_p.I93I|SLC7A8_uc010tnl.1_Silent_p.I212I|SLC7A8_uc001wiy.2_Intron|SLC7A8_uc010akj.2_Intron	NM_012244	NP_036376	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (cationic amino acid	317	Helical; (Potential).				blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity			ovary(1)	1	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	AAATGGGCATGATCCAGGCCA	0.582													36	74	---	---	---	---	PASS
CLEC14A	161198	broad.mit.edu	37	14	38724318	38724318	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38724318T>C	uc001wum.1	-	1	1257	c.910A>G	c.(910-912)AGG>GGG	p.R304G		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	304	Extracellular (Potential).					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		GGCGGGCGCCTGGTGGGCACC	0.657													24	25	---	---	---	---	PASS
PNN	5411	broad.mit.edu	37	14	39650180	39650180	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39650180A>G	uc001wuw.3	+	9	1364	c.1267A>G	c.(1267-1269)AAA>GAA	p.K423E		NM_002687	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	423	Glu-rich.				cell adhesion|regulation of transcription, DNA-dependent|transcription, DNA-dependent	catalytic step 2 spliceosome|desmosome|intermediate filament|nuclear speck	DNA binding|protein binding|structural molecule activity			ovary(1)	1	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		TGAAGCTAGCAAAGAATTGGA	0.378													33	74	---	---	---	---	PASS
FANCM	57697	broad.mit.edu	37	14	45605601	45605601	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45605601G>T	uc001wwd.3	+	1	466	c.367G>T	c.(367-369)GTG>TTG	p.V123L	FANCM_uc001wwc.2_Missense_Mutation_p.V123L|FANCM_uc010anf.2_Missense_Mutation_p.V123L|FKBP3_uc010tqf.1_5'Flank	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	123	Helicase ATP-binding.				DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						TATTGCCGCCGTGGTCATGTA	0.552								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				18	41	---	---	---	---	PASS
PTGDR	5729	broad.mit.edu	37	14	52735209	52735209	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52735209A>G	uc001wzq.2	+	1	779	c.677A>G	c.(676-678)TAT>TGT	p.Y226C		NM_000953	NP_000944	Q13258	PD2R_HUMAN	prostaglandin D2 receptor	226	Cytoplasmic (Potential).					integral to membrane|plasma membrane	prostaglandin D receptor activity|protein binding	p.Y226H(1)		ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	CGCAACCTCTATGCGATGCAC	0.701													9	26	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64593056	64593056	+	Silent	SNP	A	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64593056A>C	uc001xgm.2	+	72	13796	c.13566A>C	c.(13564-13566)ACA>ACC	p.T4522T	SYNE2_uc001xgl.2_Silent_p.T4522T|SYNE2_uc010apy.2_Silent_p.T907T|SYNE2_uc010apz.1_Silent_p.T414T	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4522	Cytoplasmic (Potential).|Potential.				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAAATATGACAGAAGAAGCAT	0.358													16	32	---	---	---	---	PASS
PLEKHH1	57475	broad.mit.edu	37	14	68052752	68052752	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68052752C>A	uc001xjl.1	+	28	4013	c.3871C>A	c.(3871-3873)CCA>ACA	p.P1291T	PLEKHH1_uc010tsw.1_Missense_Mutation_p.P859T|PLEKHH1_uc001xjn.1_Missense_Mutation_p.P806T|PLEKHH1_uc010tsx.1_Missense_Mutation_p.P156T|PLEKHH1_uc001xjo.1_Missense_Mutation_p.P156T|PLEKHH1_uc001xjp.1_Missense_Mutation_p.P156T	NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H	1291	FERM.					cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TAGATCTATCCCAGACAAGAG	0.478													8	189	---	---	---	---	PASS
EXD2	55218	broad.mit.edu	37	14	69701606	69701606	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69701606G>C	uc001xkt.2	+	7	1191	c.532G>C	c.(532-534)GAG>CAG	p.E178Q	EXD2_uc001xku.2_Missense_Mutation_p.E48Q|EXD2_uc001xkv.2_Missense_Mutation_p.E303Q|EXD2_uc001xkw.2_Missense_Mutation_p.E178Q|EXD2_uc010aqt.2_Missense_Mutation_p.E303Q|EXD2_uc010tte.1_Missense_Mutation_p.E303Q|EXD2_uc001xky.2_Missense_Mutation_p.E178Q	NM_018199	NP_060669	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	178					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						ATTGGGAGAAGAGGTTAATGG	0.478													17	40	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71444805	71444805	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71444805G>T	uc001xmo.2	+	6	2197	c.1751G>T	c.(1750-1752)CGA>CTA	p.R584L	PCNX_uc001xmn.3_Missense_Mutation_p.R584L|PCNX_uc010are.1_Missense_Mutation_p.R584L	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	584						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GTTTGCTTTCGAGGTGTTTCT	0.478													5	113	---	---	---	---	PASS
TMEM90A	646658	broad.mit.edu	37	14	74876045	74876045	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74876045G>T	uc001xpx.2	-	2	651	c.403C>A	c.(403-405)CAG>AAG	p.Q135K		NM_001105579	NP_001099049	A6NDD5	SYN1L_HUMAN	transmembrane protein 90A	135					response to biotic stimulus	Golgi apparatus|integral to membrane					0				BRCA - Breast invasive adenocarcinoma(234;0.00159)		TCTTCCTCCTGGTCATCCTCC	0.393													25	72	---	---	---	---	PASS
ATG2B	55102	broad.mit.edu	37	14	96797752	96797752	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96797752C>A	uc001yfi.2	-	11	2056	c.1691G>T	c.(1690-1692)CGA>CTA	p.R564L		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	564										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AAACACTGCTCGGAAAGACTT	0.368													4	84	---	---	---	---	PASS
WARS	7453	broad.mit.edu	37	14	100803432	100803432	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100803432G>T	uc001yhf.1	-	9	1305	c.1221C>A	c.(1219-1221)CTC>CTA	p.L407L	WARS_uc001yhe.1_Silent_p.L213L|WARS_uc001yhg.1_Silent_p.L407L|WARS_uc001yhh.1_Silent_p.L407L|WARS_uc001yhi.1_Silent_p.L366L|WARS_uc001yhj.1_Silent_p.L366L|WARS_uc001yhk.1_Silent_p.L366L|WARS_uc001yhl.1_Silent_p.L407L	NM_173701	NP_776049	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase isoform a	407					angiogenesis|negative regulation of cell proliferation|regulation of angiogenesis|tryptophanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|protein binding|tryptophan-tRNA ligase activity			breast(1)	1		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)	CGTCGTCCTCGAGGAAGAAGG	0.592													7	231	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102516143	102516143	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102516143G>A	uc001yks.2	+	76	13772	c.13608G>A	c.(13606-13608)CTG>CTA	p.L4536L		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	4536					cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GCTGGTCCCTGGAGGAGCTCT	0.597													23	25	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105408151	105408151	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105408151A>G	uc010axc.1	-	7	13757	c.13637T>C	c.(13636-13638)CTG>CCG	p.L4546P	AHNAK2_uc001ypx.2_Missense_Mutation_p.L4446P	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4546						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CACCTTGGGCAGGTGCCCTTT	0.622													91	181	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106518581	106518581	+	RNA	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106518581C>A	uc010tyt.1	-	1630		c.32856G>T								Parts of antibodies, mostly variable regions.												0						TGGAGCCTGGCGGACCCAGCT	0.572													5	187	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22466062	22466062	+	RNA	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22466062G>A	uc001yui.1	-	1		c.29C>T								Homo sapiens clone IgA5728-2 immunoglobulin A heavy chain mRNA, partial cds.																		TGTGTCTCTCGCACAGTAATA	0.517													28	390	---	---	---	---	PASS
SNORD115-10	100033447	broad.mit.edu	37	15	25432679	25432679	+	5'Flank	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25432679G>T	uc001yzd.1	+						SNORD115-11_uc001yze.1_5'Flank	NR_003302				Homo sapiens small nucleolar RNA, C/D box 115-10 (SNORD115-10), non-coding RNA.												0						GGGTGCCCTGGGTTGGGTCGA	0.537													57	123	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	26812774	26812774	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26812774C>A	uc001zaz.2	-	7	931	c.789G>T	c.(787-789)GTG>GTT	p.V263V	GABRB3_uc010uae.1_Silent_p.V178V|GABRB3_uc001zba.2_Silent_p.V263V|GABRB3_uc001zbb.2_Silent_p.V319V	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	263	Helical; (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TCCAGAAGGACACCCACGACA	0.398													12	46	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29346344	29346344	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29346344A>G	uc001zck.2	+	3	464	c.257A>G	c.(256-258)TAT>TGT	p.Y86C	APBA2_uc010azj.2_Missense_Mutation_p.Y86C|APBA2_uc010uat.1_Missense_Mutation_p.Y86C|APBA2_uc001zcl.2_Missense_Mutation_p.Y86C|APBA2_uc010uas.1_Missense_Mutation_p.Y86C	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	86					nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		GAGGAGGACTATGACGAGGGC	0.617													15	92	---	---	---	---	PASS
CAPN3	825	broad.mit.edu	37	15	42702161	42702161	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42702161G>C	uc001zpn.1	+	19	2389	c.2083G>C	c.(2083-2085)GAG>CAG	p.E695Q	CAPN3_uc001zpk.1_Missense_Mutation_p.E462Q|CAPN3_uc001zpl.1_Missense_Mutation_p.E602Q|CAPN3_uc010udf.1_Missense_Mutation_p.E608Q|CAPN3_uc010udg.1_Missense_Mutation_p.E560Q|CAPN3_uc001zpo.1_Missense_Mutation_p.E689Q|CAPN3_uc001zpp.1_Missense_Mutation_p.E603Q|CAPN3_uc001zpq.1_Missense_Mutation_p.E183Q|CAPN3_uc010bcv.1_Missense_Mutation_p.E30Q|CAPN3_uc001zpr.1_Missense_Mutation_p.E30Q|CAPN3_uc001zps.1_Missense_Mutation_p.E30Q|CAPN3_uc001zpt.1_Missense_Mutation_p.E30Q	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a	695	EF-hand 2.|Domain IV.				muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		GTTCACACTGGAGTCCTGCCG	0.607													16	40	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43367268	43367268	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43367268C>A	uc001zqq.2	-	4	503	c.437G>T	c.(436-438)GGA>GTA	p.G146V	UBR1_uc010udk.1_Missense_Mutation_p.G146V	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	146	UBR-type.				cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		ACAGAACCCTCCTCCAGTAGA	0.368													6	139	---	---	---	---	PASS
SERF2	10169	broad.mit.edu	37	15	44085881	44085881	+	Intron	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44085881C>A	uc001zsz.3	+						ELL3_uc001zsx.1_Intron|SERF2_uc010bdq.2_Missense_Mutation_p.P75H|SERF2_uc010uee.1_Intron|C15orf63_uc001ztb.2_Intron|MIR1282_hsa-mir-1282|MI0006429_RNA	NM_001018108	NP_001018118	P84101	SERF2_HUMAN	small EDRK-rich factor 2							cytosol|nucleus					0		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		CTGGTACCTCCCAGTGCCCCA	0.522													5	58	---	---	---	---	PASS
SLC24A5	283652	broad.mit.edu	37	15	48426537	48426537	+	Silent	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48426537A>G	uc001zwe.2	+	3	457	c.384A>G	c.(382-384)CTA>CTG	p.L128L	SLC24A5_uc010bel.2_Silent_p.L68L	NM_205850	NP_995322	Q71RS6	NCKX5_HUMAN	solute carrier family 24, member 5 precursor	128	Helical; Name=2; (Potential).				response to stimulus	integral to membrane|melanosome|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity				0		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		CTGCTTTCCTAGGTAAATATT	0.393													24	40	---	---	---	---	PASS
MAPK6	5597	broad.mit.edu	37	15	52353627	52353627	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52353627C>G	uc002abp.2	+	5	1791	c.997C>G	c.(997-999)CAT>GAT	p.H333D		NM_002748	NP_002739	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	333					cell cycle		ATP binding|MAP kinase activity			lung(3)|ovary(1)	4				all cancers(107;0.0028)		CCATCCTTTTCATATTGAAGA	0.353													19	49	---	---	---	---	PASS
RFX7	64864	broad.mit.edu	37	15	56385972	56385972	+	Silent	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56385972G>C	uc010bfn.2	-	9	3954	c.3954C>G	c.(3952-3954)ACC>ACG	p.T1318T	RFX7_uc010ugk.1_RNA|RFX7_uc002adn.1_Silent_p.T1132T	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	1221					regulation of transcription, DNA-dependent	nucleus	DNA binding				0						TATTACTTTTGGTGAGGTAAG	0.383													29	62	---	---	---	---	PASS
ADAM10	102	broad.mit.edu	37	15	58971384	58971384	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58971384C>G	uc002afd.1	-	4	867	c.423G>C	c.(421-423)GAG>GAC	p.E141D	ADAM10_uc010bgc.1_RNA|ADAM10_uc010ugz.1_Intron|ADAM10_uc002afe.1_Intron|ADAM10_uc002afg.2_Missense_Mutation_p.E141D	NM_001110	NP_001101	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10 precursor	141	Extracellular (Potential).				cell-cell signaling|constitutive protein ectodomain proteolysis|epidermal growth factor receptor signaling pathway|in utero embryonic development|integrin-mediated signaling pathway|monocyte activation|negative regulation of cell adhesion|Notch receptor processing|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of T cell chemotaxis|protein phosphorylation|response to tumor necrosis factor	cell surface|endomembrane system|Golgi-associated vesicle|integral to membrane|nucleus|plasma membrane	integrin binding|metalloendopeptidase activity|protein homodimerization activity|protein kinase binding|SH3 domain binding|zinc ion binding			skin(2)	2				GBM - Glioblastoma multiforme(80;0.202)		TAATATATCTCTCTGCTGGCT	0.368													15	29	---	---	---	---	PASS
CA12	771	broad.mit.edu	37	15	63634235	63634235	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63634235G>A	uc002amc.2	-	5	647	c.491C>T	c.(490-492)TCA>TTA	p.S164L	CA12_uc002amd.2_Missense_Mutation_p.S164L|CA12_uc002ame.2_Missense_Mutation_p.S104L	NM_001218	NP_001209	O43570	CAH12_HUMAN	carbonic anhydrase XII isoform 1 precursor	164	Extracellular (Potential).				one-carbon metabolic process	integral to membrane	carbonate dehydratase activity|zinc ion binding			ovary(1)	1					Acetazolamide(DB00819)	GAGGCCTTCTGACTTGTTGCT	0.473													16	19	---	---	---	---	PASS
HEXA	3073	broad.mit.edu	37	15	72639016	72639016	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72639016C>A	uc002aun.3	-	11	1389	c.1182G>T	c.(1180-1182)GAG>GAT	p.E394D	uc002aug.2_RNA|CELF6_uc002auk.3_Intron|HEXA_uc010ukn.1_Missense_Mutation_p.E405D|HEXA_uc002auo.3_Missense_Mutation_p.E257D|HEXA_uc010bix.2_Missense_Mutation_p.E394D|HEXA_uc010biy.2_Missense_Mutation_p.E257D|HEXA_uc010uko.1_Missense_Mutation_p.E220D|HEXA_uc010biz.1_RNA	NM_000520	NP_000511	P06865	HEXA_HUMAN	hexosaminidase A preproprotein	394					cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity			ovary(3)|upper_aerodigestive_tract(1)	4						CTGGAATATCCTCTCGCCACA	0.493													7	177	---	---	---	---	PASS
AP3B2	8120	broad.mit.edu	37	15	83332678	83332678	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83332678C>G	uc010uoh.1	-	19	2431	c.2254G>C	c.(2254-2256)GAG>CAG	p.E752Q	AP3B2_uc010uoi.1_Missense_Mutation_p.E771Q|AP3B2_uc010uoj.1_Missense_Mutation_p.E720Q|AP3B2_uc010bmp.2_5'Flank|AP3B2_uc010uog.1_Missense_Mutation_p.E388Q|AP3B2_uc002biy.1_5'Flank	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2	752	Glu/Ser-rich.				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)			CCTTTTCTCTCTGGCACCTTC	0.537													15	31	---	---	---	---	PASS
BNC1	646	broad.mit.edu	37	15	83935710	83935710	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83935710G>A	uc002bjt.1	-	3	401	c.313C>T	c.(313-315)CCC>TCC	p.P105S	BNC1_uc010uos.1_Missense_Mutation_p.P93S	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	105					epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						AGGCGAACGGGGATGGCCTGG	0.507													22	55	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84553954	84553954	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84553954G>T	uc002bjz.3	+	10	1286	c.1062G>T	c.(1060-1062)ACG>ACT	p.T354T	ADAMTSL3_uc010bmt.1_Silent_p.T354T|ADAMTSL3_uc010bmu.1_Silent_p.T354T	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	354						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			GCACTGTGACGTGTGGAGGAG	0.433													11	29	---	---	---	---	PASS
NTRK3	4916	broad.mit.edu	37	15	88678483	88678483	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88678483T>A	uc002bme.1	-	9	1215	c.1053A>T	c.(1051-1053)GAA>GAT	p.E351D	NTRK3_uc002bmh.2_Missense_Mutation_p.E351D|NTRK3_uc002bmf.1_Missense_Mutation_p.E351D|NTRK3_uc010upl.1_Missense_Mutation_p.E253D|NTRK3_uc010bnh.1_Missense_Mutation_p.E351D|NTRK3_uc002bmg.2_Missense_Mutation_p.E351D	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	351	Ig-like C2-type 2.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			CTTGGTAGTATTCCACATGGA	0.552			T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			19	73	---	---	---	---	PASS
ZSCAN10	84891	broad.mit.edu	37	16	3142733	3142733	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3142733C>A	uc002ctv.1	-	1	129	c.41G>T	c.(40-42)TGC>TTC	p.C14F	ZSCAN10_uc002cty.1_Intron|ZSCAN10_uc002ctw.1_Silent_p.L21L|ZSCAN10_uc002ctx.1_5'UTR	NM_032805	NP_116194	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	14	SCAN box.				negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						CCAGTGGCCGCAGAGCTCCCG	0.662													9	4	---	---	---	---	PASS
MEFV	4210	broad.mit.edu	37	16	3304583	3304583	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3304583C>G	uc002cun.1	-	2	525	c.485G>C	c.(484-486)AGA>ACA	p.R162T		NM_000243	NP_000234	O15553	MEFV_HUMAN	Mediterranean fever protein	162					inflammatory response	cytoplasm|microtubule|microtubule associated complex|nucleus	actin binding|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|lung(1)	6					Colchicine(DB01394)	GGCCTTCTCTCTGCGTTTGCT	0.761													5	2	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3778059	3778059	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3778059A>C	uc002cvv.2	-	31	7193	c.6989T>G	c.(6988-6990)CTC>CGC	p.L2330R	CREBBP_uc002cvw.2_Missense_Mutation_p.L2292R	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	2330					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CTGGCCAGGGAGATGCGAGGC	0.642			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				31	16	---	---	---	---	PASS
NOMO1	23420	broad.mit.edu	37	16	14960470	14960470	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14960470G>T	uc002dcv.2	+	15	1794	c.1728G>T	c.(1726-1728)CTG>CTT	p.L576L		NM_014287	NP_055102	Q15155	NOMO1_HUMAN	nodal modulator 1 precursor	576	Extracellular (Potential).					integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding			ovary(1)	1						TGGAAGTGCTGGAGGATGACA	0.507													6	111	---	---	---	---	PASS
GTF3C1	2975	broad.mit.edu	37	16	27497327	27497327	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27497327G>T	uc002dov.1	-	24	3889	c.3849C>A	c.(3847-3849)CTC>CTA	p.L1283L	GTF3C1_uc002dou.2_Silent_p.L1283L	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide	1283						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						CCTTGGTGTTGAGGACATTGC	0.642													5	75	---	---	---	---	PASS
MAZ	4150	broad.mit.edu	37	16	29819136	29819136	+	Nonsense_Mutation	SNP	A	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29819136A>T	uc002dty.2	+	2	1198	c.1030A>T	c.(1030-1032)AAG>TAG	p.K344*	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MAZ_uc002dtv.1_Intron|MAZ_uc010vdx.1_Nonsense_Mutation_p.K321*|MAZ_uc002dtw.2_Intron|MAZ_uc002dtx.2_Nonsense_Mutation_p.K344*|MAZ_uc010bzg.2_Intron|MAZ_uc002dtz.1_Nonsense_Mutation_p.K62*|MAZ_uc002dua.2_5'Flank|MAZ_uc010vdy.1_5'Flank	NM_002383	NP_002374	P56270	MAZ_HUMAN	MYC-associated zinc finger protein isoform 1	344	C2H2-type 4.				regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription|transcription initiation from RNA polymerase II promoter	nucleus	DNA binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1						CCACTGTGGCAAGAGCTTCTC	0.697													17	15	---	---	---	---	PASS
ZNF267	10308	broad.mit.edu	37	16	31926601	31926601	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31926601C>A	uc002ecs.3	+	4	1240	c.1031C>A	c.(1030-1032)CCT>CAT	p.P344H		NM_003414	NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	344					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						CAGATCATTCCTACCGAAGAG	0.363													7	176	---	---	---	---	PASS
ZNF267	10308	broad.mit.edu	37	16	31927618	31927618	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31927618C>G	uc002ecs.3	+	4	2257	c.2048C>G	c.(2047-2049)ACT>AGT	p.T683S		NM_003414	NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	683					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						AGAAGACATACTGGAGAGAGA	0.453													64	51	---	---	---	---	PASS
CHD9	80205	broad.mit.edu	37	16	53279391	53279391	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53279391G>T	uc002ehb.2	+	13	3362	c.3198G>T	c.(3196-3198)CAG>CAT	p.Q1066H	CHD9_uc002egy.2_Missense_Mutation_p.Q1066H|CHD9_uc002eha.1_Missense_Mutation_p.Q1066H|CHD9_uc002ehc.2_Missense_Mutation_p.Q1066H|CHD9_uc002ehf.2_Missense_Mutation_p.Q180H|CHD9_uc002ehd.2_Missense_Mutation_p.Q592H|CHD9_uc002ehe.1_Missense_Mutation_p.Q180H	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1066					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				CAGAGGAACAGGTATCCTATT	0.303													4	33	---	---	---	---	PASS
RPGRIP1L	23322	broad.mit.edu	37	16	53726041	53726041	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53726041G>T	uc002ehp.2	-	4	530	c.466C>A	c.(466-468)CGT>AGT	p.R156S	RPGRIP1L_uc002eho.3_Missense_Mutation_p.R156S|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.R156S|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.R156S|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.R156S|RPGRIP1L_uc002ehq.1_Missense_Mutation_p.R156S	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	156					negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)				GTGTTAATACGAGATTGTACA	0.378													4	107	---	---	---	---	PASS
NLRC5	84166	broad.mit.edu	37	16	57059801	57059801	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57059801A>G	uc002ekk.1	+	6	1171	c.946A>G	c.(946-948)ATG>GTG	p.M316V	NLRC5_uc010ccq.1_RNA|NLRC5_uc002ekn.2_Missense_Mutation_p.M121V|NLRC5_uc002ekl.2_Missense_Mutation_p.M121V|NLRC5_uc002ekm.2_Missense_Mutation_p.M121V|NLRC5_uc010ccr.1_RNA	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	316	NACHT.				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				CCTCCAGCCTATGGGTCCTGA	0.602													19	23	---	---	---	---	PASS
PDPR	55066	broad.mit.edu	37	16	70190383	70190383	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70190383G>T	uc002eyf.1	+	19	3198	c.2241G>T	c.(2239-2241)ATG>ATT	p.M747I	CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Missense_Mutation_p.M647I|PDPR_uc002eyg.1_Missense_Mutation_p.M414I|PDPR_uc002eyh.2_Missense_Mutation_p.M92I|PDPR_uc010vls.1_Missense_Mutation_p.M92I	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory	747					glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		CTTAGGGCATGGATTTCATTG	0.552													24	124	---	---	---	---	PASS
COG4	25839	broad.mit.edu	37	16	70543256	70543256	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70543256C>A	uc002ezc.2	-	7	891	c.880G>T	c.(880-882)GTG>TTG	p.V294L	COG4_uc002ezb.2_5'UTR|COG4_uc010cfu.2_RNA|COG4_uc002ezd.2_Missense_Mutation_p.V294L|COG4_uc002eze.2_5'UTR	NM_015386	NP_056201	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	290					Golgi organization|Golgi vesicle prefusion complex stabilization|protein transport|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0		Ovarian(137;0.0694)				TAGGTCTCCACTATTGGCTGG	0.463													15	19	---	---	---	---	PASS
PMFBP1	83449	broad.mit.edu	37	16	72170400	72170400	+	Missense_Mutation	SNP	C	G	G	rs149950926	byFrequency	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72170400C>G	uc002fcc.3	-	9	1322	c.1150G>C	c.(1150-1152)GAG>CAG	p.E384Q	PMFBP1_uc002fcd.2_Missense_Mutation_p.E384Q|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Missense_Mutation_p.E239Q	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	384	Potential.									ovary(2)	2		Ovarian(137;0.179)				AGCTGCAGCTCCTGCAGCCGG	0.557													10	30	---	---	---	---	PASS
BCMO1	53630	broad.mit.edu	37	16	81298358	81298358	+	Missense_Mutation	SNP	G	T	T	rs145899743		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81298358G>T	uc002fgn.1	+	5	803	c.585G>T	c.(583-585)AAG>AAT	p.K195N	BCMO1_uc010vnp.1_Missense_Mutation_p.K126N	NM_017429	NP_059125	Q9HAY6	BCDO1_HUMAN	beta-carotene 15,15'-monooxygenase	195					retinoid metabolic process|steroid metabolic process	cytosol	beta-carotene 15,15'-monooxygenase activity|metal ion binding|monooxygenase activity				0						GGAAGACAAAGTATGTGATTT	0.443													20	22	---	---	---	---	PASS
PLCG2	5336	broad.mit.edu	37	16	81819732	81819732	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81819732C>T	uc002fgt.2	+	2	290	c.138C>T	c.(136-138)ATC>ATT	p.I46I	PLCG2_uc010chg.1_Silent_p.I46I	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	46	PH.				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						TCCAGGTGATCATGGAGACGC	0.627													13	13	---	---	---	---	PASS
LRRC50	123872	broad.mit.edu	37	16	84182757	84182757	+	Intron	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84182757C>A	uc002fhl.3	+						LRRC50_uc010chi.1_Intron	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN	leucine rich repeat containing 50						axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0						GGTATGTGGGCATACTCCTAA	0.333									Kartagener_syndrome				10	18	---	---	---	---	PASS
SMYD4	114826	broad.mit.edu	37	17	1687711	1687711	+	Silent	SNP	G	A	A	rs144396164		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1687711G>A	uc002ftm.3	-	8	2097	c.1929C>T	c.(1927-1929)TCC>TCT	p.S643S	SMYD4_uc002ftn.1_Silent_p.S498S	NM_052928	NP_443160	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	643							zinc ion binding			skin(3)|kidney(2)	5						TGCTGACGGCGGATTCTGCAC	0.547											OREG0024075	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	35	---	---	---	---	PASS
UBE2G1	7326	broad.mit.edu	37	17	4192629	4192629	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4192629C>A	uc002fxs.2	-	4	680	c.322G>T	c.(322-324)GAG>TAG	p.E108*		NM_003342	NP_003333	P62253	UB2G1_HUMAN	ubiquitin-conjugating enzyme E2G 1	108					protein K48-linked ubiquitination|protein K63-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0						CAGCGTTCCTCTGGCTTTTCA	0.428													5	63	---	---	---	---	PASS
ZNF594	84622	broad.mit.edu	37	17	5086471	5086471	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5086471C>A	uc010cla.1	-	2	1237	c.1081G>T	c.(1081-1083)GAG>TAG	p.E361*		NM_032530	NP_115919	Q96JF6	ZN594_HUMAN	zinc finger protein 594	361	C2H2-type 9; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(1)	3						CTAAGCTCCTCATCCTTGCTG	0.453													6	149	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577505	7577505	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577505T>A	uc002gim.2	-	7	970	c.776A>T	c.(775-777)GAC>GTC	p.D259V	TP53_uc002gig.1_Missense_Mutation_p.D259V|TP53_uc002gih.2_Missense_Mutation_p.D259V|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.D127V|TP53_uc010cng.1_Missense_Mutation_p.D127V|TP53_uc002gii.1_Missense_Mutation_p.D127V|TP53_uc010cnh.1_Missense_Mutation_p.D259V|TP53_uc010cni.1_Missense_Mutation_p.D259V|TP53_uc002gij.2_Missense_Mutation_p.D259V|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.D166V|TP53_uc002gio.2_Missense_Mutation_p.D127V	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	259	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		D -> Y (in sporadic cancers; somatic mutation).|D -> A (in a sporadic cancer; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).|D -> S (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> N (in sporadic cancers; somatic mutation).|D -> V (in sporadic cancers; somatic mutation).|D -> G (in sporadic cancers; somatic mutation).|D -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.D259Y(19)|p.D259V(13)|p.0?(7)|p.D259N(6)|p.D259fs*86(4)|p.D259G(4)|p.D259fs*5(3)|p.D259E(3)|p.D259D(2)|p.?(1)|p.E258fs*85(1)|p.E258fs*71(1)|p.E258fs*2(1)|p.E258_S260delEDS(1)|p.D259S(1)|p.D259H(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGACCTGGAGTCTTCCAGTGT	0.587		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			8	12	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577506	7577506	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577506C>A	uc002gim.2	-	7	969	c.775G>T	c.(775-777)GAC>TAC	p.D259Y	TP53_uc002gig.1_Missense_Mutation_p.D259Y|TP53_uc002gih.2_Missense_Mutation_p.D259Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.D127Y|TP53_uc010cng.1_Missense_Mutation_p.D127Y|TP53_uc002gii.1_Missense_Mutation_p.D127Y|TP53_uc010cnh.1_Missense_Mutation_p.D259Y|TP53_uc010cni.1_Missense_Mutation_p.D259Y|TP53_uc002gij.2_Missense_Mutation_p.D259Y|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.D166Y|TP53_uc002gio.2_Missense_Mutation_p.D127Y	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	259	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		D -> Y (in sporadic cancers; somatic mutation).|D -> A (in a sporadic cancer; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).|D -> S (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> N (in sporadic cancers; somatic mutation).|D -> V (in sporadic cancers; somatic mutation).|D -> G (in sporadic cancers; somatic mutation).|D -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.D259Y(19)|p.D259V(13)|p.0?(7)|p.D259N(6)|p.D259fs*86(4)|p.D259G(4)|p.D259fs*5(3)|p.D259E(3)|p.D259D(2)|p.?(1)|p.E258fs*85(1)|p.E258fs*71(1)|p.E258fs*2(1)|p.E258_S260delEDS(1)|p.D259S(1)|p.D259H(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GACCTGGAGTCTTCCAGTGTG	0.582		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			8	12	---	---	---	---	PASS
TOP3A	7156	broad.mit.edu	37	17	18196077	18196077	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18196077C>T	uc002gsx.1	-	11	1392	c.1163G>A	c.(1162-1164)CGC>CAC	p.R388H	TOP3A_uc010cpz.1_5'Flank|TOP3A_uc010vxr.1_Intron|TOP3A_uc002gsw.1_Intron|TOP3A_uc010vxs.1_Missense_Mutation_p.R286H	NM_004618	NP_004609	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	388					DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(3)	3						GGCCCCCCAGCGTGGATCGGG	0.547													27	26	---	---	---	---	PASS
KCNH4	23415	broad.mit.edu	37	17	40332908	40332908	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40332908G>T	uc002hzb.2	-	1	389	c.56C>A	c.(55-57)GCC>GAC	p.A19D		NM_012285	NP_036417	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H,	19	Cytoplasmic (Potential).|PAS.				regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	two-component sensor activity|voltage-gated potassium channel activity			large_intestine(1)	1		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AAAACGGGTGGCGATGGTGTC	0.652													24	96	---	---	---	---	PASS
KCNH4	23415	broad.mit.edu	37	17	40332909	40332909	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40332909C>T	uc002hzb.2	-	1	388	c.55G>A	c.(55-57)GCC>ACC	p.A19T		NM_012285	NP_036417	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H,	19	Cytoplasmic (Potential).|PAS.				regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	two-component sensor activity|voltage-gated potassium channel activity			large_intestine(1)	1		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AAACGGGTGGCGATGGTGTCC	0.652													25	94	---	---	---	---	PASS
PTRF	284119	broad.mit.edu	37	17	40575028	40575028	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40575028G>C	uc002hzo.2	-	1	247	c.88C>G	c.(88-90)CAG>GAG	p.Q30E	PTRF_uc010wgi.1_Missense_Mutation_p.Q30E	NM_012232	NP_036364	Q6NZI2	PTRF_HUMAN	polymerase I and transcript release factor	30					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription initiation from RNA polymerase I promoter	caveola|cytosol|endoplasmic reticulum|microsome|mitochondrion|nucleoplasm	protein binding|rRNA primary transcript binding			breast(1)	1		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		TCCGCTGCCTGAGCCCCAGCG	0.677													9	13	---	---	---	---	PASS
PTRF	284119	broad.mit.edu	37	17	40575045	40575045	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40575045G>A	uc002hzo.2	-	1	230	c.71C>T	c.(70-72)CCT>CTT	p.P24L	PTRF_uc010wgi.1_Missense_Mutation_p.P24L	NM_012232	NP_036364	Q6NZI2	PTRF_HUMAN	polymerase I and transcript release factor	24					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription initiation from RNA polymerase I promoter	caveola|cytosol|endoplasmic reticulum|microsome|mitochondrion|nucleoplasm	protein binding|rRNA primary transcript binding			breast(1)	1		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		AGCGGAGGAAGGCTCCGGGGC	0.711													9	9	---	---	---	---	PASS
BECN1	8678	broad.mit.edu	37	17	40966595	40966595	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40966595C>G	uc002ibo.3	-	9	1062	c.927G>C	c.(925-927)CAG>CAC	p.Q309H	BECN1_uc010whb.1_Missense_Mutation_p.Q222H|BECN1_uc010whc.1_Missense_Mutation_p.Q233H|BECN1_uc002ibn.2_Missense_Mutation_p.Q309H	NM_003766	NP_003757	Q14457	BECN1_HUMAN	beclin 1	309					anti-apoptosis|cell cycle|cellular defense response|cytokinesis|response to virus	membrane	protein binding			ovary(1)	1		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		GCAACACAGTCTGGCCCCAAG	0.493													15	56	---	---	---	---	PASS
RUNDC1	146923	broad.mit.edu	37	17	41143505	41143505	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41143505G>A	uc002ici.1	+	5	1626	c.1614G>A	c.(1612-1614)TTG>TTA	p.L538L	RUNDC1_uc010whi.1_Silent_p.L308L	NM_173079	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	538	RUN.										0		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		ACTCAGAATTGAAGGCCTTGG	0.562													9	18	---	---	---	---	PASS
GPATCH8	23131	broad.mit.edu	37	17	42478693	42478693	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42478693G>T	uc002igw.1	-	8	816	c.752C>A	c.(751-753)TCT>TAT	p.S251Y	GPATCH8_uc002igv.1_Missense_Mutation_p.S173Y|GPATCH8_uc010wiz.1_Missense_Mutation_p.S173Y	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	251						intracellular	nucleic acid binding|zinc ion binding			ovary(2)|kidney(1)|skin(1)	4		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		GGAGAATTCAGATCCCAGGCC	0.502													31	74	---	---	---	---	PASS
ACBD4	79777	broad.mit.edu	37	17	43214419	43214419	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43214419G>C	uc002iid.2	+	5	672	c.328G>C	c.(328-330)GAG>CAG	p.E110Q	ACBD4_uc010wjj.1_Missense_Mutation_p.E110Q|ACBD4_uc002iie.2_Missense_Mutation_p.E110Q|ACBD4_uc002iif.2_Missense_Mutation_p.E110Q|ACBD4_uc002iic.2_Missense_Mutation_p.E110Q|ACBD4_uc010dae.2_Missense_Mutation_p.E32Q	NM_001135707	NP_001129179	Q8NC06	ACBD4_HUMAN	acyl-Coenzyme A binding domain containing 4	110							fatty-acyl-CoA binding			ovary(1)|kidney(1)	2						TGAGGTGGCAGAGGACATGTT	0.622													6	19	---	---	---	---	PASS
KIAA1267	284058	broad.mit.edu	37	17	44248240	44248240	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44248240C>A	uc002ikb.2	-	1	1355	c.1270G>T	c.(1270-1272)GAG>TAG	p.E424*	KIAA1267_uc002ikc.2_Nonsense_Mutation_p.E424*|KIAA1267_uc002ikd.2_Nonsense_Mutation_p.E424*|KIAA1267_uc010dav.2_Nonsense_Mutation_p.E424*	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058	424						MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				TGACGCTGCTCGGGATCAGCT	0.463													6	377	---	---	---	---	PASS
C17orf57	124989	broad.mit.edu	37	17	45405708	45405708	+	5'UTR	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45405708C>A	uc002iln.2	+	4					ITGB3_uc010wkr.1_RNA|C17orf57_uc002ilm.2_5'UTR|C17orf57_uc002ill.1_5'UTR|C17orf57_uc010daz.1_5'UTR	NM_152347	NP_689560	Q8IY85	CQ057_HUMAN	hypothetical protein LOC124989								calcium ion binding			breast(1)|central_nervous_system(1)|skin(1)	3						GAATTTACCTCTAAACAGAAA	0.303													6	138	---	---	---	---	PASS
RSAD1	55316	broad.mit.edu	37	17	48560734	48560734	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48560734G>A	uc002iqw.1	+	6	994	c.938G>A	c.(937-939)GGA>GAA	p.G313E	RSAD1_uc010wmq.1_RNA	NM_018346	NP_060816	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing	313					porphyrin biosynthetic process	mitochondrion	4 iron, 4 sulfur cluster binding|coproporphyrinogen oxidase activity|metal ion binding				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CAGGGGGCTGGAGGCCACACC	0.547													4	11	---	---	---	---	PASS
DGKE	8526	broad.mit.edu	37	17	54912380	54912380	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54912380G>T	uc002iur.2	+	2	404	c.224G>T	c.(223-225)TGC>TTC	p.C75F	DGKE_uc002ius.1_Missense_Mutation_p.C75F|C17orf67_uc002iuq.2_5'Flank	NM_003647	NP_003638	P52429	DGKE_HUMAN	diacylglycerol kinase epsilon	75	Phorbol-ester/DAG-type 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding			breast(2)	2	Breast(9;3.59e-07)					ACCTACTGCTGCGTGTGCGCG	0.687													7	23	---	---	---	---	PASS
BZRAP1	9256	broad.mit.edu	37	17	56387418	56387418	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56387418C>T	uc002ivx.3	-	21	4672	c.3801G>A	c.(3799-3801)GAG>GAA	p.E1267E	BZRAP1_uc010dcs.2_Silent_p.E1207E|BZRAP1_uc010wnt.1_Silent_p.E1267E	NM_004758	NP_004749	O95153	RIMB1_HUMAN	peripheral benzodiazepine receptor-associated	1267	Poly-Glu.					mitochondrion	benzodiazepine receptor binding			upper_aerodigestive_tract(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					cctcctcctcctcctcttcct	0.468													22	59	---	---	---	---	PASS
BCAS3	54828	broad.mit.edu	37	17	59155868	59155868	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59155868G>T	uc002iyv.3	+	22	2459	c.2350G>T	c.(2350-2352)GAT>TAT	p.D784Y	BCAS3_uc002iyu.3_Missense_Mutation_p.D769Y|BCAS3_uc002iyw.3_Missense_Mutation_p.D765Y|BCAS3_uc002iyy.3_Missense_Mutation_p.D540Y|BCAS3_uc002iyz.3_Missense_Mutation_p.D338Y|BCAS3_uc002iza.3_Missense_Mutation_p.D323Y	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1	784						nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TGATACAGATGATCTTGATCT	0.408													16	30	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62034644	62034644	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62034644G>T	uc002jds.1	-	13	2331	c.2254C>A	c.(2254-2256)CTC>ATC	p.L752I		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	752	II.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	AAGACGATGAGGAAGGAGTGG	0.577													5	72	---	---	---	---	PASS
DDX5	1655	broad.mit.edu	37	17	62500359	62500359	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62500359A>C	uc002jek.2	-	3	535	c.288T>G	c.(286-288)TTT>TTG	p.F96L	CCDC45_uc002jem.2_5'Flank|CCDC45_uc002jen.2_5'Flank|CCDC45_uc010wqb.1_5'Flank|DDX5_uc010deh.2_Missense_Mutation_p.F96L|DDX5_uc002jej.2_5'UTR|DDX5_uc010wqa.1_Intron|DDX5_uc002jel.1_5'Flank	NM_004396	NP_004387	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5	96	Q motif.				cell growth|regulation of alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA helicase activity|transcription cofactor activity			ovary(2)|lung(1)	3	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			TGGCTTCATAAAAATTTAGAA	0.393			T	ETV4	prostate								26	75	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78322000	78322000	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78322000C>T	uc002jyh.1	+	4	4307	c.4084C>T	c.(4084-4086)CAC>TAC	p.H1362Y		NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GGAGTACTTTCACAGACAGAG	0.597													4	30	---	---	---	---	PASS
PYCR1	5831	broad.mit.edu	37	17	79891161	79891161	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79891161C>T	uc002kcr.1	-	7	1167	c.889G>A	c.(889-891)GGG>AGG	p.G297R	PYCR1_uc002kcq.1_3'UTR|PYCR1_uc002kcp.2_Intron|PYCR1_uc002kcs.1_3'UTR|PYCR1_uc010wvd.1_Missense_Mutation_p.G324R|PYCR1_uc002kct.1_Missense_Mutation_p.G297R|PYCR1_uc002kcu.1_Missense_Mutation_p.G266R	NM_006907	NP_008838	P32322	P5CR1_HUMAN	pyrroline-5-carboxylate reductase 1 isoform 1	297					cellular response to oxidative stress|proline biosynthetic process	mitochondrial matrix	binding|pyrroline-5-carboxylate reductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		L-Proline(DB00172)|NADH(DB00157)	AGAGCGGTCCCTGCAGGGGAG	0.637													13	28	---	---	---	---	PASS
FASN	2194	broad.mit.edu	37	17	80053236	80053236	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80053236C>T	uc002kdu.2	-	3	357	c.240G>A	c.(238-240)CGG>CGA	p.R80R		NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase	80	Beta-ketoacyl synthase (By similarity).				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	CCAGCAGCAGCCGCAGCTGAG	0.632													11	10	---	---	---	---	PASS
C17orf101	79701	broad.mit.edu	37	17	80369398	80369398	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80369398G>A	uc002keu.1	-	3	414	c.313C>T	c.(313-315)CCC>TCC	p.P105S	C17orf101_uc002ket.1_Missense_Mutation_p.P105S|C17orf101_uc010dip.1_RNA	NM_024648	NP_078924	Q6PK18	CQ101_HUMAN	hypothetical protein LOC79701 isoform 1	105	Lumenal (Potential).					integral to membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(1)	1						CACTTTCGGGGAGTGCAGCCT	0.622													16	30	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6949175	6949175	+	Silent	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6949175T>C	uc002knm.2	-	59	8575	c.8481A>G	c.(8479-8481)GGA>GGG	p.G2827G	LAMA1_uc002knk.2_Silent_p.G157G|LAMA1_uc002knl.2_Silent_p.G280G|LAMA1_uc010wzj.1_Silent_p.G2303G	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2827	Laminin G-like 4.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCAGCATGGTTCCATCTCCCA	0.483													7	34	---	---	---	---	PASS
ANKRD12	23253	broad.mit.edu	37	18	9256230	9256230	+	Missense_Mutation	SNP	G	T	T	rs35253121	byFrequency	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9256230G>T	uc002knv.2	+	9	3222	c.2965G>T	c.(2965-2967)GGT>TGT	p.G989C	ANKRD12_uc002knw.2_Missense_Mutation_p.G966C|ANKRD12_uc002knx.2_Missense_Mutation_p.G966C|ANKRD12_uc010dkx.1_Missense_Mutation_p.G696C	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	989						nucleus				ovary(2)|central_nervous_system(1)	3						TATAGTAGACGGTAATAAAGC	0.274													14	57	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18608740	18608740	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18608740C>T	uc002kte.2	-	10	2149	c.1208G>A	c.(1207-1209)CGT>CAT	p.R403H		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	403	Interaction with FHOD1.|AGC-kinase C-terminal.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					TACTTACCTACGATTGCTATA	0.308													18	58	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22804669	22804669	+	Silent	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22804669G>C	uc002kvk.2	-	4	3460	c.3213C>G	c.(3211-3213)CTC>CTG	p.L1071L	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Silent_p.L1071L|ZNF521_uc002kvl.2_Silent_p.L851L	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	1071	C2H2-type 25; degenerate.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GGAATTCTTTGAGGCAAGATG	0.522			T	PAX5	ALL								17	47	---	---	---	---	PASS
RNF125	54941	broad.mit.edu	37	18	29648306	29648306	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29648306C>T	uc002kxf.1	+	6	1040	c.658C>T	c.(658-660)CGG>TGG	p.R220W		NM_017831	NP_060301	Q96EQ8	RN125_HUMAN	ring finger protein 125	220					negative regulation of type I interferon production	intracellular	ligase activity|zinc ion binding				0						AGTCTTAGACCGGTCACTTCT	0.328													7	34	---	---	---	---	PASS
SYT4	6860	broad.mit.edu	37	18	40850348	40850348	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40850348G>A	uc002law.2	-	4	1605	c.1236C>T	c.(1234-1236)CCC>CCT	p.P412P	SYT4_uc010dng.2_RNA|SYT4_uc010xcm.1_Silent_p.P394P|SYT4_uc010dnh.2_RNA	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	412	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			skin(5)	5						TTTGTCTCCTGGGGTAGTCAC	0.488													64	163	---	---	---	---	PASS
ME2	4200	broad.mit.edu	37	18	48434457	48434457	+	Nonsense_Mutation	SNP	C	T	T	rs138563580		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48434457C>T	uc002ley.2	+	3	389	c.133C>T	c.(133-135)CGA>TGA	p.R45*	ME2_uc010dpd.2_Nonsense_Mutation_p.R45*	NM_002396	NP_002387	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial	45					malate metabolic process	mitochondrial matrix	electron carrier activity|malate dehydrogenase (decarboxylating) activity|malate dehydrogenase (oxaloacetate-decarboxylating) activity|metal ion binding|NAD binding				0		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)	NADH(DB00157)	TTTACAAGAACGACAAATGCT	0.338													15	54	---	---	---	---	PASS
CTDP1	9150	broad.mit.edu	37	18	77475153	77475153	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77475153G>T	uc002lnh.1	+	8	1840	c.1693G>T	c.(1693-1695)GGG>TGG	p.G565W	CTDP1_uc002lni.1_Missense_Mutation_p.G565W|CTDP1_uc010drd.1_Missense_Mutation_p.G565W	NM_004715	NP_004706	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,	565					positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CGAGCTGTCGGGGGTCACTGC	0.582													4	17	---	---	---	---	PASS
STXBP2	6813	broad.mit.edu	37	19	7712063	7712063	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7712063C>T	uc002mha.3	+	17	1513	c.1468C>T	c.(1468-1470)CGG>TGG	p.R490W	STXBP2_uc002mhb.3_Missense_Mutation_p.R487W|STXBP2_uc010dvj.2_RNA|STXBP2_uc010xjr.1_Missense_Mutation_p.R501W|STXBP2_uc010dvk.2_Missense_Mutation_p.R458W|STXBP2_uc002mhc.3_Missense_Mutation_p.R226W|STXBP2_uc002mhe.1_3'UTR	NM_006949	NP_008880	Q15833	STXB2_HUMAN	syntaxin binding protein 2 isoform a	490					leukocyte mediated cytotoxicity|neutrophil degranulation|protein transport|regulation of mast cell degranulation|vesicle docking involved in exocytosis	azurophil granule|cytolytic granule|cytosol|specific granule|tertiary granule	syntaxin-3 binding			central_nervous_system(1)	1						CGTGGAGGACCGGCTGGACAG	0.637													5	11	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8993007	8993007	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8993007T>C	uc002mkp.2	-	67	41956	c.41752A>G	c.(41752-41754)ACC>GCC	p.T13918A	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.T735A|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13921	Extracellular (Potential).			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GAATACTCACTGCTGGTGGTG	0.532													29	82	---	---	---	---	PASS
ZNF560	147741	broad.mit.edu	37	19	9577339	9577339	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9577339G>C	uc002mlp.1	-	10	2494	c.2284C>G	c.(2284-2286)CAT>GAT	p.H762D	ZNF560_uc010dwr.1_Missense_Mutation_p.H656D	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560	762	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						TCTCCCATATGAGTTCTTAAA	0.433													26	88	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10083669	10083669	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10083669A>G	uc002mmq.1	-	51	3786	c.3700T>C	c.(3700-3702)TCA>CCA	p.S1234P		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	1234	Triple-helical region.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			GATGGGCCTGAGTCCCCCTTT	0.592													3	10	---	---	---	---	PASS
DOCK6	57572	broad.mit.edu	37	19	11362852	11362852	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11362852G>A	uc002mqs.3	-	5	491	c.450C>T	c.(448-450)CCC>CCT	p.P150P		NM_020812	NP_065863	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	150					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						AGACCTGGCGGGGGAGGCCCT	0.627													3	5	---	---	---	---	PASS
CCDC151	115948	broad.mit.edu	37	19	11537557	11537557	+	Silent	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11537557C>G	uc002mrs.2	-	5	803	c.660G>C	c.(658-660)GCG>GCC	p.A220A	CCDC151_uc002mrr.2_Silent_p.A155A|CCDC151_uc010dxz.2_Intron	NM_145045	NP_659482	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	220	Potential.									ovary(1)	1						CGGCCTCCTGCGCCTTCATCT	0.622													4	11	---	---	---	---	PASS
ELAVL3	1995	broad.mit.edu	37	19	11577040	11577040	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11577040C>T	uc002mry.1	-	3	660	c.280G>A	c.(280-282)GAC>AAC	p.D94N	ELAVL3_uc002mrx.1_Missense_Mutation_p.D94N	NM_001420	NP_001411	Q14576	ELAV3_HUMAN	ELAV-like protein 3 isoform 1	94	RRM 1.				cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)|skin(1)	3						ATGGCTTTGTCTGCATCATTG	0.547													15	48	---	---	---	---	PASS
FARSA	2193	broad.mit.edu	37	19	13041515	13041515	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13041515C>T	uc002mvs.2	-	2	244	c.196G>A	c.(196-198)GAG>AAG	p.E66K	FARSA_uc002mvt.2_RNA|FARSA_uc010xmv.1_Missense_Mutation_p.E66K|FARSA_uc010dyy.1_Intron	NM_004461	NP_004452	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	66					phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|phenylalanine-tRNA ligase activity|protein binding|tRNA binding			ovary(1)	1					L-Phenylalanine(DB00120)	TCCTCGCCCTCCGCAGTAAGC	0.632													15	21	---	---	---	---	PASS
OR7A10	390892	broad.mit.edu	37	19	14951900	14951900	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14951900C>G	uc002mzx.1	-	1	790	c.790G>C	c.(790-792)GCC>CCC	p.A264P		NM_001005190	NP_001005190	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A,	264	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					TTGTGGGTGGCAGCAGAACTA	0.483													25	52	---	---	---	---	PASS
SLC35E1	79939	broad.mit.edu	37	19	16664518	16664518	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16664518G>T	uc010xph.1	-	6	1223	c.1205C>A	c.(1204-1206)TCG>TAG	p.S402*	MED26_uc002nee.2_Intron	NM_024881	NP_079157	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	402					transport	integral to membrane				ovary(1)|central_nervous_system(1)	2						CAAACTGTACGAGTTTGGGTA	0.542													5	107	---	---	---	---	PASS
SFRS14	10147	broad.mit.edu	37	19	19112431	19112431	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19112431G>T	uc002nkx.2	-	8	3128	c.2982C>A	c.(2980-2982)TCC>TCA	p.S994S	SFRS14_uc002nkz.1_Silent_p.S1008S|SFRS14_uc002nla.1_Silent_p.S994S|SFRS14_uc002nlb.2_Silent_p.S994S|SFRS14_uc010xqk.1_Silent_p.S763S	NM_014884	NP_055699	Q8IX01	SUGP2_HUMAN	splicing factor, arginine/serine-rich 14	994					mRNA processing|RNA splicing	nucleus	RNA binding				0			OV - Ovarian serous cystadenocarcinoma(5;3.05e-05)|Epithelial(12;0.00161)			CCTTCTTTTTGGACATGGGAC	0.433													5	52	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22941187	22941187	+	Silent	SNP	A	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22941187A>T	uc010xrh.1	-	5	1251	c.1251T>A	c.(1249-1251)CCT>CCA	p.P417P		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CACATTTGCAAGGTTTCTCTT	0.348													19	50	---	---	---	---	PASS
CHST8	64377	broad.mit.edu	37	19	34262868	34262868	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34262868C>T	uc002nus.3	+	5	680	c.175C>T	c.(175-177)CCA>TCA	p.P59S	CHST8_uc002nut.3_Missense_Mutation_p.P59S|CHST8_uc002nuu.2_Missense_Mutation_p.P59S	NM_001127895	NP_001121367	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0)	59	Lumenal (Potential).				carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)					CCAGGACCTCCCACCAGGCGG	0.637													14	34	---	---	---	---	PASS
CD22	933	broad.mit.edu	37	19	35823475	35823475	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35823475C>A	uc010edt.2	+	3	137	c.60C>A	c.(58-60)GAC>GAA	p.D20E	CD22_uc010xst.1_5'UTR|CD22_uc010edu.2_Missense_Mutation_p.D20E|CD22_uc010edv.2_Missense_Mutation_p.D20E|CD22_uc002nzb.3_Missense_Mutation_p.D20E	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	20	Extracellular (Potential).|Ig-like V-type.				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	CTTTCTCTGACTCAAGTAAAT	0.458													9	23	---	---	---	---	PASS
ZNF585B	92285	broad.mit.edu	37	19	37680650	37680650	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37680650G>C	uc002ofq.2	-	4	459	c.205C>G	c.(205-207)CAA>GAA	p.Q69E	ZNF585B_uc002ofr.1_Translation_Start_Site	NM_152279	NP_689492	Q52M93	Z585B_HUMAN	zinc finger protein 585B	69	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTAGGAACTTGATACCCTGTT	0.468													7	42	---	---	---	---	PASS
ZNF383	163087	broad.mit.edu	37	19	37734138	37734138	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37734138G>T	uc002oft.1	+	8	1580	c.1000G>T	c.(1000-1002)GGT>TGT	p.G334C	ZNF383_uc002ofs.1_Missense_Mutation_p.G269C|ZNF383_uc002ofu.1_Missense_Mutation_p.G334C	NM_152604	NP_689817	Q8NA42	ZN383_HUMAN	zinc finger protein 383	334					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AATTCATACTGGTGAGAAACC	0.428													6	94	---	---	---	---	PASS
SUPT5H	6829	broad.mit.edu	37	19	39966828	39966828	+	Intron	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39966828G>A	uc002olo.3	+						SUPT5H_uc002olp.3_Intron|SUPT5H_uc002olq.3_Intron|SUPT5H_uc002oln.3_Intron|SUPT5H_uc002olr.3_Intron	NM_001111020	NP_001104490	O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog isoform a						cell cycle|chromatin remodeling|mRNA capping|negative regulation of transcription elongation, DNA-dependent|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|response to organic substance|retroviral genome replication|transcription elongation from RNA polymerase II promoter	nucleoplasm	enzyme binding|protein heterodimerization activity			ovary(3)|pancreas(1)	4	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TAAGGGCAGGGGGCAAGGAGA	0.572													9	25	---	---	---	---	PASS
RPS19	6223	broad.mit.edu	37	19	42373788	42373788	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42373788C>T	uc002ort.2	+	5	748	c.376C>T	c.(376-378)CAG>TAG	p.Q126*		NM_001022	NP_001013	P39019	RS19_HUMAN	ribosomal protein S19	126					endocrine pancreas development|erythrocyte differentiation|gas transport|positive regulation of cellular component movement|response to extracellular stimulus|ribosomal small subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						ACTGACACCTCAGGGACAAAG	0.617									Diamond-Blackfan_Anemia				13	53	---	---	---	---	PASS
CLPTM1	1209	broad.mit.edu	37	19	45493665	45493665	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45493665G>T	uc002pai.2	+	10	1160	c.1145G>T	c.(1144-1146)TGG>TTG	p.W382L	CLPTM1_uc010xxf.1_Missense_Mutation_p.W280L|CLPTM1_uc010xxg.1_Missense_Mutation_p.W368L	NM_001294	NP_001285	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane	382	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane				ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		ATCCAGTTCTGGAACAGCCGG	0.627													5	87	---	---	---	---	PASS
GRWD1	83743	broad.mit.edu	37	19	48949683	48949683	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48949683G>T	uc002pjd.2	+	2	462	c.229G>T	c.(229-231)GGA>TGA	p.G77*		NM_031485	NP_113673	Q9BQ67	GRWD1_HUMAN	glutamate-rich WD repeat containing 1	77						nucleolus				ovary(1)	1		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000206)|all cancers(93;0.000207)|Epithelial(262;0.0125)|GBM - Glioblastoma multiforme(486;0.0222)		GGATCACCTGGGAGACAACCG	0.552											OREG0025607	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	46	---	---	---	---	PASS
RCN3	57333	broad.mit.edu	37	19	50040310	50040310	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50040310G>C	uc002poj.2	+	4	913	c.466G>C	c.(466-468)GAG>CAG	p.E156Q		NM_020650	NP_065701	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain	156						endoplasmic reticulum lumen	calcium ion binding|protein binding			ovary(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		TCATGACGTGGAGGATGCAGA	0.532													51	146	---	---	---	---	PASS
SIGLEC11	114132	broad.mit.edu	37	19	50463852	50463852	+	Silent	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50463852C>G	uc010ybh.1	-	2	508	c.417G>C	c.(415-417)GTG>GTC	p.V139V	SIGLEC11_uc010ybi.1_Silent_p.V139V	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1	139	Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		AACTATGTCTCACACGGCTTC	0.567													10	39	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54401227	54401227	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54401227C>A	uc002qcq.1	+	10	1236	c.954C>A	c.(952-954)GGC>GGA	p.G318G	PRKCG_uc010yef.1_Missense_Mutation_p.A289D|PRKCG_uc010yeg.1_Silent_p.G318G|PRKCG_uc010yeh.1_Silent_p.G205G	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	318					activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		TGCGGATGGGcccctcttcct	0.478													20	50	---	---	---	---	PASS
LILRA2	11027	broad.mit.edu	37	19	55086892	55086892	+	Silent	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55086892C>T	uc002qgg.3	+	5	914	c.825C>T	c.(823-825)CTC>CTT	p.L275L	LILRA2_uc010ern.2_Silent_p.L275L|LILRA2_uc002qgf.2_Silent_p.L275L|LILRA2_uc010yfe.1_Silent_p.L275L|LILRA2_uc010yff.1_Silent_p.L263L|LILRA2_uc010ero.2_Silent_p.L263L|LILRA2_uc010yfg.1_Intron	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	275	Ig-like C2-type 3.|Extracellular (Potential).				defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		AGGCTGGGCTCTCCCAGGCCA	0.617													12	47	---	---	---	---	PASS
PTPRH	5794	broad.mit.edu	37	19	55713428	55713428	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55713428G>T	uc002qjq.2	-	6	1222	c.1149C>A	c.(1147-1149)ACC>ACA	p.T383T	PTPRH_uc010esv.2_Silent_p.T205T|PTPRH_uc002qjs.2_Silent_p.T390T	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	383	Extracellular (Potential).|Fibronectin type-III 4.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		TCTCACCTGTGGTGGCATTTC	0.483													9	544	---	---	---	---	PASS
BRSK1	84446	broad.mit.edu	37	19	55813535	55813535	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55813535C>A	uc002qkg.2	+	9	1133	c.856C>A	c.(856-858)CTA>ATA	p.L286I	BRSK1_uc002qkf.2_Missense_Mutation_p.L302I|BRSK1_uc002qkh.2_5'UTR	NM_032430	NP_115806	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	286					establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		TCCTTGGTACCTGTGAGTATG	0.562											OREG0025680	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	924	---	---	---	---	PASS
UBE2S	27338	broad.mit.edu	37	19	55912921	55912921	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55912921G>T	uc002qkx.1	-	4	920	c.552C>A	c.(550-552)GCC>GCA	p.A184A		NM_014501	NP_055316	Q16763	UBE2S_HUMAN	ubiquitin-conjugating enzyme E2S	184					activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|exit from mitosis|free ubiquitin chain polymerization|protein K11-linked ubiquitination|protein K27-linked ubiquitination|protein K29-linked ubiquitination|protein K6-linked ubiquitination|protein K63-linked ubiquitination	anaphase-promoting complex	ATP binding|ubiquitin-protein ligase activity				0	Breast(117;0.155)		LUSC - Lung squamous cell carcinoma(43;0.13)|BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.11)		GGCCCCCTGGGGCCCCAGGGT	0.701													8	182	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56369237	56369237	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56369237G>T	uc002qmd.3	+	3	900	c.478G>T	c.(478-480)GGA>TGA	p.G160*	NLRP4_uc002qmf.2_Nonsense_Mutation_p.G85*|NLRP4_uc010etf.2_5'UTR	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	160	NACHT.|ATP (Potential).						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		ACAAGGAATTGGAAAAACGAC	0.473													12	889	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56372833	56372833	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56372833G>T	uc002qmd.3	+	4	2360	c.1938G>T	c.(1936-1938)CAG>CAT	p.Q646H	NLRP4_uc002qmf.2_Missense_Mutation_p.Q571H|NLRP4_uc010etf.2_Missense_Mutation_p.Q477H	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	646	LRR 1.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TCCAGGTGCAGGACAGCACCC	0.567													10	568	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56372849	56372849	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56372849G>T	uc002qmd.3	+	4	2376	c.1954G>T	c.(1954-1956)GAG>TAG	p.E652*	NLRP4_uc002qmf.2_Nonsense_Mutation_p.E577*|NLRP4_uc010etf.2_Nonsense_Mutation_p.E483*	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	652	LRR 1.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CACCCTCAGCGAGTCGACCTT	0.567													7	597	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56423905	56423905	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56423905C>A	uc010ygg.1	-	5	1303	c.1278G>T	c.(1276-1278)ATG>ATT	p.M426I		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	426	NACHT.						ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TCCAACACACCATGGGGGCAC	0.438													12	911	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56465898	56465898	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56465898G>T	uc002qmh.2	+	3	545	c.474G>T	c.(472-474)ATG>ATT	p.M158I	NLRP8_uc010etg.2_Missense_Mutation_p.M158I	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	158						cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CGAATGTGATGGAAAAGTTTT	0.423													13	857	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56549482	56549482	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56549482G>T	uc002qmj.2	+	10	2707	c.2707G>T	c.(2707-2709)GGA>TGA	p.G903*	NLRP5_uc002qmi.2_Nonsense_Mutation_p.G884*	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	903	LRR 7.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GAGCCTGGCAGGAAACAAGGT	0.542													11	929	---	---	---	---	PASS
GALP	85569	broad.mit.edu	37	19	56694541	56694541	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56694541G>T	uc002qmo.1	+	5	337	c.255G>T	c.(253-255)AAG>AAT	p.K85N	GALP_uc010eti.2_3'UTR	NM_033106	NP_149097	Q9UBC7	GALP_HUMAN	galanin-like peptide isoform 1 precursor	85					neuropeptide signaling pathway	extracellular region	hormone activity				0		Colorectal(82;0.000147)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0507)		AGCCCTCCAAGAGGAATGTGA	0.388													9	637	---	---	---	---	PASS
ZSCAN5B	342933	broad.mit.edu	37	19	56701770	56701770	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56701770G>T	uc010ygh.1	-	4	914	c.914C>A	c.(913-915)TCC>TAC	p.S305Y		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	305					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TTGGGAAATGGAGGAGGCATC	0.537													14	914	---	---	---	---	PASS
ZSCAN5A	79149	broad.mit.edu	37	19	56733294	56733294	+	Nonsense_Mutation	SNP	C	A	A	rs142761513	byFrequency	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56733294C>A	uc002qmq.2	-	5	1307	c.1141G>T	c.(1141-1143)GAG>TAG	p.E381*	ZSCAN5A_uc010ygi.1_Nonsense_Mutation_p.E264*|ZSCAN5A_uc002qmr.2_Nonsense_Mutation_p.E381*|ZSCAN5A_uc002qms.1_Nonsense_Mutation_p.E380*	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	381					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						AAGAGTCTCTCGCCTGTGTGT	0.517													10	559	---	---	---	---	PASS
ZSCAN5A	79149	broad.mit.edu	37	19	56733549	56733549	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56733549T>C	uc002qmq.2	-	5	1052	c.886A>G	c.(886-888)AGT>GGT	p.S296G	ZSCAN5A_uc010ygi.1_Missense_Mutation_p.S179G|ZSCAN5A_uc002qmr.2_Missense_Mutation_p.S296G|ZSCAN5A_uc002qms.1_Missense_Mutation_p.S295G	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	296					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						CTTTTGGGACTGCTCAGATTC	0.542													774	59	---	---	---	---	PASS
ZSCAN5A	79149	broad.mit.edu	37	19	56733550	56733550	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56733550G>T	uc002qmq.2	-	5	1051	c.885C>A	c.(883-885)AGC>AGA	p.S295R	ZSCAN5A_uc010ygi.1_Missense_Mutation_p.S178R|ZSCAN5A_uc002qmr.2_Missense_Mutation_p.S295R|ZSCAN5A_uc002qms.1_Missense_Mutation_p.S294R	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	295					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						TTTTGGGACTGCTCAGATTCA	0.542													776	58	---	---	---	---	PASS
BTBD3	22903	broad.mit.edu	37	20	11899249	11899249	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11899249G>T	uc002wnz.2	+	1	685	c.326G>T	c.(325-327)AGA>ATA	p.R109I	BTBD3_uc002wny.2_Missense_Mutation_p.R48I|BTBD3_uc002woa.2_Missense_Mutation_p.R48I|BTBD3_uc010zrf.1_5'UTR|BTBD3_uc010zrg.1_5'Flank|BTBD3_uc010zrh.1_5'Flank	NM_014962	NP_055777	Q9Y2F9	BTBD3_HUMAN	BTB/POZ domain containing protein 3 isoform a	109										ovary(2)|central_nervous_system(1)	3						ATTAGAGAGAGGTAAGTGCCG	0.448													6	93	---	---	---	---	PASS
SEL1L2	80343	broad.mit.edu	37	20	13971175	13971175	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13971175C>G	uc010gcf.2	-	1	88	c.6G>C	c.(4-6)AAG>AAC	p.K2N	SEL1L2_uc002woq.3_5'UTR|SEL1L2_uc010zrl.1_Missense_Mutation_p.K2N|SEL1L2_uc002wor.2_Intron	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	2						integral to membrane	binding			ovary(2)	2						GAGACAAGGGCTTCATCTTCT	0.433													18	35	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16360239	16360239	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16360239C>T	uc002wpg.1	-	19	2566	c.2408G>A	c.(2407-2409)CGG>CAG	p.R803Q	KIF16B_uc002wpe.1_Missense_Mutation_p.R185Q|KIF16B_uc002wpf.1_Missense_Mutation_p.R185Q|KIF16B_uc010gch.1_Missense_Mutation_p.R803Q|KIF16B_uc010gci.1_Missense_Mutation_p.R803Q|KIF16B_uc010gcj.1_Missense_Mutation_p.R814Q	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	803	Glu-rich.|Potential.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity	p.R803L(1)		skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						CTCCTTCACCCGCAGGAGGGA	0.567													18	32	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20232414	20232414	+	Intron	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20232414C>A	uc002wru.2	+						C20orf26_uc010zse.1_Intron|C20orf26_uc002wrw.2_Intron|C20orf26_uc002wrv.2_Intron	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		CCAGGTAAGGCCGGGCACAGG	0.592													18	30	---	---	---	---	PASS
PAX1	5075	broad.mit.edu	37	20	21689189	21689189	+	Intron	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21689189C>A	uc002wsj.2	+						PAX1_uc010zsl.1_Intron|PAX1_uc010zsm.1_Intron	NM_006192	NP_006183	P15863	PAX1_HUMAN	paired box 1						regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding			upper_aerodigestive_tract(1)|kidney(1)	2						TCCTCTCTCTCCTGCAGGGGC	0.632													22	58	---	---	---	---	PASS
CST7	8530	broad.mit.edu	37	20	24938088	24938088	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24938088T>C	uc002wtx.1	+	2	512	c.302T>C	c.(301-303)CTA>CCA	p.L101P		NM_003650	NP_003641	O76096	CYTF_HUMAN	cystatin F	79					immune response	cytoplasm|extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1						ACAAGGGCCCTAGTTCAGGTA	0.532													18	64	---	---	---	---	PASS
SUN5	140732	broad.mit.edu	37	20	31573704	31573704	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31573704G>T	uc002wyi.2	-	11	828	c.735C>A	c.(733-735)AAC>AAA	p.N245K		NM_080675	NP_542406	Q8TC36	SUN5_HUMAN	sperm associated antigen 4-like	245	SUN.				spermatogenesis					skin(1)	1						CAGGTGTCACGTTGGGCTAGA	0.517													5	46	---	---	---	---	PASS
RBM12	10137	broad.mit.edu	37	20	34240640	34240640	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34240640T>C	uc002xdq.2	-	3	2837	c.2605A>G	c.(2605-2607)ATT>GTT	p.I869V	CPNE1_uc010zvj.1_Intron|CPNE1_uc002xde.2_Intron|CPNE1_uc002xdf.2_Intron|CPNE1_uc002xdg.2_Intron|CPNE1_uc010gfi.2_Intron|CPNE1_uc010gfj.2_Intron|CPNE1_uc002xdh.2_Intron|CPNE1_uc002xdi.2_Intron|CPNE1_uc002xdj.2_Intron|CPNE1_uc002xdk.2_Intron|CPNE1_uc002xdl.2_Intron|CPNE1_uc002xdm.2_Intron|CPNE1_uc010gfk.1_Intron|CPNE1_uc002xdn.1_Intron|CPNE1_uc002xdo.1_Intron|CPNE1_uc002xdp.1_Intron|RBM12_uc002xdr.2_Missense_Mutation_p.I869V|RBM12_uc002xds.2_Missense_Mutation_p.I869V	NM_152838	NP_690051	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	869	RRM 3.					nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			ATCTCATCAATAGACACAGTA	0.393													42	39	---	---	---	---	PASS
C20orf117	140710	broad.mit.edu	37	20	35443706	35443706	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35443706G>A	uc002xgd.1	-	5	1752	c.1425C>T	c.(1423-1425)ATC>ATT	p.I475I	C20orf117_uc002xge.1_RNA	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2	475											0		Myeloproliferative disorder(115;0.00874)				GGCGCACCAGGATGGCATGGA	0.627													16	52	---	---	---	---	PASS
C20orf117	140710	broad.mit.edu	37	20	35443718	35443718	+	Silent	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35443718G>C	uc002xgd.1	-	5	1740	c.1413C>G	c.(1411-1413)CTC>CTG	p.L471L	C20orf117_uc002xge.1_RNA	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2	471											0		Myeloproliferative disorder(115;0.00874)				TGGCATGGATGAGCTTGGTGT	0.637													11	45	---	---	---	---	PASS
C20orf117	140710	broad.mit.edu	37	20	35444418	35444418	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35444418G>A	uc002xgd.1	-	5	1040	c.713C>T	c.(712-714)GCT>GTT	p.A238V	C20orf117_uc002xge.1_RNA	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2	238											0		Myeloproliferative disorder(115;0.00874)				GTCCATCTCAGCCCGCAGGCC	0.657													16	13	---	---	---	---	PASS
RALGAPB	57148	broad.mit.edu	37	20	37137763	37137763	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37137763G>T	uc002xiw.2	+	6	1041	c.784G>T	c.(784-786)GTT>TTT	p.V262F	RALGAPB_uc010zvz.1_Missense_Mutation_p.V262F|RALGAPB_uc002xix.2_Missense_Mutation_p.V262F|RALGAPB_uc002xiy.1_Missense_Mutation_p.V262F|RALGAPB_uc002xiz.2_Missense_Mutation_p.V40F|RALGAPB_uc002xja.1_5'UTR	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	262					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						TGCATTTAAAGTTCCCGATGA	0.373													68	70	---	---	---	---	PASS
RALGAPB	57148	broad.mit.edu	37	20	37146532	37146532	+	Silent	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37146532C>A	uc002xiw.2	+	9	1563	c.1306C>A	c.(1306-1308)CGG>AGG	p.R436R	RALGAPB_uc010zvz.1_Silent_p.R436R|RALGAPB_uc002xix.2_Silent_p.R436R|RALGAPB_uc002xiy.1_Silent_p.R436R|RALGAPB_uc002xiz.2_Silent_p.R214R|RALGAPB_uc002xja.1_Silent_p.R163R	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	436					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						GCCTGCCCCTCGGAGACCAAA	0.468													6	121	---	---	---	---	PASS
KCNS1	3787	broad.mit.edu	37	20	43723776	43723776	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43723776G>T	uc002xnc.2	-	5	1713	c.1316C>A	c.(1315-1317)TCA>TAA	p.S439*	KCNS1_uc002xnd.2_Nonsense_Mutation_p.S439*	NM_002251	NP_002242	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel	439	Helical; Name=Segment S6; (Potential).					voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity|protein binding				0		Myeloproliferative disorder(115;0.0122)				GATGCAGCCTGAGGCTGCCAG	0.612													15	73	---	---	---	---	PASS
MATN4	8785	broad.mit.edu	37	20	43933243	43933243	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43933243C>A	uc002xnn.2	-	3	455	c.268G>T	c.(268-270)GCG>TCG	p.A90S	MATN4_uc002xno.2_Missense_Mutation_p.A90S|MATN4_uc002xnp.2_Missense_Mutation_p.A90S|MATN4_uc010zwr.1_Missense_Mutation_p.A38S|MATN4_uc002xnr.1_Missense_Mutation_p.A90S|RBPJL_uc002xns.2_5'Flank|RBPJL_uc002xnt.2_5'Flank	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	90	VWFA 1.					extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)				CGAGAGAACGCGCGGAGAGGG	0.647													6	35	---	---	---	---	PASS
PIGT	51604	broad.mit.edu	37	20	44050036	44050036	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44050036G>T	uc002xoh.1	+	9	1120	c.1047G>T	c.(1045-1047)GTG>GTT	p.V349V	PIGT_uc010ghd.1_Silent_p.V256V|PIGT_uc010ghc.1_RNA|PIGT_uc010ghe.1_Silent_p.V312V|PIGT_uc010ghf.1_Silent_p.V302V|PIGT_uc002xoj.1_Intron|PIGT_uc002xok.1_Silent_p.V314V|PIGT_uc010zwu.1_Silent_p.V87V|PIGT_uc002xoi.1_RNA|PIGT_uc010zwv.1_Silent_p.V87V|PIGT_uc010zww.1_Silent_p.V293V|PIGT_uc010zwx.1_Silent_p.V184V|PIGT_uc010zwy.1_Silent_p.V247V|PIGT_uc010zwz.1_Silent_p.V87V|PIGT_uc010zxa.1_Silent_p.V187V|PIGT_uc002xol.1_Intron|PIGT_uc010zxb.1_Silent_p.V25V|PIGT_uc002xom.1_5'Flank	NM_015937	NP_057021	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	349	Lumenal (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)				CCCCCCCAGTGCCCTTCCTGC	0.587													6	30	---	---	---	---	PASS
PLTP	5360	broad.mit.edu	37	20	44533736	44533736	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44533736C>T	uc002xqn.1	-	9	807	c.727G>A	c.(727-729)GAG>AAG	p.E243K	PLTP_uc002xql.1_Missense_Mutation_p.E155K|PLTP_uc002xqm.1_Missense_Mutation_p.E263K|PLTP_uc002xqo.1_Missense_Mutation_p.E191K|PLTP_uc002xqp.1_Missense_Mutation_p.E243K|PLTP_uc002xqq.1_Missense_Mutation_p.E212K|PLTP_uc010zxj.1_Missense_Mutation_p.E148K|PLTP_uc010ghj.1_Missense_Mutation_p.E243K	NM_006227	NP_006218	P55058	PLTP_HUMAN	phospholipid transfer protein isoform a	243					cellular lipid metabolic process|lipid transport	extracellular region	lipid binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				CAGTTCCTCTCAGTCAGGGGG	0.632													10	57	---	---	---	---	PASS
ZNF335	63925	broad.mit.edu	37	20	44581131	44581131	+	Silent	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44581131T>A	uc002xqw.2	-	20	2967	c.2844A>T	c.(2842-2844)CCA>CCT	p.P948P	ZNF335_uc002xqv.2_Silent_p.P60P|ZNF335_uc010zxk.1_Silent_p.P793P	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	948					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				CATCTGGACTTGGGAAGGAGA	0.627													90	56	---	---	---	---	PASS
SNAI1	6615	broad.mit.edu	37	20	48600442	48600442	+	Missense_Mutation	SNP	C	T	T	rs137950928		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48600442C>T	uc002xuz.2	+	2	234	c.164C>T	c.(163-165)TCG>TTG	p.S55L		NM_005985	NP_005976	O95863	SNAI1_HUMAN	snail 1 homolog	55					epithelial to mesenchymal transition|mesoderm formation|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|zinc ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			CCCACCGCCTCGCTGCCAATG	0.637													9	84	---	---	---	---	PASS
TAF4	6874	broad.mit.edu	37	20	60572686	60572686	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60572686C>G	uc002ybs.2	-	14	3010	c.3010G>C	c.(3010-3012)GCC>CCC	p.A1004P		NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4	1004					interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			GTGAGGTTGGCGTCCCGCTGT	0.502													16	53	---	---	---	---	PASS
TAF4	6874	broad.mit.edu	37	20	60589753	60589753	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60589753G>T	uc002ybs.2	-	2	1371	c.1371C>A	c.(1369-1371)CTC>CTA	p.L457L		NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4	457					interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CACTTCGGACGAGGACCATTC	0.617													5	81	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22910160	22910160	+	Intron	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22910160C>A	uc002yld.1	+						NCAM2_uc011acb.1_Intron	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TATTTTTTATCTTCCAGAAAA	0.299													13	17	---	---	---	---	PASS
CLDN17	26285	broad.mit.edu	37	21	31538660	31538660	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31538660C>G	uc011acv.1	-	1	276	c.276G>C	c.(274-276)TTG>TTC	p.L92F		NM_012131	NP_036263	P56750	CLD17_HUMAN	claudin 17	92	Helical; (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	Golgi apparatus|integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(2)	2						GCAGGGCGATCAAGGAGAGAG	0.567													20	34	---	---	---	---	PASS
SON	6651	broad.mit.edu	37	21	34921900	34921900	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34921900G>T	uc002yse.1	+	3	412	c.363G>T	c.(361-363)AAG>AAT	p.K121N	SON_uc002ysb.1_Missense_Mutation_p.K121N|SON_uc002ysc.2_Missense_Mutation_p.K121N|SON_uc002ysd.2_5'UTR|SON_uc002ysf.1_Intron|SON_uc002ysg.2_5'Flank	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	121					anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						agaagaaaaagaagaaagaaa	0.279											OREG0003562	type=REGULATORY REGION|Gene=AK091233|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	10	19	---	---	---	---	PASS
RIPK4	54101	broad.mit.edu	37	21	43161628	43161628	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43161628G>A	uc002yzn.1	-	8	1773	c.1725C>T	c.(1723-1725)CAC>CAT	p.H575H		NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3	575						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						AGGCAGCGTAGTGCAGTGGCA	0.672													12	19	---	---	---	---	PASS
DGCR8	54487	broad.mit.edu	37	22	20094896	20094896	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20094896G>T	uc002zri.2	+	12	2449	c.2099G>T	c.(2098-2100)CGT>CTT	p.R700L	DGCR8_uc010grz.2_Missense_Mutation_p.R667L|DGCR8_uc002zrj.2_Missense_Mutation_p.R343L	NM_022720	NP_073557	Q8WYQ5	DGCR8_HUMAN	DiGeorge syndrome critical region gene 8	700	Necessary for heme-binding and pri-miRNA processing.|Necessary for interaction with DROSHA.				primary miRNA processing	cytoplasm|cytoplasm|microtubule cytoskeleton|nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding				0	Colorectal(54;0.0993)					ATGTATGGCCGTGAGAGCAGC	0.552													15	44	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23252756	23252756	+	Intron	SNP	G	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23252756G>C	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						ATTTGGTGGAGGAACCCAGCT	0.478													8	28	---	---	---	---	PASS
HPS4	89781	broad.mit.edu	37	22	26860753	26860753	+	Silent	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26860753G>A	uc003acl.2	-	11	1502	c.843C>T	c.(841-843)GCC>GCT	p.A281A	HPS4_uc003aci.2_Silent_p.A276A|HPS4_uc003acj.2_Silent_p.A145A|HPS4_uc003ack.2_Silent_p.A72A|HPS4_uc003acn.2_Silent_p.A127A|HPS4_uc010gvd.1_Silent_p.A299A|HPS4_uc003ach.2_Silent_p.A16A	NM_022081	NP_071364	Q9NQG7	HPS4_HUMAN	light ear protein isoform a	281					lysosome organization|positive regulation of eye pigmentation|protein stabilization|protein targeting	lysosome|melanosome|membrane fraction|platelet dense granule	protein homodimerization activity				0						GATGGTGCTGGGCTGAACCAT	0.572									Hermansky-Pudlak_syndrome				13	31	---	---	---	---	PASS
C22orf42	150297	broad.mit.edu	37	22	32555004	32555004	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32555004G>T	uc003amd.2	-	1	240	c.199C>A	c.(199-201)CCG>ACG	p.P67T		NM_001010859	NP_001010859	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	67										ovary(1)|skin(1)	2						GGCGTCTTCGGGAGGCTGAGG	0.552													7	205	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41565505	41565505	+	Splice_Site	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41565505A>G	uc003azl.3	+	26	4568	c.4173_splice	c.e26-2	p.R1391_splice		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300						apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						CATTTTGTATAGGAGAGTATA	0.373			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				22	27	---	---	---	---	PASS
PRR5	55615	broad.mit.edu	37	22	45133115	45133115	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45133115G>T	uc003bfb.1	+	8	1427	c.1155G>T	c.(1153-1155)CAG>CAT	p.Q385H	PRR5_uc003bew.1_Missense_Mutation_p.Q376H|PRR5_uc003bex.1_Missense_Mutation_p.Q290H|PRR5_uc010gzt.1_Missense_Mutation_p.Q408H|PRR5_uc010gzu.1_Missense_Mutation_p.Q349H|PRR5_uc003bey.1_Missense_Mutation_p.Q376H|PRR5_uc003bez.1_Missense_Mutation_p.Q290H|PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc003bfd.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|PRR5_uc003bfa.1_Missense_Mutation_p.Q278H|PRR5_uc003bfe.1_RNA|PRR5-ARHGAP8_uc003bfg.1_Intron|PRR5_uc003bfh.1_Missense_Mutation_p.Q284H	NM_181333	NP_851850	P85299	PRR5_HUMAN	proline rich 5 (renal) isoform 1	385					cell cycle					skin(1)	1		all_neural(38;0.00409)|Ovarian(80;0.024)|Glioma(61;0.0647)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)		GGGGCCGGCAGAGTGTCGTGT	0.587													10	20	---	---	---	---	PASS
GRAMD4	23151	broad.mit.edu	37	22	47058931	47058931	+	Intron	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47058931C>G	uc003bhx.2	+						GRAMD4_uc010had.2_Intron	NM_015124	NP_055939	Q6IC98	GRAM4_HUMAN	death-inducing-protein						apoptosis	integral to membrane|mitochondrial membrane				ovary(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		TCCCTGCCCCCTGCAGAGCGC	0.701													7	15	---	---	---	---	PASS
KAL1	3730	broad.mit.edu	37	X	8503661	8503661	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8503661T>A	uc004csf.2	-	12	1963	c.1813A>T	c.(1813-1815)ATT>TTT	p.I605F		NM_000216	NP_000207	P23352	KALM_HUMAN	Kallmann syndrome 1 protein precursor	605	Fibronectin type-III 4.				axon guidance|cell adhesion|cellular component movement	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|serine-type endopeptidase inhibitor activity			ovary(3)|pancreas(1)	4						TGTGAAATAATGCTGTTGGGT	0.493													17	16	---	---	---	---	PASS
GEMIN8	54960	broad.mit.edu	37	X	14027118	14027118	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14027118T>C	uc004cwb.2	-	5	986	c.643A>G	c.(643-645)ATG>GTG	p.M215V	GEMIN8_uc004cwc.2_Missense_Mutation_p.M215V|GEMIN8_uc004cwd.2_Missense_Mutation_p.M215V	NM_017856	NP_060326	Q9NWZ8	GEMI8_HUMAN	gem (nuclear organelle) associated protein 8	215					spliceosomal snRNP assembly	Cajal body|cytoplasm|SMN complex|spliceosomal complex	protein binding				0						GCGGCCTCCATGGCTTGGATC	0.627													18	22	---	---	---	---	PASS
GPR64	10149	broad.mit.edu	37	X	19021038	19021038	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19021038A>G	uc004cyx.2	-	24	2320	c.2156T>C	c.(2155-2157)ATG>ACG	p.M719T	GPR64_uc004cyy.2_Missense_Mutation_p.M716T|GPR64_uc004cyz.2_Missense_Mutation_p.M705T|GPR64_uc004czb.2_Missense_Mutation_p.M719T|GPR64_uc004czc.2_Missense_Mutation_p.M703T|GPR64_uc004czd.2_Missense_Mutation_p.M695T|GPR64_uc004cze.2_Missense_Mutation_p.M689T|GPR64_uc004czf.2_Missense_Mutation_p.M681T|GPR64_uc004cza.2_Missense_Mutation_p.M697T|GPR64_uc004cyw.2_Missense_Mutation_p.M703T|GPR64_uc010nfj.2_Missense_Mutation_p.M600T	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64 isoform 1	719	Cytoplasmic (Potential).				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity				0	Hepatocellular(33;0.183)					GGCCAGGTACATATGGAATGC	0.413													45	19	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	28807456	28807456	+	5'UTR	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:28807456G>T	uc004dby.2	+	2						NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1						innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						TTTAAGAGCTGGAAGATGAAA	0.353													4	27	---	---	---	---	PASS
PPP1R3F	89801	broad.mit.edu	37	X	49143531	49143531	+	Silent	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49143531C>G	uc004dnh.1	+	4	2395	c.2379C>G	c.(2377-2379)CTC>CTG	p.L793L	PPP1R3F_uc011mnd.1_Silent_p.L464L|PPP1R3F_uc004dni.2_Silent_p.L447L|PPP1R3F_uc004dnj.1_Silent_p.L447L	NM_033215	NP_149992	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory (inhibitor)	793	Cytoplasmic (Potential).					integral to membrane				ovary(2)|skin(1)	3	Ovarian(276;0.236)					CGCTGTGCCTCTCTCTGGCTT	0.612													12	8	---	---	---	---	PASS
UBQLN2	29978	broad.mit.edu	37	X	56591546	56591546	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56591546C>T	uc004dus.2	+	1	1475	c.1240C>T	c.(1240-1242)CCG>TCG	p.P414S	UBQLN2_uc011moq.1_Missense_Mutation_p.P414S	NM_013444	NP_038472	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	414						cytoplasm|nucleus|plasma membrane	binding			ovary(1)|skin(1)	2						GCTGAATAGCCCGCTGTTTAC	0.537													8	9	---	---	---	---	PASS
MAGEE1	57692	broad.mit.edu	37	X	75649174	75649174	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75649174T>C	uc004ecm.1	+	1	1058	c.851T>C	c.(850-852)TTG>TCG	p.L284S		NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	284	Pro-rich.					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane				breast(3)|ovary(1)|pancreas(1)|skin(1)	6						AGCATCTCCTTGGTGCCCACC	0.692													8	9	---	---	---	---	PASS
NAP1L3	4675	broad.mit.edu	37	X	92927345	92927345	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92927345T>A	uc004efq.2	-	1	1264	c.959A>T	c.(958-960)AAG>ATG	p.K320M	FAM133A_uc004efr.1_5'Flank	NM_004538	NP_004529	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	320					nucleosome assembly	chromatin assembly complex				ovary(1)|skin(1)	2						GTCAACATTCTTTAAAACAAT	0.438													17	17	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105075047	105075047	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105075047G>A	uc004emd.2	+	2	361	c.58G>A	c.(58-60)GAT>AAT	p.D20N	NRK_uc010npc.1_5'UTR	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	20							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						TTTTTTGCAGGATCCAACTGG	0.249										HNSCC(51;0.14)			12	7	---	---	---	---	PASS
XPNPEP2	7512	broad.mit.edu	37	X	128902323	128902323	+	Silent	SNP	G	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128902323G>T	uc004eut.1	+	21	2131	c.1887G>T	c.(1885-1887)CTG>CTT	p.L629L		NM_003399	NP_003390	O43895	XPP2_HUMAN	X-prolyl aminopeptidase 2, membrane-bound	629					cellular process|proteolysis	anchored to membrane|plasma membrane	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0						GTCCAGAGCTGCAGAGGCGCC	0.612													16	9	---	---	---	---	PASS
CXorf66	347487	broad.mit.edu	37	X	139038193	139038193	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139038193C>A	uc004fbb.2	-	3	970	c.948G>T	c.(946-948)AGG>AGT	p.R316S		NM_001013403	NP_001013421	Q5JRM2	CX066_HUMAN	hypothetical protein LOC347487 precursor	316	Cytoplasmic (Potential).					integral to membrane					0						ATGCATTGTTCCTGGAATCTA	0.378													34	25	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140995703	140995703	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140995703C>G	uc004fbt.2	+	4	2799	c.2513C>G	c.(2512-2514)ACT>AGT	p.T838S	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	838							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CCCTCCTCCACTTCATCGAGT	0.552										HNSCC(15;0.026)			44	53	---	---	---	---	PASS
BGN	633	broad.mit.edu	37	X	152773694	152773694	+	Intron	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152773694C>G	uc004fhr.1	+						BGN_uc004fhq.1_Intron	NM_001711	NP_001702	P21810	PGS1_HUMAN	biglycan preproprotein							proteinaceous extracellular matrix|transport vesicle	extracellular matrix structural constituent			breast(2)	2	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GACCCGGCCTCTCTGCCTTCA	0.602													52	23	---	---	---	---	PASS
BGN	633	broad.mit.edu	37	X	152773715	152773715	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152773715C>G	uc004fhr.1	+	8	1091	c.919C>G	c.(919-921)CTG>GTG	p.L307V	BGN_uc004fhq.1_RNA	NM_001711	NP_001702	P21810	PGS1_HUMAN	biglycan preproprotein	307	LRR 10.					proteinaceous extracellular matrix|transport vesicle	extracellular matrix structural constituent			breast(2)	2	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGTGGTCTATCTGCACTCCAA	0.597													67	33	---	---	---	---	PASS
USP9Y	8287	broad.mit.edu	37	Y	14888737	14888737	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:14888737A>G	uc004fst.1	+	19	3527	c.2582A>G	c.(2581-2583)TAC>TGC	p.Y861C	USP9Y_uc010nwu.1_RNA	NM_004654	NP_004645	O00507	USP9Y_HUMAN	ubiquitin specific protease 9, Y-linked	861					BMP signaling pathway|protein deubiquitination|spermatogenesis|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity				0						ATAAAAGAGTACATTAATGAA	0.323													14	18	---	---	---	---	PASS
PRDM16	63976	broad.mit.edu	37	1	3252909	3252910	+	Intron	DEL	TG	-	-	rs35612143		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3252909_3252910delTG	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		tacatgcacatgtgtgtgtgca	0.045			T	EVI1	MDS|AML								4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	3404146	3404146	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3404146delA								ARHGEF16 (6471 upstream) : MEGF6 (367 downstream)																							tGTTAAGCTGAAAAGGTGTGT	0.209													4	2	---	---	---	---	
DNAJC11	55735	broad.mit.edu	37	1	6696159	6696159	+	Intron	DEL	G	-	-	rs147404991	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6696159delG	uc001aof.2	-						DNAJC11_uc010nzt.1_Intron|DNAJC11_uc001aog.2_Intron|DNAJC11_uc010nzu.1_Intron	NM_018198	NP_060668	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11						protein folding		heat shock protein binding|unfolded protein binding			ovary(1)|skin(1)	2	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		TGGTGACTGCGAAGGGACGGC	0.627													16	10	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	7559589	7559590	+	Intron	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7559589_7559590delGT	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		atgtatatgagtgtgtgtgtgt	0.178													4	2	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	7752040	7752043	+	Intron	DEL	GGAG	-	-	rs112512045		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7752040_7752043delGGAG	uc001aoi.2	+						CAMTA1_uc010nzv.1_Intron|CAMTA1_uc001aok.3_Intron	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		agggaaggaaggagggagggaggg	0.206													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	9283352	9283360	+	IGR	DEL	TCATCTTCT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9283352_9283360delTCATCTTCT								MIR34A (71516 upstream) : H6PD (11503 downstream)																							ttcttcttcgtcatcttcttcatcttctt	0.000													5	3	---	---	---	---	
RBP7	116362	broad.mit.edu	37	1	10068112	10068112	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10068112delA	uc001aqq.2	+						RBP7_uc009vms.2_Intron	NM_052960	NP_443192	Q96R05	RET7_HUMAN	retinol binding protein 7, cellular							cytoplasm	retinal binding|retinol binding|transporter activity				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|BRCA - Breast invasive adenocarcinoma(304;0.000302)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00856)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	actccatctcaaaaaaaaaaa	0.189													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	11679417	11679417	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11679417delT								PTCHD2 (81778 upstream) : FBXO2 (29033 downstream)																							agtaaccaacttgcccatgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	13949349	13949349	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13949349delA								PDPN (4899 upstream) : PRDM2 (77386 downstream)																							CCCCCTTTACATGTGCGCCAT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	14232051	14232051	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14232051delT								PRDM2 (80479 upstream) : KAZ (693162 downstream)																							aagtctcatcttccctgatgt	0.000													3	3	---	---	---	---	
FHAD1	114827	broad.mit.edu	37	1	15720104	15720104	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15720104delT	uc001awb.2	+						FHAD1_uc010obl.1_Intron|FHAD1_uc001awe.1_Intron|FHAD1_uc001awg.2_Intron	NM_052929	NP_443161	B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding											skin(1)	1						AGTCTTGGGCttttttttttt	0.149													3	3	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16936139	16936140	+	Intron	DEL	TC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16936139_16936140delTC	uc009vos.1	-						NBPF1_uc001aza.3_Intron|NBPF1_uc001azb.1_Intron|NBPF1_uc001azc.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		agagacaaaatctctaattgcc	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18376102	18376106	+	IGR	DEL	GTAGT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18376102_18376106delGTAGT								ACTL8 (222546 upstream) : IGSF21 (58134 downstream)																							gatggtgctggtagtgtggtggtgg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18430206	18430207	+	IGR	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18430206_18430207delTG								ACTL8 (276650 upstream) : IGSF21 (4033 downstream)																							tgtgtggacatgtgtgtgtgtt	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20505705	20505706	+	IGR	INS	-	TG	TG	rs139820513	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20505705_20505706insTG								PLA2G2C (4018 upstream) : UBXN10 (6872 downstream)																							GTCAGTTTCTCtgtgtgtgtgt	0.297													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20506015	20506016	+	IGR	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20506015_20506016delTG								PLA2G2C (4328 upstream) : UBXN10 (6562 downstream)																							TGTCAGTTTCtgtgtgtgtgtg	0.277													5	3	---	---	---	---	
CDA	978	broad.mit.edu	37	1	20939700	20939700	+	Intron	DEL	T	-	-	rs34293111		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20939700delT	uc001bdk.2	+						CDA_uc001bdl.2_Intron|CDA_uc009vpv.2_Intron	NM_001785	NP_001776	P32320	CDD_HUMAN	cytidine deaminase						cell surface receptor linked signaling pathway|cytosine metabolic process|negative regulation of cell growth|negative regulation of nucleotide metabolic process|protein homotetramerization|pyrimidine nucleoside salvage	cytosol|extracellular region	cytidine deaminase activity|nucleoside binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Lung NSC(340;1.75e-08)|all_lung(284;5.99e-08)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|GBM - Glioblastoma multiforme(114;1.06e-08)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000148)|Kidney(64;0.000184)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.199)	Azacitidine(DB00928)|Capecitabine(DB01101)|Cytarabine(DB00987)|Gemcitabine(DB00441)	ccTTCTGCAAttttttttttt	0.015													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	22489246	22489247	+	IGR	INS	-	G	G	rs144102922	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22489246_22489247insG								WNT4 (18861 upstream) : ZBTB40 (289097 downstream)																							GTGTCTTCTCAGAAGGGGATGG	0.589													4	2	---	---	---	---	
UBXN11	91544	broad.mit.edu	37	1	26633978	26633980	+	5'Flank	DEL	TAA	-	-	rs28365910		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26633978_26633980delTAA	uc001blw.2	-						UBXN11_uc001blz.1_5'Flank|UBXN11_uc001bly.2_5'Flank|UBXN11_uc001blx.2_5'Flank|UBXN11_uc001bma.2_Intron|UBXN11_uc001bmb.1_5'Flank|UBXN11_uc010ofb.1_5'Flank|UBXN11_uc010ofc.1_5'Flank	NM_183008	NP_892120	Q5T124	UBX11_HUMAN	socius isoform 2							cytoplasm|cytoskeleton				ovary(1)	1						TTCCTGCTGTTAATCATCATCAT	0.379													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	27490282	27490283	+	IGR	DEL	TG	-	-	rs112271839		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27490282_27490283delTG								SLC9A1 (8831 upstream) : WDTC1 (70724 downstream)																							GTCAGAATCCtgtgtgtgtgtg	0.371													6	3	---	---	---	---	
C1orf38	9473	broad.mit.edu	37	1	28201495	28201496	+	Intron	INS	-	T	T	rs111822413		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28201495_28201496insT	uc001bpc.3	+						C1orf38_uc001boz.2_Intron|C1orf38_uc001bpa.2_Intron|C1orf38_uc010ofn.1_Intron|C1orf38_uc010ofo.1_Intron	NM_001105556	NP_001099026	Q5TEJ8	THMS2_HUMAN	basement membrane-induced gene isoform 3						cell adhesion|inflammatory response					ovary(1)	1		Colorectal(325;3.46e-05)|all_lung(284;0.000129)|Lung NSC(340;0.000259)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;2.52e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)		tcttcttcttcttttttttttt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	28625302	28625303	+	IGR	INS	-	AAGTGA	AAGTGA	rs145746571	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28625302_28625303insAAGTGA								SESN2 (16301 upstream) : MED18 (30210 downstream)																							GAAAGAATTGGAAGTAGAAGAG	0.243													4	2	---	---	---	---	
TINAGL1	64129	broad.mit.edu	37	1	32043845	32043848	+	Intron	DEL	GTGT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32043845_32043848delGTGT	uc001bta.2	+						TINAGL1_uc001bsz.2_Intron|TINAGL1_uc010ogi.1_Intron|TINAGL1_uc010ogj.1_Intron|TINAGL1_uc010ogk.1_Intron	NM_022164	NP_071447	Q9GZM7	TINAL_HUMAN	tubulointerstitial nephritis antigen-like 1						endosome transport|immune response|proteolysis	extracellular region	cysteine-type endopeptidase activity|extracellular matrix structural constituent|polysaccharide binding|scavenger receptor activity				0		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)		GTGAGAGCTGgtgtgtgtgtgtgt	0.289													3	3	---	---	---	---	
C1orf94	84970	broad.mit.edu	37	1	34684558	34684559	+	3'UTR	DEL	AC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34684558_34684559delAC	uc001bxs.3	+	7					C1orf94_uc001bxt.2_3'UTR	NM_032884	NP_116273	Q6P1W5	CA094_HUMAN	hypothetical protein LOC84970 isoform b								protein binding				0		Myeloproliferative disorder(586;0.0393)				GGCACAAGCTACACACACACAC	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	34736822	34736827	+	IGR	DEL	CTCTCA	-	-	rs10535976		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34736822_34736827delCTCTCA								C1orf94 (52093 upstream) : MIR552 (398373 downstream)																							ctctctctctctctcactctctctct	0.160													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	35281793	35281793	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35281793delA								GJA4 (20447 upstream) : C1orf212 (37331 downstream)																							tccatctcttaaaaaaaaaaa	0.000													4	3	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39615407	39615408	+	Intron	INS	-	GATAT	GATAT	rs145778173	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39615407_39615408insGATAT	uc010ois.1	+						MACF1_uc001cda.1_Intron	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CATCCCAGCCCGATATTTAAAG	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	41336981	41336981	+	IGR	DEL	T	-	-	rs34845052		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41336981delT								CITED4 (8963 upstream) : CTPS (108026 downstream)																							tttaaaacaattttttttttt	0.050													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	41964017	41964017	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41964017delT								EDN2 (13673 upstream) : HIVEP3 (11668 downstream)																							CGAGGCCTCATTTGCAAACCT	0.567													4	2	---	---	---	---	
ERI3	79033	broad.mit.edu	37	1	44776623	44776624	+	Intron	INS	-	CGCGCG	CGCGCG	rs141114785	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44776623_44776624insCGCGCG	uc001clt.2	-						ERI3_uc010okv.1_Intron|ERI3_uc009vxg.2_Intron|ERI3_uc010okw.1_Intron|ERI3_uc001clu.2_Intron	NM_024066	NP_076971	O43414	ERI3_HUMAN	prion protein interacting protein							intracellular	exonuclease activity|metal ion binding|nucleic acid binding			ovary(2)|large_intestine(1)	3						TATGTGCACATCGCGCGCGCGC	0.381													4	2	---	---	---	---	
NASP	4678	broad.mit.edu	37	1	46063844	46063845	+	Intron	INS	-	T	T	rs151290446		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46063844_46063845insT	uc001coi.1	+						NASP_uc010olq.1_Intron|NASP_uc001coh.1_Intron|NASP_uc001coj.1_Intron|NASP_uc010olr.1_Intron	NM_002482	NP_002473	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein isoform 2						blastocyst development|cell cycle|cell proliferation|DNA replication|histone exchange|protein transport	cytoplasm|nucleus	Hsp90 protein binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					actcctgttacttttttttttt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	53094195	53094196	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53094195_53094196insA								GPX7 (19473 upstream) : FAM159A (4870 downstream)																							GATTTTAAAAGAAAAAAAAAAA	0.040													4	2	---	---	---	---	
TMEM48	55706	broad.mit.edu	37	1	54256393	54256395	+	Intron	DEL	AAC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54256393_54256395delAAC	uc001cvs.2	-						TMEM48_uc010onu.1_Intron|TMEM48_uc001cvt.2_Intron|TMEM48_uc009vzk.2_Intron|TMEM48_uc010onv.1_Intron	NM_018087	NP_060557	Q9BTX1	NDC1_HUMAN	transmembrane protein 48						mRNA transport|nuclear pore complex assembly|nuclear pore distribution|protein transport|transmembrane transport	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore			ovary(1)|pancreas(1)	2						taaataaaTAaacaacaacaaca	0.153													4	2	---	---	---	---	
FGGY	55277	broad.mit.edu	37	1	59827872	59827873	+	Intron	INS	-	CTCTT	CTCTT	rs143898997	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59827872_59827873insCTCTT	uc001czi.3	+						FGGY_uc001czg.2_Intron|FGGY_uc001czh.2_Intron|FGGY_uc009wac.2_Intron|FGGY_uc001czj.3_Intron|FGGY_uc001czk.3_Intron|FGGY_uc001czl.3_Intron	NM_018291	NP_060761	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing						carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)					tcttctttctcctatttaattt	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	62001169	62001170	+	IGR	INS	-	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62001169_62001170insG								NFIA (72710 upstream) : TM2D1 (145549 downstream)																							TTCTTTTCTTTTCTGAGTTCCT	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	62919978	62919979	+	IGR	INS	-	AT	AT	rs144984010	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62919978_62919979insAT								USP1 (2503 upstream) : DOCK7 (419 downstream)																							TTAAGTGATTCATGTAACTGGT	0.208													5	5	---	---	---	---	
DOCK7	85440	broad.mit.edu	37	1	63121101	63121102	+	Intron	INS	-	C	C	rs74678405		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63121101_63121102insC	uc001daq.2	-						DOCK7_uc001dan.2_5'Flank|DOCK7_uc001dao.2_5'Flank|DOCK7_uc001dap.2_Intron|DOCK7_uc009wah.1_Intron	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7						activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						cttttctttttttttttttttt	0.163													4	2	---	---	---	---	
LEPR	3953	broad.mit.edu	37	1	66054047	66054048	+	Intron	INS	-	A	A	rs146959251	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66054047_66054048insA	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron|LEPR_uc001dcj.2_Intron|LEPR_uc001dck.2_Intron	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AGGTATTGCTTACAAAAATTTC	0.188													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	71625594	71625594	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71625594delA	uc001dfu.1	+											Homo sapiens cDNA clone IMAGE:6592429, partial cds.																		GAGCTTTTTTAAATGGCTAAG	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	87701976	87701976	+	IGR	DEL	T	-	-	rs77687252		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87701976delT								LOC339524 (67092 upstream) : LMO4 (92175 downstream)																							tgctttacacttctcgcaagt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	87772558	87772559	+	IGR	INS	-	T	T	rs151099396	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87772558_87772559insT								LOC339524 (137674 upstream) : LMO4 (21592 downstream)																							GCCCCACTCCCTTTTTTTTTTA	0.416													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	88124719	88124724	+	IGR	DEL	TGTGTA	-	-	rs61773096		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88124719_88124724delTGTGTA								LMO4 (310116 upstream) : None (None downstream)																							tgtgtgcgtgtgtgtatgtgtgtgtg	0.350													3	3	---	---	---	---	
LRRC8D	55144	broad.mit.edu	37	1	90340003	90340004	+	Intron	DEL	TG	-	-	rs150119346		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90340003_90340004delTG	uc001dnm.2	+						LRRC8D_uc001dnn.2_Intron	NM_001134479	NP_001127951	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member							integral to membrane	protein binding			ovary(2)	2		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		AGAAACTATTtgtgtgtgtgtg	0.178													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	92041794	92041797	+	IGR	DEL	AAAC	-	-	rs76627199		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92041794_92041797delAAAC								CDC7 (50474 upstream) : HSP90B3P (58771 downstream)																							AAAGGAAAATAAACAGACTTTAGA	0.407													4	2	---	---	---	---	
SLC44A3	126969	broad.mit.edu	37	1	95347752	95347752	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95347752delA	uc001dqv.3	+						SLC44A3_uc001dqx.3_Intron|SLC44A3_uc010otq.1_Intron|SLC44A3_uc010otr.1_Intron|SLC44A3_uc001dqw.3_Intron|SLC44A3_uc010ots.1_Intron|SLC44A3_uc009wds.2_Intron|SLC44A3_uc010ott.1_Intron|SLC44A3_uc010otu.1_Intron	NM_001114106	NP_001107578	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3 isoform 1							integral to membrane|plasma membrane	choline transmembrane transporter activity			kidney(1)	1		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	acaaatgaggaaactgagccc	0.134													4	2	---	---	---	---	
DPYD	1806	broad.mit.edu	37	1	97861636	97861639	+	Intron	DEL	CTAA	-	-	rs75328501		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97861636_97861639delCTAA	uc001drv.2	-							NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	ataggaaaagctaactgatgcCAC	0.034													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	98452392	98452393	+	IGR	INS	-	CACA	CACA			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98452392_98452393insCACA								DPYD (65777 upstream) : MIR137 (59233 downstream)																							gtgtgcgcgcgcacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	98737175	98737175	+	IGR	DEL	T	-	-	rs67638994		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98737175delT								MIR137 (225448 upstream) : SNX7 (390061 downstream)																							cctaggtatcttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	101603524	101603526	+	IGR	DEL	ACT	-	-	rs151167490		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101603524_101603526delACT								DPH5 (111880 upstream) : S1PR1 (98779 downstream)																							tgctactacaactactattgcta	0.256													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	102008663	102008664	+	IGR	DEL	AG	-	-	rs68193837		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102008663_102008664delAG								S1PR1 (301587 upstream) : OLFM3 (259463 downstream)																							GAGTCTGAATAGAGTGAGGAGA	0.342													2	4	---	---	---	---	
NTNG1	22854	broad.mit.edu	37	1	107730683	107730684	+	Intron	INS	-	T	T	rs141257207	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107730683_107730684insT	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvd.1_Intron	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		TGGCATAGGCATTTTTTTTTGA	0.312													4	2	---	---	---	---	
AKNAD1	254268	broad.mit.edu	37	1	109371970	109371971	+	Intron	INS	-	A	A	rs147474499	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109371970_109371971insA	uc001dwa.2	-						AKNAD1_uc010ovb.1_Intron|AKNAD1_uc001dwb.2_Intron	NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN	hypothetical protein LOC254268											ovary(3)	3						GTAGGGTCTAGACTAGGAATTT	0.317													0	6	---	---	---	---	
AKNAD1	254268	broad.mit.edu	37	1	109407134	109407135	+	Intron	DEL	AG	-	-	rs11102571	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109407134_109407135delAG	uc010ovb.1	-							NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN	hypothetical protein LOC254268											ovary(3)	3						acacacacacagagggtatata	0.000													4	2	---	---	---	---	
GNAI3	2773	broad.mit.edu	37	1	110130991	110130991	+	Intron	DEL	A	-	-	rs71577005		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110130991delA	uc001dxz.2	+							NM_006496	NP_006487	P08754	GNAI3_HUMAN	guanine nucleotide binding protein (G protein),						cell cycle|cell division|inhibition of adenylate cyclase activity by G-protein signaling pathway|platelet activation|synaptic transmission	centrosome|heterotrimeric G-protein complex|midbody	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity			ovary(1)	1		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.046)|Colorectal(144;0.119)|Epithelial(280;0.139)|all cancers(265;0.147)|LUSC - Lung squamous cell carcinoma(189;0.237)		gcgactgagcaaaaaaaaaaa	0.204													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	111135642	111135643	+	IGR	INS	-	TGTG	TGTG	rs71580541		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111135642_111135643insTGTG								KCNA10 (73845 upstream) : KCNA2 (560 downstream)																							TCAGCAgtgtctgtgtgtgtgt	0.391													6	4	---	---	---	---	
WNT2B	7482	broad.mit.edu	37	1	113040868	113040868	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113040868delT	uc001eca.2	+						WNT2B_uc009wgg.2_Intron	NM_004185	NP_004176	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family,						chondrocyte differentiation|cornea development in camera-type eye|dorsal/ventral axis specification|forebrain regionalization|hemopoietic stem cell proliferation|iris morphogenesis|lens development in camera-type eye|lung induction|male gonad development|neuron differentiation|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding|signal transducer activity			ovary(2)|breast(2)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		atctcattcCttttttttttt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	114797242	114797243	+	IGR	DEL	AC	-	-	rs5777188		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114797242_114797243delAC								SYT6 (100770 upstream) : TRIM33 (138158 downstream)																							acacacatgtacacacacacac	0.203													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	117262744	117262744	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117262744delA								MIR320B1 (48295 upstream) : CD2 (34342 downstream)																							CTGGTTGGTGAAAAAAGGCAG	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	118885937	118885937	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118885937delC								SPAG17 (158089 upstream) : TBX15 (539729 downstream)																							tcatctgggacatagaaagga	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121425623	121425623	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121425623delG								LOC647121 (111937 upstream) : None (None downstream)																							aggcctcaaagcgttccaaac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142607969	142607970	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142607969_142607970insA								None (None upstream) : None (None downstream)																							agggacacaacaaaaaaagaaa	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143398723	143398724	+	IGR	DEL	TT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143398723_143398724delTT								None (None upstream) : LOC100286793 (248915 downstream)																							TACATACATATTTCTCATTCTT	0.233													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144675428	144675428	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144675428delC	uc009wig.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF9_uc009wii.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						tattgcaaagcttcttaaatg	0.080													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144835000	144835001	+	Intron	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144835000_144835001insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|uc001elu.1_5'Flank			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						actaaaaatacaaaaaaaaaaa	0.000													5	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144884983	144884984	+	Intron	INS	-	C	C	rs148304767		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144884983_144884984insC	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GGAGCCACAGATATtatgcaac	0.163			T	PDGFRB	MPD								5	4	---	---	---	---	
SEC22B	9554	broad.mit.edu	37	1	145116299	145116300	+	3'UTR	INS	-	TT	TT	rs71696722		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145116299_145116300insTT	uc001eml.1	+	7					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883	O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0						TTGGGAAGGTGttttttttttt	0.317													6	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145213726	145213727	+	Intron	DEL	GG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145213726_145213727delGG	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AATTTATAAAGGTCACTTTGAC	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148855290	148855290	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148855290delT								NBPF16 (96979 upstream) : LOC645166 (72996 downstream)																							CAGCGGCGGGTGGGGGCAGAA	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148907061	148907067	+	IGR	DEL	CACGGTT	-	-	rs111901985		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148907061_148907067delCACGGTT								NBPF16 (148750 upstream) : LOC645166 (21219 downstream)																							gtagtggaaccacggttcaccctaggt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148908670	148908671	+	IGR	DEL	TT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148908670_148908671delTT								NBPF16 (150359 upstream) : LOC645166 (19615 downstream)																							gcccaggtaatttttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149296575	149296575	+	IGR	DEL	C	-	-	rs111797860		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149296575delC								LOC388692 (4833 upstream) : FCGR1C (72719 downstream)																							aaaaaaacaacaacaacaaca	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149702871	149702872	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149702871_149702872insA								HIST2H2BF (303642 upstream) : FCGR1A (51378 downstream)																							cataaaatgataaaaaaaaaac	0.020													3	4	---	---	---	---	
GABPB2	126626	broad.mit.edu	37	1	151079396	151079397	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151079396_151079397insT	uc001ewr.2	+						GABPB2_uc001ews.2_Intron|GABPB2_uc001ewt.2_Intron	NM_144618	NP_653219	Q8TAK5	GABP2_HUMAN	GA repeat binding protein, beta 2						positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	protein heterodimerization activity|transcription regulatory region DNA binding				0				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)		TTGAATCTCACTTTTTTTTTTC	0.312													4	2	---	---	---	---	
RORC	6097	broad.mit.edu	37	1	151806471	151806471	+	5'Flank	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151806471delC	uc001ezh.2	-						RORC_uc010pdo.1_5'Flank|RORC_uc010pdp.1_5'Flank	NM_005060	NP_005051	P51449	RORG_HUMAN	RAR-related orphan receptor C isoform a						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ATCATTTCATCCCCACGTGCC	0.512													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	152716290	152716290	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152716290delG								C1orf68 (23386 upstream) : KPRP (14216 downstream)																							TGAAAAGAGAGACAGAAGAAG	0.512													4	2	---	---	---	---	
RHBG	57127	broad.mit.edu	37	1	156344869	156344869	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156344869delT	uc010pho.1	+						RHBG_uc010phm.1_Intron|RHBG_uc010phn.1_Intron|RHBG_uc001fos.2_Intron|RHBG_uc009wrz.2_Intron|RHBG_uc001for.2_Intron	NM_020407	NP_065140	Q9H310	RHBG_HUMAN	Rhesus blood group, B glycoprotein						transepithelial ammonium transport	anchored to plasma membrane|basolateral plasma membrane|cytoplasmic vesicle membrane|integral to plasma membrane|spectrin-associated cytoskeleton	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			ovary(2)	2	Hepatocellular(266;0.158)					CTCTAAtttcttttttttttt	0.269													4	2	---	---	---	---	
NTRK1	4914	broad.mit.edu	37	1	156810578	156810579	+	Intron	DEL	GG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156810578_156810579delGG	uc001fqf.1	+						NTRK1_uc009wsi.1_Intron	NM_001007792	NP_001007793	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1						activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	GAGTTGGGGTGGGGGTGAACAT	0.644			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			4	3	---	---	---	---	
ARHGEF11	9826	broad.mit.edu	37	1	156927131	156927131	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156927131delA	uc001fqo.2	-						ARHGEF11_uc001fqn.2_Intron|ARHGEF11_uc001fqp.1_5'Flank	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TATAGGCTGCAAAAAAAAAAA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157077436	157077436	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157077436delC								ETV3L (7836 upstream) : ETV3 (17023 downstream)																							GGCCTAAGTGCCCAACACCTG	0.597													4	2	---	---	---	---	
PYHIN1	149628	broad.mit.edu	37	1	158931092	158931092	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158931092delT	uc001ftb.2	+						PYHIN1_uc001ftc.2_Intron|PYHIN1_uc001ftd.2_Intron|PYHIN1_uc001fte.2_Intron	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1						cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					GTATCTTTTCTTATTTGTTCT	0.174													4	2	---	---	---	---	
ATP1A4	480	broad.mit.edu	37	1	160129554	160129554	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160129554delA	uc001fve.3	+						ATP1A4_uc001fvf.3_Intron	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1						ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			taatatatgtaaaatgcccag	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161944630	161944631	+	IGR	INS	-	A	A	rs141285265	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161944630_161944631insA								ATF6 (11670 upstream) : OLFML2B (8353 downstream)																							ccttattccagaaaaaaaaagt	0.158													2	6	---	---	---	---	
NOS1AP	9722	broad.mit.edu	37	1	162044706	162044706	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162044706delT	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			gtagggggtgttccaagcagg	0.000													4	2	---	---	---	---	
ALDH9A1	223	broad.mit.edu	37	1	165664747	165664748	+	Intron	DEL	TC	-	-	rs7512672		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165664747_165664748delTC	uc001gdh.1	-						ALDH9A1_uc010pky.1_Intron|ALDH9A1_uc010pkz.1_Intron|ALDH9A1_uc010pla.1_Intron	NM_000696	NP_000687	P49189	AL9A1_HUMAN	aldehyde dehydrogenase 9A1						carnitine biosynthetic process|cellular aldehyde metabolic process|hormone metabolic process|neurotransmitter biosynthetic process	cytosol|plasma membrane	3-chloroallyl aldehyde dehydrogenase activity|4-trimethylammoniobutyraldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|aminobutyraldehyde dehydrogenase activity				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				NADH(DB00157)	tttttttttttcttgagatgga	0.094													3	4	---	---	---	---	
MAEL	84944	broad.mit.edu	37	1	166976795	166976796	+	Intron	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166976795_166976796delTG	uc001gdy.1	+						MAEL_uc001gdz.1_Intron|MAEL_uc009wvf.1_Intron	NM_032858	NP_116247	Q96JY0	MAEL_HUMAN	maelstrom homolog						cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|multicellular organismal development|piRNA metabolic process|spermatogenesis	piP-body	DNA binding			skin(1)	1						aatatatgtttgtgtgtgtgtg	0.000													4	3	---	---	---	---	
RCSD1	92241	broad.mit.edu	37	1	167623996	167623996	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167623996delA	uc001gem.2	+						RCSD1_uc010pli.1_Intron	NM_052862	NP_443094	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1											ovary(2)|central_nervous_system(2)|skin(1)	5	all_hematologic(923;0.215)					aggtaaccataatctcttccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	168780757	168780758	+	IGR	INS	-	TGTG	TGTG	rs147042581	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168780757_168780758insTGTG								MGC4473 (18637 upstream) : ATP1B1 (295189 downstream)																							gtgtgtatgtttgtgtgtgtgt	0.366													4	3	---	---	---	---	
C1orf114	57821	broad.mit.edu	37	1	169408939	169408939	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169408939delC	uc009wvq.1	-							NM_021179	NP_067002	Q5TID7	CA114_HUMAN	hypothetical protein LOC57821												0	all_hematologic(923;0.208)					ctcttggtatccgggtccttg	0.000													4	2	---	---	---	---	
F5	2153	broad.mit.edu	37	1	169533094	169533097	+	Intron	DEL	TCTT	-	-	rs143022586		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169533094_169533097delTCTT	uc001ggg.1	-						F5_uc010plr.1_Intron	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	ttctattctctctttcacttctca	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	170332860	170332863	+	IGR	DEL	TGTG	-	-	rs140808199		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170332860_170332863delTGTG								LOC284688 (79511 upstream) : GORAB (168400 downstream)																							tgtctctctttgtgtgtgtgtgtg	0.000													3	3	---	---	---	---	
RFWD2	64326	broad.mit.edu	37	1	176171991	176171991	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176171991delA	uc001gku.1	-						RFWD2_uc001gkv.1_Intron|RFWD2_uc001gkw.1_Intron	NM_022457	NP_071902	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2 isoform a						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0						TCATGACACTAAGAGAGGCAA	0.338													2	4	---	---	---	---	
CACNA1E	777	broad.mit.edu	37	1	181457939	181457939	+	Intron	DEL	T	-	-	rs71906696		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181457939delT	uc001gow.2	+							NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,						energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						ACAGGCCTGCTTTTTTTTTCT	0.378													4	2	---	---	---	---	
NMNAT2	23057	broad.mit.edu	37	1	183314254	183314256	+	Intron	DEL	CTC	-	-	rs35869200		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183314254_183314256delCTC	uc001gqc.1	-							NM_015039	NP_055854	Q9BZQ4	NMNA2_HUMAN	nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1						ATCTTCTCTTCTCCTCCCCCACC	0.433													6	4	---	---	---	---	
C1orf27	54953	broad.mit.edu	37	1	186371699	186371699	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186371699delT	uc001grw.2	+						C1orf27_uc010poq.1_Intron|C1orf27_uc010por.1_Intron	NM_017847	NP_060317	Q5SWX8	ODR4_HUMAN	odorant response abnormal 4 isoform 1							integral to membrane	oxidoreductase activity|zinc ion binding			ovary(1)	1						gcctggctaattttttttttt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	189652416	189652417	+	IGR	INS	-	ACAC	ACAC	rs72353846		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189652416_189652417insACAC								None (None upstream) : FAM5C (414380 downstream)																							TCTAACTTCAAacacacacaca	0.267													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	197949866	197949866	+	IGR	DEL	C	-	-	rs5779895		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197949866delC								LHX9 (48151 upstream) : NEK7 (176242 downstream)																							ctccagagctccccccgtagg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	202997769	202997770	+	IGR	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202997769_202997770delGT								TMEM183A (3794 upstream) : PPFIA4 (5842 downstream)																							GTGGTATGGGgtgtgtgtgtgt	0.401													4	3	---	---	---	---	
PLEKHA6	22874	broad.mit.edu	37	1	204194622	204194623	+	Intron	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204194622_204194623delTG	uc001hau.2	-							NM_014935	NP_055750	Q9Y2H5	PKHA6_HUMAN	phosphoinositol 3-phosphate-binding protein-3											ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			TTCATGACACTGTACTTTCTCC	0.376													3	4	---	---	---	---	
RASSF5	83593	broad.mit.edu	37	1	206730747	206730747	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206730747delG	uc001hed.2	+						RASSF5_uc001hec.1_Intron|RASSF5_uc001hee.2_Intron|RASSF5_uc001hef.2_5'UTR	NM_182663	NP_872604	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family 5						apoptosis|intracellular signal transduction	cytoplasm|microtubule	metal ion binding|protein binding			ovary(1)	1	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CGCCGGCTCTGCCTGGTCCGC	0.751													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	211732620	211732621	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211732620_211732621insT								RD3 (66361 upstream) : SLC30A1 (15760 downstream)																							CTTCCACTAAGTGTGGGCTCTG	0.396													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	215031214	215031215	+	IGR	DEL	GG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215031214_215031215delGG								CENPF (193302 upstream) : KCNK2 (147670 downstream)																							AGTGCTTTCTGGGAAAAAAAAT	0.332													4	2	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	215841077	215841077	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215841077delA	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		aaGaagaaggaaaaaaaaaag	0.149										HNSCC(13;0.011)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	220537748	220537749	+	IGR	INS	-	CAAAA	CAAAA	rs144424948	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220537748_220537749insCAAAA								RAB3GAP2 (91905 upstream) : MARK1 (163819 downstream)																							TCAAATGGGGTCAAAACAAAAC	0.198													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223392683	223392683	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223392683delG								TLR5 (76059 upstream) : SUSD4 (1480 downstream)																							ggtactgcttggttctactac	0.000													4	2	---	---	---	---	
NVL	4931	broad.mit.edu	37	1	224456351	224456354	+	Intron	DEL	TTTG	-	-	rs36183377		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224456351_224456354delTTTG	uc001hok.2	-						NVL_uc001hol.2_Intron|NVL_uc010pvd.1_Intron|NVL_uc010pve.1_Intron|NVL_uc010pvf.1_Intron	NM_002533	NP_002524	O15381	NVL_HUMAN	nuclear VCP-like isoform 1							aggresome|cytoplasm|nucleolus	ATP binding|nucleoside-triphosphatase activity			skin(2)	2				GBM - Glioblastoma multiforme(131;0.00501)		ACTAAGCttttttgtttgtttgtt	0.020													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224691001	224691001	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224691001delC	uc001hor.1	+											full-length cDNA clone CS0DC026YN07 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).																		GCAGAGTGTTCCACATCTCCT	0.488													4	2	---	---	---	---	
SRP9	6726	broad.mit.edu	37	1	225963580	225963581	+	5'Flank	INS	-	AG	AG	rs146918694	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225963580_225963581insAG	uc001hpg.2	+						SRP9_uc001hpf.3_5'Flank|SRP9_uc001hph.2_5'Flank|SRP9_uc001hpi.3_5'Flank|SRP9_uc001hpj.1_5'Flank	NM_003133	NP_003124	P49458	SRP09_HUMAN	signal recognition particle 9kDa isoform 2						negative regulation of translational elongation|SRP-dependent cotranslational protein targeting to membrane	cytosol|signal recognition particle receptor complex|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding				0						cacacacacacacacacacacG	0.386													4	2	---	---	---	---	
C1orf95	375057	broad.mit.edu	37	1	226745601	226745601	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226745601delT	uc010pvn.1	+							NM_001003665	NP_001003665	Q69YW2	CA095_HUMAN	hypothetical protein LOC375057							integral to membrane				ovary(1)	1	Breast(184;0.133)	Prostate(94;0.0885)		GBM - Glioblastoma multiforme(131;0.113)		gatcatctcattagattctga	0.000													4	2	---	---	---	---	
ITPKB	3707	broad.mit.edu	37	1	226910568	226910568	+	Intron	DEL	G	-	-	rs66460824		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226910568delG	uc010pvo.1	-						ITPKB_uc001hqh.2_Intron	NM_002221	NP_002212	P27987	IP3KB_HUMAN	1D-myo-inositol-trisphosphate 3-kinase B								ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity			ovary(4)|central_nervous_system(1)	5		Prostate(94;0.0773)				GGCTAGAAAAGGTTTGAATAG	0.527													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	228068841	228068841	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228068841delG								PRSS38 (34672 upstream) : WNT9A (40324 downstream)																							ttattgccttgggaatggtcg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229835702	229835705	+	IGR	DEL	AAAC	-	-	rs35334261		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229835702_229835705delAAAC								URB2 (39756 upstream) : GALNT2 (357831 downstream)																							GGCCAGACTTAAACAGGCACCAAA	0.456													5	4	---	---	---	---	
TRIM67	440730	broad.mit.edu	37	1	231337910	231337911	+	Intron	INS	-	ACA	ACA			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231337910_231337911insACA	uc009xfn.1	+							NM_001004342	NP_001004342	Q6ZTA4	TRI67_HUMAN	tripartite motif-containing 67							cytoplasm|cytoskeleton	zinc ion binding			ovary(2)|breast(1)|kidney(1)	4	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				ggaggaggaggtagtggaggag	0.000													4	3	---	---	---	---	
EGLN1	54583	broad.mit.edu	37	1	231551597	231551598	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231551597_231551598insT	uc001huv.2	-						EGLN1_uc001huu.3_Intron	NM_022051	NP_071334	Q9GZT9	EGLN1_HUMAN	egl nine homolog 1						negative regulation of sequence-specific DNA binding transcription factor activity|oxygen homeostasis|response to hypoxia	cytosol	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptidyl-proline dioxygenase activity|protein binding|zinc ion binding				0		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)			Vitamin C(DB00126)	CATTATCtttcttttttttttt	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	232269415	232269416	+	IGR	INS	-	TG	TG	rs151272195	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232269415_232269416insTG								DISC1 (92399 upstream) : SIPA1L2 (264298 downstream)																							AAAGCTAAACCGGCGAAGTGGT	0.386													2	5	---	---	---	---	
C1orf57	84284	broad.mit.edu	37	1	233101195	233101196	+	Intron	DEL	GG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233101195_233101196delGG	uc001hvj.1	+						C1orf57_uc001hvi.2_Intron|C1orf57_uc009xft.1_Intron	NM_032324	NP_115700	Q9BSD7	NTPCR_HUMAN	nucleoside-triphosphatase C1orf57								ATP binding|nucleoside-triphosphatase activity|nucleotide phosphatase activity|transferase activity				0		all_cancers(173;0.0818)|Prostate(94;0.137)				tgaagttgctgggaggactgaa	0.025													4	2	---	---	---	---	
SLC35F3	148641	broad.mit.edu	37	1	234083498	234083499	+	Intron	DEL	GA	-	-	rs55825277		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234083498_234083499delGA	uc001hvy.1	+							NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			TAagagggaggagagagagaga	0.327													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	235266730	235266730	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235266730delT								IRF2BP2 (521459 upstream) : TOMM20 (5930 downstream)																							CAGGTGTGCCTTttttttttt	0.289													4	2	---	---	---	---	
TBCE	6905	broad.mit.edu	37	1	235539477	235539478	+	Intron	INS	-	A	A	rs149185894	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235539477_235539478insA	uc001hwz.1	+						TBCE_uc010pxq.1_Intron|TBCE_uc001hxa.1_Intron|TBCE_uc010pxr.1_Intron|TBCE_uc001hxb.1_Intron	NM_003193	NP_003184	Q15813	TBCE_HUMAN	beta-tubulin cofactor E						'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|nucleus|plasma membrane	chaperone binding				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)			GGTAGGAATGGAAAAAAAAAAT	0.376													4	2	---	---	---	---	
LYST	1130	broad.mit.edu	37	1	236043533	236043533	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236043533delA	uc001hxl.1	-						LYST_uc009xgb.1_Intron|LYST_uc010pxs.1_Intron|LYST_uc001hxm.2_Intron	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GAGAAGAAGGAAGACTATATC	0.343									Chediak-Higashi_syndrome				4	2	---	---	---	---	
EDARADD	128178	broad.mit.edu	37	1	236589806	236589807	+	Intron	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236589806_236589807insA	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			gtgagacaaacattgtggcatc	0.000													3	3	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	239564797	239564797	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239564797delT	uc001hyo.1	+									P20309	ACM3_HUMAN	Homo sapiens clone N10 NTera2D1 teratocarcinoma, m3 muscarinic acetylcholine receptor mRNA, partial cds.						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	TCttttttccttttttttttc	0.159													4	2	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240348445	240348446	+	Intron	INS	-	T	T	rs146703647	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240348445_240348446insT	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			cctcctataccttccccttctc	0.059													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	240822699	240822699	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240822699delG								GREM2 (47237 upstream) : RGS7 (108856 downstream)																							GCTCAGCCCAGGGCTAGAAAG	0.473													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	243019418	243019419	+	IGR	INS	-	TATA	TATA	rs144050012	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243019418_243019419insTATA								PLD5 (331420 upstream) : CEP170 (268312 downstream)																							gtattccatggtatatatatac	0.000													4	2	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245589724	245589724	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245589724delT	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			AAGCTGTCCCTCACTTTCTCC	0.478													4	2	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245598356	245598363	+	Intron	DEL	TCCATCCA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245598356_245598363delTCCATCCA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			catccatctctccatccatccatccatc	0.034													6	3	---	---	---	---	
ZNF496	84838	broad.mit.edu	37	1	247485235	247485235	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247485235delT	uc001ico.2	-						ZNF496_uc009xgv.2_Intron|ZNF496_uc001icp.2_Intron|ZNF496_uc010pyv.1_Intron	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496						positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			AGATGCCCCCTAACTGGGTAA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	941461	941461	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:941461delT								TMEM18 (264022 upstream) : SNTG2 (5094 downstream)																							ctaagtatcattttttttttg	0.000													4	2	---	---	---	---	
TPO	7173	broad.mit.edu	37	2	1473774	1473774	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1473774delA	uc002qww.2	+						TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Intron|TPO_uc002qwr.2_Intron|TPO_uc002qwx.2_Intron|TPO_uc010yio.1_Intron|TPO_uc010yip.1_Intron	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a						cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	gatccGTCACAAAAAATCCTC	0.179													4	2	---	---	---	---	
TSSC1	7260	broad.mit.edu	37	2	3340805	3340833	+	Intron	DEL	AAGAAAAGAGAAGGGAAAAGGGTAAAAAG	-	-	rs72179506		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3340805_3340833delAAGAAAAGAGAAGGGAAAAGGGTAAAAAG	uc002qxj.2	-							NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		gggaagggaaaagaaaagagaagggaaaagggtaaaaagaagggaaggg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	4475351	4475352	+	IGR	INS	-	TCTG	TCTG	rs71398829		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4475351_4475352insTCTG								ALLC (725093 upstream) : None (None downstream)																							ACTTTTCTTGCTCTTATTTTGG	0.431													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	4505741	4505742	+	IGR	DEL	TA	-	-	rs70939919		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4505741_4505742delTA								ALLC (755483 upstream) : None (None downstream)																							tgtgtgtgtgtatgtgtgtgtg	0.262													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	4517865	4517867	+	IGR	DEL	AGA	-	-	rs140796577	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4517865_4517867delAGA								ALLC (767607 upstream) : None (None downstream)																							gaggaggaggagaacaaggagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6040580	6040581	+	IGR	INS	-	T	T	rs150508052	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6040580_6040581insT								SOX11 (199064 upstream) : LOC150622 (32238 downstream)																							GACTCCATATAGTTACTGGCAG	0.317													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7427793	7427793	+	IGR	DEL	A	-	-	rs71402844		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7427793delA								RNF144A (243486 upstream) : LOC339788 (634765 downstream)																							gacccgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7675597	7675598	+	IGR	INS	-	TT	TT	rs150951590	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7675597_7675598insTT								RNF144A (491290 upstream) : LOC339788 (386960 downstream)																							cttagtcttgcttgtttcgcag	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	10685077	10685078	+	IGR	DEL	CA	-	-	rs28710178		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10685077_10685078delCA								ODC1 (96624 upstream) : NOL10 (25816 downstream)																							acccacacaccacacacacaca	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	10855930	10855930	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10855930delT								NOL10 (25818 upstream) : ATP6V1C2 (5845 downstream)																							ttttcttttcttttttttttt	0.000													4	2	---	---	---	---	
LPIN1	23175	broad.mit.edu	37	2	11829325	11829325	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11829325delA	uc010yjm.1	+							NM_145693	NP_663731	Q14693	LPIN1_HUMAN	lipin 1						fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		cgatccttgtaagaaacacac	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12597014	12597014	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12597014delG	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		AATATAAATAGGATTAGTCTT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	13256210	13256211	+	IGR	INS	-	AC	AC	rs148464397	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13256210_13256211insAC								TRIB2 (373354 upstream) : None (None downstream)																							GTCATTATTTTATATATTGCTA	0.436													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16163426	16163427	+	IGR	INS	-	TAAAG	TAAAG	rs144022606	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16163426_16163427insTAAAG								MYCN (76298 upstream) : FAM49A (570474 downstream)																							GCCTTGGAGATTAATGTGGATT	0.342													4	2	---	---	---	---	
KCNS3	3790	broad.mit.edu	37	2	18058749	18058749	+	5'Flank	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18058749delA	uc002rcv.2	+						KCNS3_uc002rcw.2_5'Flank	NM_002252	NP_002243	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel						energy reserve metabolic process|regulation of insulin secretion	Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity			ovary(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GAACAATTAGAAAACCCACAC	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18676774	18676774	+	IGR	DEL	C	-	-	rs72118019		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18676774delC								KCNS3 (562550 upstream) : NT5C1B (59217 downstream)																							cttccttcctcccCTTCCCCT	0.050													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18938065	18938066	+	IGR	INS	-	TGTG	TGTG	rs149380685	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18938065_18938066insTGTG								NT5C1B (167227 upstream) : OSR1 (613181 downstream)																							tatgagtgtgttgtgtgtgtgt	0.262													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18972407	18972410	+	IGR	DEL	TCTT	-	-	rs6715976		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18972407_18972410delTCTT								NT5C1B (201569 upstream) : OSR1 (578837 downstream)																							tgtctctctctcttccttccttcc	0.113													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20332380	20332381	+	IGR	INS	-	A	A	rs78477613		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20332380_20332381insA								LAPTM4A (80591 upstream) : SDC1 (68177 downstream)																							aaatcaggaagaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	21184938	21184939	+	IGR	INS	-	G	G	rs138795477	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21184938_21184939insG								C2orf43 (162111 upstream) : APOB (39363 downstream)																							TGCCCCATGGCGGGGGGGTTGC	0.520													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	21997091	21997091	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21997091delC								APOB (730146 upstream) : None (None downstream)																							GTTGATGACTCCACATGCCAG	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	23717635	23717636	+	IGR	INS	-	C	C	rs145239657	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23717635_23717636insC								None (None upstream) : KLHL29 (37819 downstream)																							GATTCTGGTGACCGTCACCTAG	0.545													3	7	---	---	---	---	
DTNB	1838	broad.mit.edu	37	2	25655075	25655076	+	Intron	INS	-	AC	AC	rs142938471	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25655075_25655076insAC	uc002rgh.2	-						DTNB_uc002rgg.2_Intron|DTNB_uc010yko.1_Intron|DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc002rgr.1_Intron|DTNB_uc010ykq.1_Intron	NM_021907	NP_068707	O60941	DTNB_HUMAN	dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAGAGTGCGTacacacacaca	0.302													5	3	---	---	---	---	
ASXL2	55252	broad.mit.edu	37	2	26070275	26070275	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26070275delT	uc002rgs.2	-							NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAAACATCCATTTACCCCTTT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	27584177	27584178	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27584177_27584178insA								GTF3C2 (4309 upstream) : EIF2B4 (3043 downstream)																							ccatctcaaataaaaaaaaaag	0.000													6	3	---	---	---	---	
IFT172	26160	broad.mit.edu	37	2	27694906	27694906	+	Intron	DEL	A	-	-	rs112509425		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27694906delA	uc002rku.2	-						IFT172_uc002rkw.2_Intron|IFT172_uc010yls.1_3'UTR|IFT172_uc010ezc.2_3'UTR|IFT172_uc002rkv.2_3'UTR	NM_015662	NP_056477	Q9UG01	IF172_HUMAN	selective LIM binding factor homolog						cilium assembly	cilium	binding			large_intestine(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)					cactgtctccaaaaaaaaaaa	0.174													4	4	---	---	---	---	
ALK	238	broad.mit.edu	37	2	29728613	29728613	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29728613delA	uc002rmy.2	-							NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor						protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	TCACCATTCTAAAAGGCCAAC	0.433			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				4	2	---	---	---	---	
TMEM178	130733	broad.mit.edu	37	2	39905103	39905103	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39905103delA	uc002rrt.2	+						TMEM178_uc010fam.1_Intron	NM_152390	NP_689603	Q8NBL3	TM178_HUMAN	transmembrane protein 178 precursor							integral to membrane					0		all_hematologic(82;0.248)				GTTCGACaagaaaaaaaaaaa	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	41841111	41841114	+	IGR	DEL	AATG	-	-	rs113855323		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41841111_41841114delAATG								None (None upstream) : PKDCC (434047 downstream)																							gaagacagacaatgaatgaatgaa	0.000													4	2	---	---	---	---	
THADA	63892	broad.mit.edu	37	2	43771185	43771185	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43771185delG	uc002rsw.3	-						THADA_uc010far.2_Intron|THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron|THADA_uc010fas.1_Intron|THADA_uc002rsz.2_Intron|THADA_uc010fat.1_Intron|THADA_uc002rta.2_Intron	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				attaatttttgtataaggtgt	0.000													6	3	---	---	---	---	
C2orf34	79823	broad.mit.edu	37	2	44661048	44661048	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44661048delG	uc002rum.2	+						C2orf34_uc002rul.2_Intron	NM_024766	NP_079042	Q7Z624	CMKMT_HUMAN	hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)				TCATCTGTCTGGTGGTGTGTC	0.383													4	2	---	---	---	---	
C2orf34	79823	broad.mit.edu	37	2	44778269	44778277	+	Intron	DEL	AGATTATGT	-	-	rs149795629		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44778269_44778277delAGATTATGT	uc002rum.2	+							NM_024766	NP_079042	Q7Z624	CMKMT_HUMAN	hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)				TGTAGTCACAAGATTATGTAGTCCTGTTT	0.421													4	2	---	---	---	---	
C2orf34	79823	broad.mit.edu	37	2	44902025	44902025	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44902025delA	uc002rum.2	+							NM_024766	NP_079042	Q7Z624	CMKMT_HUMAN	hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)				CCCCACAAGGAAAAAAAAAAC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	45092119	45092120	+	IGR	INS	-	A	A	rs147781289	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45092119_45092120insA								C2orf34 (92390 upstream) : SIX3 (76917 downstream)																							ctgacaacaccaaatgcaggtg	0.000													3	3	---	---	---	---	
PRKCE	5581	broad.mit.edu	37	2	46233615	46233615	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46233615delC	uc002rut.2	+							NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			CTTGAGTAAGCCCTTATGGGA	0.488													4	2	---	---	---	---	
ATP6V1E2	90423	broad.mit.edu	37	2	46764731	46764731	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46764731delA	uc002ruz.2	-							NM_080653	NP_542384	Q96A05	VATE2_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1						cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting two-sector ATPase complex, catalytic domain	proton-transporting ATPase activity, rotational mechanism			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.151)			agatgtgcagaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	50022211	50022211	+	IGR	DEL	T	-	-	rs112301111		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50022211delT								FSHR (640581 upstream) : NRXN1 (123433 downstream)																							AAGACTACACttttttttttt	0.169													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	52286864	52286865	+	IGR	INS	-	A	A	rs139740918	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52286864_52286865insA								None (None upstream) : None (None downstream)																							tggcctaatacaAAAAACAACA	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	52459654	52459654	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52459654delA								None (None upstream) : None (None downstream)																							gcaaacaaacaaaaaaaaccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	52643644	52643645	+	IGR	INS	-	AG	AG	rs149851258	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52643644_52643645insAG								None (None upstream) : None (None downstream)																							GGAGACCAGTCAGAGTCACAGT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	58071691	58071691	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58071691delA								None (None upstream) : VRK2 (63095 downstream)																							TGATATAGATAAGAGATGATA	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60023237	60023238	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60023237_60023238insA								None (None upstream) : BCL11A (655065 downstream)																							GATTAAGGGGGAAATGAAAGCA	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60401702	60401703	+	IGR	INS	-	A	A	rs71400239		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60401702_60401703insA								None (None upstream) : BCL11A (276600 downstream)																							gcttccataacaaaaaaaaaaa	0.149													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60504716	60504716	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60504716delT								None (None upstream) : BCL11A (173587 downstream)																							GGGATAGTGATTGTCAGTGGT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	61847892	61847892	+	IGR	DEL	T	-	-	rs111689523		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61847892delT								XPO1 (82474 upstream) : FAM161A (204093 downstream)																							tgagggcttctttacaacatg	0.005													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	62610343	62610344	+	IGR	INS	-	T	T	rs11454476		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62610343_62610344insT								B3GNT2 (158479 upstream) : TMEM17 (117012 downstream)																							agacagtccaCttttttttttt	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65362077	65362078	+	IGR	DEL	TT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65362077_65362078delTT								RAB1A (4642 upstream) : ACTR2 (92751 downstream)																							TTATCAAATGTTTATGACCTGA	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65932196	65932197	+	Intron	INS	-	AC	AC	rs138947965	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65932196_65932197insAC	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																		gaaaactgtatacacacacaca	0.000													5	3	---	---	---	---	
DYSF	8291	broad.mit.edu	37	2	71795694	71795695	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71795694_71795695insT	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						CATTAAAAAAAttttttttttt	0.238													4	3	---	---	---	---	
TET3	200424	broad.mit.edu	37	2	74328275	74328275	+	Frame_Shift_Del	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74328275delG	uc002skb.3	+	9	3955	c.3955delG	c.(3955-3957)GGCfs	p.G1319fs		NM_144993	NP_659430	O43151	TET3_HUMAN	tet oncogene family member 3	1319							metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						CGGTGTGGGTGGCAGCTGGGG	0.602													26	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	75950723	75950724	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75950723_75950724insT								C2orf3 (12612 upstream) : None (None downstream)																							CAttctttttcttttttttgac	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	78258649	78258650	+	Intron	INS	-	AGGA	AGGA	rs146670198	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78258649_78258650insAGGA	uc002snu.3	-											Homo sapiens cDNA clone IMAGE:4816654.																		aaagaaacgagaggaaggaagg	0.000													4	2	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87794560	87794560	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87794560delT	uc002srs.3	+						NCRNA00152_uc002ssk.3_Intron|NCRNA00152_uc010fgy.2_Intron|NCRNA00152_uc010fgz.2_Intron			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						ACACTTCAGCTTTGATTTATG	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91878148	91878149	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91878148_91878149insA								LOC654342 (30173 upstream) : GGT8P (85219 downstream)																							agagtttccttaaaaaaaaata	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91919175	91919176	+	IGR	INS	-	G	G	rs143021810	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91919175_91919176insG								LOC654342 (71200 upstream) : GGT8P (44192 downstream)																							CTGTGCCTAGAGAGGTAGGTTT	0.465													4	2	---	---	---	---	
ANKRD36	375248	broad.mit.edu	37	2	97833967	97833968	+	Intron	INS	-	TT	TT	rs72413805		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97833967_97833968insTT	uc010yva.1	+						ANKRD36_uc010fic.2_Intron|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron|ANKRD36_uc002sxq.1_Intron	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36												0						TGATTACCAGCTTGAATTTCtg	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	99020282	99020283	+	IGR	DEL	CA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99020282_99020283delCA								CNGA3 (5225 upstream) : INPP4A (41038 downstream)																							gttgccccaccacacacacaca	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	100142471	100142471	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100142471delT								REV1 (35991 upstream) : AFF3 (21247 downstream)																							taacatcaacttttttttttt	0.000													4	2	---	---	---	---	
AFF3	3899	broad.mit.edu	37	2	100408956	100408957	+	Intron	INS	-	AAAC	AAAC	rs150902761	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100408956_100408957insAAAC	uc002tag.2	-						AFF3_uc002taf.2_Intron|AFF3_uc010fiq.1_Intron|AFF3_uc010yvr.1_Intron|AFF3_uc002tah.1_Intron|AFF3_uc010fir.1_Intron	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						aaacaaaacaaaaacaaacaaa	0.025													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	102177191	102177192	+	IGR	INS	-	AC	AC			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102177191_102177192insAC								RFX8 (86026 upstream) : MAP4K4 (137296 downstream)																							gaagtgtgtgtacacacacaca	0.000													4	2	---	---	---	---	
IL1RL2	8808	broad.mit.edu	37	2	102837140	102837141	+	Intron	DEL	TG	-	-	rs67680695		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102837140_102837141delTG	uc002tbs.2	+						IL1RL2_uc002tbt.2_Intron	NM_003854	NP_003845	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2 precursor						cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2						CATTAgtgtatgtgtgtgtgtg	0.337													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106197464	106197464	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106197464delT								FHL2 (142234 upstream) : NCK2 (163890 downstream)																							TCATTGGAAATTACTAAAATG	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106605471	106605472	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106605471_106605472insT								NCK2 (94745 upstream) : C2orf40 (76641 downstream)																							GATCTCTTTTATTTTTTTTCTT	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	107266244	107266245	+	IGR	DEL	TT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107266244_107266245delTT								RGPD3 (181443 upstream) : ST6GAL2 (151813 downstream)																							tcacaagagatttctctgtagc	0.000													4	2	---	---	---	---	
LIMS1	3987	broad.mit.edu	37	2	109292601	109292601	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109292601delA	uc002teg.2	+						LIMS1_uc002tef.2_Intron|LIMS1_uc002teh.2_Intron|LIMS1_uc002tei.2_Intron|LIMS1_uc002tej.2_Intron|LIMS1_uc002tek.3_Intron	NM_004987	NP_004978	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1						cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding				0						AATCTTCATGATTCAGGTGTC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	119686644	119686644	+	IGR	DEL	G	-	-	rs77557373		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119686644delG								EN1 (80885 upstream) : MARCO (13101 downstream)																							AAGCCCTCTAGGTGCTCTCTG	0.463													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122527771	122527771	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122527771delT								TSN (2345 upstream) : None (None downstream)																							atattccacattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	128160683	128160683	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128160683delA								MAP3K2 (59878 upstream) : PROC (15334 downstream)																							cacacataacaagagtgaata	0.015													5	3	---	---	---	---	
POTEE	445582	broad.mit.edu	37	2	131982840	131982840	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131982840delG	uc002tsn.2	+						PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Intron|POTEE_uc002tsl.2_Intron	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,								ATP binding				0						CTTGAAgccaggcatggtggt	0.129													4	2	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133012080	133012081	+	Intron	INS	-	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133012080_133012081insC	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						aggagtagcgactgcagtgtgt	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133032788	133032793	+	IGR	DEL	GAGAGA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133032788_133032793delGAGAGA								NCRNA00164 (17246 upstream) : GPR39 (141354 downstream)																							gtgtgtgtAGGAGAGAGAGAGAGAGA	0.364													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133117675	133117676	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133117675_133117676insA								NCRNA00164 (102133 upstream) : GPR39 (56471 downstream)																							aatatcctaccaaaaagacaca	0.000													5	4	---	---	---	---	
GPR39	2863	broad.mit.edu	37	2	133232145	133232146	+	Intron	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133232145_133232146delTG	uc002ttl.2	+							NM_001508	NP_001499	O43194	GPR39_HUMAN	G protein-coupled receptor 39							integral to plasma membrane	G-protein coupled receptor activity|metal ion binding				0						gtggagtgtttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
SPOPL	339745	broad.mit.edu	37	2	139293126	139293126	+	Intron	DEL	T	-	-	rs145075255		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139293126delT	uc002tvh.2	+							NM_001001664	NP_001001664	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like							nucleus				skin(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0296)		ttctagtagCTTttttttttt	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	140258730	140258731	+	IGR	DEL	CA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140258730_140258731delCA								NXPH2 (720919 upstream) : LRP1B (730265 downstream)																							gacacacatgcacacacacaca	0.000													4	2	---	---	---	---	
CCDC148	130940	broad.mit.edu	37	2	159281478	159281478	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159281478delG	uc002tzq.2	-						CCDC148_uc002tzr.2_Intron|CCDC148_uc010foh.2_Intron|CCDC148_uc010foi.1_Intron|CCDC148_uc010foj.1_Intron|CCDC148_uc010fok.1_Intron|CCDC148_uc002tzs.1_Intron	NM_138803	NP_620158	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148											ovary(2)	2						AATCAAAGTTGCACAACCCAA	0.413													4	2	---	---	---	---	
DPP4	1803	broad.mit.edu	37	2	162922704	162922704	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162922704delC	uc002ubz.2	-						DPP4_uc010fpb.2_Intron|DPP4_uc002uca.1_Intron|DPP4_uc002ucb.1_Intron	NM_001935	NP_001926	P27487	DPP4_HUMAN	dipeptidylpeptidase IV						cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)	ttctctccttccctcactctt	0.154													4	2	---	---	---	---	
SCN9A	6335	broad.mit.edu	37	2	167200309	167200313	+	Intron	DEL	AAAAG	-	-	rs10600585		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167200309_167200313delAAAAG	uc010fpl.2	-							NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	gtgtttcaaaaaaagaaaagaaaag	0.102													4	2	---	---	---	---	
LRP2	4036	broad.mit.edu	37	2	170038236	170038260	+	Intron	DEL	AGACTGCATTCTGAATTCTTTTCTG	-	-	rs61106961		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170038236_170038260delAGACTGCATTCTGAATTCTTTTCTG	uc002ues.2	-							NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TCTGTAGAGCAGACTGCATTCTGAATTCTTTTCTGCATTCAGAAA	0.378													5	3	---	---	---	---	
DYNC1I2	1781	broad.mit.edu	37	2	172560452	172560453	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172560452_172560453insT	uc002uha.1	+						DYNC1I2_uc002uhc.2_Intron|DYNC1I2_uc002uhb.1_Intron|DYNC1I2_uc010zds.1_Intron|DYNC1I2_uc002uhd.1_Intron|DYNC1I2_uc002uhe.1_Intron|DYNC1I2_uc002uhf.1_Intron|DYNC1I2_uc010zdt.1_Intron|DYNC1I2_uc002uhg.1_5'Flank	NM_001378	NP_001369	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|microtubule-based movement|transport	centrosome|cytosol|dynein complex|microtubule|vesicle	microtubule motor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.198)			CAACACTCCCATTCCCTACATT	0.416													4	2	---	---	---	---	
PDK1	5163	broad.mit.edu	37	2	173432377	173432377	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173432377delT	uc002uhr.2	+						PDK1_uc010zdz.1_Intron|PDK1_uc010zea.1_Intron|PDK1_uc002uhq.1_Intron|PDK1_uc002uhs.2_Intron|PDK1_uc010zeb.1_Intron	NM_002610	NP_002601	Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase 1 precursor						glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|small GTPase mediated signal transduction	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			lung(3)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.12)			ATATTAACTCTTTTGAGCCAT	0.368									Autosomal_Dominant_Polycystic_Kidney_Disease				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177063645	177063645	+	IGR	DEL	C	-	-	rs71409076		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177063645delC								HOXD1 (8010 upstream) : MTX2 (70478 downstream)																							gagtgagactccgtctcaaaa	0.104													4	4	---	---	---	---	
OSBPL6	114880	broad.mit.edu	37	2	179232610	179232610	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179232610delT	uc002ulx.2	+						OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Intron|OSBPL6_uc010zfe.1_Intron|OSBPL6_uc002ulz.2_Intron|OSBPL6_uc002uma.2_Intron	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			CTGTTAGGCCTTTGGTCCTGT	0.502													4	2	---	---	---	---	
CCDC141	285025	broad.mit.edu	37	2	179847021	179847022	+	Intron	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179847021_179847022delTG	uc002ung.2	-									Q6ZP82	CC141_HUMAN	SubName: Full=Putative uncharacterized protein CCDC141; SubName: Full=Putative uncharacterized protein FLJ39502;								protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			aaaaattggttgtgtttcttta	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	183405232	183405232	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183405232delC								PDE1A (17725 upstream) : DNAJC10 (175767 downstream)																							ACTAACCTCTCCCACTTTAAA	0.343													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	185024008	185024009	+	IGR	DEL	GT	-	-	rs71401986		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185024008_185024009delGT								NUP35 (997601 upstream) : ZNF804A (439084 downstream)																							tcccattggggtgtgtgtgtgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	187860221	187860224	+	IGR	DEL	GTGT	-	-	rs141476621		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187860221_187860224delGTGT								ZSWIM2 (146324 upstream) : CALCRL (347627 downstream)																							CTCTAATTTAgtgtgtgtgtgtgt	0.230													4	2	---	---	---	---	
MYO1B	4430	broad.mit.edu	37	2	192168963	192168963	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192168963delT	uc010fsg.2	+						MYO1B_uc002usq.2_Intron|MYO1B_uc002usr.2_Intron|MYO1B_uc002uss.1_Intron	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1							myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			ACTTTCAAAGTTTTCTTCCCA	0.338													4	2	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	206119915	206119916	+	Intron	DEL	CT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206119915_206119916delCT	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CTCAGGCAGGCTCTCTCTTGGT	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	207490134	207490135	+	IGR	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207490134_207490135delGT								ADAM23 (7457 upstream) : LOC200726 (17007 downstream)																							TCCCCTGCTCgtgtgtgtgtgt	0.406													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	216113997	216113997	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216113997delT								ABCA12 (110846 upstream) : ATIC (62695 downstream)																							GCCTTCTAAAttttttttttt	0.199													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	223253368	223253371	+	IGR	DEL	CTTT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223253368_223253371delCTTT								CCDC140 (83432 upstream) : SGPP2 (35951 downstream)																							ttcttccttcctttcttccttcct	0.235													13	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	224614789	224614789	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224614789delT								SCG2 (147668 upstream) : AP1S3 (5259 downstream)																							ATTTGTGCACTTTCTGTAAAT	0.338													4	2	---	---	---	---	
IRS1	3667	broad.mit.edu	37	2	227664854	227664854	+	5'Flank	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227664854delG	uc002voh.3	-							NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1						fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GGGGGGCCACGGGGGGGCACT	0.706													4	2	---	---	---	---	
PID1	55022	broad.mit.edu	37	2	230003582	230003583	+	Intron	INS	-	A	A	rs146663435	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230003582_230003583insA	uc002vpr.3	-						PID1_uc002vps.3_Intron|PID1_uc002vpt.3_Intron|PID1_uc002vpu.3_Intron	NM_001100818	NP_001094288	Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1							cytoplasm				breast(3)|skin(1)	4		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)		GTAGAAGGAGGAAAAAAAAATG	0.401													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	232445309	232445311	+	IGR	DEL	GGA	-	-	rs111897916		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232445309_232445311delGGA								NMUR1 (50127 upstream) : C2orf57 (12301 downstream)																							agaagaagagggaggaggaggag	0.000													3	4	---	---	---	---	
SPP2	6694	broad.mit.edu	37	2	234977837	234977838	+	Intron	DEL	AG	-	-	rs79821553		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234977837_234977838delAG	uc002vvk.1	+						SPP2_uc010fyl.1_Intron	NM_006944	NP_008875	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa precursor						bone remodeling|skeletal system development	extracellular region	endopeptidase inhibitor activity				0		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		tttgagagaaagagagagagag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235191159	235191159	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235191159delC								SPP2 (205383 upstream) : ARL4C (210529 downstream)																							caactggtctccgcgagcctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	236077947	236077953	+	IGR	DEL	GATGGTG	-	-	rs140105235		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236077947_236077953delGATGGTG								SH3BP4 (113591 upstream) : AGAP1 (324783 downstream)																							tgatggtgatgatggtgaatggtgatg	0.034													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	238039711	238039712	+	IGR	DEL	TG	-	-	rs144613674		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238039711_238039712delTG								COPS8 (32224 upstream) : COL6A3 (192943 downstream)																							gtgcatatgatgtgagtgtaat	0.035													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241248832	241248833	+	IGR	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241248832_241248833delTG								OTOS (168759 upstream) : GPC1 (126282 downstream)																							tgtgtatctctgtgtgtgtgtc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241901004	241901005	+	Intron	DEL	CA	-	-	rs77244041		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241901004_241901005delCA	uc002waf.2	-											Homo sapiens, clone IMAGE:5745636, mRNA.																		cacatacactcacacacacaca	0.064													3	5	---	---	---	---	
STK25	10494	broad.mit.edu	37	2	242443112	242443121	+	Intron	DEL	AAAAAAAAAA	-	-	rs67843755		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242443112_242443121delAAAAAAAAAA	uc002wbm.2	-						STK25_uc002wbn.2_Intron|STK25_uc002wbo.2_Intron|STK25_uc010zos.1_Intron|STK25_uc010zot.1_Intron|STK25_uc002wbp.2_Intron|STK25_uc010fzo.2_Intron|STK25_uc010zou.1_Intron|STK25_uc010zov.1_Intron|STK25_uc010zow.1_Intron	NM_006374	NP_006365	O00506	STK25_HUMAN	serine/threonine kinase 25						response to oxidative stress|signal transduction	Golgi apparatus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity				0		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		actccgtctcaaaaaaaaaaaaaaaaaaaa	0.214													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	242867636	242867636	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242867636delT								C2orf85 (52154 upstream) : LOC728323 (163208 downstream)																							AGTGCCGCCCTTCCTCCCATG	0.622													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	1944001	1944002	+	IGR	DEL	AG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1944001_1944002delAG								CNTN6 (498724 upstream) : CNTN4 (196548 downstream)																							aagagaaaaaagagagagaaag	0.193													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	1989985	1989986	+	IGR	INS	-	TG	TG	rs2729293		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1989985_1989986insTG								CNTN6 (544708 upstream) : CNTN4 (150564 downstream)																							AGAAATAAgtatgtgtgtgtgt	0.267													4	2	---	---	---	---	
ITPR1	3708	broad.mit.edu	37	3	4871537	4871538	+	Intron	INS	-	CTCC	CTCC	rs148669080	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4871537_4871538insCTCC	uc003bqa.2	+						ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron|ITPR1_uc003bqc.2_Intron|ITPR1_uc010hcc.1_Intron|ITPR1_uc011asv.1_Intron	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		cctatttatcactccctccctc	0.059													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	5372497	5372500	+	IGR	DEL	TTCT	-	-	rs67782122		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5372497_5372500delTTCT								EDEM1 (110848 upstream) : None (None downstream)																							CCATGGGACATTCTTTCTATTGCT	0.446													2	4	---	---	---	---	
ATG7	10533	broad.mit.edu	37	3	11517343	11517346	+	Intron	DEL	ACAC	-	-	rs34727633		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11517343_11517346delACAC	uc003bwc.2	+						ATG7_uc003bwd.2_Intron|ATG7_uc011aum.1_Intron	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						TGTCTCTGAGacacacacacacac	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	12740811	12740812	+	IGR	DEL	TG	-	-	rs149679157		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12740811_12740812delTG								RAF1 (35111 upstream) : TMEM40 (34580 downstream)																							catgtgattttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
RFTN1	23180	broad.mit.edu	37	3	16435158	16435159	+	Intron	INS	-	T	T	rs35917033		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16435158_16435159insT	uc003cay.2	-						RFTN1_uc010hes.2_Intron	NM_015150	NP_055965	Q14699	RFTN1_HUMAN	raft-linking protein							plasma membrane				ovary(3)|central_nervous_system(1)	4						agctgatggacttttttttttt	0.000													3	3	---	---	---	---	
LRRC3B	116135	broad.mit.edu	37	3	26682101	26682101	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:26682101delT	uc003cdp.2	+						LRRC3B_uc003cdq.2_Intron	NM_052953	NP_443185	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B precursor							integral to membrane				pancreas(2)|ovary(1)|skin(1)	4						GTCAGGGTTATTTTTAAAATA	0.219													4	3	---	---	---	---	
SLC4A7	9497	broad.mit.edu	37	3	27465427	27465427	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27465427delA	uc003cdv.2	-						SLC4A7_uc011awu.1_Intron|SLC4A7_uc011awv.1_Intron|SLC4A7_uc003cdu.3_Intron|SLC4A7_uc011aww.1_Intron|SLC4A7_uc011awx.1_Intron|SLC4A7_uc011awy.1_Intron|SLC4A7_uc011awz.1_Intron|SLC4A7_uc011axa.1_Intron|SLC4A7_uc011axb.1_Intron|SLC4A7_uc010hfm.2_3'UTR|SLC4A7_uc010hfl.2_Intron|SLC4A7_uc003cdw.2_Intron	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate							apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)|skin(1)	5						CCAGTCTACTAAAAAATTACT	0.294													7	6	---	---	---	---	
TGFBR2	7048	broad.mit.edu	37	3	30678556	30678556	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30678556delA	uc003ceo.2	+						TGFBR2_uc003cen.2_Intron	NM_003242	NP_003233	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II						activation of protein kinase activity|brain development|embryonic cranial skeleton morphogenesis|embryonic hemopoiesis|heart development|myeloid dendritic cell differentiation|palate development|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of B cell tolerance induction|positive regulation of mesenchymal cell proliferation|positive regulation of NK T cell differentiation|positive regulation of reactive oxygen species metabolic process|positive regulation of T cell tolerance induction|positive regulation of tolerance induction to self antigen|response to cholesterol|response to drug|transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|vasculogenesis	caveola|external side of plasma membrane	ATP binding|glycosaminoglycan binding|metal ion binding|protein binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type II|type I transforming growth factor beta receptor binding|type I transforming growth factor beta receptor binding|type III transforming growth factor beta receptor binding			pancreas(9)|large_intestine(6)|stomach(4)|lung(3)|ovary(3)|central_nervous_system(1)	26						actctgtctgaaaaaaaaaaa	0.020													4	2	---	---	---	---	
NKTR	4820	broad.mit.edu	37	3	42660111	42660112	+	Intron	INS	-	T	T	rs151179294	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42660111_42660112insT	uc003clo.2	+						NKTR_uc003cll.1_Intron|NKTR_uc003clm.1_Intron|NKTR_uc003clp.2_Intron|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_5'Flank	NM_005385	NP_005376	P30414	NKTR_HUMAN	natural killer-tumor recognition sequence						protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)		taatttttgtattttttttttt	0.000													4	2	---	---	---	---	
SETD2	29072	broad.mit.edu	37	3	47070556	47070556	+	Intron	DEL	T	-	-	rs35295276		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47070556delT	uc003cqs.2	-						SETD2_uc003cqv.2_Intron|SETD2_uc003cqr.2_Intron	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AAACTTTTAAttttttttttt	0.209			N|F|S|Mis		clear cell renal carcinoma								2	4	---	---	---	---	
DNAH1	25981	broad.mit.edu	37	3	52373821	52373822	+	Intron	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52373821_52373822delTG	uc011bef.1	+						DNAH1_uc003ddt.1_Intron	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1						ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		tgtgtgtgtctgtgtgtgtgtg	0.000													4	2	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	55008544	55008544	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55008544delC	uc003dhf.2	+						CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CACTCCCAGGCACCCTGCCCT	0.333													4	2	---	---	---	---	
ERC2	26059	broad.mit.edu	37	3	56322988	56322988	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56322988delG	uc003dhr.1	-							NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TCACGGCCTTGGGGCGTGGTG	0.403													4	2	---	---	---	---	
C3orf67	200844	broad.mit.edu	37	3	59006270	59006271	+	Intron	DEL	TG	-	-	rs112497186		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59006270_59006271delTG	uc003dkt.1	-						C3orf67_uc003dkv.1_Intron|C3orf67_uc003dkw.2_Intron|C3orf67_uc011bfg.1_Intron	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844												0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		CATGAAATAATGTGTGTGTGTG	0.139													4	4	---	---	---	---	
FHIT	2272	broad.mit.edu	37	3	60022492	60022495	+	Intron	DEL	TTTG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60022492_60022495delTTTG	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		GTCAACAGGTtttgtttgtttgtt	0.338			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				4	2	---	---	---	---	
FHIT	2272	broad.mit.edu	37	3	61196985	61196986	+	Intron	INS	-	TT	TT	rs137938145	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61196985_61196986insTT	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		taatactgcacttttccgatgg	0.000			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				4	2	---	---	---	---	
SYNPR	132204	broad.mit.edu	37	3	63476585	63476585	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63476585delA	uc003dlq.2	+						SYNPR_uc003dlp.2_Intron|SYNPR_uc011bfk.1_Intron|SYNPR_uc011bfl.1_Intron|SYNPR_uc010hnt.2_Intron|SYNPR_uc011bfm.1_Intron	NM_144642	NP_653243	Q8TBG9	SYNPR_HUMAN	synaptoporin isoform 2							cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	transporter activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		gattacaggcagccaccatca	0.000													4	2	---	---	---	---	
MAGI1	9223	broad.mit.edu	37	3	65600698	65600698	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65600698delA	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc010hny.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		ctgtgtctccaaaaaaaaaaa	0.075													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	68006914	68006915	+	IGR	INS	-	A	A	rs139318929		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68006914_68006915insA								SUCLG2 (301876 upstream) : FAM19A1 (33819 downstream)																							TTCTGTGAGTTTATGTATTTTT	0.168													5	3	---	---	---	---	
FRMD4B	23150	broad.mit.edu	37	3	69261177	69261178	+	Intron	INS	-	C	C	rs148776556	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69261177_69261178insC	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnx.1_Intron|FRMD4B_uc011bga.1_Intron	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CAGAGTAGACACCCCCCaaaaa	0.178													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75703977	75703978	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75703977_75703978insT								MIR1324 (23968 upstream) : ZNF717 (54816 downstream)																							TCTTTTCTGAATTTTTTATTTT	0.322													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75741762	75741764	+	IGR	DEL	TTA	-	-	rs140744949		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75741762_75741764delTTA								MIR1324 (61753 upstream) : ZNF717 (17030 downstream)																							gaaagacttcttatgtttgagaa	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	80680004	80680005	+	IGR	INS	-	AC	AC	rs139111880	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80680004_80680005insAC								ROBO1 (862945 upstream) : GBE1 (858845 downstream)																							TTTCAACCTATacacacacaca	0.327													1	5	---	---	---	---	
EPHA6	285220	broad.mit.edu	37	3	97107152	97107153	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97107152_97107153insT	uc010how.1	+							NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						gagaagaaaactttttttttta	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	98861308	98861309	+	IGR	INS	-	C	C	rs146614520	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98861308_98861309insC								DCBLD2 (240775 upstream) : COL8A1 (496145 downstream)																							agcacagactaccataggacac	0.015													3	3	---	---	---	---	
FILIP1L	11259	broad.mit.edu	37	3	99787195	99787196	+	Intron	DEL	TG	-	-	rs63514560		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99787195_99787196delTG	uc003dtm.2	-						C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_Intron	NM_182909	NP_878913	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like isoform 1							cytoplasm|membrane|myosin complex|nucleus				ovary(1)	1						AAAGAGCCTCtgtgtgtgtgtg	0.144													4	3	---	---	---	---	
FILIP1L	11259	broad.mit.edu	37	3	99833339	99833340	+	5'UTR	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99833339_99833340delTG	uc003dtm.2	-	1					C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_5'UTR	NM_182909	NP_878913	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like isoform 1							cytoplasm|membrane|myosin complex|nucleus				ovary(1)	1						TGAGCACGTCtgtgtgtgtgtg	0.465													4	3	---	---	---	---	
GPR128	84873	broad.mit.edu	37	3	100381714	100381715	+	Intron	INS	-	A	A	rs138062331	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100381714_100381715insA	uc003duc.2	+						GPR128_uc011bhc.1_Intron|GPR128_uc003dud.2_Intron	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						GGGGATGGCAGAAAAAAGACAC	0.292													3	3	---	---	---	---	
NFKBIZ	64332	broad.mit.edu	37	3	101577972	101577973	+	Intron	INS	-	C	C	rs144867669	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101577972_101577973insC	uc003dvp.2	+						NFKBIZ_uc003dvo.2_Intron|NFKBIZ_uc010hpo.2_Intron|NFKBIZ_uc003dvq.2_Intron	NM_031419	NP_113607	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(2)	2						TCTGAAATAAGTTTAAAAGGAG	0.272													3	3	---	---	---	---	
LOC100302640	100302640	broad.mit.edu	37	3	106714506	106714511	+	Intron	DEL	ACACAA	-	-	rs146888814		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106714506_106714511delACACAA	uc003dwf.3	-											Homo sapiens cDNA clone IMAGE:5284861.												0						acacacacacacacaaacacacacac	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	107225436	107225437	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107225436_107225437insT								CCDC54 (127955 upstream) : BBX (16346 downstream)																							CCATATGGCAATTTtttttctg	0.203													4	2	---	---	---	---	
GUCA1C	9626	broad.mit.edu	37	3	108654606	108654606	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108654606delT	uc003dxj.2	-						GUCA1C_uc003dxk.2_Intron	NM_005459	NP_005450	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C						signal transduction|visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						ATATGGTTAATTTTTTTCCTT	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	110572139	110572139	+	IGR	DEL	A	-	-	rs76538386		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110572139delA								None (None upstream) : PVRL3 (218726 downstream)																							gtgaagttccaaagactctat	0.040													2	4	---	---	---	---	
PVRL3	25945	broad.mit.edu	37	3	110824830	110824831	+	Intron	DEL	TT	-	-	rs62849760		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110824830_110824831delTT	uc003dxt.1	+						PVRL3_uc003dxu.1_Intron	NM_015480	NP_056295	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3 precursor						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane	cell adhesion molecule binding|protein homodimerization activity			upper_aerodigestive_tract(2)	2						ttaccagtgctttttttttttt	0.064													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	112092070	112092070	+	IGR	DEL	T	-	-	rs11336605		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112092070delT								CD200 (10414 upstream) : BTLA (90745 downstream)																							acccaggtaattttttttttt	0.000													4	2	---	---	---	---	
ATP6V1A	523	broad.mit.edu	37	3	113504712	113504713	+	Intron	DEL	TT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113504712_113504713delTT	uc003eao.2	+						ATP6V1A_uc011bik.1_Intron	NM_001690	NP_001681	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit A						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			ovary(2)|skin(1)	3						TCTTTCtttctttttttttttt	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	116480877	116480878	+	IGR	DEL	TC	-	-	rs34011879		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116480877_116480878delTC								LOC285194 (44992 upstream) : None (None downstream)																							TTTCTCCTGTtctctctctctc	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	116742635	116742640	+	IGR	DEL	CTCCCT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116742635_116742640delCTCCCT								LOC285194 (306750 upstream) : None (None downstream)																							tccttcccccctccctctttccttgc	0.044													6	3	---	---	---	---	
EAF2	55840	broad.mit.edu	37	3	121565566	121565567	+	Intron	INS	-	T	T	rs11387474		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121565566_121565567insT	uc003een.2	+						EAF2_uc003eeo.2_Intron	NM_018456	NP_060926	Q96CJ1	EAF2_HUMAN	ELL associated factor 2						apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	protein binding				0				GBM - Glioblastoma multiforme(114;0.0972)		CTTTAGTTGGATTTTTTTTTTT	0.361													4	3	---	---	---	---	
HEG1	57493	broad.mit.edu	37	3	124714940	124714941	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124714940_124714941insT	uc003ehs.3	-						HEG1_uc003ehr.3_Intron|HEG1_uc011bke.1_Intron	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN	HEG homolog 1 precursor							extracellular region|integral to membrane	calcium ion binding			ovary(2)	2						CAtttgttttcttttttttttt	0.257													4	2	---	---	---	---	
ZNF148	7707	broad.mit.edu	37	3	124986426	124986428	+	Intron	DEL	AAT	-	-	rs138061467		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124986426_124986428delAAT	uc003ehx.3	-						SLC12A8_uc003ehw.3_Intron|ZNF148_uc003ehz.3_Intron|ZNF148_uc010hsa.2_Intron|ZNF148_uc003eia.3_Intron|ZNF148_uc003ehy.2_Intron	NM_021964	NP_068799	Q9UQR1	ZN148_HUMAN	zinc finger protein 148						cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4						catacctcacaataataagagcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	125566939	125566947	+	IGR	DEL	AAGAGGGAG	-	-	rs112527147		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125566939_125566947delAAGAGGGAG								MIR548I1 (57544 upstream) : LOC100125556 (68497 downstream)																							CAACGGATTAAAGAGGGAGAAGCCCACGA	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	126858113	126858114	+	IGR	DEL	GT	-	-	rs111608692	byFrequency	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126858113_126858114delGT								PLXNA1 (101885 upstream) : TPRA1 (433794 downstream)																							agagaTGGGGGTGTGTGTGTGT	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	126873114	126873117	+	IGR	DEL	GTGT	-	-	rs72121332		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126873114_126873117delGTGT								PLXNA1 (116886 upstream) : TPRA1 (418791 downstream)																							gtgtatgagggtgtgtgtatgtga	0.044													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128137463	128137463	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128137463delC								EEFSEC (9975 upstream) : DNAJB8 (43819 downstream)																							CTGCCCAGCACCCCCTACTCT	0.622													9	5	---	---	---	---	
ATP2C1	27032	broad.mit.edu	37	3	130568777	130568777	+	5'Flank	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130568777delT	uc011bli.1	+						ATP2C1_uc011blg.1_5'Flank|ATP2C1_uc011blh.1_5'Flank	NM_001001487	NP_001001487	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1b						actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	TCTTTTGTTCTTTTTTTTTTA	0.259									Hailey-Hailey_disease				4	2	---	---	---	---	
ATP2C1	27032	broad.mit.edu	37	3	130600191	130600196	+	Intron	DEL	CTCCTC	-	-	rs115679514		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130600191_130600196delCTCCTC	uc011bli.1	+						ATP2C1_uc011blg.1_Intron|ATP2C1_uc011blh.1_Intron	NM_001001487	NP_001001487	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1b						actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	tcttcttcttctcctcctcctcctcc	0.170									Hailey-Hailey_disease				7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	133795930	133795931	+	IGR	DEL	AC	-	-	rs72373180		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133795930_133795931delAC								SLCO2A1 (47010 upstream) : RYK (80047 downstream)																							TCTCTCTTTTacacacacacac	0.252													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	133881079	133881079	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133881079delT								RYK (-88507 upstream) : RYK (-5101 downstream)																							gcttcaaccattttttttttt	0.000													4	2	---	---	---	---	
EPHB1	2047	broad.mit.edu	37	3	134571506	134571507	+	Intron	INS	-	GT	GT	rs146683756		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134571506_134571507insGT	uc003eqt.2	+						EPHB1_uc010htz.1_Intron|EPHB1_uc011bly.1_Intron	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						GTAAATGTGGGgtgtgtgtgtg	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	135406466	135406467	+	IGR	DEL	TG	-	-	rs63085362		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135406466_135406467delTG								EPHB1 (427161 upstream) : PPP2R3A (278100 downstream)																							GCCAGAAGTCtgtgtgtgtgtg	0.436													4	2	---	---	---	---	
NCK1	4690	broad.mit.edu	37	3	136585775	136585775	+	Intron	DEL	T	-	-	rs11294236		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136585775delT	uc003erh.2	+							NM_006153	NP_006144	P16333	NCK1_HUMAN	NCK adaptor protein 1						axon guidance|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of translation|signal complex assembly|T cell activation|T cell receptor signaling pathway	cytosol|endoplasmic reticulum|nucleus	cytoskeletal adaptor activity|receptor binding|receptor signaling complex scaffold activity			pancreas(1)	1						GTCTTTAAAATTTTTTTTTTC	0.189													6	3	---	---	---	---	
MRAS	22808	broad.mit.edu	37	3	138070102	138070103	+	Intron	INS	-	AAA	AAA	rs144379400	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138070102_138070103insAAA	uc003esh.3	+						MRAS_uc011bmi.1_Intron|MRAS_uc003esi.3_Intron|MRAS_uc011bmj.1_Intron	NM_012219	NP_036351	O14807	RASM_HUMAN	muscle RAS oncogene homolog precursor						actin cytoskeleton organization|muscle organ development|Ras protein signal transduction	intracellular|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity			lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						TCATGAGCATTGTGTAGTTTGT	0.411													2	6	---	---	---	---	
MRAS	22808	broad.mit.edu	37	3	138090664	138090665	+	Intron	DEL	CT	-	-	rs66522727		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138090664_138090665delCT	uc003esh.3	+						MRAS_uc011bmi.1_Intron|MRAS_uc003esi.3_Intron|MRAS_uc011bmj.1_Intron	NM_012219	NP_036351	O14807	RASM_HUMAN	muscle RAS oncogene homolog precursor						actin cytoskeleton organization|muscle organ development|Ras protein signal transduction	intracellular|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity			lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						CTTCTGGAAACTCTTGGCTTCC	0.510													1	7	---	---	---	---	
ZBTB38	253461	broad.mit.edu	37	3	141097204	141097205	+	Intron	DEL	AC	-	-	rs10575001		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141097204_141097205delAC	uc003etw.2	+							NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38						positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						acatacaggtacacacacacac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	145046817	145046817	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145046817delT								None (None upstream) : PLOD2 (740411 downstream)																							ttgccagtcctttttttgcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	145187215	145187216	+	IGR	INS	-	TAGT	TAGT	rs141755741	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145187215_145187216insTAGT								None (None upstream) : PLOD2 (600012 downstream)																							aaaaaaacagatagataacaga	0.015													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	145645032	145645038	+	IGR	DEL	TAGAAGA	-	-	rs72486427		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145645032_145645038delTAGAAGA								None (None upstream) : PLOD2 (142190 downstream)																							AAGACAATGTTAGAAGATAGAACACAA	0.353													3	3	---	---	---	---	
CPB1	1360	broad.mit.edu	37	3	148562685	148562685	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148562685delA	uc003ewl.2	+							NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TAAAAGCACCAAAAAAAAAAA	0.139													5	3	---	---	---	---	
GYG1	2992	broad.mit.edu	37	3	148726945	148726946	+	Intron	INS	-	A	A	rs76612354		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148726945_148726946insA	uc003ewn.2	+						GYG1_uc011bnp.1_Intron|GYG1_uc003ewo.2_Intron|GYG1_uc003ewp.2_Intron	NM_004130	NP_004121	P46976	GLYG_HUMAN	glycogenin 1						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	glycogenin glucosyltransferase activity|metal ion binding|protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			gactccgtctcaaaaaaaaaaa	0.114													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	152473871	152473871	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152473871delC								MBNL1 (290303 upstream) : P2RY1 (78865 downstream)																							TAACTGCTTACCATAAAACTT	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	153538810	153538810	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153538810delT								C3orf79 (318327 upstream) : SGEF (300339 downstream)																							AGCTCATCCCTGACTCCATGA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	154252154	154252155	+	IGR	DEL	AC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154252154_154252155delAC								GPR149 (104650 upstream) : MME (489758 downstream)																							tatctgagagacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	154478782	154478783	+	IGR	DEL	TG	-	-	rs112227526		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154478782_154478783delTG								GPR149 (331278 upstream) : MME (263130 downstream)																							tgagtgtatatgtgtgtgtgtg	0.054													3	5	---	---	---	---	
PLCH1	23007	broad.mit.edu	37	3	155319484	155319484	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155319484delT	uc011bok.1	-						PLCH1_uc011boj.1_Intron|PLCH1_uc011bol.1_Intron	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CTGATGCTGATTTTTTTTTac	0.164													4	2	---	---	---	---	
PLCH1	23007	broad.mit.edu	37	3	155363749	155363749	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155363749delG	uc011bok.1	-						PLCH1_uc011boj.1_Intron|PLCH1_uc011bol.1_Intron	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			agcaggatctggggggaaagg	0.000													4	2	---	---	---	---	
KCNAB1	7881	broad.mit.edu	37	3	155905834	155905835	+	Intron	INS	-	T	T	rs138792111	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155905834_155905835insT	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CATTCATTCTCTTTATAGCTTC	0.411													1	6	---	---	---	---	
PPM1L	151742	broad.mit.edu	37	3	160666108	160666108	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160666108delC	uc003fdr.2	+						PPM1L_uc003fds.2_Intron|PPM1L_uc003fdt.2_Intron|PPM1L_uc010hwf.2_Intron	NM_139245	NP_640338	Q5SGD2	PPM1L_HUMAN	protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			ATCTCATTTTCCTCTTGCTAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161452762	161452762	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161452762delT								OTOL1 (231034 upstream) : None (None downstream)																							ctgatcttcctTttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	168153866	168153866	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168153866delG								GOLIM4 (340449 upstream) : MIR551B (115776 downstream)																							acagcttgctgagggagtggt	0.114													4	2	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	168949563	168949563	+	Intron	DEL	A	-	-	rs72097796		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168949563delA	uc011bpj.1	-						MECOM_uc003ffl.2_Intron|MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						CCATGACCAGAAAAAAAAAAA	0.179													4	2	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	169178851	169178852	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169178851_169178852insT	uc011bpj.1	-						MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						CCAATGTTTTCTTTTTTTTTCT	0.401													4	2	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	171896444	171896444	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171896444delG	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron|FNDC3B_uc003fhx.2_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		ACACTCAGCCGGGGCATCCCT	0.463													4	2	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	171966896	171966897	+	Intron	INS	-	T	T	rs142246558	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171966896_171966897insT	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		GTTAGCTGTAATTTTTTTAATG	0.327													5	5	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	172018254	172018255	+	Intron	INS	-	T	T	rs147349498	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172018254_172018255insT	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TGTTCCATTTATTTTTTTTTTA	0.322													3	5	---	---	---	---	
NCEH1	57552	broad.mit.edu	37	3	172348906	172348907	+	3'UTR	INS	-	CCTC	CCTC	rs140880048	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172348906_172348907insCCTC	uc011bpx.1	-	5					NCEH1_uc003fig.2_3'UTR|NCEH1_uc011bpw.1_3'UTR|NCEH1_uc011bpy.1_3'UTR	NM_001146276	NP_001139748	Q6PIU2	NCEH1_HUMAN	arylacetamide deacetylase-like 1 isoform a						lipid catabolic process	endoplasmic reticulum|integral to membrane|microsome	carboxylesterase activity				0						ACAGTGGTTGACCTCTTTTTTC	0.337													4	2	---	---	---	---	
TBL1XR1	79718	broad.mit.edu	37	3	176856398	176856398	+	Intron	DEL	A	-	-	rs60532991		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176856398delA	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron|TBL1XR1_uc003fiy.2_Intron	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			aaaaaGGGAGAGGGGGAAAGT	0.274													5	4	---	---	---	---	
FXR1	8087	broad.mit.edu	37	3	180641299	180641299	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180641299delT	uc003fkq.2	+						FXR1_uc003fkp.2_Intron|FXR1_uc003fkr.2_Intron|FXR1_uc011bqj.1_Intron|FXR1_uc003fks.2_Intron|FXR1_uc011bqk.1_Intron|FXR1_uc011bql.1_Intron	NM_005087	NP_005078	P51114	FXR1_HUMAN	fragile X mental retardation-related protein 1						apoptosis|cell differentiation|muscle organ development	nucleolus|polysome				breast(1)	1	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			TTAGTGAGGCTTTTTTTTTTC	0.348													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181600968	181600969	+	IGR	DEL	AC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181600968_181600969delAC								SOX2OT (141965 upstream) : ATP11B (910322 downstream)																							acgtgtgcatacacacacacac	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182050042	182050043	+	IGR	INS	-	G	G	rs139729309	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182050042_182050043insG								SOX2OT (591039 upstream) : ATP11B (461248 downstream)																							TCTCCACCTAtaccttggtaaa	0.213													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182389119	182389120	+	IGR	INS	-	A	A	rs77034400		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182389119_182389120insA								SOX2OT (930116 upstream) : ATP11B (122171 downstream)																							CTTTCCTTTGCAAAAAAAAAAA	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	183279760	183279760	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183279760delA								KLHL6 (6261 upstream) : KLHL24 (73651 downstream)																							acctagtctcaaaaaaaaaaa	0.169													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	183778476	183778479	+	IGR	DEL	GTTT	-	-	rs111532443		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183778476_183778479delGTTT								HTR3C (17 upstream) : HTR3E (36373 downstream)																							TGGCTCTTCAgtttgtttgtttgt	0.235													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184512923	184512923	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184512923delT								MAGEF1 (83087 upstream) : VPS8 (17008 downstream)																							ggcaagccactttaacttctt	0.124													5	5	---	---	---	---	
MAP3K13	9175	broad.mit.edu	37	3	185143868	185143869	+	Intron	INS	-	CTTCTT	CTTCTT	rs139390268	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185143868_185143869insCTTCTT	uc010hyf.2	+						MAP3K13_uc011brt.1_Intron|MAP3K13_uc003fph.3_Intron|MAP3K13_uc011bru.1_Intron|MAP3K13_uc003fpi.2_Intron|MAP3K13_uc010hyg.2_Intron	NM_004721	NP_004712	O43283	M3K13_HUMAN	mitogen-activated protein kinase kinase kinase						activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			ovary(2)|skin(1)	3	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			tccctctTCTCCttcttcttct	0.050													6	4	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	187907843	187907844	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187907843_187907844insT	uc011bsg.1	+							NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		cattctgtggattttttttttt	0.094			T	HMGA2|MLL|C12orf9	lipoma|leukemia								5	3	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188372321	188372322	+	Intron	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188372321_188372322delTG	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		TTCTCtgtgttgtgtgtgtgtg	0.287			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	2	---	---	---	---	
TP63	8626	broad.mit.edu	37	3	189430547	189430550	+	Intron	DEL	AGAC	-	-	rs67215971		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189430547_189430550delAGAC	uc003fry.2	+						TP63_uc003frx.2_Intron|TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1						anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		tcagattgaaagacagagtaggca	0.054									Hay-Wells_syndrome	HNSCC(45;0.13)			2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	191281594	191281595	+	IGR	INS	-	C	C	rs142172858	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191281594_191281595insC								PYDC2 (102351 upstream) : FGF12 (578089 downstream)																							TCTTAAGAGTTCGTCAATGGCA	0.371													6	3	---	---	---	---	
FGF12	2257	broad.mit.edu	37	3	191861694	191861698	+	3'UTR	DEL	ATTTT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191861694_191861698delATTTT	uc003fsx.2	-	5					FGF12_uc003fsy.2_3'UTR	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		TTGCGTTGTCATTTTATTTTCCTCT	0.273													12	8	---	---	---	---	
FGF12	2257	broad.mit.edu	37	3	192103443	192103449	+	Intron	DEL	ATAGTTT	-	-	rs149960789		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192103443_192103449delATAGTTT	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		catataaaccatagtttatatgtccaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193431955	193431955	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193431955delT								OPA1 (16356 upstream) : LOC100128023 (278929 downstream)																							agtttggaactttttagagac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194075230	194075231	+	IGR	INS	-	TG	TG			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194075230_194075231insTG								CPN2 (3173 upstream) : LRRC15 (746 downstream)																							GCCTGCATGCATGTGTGTGTGT	0.446													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195353385	195353386	+	IGR	DEL	CG	-	-	rs111429267		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195353385_195353386delCG								APOD (42309 upstream) : SDHAP2 (31524 downstream)																							catgcacacacgcgcacacaca	0.030													6	7	---	---	---	---	
SDHAP2	727956	broad.mit.edu	37	3	195414994	195414995	+	Intron	INS	-	C	C	rs146201388	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195414994_195414995insC	uc003fuw.2	+						SDHAP2_uc003fuv.2_Intron					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						ATAAATTTGTTCTTAAAGTGTA	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195439719	195439720	+	IGR	INS	-	CT	CT	rs63098860		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195439719_195439720insCT								MIR570 (13351 upstream) : MUC20 (8033 downstream)																							tcctgccctaactcctccctga	0.144													9	5	---	---	---	---	
UBXN7	26043	broad.mit.edu	37	3	196080741	196080742	+	3'UTR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196080741_196080742insT	uc003fwm.3	-	11					UBXN7_uc003fwn.3_3'UTR|UBXN7_uc010iae.2_3'UTR	NM_015562	NP_056377	O94888	UBXN7_HUMAN	UBX domain containing 7								protein binding			ovary(2)|pancreas(1)	3						TCCTCCCTAGCTTTTTTTTTTT	0.317													4	2	---	---	---	---	
DLG1	1739	broad.mit.edu	37	3	197028588	197028588	+	5'Flank	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197028588delT	uc010ial.2	-						uc003fxq.2_Intron	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		ttttcttttcttttttttttt	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	197186342	197186343	+	IGR	INS	-	G	G	rs146812946		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197186342_197186343insG								DLG1 (160199 upstream) : BDH1 (50312 downstream)																							tgtggtcaggagggatgtggtc	0.129													3	6	---	---	---	---	
BDH1	622	broad.mit.edu	37	3	197255172	197255173	+	Intron	INS	-	AA	AA	rs62282550		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197255172_197255173insAA	uc003fxr.2	-						BDH1_uc003fxs.2_Intron|BDH1_uc003fxt.2_Intron|BDH1_uc003fxu.2_Intron	NM_203314	NP_976059	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1						cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity			ovary(1)	1	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	NADH(DB00157)	agtgagtgagtgagtgtgtgtg	0.248													3	3	---	---	---	---	
POLN	353497	broad.mit.edu	37	4	2198366	2198366	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2198366delA	uc003ger.2	-						POLN_uc010ich.1_Intron|POLN_uc011bvi.1_Intron	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			GTGGCTCTGGAAAAAAAAAAA	0.398								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3070474	3070475	+	IGR	INS	-	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3070474_3070475insG								GRK4 (28000 upstream) : HTT (5933 downstream)																							ctctgccccttgggctcaaatg	0.000													4	2	---	---	---	---	
RGS12	6002	broad.mit.edu	37	4	3367081	3367081	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3367081delA	uc003ggw.2	+						RGS12_uc003ggu.2_Intron|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_Intron|RGS12_uc003ggv.2_Intron|RGS12_uc003ggy.1_Intron	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1							condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		gGGAGTCTggagggaggaggg	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3582008	3582011	+	Intron	DEL	CATC	-	-	rs142292377		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3582008_3582011delCATC	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																		cccatttattcatccatccatcca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3601952	3601952	+	IGR	DEL	T	-	-	rs67516442		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3601952delT								LRPAP1 (67728 upstream) : ADRA2C (166123 downstream)																							CATTCCTTACTTTTTTTTAGC	0.562													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3619775	3619776	+	IGR	DEL	TC	-	-	rs3082835		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3619775_3619776delTC								LRPAP1 (85551 upstream) : ADRA2C (148299 downstream)																							ggtgtttcagtcacaTTTTTTC	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3817072	3817081	+	IGR	DEL	AATATACTAT	-	-	rs79202006	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3817072_3817081delAATATACTAT								ADRA2C (46821 upstream) : LOC348926 (126589 downstream)																							actgtactccaatatactatactatactac	0.071													6	3	---	---	---	---	
PPP2R2C	5522	broad.mit.edu	37	4	6427540	6427541	+	Intron	INS	-	TG	TG	rs147253945	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6427540_6427541insTG	uc003gjc.2	-						PPP2R2C_uc011bwd.1_Intron|PPP2R2C_uc011bwe.1_Intron	NM_020416	NP_065149	Q9Y2T4	2ABG_HUMAN	gamma isoform of regulatory subunit B55, protein						signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						CGATGCTTGGCtgtgtgtgtgt	0.262													6	3	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7503074	7503075	+	Intron	DEL	AG	-	-	rs112722389		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7503074_7503075delAG	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						AGTGAAAAACAGAAGCAGCACA	0.455													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13028834	13028835	+	IGR	INS	-	T	T	rs138748870	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13028834_13028835insT								None (None upstream) : HSP90AB2P (306202 downstream)																							tgctatgaatgttttttttccT	0.178													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	14403456	14403463	+	IGR	DEL	CACACACA	-	-	rs62410074		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14403456_14403463delCACACACA								BOD1L (774128 upstream) : CPEB2 (602059 downstream)																							CTCTCTTTTTcacacacacacacacaca	0.106													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	18713504	18713504	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18713504delT								LCORL (690119 upstream) : None (None downstream)																							cttcctctccttcctttcttc	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	19166733	19166733	+	IGR	DEL	A	-	-	rs113087529		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19166733delA								None (None upstream) : None (None downstream)																							AAACTGCCTTAAAAAAAAAAa	0.159													4	2	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21908106	21908108	+	Intron	DEL	CCC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21908106_21908108delCCC	uc003gqi.1	-							NM_147182	NP_671711	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				gaagtgttctcccccacagcctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33447784	33447784	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33447784delC								None (None upstream) : None (None downstream)																							TTCTTATCGACCCCCCATTTT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33684718	33684719	+	IGR	INS	-	AC	AC	rs139106216	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33684718_33684719insAC								None (None upstream) : None (None downstream)																							AATGCAAAATTacacacacaca	0.282													3	3	---	---	---	---	
ARAP2	116984	broad.mit.edu	37	4	36227041	36227041	+	Intron	DEL	G	-	-	rs34696423		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36227041delG	uc003gsq.1	-						ARAP2_uc003gsr.1_Intron	NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH						regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						CAACTCCCATGGGCAATGTGG	0.517													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	37699579	37699579	+	IGR	DEL	A	-	-	rs67981500		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37699579delA								RELL1 (11580 upstream) : PGM2 (128703 downstream)																							GGTTTTTTGGAGACATCTCTA	0.299													2	6	---	---	---	---	
PDS5A	23244	broad.mit.edu	37	4	39918635	39918636	+	Intron	INS	-	A	A	rs10001599	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39918635_39918636insA	uc003guv.3	-						PDS5A_uc010ifo.2_Intron|PDS5A_uc003guw.3_Intron	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						ACaaaaaaattaaaaaaaaaaa	0.307													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	40330813	40330814	+	IGR	INS	-	T	T	rs145221373	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40330813_40330814insT								RHOH (84532 upstream) : CHRNA9 (6655 downstream)																							caatgcatacatgcaggtcagc	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	40642137	40642137	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40642137delA								RBM47 (9497 upstream) : NSUN7 (109777 downstream)																							caagaccctgaaaaaaaaaaa	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	40659274	40659274	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40659274delT								RBM47 (26634 upstream) : NSUN7 (92640 downstream)																							TCCCACAATCttttttttttt	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	41324350	41324350	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41324350delT								UCHL1 (53905 upstream) : LIMCH1 (38454 downstream)																							ctcaggaaacttataatcatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	41342148	41342149	+	IGR	INS	-	T	T	rs150861455	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41342148_41342149insT								UCHL1 (71703 upstream) : LIMCH1 (20655 downstream)																							tggtttgtgtgttttttttttc	0.000													4	2	---	---	---	---	
LIMCH1	22998	broad.mit.edu	37	4	41645336	41645337	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41645336_41645337insT	uc003gvu.3	+						LIMCH1_uc003gvv.3_Intron|LIMCH1_uc003gvw.3_Intron|LIMCH1_uc003gvx.3_Intron|LIMCH1_uc003gwe.3_Intron|LIMCH1_uc003gvy.3_Intron|LIMCH1_uc003gwa.3_Intron|LIMCH1_uc003gvz.3_Intron|LIMCH1_uc011byu.1_Intron|LIMCH1_uc003gwc.3_Intron|LIMCH1_uc003gwd.3_Intron|LIMCH1_uc011byv.1_Intron	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a						actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						GTGCATGGTAGTTTTTTTTTTC	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49218022	49218022	+	IGR	DEL	A	-	-	rs78904448		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49218022delA								CWH43 (153929 upstream) : None (None downstream)																							aattccccagaaaaaataaca	0.000													4	4	---	---	---	---	
KIT	3815	broad.mit.edu	37	4	55604337	55604337	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55604337delT	uc010igr.2	+						KIT_uc010igs.2_Intron	NM_000222	NP_000213	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral						male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity			soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGGTGTGCCCTTTTAGAAGAG	0.388		1	Mis|O		GIST|AML|TGCT|mastocytosis|mucosal melanoma	GIST|epithelioma	Piebald trait		Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors				4	2	---	---	---	---	
LPHN3	23284	broad.mit.edu	37	4	62697888	62697888	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62697888delT	uc010ihh.2	+						LPHN3_uc003hcq.3_Intron|LPHN3_uc003hcs.1_Intron	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						tgtatgagacttggagagggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	63489685	63489686	+	IGR	INS	-	C	C	rs143288276	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63489685_63489686insC								LPHN3 (551518 upstream) : None (None downstream)																							gcacctattgtccagctactac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	67226013	67226014	+	IGR	INS	-	G	G	rs141350431	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67226013_67226014insG								MIR1269 (83367 upstream) : None (None downstream)																							atctttacagagataaacctga	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	70306067	70306067	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70306067delA								UGT2B28 (145300 upstream) : UGT2B4 (39817 downstream)																							TAGATACTTTAAAAAAAAAAA	0.224													4	2	---	---	---	---	
SLC4A4	8671	broad.mit.edu	37	4	72359466	72359466	+	Intron	DEL	C	-	-	rs33923620		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72359466delC	uc003hfy.2	+						SLC4A4_uc010iic.2_Intron|SLC4A4_uc010iib.2_Intron|SLC4A4_uc003hfz.2_Intron|SLC4A4_uc003hgc.3_Intron|SLC4A4_uc010iid.2_Intron	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate							basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			TCCTTTTCATCCCCCTAACCA	0.259													4	2	---	---	---	---	
BMP2K	55589	broad.mit.edu	37	4	79709531	79709532	+	Intron	DEL	TT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79709531_79709532delTT	uc003hlk.2	+						BMP2K_uc010ijl.1_Intron|BMP2K_uc003hlj.2_Intron	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a							nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1						gATCTAAGGATTTTTTTTTTTT	0.173													4	2	---	---	---	---	
C4orf22	255119	broad.mit.edu	37	4	81468315	81468315	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81468315delT	uc003hmf.2	+						C4orf22_uc010ijp.2_Intron	NM_152770	NP_689983	Q6V702	CD022_HUMAN	hypothetical protein LOC255119											skin(2)	2						aatagcatggtactcatataa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	82715263	82715263	+	IGR	DEL	G	-	-	rs35489577		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82715263delG								RASGEF1B (322202 upstream) : HNRNPD (559204 downstream)																							cacaaggcaagggggggggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	84855464	84855465	+	Intron	INS	-	AAACAAAC	AAACAAAC	rs111951096		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84855464_84855465insAAACAAAC	uc010ikd.1	-											Homo sapiens cDNA FLJ37966 fis, clone CTONG2009871.																		ctctgtctcaaaaacaaacaaa	0.119													4	2	---	---	---	---	
FAM13A	10144	broad.mit.edu	37	4	89666319	89666320	+	Intron	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89666319_89666320delTG	uc003hse.1	-						FAM13A_uc003hsa.1_Intron|FAM13A_uc003hsb.1_Intron|FAM13A_uc003hsd.1_Intron|FAM13A_uc003hsc.1_Intron|FAM13A_uc011cdq.1_Intron|FAM13A_uc003hsf.1_Intron|FAM13A_uc003hsg.1_Intron	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						GATAAACGTCTGTGTGTGTGTG	0.277													4	2	---	---	---	---	
FAM190A	401145	broad.mit.edu	37	4	91375380	91375380	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91375380delT	uc003hsv.3	+						FAM190A_uc010ikv.2_Intron|FAM190A_uc003hsw.2_Intron	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2						ttgtttcatgttttttttttt	0.000													4	2	---	---	---	---	
BMPR1B	658	broad.mit.edu	37	4	95720455	95720457	+	Intron	DEL	TTT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95720455_95720457delTTT	uc003htm.3	+							NM_001203	NP_001194	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB						BMP signaling pathway|cartilage condensation|eye development|limb morphogenesis|ovarian cumulus expansion|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	receptor complex	ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta receptor activity			lung(4)|skin(2)|stomach(1)|breast(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		TGGGTGACTGttttttttttttt	0.232													4	2	---	---	---	---	
TSPAN5	10098	broad.mit.edu	37	4	99544061	99544061	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99544061delA	uc003hub.2	-						TSPAN5_uc011cdz.1_Intron	NM_005723	NP_005714	P62079	TSN5_HUMAN	transmembrane 4 superfamily member 9							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		ACAAAATTATAATATTGGTGG	0.169													4	2	---	---	---	---	
NFKB1	4790	broad.mit.edu	37	4	103495863	103495863	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103495863delT	uc011ceq.1	+						NFKB1_uc011cep.1_Intron	NM_003998	NP_003989	P19838	NFKB1_HUMAN	nuclear factor kappa-B, subunit 1 isoform 1						anti-apoptosis|apoptosis|cellular response to mechanical stimulus|inflammatory response|innate immune response|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of calcidiol 1-monooxygenase activity|nerve growth factor receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter	cytosol|I-kappaB/NF-kappaB complex|mitochondrion|nucleoplasm	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)|breast(2)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Dexamethasone(DB01234)|Pranlukast(DB01411)|Thalidomide(DB01041)	gtgctgcctgttttctagtgt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	104184642	104184642	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104184642delT								CENPE (65076 upstream) : TACR3 (325983 downstream)																							aaatgttccctttttgctgca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	104730427	104730428	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104730427_104730428insT								TACR3 (89454 upstream) : CXXC4 (662917 downstream)																							tcatttcaaccttggcgaatct	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	110268685	110268685	+	RNA	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110268685delG	uc003hzi.1	-	8		c.1379delC								Homo sapiens cDNA FLJ25407 fis, clone TST02904.																		CTTGCCGACAGGGGCTTCCTA	0.507													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	116759274	116759275	+	IGR	INS	-	A	A	rs138184676	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116759274_116759275insA								NDST4 (724242 upstream) : MIR1973 (461606 downstream)																							tccatcacattaacagaaccaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	124956856	124956856	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124956856delA								LOC285419 (105338 upstream) : ANKRD50 (628612 downstream)																							TTGATAAACTAAATGTCTGAT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	137158044	137158044	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137158044delT								None (None upstream) : None (None downstream)																							actagcagcattttgccccat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	138568049	138568050	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138568049_138568050insA								PCDH18 (114401 upstream) : SLC7A11 (517198 downstream)																							AAATTAAAGTGAAAAAAAAAAG	0.144													4	2	---	---	---	---	
MAML3	55534	broad.mit.edu	37	4	140735179	140735180	+	Intron	INS	-	AC	AC	rs142662771	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140735179_140735180insAC	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					cacaaacacaaacacacacaca	0.020													3	5	---	---	---	---	
INPP4B	8821	broad.mit.edu	37	4	143437919	143437919	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143437919delT	uc003iix.3	-						INPP4B_uc003iiw.3_Intron|INPP4B_uc011cho.1_5'Flank	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					tcctgttttgttttttttttt	0.144													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	150065302	150065311	+	IGR	DEL	TTTCTTTCTT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150065302_150065311delTTTCTTTCTT								NR3C2 (701659 upstream) : DCLK2 (934769 downstream)																							tctccttttctttctttctttttctttctt	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	150822699	150822700	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150822699_150822700insT								None (None upstream) : DCLK2 (177380 downstream)																							ACTCGTTTTTGTTTTTTTTTTT	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	155441725	155441726	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155441725_155441726insT								DCHS2 (28795 upstream) : PLRG1 (15937 downstream)																							tgcctgggtaattttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	156042489	156042489	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156042489delA								RBM46 (292525 upstream) : NPY2R (87292 downstream)																							taaaatgtataaaaccaagct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	156964491	156964493	+	IGR	DEL	TTG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156964491_156964493delTTG								CTSO (89443 upstream) : PDGFC (718271 downstream)																							tcctggtcttttgttgttgttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	158109102	158109102	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158109102delA								GLRB (15860 upstream) : GRIA2 (32193 downstream)																							accctcccccactgcctacct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	159392244	159392245	+	IGR	INS	-	AA	AA	rs112183210		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159392244_159392245insAA								TMEM144 (215806 upstream) : RXFP1 (50802 downstream)																							TACGCCGATGGAAAAAAAAAAA	0.376													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	168970712	168970712	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168970712delG								SPOCK3 (814971 upstream) : ANXA10 (42995 downstream)																							tgattttacaggctcataggt	0.000													4	2	---	---	---	---	
GALNTL6	442117	broad.mit.edu	37	4	173253674	173253675	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173253674_173253675insT	uc003isv.2	+							NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						atccgatcaagttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	176330912	176330914	+	IGR	DEL	ACA	-	-	rs145288438		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176330912_176330914delACA								ADAM29 (431582 upstream) : GPM6A (223175 downstream)																							acgcatgggcacaacaacatgca	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	179453415	179453416	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179453415_179453416insT								LOC285501 (541512 upstream) : None (None downstream)																							AGTCATCCACCttttttttttt	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	181107428	181107428	+	IGR	DEL	G	-	-	rs112071683		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181107428delG								None (None upstream) : None (None downstream)																							ttttttttttgttgttctttt	0.134													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	189192122	189192124	+	IGR	DEL	CAG	-	-	rs141295719		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189192122_189192124delCAG								TRIML1 (123473 upstream) : None (None downstream)																							gcagccccaccagcagcagcagc	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	189459065	189459065	+	RNA	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189459065delT	uc003izp.1	+	6		c.1791delT								Homo sapiens cDNA FLJ38649 fis, clone HHDPC2007302.																		CCCTGTATGGTTTTTTTTTTT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190540544	190540544	+	IGR	DEL	A	-	-	rs68148160		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190540544delA								None (None upstream) : FRG1 (321430 downstream)																							ATAGGAGGGGAAAAAAAATCT	0.358													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190550629	190550630	+	IGR	INS	-	AA	AA	rs143818999		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190550629_190550630insAA								None (None upstream) : FRG1 (311344 downstream)																							ACGAGTCACATAAAAAAATCAC	0.188													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190578545	190578546	+	IGR	INS	-	TG	TG	rs75843150		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190578545_190578546insTG								None (None upstream) : FRG1 (283428 downstream)																							ATATATATATAGACATATATAT	0.327													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190588272	190588275	+	IGR	DEL	CAAG	-	-	rs147776620		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190588272_190588275delCAAG								None (None upstream) : FRG1 (273699 downstream)																							tgtatgaactcaagcaagttattt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190629930	190629930	+	IGR	DEL	A	-	-	rs11362370		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190629930delA								None (None upstream) : FRG1 (232044 downstream)																							ATTTACAAATATTTTTTTGAT	0.373													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190859409	190859410	+	Intron	INS	-	A	A	rs148564803	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190859409_190859410insA	uc003izq.2	-						FRG1_uc003izs.2_5'Flank					Homo sapiens cDNA clone IMAGE:30384438.																		TCCCTCAACTTACAGTGTGCTA	0.421													6	3	---	---	---	---	
TUBB4Q	56604	broad.mit.edu	37	4	190908786	190908786	+	5'Flank	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190908786delA	uc011clg.1	-							NM_020040	NP_064424	Q99867	TBB4Q_HUMAN	tubulin, beta polypeptide 4, member Q						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;4.1e-31)|Epithelial(3;1.44e-30)|OV - Ovarian serous cystadenocarcinoma(60;2.03e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00839)|READ - Rectum adenocarcinoma(43;0.155)		tcacataaagaaaaaatggtt	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190917343	190917343	+	IGR	DEL	G	-	-	rs151260771		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190917343delG								TUBB4Q (11319 upstream) : LOC653545 (91223 downstream)																							ttctgtgcctgacttatttca	0.000													4	4	---	---	---	---	
CEP72	55722	broad.mit.edu	37	5	649938	649938	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:649938delG	uc003jbf.2	+							NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa						G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			TGTGAGGTGTGGACTGTGAGG	0.587													5	3	---	---	---	---	
CEP72	55722	broad.mit.edu	37	5	649980	649981	+	Intron	INS	-	TG	TG	rs142053577		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:649980_649981insTG	uc003jbf.2	+							NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa						G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			TGAGGCGTGACTGAGGTGTGGA	0.594													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7830205	7830209	+	IGR	DEL	AAAAA	-	-	rs10558677		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7830205_7830209delAAAAA								ADCY2 (11 upstream) : C5orf49 (1304 downstream)																							aaaaaaaaagaaaaaaaagaaaaaG	0.137													3	3	---	---	---	---	
DAP	1611	broad.mit.edu	37	5	10712801	10712801	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10712801delG	uc003jez.3	-						DAP_uc011cmw.1_Intron	NM_004394	NP_004385	P51397	DAP1_HUMAN	death-associated protein						activation of caspase activity|cellular response to amino acid starvation|induction of apoptosis by extracellular signals|negative regulation of autophagy|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent		death domain binding				0		Ovarian(839;1.34e-05)|Breast(839;0.0634)|Lung NSC(810;0.0804)				acatggcacaggggagagagt	0.259													4	2	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11818955	11818955	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11818955delG	uc003jfa.1	-						CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						TGAGTAACATGGTCAACTCTG	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	15171468	15171469	+	IGR	DEL	AA	-	-	rs5866135		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15171468_15171469delAA								ANKH (299581 upstream) : FBXL7 (328836 downstream)																							GTGTTCACAGAAAAAAAAAAAG	0.470													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	15245837	15245838	+	IGR	INS	-	A	A	rs138687372	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15245837_15245838insA								ANKH (373950 upstream) : FBXL7 (254467 downstream)																							ttttaaatgggaaaaggggaga	0.000													4	3	---	---	---	---	
MARCH11	441061	broad.mit.edu	37	5	16151648	16151648	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16151648delT	uc003jfo.2	-							NM_001102562	NP_001096032	A6NNE9	MARHB_HUMAN	membrane-associated ring finger (C3HC4) 11							cytoplasmic vesicle membrane|integral to membrane	ligase activity|zinc ion binding				0						CAGGCTGATCTTTTTTTTTTT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	18100347	18100347	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18100347delA								BASP1 (823412 upstream) : None (None downstream)																							TTTTATTTCTAATCTGATATG	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20546582	20546582	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20546582delG								CDH18 (558275 upstream) : GUSBP1 (795360 downstream)																							ttgcatggatgggaggcctca	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	26720911	26720911	+	IGR	DEL	T	-	-	rs113235443		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26720911delT								None (None upstream) : CDH9 (159798 downstream)																							TCTTTGTGTGTTTTTTTTTTC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	26855023	26855023	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26855023delA								None (None upstream) : CDH9 (25686 downstream)																							gggattagggaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28688865	28688867	+	IGR	DEL	CTT	-	-	rs34740402		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28688865_28688867delCTT								None (None upstream) : None (None downstream)																							CCTCCTCCTCCTTCTTCTTCTTT	0.118													3	4	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31802443	31802443	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31802443delT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						agaggtttagtggtgttcctg	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	32691488	32691488	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32691488delC								SUB1 (87303 upstream) : NPR3 (19272 downstream)																							TTCAATGTATCACATGCAGTT	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	32817230	32817231	+	IGR	DEL	AC	-	-	rs35340563		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32817230_32817231delAC								C5orf23 (25411 upstream) : TARS (623571 downstream)																							CATgagagagacagagagagag	0.213													3	6	---	---	---	---	
TTC23L	153657	broad.mit.edu	37	5	34852577	34852578	+	Intron	INS	-	A	A	rs146987686	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34852577_34852578insA	uc003jiu.2	+							NM_144725	NP_653326	Q6PF05	TT23L_HUMAN	tetratricopeptide repeat domain 23-like								binding			central_nervous_system(1)	1						GCTTGTGTTATAAAATGAGAGA	0.450													2	5	---	---	---	---	
DNAJC21	134218	broad.mit.edu	37	5	34930553	34930554	+	Intron	INS	-	T	T	rs140840502	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34930553_34930554insT	uc003jjc.2	+						DNAJC21_uc003jjb.2_Intron	NM_001012339	NP_001012339	Q5F1R6	DJC21_HUMAN	DnaJ homology subfamily A member 5 isoform 2						protein folding	ribosome	heat shock protein binding|nucleic acid binding|unfolded protein binding|zinc ion binding			breast(1)|skin(1)	2	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			TTTTTTCGCTGTTTTTTTTTTC	0.386													4	2	---	---	---	---	
DNAJC21	134218	broad.mit.edu	37	5	34952228	34952229	+	Intron	INS	-	TGTG	TGTG	rs143294092	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34952228_34952229insTGTG	uc003jjc.2	+						DNAJC21_uc003jjb.2_Intron|DNAJC21_uc010iuu.1_Intron|DNAJC21_uc003jjd.2_RNA	NM_001012339	NP_001012339	Q5F1R6	DJC21_HUMAN	DnaJ homology subfamily A member 5 isoform 2						protein folding	ribosome	heat shock protein binding|nucleic acid binding|unfolded protein binding|zinc ion binding			breast(1)|skin(1)	2	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			TTTTTAAAAAAtgtgtgtgtgt	0.312													4	2	---	---	---	---	
EGFLAM	133584	broad.mit.edu	37	5	38439489	38439489	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38439489delA	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron|EGFLAM_uc003jle.1_Intron|EGFLAM_uc003jlf.1_Intron	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					CCAGGAACTTAAAAAAAAAAA	0.398													2	4	---	---	---	---	
PLCXD3	345557	broad.mit.edu	37	5	41406637	41406637	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41406637delC	uc003jmm.1	-							NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X						intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						ctcttgcttgcccttcaaacc	0.159													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	41664366	41664366	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41664366delT								PLCXD3 (153636 upstream) : OXCT1 (65802 downstream)																							attattttgcttggaaactaa	0.000													3	3	---	---	---	---	
GHR	2690	broad.mit.edu	37	5	42430709	42430710	+	Intron	INS	-	GTGT	GTGT	rs141602161	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42430709_42430710insGTGT	uc003jmt.2	+						uc003jmu.2_Intron|uc003jmv.1_Intron	NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor						2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	ATGCTAGTCCCgtgtgtgtgtg	0.312													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44106467	44106468	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44106467_44106468insT								NNT (400800 upstream) : FGF10 (198629 downstream)																							gtaacccatgcttttttttttg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	45122280	45122280	+	IGR	DEL	T	-	-	rs76473227	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45122280delT								MRPS30 (306666 upstream) : HCN1 (137073 downstream)																							AATGGGTGTGTTTTTTTTTGT	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	46324705	46324705	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46324705delG								HCN1 (628485 upstream) : None (None downstream)																							caaaaagagtgtttcaaaact	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	51342019	51342019	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51342019delT								ISL1 (651462 upstream) : ITGA1 (741755 downstream)																							TACTTTTTCCTTCACACAACA	0.279													4	2	---	---	---	---	
SLC38A9	153129	broad.mit.edu	37	5	54944946	54944946	+	Intron	DEL	A	-	-	rs35843566		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54944946delA	uc003jqf.2	-						SLC38A9_uc003jqd.2_Intron|SLC38A9_uc010ivx.2_Intron|SLC38A9_uc003jqe.2_Intron|SLC38A9_uc010ivy.2_Intron	NM_173514	NP_775785	Q8NBW4	S38A9_HUMAN	solute carrier family 38, member 9						amino acid transport|sodium ion transport	integral to membrane					0		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)				TGCTCAGCATAAAAAAAAAAT	0.299													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	55759590	55759592	+	IGR	DEL	CAA	-	-	rs34300452		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55759590_55759592delCAA								ANKRD55 (230404 upstream) : MAP3K1 (351308 downstream)																							acaacaacatcaacaacaacaac	0.000													2	4	---	---	---	---	
C5orf35	133383	broad.mit.edu	37	5	56210885	56210885	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56210885delT	uc003jqx.2	+						C5orf35_uc003jqy.2_Intron	NM_153706	NP_714917	Q8NE22	CE035_HUMAN	hypothetical protein LOC133383											ovary(1)	1		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.173)		OV - Ovarian serous cystadenocarcinoma(10;2.58e-39)		TGGGGTAAAATTTTTTTTTTA	0.264													4	2	---	---	---	---	
GPBP1	65056	broad.mit.edu	37	5	56557233	56557233	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56557233delA	uc003jrh.3	+						GPBP1_uc010iwg.2_Intron|GPBP1_uc003jri.3_Intron|GPBP1_uc003jrj.3_Intron|GPBP1_uc003jrk.3_Intron|GPBP1_uc003jrl.3_Intron	NM_022913	NP_075064	Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			large_intestine(1)|central_nervous_system(1)	2		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		AATTGCTTTTAAAAAAAAAAA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	60890260	60890261	+	IGR	DEL	AG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60890260_60890261delAG								ZSWIM6 (48262 upstream) : FLJ37543 (43375 downstream)																							atttgggccaagacatgacaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	62197278	62197279	+	IGR	INS	-	TA	TA	rs140197483	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:62197278_62197279insTA								ISCA1P1 (124108 upstream) : None (None downstream)																							TTGTTTCATGTTATTTTACTTT	0.089													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	65772911	65772911	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65772911delA								SFRS12 (296199 upstream) : MAST4 (119265 downstream)																							aaaaatacagaaaaaattagc	0.000													4	2	---	---	---	---	
MAST4	375449	broad.mit.edu	37	5	66374162	66374162	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66374162delA	uc003jut.1	+						MAST4_uc003jus.2_Intron|MAST4_uc003juu.1_Intron|MAST4_uc011cra.1_Intron|MAST4_uc010ixa.2_Intron|MAST4_uc003juv.2_Intron|MAST4_uc003juw.2_Intron	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CCTTGATGTGAAAAAAAAAAA	0.144													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	66935380	66935381	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66935380_66935381insT								CD180 (442763 upstream) : PIK3R1 (576223 downstream)																							gttttcttgtcttttttttttt	0.361													4	2	---	---	---	---	
PIK3R1	5295	broad.mit.edu	37	5	67579961	67579962	+	Intron	DEL	CT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67579961_67579962delCT	uc003jva.2	+						PIK3R1_uc003jvb.2_Intron	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	gggttaatgcctctctcctggg	0.139			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			1	6	---	---	---	---	
MARVELD2	153562	broad.mit.edu	37	5	68713766	68713766	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68713766delA	uc003jwq.2	+						MARVELD2_uc010ixf.2_Intron|MARVELD2_uc003jwr.1_Intron|MARVELD2_uc003jws.1_5'Flank	NM_001038603	NP_001033692	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2 isoform 1						sensory perception of sound	integral to membrane|tight junction					0		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
AP3B1	8546	broad.mit.edu	37	5	77373507	77373508	+	Intron	INS	-	C	C	rs149721591	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77373507_77373508insC	uc003kfj.2	-							NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1						endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		tcttctaggagcgtcattcttc	0.050									Hermansky-Pudlak_syndrome				2	6	---	---	---	---	
POLR3G	10622	broad.mit.edu	37	5	89793973	89793974	+	Intron	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89793973_89793974delTG	uc003kjq.2	+						POLR3G_uc011cuc.1_Intron	NM_006467	NP_006458	O15318	RPC7_HUMAN	polymerase (RNA) III (DNA directed) polypeptide						innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA-directed RNA polymerase activity				0		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;2.74e-31)|Epithelial(54;8.2e-26)|all cancers(79;3.86e-22)		CCCCCATGTATGTGTGTGTGTG	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90476961	90476962	+	IGR	DEL	TT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90476961_90476962delTT								GPR98 (16929 upstream) : ARRDC3 (187579 downstream)																							TTATTACTTGTTGTCAAGTCCA	0.381													4	2	---	---	---	---	
C5orf36	285600	broad.mit.edu	37	5	93882223	93882226	+	Intron	DEL	AGAG	-	-	rs34483380		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93882223_93882226delAGAG	uc011cuk.1	-						C5orf36_uc003kkp.2_Intron	NM_001145678	NP_001139150	Q8IV33	K0825_HUMAN	hypothetical protein LOC285600 isoform 1												0		all_cancers(142;2.12e-08)|all_epithelial(76;5.95e-11)|all_lung(232;0.000996)|Lung NSC(167;0.0108)|Ovarian(174;0.0218)|Colorectal(57;0.0329)|Breast(839;0.214)|Lung SC(612;0.236)		all cancers(79;3.96e-19)		ggctcagcacagagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	96629150	96629150	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96629150delT								RIOK2 (110145 upstream) : None (None downstream)																							gctttttgactttttgccgtc	0.000													4	2	---	---	---	---	
C5orf30	90355	broad.mit.edu	37	5	102595923	102595923	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102595923delT	uc003kog.1	+						C5orf30_uc003koh.1_Intron	NM_033211	NP_149988	Q96GV9	CE030_HUMAN	hypothetical protein LOC90355												0		all_cancers(142;2.22e-05)|all_epithelial(76;9.54e-08)|Prostate(80;0.0174)|Colorectal(57;0.0551)|Ovarian(225;0.11)|Lung NSC(167;0.136)|all_lung(232;0.18)		Epithelial(69;2.84e-14)|COAD - Colon adenocarcinoma(37;0.00762)		CTCATTTTCCTTTTTTTTTTT	0.358													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	104043328	104043329	+	IGR	INS	-	AGG	AGG	rs149412818	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:104043328_104043329insAGG								None (None upstream) : RAB9BP1 (391846 downstream)																							gaagaagaagaaggaggaggag	0.030													5	5	---	---	---	---	
PJA2	9867	broad.mit.edu	37	5	108735990	108735990	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108735990delA	uc003kos.3	-							NM_014819	NP_055634	O43164	PJA2_HUMAN	praja 2, RING-H2 motif containing						long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		agactgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
C5orf13	9315	broad.mit.edu	37	5	111109570	111109570	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111109570delC	uc011cvr.1	-						C5orf13_uc011cvs.1_Intron	NM_001142475	NP_001135947	Q16612	NP311_HUMAN	neuronal protein 3.1 isoform c							cytoplasm				skin(1)	1		all_cancers(142;0.00597)|all_epithelial(76;0.000144)|Prostate(80;0.0115)|Colorectal(10;0.0446)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;5.45e-09)|Epithelial(69;2e-08)|all cancers(49;1.9e-06)|COAD - Colon adenocarcinoma(37;0.0514)|Colorectal(14;0.0629)		AGAAATCTTGCGGGGCTTAGG	0.473													4	2	---	---	---	---	
MCC	4163	broad.mit.edu	37	5	112675135	112675136	+	Intron	INS	-	GCGCGC	GCGCGC	rs145838279	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112675135_112675136insGCGCGC	uc003kql.3	-						MCC_uc003kqk.3_Intron	NM_001085377	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		tgtgtgtgtgtgcgtgcatgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	117287753	117287753	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117287753delC								None (None upstream) : DTWD2 (884818 downstream)																							cacaatgtttcccttggcccc	0.085													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	117765916	117765916	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117765916delA								None (None upstream) : DTWD2 (406655 downstream)																							TGTTTCTTCCAATATTTTTCT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123224810	123224810	+	IGR	DEL	A	-	-	rs111695947		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123224810delA								CSNK1G3 (272348 upstream) : ZNF608 (747800 downstream)																							agccaaagggaaaaaataaga	0.040													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	126092904	126092904	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126092904delA								C5orf48 (120930 upstream) : LMNB1 (19929 downstream)																							gatcctgtataaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	126179100	126179100	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126179100delA								LMNB1 (6391 upstream) : MARCH3 (24307 downstream)																							gatttgggataaagaaaaagg	0.000													4	2	---	---	---	---	
MARCH3	115123	broad.mit.edu	37	5	126309832	126309833	+	Intron	INS	-	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126309832_126309833insC	uc003kuf.2	-						MARCH3_uc011cxc.1_Intron	NM_178450	NP_848545	Q86UD3	MARH3_HUMAN	membrane-associated ring finger (C3HC4) 3						endocytosis	cytoplasmic vesicle membrane|early endosome membrane|integral to membrane|lysosome	ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.074)|OV - Ovarian serous cystadenocarcinoma(64;0.0793)		ctcatgatccacccgcctcagc	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	133022904	133022904	+	IGR	DEL	G	-	-	rs35293380		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133022904delG								FSTL4 (74681 upstream) : C5orf15 (268295 downstream)																							AGGCTAAATAGGGGGGGCATG	0.473													3	3	---	---	---	---	
DDX46	9879	broad.mit.edu	37	5	134122588	134122589	+	Intron	INS	-	TTG	TTG	rs141573785	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134122588_134122589insTTG	uc003kzw.2	+						DDX46_uc003kzv.1_Intron	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46						mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCAGAGGTGTTttgttgttgtt	0.144													4	2	---	---	---	---	
TGFBI	7045	broad.mit.edu	37	5	135378363	135378364	+	Intron	INS	-	A	A	rs149028710	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135378363_135378364insA	uc003lbf.3	+						TGFBI_uc003lbg.3_Intron|TGFBI_uc003lbh.3_Intron	NM_000358	NP_000349	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa						angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding			breast(3)|ovary(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AAGCAAACAGGAAAAAAAAAGA	0.450													4	3	---	---	---	---	
PAIP2	51247	broad.mit.edu	37	5	138674725	138674725	+	5'Flank	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138674725delT	uc003led.2	+							NM_016480	NP_057564	Q9BPZ3	PAIP2_HUMAN	poly(A) binding protein interacting protein 2						negative regulation of translational initiation	cytoplasm	protein binding|translation repressor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ataaatattcttacatgtctc	0.035													4	2	---	---	---	---	
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139809651	139809651	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139809651delT	uc003lfs.1	+						ANKHD1_uc003lfq.1_Intron|ANKHD1_uc003lfr.2_Intron|ANKHD1_uc003lfp.2_Intron|ANKHD1_uc003lfo.2_Intron|ANKHD1_uc010jfk.2_Intron	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein							cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCTCCTCCCTTTTGTTTGTT	0.373													4	2	---	---	---	---	
DIAPH1	1729	broad.mit.edu	37	5	140898948	140898949	+	Intron	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140898948_140898949delTG	uc003llb.3	-						DIAPH1_uc011dbd.1_Intron|DIAPH1_uc003llc.3_Intron	NM_005219	NP_005210	O60610	DIAP1_HUMAN	diaphanous 1 isoform 1						regulation of microtubule-based process|sensory perception of sound	cytoplasm|cytoskeleton|ruffle membrane	actin binding|receptor binding|Rho GTPase binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTCTGTGCATGTGTGTGTGTG	0.416													6	3	---	---	---	---	
FGF1	2246	broad.mit.edu	37	5	142065439	142065440	+	Intron	INS	-	AC	AC	rs35997480		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142065439_142065440insAC	uc003lmn.3	-						FGF1_uc003lmp.3_Intron|FGF1_uc003lmq.2_Intron|FGF1_uc010jgj.2_Intron|FGF1_uc003lmr.2_Intron|FGF1_uc003lms.3_Intron	NM_000800	NP_000791	P05230	FGF1_HUMAN	fibroblast growth factor 1 (acidic) isoform 1						angiogenesis|cellular response to heat|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of angiogenesis|positive regulation of cell division|positive regulation of cell migration|positive regulation of cholesterol biosynthetic process|positive regulation of intracellular protein kinase cascade|positive regulation of transcription from RNA polymerase II promoter	cell cortex|cytosol|extracellular space	fibroblast growth factor receptor binding|growth factor activity|heparin binding|S100 alpha binding				0		all_neural(839;0.0416)|Ovarian(839;0.0955)|all_hematologic(541;0.1)|Prostate(461;0.157)|Lung NSC(810;0.21)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00032)	Pentosan Polysulfate(DB00686)	acacacacaaaacacacacaca	0.351													6	3	---	---	---	---	
ARHGAP26	23092	broad.mit.edu	37	5	142547417	142547417	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142547417delT	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTTTTTGAGCTTTTTTTTAAC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	143295543	143295543	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143295543delT								HMHB1 (95261 upstream) : YIPF5 (242188 downstream)																							taagaaggtgttgccaatttt	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	143994389	143994389	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143994389delG								KCTD16 (137445 upstream) : None (None downstream)																							aggaggttctggaggaacccc	0.000													4	2	---	---	---	---	
PPARGC1B	133522	broad.mit.edu	37	5	149142291	149142292	+	Intron	INS	-	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149142291_149142292insG	uc003lrc.2	+						PPARGC1B_uc003lrb.1_Intron|PPARGC1B_uc003lrd.2_Intron	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor						estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			cttggcaacttgggttttgagc	0.158													4	2	---	---	---	---	
PDGFRB	5159	broad.mit.edu	37	5	149519261	149519262	+	Intron	INS	-	C	C	rs145005489	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149519261_149519262insC	uc003lro.2	-						PDGFRB_uc010jhd.2_Intron|PDGFRB_uc011dcg.1_5'Flank	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta						aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	gagttagaccaAggctgggcat	0.020			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	149542357	149542357	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149542357delG								PDGFRB (6935 upstream) : CDX1 (3987 downstream)																							TCCTGGCAGCGGGGGCCAGAT	0.318													6	3	---	---	---	---	
CAMK2A	815	broad.mit.edu	37	5	149633420	149633421	+	Intron	INS	-	AGC	AGC	rs139916117	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149633420_149633421insAGC	uc003lru.2	-						CAMK2A_uc003lrt.2_Intron|CAMK2A_uc010jhe.2_Intron|CAMK2A_uc010jhf.1_Intron	NM_171825	NP_741960	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|positive regulation of NF-kappaB transcription factor activity|synaptic transmission	cell junction|cytosol|endocytic vesicle membrane|nucleoplasm|presynaptic membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)	1		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			caccacaataaagcagcagcag	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	149833175	149833175	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149833175delA								RPS14 (3856 upstream) : NDST1 (44165 downstream)																							catctcaaagaaaaaaaaaga	0.000													4	2	---	---	---	---	
GALNT10	55568	broad.mit.edu	37	5	153701362	153701362	+	Intron	DEL	T	-	-	rs66509634		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153701362delT	uc003lvh.2	+						GALNT10_uc003lvg.1_Intron|GALNT10_uc010jic.2_Intron|GALNT10_uc010jid.2_Intron	NM_198321	NP_938080	Q86SR1	GLT10_HUMAN	GalNAc transferase 10 isoform a							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			ACCTGCCCCctagacagcacc	0.294													2	4	---	---	---	---	
FABP6	2172	broad.mit.edu	37	5	159614152	159614152	+	5'Flank	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159614152delA	uc003lxx.1	+							NM_001130958	NP_001124430	P51161	FABP6_HUMAN	gastrotropin isoform 1						bile acid and bile salt transport|bile acid metabolic process|negative regulation of cell proliferation	cytosol	transporter activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			tgacatagtgaaaaaaaaaaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	162831667	162831668	+	IGR	DEL	CA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162831667_162831668delCA								None (None upstream) : CCNG1 (32909 downstream)																							catgcgtgcgcacacacacaca	0.223													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163084476	163084478	+	IGR	DEL	CAA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163084476_163084478delCAA								MAT2B (138143 upstream) : None (None downstream)																							acaacaacagcaacaacaacaac	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	164784687	164784688	+	IGR	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164784687_164784688delTG								None (None upstream) : None (None downstream)																							GCTTTTTATTtgtgtgtgtgtg	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170940011	170940012	+	IGR	DEL	CA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170940011_170940012delCA								FGF18 (55849 upstream) : FBXW11 (348544 downstream)																							TGTACAAGGCcacacacacaca	0.337													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	171636402	171636402	+	IGR	DEL	A	-	-	rs112737097		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171636402delA								STK10 (21056 upstream) : UBTD2 (248 downstream)																							aacaaacaacaaaAAAAAAAA	0.174													4	2	---	---	---	---	
ATP6V0E1	8992	broad.mit.edu	37	5	172441768	172441769	+	Intron	DEL	AT	-	-	rs75712331		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172441768_172441769delAT	uc003mcd.1	+							NM_003945	NP_003936	O15342	VA0E1_HUMAN	ATPase, H+ transporting, lysosomal 9kDa, V0						ATP hydrolysis coupled proton transport|cell growth|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport|vacuolar acidification	endosome membrane|integral to membrane|membrane fraction|proton-transporting V-type ATPase, V0 domain|vacuole	proton-transporting ATPase activity, rotational mechanism				0	Renal(175;0.000159)|Lung NSC(126;0.00223)|all_lung(126;0.00391)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			gggtacaaacatgtggggtacc	0.000													3	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180555193	180555196	+	IGR	DEL	CACA	-	-	rs112586253		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180555193_180555196delCACA								BTNL9 (66671 upstream) : OR2V2 (26747 downstream)																							gtcctctcctcacacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180589869	180589876	+	IGR	DEL	GTGTGTGT	-	-	rs113099032		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180589869_180589876delGTGTGTGT								OR2V2 (6980 upstream) : TRIM7 (31048 downstream)																							caTGTTTGGGgtgtgtgtgtgtgtgtgt	0.019													4	2	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	496100	496101	+	Intron	DEL	TA	-	-	rs79399319		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:496100_496101delTA	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		cctactgatttatgaggagcgc	0.000													0	7	---	---	---	---	
CDYL	9425	broad.mit.edu	37	6	4817589	4817590	+	Intron	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4817589_4817590insA	uc003mwi.2	+						CDYL_uc003mwj.2_Intron|CDYL_uc003mwk.2_Intron	NM_001143971	NP_001137443	Q9Y232	CDYL1_HUMAN	chromodomain protein, Y chromosome-like isoform						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		TTAAGAGAATTAAAAAAAAAAA	0.312													4	2	---	---	---	---	
DSP	1832	broad.mit.edu	37	6	7544724	7544725	+	Intron	INS	-	TT	TT	rs71542869	byFrequency	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7544724_7544725insTT	uc003mxp.1	+						DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ttctttctttcttttttttttt	0.243													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9386035	9386035	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9386035delT								HULC (731958 upstream) : None (None downstream)																							ttgagtcttctttttttttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14452721	14452721	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14452721delT								CD83 (315575 upstream) : JARID2 (793013 downstream)																							AAAAGAATACTTTTTTTTTTT	0.373													4	2	---	---	---	---	
JARID2	3720	broad.mit.edu	37	6	15274162	15274162	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15274162delT	uc003nbj.2	+						JARID2_uc011diu.1_Intron|JARID2_uc011div.1_Intron	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein						central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				TGTCTATATCttttttttttt	0.184													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	21486193	21486194	+	IGR	INS	-	GT	GT	rs138659445	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21486193_21486194insGT								CDKAL1 (253561 upstream) : SOX4 (107778 downstream)																							TGATCTTCTCCgtgtgtgtgtg	0.173													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	25905701	25905701	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25905701delT								SLC17A3 (31230 upstream) : SLC17A2 (7290 downstream)																							CATCTTCTGATTTCAAAAAAG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28984635	28984636	+	IGR	INS	-	C	C	rs140121395	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28984635_28984636insC								ZNF311 (11542 upstream) : OR2W1 (27354 downstream)																							CTGGGGTCCAGGCTCGCCGGAG	0.574													3	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29049194	29049197	+	IGR	DEL	TTCC	-	-	rs111521915		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29049194_29049197delTTCC								OR2W1 (36242 upstream) : OR2B3 (4789 downstream)																							ccttctctttttccttccttcctt	0.000													3	3	---	---	---	---	
UHRF1BP1	54887	broad.mit.edu	37	6	34841704	34841704	+	3'UTR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34841704delA	uc003oju.3	+	21					UHRF1BP1_uc010jvm.1_Intron|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1											ovary(3)	3						atttgactagAAAAAAAAAAT	0.075													4	2	---	---	---	---	
SRPK1	6732	broad.mit.edu	37	6	35810503	35810504	+	Intron	INS	-	A	A	rs3213580	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35810503_35810504insA	uc003olj.2	-						SRPK1_uc011dtg.1_Intron|SRPK1_uc003olh.2_Intron|SRPK1_uc003oli.2_Intron	NM_003137	NP_003128	Q96SB4	SRPK1_HUMAN	SFRS protein kinase 1						cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						ATAGATCATTTAAAAAAAAAAA	0.307													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	36916407	36916408	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36916407_36916408insT								C6orf89 (19669 upstream) : PI16 (5801 downstream)																							tccttccttcctccttccctcc	0.025													4	3	---	---	---	---	
PPP2R5D	5528	broad.mit.edu	37	6	42974327	42974327	+	Frame_Shift_Del	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42974327delC	uc003oth.2	+	3	318	c.232delC	c.(232-234)CCCfs	p.P78fs	MEA1_uc010jyc.1_Intron|PPP2R5D_uc003otg.2_Frame_Shift_Del_p.P78fs|PPP2R5D_uc010jyd.2_Intron|PPP2R5D_uc011dva.1_5'UTR|PPP2R5D_uc003oti.2_5'UTR|PPP2R5D_uc003otj.2_5'UTR	NM_006245	NP_006236	Q14738	2A5D_HUMAN	delta isoform of regulatory subunit B56, protein	78					nervous system development|signal transduction	cytoplasm|nucleus|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			breast(1)|central_nervous_system(1)	2			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CTCAGGGGGGCCCCAGATTGT	0.512													34	31	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	44020499	44020501	+	Intron	DEL	TGT	-	-	rs67120037		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44020499_44020501delTGT	uc003owm.1	-											Homo sapiens cDNA: FLJ21083 fis, clone CAS03150.																		aaggggtgtgtgttgttgttgtt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	48164546	48164546	+	IGR	DEL	C	-	-	rs113822643		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48164546delC								C6orf138 (85603 upstream) : None (None downstream)																							ATGTTTGCTTCTTATGGAGGT	0.343													2	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57208284	57208288	+	Intron	DEL	TTTGA	-	-	rs10536721		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57208284_57208288delTTTGA	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CAGAATGAACTTTGATACAGCCAAT	0.390													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57264916	57264916	+	Intron	DEL	A	-	-	rs113865379		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57264916delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		gtttgtattgatatgtgtaca	0.000													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57292142	57292143	+	Intron	INS	-	TTG	TTG	rs145484587	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57292142_57292143insTTG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttctttgagacttgtcgctctg	0.050													2	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57347709	57347710	+	Intron	INS	-	TT	TT	rs146189750	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57347709_57347710insTT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGGAAAGTAGAtttttttgttg	0.223													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57385850	57385851	+	Intron	INS	-	TCCTGA	TCCTGA	rs139159987		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57385850_57385851insTCCTGA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AACCCGTATGGTTTCCATGGAT	0.356													4	5	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57506154	57506154	+	Intron	DEL	G	-	-	rs111228083		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57506154delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		aagcaagaaagatctaaagtc	0.000													5	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57510181	57510182	+	Intron	INS	-	T	T	rs147008809	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57510181_57510182insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AAAATGCAAAATTATATTGGAT	0.223													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57531917	57531917	+	IGR	DEL	C	-	-	rs149927103		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57531917delC								PRIM2 (18542 upstream) : GUSBL2 (714242 downstream)																							gcttcctgttcccacgacatt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57553450	57553450	+	IGR	DEL	T	-	-	rs145399837		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57553450delT								PRIM2 (40075 upstream) : GUSBL2 (692709 downstream)																							gtgaaataaattgatgaatac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57557095	57557095	+	IGR	DEL	T	-	-	rs79478192		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57557095delT								PRIM2 (43720 upstream) : GUSBL2 (689064 downstream)																							atttacaaagtaaagaggttt	0.000													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57592831	57592834	+	IGR	DEL	CAAA	-	-	rs35089396		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57592831_57592834delCAAA								PRIM2 (79456 upstream) : GUSBL2 (653325 downstream)																							caccagaagccaaacagatgtcgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57767371	57767372	+	IGR	INS	-	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57767371_57767372insC								PRIM2 (253996 upstream) : GUSBL2 (478787 downstream)																							TTAGATGGTGTCCCCTGCGTCC	0.431													4	3	---	---	---	---	
GUSBL2	375513	broad.mit.edu	37	6	58287238	58287239	+	Intron	INS	-	TAAC	TAAC			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58287238_58287239insTAAC	uc011dxq.1	-						GUSBL2_uc011dxp.1_Intron|GUSBL2_uc003peb.3_Intron|GUSBL2_uc003pec.3_Intron|GUSBL2_uc003ped.3_Intron|GUSBL2_uc003pee.3_Intron					SubName: Full=Putative uncharacterized protein ENSP00000348869; Flags: Fragment;												0						CAGGACTCTCATAACTGTCACC	0.381													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58754683	58754684	+	IGR	INS	-	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58754683_58754684insC								GUSBL2 (466959 upstream) : None (None downstream)																							ttctagtttttatcctgggata	0.015													4	2	---	---	---	---	
KHDRBS2	202559	broad.mit.edu	37	6	62880857	62880858	+	Intron	INS	-	A	A	rs34963723		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62880857_62880858insA	uc003peg.2	-							NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		aagataaacgcaaaaaaaaaaa	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	64159447	64159447	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64159447delA								LGSN (129565 upstream) : PTP4A1 (72204 downstream)																							agactccgtcaaaaaaaaaaa	0.010													4	2	---	---	---	---	
PTP4A1	7803	broad.mit.edu	37	6	64285620	64285620	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64285620delT	uc003pek.2	+						PTP4A1_uc003pel.2_Intron	NM_003463	NP_003454	Q93096	TP4A1_HUMAN	protein tyrosine phosphatase type IVA, member 1						cell cycle|multicellular organismal development	early endosome|endoplasmic reticulum|internal side of plasma membrane|spindle	protein binding|protein tyrosine phosphatase activity				0	all_cancers(3;0.071)|all_epithelial(2;0.0146)|Lung NSC(77;0.175)		Epithelial(2;0.0365)|LUSC - Lung squamous cell carcinoma(74;0.0644)|all cancers(2;0.112)|Lung(124;0.13)			ATGAGAGTTGTTTCCTTTTTA	0.249													4	2	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	64969576	64969580	+	Intron	DEL	GTTCT	-	-	rs147765368		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64969576_64969580delGTTCT	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						cacaatctgagttctgtgtgtgcat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	66423078	66423079	+	IGR	INS	-	A	A	rs112570278		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66423078_66423079insA								EYS (5960 upstream) : MCART3P (74693 downstream)																							gatcacaaatcatgcatgtgac	0.119													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	66837417	66837417	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66837417delG								MCART3P (338042 upstream) : None (None downstream)																							GGTGGGAGGTGGGGAGGAATT	0.234													4	2	---	---	---	---	
COL19A1	1310	broad.mit.edu	37	6	70652632	70652633	+	Intron	INS	-	TG	TG	rs138975770	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70652632_70652633insTG	uc003pfc.1	+						COL19A1_uc010kam.1_Intron	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						cattgtgtgtatgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	83545983	83545984	+	IGR	INS	-	C	C	rs140779260	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83545983_83545984insC								TPBG (469369 upstream) : UBE2CBP (56202 downstream)																							CTCAGGTTTCACGCTTCCCTCC	0.535													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	89943384	89943386	+	IGR	DEL	GCG	-	-	rs113460308		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89943384_89943386delGCG								GABRR1 (15888 upstream) : GABRR2 (23853 downstream)																							gaatgaagctgcggcccctcgca	0.000													2	4	---	---	---	---	
MDN1	23195	broad.mit.edu	37	6	90364824	90364825	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90364824_90364825insT	uc003pnn.1	-							NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog						protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ctACTGCTCTATTTTTTTTTTT	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	98186536	98186536	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98186536delG								C6orf167 (455475 upstream) : MIR2113 (285871 downstream)																							acatacgcatgggcaaaaact	0.000													4	2	---	---	---	---	
GRIK2	2898	broad.mit.edu	37	6	101971972	101971972	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101971972delT	uc003pqp.3	+						GRIK2_uc003pqn.2_Intron|GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	GATAATGGTGTTTATTGTTTC	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	104385316	104385316	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104385316delA								None (None upstream) : HACE1 (790652 downstream)																							tgagggatccacctccaggac	0.000													4	2	---	---	---	---	
QRSL1	55278	broad.mit.edu	37	6	107086180	107086181	+	Intron	INS	-	T	T	rs142831825	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107086180_107086181insT	uc003prm.2	+						QRSL1_uc003prl.2_Intron	NM_018292	NP_060762	Q9H0R6	QRSL1_HUMAN	glutaminyl-tRNA synthase						translation		ATP binding|carbon-nitrogen ligase activity, with glutamine as amido-N-donor				0	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;0.00768)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.248)	Epithelial(6;0.000334)|all cancers(7;0.00157)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0152)	BRCA - Breast invasive adenocarcinoma(108;0.118)|all cancers(137;0.167)|Epithelial(106;0.176)		GTTTACAtttctttttttttct	0.178													1	5	---	---	---	---	
CDC40	51362	broad.mit.edu	37	6	110531756	110531756	+	Intron	DEL	A	-	-	rs72468468		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110531756delA	uc003pua.2	+							NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		ctcatctcagaaaaaaaaaaa	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	112324316	112324317	+	IGR	DEL	GC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112324316_112324317delGC								FYN (129689 upstream) : WISP3 (50961 downstream)																							acacacaagtgcgcgcgcacac	0.124													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	114931975	114931975	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114931975delG								HS3ST5 (268435 upstream) : None (None downstream)																							catatgaagagggacatgttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	120721448	120721448	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120721448delT								None (None upstream) : C6orf170 (679179 downstream)																							attattaggctttttttttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	123144196	123144196	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123144196delG								SMPDL3A (13334 upstream) : CLVS2 (173386 downstream)																							cgaaagtgctgggattacCAC	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	126417699	126417700	+	IGR	INS	-	T	T	rs78382149		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126417699_126417700insT								TRMT11 (57281 upstream) : CENPW (243553 downstream)																							TAGATTTTAGCTTTTTTTTTTT	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	130193436	130193436	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130193436delT								C6orf191 (11020 upstream) : L3MBTL3 (146298 downstream)																							AATTCTCAGATTTTTTTTTTA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134723987	134723998	+	IGR	DEL	TCCTTCCCTCCC	-	-	rs148190110	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134723987_134723998delTCCTTCCCTCCC								SGK1 (84791 upstream) : ALDH8A1 (514531 downstream)																							cttccttccttccttccctccctccctccctc	0.000													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	141686985	141686985	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:141686985delT								None (None upstream) : NMBR (709761 downstream)																							tatgaatttattttatgtctg	0.015													4	2	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	144872273	144872274	+	Intron	DEL	AC	-	-	rs34628994		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144872273_144872274delAC	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GCAAATGGTGacacacacacac	0.208													6	3	---	---	---	---	
PCMT1	5110	broad.mit.edu	37	6	150071147	150071147	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150071147delG	uc003qne.2	+						PCMT1_uc003qna.2_Intron|PCMT1_uc003qnb.2_Intron|PCMT1_uc011eeg.1_Intron|PCMT1_uc003qnc.2_Intron|PCMT1_uc003qnd.2_Intron|PCMT1_uc003qnf.2_Intron	NM_005389	NP_005380			protein-L-isoaspartate (D-aspartate)											ovary(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		GGCCTGGACCGGGTCCCCCTG	0.687													4	2	---	---	---	---	
PCMT1	5110	broad.mit.edu	37	6	150093337	150093337	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150093337delT	uc003qne.2	+						PCMT1_uc003qna.2_Intron|PCMT1_uc003qnb.2_Intron|PCMT1_uc011eeg.1_Intron|PCMT1_uc003qnc.2_5'UTR|PCMT1_uc003qnd.2_Intron|PCMT1_uc003qnf.2_Intron	NM_005389	NP_005380			protein-L-isoaspartate (D-aspartate)											ovary(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		CGAAGGCACCTGCTACCACCG	0.458													4	2	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	163023280	163023281	+	Intron	DEL	GA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163023280_163023281delGA	uc003qtx.3	-						PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		cgttgagagggagagaagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168489561	168489561	+	IGR	DEL	C	-	-	rs35785724		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168489561delC								FRMD1 (9722 upstream) : DACT2 (218025 downstream)																							AACCTCCCCACTCCTTGTGTC	0.582													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168674210	168674210	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168674210delG								FRMD1 (194371 upstream) : DACT2 (33376 downstream)																							GCTTCCAGGAGGAGGAAGGTC	0.612													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1813387	1813387	+	IGR	DEL	T	-	-	rs111657521		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1813387delT								ELFN1 (25797 upstream) : MAD1L1 (42041 downstream)																							ctctgtactcttgtttcattg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	2292527	2292528	+	IGR	DEL	CT	-	-	rs147898362		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2292527_2292528delCT								NUDT1 (1747 upstream) : SNX8 (2113 downstream)																							tgcccccttgctctctcacccc	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	27535462	27535465	+	IGR	DEL	GTGT	-	-	rs72386028		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27535462_27535465delGTGT								EVX1 (249270 upstream) : HIBADH (29598 downstream)																							tatattctccgtgtgtgtgtgtgt	0.034													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	28974176	28974177	+	IGR	INS	-	T	T	rs142071600	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28974176_28974177insT								CREB5 (108667 upstream) : TRIL (18799 downstream)																							gcactgccttgtgggggagtga	0.000													4	3	---	---	---	---	
INMT	11185	broad.mit.edu	37	7	30770145	30770145	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30770145delA	uc010kwc.1	+									O95050	INMT_HUMAN	Homo sapiens indolethylamine N-methyltransferase (INMT) mRNA, INMT-1 allele, complete cds.							cytoplasm	amine N-methyltransferase activity				0						ATGGCTTAGGAAAGGTGTATG	0.368													4	2	---	---	---	---	
AAA1	404744	broad.mit.edu	37	7	34442767	34442768	+	Intron	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34442767_34442768delGT	uc010kwo.1	-						AAA1_uc010kwp.1_Intron|AAA1_uc003tdz.2_Intron|AAA1_uc010kwq.1_Intron					Homo sapiens AAA1 variant IA mRNA, complete cds; alternatively spliced.												0						gtgcctgtgcgtgtgtgtgtgt	0.213													3	3	---	---	---	---	
EEPD1	80820	broad.mit.edu	37	7	36274796	36274796	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36274796delA	uc003tfa.2	+							NM_030636	NP_085139	Q7L9B9	EEPD1_HUMAN	endonuclease/exonuclease/phosphatase family						DNA repair		DNA binding				0						ggtttcccccacagcctccag	0.109													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	37724968	37724971	+	Intron	DEL	CCTG	-	-	rs66649444	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37724968_37724971delCCTG	uc003tfl.2	+											Homo sapiens, clone IMAGE:3881224, mRNA.																		ctccttccttcctgcctgcctgcc	0.059													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	49742885	49742885	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49742885delT								CDC14C (775836 upstream) : VWC2 (70372 downstream)																							CTCGCTGGTCTTTTCCATCCT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53421222	53421223	+	IGR	DEL	GT	-	-	rs5884312		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53421222_53421223delGT								POM121L12 (316605 upstream) : HPVC1 (847694 downstream)																							aggatgaagagtgtgtgtgtgt	0.035													6	3	---	---	---	---	
PSPH	5723	broad.mit.edu	37	7	56089118	56089119	+	Intron	INS	-	T	T	rs112702219		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56089118_56089119insT	uc003trg.2	-						PSPH_uc003trh.2_Intron|PSPH_uc003tri.2_Intron|PSPH_uc003trj.2_Intron	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ttctttctttcttttttttttt	0.158													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57625723	57625723	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57625723delA								ZNF716 (92458 upstream) : None (None downstream)																							GCTATTTTATAGTAGTTAGCA	0.269													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57714133	57714134	+	IGR	INS	-	G	G	rs149586851	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57714133_57714134insG								ZNF716 (180868 upstream) : None (None downstream)																							aggagcaaagagtttctgcaaa	0.050													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57723595	57723595	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57723595delA								ZNF716 (190330 upstream) : None (None downstream)																							AGTAtttttgagacagaattt	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57734142	57734143	+	IGR	INS	-	T	T	rs144782587	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57734142_57734143insT								ZNF716 (200877 upstream) : None (None downstream)																							GTACTAAATGATTTTTTAAGAT	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57918205	57918205	+	IGR	DEL	G	-	-	rs112755486		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57918205delG								ZNF716 (384940 upstream) : None (None downstream)																							TTTGCAGCCTGAAGTATCTTG	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57987108	57987108	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57987108delA								ZNF716 (453843 upstream) : None (None downstream)																							tcacagtgttaaacctttctt	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61536664	61536664	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61536664delG								None (None upstream) : None (None downstream)																							ggatatttctggagtcctttg	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63116551	63116552	+	IGR	DEL	CA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63116551_63116552delCA								LOC100287704 (304400 upstream) : ZNF727 (389269 downstream)																							cacacacactcacacacacaca	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64969197	64969201	+	IGR	DEL	TCATT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64969197_64969201delTCATT								ZNF92 (103200 upstream) : INTS4L2 (143576 downstream)																							tttcacttcatcatttcatttcatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67293651	67293651	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67293651delG								STAG3L4 (507139 upstream) : None (None downstream)																							aagttatcttggttatgaatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67805292	67805293	+	IGR	INS	-	AAACA	AAACA			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67805292_67805293insAAACA								None (None upstream) : None (None downstream)																							gaccctgtctcaaacaaaacaa	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68165990	68165990	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68165990delT								None (None upstream) : AUTS2 (897915 downstream)																							CCTGGCCCCAttttttttttt	0.194													2	4	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	69961535	69961538	+	Intron	DEL	CAGA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69961535_69961538delCAGA	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		cgtacacagtcagacacacacaca	0.034													6	3	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	70202858	70202858	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70202858delA	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GATTAGCAGTAAAATATAATG	0.308													4	2	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	70786853	70786853	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70786853delT	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ccttccttcctttccttcctt	0.000													5	3	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71311611	71311611	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71311611delA	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				TCTACAGGGTAACCCTCCTTC	0.289													4	2	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71704679	71704679	+	Intron	DEL	A	-	-	rs34171338		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71704679delA	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				GATGCTACAGAAAAAAAAAAT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	71961363	71961364	+	IGR	INS	-	A	A	rs144674337	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71961363_71961364insA								CALN1 (49227 upstream) : TYW1B (62365 downstream)																							gtttgtatcagaaaaaaccatc	0.005													4	4	---	---	---	---	
TYW1B	441250	broad.mit.edu	37	7	72163617	72163617	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72163617delA	uc011kej.1	-						TYW1B_uc011keh.1_Intron|TYW1B_uc011kei.1_Intron	NM_001145440	NP_001138912	Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B isoform						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity				0						actccatctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
ELN	2006	broad.mit.edu	37	7	73464935	73464936	+	Intron	INS	-	CATT	CATT	rs142826188	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73464935_73464936insCATT	uc003tzw.2	+						RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_Intron|ELN_uc011kfe.1_Intron|ELN_uc003tzn.2_Intron|ELN_uc003tzz.2_Intron|ELN_uc003tzo.2_Intron|ELN_uc003tzp.2_Intron|ELN_uc003tzq.2_Intron|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Intron|ELN_uc003tzt.2_Intron|ELN_uc003tzu.2_Intron|ELN_uc003tzv.2_Intron|ELN_uc003tzx.2_Intron|ELN_uc011kff.1_Intron|ELN_uc003tzy.2_Intron	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor						blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	attcacccatgcattcattcat	0.010			T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						4	2	---	---	---	---	
GTF2IRD1	9569	broad.mit.edu	37	7	73962752	73962752	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73962752delA	uc003uaq.2	+						GTF2IRD1_uc010lbq.2_Intron|GTF2IRD1_uc003uap.2_Intron|GTF2IRD1_uc003uar.1_Intron	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1							nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						acttcgtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	75381918	75381918	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75381918delG								HIP1 (13639 upstream) : CCL26 (16924 downstream)																							aaaaaaaaaaGGttttttttt	0.010													4	2	---	---	---	---	
DTX2	113878	broad.mit.edu	37	7	76095910	76095910	+	Intron	DEL	T	-	-	rs66718202		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76095910delT	uc003uff.3	+						DTX2_uc011kgk.1_Intron|DTX2_uc003ufg.3_Intron|DTX2_uc003ufh.3_Intron	NM_020892	NP_065943	Q86UW9	DTX2_HUMAN	deltex 2 isoform a						Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding			ovary(1)|skin(1)	2						tctctgtctcttttttttttt	0.124													4	2	---	---	---	---	
PMS2L11	441263	broad.mit.edu	37	7	76626783	76626784	+	Intron	INS	-	GTG	GTG			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76626783_76626784insGTG	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						tgtgtggaggtgggtgtgtggg	0.000													4	2	---	---	---	---	
CCDC146	57639	broad.mit.edu	37	7	76807936	76807936	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76807936delG	uc003uga.2	+						CCDC146_uc003ufz.1_Intron	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146											ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				AGTTAATACAGTTTTAATCAC	0.294													5	3	---	---	---	---	
PION	54103	broad.mit.edu	37	7	77032002	77032002	+	Intron	DEL	A	-	-	rs71716185		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77032002delA	uc003ugf.2	-						PION_uc003ugg.1_Intron	NM_017439	NP_059135	A4D1B5	GSAP_HUMAN	pigeon homolog						beta-amyloid formation|regulation of proteolysis	trans-Golgi network	beta-amyloid binding			central_nervous_system(1)	1						AAAGGTCCGTAAAAAAAAAAA	0.323													4	2	---	---	---	---	
MAGI2	9863	broad.mit.edu	37	7	78808027	78808028	+	Intron	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78808027_78808028insA	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				gactccatttcaaaaaaaaaaa	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	85769613	85769614	+	IGR	INS	-	AC	AC	rs141378531	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85769613_85769614insAC								SEMA3D (953442 upstream) : GRM3 (503616 downstream)																							ATTacacacatacacacacaca	0.223													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	87951161	87951161	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87951161delT								STEAP4 (14952 upstream) : ZNF804B (437592 downstream)																							tttgCCTTAGTTTTTAGAAAG	0.189													4	2	---	---	---	---	
FAM133B	257415	broad.mit.edu	37	7	92221918	92221919	+	5'Flank	DEL	CC	-	-	rs68159250		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92221918_92221919delCC	uc003umc.2	-						FAM133B_uc003umb.2_5'Flank|FAM133B_uc003umd.2_5'Flank	NM_152789	NP_690002	Q5BKY9	F133B_HUMAN	hypothetical protein LOC257415 isoform 1											ovary(1)	1	all_cancers(62;7.39e-11)|all_epithelial(64;7.03e-10)|Breast(17;0.00201)|all_lung(186;0.0384)|Lung NSC(181;0.053)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;9.78e-06)|all cancers(6;1.67e-05)|Epithelial(20;0.113)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			cacacacacacccacccacacC	0.243													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	96063437	96063438	+	IGR	INS	-	C	C	rs138280562	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96063437_96063438insC								SLC25A13 (111978 upstream) : SHFM1 (238799 downstream)																							cccattcctgtccccccaccag	0.000													4	2	---	---	---	---	
ZNF3	7551	broad.mit.edu	37	7	99667789	99667790	+	3'UTR	INS	-	T	T	rs148676350	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99667789_99667790insT	uc003usq.2	-	6					ZNF3_uc003usp.2_Intron|ZNF3_uc003usr.2_3'UTR|ZNF3_uc010lgj.2_3'UTR|ZNF3_uc003uss.2_3'UTR|ZNF3_uc003ust.3_3'UTR	NM_032924	NP_116313	P17036	ZNF3_HUMAN	zinc finger protein 3 isoform 2						cell differentiation|leukocyte activation|multicellular organismal development	nucleus	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			ttgtttttttgttttttttttc	0.485													4	2	---	---	---	---	
AP4M1	9179	broad.mit.edu	37	7	99700033	99700033	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99700033delA	uc003utb.3	+						MCM7_uc003usv.1_5'Flank|MCM7_uc003usw.1_5'Flank|MCM7_uc003usx.1_5'Flank|AP4M1_uc011kjg.1_Intron|AP4M1_uc010lgl.1_Intron|AP4M1_uc003utc.3_Intron|AP4M1_uc010lgm.2_Intron|AP4M1_uc003utd.2_Intron|AP4M1_uc011kjh.1_Intron|AP4M1_uc003ute.3_Intron|AP4M1_uc003utf.3_Intron	NM_004722	NP_004713	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|coated pit|Golgi trans cisterna	transporter activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGGGGTGGGGAAAAAAAAAAA	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100750100	100750101	+	IGR	INS	-	T	T	rs150727577	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100750100_100750101insT								TRIM56 (15092 upstream) : SERPINE1 (20278 downstream)																							ttgtttgtttgtttaagacggg	0.163													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	101203846	101203846	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101203846delT								EMID2 (1542 upstream) : MYL10 (52760 downstream)																							gctacaagtgttttttttttt	0.000													4	2	---	---	---	---	
NAPEPLD	222236	broad.mit.edu	37	7	102791910	102791911	+	5'Flank	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102791910_102791911insT	uc003vbc.2	-						NAPEPLD_uc003vbd.2_5'Flank|NAPEPLD_uc011klj.1_5'Flank|NAPEPLD_uc003vbe.2_5'Flank|NAPEPLD_uc003vbf.2_5'Flank	NM_198990	NP_945341	Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D						phospholipid catabolic process	membrane	metal ion binding			skin(1)	1						Cttcttttttcttttttttttg	0.203													4	2	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103216327	103216327	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103216327delT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCTCTCTCTCttttttttctt	0.189													6	3	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103449908	103449909	+	Intron	INS	-	T	T	rs139962918	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103449908_103449909insT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		agccagccacctccaggagaga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	104650299	104650299	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104650299delG								LOC723809 (83207 upstream) : LOC100216545 (690 downstream)																							AGACAACGCTGACAACGCCGC	0.343													4	2	---	---	---	---	
PUS7	54517	broad.mit.edu	37	7	105161846	105161855	+	Intron	DEL	TTTCAGCTTG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105161846_105161855delTTTCAGCTTG	uc003vcx.2	-						PUS7_uc003vcy.2_Intron|PUS7_uc003vcz.1_Intron	NM_019042	NP_061915	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 homolog						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			breast(1)	1						AGGACTCGAATTTCAGCTTGCACAGCAGCA	0.514													4	3	---	---	---	---	
PNPLA8	50640	broad.mit.edu	37	7	108150621	108150622	+	Intron	INS	-	A	A	rs35880371		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108150621_108150622insA	uc003vff.1	-						PNPLA8_uc003vfg.1_Intron|PNPLA8_uc003vfh.1_Intron|PNPLA8_uc003vfi.1_Intron|PNPLA8_uc003vfj.1_Intron|PNPLA8_uc003vfk.1_Intron	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8						fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2						taaagtataataaaaaaaaaaa	0.203													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	109519398	109519398	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109519398delT								C7orf66 (994761 upstream) : EIF3IP1 (79886 downstream)																							TGCCCCTTCCTTTCTGGTGAA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	112652621	112652622	+	IGR	INS	-	TAC	TAC	rs140530180	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112652621_112652622insTAC								C7orf60 (72689 upstream) : GPR85 (67846 downstream)																							tacacatggaatactattcagc	0.000													5	3	---	---	---	---	
CADPS2	93664	broad.mit.edu	37	7	122311619	122311619	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122311619delA	uc010lkp.2	-						CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						accatcgcttaaaaaaaaaaC	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	124462388	124462389	+	IGR	INS	-	A	A	rs148739261	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124462388_124462389insA								GPR37 (56707 upstream) : POT1 (52 downstream)																							GCTAAAAACTGAAAATTTTTTT	0.312													2	4	---	---	---	---	
POT1	25913	broad.mit.edu	37	7	124506486	124506487	+	Intron	INS	-	ATGTTCAACCACA	ATGTTCAACCACA	rs143205775	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124506486_124506487insATGTTCAACCACA	uc003vlm.2	-						POT1_uc011koe.1_Intron|POT1_uc003vlk.2_Intron|POT1_uc003vll.2_Intron|POT1_uc003vlo.2_Intron|POT1_uc003vln.2_Intron	NM_015450	NP_056265	Q9NUX5	POTE1_HUMAN	protection of telomeres 1 isoform 1						DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity			central_nervous_system(1)	1						GTATCCATTTCATGTTCAACCA	0.450													5	3	---	---	---	---	
GRM8	2918	broad.mit.edu	37	7	126460745	126460746	+	Intron	DEL	TC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126460745_126460746delTC	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron|GRM8_uc003vlu.1_Intron	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	ACCAGTTCTTTCTCTCTCTCTC	0.475										HNSCC(24;0.065)			4	2	---	---	---	---	
GRM8	2918	broad.mit.edu	37	7	126721638	126721639	+	Intron	INS	-	T	T	rs138169082	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126721638_126721639insT	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron|GRM8_uc003vlu.1_Intron	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	gccttcatgggtaaacccccac	0.193										HNSCC(24;0.065)			3	4	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127539331	127539332	+	Intron	DEL	AC	-	-	rs35926446		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127539331_127539332delAC	uc003vmi.2	+						SND1_uc010lle.2_Intron	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						CCTGcacacaacacacacacac	0.287													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	128567576	128567576	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128567576delT								KCP (16803 upstream) : IRF5 (10193 downstream)																							aatgagaatcttttttttttt	0.000													3	3	---	---	---	---	
EXOC4	60412	broad.mit.edu	37	7	133071579	133071580	+	Intron	INS	-	T	T	rs34636956		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133071579_133071580insT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vri.2_Intron|EXOC4_uc003vrj.2_Intron	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				TGAAAGGAGAGTTTTTTTTTTT	0.381													4	2	---	---	---	---	
EXOC4	60412	broad.mit.edu	37	7	133082045	133082046	+	Intron	INS	-	T	T	rs113799305		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133082045_133082046insT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vri.2_Intron|EXOC4_uc003vrj.2_Intron	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				acccagccaaattttttttttt	0.000													1	5	---	---	---	---	
EXOC4	60412	broad.mit.edu	37	7	133660499	133660502	+	Intron	DEL	CACA	-	-	rs71823350		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133660499_133660502delCACA	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron|EXOC4_uc011kpq.1_Intron	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				AATGCGTGTGcacacacacacaca	0.098													3	3	---	---	---	---	
RAB19	401409	broad.mit.edu	37	7	140120221	140120222	+	Intron	DEL	AA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140120221_140120222delAA	uc010lni.2	+						RAB19_uc011krc.1_Intron	NM_001008749	NP_001008749	A4D1S5	RAB19_HUMAN	RAB19, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding				0	Melanoma(164;0.0142)					actccatatcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	140854531	140854532	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140854531_140854532insT								MRPS33 (139750 upstream) : AGK (396546 downstream)																							AACTTGTTAACttttttttttt	0.243													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142465436	142465437	+	Intron	INS	-	A	A	rs140766433	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142465436_142465437insA	uc011krr.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|uc003wan.1_Intron|TRY6_uc011kso.1_5'Flank					SubName: Full=V_segment translation product; Flags: Fragment;																		atgataaaatgaaaaaaAAACA	0.144													4	5	---	---	---	---	
OR2A5	393046	broad.mit.edu	37	7	143745683	143745683	+	5'Flank	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143745683delG	uc011ktw.1	+							NM_012365	NP_036497	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Melanoma(164;0.0783)					AATCCATCCAGGGCAAGACTG	0.418													4	4	---	---	---	---	
OR2A9P	441295	broad.mit.edu	37	7	144017519	144017520	+	Intron	INS	-	CA	CA	rs140856845	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144017519_144017520insCA	uc003wec.1	-											SubName: Full=Seven transmembrane helix receptor;												0						ACATGCGTGTGcacacacacac	0.208													7	4	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	147090576	147090577	+	Intron	DEL	AA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147090576_147090577delAA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CCAATTATTCAAAAAAAAAAAA	0.347										HNSCC(39;0.1)			4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	147568753	147568754	+	Intron	INS	-	T	T	rs5888290		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147568753_147568754insT	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ATTCCTTTCTCTTTTTTTTTTT	0.441										HNSCC(39;0.1)			4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	147852029	147852029	+	Intron	DEL	A	-	-	rs74453377		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147852029delA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			accacatctcaaaaaaaaaaa	0.199										HNSCC(39;0.1)			3	4	---	---	---	---	
ZNF862	643641	broad.mit.edu	37	7	149544682	149544691	+	Intron	DEL	GTGTGTGTGT	-	-	rs112892675		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149544682_149544691delGTGTGTGTGT	uc010lpn.2	+						ZNF862_uc003wgm.2_Intron	NM_001099220	NP_001092690	O60290	ZN862_HUMAN	zinc finger protein 862						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|nucleic acid binding|protein dimerization activity			skin(1)	1						GAAAATTCAGgtgtgtgtgtgtgtgtgtgt	0.395													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	149578413	149578416	+	5'Flank	DEL	TATC	-	-	rs150278733		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149578413_149578416delTATC	uc003wgt.1	+											Homo sapiens cDNA clone IMAGE:40014135.																		TTTCTAGCATTATCTATCTCTACA	0.549													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	150607557	150607557	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150607557delT								ABP1 (49178 upstream) : KCNH2 (34493 downstream)																							ggtgtgtgtgtggtgtgtgtg	0.000													4	2	---	---	---	---	
ASB10	136371	broad.mit.edu	37	7	150878701	150878701	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150878701delC	uc003wjm.1	-						ASB10_uc003wjl.1_Intron|ASB10_uc003wjn.1_Intron	NM_001142459	NP_001135931	Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box-containing 10						intracellular signal transduction						0			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGTGCCCttctttttttttt	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	151016241	151016242	+	IGR	INS	-	T	T	rs148426678	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151016241_151016242insT								SMARCD3 (42010 upstream) : NUB1 (22616 downstream)																							tgggttcttagttttttttctg	0.069													4	2	---	---	---	---	
PRKAG2	51422	broad.mit.edu	37	7	151402412	151402413	+	Intron	INS	-	T	T	rs138765984	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151402412_151402413insT	uc003wkk.2	-						PRKAG2_uc011kvl.1_Intron|PRKAG2_uc003wkj.2_Intron|PRKAG2_uc010lqe.1_Intron|PRKAG2_uc003wkm.1_Intron	NM_016203	NP_057287	Q9UGJ0	AAKG2_HUMAN	AMP-activated protein kinase gamma2 subunit						ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)		GGATTATGGTGTTTTTTCTCTT	0.460													5	4	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152106898	152106898	+	Intron	DEL	A	-	-	rs10707629		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152106898delA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GTTTTTTTTTAAATCATCATG	0.254			N		medulloblastoma								1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152313756	152313756	+	IGR	DEL	A	-	-	rs112074007		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152313756delA								LOC100128822 (151128 upstream) : XRCC2 (29833 downstream)																							attccatctcaaaaaaaaaaa	0.104													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	153108675	153108686	+	IGR	DEL	GGCGCTTCTCGA	-	-	rs112536733	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153108675_153108686delGGCGCTTCTCGA								ACTR3B (556212 upstream) : DPP6 (475733 downstream)																							acccacgattggcgcttctcgagagccaattt	0.000													4	2	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	154002708	154002714	+	Intron	DEL	AGAGAGA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154002708_154002714delAGAGAGA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron|DPP6_uc010lqh.1_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			tgtgtgCATGAGAGAGACAGAGACAGA	0.391													6	5	---	---	---	---	
CNPY1	285888	broad.mit.edu	37	7	155308704	155308705	+	Intron	DEL	GT	-	-	rs67625567		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155308704_155308705delGT	uc003wmc.1	-							NM_001103176	NP_001096646	Q3B7I2	CNPY1_HUMAN	canopy 1 homolog												0	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		ACGTGCACGCGTGTGTGTGTCC	0.515													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155739484	155739487	+	IGR	DEL	TTCC	-	-	rs72203088		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155739484_155739487delTTCC								SHH (134517 upstream) : C7orf4 (593698 downstream)																							ttctttctctttccttccttcctt	0.000													4	3	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157729730	157729730	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157729730delC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CGCATGTCAACccccttcact	0.239													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157948264	157948269	+	Intron	DEL	CATCAC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157948264_157948269delCATCAC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		tcattgccatcatcaccatcaccatc	0.000													3	3	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158139468	158139468	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158139468delT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		acttgctgtctttttaataat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	158510542	158510544	+	IGR	DEL	CTT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158510542_158510544delCTT								NCAPG2 (13022 upstream) : ESYT2 (13145 downstream)																							cttcttcttccttcttcttctcc	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	158999637	158999638	+	IGR	INS	-	GA	GA			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158999637_158999638insGA								VIPR2 (61988 upstream) : None (None downstream)																							ATGATGCAaaggagagagagag	0.035													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2262794	2262794	+	IGR	DEL	T	-	-	rs79274177		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2262794delT								MYOM2 (169415 upstream) : CSMD1 (530082 downstream)																							ACATCTTATATTTGATGCTGA	0.443													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	12443687	12443688	+	Intron	INS	-	GGGTGGAT	GGGTGGAT	rs113126637	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12443687_12443688insGGGTGGAT	uc003wvy.3	-											Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																		gaaggaaggaagggtggatgga	0.168													6	4	---	---	---	---	
SGCZ	137868	broad.mit.edu	37	8	14011450	14011451	+	Intron	DEL	AC	-	-	rs6981793		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14011450_14011451delAC	uc003wwq.2	-						SGCZ_uc010lss.2_Intron	NM_139167	NP_631906	Q96LD1	SGCZ_HUMAN	sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		acacacacagacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	18231182	18231183	+	IGR	DEL	TA	-	-	rs78419169		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18231182_18231183delTA								NAT1 (149985 upstream) : NAT2 (17572 downstream)																							gctgagtgtgtatgtgttaatc	0.000													4	3	---	---	---	---	
INTS10	55174	broad.mit.edu	37	8	19707998	19707998	+	Intron	DEL	T	-	-	rs36125539		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19707998delT	uc003wzj.2	+							NM_018142	NP_060612	Q9NVR2	INT10_HUMAN	integrator complex subunit 10						snRNA processing	integrator complex	protein binding			ovary(1)	1				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		CAAAGCTGGATTTTTTTTTTC	0.333													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	19785860	19785861	+	IGR	DEL	TG	-	-	rs71874258	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19785860_19785861delTG								INTS10 (76276 upstream) : LPL (10721 downstream)																							tgtctgtgtatgtgtgtgtgtg	0.238													4	2	---	---	---	---	
DOCK5	80005	broad.mit.edu	37	8	25229912	25229913	+	Intron	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25229912_25229913delGT	uc003xeg.2	+						DOCK5_uc010luf.1_Intron|DOCK5_uc003xeh.1_Intron|PPP2R2A_uc003xek.2_5'Flank|DOCK5_uc003xei.2_Intron|DOCK5_uc003xej.2_Intron	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GTTGCATGAGGTGTGTGTGTGT	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	30127616	30127617	+	IGR	INS	-	T	T	rs111995913		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30127616_30127617insT								DCTN6 (86557 upstream) : RBPMS (114327 downstream)																							TCCAAAATAACttttttttttt	0.064													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	38360101	38360106	+	IGR	DEL	TGTATG	-	-	rs72080020		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38360101_38360106delTGTATG								FGFR1 (33749 upstream) : C8orf86 (8246 downstream)																							tgtatgtgactgtatgtgtatgtgtg	0.146													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	41309367	41309368	+	IGR	INS	-	T	T	rs142718119	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41309367_41309368insT								SFRP1 (142387 upstream) : GOLGA7 (38713 downstream)																							tacttttggtatcccattatac	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	41982621	41982622	+	IGR	INS	-	A	A	rs76275907		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41982621_41982622insA								MYST3 (73116 upstream) : AP3M2 (27842 downstream)																							gactccatcgcaaaaaaaaaaa	0.158													3	3	---	---	---	---	
SLC20A2	6575	broad.mit.edu	37	8	42389439	42389439	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42389439delA	uc010lxm.2	-						SLC20A2_uc003xpe.2_Intron	NM_006749	NP_006740	Q08357	S20A2_HUMAN	solute carrier family 20, member 2						interspecies interaction between organisms	integral to plasma membrane|membrane fraction	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			ovary(2)	2	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			aaaaataaataaaaaggaaag	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	48142135	48142135	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48142135delA								BEYLA (374728 upstream) : KIAA0146 (31407 downstream)																							gacttcgcctaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49583541	49583542	+	IGR	INS	-	T	T	rs141929680	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49583541_49583542insT								UBE2V2 (609089 upstream) : EFCAB1 (39809 downstream)																							TTAGCATAAtctttttttttta	0.238													4	2	---	---	---	---	
ST18	9705	broad.mit.edu	37	8	53041618	53041619	+	Intron	DEL	AT	-	-	rs33920169		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53041618_53041619delAT	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				GTCATCCTGCATATATATACAT	0.238													1	5	---	---	---	---	
XKR4	114786	broad.mit.edu	37	8	56084771	56084771	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56084771delA	uc003xsf.2	+							NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related							integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)			actctctctcaaaaaaaaaaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	56488354	56488355	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56488354_56488355insA								XKR4 (49646 upstream) : TMEM68 (162965 downstream)																							actctgttctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57279081	57279082	+	IGR	INS	-	AT	AT	rs148076819	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57279081_57279082insAT								SDR16C5 (45840 upstream) : PENK (74431 downstream)																							tgcacttatgcaaataactgta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57314335	57314336	+	IGR	DEL	AC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57314335_57314336delAC								SDR16C5 (81094 upstream) : PENK (39177 downstream)																							acacacacatacacacacacac	0.213													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57429653	57429654	+	Intron	INS	-	G	G	rs142194348	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57429653_57429654insG	uc003xtb.1	+											Homo sapiens cDNA FLJ34244 fis, clone FCBBF3028794.																		CCTGAACACCAGGGGCAATTCC	0.406													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	61291345	61291346	+	IGR	INS	-	A	A	rs75759259		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61291345_61291346insA								CA8 (97391 upstream) : RAB2A (138213 downstream)																							gactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	65729741	65729744	+	IGR	DEL	TAGA	-	-	rs112888858		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65729741_65729744delTAGA								CYP7B1 (18393 upstream) : ARMC1 (785328 downstream)																							gtaggtagattagatagatagata	0.108													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	66477582	66477585	+	5'Flank	DEL	AAAG	-	-	rs62944460		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66477582_66477585delAAAG	uc003xvk.1	-											Homo sapiens cDNA FLJ37641 fis, clone BRHIP2000087.																		AATCCCTTTTAAAGAAAGATGGGA	0.172													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	66480149	66480150	+	IGR	INS	-	ACAC	ACAC	rs62746962		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66480149_66480150insACAC								CYP7B1 (768801 upstream) : ARMC1 (34922 downstream)																							cactgtctcaaacacgcacaca	0.129													4	2	---	---	---	---	
KCNB2	9312	broad.mit.edu	37	8	73643326	73643326	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73643326delA	uc003xzb.2	+							NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related						regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			TGCAGTGGCCAGAAACTCACA	0.448													6	3	---	---	---	---	
STAU2	27067	broad.mit.edu	37	8	74498882	74498882	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74498882delA	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron|STAU2_uc003xzo.2_Intron|STAU2_uc003xzp.2_Intron|STAU2_uc011lfi.1_Intron|STAU2_uc003xzq.2_Intron|STAU2_uc010lzk.2_Intron|STAU2_uc010lzl.1_Intron	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			aaaaaaatgcaaaaaaaaaaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	78487484	78487487	+	IGR	DEL	AGAG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78487484_78487487delAGAG								PEX2 (574960 upstream) : PKIA (940849 downstream)																							aattggcggtagagagagagatag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81136020	81136020	+	IGR	DEL	A	-	-	rs111885556		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81136020delA								TPD52 (52184 upstream) : ZBTB10 (261834 downstream)																							aaccccatccaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81513263	81513263	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81513263delC								ZBTB10 (78655 upstream) : ZNF704 (37506 downstream)																							AGTTGAACCTCCCCCCTACTC	0.378													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	84241063	84241064	+	IGR	DEL	GT	-	-	rs34948946		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84241063_84241064delGT								None (None upstream) : RALYL (854389 downstream)																							TACCTGCTTAgtgtgtgtgtgt	0.213													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	84500537	84500538	+	IGR	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84500537_84500538delGT								None (None upstream) : RALYL (594915 downstream)																							atttataaaagtgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	89004629	89004630	+	IGR	INS	-	A	A	rs142545009	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89004629_89004630insA								DCAF4L2 (118333 upstream) : MMP16 (44832 downstream)																							TGACAAGAAACAACAAATCTAA	0.277													1	6	---	---	---	---	
TMEM64	169200	broad.mit.edu	37	8	91637753	91637754	+	3'UTR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91637753_91637754insA	uc003yen.2	-	3					TMEM64_uc003yeo.2_3'UTR|TMEM64_uc011lgf.1_3'UTR	NM_001008495	NP_001008495	Q6YI46	TMM64_HUMAN	transmembrane protein 64 isoform 1							integral to membrane					0			BRCA - Breast invasive adenocarcinoma(11;0.0598)			ATTCTTGCTTTAAAAAAAAAAA	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	93396878	93396878	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93396878delT								RUNX1T1 (289172 upstream) : C8orf83 (498987 downstream)																							agtctgtgtcttttaattgga	0.000													4	2	---	---	---	---	
ESRP1	54845	broad.mit.edu	37	8	95719493	95719493	+	3'UTR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95719493delA	uc003ygq.3	+	16					ESRP1_uc003ygr.3_3'UTR|ESRP1_uc003ygs.3_3'UTR|ESRP1_uc003ygt.3_3'UTR|ESRP1_uc003ygu.3_3'UTR|ESRP1_uc003ygv.2_3'UTR|ESRP1_uc003ygw.2_3'UTR	NM_017697	NP_060167	Q6NXG1	ESRP1_HUMAN	RNA binding motif protein 35A isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	nucleus|plasma membrane	mRNA binding|nucleotide binding		ESRP1/RAF1(4)	prostate(4)	4						CAATAGGAAGAAAAAAAAAAA	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96736883	96736883	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96736883delC								C8orf37 (455446 upstream) : GDF6 (417677 downstream)																							TATtccttttcccttctcttc	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	98564102	98564102	+	IGR	DEL	T	-	-	rs112286705		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98564102delT								TSPYL5 (273926 upstream) : MTDH (92305 downstream)																							taagtgtgtcttttttttttt	0.000													5	4	---	---	---	---	
MATN2	4147	broad.mit.edu	37	8	99043662	99043664	+	Intron	DEL	ATA	-	-	rs7012944	byFrequency	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99043662_99043664delATA	uc003yic.2	+						MATN2_uc010mbh.1_Intron|MATN2_uc003yid.2_Intron|MATN2_uc003yie.1_Intron|MATN2_uc010mbi.1_Intron|MATN2_uc010mbj.1_Intron|RPL30_uc010mbk.1_Intron	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor							proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			gccaagcagtataataagtgttt	0.158													6	4	---	---	---	---	
NIPAL2	79815	broad.mit.edu	37	8	99284113	99284113	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99284113delT	uc003yil.1	-						NIPAL2_uc003yim.1_Intron	NM_024759	NP_079035	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2							integral to membrane					0						ttgttgagagttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103447524	103447525	+	IGR	INS	-	CA	CA	rs72683009	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103447524_103447525insCA								UBR5 (23029 upstream) : ODF1 (116323 downstream)																							acacacacacgcacacacacac	0.213													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103702027	103702027	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103702027delA								KLF10 (34044 upstream) : AZIN1 (136510 downstream)																							actctgtctcaaaaaaaaaaa	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103998133	103998133	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103998133delA								AZIN1 (121736 upstream) : ATP6V1C1 (35115 downstream)																							catttctactaaaactacaaa	0.000													4	2	---	---	---	---	
BAALC	79870	broad.mit.edu	37	8	104183653	104183653	+	Intron	DEL	A	-	-	rs35336505		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104183653delA	uc003yld.2	+						BAALC_uc003yle.2_Intron|uc003ylf.2_Intron|uc010mcb.1_Intron	NM_024812	NP_079088	Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic isoform 1							centrosome|membrane|nucleus					0			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			agagagaatgaaaataaaaag	0.085													5	3	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	104623903	104623903	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104623903delT	uc003ylp.2	+							NM_001100117	NP_001093587	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			tatttgttacttttttttttc	0.000										HNSCC(12;0.0054)			4	2	---	---	---	---	
ZFPM2	23414	broad.mit.edu	37	8	106689933	106689933	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106689933delA	uc003ymd.2	+							NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AAAACATAAGAAAAAAAAAAT	0.318													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	107264038	107264038	+	IGR	DEL	A	-	-	rs113739105		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107264038delA								ZFPM2 (447273 upstream) : OXR1 (18435 downstream)																							ACCACAAAAGAAAAAAAAAAT	0.294													4	2	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113255464	113255465	+	Intron	INS	-	A	A	rs142070991	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113255464_113255465insA	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATTTCAATCATAAAAAAAaaat	0.158										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			4	2	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113497057	113497057	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113497057delT	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ggatttgggattttcagatta	0.000										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	118365801	118365803	+	IGR	DEL	ACA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118365801_118365803delACA								SLC30A8 (176849 upstream) : MED30 (167162 downstream)																							gttgaaaaatacaacaccaaatt	0.000													4	2	---	---	---	---	
TNFRSF11B	4982	broad.mit.edu	37	8	119960846	119960847	+	Intron	INS	-	AAG	AAG	rs146214072	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119960846_119960847insAAG	uc003yon.3	-						TNFRSF11B_uc010mdc.1_Intron	NM_002546	NP_002537	O00300	TR11B_HUMAN	osteoprotegerin precursor						apoptosis|skeletal system development		cytokine activity|receptor activity			central_nervous_system(2)	2	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			AGTTTCAGCTTAAGTAAAATTT	0.450													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	121961798	121961801	+	IGR	DEL	TATC	-	-	rs10531093		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121961798_121961801delTATC								SNTB1 (137489 upstream) : HAS2 (663470 downstream)																							AGTGTTCAAATATCTATCTACATG	0.127													3	3	---	---	---	---	
TMEM65	157378	broad.mit.edu	37	8	125362361	125362362	+	Intron	DEL	GT	-	-	rs72149469		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125362361_125362362delGT	uc010mdl.2	-							NM_194291	NP_919267	Q6PI78	TMM65_HUMAN	transmembrane protein 65							integral to membrane					0	Lung NSC(37;1.18e-11)|Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TAATACATCAgtgtgtgtgtgt	0.238													4	2	---	---	---	---	
MTSS1	9788	broad.mit.edu	37	8	125675298	125675298	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125675298delA	uc003yrk.2	-						MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CCCAACGCTGAAACCTCCCTC	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128656742	128656743	+	IGR	INS	-	T	T	rs78560248		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128656742_128656743insT								LOC727677 (162358 upstream) : MYC (91022 downstream)																							CTTACCTCttcttttttttttt	0.238													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	130317001	130317004	+	IGR	DEL	AAAC	-	-	rs139651345		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130317001_130317004delAAAC								None (None upstream) : GSDMC (443439 downstream)																							aaaaaacaaaaaacaaacaaacaa	0.000													4	5	---	---	---	---	
KCNQ3	3786	broad.mit.edu	37	8	133292100	133292101	+	Intron	INS	-	GT	GT	rs146068332	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133292100_133292101insGT	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			tgtatatatgcgtgtgtgtgtg	0.149													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	138196083	138196084	+	IGR	INS	-	CTTT	CTTT	rs141078755	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138196083_138196084insCTTT								None (None upstream) : FAM135B (946184 downstream)																							tgcttcagccactccagtcatc	0.069													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	138785834	138785835	+	IGR	INS	-	CAGAAGTCCT	CAGAAGTCCT	rs139579312	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138785834_138785835insCAGAAGTCCT								None (None upstream) : FAM135B (356433 downstream)																							GACCATAATGCCATGAAACAAT	0.460													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	138927952	138927953	+	IGR	INS	-	AGTG	AGTG			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138927952_138927953insAGTG								None (None upstream) : FAM135B (214315 downstream)																							TGAGGCCAGTAAGTGACTCTGT	0.421													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140027649	140027650	+	IGR	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs139596738	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140027649_140027650insGTGTGTGTGT								COL22A1 (101413 upstream) : KCNK9 (585432 downstream)																							tacctatcgcagtgtgtgtgtg	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143991733	143991734	+	IGR	DEL	CA	-	-	rs111934850		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143991733_143991734delCA								CYP11B1 (30497 upstream) : CYP11B2 (241 downstream)																							attaggcaggcacacacacaca	0.005													4	2	---	---	---	---	
TOP1MT	116447	broad.mit.edu	37	8	144412112	144412113	+	Intron	INS	-	G	G	rs147483219	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144412112_144412113insG	uc003yxz.2	-						TOP1MT_uc011lkd.1_Intron|TOP1MT_uc011lke.1_Intron|TOP1MT_uc010mfb.2_Intron|TOP1MT_uc010mfd.1_Intron	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor						DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	GGTTTAGAGATGGGGGGTGAGC	0.347													5	3	---	---	---	---	
MAPK15	225689	broad.mit.edu	37	8	144802438	144802438	+	Frame_Shift_Del	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144802438delC	uc003yzj.2	+	8	801	c.760delC	c.(760-762)CTGfs	p.L254fs		NM_139021	NP_620590	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	254	Protein kinase.				protein autophosphorylation	extracellular region	ATP binding|MAP kinase activity|SH3 domain binding			lung(2)	2	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TGCCTCTGTGCTGCACCAGCT	0.672													11	5	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	400603	400605	+	Intron	DEL	CAC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:400603_400605delCAC	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc010mgw.1_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		cctccaccatcaccaccaccacc	0.000													7	4	---	---	---	---	
AK3	50808	broad.mit.edu	37	9	4714080	4714081	+	Intron	DEL	AC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4714080_4714081delAC	uc003ziq.1	-						AK3_uc003zip.1_Intron|AK3_uc011lma.1_Intron|AK3_uc003zir.1_Intron	NM_016282	NP_057366	Q9UIJ7	KAD3_HUMAN	adenylate kinase 3						blood coagulation	mitochondrial matrix	ATP binding|GTP binding|nucleoside triphosphate adenylate kinase activity			ovary(2)	2	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)		ctacacatatacacacctacac	0.000													4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8642660	8642660	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8642660delG	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		AGAAGAGTGAGGGGTGGTTCC	0.512										TSP Lung(15;0.13)			1	5	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	9425588	9425589	+	Intron	INS	-	ACTT	ACTT	rs147870208	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9425588_9425589insACTT	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CACAGGCTGACACAATGTGGAA	0.228										TSP Lung(15;0.13)			5	9	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	9889789	9889790	+	Intron	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9889789_9889790delGT	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ttcctgctgagtgtgtgtgtgt	0.000										TSP Lung(15;0.13)			4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	10135453	10135454	+	Intron	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:10135453_10135454insA	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		caatgtgatagaaaaaaatatt	0.000										TSP Lung(15;0.13)			4	2	---	---	---	---	
MOBKL2B	79817	broad.mit.edu	37	9	27336941	27336941	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27336941delA	uc003zqn.2	-							NM_024761	NP_079037	Q86TA1	MOL2B_HUMAN	MOB1, Mps One Binder kinase activator-like 2B								metal ion binding|protein binding			ovary(1)|pleura(1)	2		all_neural(11;9.12e-11)		Lung(218;6.54e-05)|LUSC - Lung squamous cell carcinoma(38;0.000397)		AGTCCCCCGGAAAAGGCCGTC	0.498													4	2	---	---	---	---	
LINGO2	158038	broad.mit.edu	37	9	28189692	28189699	+	Intron	DEL	AGGGAGGG	-	-	rs71512429	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28189692_28189699delAGGGAGGG	uc003zqu.1	-						LINGO2_uc010mjf.1_Intron|LINGO2_uc003zqv.1_Intron	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		ggaggaaggaagggagggaggaaggaag	0.149													5	3	---	---	---	---	
RUSC2	9853	broad.mit.edu	37	9	35543126	35543126	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35543126delA	uc003zww.2	+						RUSC2_uc010mkq.2_Intron|RUSC2_uc003zwx.3_Intron	NM_014806	NP_055621	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2							cytosol				ovary(1)	1			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CCCCTCAAAGAAAAAAAATTG	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	37053660	37053661	+	IGR	INS	-	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37053660_37053661insG								PAX5 (19184 upstream) : ZCCHC7 (66808 downstream)																							tgtctcaaaaaaaagaaaaaaG	0.183													4	2	---	---	---	---	
FRMPD1	22844	broad.mit.edu	37	9	37736882	37736883	+	Intron	DEL	GC	-	-	rs151329428		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37736882_37736883delGC	uc004aag.1	+						FRMPD1_uc004aah.1_Intron|FRMPD1_uc011lqm.1_Intron|FRMPD1_uc011lqn.1_Intron	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1							cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		gtgtatgtgtgCGCACACACAC	0.376													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44122397	44122398	+	IGR	DEL	TT	-	-	rs117805393		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44122397_44122398delTT								FAM75A6 (491667 upstream) : FAM27C (867838 downstream)																							AGCAGTAGTGTTTTTTTTTTTA	0.134													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66460611	66460611	+	5'Flank	DEL	T	-	-	rs149679567		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66460611delT	uc004aeb.2	-						uc004aec.2_Intron					Homo sapiens cDNA clone IMAGE:3941306, partial cds.																		tttgtaaatattttttcctca	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66508835	66508835	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66508835delG								LOC442421 (5808 upstream) : AQP7P1 (745432 downstream)																							AAAGTCTGTAGACATCTCTAG	0.483													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66516370	66516370	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66516370delG	uc010mnh.1	-											Homo sapiens cDNA FLJ20444 fis, clone KAT05128.																		TTCAGTGACAGTTACATAATC	0.433													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66822346	66822346	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66822346delC								LOC442421 (319319 upstream) : AQP7P1 (431921 downstream)																							tcagaaacttccttgtgatgt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66823200	66823200	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66823200delT								LOC442421 (320173 upstream) : AQP7P1 (431067 downstream)																							cagaaacttctttgtgatgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66834818	66834818	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66834818delA								LOC442421 (331791 upstream) : AQP7P1 (419449 downstream)																							atcttcccataaaaactagac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66850601	66850602	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66850601_66850602insA								LOC442421 (347574 upstream) : AQP7P1 (403665 downstream)																							gcctatggtggaaaggaaataa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66862128	66862128	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66862128delT								LOC442421 (359101 upstream) : AQP7P1 (392139 downstream)																							tgaatgtttatccctcatgaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68375418	68375419	+	IGR	INS	-	AC	AC	rs138387266		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68375418_68375419insAC								FAM27B (581229 upstream) : MIR1299 (626820 downstream)																							aaaacaaacaaaaaaaaaaaaa	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68402732	68402733	+	IGR	INS	-	TGAAT	TGAAT			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68402732_68402733insTGAAT								FAM27B (608543 upstream) : MIR1299 (599506 downstream)																							ATCTCACATGATGAAGACTAAA	0.287													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68430746	68430746	+	IGR	DEL	T	-	-	rs113456947		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68430746delT								FAM27B (636557 upstream) : MIR1299 (571493 downstream)																							TTTTACTAGCTTCTTATATCC	0.313													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69958279	69958280	+	IGR	INS	-	T	T	rs144772588	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69958279_69958280insT								LOC100133920 (293330 upstream) : FOXD4L5 (217429 downstream)																							atctagagcacttgaggcctat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70940393	70940394	+	IGR	DEL	GA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70940393_70940394delGA								FOXD4L3 (20393 upstream) : LOC572558 (29717 downstream)																							tgatgataaggagagagtctgc	0.000													6	3	---	---	---	---	
TRPM3	80036	broad.mit.edu	37	9	73437676	73437677	+	Intron	DEL	TG	-	-	rs113090222		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73437676_73437677delTG	uc004aid.2	-						TRPM3_uc004ahu.2_Intron|TRPM3_uc004ahv.2_Intron|TRPM3_uc004ahw.2_Intron|TRPM3_uc004ahx.2_Intron|TRPM3_uc004ahy.2_Intron|TRPM3_uc004ahz.2_Intron|TRPM3_uc004aia.2_Intron|TRPM3_uc004aib.2_Intron|TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron|TRPM3_uc004aie.2_Intron|TRPM3_uc004aif.2_Intron|TRPM3_uc004aig.2_Intron	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						AGATTTGTCTtgtgtgtgtgtg	0.183													4	2	---	---	---	---	
TRPM3	80036	broad.mit.edu	37	9	73851961	73851961	+	Intron	DEL	A	-	-	rs72457993		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73851961delA	uc004aii.2	-							NM_206948	NP_996831	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						agactccatcaaaaaaaaaaa	0.015													4	2	---	---	---	---	
GDA	9615	broad.mit.edu	37	9	74729848	74729849	+	Intron	DEL	AG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74729848_74729849delAG	uc011lse.1	+							NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase						nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		TTAATGGGACAGAGAGAGAGTG	0.505													4	2	---	---	---	---	
PCSK5	5125	broad.mit.edu	37	9	78517262	78517262	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78517262delC	uc004ajz.2	+						PCSK5_uc004ajy.2_Intron|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						ATAAAAGGTGCCACTTCTGAA	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90460007	90460008	+	IGR	DEL	CT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90460007_90460008delCT								CTSL3 (58208 upstream) : C9orf79 (37733 downstream)																							AAAAGTCTTGCTCtgtgtgtgt	0.292													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	102487220	102487220	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102487220delT	uc004bad.1	-											Homo sapiens cDNA FLJ32889 fis, clone TESTI2004560.																		tctgttgttgttttttttccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	116471049	116471049	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116471049delC								RGS3 (111032 upstream) : ZNF618 (167513 downstream)																							TTCCAGTTCTCCCCAGTTAGG	0.229													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	117696496	117696497	+	IGR	INS	-	C	C	rs147173166	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117696496_117696497insC								TNFSF8 (3726 upstream) : TNC (86309 downstream)																							GAGAGTGACCACCCAGCCTCCT	0.490													3	3	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119188051	119188051	+	3'UTR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119188051delC	uc004bjs.1	-	23					ASTN2_uc004bjr.1_3'UTR|ASTN2_uc004bjt.1_3'UTR|ASTN2_uc004bjp.1_3'UTR|ASTN2_uc004bjq.1_Intron|ASTN2_uc011lxr.1_Intron|ASTN2_uc011lxs.1_Intron|ASTN2_uc011lxt.1_3'UTR|ASTN2_uc004bjo.1_3'UTR	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						CCCCAGCCCACCCAGGCCCCA	0.602													15	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120252620	120252620	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120252620delG								ASTN2 (75303 upstream) : TLR4 (213840 downstream)																							AAATTAATCTGGgaatagatg	0.139													4	2	---	---	---	---	
DAB2IP	153090	broad.mit.edu	37	9	124430476	124430476	+	Intron	DEL	T	-	-	rs34264250		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124430476delT	uc004bln.2	+							NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform						activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2						CTGTTGTTGAttttttttttt	0.040													4	3	---	---	---	---	
GARNL3	84253	broad.mit.edu	37	9	130104531	130104533	+	In_Frame_Del	DEL	CAA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130104531_130104533delCAA	uc011mae.1	+	14	1570_1572	c.1169_1171delCAA	c.(1168-1173)CCAACA>CCA	p.T391del	GARNL3_uc011mad.1_In_Frame_Del_p.T369del|GARNL3_uc004bqt.1_In_Frame_Del_p.T172del	NM_032293	NP_115669	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	391	Rap-GAP.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity|small GTPase regulator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						TTGGAAACCCCAACATTTGCCCA	0.379													35	24	---	---	---	---	
ODF2	4957	broad.mit.edu	37	9	131217957	131217958	+	5'Flank	INS	-	GA	GA	rs149078806	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131217957_131217958insGA	uc011mbd.1	+						ODF2_uc011maz.1_Intron|ODF2_uc011mba.1_5'Flank|ODF2_uc010myb.2_5'Flank|ODF2_uc011mbb.1_5'Flank|ODF2_uc011mbc.1_5'Flank|ODF2_uc004bva.2_5'Flank|ODF2_uc004bvb.2_5'Flank|ODF2_uc011mbe.1_5'Flank|ODF2_uc004bvc.2_5'Flank|ODF2_uc010myc.2_5'Flank|ODF2_uc011mbf.1_5'Flank|ODF2_uc004bvd.3_5'Flank|ODF2_uc004bve.2_5'Flank	NM_002540	NP_002531	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2 isoform 1						cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity			ovary(1)	1						TGTGGGCAGGGGAGAGGCCGGG	0.535													2	5	---	---	---	---	
MED27	9442	broad.mit.edu	37	9	134827748	134827748	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134827748delG	uc004cbe.1	-						MED27_uc004cbf.1_Intron|MED27_uc011mco.1_Intron|MED27_uc004cbg.3_Intron	NM_004269	NP_004260	Q6P2C8	MED27_HUMAN	mediator complex subunit 27						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleolus|transcription factor complex	protein binding|transcription coactivator activity			skin(1)	1		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		GACATGGACTGGGGGGAAGCA	0.517													4	2	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137618547	137618547	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137618547delT	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		gaaggactggtagatgtagat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138016485	138016486	+	IGR	INS	-	AAGA	AAGA	rs147997959	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138016485_138016486insAAGA								OLFM1 (3454 upstream) : KIAA0649 (355162 downstream)																							agaaaagaaagaagaaagaaag	0.000													4	3	---	---	---	---	
WDR37	22884	broad.mit.edu	37	10	1170598	1170607	+	Intron	DEL	GTGTGTGTGT	-	-	rs113902959		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1170598_1170607delGTGTGTGTGT	uc001igf.1	+						WDR37_uc009xhm.1_Intron|WDR37_uc009xhn.1_Intron|WDR37_uc001igg.1_Intron	NM_014023	NP_054742	Q9Y2I8	WDR37_HUMAN	WD repeat domain 37												0		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		CCATTGAGCAgtgtgtgtgtgtgtgtgtgt	0.367													4	3	---	---	---	---	
ADARB2	105	broad.mit.edu	37	10	1265793	1265798	+	Intron	DEL	TGATGA	-	-	rs112182007		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1265793_1265798delTGATGA	uc009xhq.2	-							NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		atggtgatggtgatgatgatggtaat	0.000													3	3	---	---	---	---	
ADARB2	105	broad.mit.edu	37	10	1598697	1598698	+	Intron	DEL	CG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1598697_1598698delCG	uc009xhq.2	-						uc001ign.2_Intron	NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GCTGgtgcttcgcaaactttgc	0.045													4	2	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7433428	7433428	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7433428delA	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron|SFMBT2_uc001ijo.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						actctgtctcaaaaaaaaaaa	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	9733846	9733846	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9733846delA								None (None upstream) : None (None downstream)																							TACAAGCCCTAGCGAGGATGA	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	12378471	12378473	+	IGR	DEL	AAC	-	-	rs149598799		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12378471_12378473delAAC								CDC123 (85884 upstream) : CAMK1D (13110 downstream)																							ctctgtctcaaacaacaacaaca	0.000													3	4	---	---	---	---	
FRMD4A	55691	broad.mit.edu	37	10	13806506	13806507	+	Intron	INS	-	AAAC	AAAC	rs142282706	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13806506_13806507insAAAC	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						ctgcctcaaataaacaaacaaa	0.134													4	2	---	---	---	---	
ST8SIA6	338596	broad.mit.edu	37	10	17431463	17431464	+	Intron	DEL	AC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17431463_17431464delAC	uc001ipd.2	-						ST8SIA6_uc010qce.1_Intron|uc001ipe.2_Intron|uc001ipf.1_Intron	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						TCCCTGCCCAACACACACACAT	0.490													4	3	---	---	---	---	
NSUN6	221078	broad.mit.edu	37	10	18847463	18847467	+	Intron	DEL	GAATG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18847463_18847467delGAATG	uc010qcp.1	-							NM_182543	NP_872349	Q8TEA1	NSUN6_HUMAN	NOL1/NOP2/Sun domain family, member 6								methyltransferase activity|RNA binding			ovary(2)	2						atggaacggagaatggaatggaatg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19318910	19318911	+	IGR	INS	-	T	T	rs150651428		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19318910_19318911insT								ARL5B (351970 upstream) : PLXDC2 (786461 downstream)																							actattttttcttttttttttt	0.000													3	3	---	---	---	---	
NEBL	10529	broad.mit.edu	37	10	21175289	21175290	+	Intron	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21175289_21175290insA	uc001iqi.2	-						NEBL_uc001iqj.2_Intron|NEBL_uc001iqk.2_Intron	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform						regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						ccgtctctactaaaaaaaaaaa	0.000													4	2	---	---	---	---	
NEBL	10529	broad.mit.edu	37	10	21210723	21210724	+	Intron	INS	-	AT	AT	rs143458328	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21210723_21210724insAT	uc001iqk.2	-							NM_213569	NP_998734	O76041	NEBL_HUMAN	nebulette non-muscle isoform						regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						cacacacacacatatgtataca	0.069													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	23437357	23437358	+	IGR	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23437357_23437358delGT								MSRB2 (26416 upstream) : PTF1A (44102 downstream)																							gtgtgtgttcgtgtgtgtgtgt	0.040													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	24849596	24849596	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24849596delG								KIAA1217 (12825 upstream) : ARHGAP21 (22942 downstream)																							GGGAGCTGTTGGGGTGACAAG	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	26721849	26721850	+	IGR	INS	-	CTT	CTT	rs145473113	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26721849_26721850insCTT								GAD2 (128358 upstream) : APBB1IP (5416 downstream)																							agtcaattaaacttttctttat	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	29019670	29019670	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29019670delT								BAMBI (47802 upstream) : LYZL1 (558320 downstream)																							ccttCCTTCCttttttttttt	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38877438	38877438	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38877438delG								LOC399744 (136358 upstream) : None (None downstream)																							aaatatcatcgaaattgaatc	0.000													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38880827	38880827	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38880827delA								LOC399744 (139747 upstream) : None (None downstream)																							aatcatcatcaaaatggaatc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42407718	42407718	+	IGR	DEL	T	-	-	rs149758533		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42407718delT								None (None upstream) : LOC441666 (419597 downstream)																							gaaagaagaattctgagaaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42643681	42643682	+	IGR	DEL	GG	-	-	rs111767435		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42643681_42643682delGG								None (None upstream) : LOC441666 (183633 downstream)																							ttttcttgttggtttttttttt	0.149													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42654204	42654208	+	IGR	DEL	CTGTT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42654204_42654208delCTGTT								None (None upstream) : LOC441666 (173107 downstream)																							catgactctcctgttctcaaatgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	48862227	48862228	+	Intron	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48862227_48862228insA	uc001jfy.3	-						FRMPD2L1_uc001jfz.3_Intron	NM_001042525	NP_001035990			FERM and PDZ domain containing 2 like 1 isoform																		AAATGGAAGAGAAAAAAAAAAA	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	49869999	49870000	+	IGR	INS	-	C	C	rs55646402	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49869999_49870000insC								ARHGAP22 (5689 upstream) : WDFY4 (22921 downstream)																							CACttcttcttttttttttttt	0.010													4	2	---	---	---	---	
WDFY4	57705	broad.mit.edu	37	10	50012821	50012822	+	Intron	INS	-	GG	GG	rs146911430	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50012821_50012822insGG	uc001jha.3	+						WDFY4_uc001jhb.1_Intron	NM_020945	NP_065996	Q6ZS81	WDFY4_HUMAN	WDFY family member 4							integral to membrane	binding				0						TATCTGAGGGAGGGGGTATGGA	0.450													4	2	---	---	---	---	
BICC1	80114	broad.mit.edu	37	10	60570079	60570079	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60570079delG	uc001jki.1	+						BICC1_uc001jkj.1_Intron	NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						CATCCTGGCTGGTGTTTAGCA	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	63138939	63138940	+	IGR	INS	-	G	G	rs151237397	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63138939_63138940insG								RHOBTB1 (377741 upstream) : TMEM26 (27461 downstream)																							tataatctcctgtgtgccattt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	69610326	69610326	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69610326delA								DNAJC12 (12389 upstream) : SIRT1 (34101 downstream)																							tcaaaaaatgaaaaaagaaaT	0.100													4	2	---	---	---	---	
NEUROG3	50674	broad.mit.edu	37	10	71334208	71334209	+	5'Flank	DEL	AG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71334208_71334209delAG	uc001jpp.2	-							NM_020999	NP_066279	Q9Y4Z2	NGN3_HUMAN	neurogenin 3						central nervous system development|endocrine pancreas development|peripheral nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	transcription coactivator activity				0						ctgagactacaggcatgcgcca	0.000													3	3	---	---	---	---	
PPA1	5464	broad.mit.edu	37	10	71995618	71995618	+	5'Flank	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71995618delG	uc001jqv.1	-							NM_021129	NP_066952	Q15181	IPYR_HUMAN	pyrophosphatase 1						diphosphate metabolic process|tRNA aminoacylation for protein translation	cytosol	inorganic diphosphatase activity|magnesium ion binding			breast(1)	1						ctgagtagctgggatcacagg	0.000													4	2	---	---	---	---	
KIAA1274	27143	broad.mit.edu	37	10	72245160	72245160	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72245160delT	uc001jrd.3	+							NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274											ovary(2)|central_nervous_system(1)	3						AGCAAACttcttttttttttt	0.199													5	3	---	---	---	---	
SLC29A3	55315	broad.mit.edu	37	10	73092556	73092556	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73092556delT	uc001jrr.3	+						SLC29A3_uc001jrs.3_Intron|SLC29A3_uc010qjq.1_Intron|SLC29A3_uc001jrt.3_Intron|SLC29A3_uc001jru.3_Intron	NM_018344	NP_060814	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (nucleoside						nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|late endosome membrane|lysosomal membrane	nucleoside transmembrane transporter activity				0						CTGTGATGGCTTTTTCTTCTG	0.458													4	2	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73231303	73231304	+	Intron	INS	-	CAGATTG	CAGATTG	rs143123050	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73231303_73231304insCAGATTG	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc001jrv.2_Intron|CDH23_uc009xql.2_Intron	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CCAGTGATACCCAGTCTCCAGC	0.604													4	3	---	---	---	---	
CBARA1	10367	broad.mit.edu	37	10	74193363	74193363	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74193363delT	uc001jtb.1	-						CBARA1_uc010qjw.1_Intron|CBARA1_uc010qjx.1_Intron|CBARA1_uc009xqo.1_Intron	NM_006077	NP_006068	Q9BPX6	MICU1_HUMAN	calcium binding atopy-related autoantigen 1						calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1						tttttttgtatttttagtaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	76499745	76499745	+	IGR	DEL	A	-	-	rs77616102		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76499745delA								ADK (30686 upstream) : MYST4 (86634 downstream)																							actggtcttgaaaaaaaaaaa	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	83045262	83045262	+	IGR	DEL	G	-	-	rs149639894	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83045262delG								SH2D4B (638946 upstream) : NRG3 (589808 downstream)																							TTAGATCAGCGAAAAAAACTC	0.318													4	2	---	---	---	---	
NRG3	10718	broad.mit.edu	37	10	83656983	83656983	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83656983delA	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		ggagaggtagaaaaggtcagg	0.000													4	2	---	---	---	---	
FAM190B	54462	broad.mit.edu	37	10	86235785	86235785	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86235785delT	uc001kdh.1	+						FAM190B_uc010qmd.1_Intron|FAM190B_uc001kdi.1_Intron|FAM190B_uc010qme.1_Intron	NM_018999	NP_061872	Q9H7U1	F190B_HUMAN	granule cell antiserum positive 14											ovary(3)|skin(1)	4						agatacagggttttgccttgt	0.000													4	2	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	87937614	87937615	+	Intron	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87937614_87937615delTG	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	CTTCAGTGTATGTGTGTGTGTG	0.421										Multiple Myeloma(13;0.14)			4	2	---	---	---	---	
LOC728190	728190	broad.mit.edu	37	10	88974682	88974682	+	Intron	DEL	T	-	-	rs113190570		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88974682delT	uc009xtc.2	-						LOC728190_uc009xtd.2_Intron					Homo sapiens cDNA FLJ34397 fis, clone HCHON2001110.												0						ttttcttttcttttttttttt	0.264													4	3	---	---	---	---	
PAPSS2	9060	broad.mit.edu	37	10	89448732	89448732	+	Intron	DEL	C	-	-	rs112850608		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89448732delC	uc001kex.2	+						PAPSS2_uc001kew.2_Intron|PAPSS2_uc009xtg.1_Intron	NM_004670	NP_004661	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|protein binding|sulfate adenylyltransferase (ATP) activity			central_nervous_system(1)|skin(1)	2		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		AAAAAAAAAACTGTATGGAAA	0.338													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	89803176	89803176	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89803176delG								PTEN (74645 upstream) : RNLS (88881 downstream)																							aacagcaagtgggcaaaggcc	0.000													3	5	---	---	---	---	
EXOC6	54536	broad.mit.edu	37	10	94661839	94661840	+	Intron	DEL	AC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94661839_94661840delAC	uc001kig.2	+						EXOC6_uc010qnr.1_Intron|EXOC6_uc001kie.2_Intron|EXOC6_uc009xub.2_Intron|EXOC6_uc009xuc.2_Intron	NM_019053	NP_061926	Q8TAG9	EXOC6_HUMAN	SEC15-like 1 isoform a						protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)				acacacacatacacacacacac	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	94970170	94970170	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94970170delA								CYP26A1 (132529 upstream) : MYOF (96017 downstream)																							gcctcaacagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	99107385	99107386	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99107385_99107386insA								FRAT2 (12927 upstream) : RRP12 (9073 downstream)																							ccagtgatcttaaaaaaaaaaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	101621733	101621735	+	IGR	DEL	TGG	-	-	rs145545920		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101621733_101621735delTGG								ABCC2 (10071 upstream) : DNMBP (13599 downstream)																							ttgttgttgttggtggtatttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	107364023	107364024	+	IGR	DEL	TC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107364023_107364024delTC								SORCS3 (339030 upstream) : SORCS1 (969398 downstream)																							aacttTATCAtctctctctctc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	110822787	110822788	+	IGR	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110822787_110822788delTG								None (None upstream) : XPNPEP1 (801736 downstream)																							tgagtgtgtatgtgtgtgtgtg	0.208													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	111240432	111240432	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111240432delT								None (None upstream) : XPNPEP1 (384092 downstream)																							acaccagctctttttttgcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	115794868	115794869	+	IGR	INS	-	A	A	rs11458100		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115794868_115794869insA								NHLRC2 (126416 upstream) : ADRB1 (8937 downstream)																							gagactgtctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
ABLIM1	3983	broad.mit.edu	37	10	116272667	116272678	+	Intron	DEL	GAAAGAAAGAGA	-	-	rs71473046	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116272667_116272678delGAAAGAAAGAGA	uc010qsg.1	-						ABLIM1_uc010qsh.1_Intron|ABLIM1_uc010qsi.1_Intron|ABLIM1_uc010qsk.1_Intron|ABLIM1_uc009xyp.2_Intron|ABLIM1_uc010qsf.1_Intron|ABLIM1_uc009xyn.2_Intron|ABLIM1_uc010qsj.1_Intron|ABLIM1_uc009xyo.2_Intron	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		aggaaggaaggaaagaaagagagaaagaaaga	0.137													2	4	---	---	---	---	
GFRA1	2674	broad.mit.edu	37	10	118001998	118001998	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118001998delT	uc001lcj.2	-						GFRA1_uc001lci.2_Intron|GFRA1_uc009xyr.2_Intron	NM_005264	NP_005255	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1 isoform a						axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity			ovary(1)|pancreas(1)	2		Lung NSC(174;0.21)		all cancers(201;0.0337)		CATAAAAACAttttttttttt	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	119652851	119652852	+	IGR	INS	-	TGTGTG	TGTGTG	rs141214244	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119652851_119652852insTGTGTG								EMX2 (343795 upstream) : RAB11FIP2 (111577 downstream)																							CTATATATATTtgtgtgtgtgt	0.371													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125343858	125343859	+	IGR	INS	-	A	A	rs35637549		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125343858_125343859insA								BUB3 (418972 upstream) : GPR26 (82012 downstream)																							ATCGAGCCCCCGAGGCCCTCCC	0.614													4	2	---	---	---	---	
CPXM2	119587	broad.mit.edu	37	10	125607042	125607042	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125607042delA	uc001lhk.1	-						CPXM2_uc001lhj.2_Intron	NM_198148	NP_937791	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2						cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		actctgtctcaaaaaaaaaag	0.114													4	2	---	---	---	---	
ADAM12	8038	broad.mit.edu	37	10	127831853	127831854	+	Intron	INS	-	TG	TG	rs140327815	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127831853_127831854insTG	uc001ljk.2	-						ADAM12_uc010qul.1_Intron|ADAM12_uc001ljm.2_Intron|ADAM12_uc001ljn.2_Intron|ADAM12_uc001ljl.3_Intron	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		atgggtatgcatgtgtgtgtgt	0.000													2	4	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	129000588	129000588	+	Intron	DEL	A	-	-	rs76124846		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129000588delA	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		ctctgtctccaaaaaaaaaaa	0.234													4	2	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	129121315	129121325	+	Intron	DEL	GATCAATGCTC	-	-	rs142905153		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129121315_129121325delGATCAATGCTC	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CTGGATGATTGATCAATGCTCGATCAATGCG	0.517													3	3	---	---	---	---	
PTPRE	5791	broad.mit.edu	37	10	129828662	129828662	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129828662delA	uc001lkb.2	+						PTPRE_uc009yat.2_Intron|PTPRE_uc010qup.1_Intron|PTPRE_uc009yau.2_Intron|PTPRE_uc001lkc.1_Intron	NM_006504	NP_006495	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E						negative regulation of insulin receptor signaling pathway|protein phosphorylation	cytoplasm|integral to membrane|intermediate filament cytoskeleton|nucleus|plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(1)	1		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)				gagggaggggaaagagagaga	0.378													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130361032	130361037	+	IGR	DEL	GAGGAG	-	-	rs147711950		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130361032_130361037delGAGGAG								MKI67 (436564 upstream) : MGMT (904417 downstream)																							aggaaagagagaggaggaggaagaga	0.136													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132327727	132327730	+	IGR	DEL	CAAA	-	-	rs112740957		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132327727_132327730delCAAA								GLRX3 (344943 upstream) : TCERG1L (562926 downstream)																							gattctgtctcaaacaaacaaaca	0.000													4	3	---	---	---	---	
JAKMIP3	282973	broad.mit.edu	37	10	133916959	133916960	+	5'Flank	DEL	GG	-	-	rs10537368		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133916959_133916960delGG	uc001lkx.3	+							NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		AGGAGCAGCTGGGGGGGGGAGG	0.663													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135466239	135466240	+	IGR	INS	-	G	G			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135466239_135466240insG								FRG2B (25940 upstream) : LOC653544 (24039 downstream)																							cactttttgatggttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	357906	357909	+	IGR	DEL	ACAC	-	-	rs111279816		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:357906_357909delACAC								IFITM3 (36992 upstream) : B4GALNT4 (11886 downstream)																							ccacgcacatacacacacaccatg	0.059													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	1640465	1640466	+	IGR	INS	-	G	G	rs145054280		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1640465_1640466insG								KRTAP5-3 (10772 upstream) : KRTAP5-4 (1722 downstream)																							gaaaaaaaaaaaaTTCCTTTCA	0.020													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	5988139	5988140	+	IGR	INS	-	AT	AT			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5988139_5988140insAT								OR56A3 (18617 upstream) : OR56A5 (645 downstream)																							cacacacacacacacacacaca	0.238													4	2	---	---	---	---	
SWAP70	23075	broad.mit.edu	37	11	9732939	9732940	+	Intron	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9732939_9732940delTG	uc001mhw.2	+						SWAP70_uc001mhv.2_Intron|SWAP70_uc001mhx.2_Intron	NM_015055	NP_055870	Q9UH65	SWP70_HUMAN	SWAP-70 protein							cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		ttgccttttatgtgtgtgtgtg	0.158													5	3	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19473655	19473660	+	Intron	DEL	GTGTGT	-	-	rs72309190		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19473655_19473660delGTGTGT	uc001mpp.2	+							NM_001111018	NP_001104488	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						GGTTACAAAAgtgtgtgtgtgtgtgt	0.301													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19649475	19649475	+	Intron	DEL	G	-	-	rs150765143		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19649475delG	uc001mpp.2	+							NM_001111018	NP_001104488	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						aaaaaaaaaagaagaagaaga	0.000													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	20107882	20107892	+	Intron	DEL	CCTGTGTCCTT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20107882_20107892delCCTGTGTCCTT	uc001mpr.3	+						NAV2_uc001mpp.2_Intron|NAV2_uc009yhx.2_Intron|NAV2_uc009yhz.2_Intron|NAV2_uc001mpu.2_Intron	NM_182964	NP_892009	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 1							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						cacctcaaggcctgtgtccttcctgtgtcct	0.090													4	2	---	---	---	---	
NELL1	4745	broad.mit.edu	37	11	21460614	21460615	+	Intron	INS	-	ATAG	ATAG	rs142502112	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21460614_21460615insATAG	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron|NELL1_uc001mqg.2_Intron|NELL1_uc001mqh.2_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						AACTGCAGGTAATAGAGGTGTG	0.406													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	23201008	23201008	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:23201008delA								SVIP (349626 upstream) : None (None downstream)																							tttctcctgtaaactagtttt	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	24455217	24455218	+	IGR	INS	-	T	T	rs67053321		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24455217_24455218insT								None (None upstream) : LUZP2 (63338 downstream)																							CTTTTTTTTACTTTTTtttttt	0.178													3	3	---	---	---	---	
SLC1A2	6506	broad.mit.edu	37	11	35428186	35428187	+	Intron	INS	-	A	A	rs138528118	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35428186_35428187insA	uc001mwd.2	-						SLC1A2_uc001mwe.2_Intron|SLC1A2_uc010rev.1_Intron	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2						D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	gctgaaggaagaaaaaaaaggc	0.163													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	37784110	37784114	+	IGR	DEL	TTTTG	-	-	rs76321158		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37784110_37784114delTTTTG								None (None upstream) : None (None downstream)																							ttgtttgtttttttgttttgttttg	0.151													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	39457752	39457753	+	IGR	INS	-	AAAC	AAAC	rs144084945	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:39457752_39457753insAAAC								None (None upstream) : LRRC4C (678000 downstream)																							ctgtctcaTTTAAACAAACAAA	0.173													3	6	---	---	---	---	
TTC17	55761	broad.mit.edu	37	11	43381714	43381715	+	Intron	INS	-	A	A	rs117486228	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43381714_43381715insA	uc001mxi.2	+						TTC17_uc001mxh.2_Intron	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17								binding			ovary(5)	5						CGTTTAAGGTGAGGTTTAGATT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	43586449	43586450	+	IGR	DEL	TT	-	-	rs67089721		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43586449_43586450delTT								MIR670 (5146 upstream) : MIR129-2 (16494 downstream)																							tttcttcttctttttttttttt	0.178													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	44279955	44279955	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44279955delA								EXT2 (12976 upstream) : ALX4 (6204 downstream)																							ACACTCCAGGAAGATCTCTAG	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	51579729	51579730	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51579729_51579730insA								OR4C46 (63520 upstream) : None (None downstream)																							tccacttgcagttctacgaaag	0.000													4	2	---	---	---	---	
TNKS1BP1	85456	broad.mit.edu	37	11	57069703	57069703	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57069703delT	uc001njr.2	-						TNKS1BP1_uc001njp.2_Intron|TNKS1BP1_uc001njq.2_Splice_Site_p.Q134_splice|TNKS1BP1_uc001njs.2_Intron	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1						nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				GGTGTCCTGCTTGGGGCAATG	0.652													13	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	58757005	58757005	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58757005delC	uc001nng.1	-											Homo sapiens cDNA FLJ34127 fis, clone FCBBF3010124.																		ttcagctacgccctgcccaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	59714904	59714904	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59714904delC	uc001nok.1	+											Homo sapiens mRNA for hypothetical protein, partial sequence, clone:Hsa11-digit01-13-09-F.																		tactattatgccaaattcagg	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	59795411	59795412	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59795411_59795412insA								TCN1 (161370 upstream) : PLAC1L (12336 downstream)																							agattgtctttaaaaaaaaaaG	0.188													2	4	---	---	---	---	
RTN3	10313	broad.mit.edu	37	11	63507760	63507760	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63507760delT	uc001nxq.2	+						RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Intron|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Intron|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b						apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						TCTTAGtttcttttttttttt	0.164													4	2	---	---	---	---	
ANKRD13D	338692	broad.mit.edu	37	11	67062888	67062888	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67062888delA	uc001okc.1	+						ANKRD13D_uc001okd.1_Intron|ANKRD13D_uc001oke.1_Intron|uc001okf.1_5'Flank|ANKRD13D_uc001okg.1_5'Flank|ANKRD13D_uc001okh.1_5'Flank	NM_207354	NP_997237	Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D											ovary(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			actccatctcaaaaaaaaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68387403	68387410	+	IGR	DEL	ACACACAA	-	-	rs148816473	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68387403_68387410delACACACAA								SAPS3 (4604 upstream) : GAL (64573 downstream)																							acacacacacacacacaaactattagaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	70041119	70041122	+	IGR	DEL	GATG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70041119_70041122delGATG								ANO1 (5470 upstream) : FADD (8147 downstream)																							tggatggatagatggatggatgga	0.000													6	3	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70470710	70470711	+	Intron	INS	-	C	C	rs138528335	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70470710_70470711insC	uc001oqc.2	-						SHANK2_uc010rqn.1_Intron|SHANK2_uc001opz.2_Intron|uc009ysn.1_Intron|SHANK2_uc010rqp.1_Intron	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GGGTGATGGTGCCCCCCCAAAC	0.337													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	71386058	71386059	+	IGR	DEL	TC	-	-	rs113542915		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71386058_71386059delTC								KRTAP5-11 (92137 upstream) : FAM86C (112498 downstream)																							TCTCTTATGGtctctctctctc	0.252													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	79754203	79754203	+	IGR	DEL	G	-	-	rs113870098		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79754203delG								ODZ4 (602508 upstream) : None (None downstream)																							AACAAATCTTGtttttttttt	0.184													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	81622871	81622872	+	Intron	INS	-	GTGT	GTGT	rs138559598	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81622871_81622872insGTGT	uc001ozo.1	-											Homo sapiens cDNA clone IMAGE:5298883.																		TACACAAACAAgtgtgtgtgtg	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	82115831	82115831	+	5'Flank	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82115831delT	uc001ozo.1	-											Homo sapiens cDNA clone IMAGE:5298883.																		ctttatgagctacactcaccg	0.000													3	3	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	83680980	83680981	+	Intron	INS	-	A	A	rs34554842		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83680980_83680981insA	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Intron	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GTGTTTCCTCTAAAAAAAAAAA	0.277													4	2	---	---	---	---	
ME3	10873	broad.mit.edu	37	11	86260034	86260034	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86260034delT	uc001pbz.2	-						ME3_uc001pca.2_Intron|ME3_uc009yvk.2_Intron|ME3_uc010rtr.1_Intron	NM_001014811	NP_001014811	Q16798	MAON_HUMAN	mitochondrial malic enzyme 3 precursor						aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)	caacatcacctggacttcgtt	0.129													4	2	---	---	---	---	
NOX4	50507	broad.mit.edu	37	11	89106446	89106446	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89106446delA	uc001pct.2	-						NOX4_uc009yvr.2_Intron|NOX4_uc001pcu.2_Intron|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Intron|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Intron|NOX4_uc009yvq.2_Intron	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				CTGTACAAGCaaaaaaaaaaa	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	91538308	91538308	+	IGR	DEL	C	-	-	rs11354342		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91538308delC								MIR1261 (935938 upstream) : FAT3 (546954 downstream)																							atgagatccacctttttcagc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	93029671	93029671	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93029671delT								SLC36A4 (98576 upstream) : CCDC67 (33485 downstream)																							TAACAGCTCCTGGAACAGATG	0.363													4	2	---	---	---	---	
CCDC82	79780	broad.mit.edu	37	11	96091831	96091831	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96091831delA	uc009ywp.2	-						CCDC82_uc009ywq.2_Intron|CCDC82_uc001pfx.3_Intron|CCDC82_uc009ywr.2_Intron	NM_024725	NP_079001	Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82								protein binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		ATACTCTGTCAAAAAAAAAAA	0.383													4	4	---	---	---	---	
PDGFD	80310	broad.mit.edu	37	11	103921827	103921828	+	Intron	INS	-	A	A	rs112708876	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103921827_103921828insA	uc001phq.2	-						PDGFD_uc001php.2_Intron	NM_025208	NP_079484	Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D isoform 1						positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		GGTGATACAGGAAAAAAAAATG	0.361													4	2	---	---	---	---	
GUCY1A2	2977	broad.mit.edu	37	11	106612214	106612220	+	Intron	DEL	AGAAGGA	-	-	rs5794490		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106612214_106612220delAGAAGGA	uc001pjg.1	-						GUCY1A2_uc010rvo.1_Intron|GUCY1A2_uc009yxn.1_Intron	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2						intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		GTATCAAAGGAGAAGGAAGAAGGAAAA	0.382													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	110919430	110919430	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110919430delT								ARHGAP20 (335518 upstream) : C11orf53 (207277 downstream)																							GGGCTGCTAAttttttttttt	0.229													6	3	---	---	---	---	
NCAM1	4684	broad.mit.edu	37	11	113066632	113066633	+	Intron	INS	-	GTGT	GTGT	rs147186511	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113066632_113066633insGTGT	uc009yyq.1	+						NCAM1_uc001pno.2_Intron	NM_001076682	NP_001070150	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1 isoform 3						axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		TTGTTTGCAGGgtgtgtgtgtg	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113655424	113655425	+	IGR	DEL	AT	-	-	rs142227020	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113655424_113655425delAT								CLDN25 (4217 upstream) : USP28 (13173 downstream)																							GTGGAGGAAAATATAACTTAGG	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113830346	113830346	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113830346delA								HTR3B (13064 upstream) : HTR3A (15451 downstream)																							cctgagacccaggccgctgca	0.015													4	2	---	---	---	---	
DSCAML1	57453	broad.mit.edu	37	11	117596733	117596733	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117596733delC	uc001prh.1	-						DSCAML1_uc001pri.1_Intron	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		ACATCCTCAGCCCAGGTCAGG	0.562													4	2	---	---	---	---	
PVRL1	5818	broad.mit.edu	37	11	119580231	119580231	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119580231delG	uc001pwv.2	-						PVRL1_uc001pwu.1_Intron|PVRL1_uc001pww.2_Intron	NM_002855	NP_002846	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 isoform 1						adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		CTCACTTCCAGGGGTGGAGGT	0.612													4	2	---	---	---	---	
PKNOX2	63876	broad.mit.edu	37	11	125042961	125042962	+	Intron	DEL	GC	-	-	rs140147072		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125042961_125042962delGC	uc001qbu.2	+						PKNOX2_uc010saz.1_Intron|PKNOX2_uc010sba.1_Intron|PKNOX2_uc010sbb.1_Intron	NM_022062	NP_071345	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2							nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		ctacagctaagcagtgtgcaca	0.030													3	3	---	---	---	---	
DCPS	28960	broad.mit.edu	37	11	126176711	126176711	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126176711delC	uc001qdp.2	+							NM_014026	NP_054745	Q96C86	DCPS_HUMAN	mRNA decapping enzyme						deadenylation-dependent decapping of nuclear-transcribed mRNA|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	exoribonuclease activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		GGTATGGTGACCAGACTCTCT	0.358													16	7	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126327105	126327106	+	Intron	DEL	TA	-	-	rs71048790		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126327105_126327106delTA	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		tgtgtgtgtgtatgtgtatgtg	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127462027	127462030	+	IGR	DEL	GGAA	-	-	rs56260475		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127462027_127462030delGGAA								KIRREL3 (588672 upstream) : ETS1 (866626 downstream)																							agggaaggagggaaggaaggaagg	0.000													4	4	---	---	---	---	
ETS1	2113	broad.mit.edu	37	11	128381105	128381105	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128381105delA	uc010sbs.1	-						ETS1_uc001qej.2_Intron|ETS1_uc009zch.2_Intron|ETS1_uc009zcg.2_Intron	NM_005238	NP_005229	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene						cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		CTCCTTTACTAAAAGGGGTAA	0.348													4	2	---	---	---	---	
ETS1	2113	broad.mit.edu	37	11	128422617	128422618	+	Intron	INS	-	T	T	rs137915493	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128422617_128422618insT	uc001qej.2	-							NM_001143820	NP_001137292	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene						cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		ATGGGATGGACGAGGTCTTGTG	0.470													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	128747212	128747212	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128747212delA								KCNJ1 (9944 upstream) : KCNJ5 (14101 downstream)																							aactccatctaaaaaaaaaaa	0.124													3	3	---	---	---	---	
PRDM10	56980	broad.mit.edu	37	11	129833043	129833044	+	Intron	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129833043_129833044insA	uc001qfm.2	-						PRDM10_uc001qfn.2_Intron|PRDM10_uc009zct.1_Intron	NM_020228	NP_064613	Q9NQV6	PRD10_HUMAN	PR domain containing 10 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		gactctatctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	132110250	132110250	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132110250delG	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron|NTM_uc001qgr.2_Intron	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						AAGACAGAGTGGAATCTAGCA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	60918	60919	+	IGR	INS	-	A	A	rs78462980		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60918_60919insA								None (None upstream) : LOC100288778 (13353 downstream)																							gaacctgtgtcaaaaaaaaaaa	0.010													4	3	---	---	---	---	
SLC6A12	6539	broad.mit.edu	37	12	310324	310324	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:310324delG	uc001qhz.2	-						SLC6A12_uc001qhx.2_5'Flank|SLC6A12_uc001qhy.2_5'Flank|SLC6A12_uc001qia.2_Intron|SLC6A12_uc001qib.2_Intron|SLC6A12_uc009zdh.1_Intron|SLC6A12_uc009zdi.1_Intron	NM_003044	NP_003035	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter						cellular nitrogen compound metabolic process|neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			ATGGGGTGCTGGAACTGCATG	0.512													4	2	---	---	---	---	
CACNA2D4	93589	broad.mit.edu	37	12	1966455	1966455	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1966455delC	uc001qjp.2	-						CACNA2D4_uc009zds.1_Intron|CACNA2D4_uc009zdt.1_Intron	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CAGATGACAGCTAAGCTGGGG	0.587													4	2	---	---	---	---	
CACNA1C	775	broad.mit.edu	37	12	2720634	2720634	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2720634delG	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	agatggagaagggaggGATGA	0.398													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	4041208	4041208	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4041208delT								PARP11 (58600 upstream) : CCND2 (341694 downstream)																							CCCCCCAAGATTTTTTTTTTA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5004691	5004692	+	IGR	DEL	AC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5004691_5004692delAC								KCNA6 (44414 upstream) : KCNA1 (14381 downstream)																							AGGGCAAGGAACACACACACAC	0.218													4	2	---	---	---	---	
PRB4	5545	broad.mit.edu	37	12	11219476	11219477	+	Intron	INS	-	T	T	rs138031248	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11219476_11219477insT	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qzj.2_Intron	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1						AATTTCTTTGCTTCTTTTTCTT	0.302										HNSCC(22;0.051)			2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	13474548	13474548	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13474548delT								EMP1 (104841 upstream) : C12orf36 (49475 downstream)																							GCTCTATCTCTTTTTTTTTTA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	14903094	14903096	+	IGR	DEL	CAA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14903094_14903096delCAA								GUCY2C (53575 upstream) : HIST4H4 (17838 downstream)																							aaatttccctcaatctagaattt	0.123													4	2	---	---	---	---	
PIK3C2G	5288	broad.mit.edu	37	12	18473303	18473303	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18473303delG	uc001rdt.2	+						PIK3C2G_uc010sia.1_Intron|PIK3C2G_uc010sib.1_Intron|PIK3C2G_uc010sic.1_Intron	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma						cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				ATGGGCCATAGGCATGATATT	0.318													3	3	---	---	---	---	
ST8SIA1	6489	broad.mit.edu	37	12	22391098	22391098	+	Intron	DEL	C	-	-	rs75375196		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22391098delC	uc001rfo.3	-						ST8SIA1_uc009zix.2_Intron	NM_003034	NP_003025	Q92185	SIA8A_HUMAN	alpha-2,8-sialyltransferase 1						glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(3)	3						cttgagaactccccccccaac	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	23655914	23655914	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23655914delT								ETNK1 (812307 upstream) : SOX5 (29318 downstream)																							AGCACACAGGTTTTTTTTTAA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	28926796	28926797	+	IGR	INS	-	GT	GT	rs145528269	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28926796_28926797insGT								CCDC91 (223698 upstream) : FAR2 (375435 downstream)																							tagtctgtaaggtgtgtgtgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31269805	31269806	+	Intron	INS	-	AAG	AAG	rs10650892		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31269805_31269806insAAG	uc010sjy.1	-						uc001rjy.2_Intron|uc001rjz.2_Intron					RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		CAATATTCCTCAAACTTCTCTT	0.307													4	2	---	---	---	---	
DENND5B	160518	broad.mit.edu	37	12	31548275	31548275	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31548275delC	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc009zjq.1_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2						cgcctgcaatcccagcactct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38113186	38113186	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38113186delG								None (None upstream) : ALG10B (597371 downstream)																							aacattctgagcaacttcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	47322545	47322545	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47322545delC								SLC38A4 (102765 upstream) : AMIGO2 (146946 downstream)																							cagcccagttcccaacaagcc	0.005													4	2	---	---	---	---	
VDR	7421	broad.mit.edu	37	12	48261193	48261194	+	Intron	DEL	TG	-	-	rs34151020		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48261193_48261194delTG	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	CTATGTAAGTtgtgtgtgtgtg	0.257													3	4	---	---	---	---	
VDR	7421	broad.mit.edu	37	12	48265145	48265146	+	Intron	DEL	TC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48265145_48265146delTC	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	ttctttcctttctctctctctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	50341037	50341037	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50341037delT								LOC283332 (35391 upstream) : AQP2 (3487 downstream)																							ccatcttaacttttttttttt	0.000													4	2	---	---	---	---	
DIP2B	57609	broad.mit.edu	37	12	51082441	51082442	+	Intron	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51082441_51082442insA	uc001rwv.2	+						DIP2B_uc009zlt.2_Intron	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						tctcaaaaaagaaaaaaaTACA	0.015													4	2	---	---	---	---	
KRT72	140807	broad.mit.edu	37	12	52983786	52983787	+	Intron	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52983786_52983787delTG	uc001sar.2	-						KRT72_uc001saq.2_Intron|KRT72_uc010sns.1_Intron|KRT72_uc010snt.1_Intron	NM_001146225	NP_001139697	Q14CN4	K2C72_HUMAN	keratin 72 isoform 1							keratin filament	structural molecule activity			ovary(5)|pancreas(1)	6				BRCA - Breast invasive adenocarcinoma(357;0.195)		tgtgtgtgtctgtgtgtgtgtg	0.371													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	55047068	55047069	+	IGR	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55047068_55047069delGT								DCD (4919 upstream) : MUCL1 (201230 downstream)																							atgtgtgtgcgtgtgtgtgtgt	0.421													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	57191330	57191330	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57191330delA								HSD17B6 (9756 upstream) : SDR9C7 (126289 downstream)																							ataaatacctaaatgtgaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	58730823	58730823	+	IGR	DEL	T	-	-	rs113043542		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58730823delT								XRCC6BP1 (379772 upstream) : LRIG3 (535115 downstream)																							tcctttcagcttttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	61071034	61071034	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61071034delT								SLC16A7 (895627 upstream) : None (None downstream)																							tgtattgctatttttttttta	0.000													4	2	---	---	---	---	
PTPRR	5801	broad.mit.edu	37	12	71280351	71280351	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71280351delT	uc001swi.1	-							NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R						in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		ATCATCAATATTCATTGACTA	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76235335	76235335	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76235335delA								KRR1 (329917 upstream) : PHLDA1 (183893 downstream)																							tcaagtgagcaaaataagctc	0.179													4	2	---	---	---	---	
PTPRQ	374462	broad.mit.edu	37	12	81040263	81040264	+	Intron	INS	-	G	G	rs143817505	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81040263_81040264insG	uc001sze.2	+							NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0						atcccccttgaggggtgaggga	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	88698394	88698394	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88698394delG								TMTC3 (104731 upstream) : KITLG (188175 downstream)																							tctagtatttggacatctgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	88978844	88978845	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88978844_88978845insT								KITLG (4606 upstream) : DUSP6 (762994 downstream)																							cccggcTTAGATTTTTTTTTTT	0.158													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	89517438	89517439	+	IGR	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89517438_89517439delTG								KITLG (543200 upstream) : DUSP6 (224400 downstream)																							AGATCACATTtgtgtgtgtgtg	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	91678422	91678422	+	IGR	DEL	A	-	-	rs34297879		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91678422delA								DCN (101616 upstream) : BTG1 (700444 downstream)																							accctgtttcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	92113576	92113577	+	IGR	INS	-	AGGG	AGGG			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92113576_92113577insAGGG								DCN (536770 upstream) : BTG1 (265289 downstream)																							ggatagaaggaagggagggagg	0.124													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	95183247	95183248	+	IGR	INS	-	ACCG	ACCG	rs151257972	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95183247_95183248insACCG								TMCC3 (138923 upstream) : MIR492 (44926 downstream)																							CAACATAGCATACCGCCTAGCT	0.406													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	99007086	99007087	+	IGR	INS	-	TG	TG	rs35224859		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99007086_99007087insTG								SLC25A3 (11309 upstream) : IKBIP (96 downstream)																							TGCTTCTCCTAtgtgtgtgtgt	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	105831752	105831753	+	IGR	INS	-	A	A	rs147823503	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105831752_105831753insA								C12orf75 (66457 upstream) : NUAK1 (625372 downstream)																							aaatggtcaacacttataaaat	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	106190981	106190982	+	IGR	DEL	TC	-	-	rs145953859		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106190981_106190982delTC								C12orf75 (425686 upstream) : NUAK1 (266143 downstream)																							TGATAGGTTATCTGGCAGCCAG	0.376													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	107539824	107539825	+	IGR	INS	-	T	T	rs139546706	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107539824_107539825insT								CRY1 (52226 upstream) : BTBD11 (172372 downstream)																							TTCTCCAGGTATTTTTTCCATA	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	109750596	109750597	+	IGR	DEL	TT	-	-	rs112905732		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109750596_109750597delTT								FOXN4 (3571 upstream) : MYO1H (75927 downstream)																							ttttgttttgtttttttttttt	0.386													2	4	---	---	---	---	
CUX2	23316	broad.mit.edu	37	12	111749098	111749099	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111749098_111749099insT	uc001tsa.1	+							NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						GTCATCAtttcttttttttttt	0.084													4	2	---	---	---	---	
CUX2	23316	broad.mit.edu	37	12	111766384	111766385	+	Intron	INS	-	TG	TG			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111766384_111766385insTG	uc001tsa.1	+							NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						CCAATTTCTTTtgtgtgtgtgt	0.248													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	115341586	115341587	+	IGR	DEL	TG	-	-	rs141764472		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115341586_115341587delTG								TBX3 (219617 upstream) : None (None downstream)																							tgtgtgagactgtgtgtgcatg	0.079													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	115341669	115341670	+	IGR	INS	-	GT	GT	rs139335987	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115341669_115341670insGT								TBX3 (219700 upstream) : None (None downstream)																							tgagaatgtgagtgtgtgagtg	0.000													4	4	---	---	---	---	
CIT	11113	broad.mit.edu	37	12	120223370	120223370	+	Intron	DEL	T	-	-	rs35722685		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120223370delT	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		catcccggacttttttttttt	0.000													4	2	---	---	---	---	
RNF10	9921	broad.mit.edu	37	12	121011158	121011158	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121011158delT	uc001typ.3	+						RNF10_uc010szk.1_Intron|RNF10_uc001tyq.3_Intron	NM_014868	NP_055683	Q8N5U6	RNF10_HUMAN	ring finger protein 10						negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ccatatccccttttttttccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	121074609	121074609	+	IGR	DEL	T	-	-	rs112543887		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121074609delT								POP5 (55408 upstream) : CABP1 (3813 downstream)																							ACCCTCTGCCttttttttttt	0.080													4	2	---	---	---	---	
C12orf43	64897	broad.mit.edu	37	12	121444024	121444026	+	Intron	DEL	AAG	-	-	rs144577739		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121444024_121444026delAAG	uc001tzh.1	-						C12orf43_uc009zxa.1_Intron|C12orf43_uc010szo.1_Intron|C12orf43_uc010szp.1_Intron|C12orf43_uc001tzi.1_Intron	NM_022895	NP_075046	Q96C57	CL043_HUMAN	hypothetical protein LOC64897												0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					atctcaaaaaaagaaaaaaaaaa	0.044													6	3	---	---	---	---	
RNF34	80196	broad.mit.edu	37	12	121846781	121846782	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121846781_121846782insT	uc001ual.1	+						RNF34_uc010szw.1_Intron|RNF34_uc001uak.1_Intron|RNF34_uc001uam.1_Intron	NM_025126	NP_079402	Q969K3	RNF34_HUMAN	ring finger protein 34 isoform 2						apoptosis	endomembrane system|membrane|nuclear speck	ligase activity|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)		GTGACCCtttcttttttttttt	0.203													5	3	---	---	---	---	
MLXIP	22877	broad.mit.edu	37	12	122613933	122613933	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122613933delA	uc001ubq.2	+						MLXIP_uc001ubr.2_Intron|MLXIP_uc001ubs.1_5'Flank	NM_014938	NP_055753	Q9HAP2	MLXIP_HUMAN	MLX interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial outer membrane|nucleus	DNA binding			ovary(2)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		TAGCCTGGGCAATGGCCTGCC	0.627													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	126916021	126916022	+	IGR	INS	-	A	A	rs34994714		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126916021_126916022insA								TMEM132B (772432 upstream) : LOC100128554 (11005 downstream)																							TTAAAGCCCTGAAAAAAAAAAA	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128660755	128660756	+	IGR	INS	-	T	T	rs5801780		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128660755_128660756insT								None (None upstream) : TMEM132C (238535 downstream)																							TTATATTTCCATTTTTTTTTTT	0.307													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	129334168	129334183	+	IGR	DEL	CTTCTTACTTTTATTA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129334168_129334183delCTTCTTACTTTTATTA								SLC15A4 (25627 upstream) : GLT1D1 (3898 downstream)																							tcctttctttcttcTTACTTTTATTACTTCTtttgt	0.051													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131873951	131873951	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131873951delG								LOC116437 (176476 upstream) : SFRS8 (321684 downstream)																							AGACACACATGGGGGTGAGGA	0.577													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	133047379	133047380	+	IGR	INS	-	ATATACAG	ATATACAG	rs143966760	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133047379_133047380insATATACAG								GALNT9 (141474 upstream) : FBRSL1 (19777 downstream)																							cacacacacacgagtgttattc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19320620	19320620	+	5'Flank	DEL	T	-	-	rs113823012		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19320620delT	uc001ulv.1	-											DQ586768																		taggcctcactgaccaagtcc	0.139													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	21906560	21906560	+	RNA	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21906560delT	uc001unz.1	+	3		c.2089delT								Homo sapiens cDNA FLJ33446 fis, clone BRAMY1000095.																		ATTAAAGTTGTTTCTTTGTCA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	37663055	37663056	+	IGR	INS	-	T	T	rs112023150		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37663055_37663056insT								FAM48A (29205 upstream) : CSNK1A1L (14341 downstream)																							TGAAtttttagttttttttttt	0.218													3	3	---	---	---	---	
LOC646982	646982	broad.mit.edu	37	13	41034386	41034386	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41034386delA	uc010tfa.1	-						LOC646982_uc001uxj.3_Intron|LOC646982_uc001uxk.2_Intron	NR_024507				Homo sapiens cDNA, FLJ17553.												0						attccatattaaaaaaaaaaa	0.189													4	2	---	---	---	---	
GTF2F2	2963	broad.mit.edu	37	13	45848914	45848914	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45848914delC	uc001uzw.2	+						GTF2F2_uc001uzv.2_Intron	NM_004128	NP_004119	P13984	T2FB_HUMAN	general transcription factor IIF, polypeptide 2,						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	microtubule cytoskeleton|transcription factor TFIIF complex	ATP binding|ATP-dependent helicase activity|DNA binding|protein binding				0		Lung NSC(96;0.00115)|Prostate(109;0.00578)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000647)		cctgtctccacaaaaaacaca	0.000													4	2	---	---	---	---	
WDFY2	115825	broad.mit.edu	37	13	52206680	52206680	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52206680delT	uc001vfp.2	+						WDFY2_uc010ads.1_Intron|WDFY2_uc010adt.1_Intron	NM_052950	NP_443182	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2								metal ion binding				0		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		tcccgttTGGTTTTATGCAGG	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	63609989	63609990	+	IGR	INS	-	T	T	rs149443083		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63609989_63609990insT								None (None upstream) : OR7E156P (701578 downstream)																							TGTAAAAAATCGATTGTGGTTT	0.248													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	71894421	71894421	+	IGR	DEL	T	-	-	rs66695258		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:71894421delT								None (None upstream) : DACH1 (117677 downstream)																							ATTCAAAGGCTTTTTTTTTTC	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	74005615	74005615	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74005615delT								KLF5 (353940 upstream) : KLF12 (254535 downstream)																							GTAAACTCGCttttttttttt	0.224													4	3	---	---	---	---	
LMO7	4008	broad.mit.edu	37	13	76340020	76340020	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76340020delG	uc001vjv.2	+						LMO7_uc010thv.1_Intron|LMO7_uc001vjt.1_Intron|LMO7_uc010thw.1_Intron|LMO7_uc001vju.1_Intron	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AAAAAGCCCTGGGGTCTGATT	0.443													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	81987047	81987047	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81987047delG								None (None upstream) : None (None downstream)																							gaaattttgtggtcctcactc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	84337546	84337546	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84337546delA								None (None upstream) : SLITRK1 (113798 downstream)																							tgtaatccataaatacgtaca	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	100060102	100060102	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100060102delT								UBAC2 (21351 upstream) : TM9SF2 (93626 downstream)																							CTGAAGAAGCTTTTCCTGGGG	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	104473115	104473115	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104473115delA								SLC10A2 (753919 upstream) : None (None downstream)																							ttggtctcccaaagtgctggg	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	111293683	111293684	+	IGR	INS	-	ATCG	ATCG	rs138202676	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111293683_111293684insATCG								CARKD (1343 upstream) : CARS2 (73 downstream)																							TACTTCACTCAATCGACGGTGA	0.525													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19462759	19462762	+	IGR	DEL	TCTC	-	-	rs112269645		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19462759_19462762delTCTC								OR11H12 (84187 upstream) : POTEG (90603 downstream)																							cctccctcTGTCTCTCTCtttctt	0.025													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20047744	20047747	+	IGR	DEL	AGTC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20047744_20047747delAGTC								P704P (27472 upstream) : OR4Q3 (167840 downstream)																							tccgtttcatagtcaggaacattt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20054748	20054748	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20054748delG								P704P (34476 upstream) : OR4Q3 (160839 downstream)																							ttaacatggtggcaaggcaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	27617745	27617746	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27617745_27617746insT								NOVA1 (550785 upstream) : None (None downstream)																							gttggaatttcttttttttTTC	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	29225302	29225305	+	IGR	DEL	GAAG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29225302_29225305delGAAG								None (None upstream) : FOXG1 (10982 downstream)																							agcagggaaagaaggaaggaagga	0.113													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	34564326	34564327	+	IGR	INS	-	A	A	rs71433647		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34564326_34564327insA								EGLN3 (144039 upstream) : C14orf147 (337818 downstream)																							gactccatctcaaaaaaaaaaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	35161547	35161548	+	IGR	INS	-	CA	CA	rs138885960	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35161547_35161548insCA								SNX6 (62181 upstream) : CFL2 (18040 downstream)																							CTTTCCCAAACcacacacacac	0.312													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	38413611	38413611	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38413611delC	uc001wug.2	+											Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																		tcaattatctccacctggccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	39850871	39850872	+	IGR	INS	-	TTT	TTT	rs61470617		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39850871_39850872insTTT								CTAGE5 (30476 upstream) : FBXO33 (16006 downstream)																							tttgctggctgttttttttttt	0.000													4	2	---	---	---	---	
C14orf182	283551	broad.mit.edu	37	14	50466434	50466435	+	Intron	DEL	AT	-	-	rs34478742		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50466434_50466435delAT	uc001wxi.1	-							NM_001012706	NP_001012724	A1A4T8	CN182_HUMAN	hypothetical protein LOC283551												0						TTCTCAACACATGTTTGGCCTA	0.322													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	53106973	53106974	+	IGR	INS	-	GAA	GAA	rs143391271	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53106973_53106974insGAA								GPR137C (2543 upstream) : ERO1L (1633 downstream)																							acacgaaagtggaagttagatg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	53715043	53715043	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53715043delC								DDHD1 (94997 upstream) : BMP4 (701414 downstream)																							GGCCAAACTACCCCAGTTTTC	0.259													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	55024676	55024676	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55024676delA								CGRRF1 (19344 upstream) : SAMD4A (9961 downstream)																							GTGCAGAGGGAAAAAAAAAGG	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	58115717	58115720	+	IGR	DEL	TGTT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58115717_58115720delTGTT								SLC35F4 (52102 upstream) : C14orf37 (355089 downstream)																							gcacacttgctgtttgttcacttc	0.010													4	3	---	---	---	---	
PRKCH	5583	broad.mit.edu	37	14	61994869	61994870	+	Intron	INS	-	ACAC	ACAC	rs138892396	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61994869_61994870insACAC	uc001xfn.2	+						PRKCH_uc010tsa.1_Intron|PRKCH_uc010tsb.1_Intron	NM_006255	NP_006246	P24723	KPCL_HUMAN	protein kinase C, eta						intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTATTTGTTTTacacacacaca	0.223													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	65142900	65142900	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65142900delA								C14orf50 (86804 upstream) : PLEKHG3 (28293 downstream)																							actccaactcaaaaaaaaaaG	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	66536747	66536747	+	IGR	DEL	A	-	-	rs76462479		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66536747delA								FUT8 (326786 upstream) : C14orf53 (416362 downstream)																							cccagacctcaaccacaggtg	0.070													3	3	---	---	---	---	
TMEM229B	161145	broad.mit.edu	37	14	67963367	67963368	+	Intron	DEL	TC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67963367_67963368delTC	uc001xjk.2	-						TMEM229B_uc001xjj.1_Intron	NM_182526	NP_872332	Q8NBD8	T229B_HUMAN	transmembrane protein 229B							integral to membrane				central_nervous_system(1)	1						tttctttctttctctctctctc	0.124													4	2	---	---	---	---	
SMOC1	64093	broad.mit.edu	37	14	70380173	70380174	+	Intron	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70380173_70380174delGT	uc001xls.1	+						SMOC1_uc001xlt.1_Intron	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN	secreted modular calcium-binding protein 1						cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding			upper_aerodigestive_tract(1)|pancreas(1)	2				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		atgaattggcgtgtgtgtgtgt	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	71025205	71025206	+	IGR	DEL	TG	-	-	rs28612538	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71025205_71025206delTG								ADAM20 (23473 upstream) : MED6 (25752 downstream)																							catgtatgaatgtgtgtgtgtg	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	71846019	71846019	+	IGR	DEL	T	-	-	rs79605339		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71846019delT								PCNX (263920 upstream) : SNORD56B (19035 downstream)																							tctttctttcttttttttttt	0.154													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	73079701	73079702	+	RNA	INS	-	GT	GT	rs143434829	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73079701_73079702insGT	uc010arh.1	-	1		c.102_103insAC								Homo sapiens cDNA FLJ14079 fis, clone HEMBB1002134, weakly similar to ZINC-FINGER PROTEIN NEURO-D4.																		TTAAGTAGGGCgtgtgtgtgtg	0.381													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79023170	79023170	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79023170delA	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		AGTTGATGGTAAAAAAAAAAT	0.219													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79644599	79644600	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79644599_79644600insT	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CTTACATGCAATTTTTTTAAAA	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	84275230	84275231	+	IGR	DEL	AA	-	-	rs34450492		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84275230_84275231delAA								None (None upstream) : None (None downstream)																							attccgtctcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86750435	86750440	+	IGR	DEL	ACACAC	-	-	rs34271575		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86750435_86750440delACACAC								FLRT2 (656166 upstream) : None (None downstream)																							acacacacatacacacacacacacac	0.296													3	3	---	---	---	---	
FOXN3	1112	broad.mit.edu	37	14	89913548	89913548	+	Intron	DEL	A	-	-	rs78658665		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89913548delA	uc001xxo.3	-						FOXN3_uc010atk.2_Intron|FOXN3_uc001xxp.2_Intron	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						cacaaaaaggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TTC7B	145567	broad.mit.edu	37	14	91041330	91041338	+	Intron	DEL	CCCTGGCCT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91041330_91041338delCCCTGGCCT	uc001xyp.2	-						TTC7B_uc001xyo.2_Intron|TTC7B_uc010ats.2_Intron	NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)				GACCTTCTGACCCTGGCCTCCCTGGCCTC	0.608													6	3	---	---	---	---	
TTC7B	145567	broad.mit.edu	37	14	91174103	91174103	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91174103delG	uc001xyp.2	-							NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)				attctttgaaggctgagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97085226	97085226	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97085226delA								PAPOLA (51780 upstream) : VRK1 (178458 downstream)																							ACAACCCTAGAAGAGTGGCCT	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97537263	97537264	+	IGR	INS	-	TG	TG	rs138283256	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97537263_97537264insTG								VRK1 (189313 upstream) : C14orf64 (854683 downstream)																							GGTGGGGATTTtgtgtgtgtgt	0.366													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98825682	98825685	+	IGR	DEL	TTCC	-	-	rs28563978		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98825682_98825685delTTCC								C14orf64 (381221 upstream) : C14orf177 (352265 downstream)																							ttttctttctttcctttctttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	104681942	104681942	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104681942delA								KIF26A (34708 upstream) : C14orf180 (364114 downstream)																							gtgtgtagggaggcgagtgtg	0.000													6	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106161843	106161844	+	Intron	DEL	AC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106161843_106161844delAC	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron					Parts of antibodies, mostly variable regions.												0						aagcagagagacagagagagac	0.005													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20000405	20000405	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20000405delG								None (None upstream) : GOLGA6L6 (736689 downstream)																							caaatgtccagtttcagattc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20106764	20106764	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20106764delA								None (None upstream) : GOLGA6L6 (630330 downstream)																							AAAAGGGGGGAAAGTGTAATG	0.259													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20499020	20499047	+	IGR	DEL	AGCCTAGGAGCAATAGGCTACACCATAC	-	-	rs9744824	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20499020_20499047delAGCCTAGGAGCAATAGGCTACACCATAC								None (None upstream) : GOLGA6L6 (238047 downstream)																							acaggtgtgtagcctaggagcaataggctacaccatacagcctaggtg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20527370	20527372	+	IGR	DEL	ATC	-	-	rs148807711		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20527370_20527372delATC								None (None upstream) : GOLGA6L6 (209722 downstream)																							TATCCATATTATCACTACCAAGT	0.315													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20552398	20552401	+	IGR	DEL	CTCA	-	-	rs34654161		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20552398_20552401delCTCA								None (None upstream) : GOLGA6L6 (184693 downstream)																							gagatggagtctcactcagtcgcc	0.196													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20601516	20601517	+	Intron	DEL	TG	-	-	rs113700902		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20601516_20601517delTG	uc001ytg.2	-						uc010tyx.1_Intron					RecName: Full=Putative HERC2-like protein 3;																		AAGTGCCACATGTGTTTGCAAA	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20608792	20608794	+	Intron	DEL	TTC	-	-	rs10593453		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20608792_20608794delTTC	uc001ytg.2	-						uc010tyx.1_Intron					RecName: Full=Putative HERC2-like protein 3;																		aatttgttaattcttttgtttct	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21901698	21901698	+	IGR	DEL	G	-	-	rs113614476		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21901698delG								NF1P1 (767073 upstream) : LOC646214 (30816 downstream)																							accagaaacagggggagggtc	0.114													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21907782	21907782	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21907782delG								NF1P1 (773157 upstream) : LOC646214 (24732 downstream)																							tgagggtgatggaaatagtct	0.065													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21910006	21910006	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21910006delC								NF1P1 (775381 upstream) : LOC646214 (22508 downstream)																							atgacacagaccttgtctcaa	0.095													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	24734174	24734174	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24734174delA								PWRN2 (319079 upstream) : PWRN1 (44665 downstream)																							tgccatcttgaaaaaaaaaaA	0.015													4	2	---	---	---	---	
GABRB3	2562	broad.mit.edu	37	15	26923711	26923712	+	Intron	DEL	GA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26923711_26923712delGA	uc001zaz.2	-						GABRB3_uc001zba.2_Intron|GABRB3_uc001zbb.2_Intron	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	gaatgagagtgagagagagaga	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	38190495	38190495	+	IGR	DEL	T	-	-	rs72361598		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38190495delT								MEIS2 (796995 upstream) : TMCO5A (36332 downstream)																							gccttttccattttttttttt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	40439335	40439335	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40439335delA								BMF (38260 upstream) : BUB1B (13875 downstream)																							AGGGGTGAGGAAGGCTGGTTG	0.592													4	2	---	---	---	---	
RTF1	23168	broad.mit.edu	37	15	41726823	41726823	+	Intron	DEL	T	-	-	rs142035079		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41726823delT	uc001zny.2	+							NM_015138	NP_055953	Q92541	RTF1_HUMAN	Paf1/RNA polymerase II complex component						histone modification|regulation of transcription, DNA-dependent|transcription initiation, DNA-dependent	nucleoplasm	protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		TACTAATGTCttttttttttt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	46121634	46121638	+	IGR	DEL	AAGTG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46121634_46121638delAAGTG								SQRDL (138156 upstream) : None (None downstream)																							cctggcctgaaagtggggccttact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	48658247	48658247	+	IGR	DEL	T	-	-	rs12439526	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48658247delT								DUT (22679 upstream) : FBN1 (42258 downstream)																							tgaatgaatATGGAAGATATA	0.124													4	2	---	---	---	---	
FAM81A	145773	broad.mit.edu	37	15	59743653	59743653	+	Intron	DEL	T	-	-	rs112703661		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59743653delT	uc002agc.2	+						FAM81A_uc010uha.1_Intron	NM_152450	NP_689663	Q8TBF8	FA81A_HUMAN	hypothetical protein LOC145773											ovary(1)	1						ACACCAATAAttttttttttt	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	63193188	63193189	+	IGR	INS	-	CA	CA	rs139896802	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63193188_63193189insCA								TLN2 (56361 upstream) : TPM1 (141649 downstream)																							GAAGGCAGAAGCATGGCACCAA	0.564													3	3	---	---	---	---	
DAPK2	23604	broad.mit.edu	37	15	64253053	64253054	+	Intron	INS	-	TAT	TAT			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64253053_64253054insTAT	uc002amr.2	-						DAPK2_uc010uim.1_Intron|DAPK2_uc010bgu.1_Intron	NM_014326	NP_055141	Q9UIK4	DAPK2_HUMAN	death-associated kinase 2						apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			stomach(1)|central_nervous_system(1)	2				LUAD - Lung adenocarcinoma(2;0.215)		ctgtagatgtctattaggtctg	0.000													4	2	---	---	---	---	
SMAD6	4091	broad.mit.edu	37	15	67030048	67030048	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67030048delA	uc002aqf.2	+						SMAD6_uc010bhx.2_Intron|SMAD6_uc002aqg.2_Intron	NM_005585	NP_005576	O43541	SMAD6_HUMAN	SMAD family member 6 isoform 1						BMP signaling pathway|immune response|negative regulation of apoptosis|negative regulation of BMP signaling pathway|negative regulation of caspase activity|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of SMAD protein complex assembly|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of S phase of mitotic cell cycle|response to laminar fluid shear stress|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	cytosol|transcription factor complex	co-SMAD binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity|type I activin receptor binding|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding			skin(1)	1						GAGAAAAAGGAAAAAAAAAAA	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70755379	70755394	+	IGR	DEL	ACACACACACACACAC	-	-	rs72435034		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70755379_70755394delACACACACACACACAC								TLE3 (365123 upstream) : UACA (191501 downstream)																							CATCTACAAAacacacacacacacacacacacacac	0.431													6	3	---	---	---	---	
THSD4	79875	broad.mit.edu	37	15	72068979	72068980	+	Intron	DEL	CC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72068979_72068980delCC	uc002atb.1	+						THSD4_uc002ate.2_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						cccagcaaggcccaggcagagg	0.000													4	2	---	---	---	---	
UBE2Q2	92912	broad.mit.edu	37	15	76175947	76175948	+	Intron	INS	-	T	T	rs79241469		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76175947_76175948insT	uc002bbg.2	+						UBE2Q2_uc002bbh.2_Intron|UBE2Q2_uc010umn.1_Intron|UBE2Q2_uc002bbi.2_Intron	NM_173469	NP_775740	Q8WVN8	UB2Q2_HUMAN	ubiquitin-conjugating enzyme E2Q 2 isoform 1						protein K48-linked ubiquitination	cytoplasm	ATP binding|ubiquitin-protein ligase activity			ovary(2)	2						cctggccTGCATTTTTTTTTTT	0.010													4	2	---	---	---	---	
WDR61	80349	broad.mit.edu	37	15	78585309	78585309	+	Intron	DEL	T	-	-	rs71947790		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78585309delT	uc002bdn.2	-						WDR61_uc002bdo.2_Intron|WDR61_uc010umz.1_Intron|WDR61_uc010una.1_Intron	NM_025234	NP_079510	Q9GZS3	WDR61_HUMAN	WD repeat domain 61								protein binding			ovary(1)|skin(1)	2						GACTTTAAGATTTTTTTTTTT	0.333													5	3	---	---	---	---	
AGPHD1	123688	broad.mit.edu	37	15	78828213	78828213	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78828213delC	uc010ble.2	+							NM_001083612	NP_001077081	A2RU49	AGPD1_HUMAN	aminoglycoside phosphotransferase domain							cytoplasm	kinase activity				0						gcatgtgccaccatgcccaac	0.000													4	2	---	---	---	---	
ALPK3	57538	broad.mit.edu	37	15	85357737	85357737	+	5'Flank	DEL	A	-	-	rs79304369		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85357737delA	uc002ble.2	+							NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3						heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			cctgtctcataaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	88916420	88916421	+	IGR	INS	-	AGA	AGA	rs148831649	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88916420_88916421insAGA								NTRK3 (116759 upstream) : MRPL46 (86287 downstream)																							TTAGAGCTCATAGAAGAAGGCA	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	91919388	91919389	+	IGR	DEL	GA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91919388_91919389delGA								SV2B (80740 upstream) : SLCO3A1 (477549 downstream)																							cggaagaagggagagagagaga	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92736578	92736579	+	IGR	INS	-	CCTCTG	CCTCTG	rs137914171	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92736578_92736579insCCTCTG								SLCO3A1 (20913 upstream) : ST8SIA2 (200561 downstream)																							acctggatttccctctgcctct	0.059													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	93791214	93791215	+	IGR	INS	-	T	T	rs148358191	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93791214_93791215insT								RGMA (158781 upstream) : MCTP2 (983586 downstream)																							CCTCTAGTCTGTTTTtttttta	0.198													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	95276903	95276904	+	IGR	INS	-	TG	TG	rs148025171	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95276903_95276904insTG								MCTP2 (249723 upstream) : LOC145820 (699418 downstream)																							CTTTGGTTAACTGtgtgtgtgt	0.129													4	3	---	---	---	---	
ALDH1A3	220	broad.mit.edu	37	15	101423250	101423250	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101423250delT	uc002bwn.3	+						ALDH1A3_uc010bpb.2_Intron|ALDH1A3_uc010bpa.1_Intron	NM_000693	NP_000684	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1A3						retinal metabolic process	cytoplasm	aldehyde dehydrogenase|protein homodimerization activity			central_nervous_system(2)|lung(1)|pancreas(1)	4	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		NADH(DB00157)|Vitamin A(DB00162)	CAAACAGTAATTTTTTTTGGA	0.343													4	2	---	---	---	---	
LMF1	64788	broad.mit.edu	37	16	908618	908619	+	Intron	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:908618_908619delGT	uc002ckj.2	-						LMF1_uc010brg.2_Intron|LMF1_uc010brh.2_Intron|LMF1_uc010bri.2_Intron|LMF1_uc002ckk.2_Intron	NM_022773	NP_073610	Q96S06	LMF1_HUMAN	lipase maturation factor 1							endoplasmic reticulum membrane|integral to membrane					0		Hepatocellular(780;0.00308)				GTGTGCAGTGGTGTCTCGGGAC	0.658													6	5	---	---	---	---	
CRAMP1L	57585	broad.mit.edu	37	16	1674419	1674419	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1674419delT	uc010uvh.1	+							NM_020825	NP_065876	Q96RY5	CRML_HUMAN	Crm, cramped-like							nucleus	DNA binding				0						TGGCttttgcttttttttttt	0.184													4	2	---	---	---	---	
CREBBP	1387	broad.mit.edu	37	16	3873569	3873569	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3873569delA	uc002cvv.2	-						CREBBP_uc002cvw.2_Intron	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a						cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CTCAGGACACAAAAAGCCAGG	0.502			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	6020279	6020279	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6020279delT								FAM86A (872490 upstream) : A2BP1 (48853 downstream)																							CTGGTTACTCTTTTTTTTTAT	0.343													4	2	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	6225504	6225504	+	Intron	DEL	C	-	-	rs140760220	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6225504delC	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		ttctgtaGGTCGGGGGGGTGG	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9354279	9354279	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9354279delT								C16orf72 (140734 upstream) : GRIN2A (492988 downstream)																							aggcctgaaatgtttactctc	0.154													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	10613054	10613054	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10613054delG								ATF7IP2 (35560 upstream) : EMP2 (9226 downstream)																							ttgtagagatggggcctccct	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	11320614	11320614	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11320614delT								CLEC16A (44570 upstream) : C16orf75 (22892 downstream)																							tctttctttcttttttttttt	0.020													4	2	---	---	---	---	
SNX29	92017	broad.mit.edu	37	16	12476504	12476505	+	Intron	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12476504_12476505insA	uc002dby.3	+							NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1						taaaacaacatacgtttatttg	0.015													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	17768800	17768801	+	IGR	INS	-	T	T	rs77381018		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17768800_17768801insT								XYLT1 (204062 upstream) : NOMO2 (742382 downstream)																							tgtcactcatcttttttttttt	0.000													3	3	---	---	---	---	
LOC728276	728276	broad.mit.edu	37	16	19298749	19298749	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19298749delG	uc002dga.3	+						LOC728276_uc002dfz.3_Intron	NR_024436				RecName: Full=C-type lectin domain-containing protein UNQ5810/PRO19627; Flags: Precursor;												0						ccatcacattgggagtcagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	24415651	24415651	+	IGR	DEL	A	-	-	rs36059013		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24415651delA								CACNG3 (41915 upstream) : RBBP6 (133363 downstream)																							aaagccaaggaGACAAAAGAT	0.239													2	4	---	---	---	---	
HS3ST4	9951	broad.mit.edu	37	16	26148202	26148203	+	3'UTR	DEL	CA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26148202_26148203delCA	uc002dof.2	+	2						NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		cacacccacccacacacacaca	0.406													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26315529	26315529	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26315529delA								HS3ST4 (166521 upstream) : C16orf82 (762690 downstream)																							tattagatgtaaaatactttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26711826	26711827	+	IGR	DEL	AC	-	-	rs71387737		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26711826_26711827delAC								HS3ST4 (562818 upstream) : C16orf82 (366392 downstream)																							tgaaaattatacacacacacac	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	27027783	27027785	+	IGR	DEL	CCC	-	-	rs10538188		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27027783_27027785delCCC								HS3ST4 (878775 upstream) : C16orf82 (50434 downstream)																							ctttcttcttccccttccccttc	0.015													5	3	---	---	---	---	
IL21R	50615	broad.mit.edu	37	16	27416347	27416347	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27416347delT	uc002doq.1	+						IL21R_uc002dor.1_Intron	NM_181078	NP_851564	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor precursor						natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)|lung(1)|breast(1)	4						CATGttttacttttttttttt	0.259			T	BCL6	NHL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32356128	32356128	+	IGR	DEL	A	-	-	rs144290086		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32356128delA								HERC2P4 (192254 upstream) : TP53TG3B (328713 downstream)																							agcctgtctcaaaaaaaaaaa	0.050													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32501375	32501376	+	IGR	INS	-	T	T	rs148589092	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32501375_32501376insT								HERC2P4 (337501 upstream) : TP53TG3B (183465 downstream)																							ttgtaacactgtttttttgtcc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32617358	32617358	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32617358delC								HERC2P4 (453484 upstream) : TP53TG3B (67483 downstream)																							TTCATCACCACTGCGTTTTCC	0.398													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32847247	32847247	+	IGR	DEL	T	-	-	rs112612876		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32847247delT								TP53TG3B (158369 upstream) : SLC6A10P (41550 downstream)																							ctgcttaaccttttttgattt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33238629	33238629	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33238629delT								SLC6A10P (342166 upstream) : MIR1826 (726879 downstream)																							cttggctggcttggctggctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33585502	33585502	+	IGR	DEL	C	-	-	rs113576834		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33585502delC								SLC6A10P (689039 upstream) : MIR1826 (380006 downstream)																							GTTACCCTCACCTTTTCTTCC	0.458													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33852644	33852646	+	IGR	DEL	GCC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33852644_33852646delGCC								SLC6A10P (956181 upstream) : MIR1826 (112862 downstream)																							GCGGCTTTTTGCCGCCGCCTCCG	0.660													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33892683	33892683	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33892683delG								SLC6A10P (996220 upstream) : MIR1826 (72825 downstream)																							gattccgtttgggtccattag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33901799	33901803	+	IGR	DEL	TGCTC	-	-	rs76807632		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33901799_33901803delTGCTC								None (None upstream) : MIR1826 (63705 downstream)																							cattccactgtgctctactccactc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33958177	33958177	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33958177delT								None (None upstream) : MIR1826 (7331 downstream)																							tgtgtgtctgttttttttctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33997072	33997072	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33997072delA								MIR1826 (31480 upstream) : UBE2MP1 (406730 downstream)																							tggacacatcacaaagaactt	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	35261557	35261557	+	IGR	DEL	C	-	-	rs7339451	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:35261557delC								LOC146481 (546590 upstream) : None (None downstream)																							ttgattgaggcagttttgaat	0.000													6	3	---	---	---	---	
SIAH1	6477	broad.mit.edu	37	16	48412267	48412269	+	Intron	DEL	AAC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48412267_48412269delAAC	uc002efo.1	-						SIAH1_uc002efl.2_Intron	NM_003031	NP_003022	Q8IUQ4	SIAH1_HUMAN	seven in absentia homolog 1 isoform a						axon guidance|cell cycle|neuron apoptosis|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	beta-catenin destruction complex|cytosol|nucleus	protein C-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				tttgtcacaaaacaacaacaaca	0.000													4	2	---	---	---	---	
IRX6	79190	broad.mit.edu	37	16	55361548	55361548	+	Frame_Shift_Del	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55361548delG	uc002ehy.2	+	4	997	c.464delG	c.(463-465)CGGfs	p.R155fs	IRX6_uc002ehx.2_Frame_Shift_Del_p.R155fs|IRX6_uc010ccb.1_RNA	NM_024335	NP_077311	P78412	IRX6_HUMAN	iroquois homeobox protein 6	155	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(1)	6						AACGCGACCCGGGAGACCACC	0.562													14	12	---	---	---	---	
GNAO1	2775	broad.mit.edu	37	16	56322945	56322946	+	Intron	INS	-	G	G	rs60893469		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56322945_56322946insG	uc002eit.3	+						GNAO1_uc002eiu.3_Intron	NM_138736	NP_620073	P09471	GNAO_HUMAN	guanine nucleotide binding protein, alpha						dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity			lung(1)|breast(1)	2		all_neural(199;0.159)				TATCCAAAAAAGGGGGGGGGAG	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	60261403	60261404	+	IGR	DEL	TC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60261403_60261404delTC								None (None upstream) : None (None downstream)																							cctctttctttctctctctctc	0.050													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	62304032	62304033	+	IGR	DEL	AC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62304032_62304033delAC								CDH8 (233996 upstream) : None (None downstream)																							TGTCTTCCTAACACTGTTTTTT	0.292													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	65283596	65283599	+	IGR	DEL	AAGT	-	-	rs140006855		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65283596_65283599delAAGT								CDH11 (127677 upstream) : LOC283867 (34803 downstream)																							ACAGGAGTTAAAGTAAGAGAGTTA	0.471													3	4	---	---	---	---	
TMCO7	79613	broad.mit.edu	37	16	68951148	68951148	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68951148delT	uc002ewi.3	+							NM_024562	NP_078838	Q9C0B7	TMCO7_HUMAN	transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)		tgattgcccattttttggtgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	74437886	74437886	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74437886delG								LOC283922 (35733 upstream) : CLEC18B (4645 downstream)																							aaaactagctgggtgtggtgg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	79788296	79788297	+	IGR	INS	-	T	T	rs149842698	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79788296_79788297insT								MAF (153674 upstream) : DYNLRB2 (786557 downstream)																							TGTACCATGCCTTTTTTTTCTT	0.213													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	80604007	80604008	+	5'Flank	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80604007_80604008insA	uc002ffr.1	-											Homo sapiens cDNA FLJ25790 fis, clone TST06909.																		ggttgagacccaaaaaaataat	0.124													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85456190	85456190	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85456190delA								FAM92B (310076 upstream) : KIAA0182 (188839 downstream)																							tggCCAAAAGAAAAAAAAAAA	0.433													4	2	---	---	---	---	
RTN4RL1	146760	broad.mit.edu	37	17	1902752	1902753	+	Intron	DEL	AC	-	-	rs67530047		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1902752_1902753delAC	uc002ftp.2	-							NM_178568	NP_848663	Q86UN2	R4RL1_HUMAN	reticulon 4 receptor-like 1 precursor						axon regeneration	anchored to plasma membrane	receptor activity				0						aaaaaataaaacacacacacac	0.218													6	3	---	---	---	---	
CAMKK1	84254	broad.mit.edu	37	17	3765057	3765058	+	3'UTR	INS	-	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3765057_3765058insC	uc002fwt.2	-	16					CAMKK1_uc002fwu.2_3'UTR	NM_172206	NP_757343	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase 1						synaptic transmission	cytosol|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)	1				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		TGGGCAGGGTACCCCCCTCTCC	0.649													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	4649998	4649998	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4649998delC								ZMYND15 (588 upstream) : TM4SF5 (25189 downstream)																							CAGTGAAAGGCCCCAGCCACC	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	8174468	8174469	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8174468_8174469insA								PFAS (660 upstream) : SLC25A35 (16613 downstream)																							CGTGGATTTTGAAGGGGGAGCA	0.460													4	2	---	---	---	---	
GAS7	8522	broad.mit.edu	37	17	9884540	9884541	+	Intron	INS	-	A	A	rs140766391	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9884540_9884541insA	uc002gmg.1	-						GAS7_uc010vvd.1_Intron|GAS7_uc002gmi.2_Intron|GAS7_uc002gmj.1_Intron|GAS7_uc010coh.1_Intron	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						acccagaaggggaggttgcagt	0.000			T	MLL	AML*								4	2	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11647151	11647151	+	Intron	DEL	T	-	-	rs113809412		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11647151delT	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CTTGGCTGCAttttttttttt	0.154													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	12156549	12156550	+	IGR	DEL	AG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12156549_12156550delAG								MAP2K4 (109499 upstream) : MYOCD (412657 downstream)																							ACGGTGAAGCAGAGAGAGAGAG	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	13380030	13380031	+	IGR	DEL	GT	-	-	rs35966709		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13380030_13380031delGT								ELAC2 (458671 upstream) : HS3ST3A1 (18975 downstream)																							CACTTCAGGGgtgtgtgtgtgt	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	15675410	15675417	+	IGR	DEL	TTGGTTGG	-	-	rs59831365	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15675410_15675417delTTGGTTGG								TBC1D26 (25930 upstream) : MEIS3P1 (14747 downstream)																							gtttgtttgtttggttggttggttggtt	0.029													4	2	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21317801	21317801	+	Intron	DEL	G	-	-	rs148369818		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21317801delG	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	aagaaaaaaagaaagaaaaga	0.214										Prostate(3;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21886548	21886548	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21886548delG								FAM27L (60045 upstream) : FLJ36000 (17514 downstream)																							CAGAACTTCAGTAGCTTAAGA	0.363													5	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	22214098	22214099	+	IGR	DEL	TC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22214098_22214099delTC								FLJ36000 (301028 upstream) : None (None downstream)																							TTCTTCACCTTCTACATCAGGA	0.530													4	2	---	---	---	---	
NOS2	4843	broad.mit.edu	37	17	26115222	26115223	+	Intron	INS	-	CACA	CACA	rs138491079	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26115222_26115223insCACA	uc002gzu.2	-						NOS2_uc010crh.1_Intron|NOS2_uc010wab.1_Intron	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A						arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	Gcacacgcgtgcacacacacac	0.347													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	29957464	29957465	+	IGR	INS	-	G	G	rs150952760	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29957464_29957465insG								MIR365-2 (54924 upstream) : C17orf79 (221420 downstream)																							TGTCCTTCCTCGTCCCCAGTGC	0.485													5	3	---	---	---	---	
RFFL	117584	broad.mit.edu	37	17	33351435	33351435	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33351435delA	uc002hin.1	-						RFFL_uc002hiq.2_Intron|RFFL_uc002him.1_Intron|RFFL_uc010cti.1_Intron|RFFL_uc002hip.1_Intron|RFFL_uc002hio.1_Intron	NM_001017368	NP_001017368	Q8WZ73	RFFL_HUMAN	rififylin						apoptosis	membrane	ligase activity|zinc ion binding				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CTCCAAGCATAACCTCATCCT	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	34179802	34179802	+	IGR	DEL	T	-	-	rs74810165		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34179802delT								TAF15 (5565 upstream) : C17orf66 (2158 downstream)																							CTGAGACCAGTGGGTGTCTTT	0.333													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	37157975	37157975	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37157975delC								FBXO47 (34320 upstream) : PLXDC1 (61581 downstream)																							gccttggcctcccaaagtgct	0.114													4	2	---	---	---	---	
IKZF3	22806	broad.mit.edu	37	17	37931458	37931458	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37931458delA	uc002hsu.2	-						IKZF3_uc002htd.2_Intron|IKZF3_uc010cwd.2_Intron|IKZF3_uc002hsv.2_Intron|IKZF3_uc010cwe.2_Intron|IKZF3_uc010cwf.2_Intron|IKZF3_uc010cwg.2_Intron|IKZF3_uc002hsw.2_Intron|IKZF3_uc002hsx.2_Intron|IKZF3_uc002hsy.2_Intron|IKZF3_uc002hsz.2_Intron|IKZF3_uc002hta.2_Intron|IKZF3_uc002htb.2_Intron|IKZF3_uc010cwh.2_Intron|IKZF3_uc002htc.2_Intron|IKZF3_uc010wel.1_Intron	NM_012481	NP_036613	Q9UKT9	IKZF3_HUMAN	aiolos isoform 1						B cell activation|mesoderm development|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)|kidney(2)|skin(2)	6	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			ACAACTTACGAAAAAAAAAAA	0.234													4	2	---	---	---	---	
ETV4	2118	broad.mit.edu	37	17	41619319	41619319	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41619319delG	uc002idw.2	-						ETV4_uc010wih.1_Intron|ETV4_uc010czh.2_Intron|ETV4_uc010wii.1_Intron|ETV4_uc002idx.2_Intron|ETV4_uc010wij.1_Intron|ETV4_uc002idy.1_Intron	NM_001986	NP_001977	P43268	ETV4_HUMAN	ets variant gene 4 (E1A enhancer binding						positive regulation of transcription, DNA-dependent	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/ETV4(6)	bone(4)|soft_tissue(2)|ovary(1)	7		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0798)		ACATGCACTCGGACGCATATT	0.517			T	EWSR1|TMPRSS2|DDX5|KLK2|CANT1	Ewing sarcoma|Prostate carcinoma								4	2	---	---	---	---	
KIAA1267	284058	broad.mit.edu	37	17	44294837	44294837	+	Intron	DEL	A	-	-	rs34158594		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44294837delA	uc010dav.2	-							NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				gagagactctaaaaaaaaaaa	0.000													4	2	---	---	---	---	
KIAA1267	284058	broad.mit.edu	37	17	44298363	44298363	+	Intron	DEL	T	-	-	rs72473631		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44298363delT	uc010dav.2	-							NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				cCTAAAGATCTTTTTTTtttt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48210269	48210270	+	IGR	INS	-	T	T	rs78474874		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48210269_48210270insT								SAMD14 (3102 upstream) : PPP1R9B (832 downstream)																							cctgggggtgctgccactcatc	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	54175800	54175801	+	IGR	DEL	CG	-	-	rs71974439		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54175800_54175801delCG								PCTP (321053 upstream) : ANKFN1 (55035 downstream)																							cacacacacacgcgcgcgcaca	0.114													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	56251128	56251128	+	IGR	DEL	T	-	-	rs77409282		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56251128delT								OR4D2 (3189 upstream) : EPX (18994 downstream)																							cttttaaaacttttttttttg	0.000													4	2	---	---	---	---	
NACA2	342538	broad.mit.edu	37	17	59670602	59670602	+	5'Flank	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59670602delA	uc002izj.2	-							NM_199290	NP_954984	Q9H009	NACA2_HUMAN	nascent-polypeptide-associated complex alpha						protein transport	cytoplasm|nucleus				ovary(1)	1	all_epithelial(1;3.12e-14)					ctctgtctcgaaaaaaaaaaa	0.015													4	2	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60541353	60541353	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60541353delT	uc002izx.3	+									Q86UE8	TLK2_HUMAN	SubName: Full=Putative uncharacterized protein TLK1; Flags: Fragment;						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						CTCATCTGCATTTCTTCTCTT	0.458													4	2	---	---	---	---	
TCAM1P	146771	broad.mit.edu	37	17	61936362	61936362	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61936362delC	uc002jcf.2	+							NR_002947				Homo sapiens TCAM-1 pseudogene mRNA for testicular cell adhesion molecule 1.												0						GCCTCTGAAGCCCCTCTGGTA	0.403													1	6	---	---	---	---	
RGS9	8787	broad.mit.edu	37	17	63187486	63187486	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63187486delT	uc002jfe.2	+						RGS9_uc010dem.2_Intron|RGS9_uc002jfd.2_Intron|RGS9_uc002jff.2_Intron|RGS9_uc002jfg.2_Intron	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1						intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						TGTGAACCAGTTTTTTTTTTT	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	63483311	63483311	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63483311delC								RGS9 (259492 upstream) : AXIN2 (41374 downstream)																							atggccacctccctcaacttg	0.015													1	7	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	63711186	63711186	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63711186delG	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron|CCDC46_uc002jfk.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			TTAGGGTAATGGTAACAGAAA	0.448													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	66231975	66231976	+	IGR	DEL	TT	-	-	rs72439805		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66231975_66231976delTT								LOC440461 (35539 upstream) : AMZ2 (12169 downstream)																							AAAATCTTACtttttttttttt	0.297													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68579522	68579523	+	IGR	INS	-	T	T	rs139250747	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68579522_68579523insT								KCNJ2 (403341 upstream) : None (None downstream)																							AGCAACAGCCCTTTTTTTTTAC	0.332													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72095153	72095154	+	IGR	DEL	CA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72095153_72095154delCA								C17orf54 (270477 upstream) : RPL38 (104641 downstream)																							cacacatttgcacacacacacG	0.248													6	6	---	---	---	---	
RAB37	326624	broad.mit.edu	37	17	72729648	72729648	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72729648delG	uc010dfu.2	+						RAB37_uc002jlc.2_Intron|RAB37_uc002jld.2_Intron	NM_175738	NP_783865	Q96AX2	RAB37_HUMAN	RAB37, member RAS oncogene family isoform 3						protein transport|small GTPase mediated signal transduction	ER-Golgi intermediate compartment	GTP binding			ovary(1)	1						tgaggtgtgtgtggtgaggtg	0.025													3	3	---	---	---	---	
SLC16A5	9121	broad.mit.edu	37	17	73099269	73099269	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73099269delC	uc002jmr.2	+						SLC16A5_uc002jms.1_Intron|SLC16A5_uc002jmt.2_Intron|SLC16A5_uc002jmu.2_Intron|SLC16A5_uc010wrt.1_Intron	NM_004695	NP_004686	O15375	MOT6_HUMAN	solute carrier family 16, member 5						organic anion transport	integral to plasma membrane|membrane fraction	secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	caggtgtgagccaccgctccc	0.000													4	2	---	---	---	---	
SEPT9	10801	broad.mit.edu	37	17	75481141	75481141	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75481141delG	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron|SEPT9_uc002jtv.2_Intron|SEPT9_uc002jtw.2_Intron|SEPT9_uc010wtl.1_Intron|SEPT9_uc002jty.3_Intron|SEPT9_uc010wtm.1_Intron|SEPT9_uc010wtn.1_Intron|SEPT9_uc010dhd.2_Intron	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)			tgattgtggtggtggtaatgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75579493	75579493	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75579493delC								SEPT9 (82817 upstream) : FLJ45079 (295616 downstream)																							GTAATTTAggccgggcgcggt	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75803209	75803209	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75803209delA								SEPT9 (306533 upstream) : FLJ45079 (71900 downstream)																							TCACACTTACAAAAAAAAAAA	0.333													4	2	---	---	---	---	
CYTH1	9267	broad.mit.edu	37	17	76780981	76780981	+	5'Flank	DEL	T	-	-	rs113887674		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76780981delT	uc002jvw.2	-							NM_017456	NP_059430	Q15438	CYH1_HUMAN	cytohesin 1 isoform 2						regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						TGATCAGAGAttttttttttt	0.224													3	4	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77197549	77197550	+	Intron	INS	-	C	C	rs145600699	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77197549_77197550insC	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			GGGCTAGGGAGCCCTCCTGGGC	0.574													4	3	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77400739	77400740	+	Intron	INS	-	C	C	rs147736108	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77400739_77400740insC	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			CCTCCTCACCACCCCTGTGGGT	0.644													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	77693945	77693946	+	IGR	INS	-	TTCA	TTCA	rs112342341		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77693945_77693946insTTCA								HRNBP3 (215265 upstream) : ENPP7 (10936 downstream)																							gcattcatcccttcattcattc	0.431													4	2	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78904268	78904268	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78904268delC	uc002jyt.1	+						RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						cccagctcatccccagctcat	0.139													5	3	---	---	---	---	
TBCD	6904	broad.mit.edu	37	17	80878413	80878414	+	Intron	DEL	TT	-	-	rs3214869		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80878413_80878414delTT	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kgb.1_Intron	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GCGTCTATCCTTTTTTTTTTTT	0.441													4	3	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	4265545	4265548	+	Intron	DEL	CCTT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4265545_4265548delCCTT	uc010wyz.1	-							NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				ccttccctccccttccttccttcc	0.000													4	2	---	---	---	---	
LAMA1	284217	broad.mit.edu	37	18	7067857	7067857	+	Intron	DEL	T	-	-	rs66727418		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7067857delT	uc002knm.2	-						LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCTTTTCGCAttttttttttt	0.279													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	9457283	9457285	+	IGR	DEL	AGG	-	-	rs66542513		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9457283_9457285delAGG								TWSG1 (54866 upstream) : RALBP1 (17722 downstream)																							tgacttgcaaaggaggagatcac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11609423	11609425	+	IGR	DEL	AAG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11609423_11609425delAAG								FAM38B (907444 upstream) : GNAL (79711 downstream)																							caaaaaaaaaaagaaagaaaGAA	0.241													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15404526	15404526	+	IGR	DEL	A	-	-	rs138925969		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15404526delA								LOC644669 (78608 upstream) : None (None downstream)																							ctgcaagtggaactttggagc	0.000													5	3	---	---	---	---	
GATA6	2627	broad.mit.edu	37	18	19761882	19761882	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19761882delT	uc002ktt.1	+						GATA6_uc002ktu.1_Intron	NM_005257	NP_005248	Q92908	GATA6_HUMAN	GATA binding protein 6						blood coagulation|cardiac vascular smooth muscle cell differentiation|cellular response to hypoxia|intestinal epithelial cell differentiation|male gonad development|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor-beta1 production|negative regulation of transforming growth factor-beta2 production|outflow tract septum morphogenesis|positive regulation of angiogenesis|positive regulation of cell cycle arrest|positive regulation of transcription from RNA polymerase II promoter|response to drug|response to growth factor stimulus		protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(3)	3	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			gTAGTAACTGTTTTTAAAAAT	0.139													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	21070885	21070885	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21070885delA								RIOK3 (7788 upstream) : C18orf8 (12577 downstream)																							gacctttgtcaaaaatgagtt	0.000													4	2	---	---	---	---	
C18orf34	374864	broad.mit.edu	37	18	30977072	30977073	+	Intron	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30977072_30977073insA	uc002kxn.2	-						C18orf34_uc010xbr.1_Intron|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Intron|C18orf34_uc002kxp.2_Intron	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1											ovary(1)	1						ATATGTGACAGAAAAAAGAGAT	0.312													15	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	35384104	35384104	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35384104delT								CELF4 (238104 upstream) : None (None downstream)																							tccctcagcatttgcttgtct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	35808501	35808501	+	IGR	DEL	G	-	-	rs112176630		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35808501delG								CELF4 (662501 upstream) : LOC647946 (978387 downstream)																							aagagagggaggggggaggga	0.030													3	4	---	---	---	---	
RIT2	6014	broad.mit.edu	37	18	40387757	40387758	+	Intron	DEL	TG	-	-	rs111994266		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40387757_40387758delTG	uc002lav.2	-						RIT2_uc010dnf.2_Intron	NM_002930	NP_002921	Q99578	RIT2_HUMAN	Ras-like without CAAX 2						nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			ovary(1)	1						ACAAAGTGAAtgtgtgtgtgtg	0.302													4	2	---	---	---	---	
KIAA0427	9811	broad.mit.edu	37	18	46124091	46124091	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46124091delT	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						caatgaagccttttttcttta	0.100													4	2	---	---	---	---	
KIAA0427	9811	broad.mit.edu	37	18	46199799	46199800	+	Intron	INS	-	TTG	TTG	rs141450882	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46199799_46199800insTTG	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						CTGAGACACATTTGTTGTTGTT	0.327													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	46500291	46500292	+	IGR	INS	-	AC	AC	rs111695929		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46500291_46500292insAC								SMAD7 (23210 upstream) : DYM (69880 downstream)																							cacacacacaaacacacacaca	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	47823607	47823607	+	IGR	DEL	A	-	-	rs143466162	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47823607delA								CXXC1 (8915 upstream) : SKA1 (77785 downstream)																							agaaggaaggaaaggaaggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	49746329	49746332	+	IGR	DEL	CACA	-	-	rs113740003		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49746329_49746332delCACA								None (None upstream) : DCC (120239 downstream)																							CATGTGCATGcacacacacacaca	0.265													6	3	---	---	---	---	
SEC11C	90701	broad.mit.edu	37	18	56814910	56814910	+	Intron	DEL	C	-	-	rs111885977		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56814910delC	uc002lht.2	+						SEC11C_uc010dpo.1_Intron|SEC11C_uc010xej.1_Intron	NM_033280	NP_150596	Q9BY50	SC11C_HUMAN	SEC11-like 3						energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	endoplasmic reticulum membrane|integral to membrane|microsome	serine-type peptidase activity				0		Colorectal(73;0.175)				gtgaaggggaccgtagggctg	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	60056865	60056866	+	IGR	INS	-	C	C	rs140103617	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60056865_60056866insC								TNFRSF11A (3363 upstream) : ZCCHC2 (133792 downstream)																							CCTCCCTCTTACCCAGTTATCC	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	60651843	60651843	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60651843delT								PHLPP1 (4178 upstream) : BCL2 (138736 downstream)																							TCTAAGGTGGTTTTTTTTTTC	0.393													4	2	---	---	---	---	
BCL2	596	broad.mit.edu	37	18	60859978	60859978	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60859978delT	uc002lit.1	-						BCL2_uc002liu.1_Intron	NM_000633	NP_000624	P10415	BCL2_HUMAN	B-cell lymphoma protein 2 alpha isoform						activation of pro-apoptotic gene products|anti-apoptosis|apoptosis in response to endoplasmic reticulum stress|B cell proliferation|B cell receptor signaling pathway|defense response to virus|female pregnancy|humoral immune response|induction of apoptosis by intracellular signals|negative regulation of cellular pH reduction|negative regulation of mitochondrial depolarization|negative regulation of neuron apoptosis|neuron apoptosis|positive regulation of B cell proliferation|positive regulation of cell growth|protein polyubiquitination|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|regulation of transmembrane transporter activity|release of cytochrome c from mitochondria|response to cytokine stimulus|response to DNA damage stimulus|response to drug|response to iron ion|response to nicotine|response to toxin	endoplasmic reticulum membrane|mitochondrial outer membrane|nuclear membrane|pore complex	BH3 domain binding|channel activity|protease binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|ubiquitin protein ligase binding			central_nervous_system(1)	1		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Fludarabine(DB01073)|Melatonin(DB01065)|Paclitaxel(DB01229)|Rasagiline(DB01367)	CCTTCACCCCTGCCCCAGCAT	0.512			T	IGH@	NHL|CLL								5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	61054596	61054596	+	IGR	DEL	T	-	-	rs68164873		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61054596delT								KDSR (20090 upstream) : VPS4B (1831 downstream)																							agtattttccttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	64864800	64864800	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64864800delT								CDH19 (593584 upstream) : DSEL (309019 downstream)																							tcttcttttcttttttttttt	0.035													4	2	---	---	---	---	
RTTN	25914	broad.mit.edu	37	18	67842519	67842519	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67842519delA	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron|RTTN_uc002lkq.1_Intron	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				TAGGAAAAAGAAAAGTACTAG	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	70127656	70127657	+	IGR	DEL	GT	-	-	rs113381414		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70127656_70127657delGT								None (None upstream) : CBLN2 (76258 downstream)																							TCTGTGAGGGgtgtgtgtgtgt	0.401													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	73670459	73670460	+	IGR	DEL	TG	-	-	rs112280399		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73670459_73670460delTG								C18orf62 (530870 upstream) : ZNF516 (401159 downstream)																							ggtgtgtgcatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	74499987	74499988	+	IGR	DEL	AA	-	-	rs72051512		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74499987_74499988delAA								LOC284276 (228204 upstream) : ZNF236 (36128 downstream)																							gtgctgactcaaagagtgagca	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76004209	76004210	+	IGR	DEL	CA	-	-	rs147563115	byFrequency	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76004209_76004210delCA								None (None upstream) : SALL3 (736065 downstream)																							cacacacgcgcacacacacaca	0.416													4	2	---	---	---	---	
ATP9B	374868	broad.mit.edu	37	18	77114648	77114649	+	Intron	INS	-	A	A	rs142362545	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77114648_77114649insA	uc002lmx.2	+						ATP9B_uc002lmw.1_Intron|ATP9B_uc002lmz.1_Intron|ATP9B_uc002lna.2_Intron|ATP9B_uc002lnb.1_Intron|ATP9B_uc010drb.2_Intron	NM_198531	NP_940933	O43861	ATP9B_HUMAN	ATPase, class II, type 9B						ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		ggaggtgaggtagatgggttcc	0.351													3	5	---	---	---	---	
CTDP1	9150	broad.mit.edu	37	18	77444926	77444927	+	Intron	DEL	GG	-	-	rs113059721		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77444926_77444927delGG	uc002lnh.1	+						CTDP1_uc002lni.1_Intron|CTDP1_uc010drd.1_Intron	NM_004715	NP_004706	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,						positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CTGGTGAGGAGGACGGTGCAGG	0.589													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	480958	480970	+	IGR	DEL	GGGAAGGATGATG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:480958_480970delGGGAAGGATGATG								ODF3L2 (5975 upstream) : MADCAM1 (15520 downstream)																							gaaggaatgtgggaaggatgatggggaaggatg	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	481338	481338	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:481338delG								ODF3L2 (6355 upstream) : MADCAM1 (15152 downstream)																							ggatgatggagaaggatgatg	0.095													9	4	---	---	---	---	
BTBD2	55643	broad.mit.edu	37	19	1990666	1990676	+	Intron	DEL	CCCGCCGAGGC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1990666_1990676delCCCGCCGAGGC	uc002lup.1	-						BTBD2_uc002luo.1_Intron	NM_017797	NP_060267	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2							cytoplasmic mRNA processing body	protein binding			ovary(1)|skin(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCGGACCCTCCCGCCGAGGCCCCGCTGGGA	0.635													4	3	---	---	---	---	
NFIC	4782	broad.mit.edu	37	19	3370479	3370482	+	Intron	DEL	CTCT	-	-	rs67863049		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3370479_3370482delCTCT	uc010xhi.1	+						NFIC_uc002lxo.2_Intron|NFIC_uc010xhh.1_Intron|NFIC_uc002lxp.2_Intron|NFIC_uc010xhj.1_Intron	NM_205843	NP_995315	P08651	NFIC_HUMAN	nuclear factor I/C isoform 2						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		CAGCGTtctcctctctctctctct	0.245													4	2	---	---	---	---	
FUT5	2527	broad.mit.edu	37	19	5885322	5885323	+	Intron	DEL	AA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5885322_5885323delAA	uc010duo.2	-							NM_002034	NP_002025	Q11128	FUT5_HUMAN	fucosyltransferase 5						L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						actccgtctcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
C3	718	broad.mit.edu	37	19	6719772	6719772	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6719772delC	uc002mfm.2	-							NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor						complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		CCCACACATGCCCCAAACCCT	0.517													4	2	---	---	---	---	
ARHGEF18	23370	broad.mit.edu	37	19	7515239	7515239	+	Intron	DEL	C	-	-	rs75324578		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7515239delC	uc002mgi.2	+						ARHGEF18_uc010xjm.1_Intron|ARHGEF18_uc002mgh.2_Intron|ARHGEF18_uc002mgj.1_Intron	NM_001130955	NP_001124427	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor 18						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)				GATGTTAATGCGGGATCTTGC	0.433													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	10596546	10596546	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10596546delA								PDE4A (16239 upstream) : KEAP1 (250 downstream)																							actccatctcaaaaaaaaaaa	0.005													4	2	---	---	---	---	
ELAVL3	1995	broad.mit.edu	37	19	11566921	11566921	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11566921delT	uc002mry.1	-						ELAVL3_uc002mrx.1_Intron	NM_001420	NP_001411	Q14576	ELAV3_HUMAN	ELAV-like protein 3 isoform 1						cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)|skin(1)	3						TCACCCCttcttttttttttt	0.169													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13743428	13743429	+	IGR	INS	-	T	T	rs34972233		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13743428_13743429insT								CACNA1A (126154 upstream) : CCDC130 (99145 downstream)																							tccttccttccttTTTTTTTTT	0.020													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13955914	13955915	+	IGR	DEL	CA	-	-	rs111729007		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13955914_13955915delCA								MIR23A (8441 upstream) : MIR181C (29598 downstream)																							AATGGCATGGcacacacacaca	0.312													6	3	---	---	---	---	
EPS15L1	58513	broad.mit.edu	37	19	16533782	16533782	+	Intron	DEL	G	-	-	rs72566759		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16533782delG	uc002ndz.1	-						EPS15L1_uc002ndx.2_Intron|EPS15L1_uc002ndy.2_Intron|EPS15L1_uc010xpe.1_Intron|EPS15L1_uc010xpf.1_Intron|EPS15L1_uc002nea.1_Intron|EPS15L1_uc010eah.1_Intron|EPS15L1_uc002neb.1_Intron|EPS15L1_uc002nec.1_Intron	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway						endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5						gaaaaaaaaaGGGGGGGGGGA	0.254													3	3	---	---	---	---	
C19orf44	84167	broad.mit.edu	37	19	16615415	16615415	+	Intron	DEL	T	-	-	rs11340318		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16615415delT	uc002neh.1	+						MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Intron|C19orf44_uc002neg.2_Intron|C19orf44_uc010eai.1_Intron	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167												0						CTTCTGTCTGttttttttttt	0.254													6	8	---	---	---	---	
MED26	9441	broad.mit.edu	37	19	16654077	16654077	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16654077delT	uc002nee.2	-						CHERP_uc002nei.1_5'Flank|CHERP_uc002nej.2_5'Flank	NM_004831		O95402	MED26_HUMAN	mediator complex subunit 26						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|RNA polymerase II transcription cofactor activity|transcription coactivator activity			ovary(2)	2						CCTTTATCCGTtttttttttt	0.254													4	2	---	---	---	---	
ELL	8178	broad.mit.edu	37	19	18592376	18592376	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18592376delC	uc002njh.2	-						ELL_uc010ebq.2_Intron	NM_006532	NP_006523	P55199	ELL_HUMAN	elongation factor RNA polymerase II						positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding			lung(1)	1				GBM - Glioblastoma multiforme(1328;7.81e-07)		agggtaacctccccatctcaa	0.000			T	MLL	AL								4	2	---	---	---	---	
ZNF429	353088	broad.mit.edu	37	19	21718930	21718935	+	Intron	DEL	TTATAT	-	-	rs10605319		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21718930_21718935delTTATAT	uc002nqd.1	+						ZNF429_uc010ecu.1_Intron	NM_001001415	NP_001001415	Q86V71	ZN429_HUMAN	zinc finger protein 429						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						TATGTCTTTGTTATATTTATATGTTT	0.291													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24362994	24362995	+	IGR	INS	-	AG	AG	rs148884296	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24362994_24362995insAG								LOC100101266 (16745 upstream) : None (None downstream)																							caggaggaaaaagaaggaaagg	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29076646	29076646	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29076646delA	uc002nsa.1	-											Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																		CTCCCTCCATAACCTCCTGTT	0.502													4	2	---	---	---	---	
PEPD	5184	broad.mit.edu	37	19	33976172	33976172	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33976172delG	uc002nur.3	-						PEPD_uc010xrr.1_Intron|PEPD_uc010xrs.1_Intron	NM_000285	NP_000276	P12955	PEPD_HUMAN	prolidase isoform 1						cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity			ovary(2)	2	Esophageal squamous(110;0.137)					ggccgaggcaggtgaatcacc	0.114													5	3	---	---	---	---	
FXYD5	53827	broad.mit.edu	37	19	35647433	35647433	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35647433delC	uc002nyg.1	+						FXYD5_uc010xsq.1_Intron|FXYD5_uc002nyh.1_Intron	NM_014164	NP_054883	Q96DB9	FXYD5_HUMAN	FXYD domain-containing ion transport regulator 5						microvillus assembly|negative regulation of calcium-dependent cell-cell adhesion	integral to membrane	actin binding|cadherin binding|ion channel activity				0	all_lung(56;9.4e-09)|Lung NSC(56;1.4e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.75e-22)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;7.07e-19)|LUSC - Lung squamous cell carcinoma(66;0.0221)			tcagggagggcctcactgagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35962566	35962567	+	IGR	INS	-	A	A	rs74172738		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35962566_35962567insA								FFAR2 (19899 upstream) : KRTDAP (15663 downstream)																							cagcccgggggacagagcgaga	0.000													4	2	---	---	---	---	
ZNF461	92283	broad.mit.edu	37	19	37137008	37137022	+	Intron	DEL	TTGTTGTTGTTGTTA	-	-	rs141622020		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37137008_37137022delTTGTTGTTGTTGTTA	uc002oem.2	-						ZNF461_uc002oen.2_Intron|ZNF461_uc010xtj.1_Intron	NM_153257	NP_694989	Q8TAF7	ZN461_HUMAN	gonadotropin inducible transcription repressor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			Tttgttgttgttgttgttgttgttattgttgttgt	0.014													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	37516266	37516268	+	IGR	DEL	TGT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37516266_37516268delTGT								ZNF568 (27432 upstream) : ZNF420 (53114 downstream)																							TAAAGTTAACTGTTGTTGTTTTT	0.325													6	4	---	---	---	---	
MAP4K1	11184	broad.mit.edu	37	19	39106023	39106025	+	Intron	DEL	ACA	-	-	rs145574893		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39106023_39106025delACA	uc002oix.1	-						MAP4K1_uc002oiy.1_Intron|MAP4K1_uc010xug.1_5'Flank	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			aaggaaaggcacagagacagaga	0.010													2	4	---	---	---	---	
CAPN12	147968	broad.mit.edu	37	19	39221212	39221212	+	3'UTR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39221212delC	uc002ojd.1	-	21					CAPN12_uc010egd.1_3'UTR|CAPN12_uc002ojc.1_3'UTR	NM_144691	NP_653292	Q6ZSI9	CAN12_HUMAN	calpain 12						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CTGTGTCTGTCCTCCACCTTC	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	40069900	40069901	+	IGR	INS	-	TGTT	TGTT	rs139365448	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40069900_40069901insTGTT								EID2 (39062 upstream) : LGALS13 (23268 downstream)																							atttggctctctgtctatcatt	0.000													4	2	---	---	---	---	
EGLN2	112398	broad.mit.edu	37	19	41310081	41310081	+	Intron	DEL	C	-	-	rs3832341		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41310081delC	uc010ehd.2	+						EGLN2_uc002opg.3_Intron|EGLN2_uc002oph.2_Intron|EGLN2_uc002opi.2_Intron	NM_080732	NP_542770	Q96KS0	EGLN2_HUMAN	EGL nine (C.elegans) homolog 2						cell redox homeostasis|estrogen receptor signaling pathway|positive regulation of protein catabolic process|regulation of cell growth|response to hypoxia	cytoplasm|nucleus	ferrous iron binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|oxygen sensor activity			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	GCAGTGCACTCCAGTCTGCAG	0.617													4	2	---	---	---	---	
CYP2A7	1549	broad.mit.edu	37	19	41466234	41466235	+	Intron	DEL	TC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41466234_41466235delTC	uc002opo.2	-							NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			ttctctctcttctctctctctc	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42684656	42684657	+	IGR	DEL	AG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42684656_42684657delAG								POU2F2 (48026 upstream) : DEDD2 (18095 downstream)																							CGTGTACAATAGACCTAGGAGG	0.396													4	2	---	---	---	---	
KCNN4	3783	broad.mit.edu	37	19	44271442	44271443	+	Intron	DEL	AG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44271442_44271443delAG	uc002oxl.2	-						KCNN4_uc010eiz.2_Intron	NM_002250	NP_002241	O15554	KCNN4_HUMAN	intermediate conductance calcium-activated						defense response	voltage-gated potassium channel complex	calcium-activated potassium channel activity|calmodulin binding			ovary(2)	2		Prostate(69;0.0352)			Clotrimazole(DB00257)|Halothane(DB01159)|Quinine(DB00468)	CAGGACAGGCAGAGAGAGAGAG	0.594													4	2	---	---	---	---	
ZNF235	9310	broad.mit.edu	37	19	44794362	44794362	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44794362delC	uc002oza.3	-						ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF235_uc002ozb.3_Intron|ZNF235_uc010xwx.1_Intron	NM_004234	NP_004225	Q14590	ZN235_HUMAN	zinc finger protein 93 homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)	3		Prostate(69;0.0352)|all_neural(266;0.116)				ACCAGTCCAGCCCAGCCAAGA	0.522													4	2	---	---	---	---	
EML2	24139	broad.mit.edu	37	19	46144655	46144656	+	5'Flank	INS	-	GACCT	GACCT	rs138124478	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46144655_46144656insGACCT	uc002pcn.2	-						EML2_uc002pco.2_5'Flank|EML2_uc002pcp.2_5'Flank|EML2_uc010xxl.1_Intron|EML2_uc010xxm.1_Intron|EML2_uc010xxn.1_Intron|EML2_uc010xxo.1_5'Flank|EML2_uc010ekj.2_5'Flank|uc002pcr.1_5'Flank|MIR330_hsa-mir-330|MI0000803_5'Flank|uc010ekl.2_3'UTR|uc002pcs.2_5'Flank	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like						sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		CTCACCCAGTAGACCTGACCGT	0.554													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	46846757	46846757	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46846757delT								HIF3A (68 upstream) : PPP5C (3537 downstream)																							GCTGAGTGTCTTTTTTTTTtt	0.289													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	46895565	46895565	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46895565delC								PPP5C (1462 upstream) : CCDC8 (18022 downstream)																							CTTGGCCGTGCAGGGCGCACC	0.428													4	2	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50277437	50277437	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50277437delG	uc002ppn.2	+						AP2A1_uc010enj.1_Intron|AP2A1_uc002ppo.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		GTTTCCAGCTGGTTATTGTGT	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	51912569	51912569	+	IGR	DEL	T	-	-	rs67647982		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51912569delT								LIM2 (21359 upstream) : SIGLEC10 (707 downstream)																							CTATCTAGTCttttttttttt	0.065													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54532847	54532848	+	IGR	INS	-	T	T	rs149032239	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54532847_54532848insT								CACNG6 (16929 upstream) : VSTM1 (11237 downstream)																							aaatctctttcttttttttttg	0.000													4	2	---	---	---	---	
NLRP13	126204	broad.mit.edu	37	19	56443864	56443865	+	5'Flank	INS	-	TTTTTG	TTTTTG	rs145915426	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56443864_56443865insTTTTTG	uc010ygg.1	-							NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing								ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		AGTACACttttttgttgttgtt	0.188													18	32	---	---	---	---	
NLRP5	126206	broad.mit.edu	37	19	56528869	56528870	+	Intron	INS	-	C	C			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56528869_56528870insC	uc002qmj.2	+						NLRP5_uc002qmi.2_Intron	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5							mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		agtatttaattcccttttgttt	0.000													4	29	---	---	---	---	
NLRP5	126206	broad.mit.edu	37	19	56531052	56531053	+	Intron	DEL	AT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56531052_56531053delAT	uc002qmj.2	+						NLRP5_uc002qmi.2_Intron	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5							mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GATGTTAAACATATGGCCAAGA	0.267													31	18	---	---	---	---	
ZNF667	63934	broad.mit.edu	37	19	56969367	56969367	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56969367delC	uc002qnd.2	-						ZNF667_uc010etl.2_Intron|ZNF667_uc002qne.2_Intron|ZNF667_uc010etm.2_Intron	NM_022103	NP_071386	Q5HYK9	ZN667_HUMAN	zinc finger protein 667						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		gcagtcctcaccagacaccga	0.000													4	2	---	---	---	---	
ZNF835	90485	broad.mit.edu	37	19	57180098	57180099	+	Intron	INS	-	ACAGA	ACAGA	rs141479825	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57180098_57180099insACAGA	uc010ygo.1	-						ZNF835_uc010ygn.1_Intron	NM_001005850	NP_001005850			zinc finger protein 835											pancreas(3)|skin(1)	4						ggtggggctggacagagcaact	0.054													4	2	---	---	---	---	
PTPRA	5786	broad.mit.edu	37	20	3005542	3005542	+	Intron	DEL	C	-	-	rs11087562		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3005542delC	uc010zqd.1	+						PTPRA_uc002whj.2_Intron|PTPRA_uc002whk.2_Intron|PTPRA_uc002whl.2_Intron|PTPRA_uc002whm.2_Intron|PTPRA_uc002whn.2_Intron|PTPRA_uc002who.2_Intron	NM_002836	NP_002827	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A						axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1						GCAGTtttttctgtaagagcc	0.219													4	3	---	---	---	---	
RNF24	11237	broad.mit.edu	37	20	3995386	3995387	+	Intron	INS	-	CA	CA	rs146278311	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3995386_3995387insCA	uc002wkh.2	-						RNF24_uc002wki.2_Intron|RNF24_uc002wkj.2_Intron	NM_007219	NP_009150	Q9Y225	RNF24_HUMAN	ring finger protein 24 isoform 1							Golgi membrane|integral to membrane	zinc ion binding				0						ACTTGAATGCGcacacacacac	0.366													5	4	---	---	---	---	
ADRA1D	146	broad.mit.edu	37	20	4232001	4232001	+	5'Flank	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4232001delA	uc002wkr.2	-							NM_000678	NP_000669	P25100	ADA1D_HUMAN	alpha-1D-adrenergic receptor						cell proliferation|cell-cell signaling|DNA metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|multicellular organismal development|positive regulation of cell proliferation	integral to plasma membrane	alpha1-adrenergic receptor activity				0					Alfuzosin(DB00346)|Bethanidine(DB00217)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Doxazosin(DB00590)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Methotrimeprazine(DB01403)|Norepinephrine(DB00368)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)	TGGTCGTCATAAGGTCTGCAA	0.493													4	2	---	---	---	---	
CDS2	8760	broad.mit.edu	37	20	5165665	5165666	+	Intron	DEL	GG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5165665_5165666delGG	uc002wls.2	+						CDS2_uc002wlr.1_Intron|CDS2_uc010zqt.1_Intron|CDS2_uc002wlu.2_Intron|CDS2_uc010zqu.1_Intron|CDS2_uc002wlv.2_Intron|CDS2_uc010zqv.1_Intron	NM_003818	NP_003809	O95674	CDS2_HUMAN	phosphatidate cytidylyltransferase 2						phospholipid biosynthetic process	integral to membrane|mitochondrial inner membrane	phosphatidate cytidylyltransferase activity				0						AGATCAGCCTGGCAGACAGAAG	0.436													25	12	---	---	---	---	
CRLS1	54675	broad.mit.edu	37	20	6002982	6002982	+	Intron	DEL	T	-	-	rs71334377		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6002982delT	uc002wmn.3	+						CRLS1_uc010gbq.2_Intron|CRLS1_uc010gbr.2_Intron	NM_019095	NP_061968	Q9UJA2	CRLS1_HUMAN	cardiolipin synthase 1 isoform 1						phospholipid biosynthetic process	integral to membrane|mitochondrial inner membrane	phosphotransferase activity, for other substituted phosphate groups				0						aatccattgcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	6044049	6044049	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6044049delG								LRRN4 (9355 upstream) : FERMT1 (11444 downstream)																							ctggaattcaggggagagctg	0.030													4	2	---	---	---	---	
SNAP25	6616	broad.mit.edu	37	20	10287451	10287452	+	3'UTR	DEL	AC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10287451_10287452delAC	uc002wnq.1	+	8					SNAP25_uc002wnr.1_3'UTR|SNAP25_uc002wns.1_3'UTR|SNAP25_uc010gca.1_3'UTR|SNAP25_uc010gcb.1_3'UTR|SNAP25_uc010gcc.1_3'UTR	NM_130811	NP_570824	P60880	SNP25_HUMAN	synaptosomal-associated protein 25 isoform						energy reserve metabolic process|glutamate secretion|neurotransmitter uptake|synaptic vesicle docking involved in exocytosis	cell junction|growth cone|perinuclear region of cytoplasm|synapse|synaptosome				skin(2)	2					Botulinum Toxin Type A(DB00083)	TGATGAGACAACACACACACAC	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	11176503	11176504	+	IGR	DEL	CA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11176503_11176504delCA								JAG1 (521809 upstream) : BTBD3 (694973 downstream)																							CATGTGCGAGCACACACACACA	0.272													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12771578	12771578	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12771578delA								BTBD3 (864336 upstream) : SPTLC3 (218049 downstream)																							atctggtgagaaacttcttgc	0.000													4	2	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	14083490	14083490	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14083490delT	uc002wou.2	+						MACROD2_uc002wot.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GGGGAAGAACTTTTTTTTTTG	0.338													4	2	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15279096	15279097	+	Intron	DEL	AG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15279096_15279097delAG	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				AATGGAAGCAAGAGAGAGAGAG	0.475													4	2	---	---	---	---	
KIF16B	55614	broad.mit.edu	37	20	16362861	16362861	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16362861delG	uc002wpg.1	-						KIF16B_uc002wpe.1_5'Flank|KIF16B_uc002wpf.1_5'Flank|KIF16B_uc010gch.1_Intron|KIF16B_uc010gci.1_Intron|KIF16B_uc010gcj.1_Intron	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23						cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						AGGAATATCAGGAGAAAAGCA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	17827042	17827043	+	IGR	INS	-	C	C	rs138284371	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17827042_17827043insC								BANF2 (110525 upstream) : SNX5 (95203 downstream)																							ccctgagctctccccgcctctg	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19814744	19814744	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19814744delA								SLC24A3 (111204 upstream) : RIN2 (55466 downstream)																							TAGTGTGTGTAATGGTTATGG	0.478													4	2	---	---	---	---	
PYGB	5834	broad.mit.edu	37	20	25266356	25266358	+	Intron	DEL	GTG	-	-	rs150320283		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25266356_25266358delGTG	uc002wup.2	+							NM_002862	NP_002853	P11216	PYGB_HUMAN	brain glycogen phosphorylase						glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					Pyridoxal Phosphate(DB00114)	gcatgtacctgtgGTGGACCTGC	0.113													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25741199	25741199	+	IGR	DEL	A	-	-	rs113857342		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25741199delA								ZNF337 (63730 upstream) : FAM182B (2903 downstream)																							ttggatttgtaaggttaagta	0.114													4	4	---	---	---	---	
FAM182B	728882	broad.mit.edu	37	20	25756137	25756137	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25756137delC	uc010zth.1	-						FAM182B_uc002wvd.1_Intron|FAM182B_uc002wve.2_Intron|FAM182B_uc010zti.1_Intron	NR_027061				Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0						TTTTTTTTAACCACTGGCAAT	0.308													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25867976	25867976	+	IGR	DEL	G	-	-	rs111513763		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25867976delG								FAM182B (19190 upstream) : LOC100134868 (122459 downstream)																							TTGCTCCTCAGGAGCTCCCCG	0.517													9	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25868168	25868171	+	IGR	DEL	AAAG	-	-	rs138714192		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25868168_25868171delAAAG								FAM182B (19382 upstream) : LOC100134868 (122264 downstream)																							CACAAAAAAAAAAGGAAACATAGA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25906763	25906763	+	IGR	DEL	A	-	-	rs2386759		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25906763delA								FAM182B (57977 upstream) : LOC100134868 (83672 downstream)																							TCAGAATAACATTTTTTTTGC	0.289													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25909148	25909149	+	IGR	DEL	TG	-	-	rs28749330	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25909148_25909149delTG								FAM182B (60362 upstream) : LOC100134868 (81286 downstream)																							ccactttttttgttttttaaga	0.000													9	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26083084	26083084	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26083084delC								FAM182A (15532 upstream) : C20orf191 (969 downstream)																							tctgctttttctgatatttgg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26298342	26298343	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26298342_26298343insT								MIR663 (109428 upstream) : None (None downstream)																							gcctatggtgaaaaggaaatat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29481053	29481053	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29481053delA								None (None upstream) : FRG1B (130826 downstream)																							aagaagtctcaaaagatctga	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29587725	29587725	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29587725delT								None (None upstream) : FRG1B (24154 downstream)																							gttttttaaatttccctttca	0.000													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29588041	29588042	+	IGR	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29588041_29588042delTG								None (None upstream) : FRG1B (23837 downstream)																							aaagactgactgtattatttct	0.000													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29647745	29647745	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29647745delC	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						ggaaggaaggcagagagggaa	0.000													6	4	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29648450	29648450	+	Intron	DEL	T	-	-	rs143554592		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29648450delT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						cagaactccctctcctgtttt	0.000													6	4	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29648657	29648657	+	Intron	DEL	T	-	-	rs71221959		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29648657delT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						attaaaaaaatttatagaagt	0.000													8	5	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29650821	29650821	+	Intron	DEL	T	-	-	rs73620399		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29650821delT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						tgtagaggtcttttgtctctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31458666	31458667	+	Intron	DEL	TT	-	-	rs72266480		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31458666_31458667delTT	uc010zub.1	+							NM_001143967	NP_001137439			EF-hand calcium binding domain 8																		Cttcttcttctttttttttttt	0.074													5	3	---	---	---	---	
RALY	22913	broad.mit.edu	37	20	32649134	32649134	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32649134delA	uc002xab.2	+						RALY_uc010zui.1_Intron|RALY_uc002xac.2_Intron|RALY_uc002xad.2_Intron|RALY_uc002xae.1_Intron	NM_016732	NP_057951	Q9UKM9	RALY_HUMAN	RNA binding protein (autoantigenic,							catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(1)	1						GAGAGACAAGAAAAGGAAAAA	0.383													4	2	---	---	---	---	
PIGU	128869	broad.mit.edu	37	20	33267951	33267951	+	5'Flank	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33267951delA	uc002xas.2	-						PIGU_uc010zul.1_5'Flank|PIGU_uc002xat.2_5'Flank|PIGU_uc010gev.1_5'Flank	NM_080476	NP_536724	Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0						accttgcctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
EDEM2	55741	broad.mit.edu	37	20	33774756	33774756	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33774756delA	uc010zuv.1	-							NM_018217	NP_060687	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00936)			actctgtctcaaaaaaaaaaa	0.159													4	2	---	---	---	---	
CEP250	11190	broad.mit.edu	37	20	34049215	34049216	+	Intron	INS	-	TCT	TCT	rs144048444	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34049215_34049216insTCT	uc002xcm.2	+						CEP250_uc010zve.1_Intron|CEP250_uc010gfe.1_Intron|CEP250_uc010zvd.1_Intron	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2						centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			acacccagaactctttaccacc	0.302													5	4	---	---	---	---	
DLGAP4	22839	broad.mit.edu	37	20	35076850	35076850	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35076850delT	uc002xff.2	+						DLGAP4_uc010zvp.1_Intron	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a						cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				ggcaagctagttcgccttcct	0.104													4	2	---	---	---	---	
VSTM2L	128434	broad.mit.edu	37	20	36564453	36564454	+	Intron	INS	-	T	T	rs72002474		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36564453_36564454insT	uc002xhk.3	+							NM_080607	NP_542174	Q96N03	VTM2L_HUMAN	V-set and transmembrane domain containing 2 like											ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				tacctagctaattttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37885921	37885921	+	IGR	DEL	T	-	-	rs111349867		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37885921delT								LOC339568 (32530 upstream) : None (None downstream)																							catttttgtattttttttttt	0.164													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	39535318	39535319	+	IGR	INS	-	A	A	rs79870177		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39535318_39535319insA								MAFB (217442 upstream) : TOP1 (122143 downstream)																							cctttctctacaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	39639037	39639037	+	Intron	DEL	T	-	-	rs11086795		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39639037delT	uc002xjj.2	+						uc002xjk.2_Intron					Homo sapiens cDNA FLJ10978 fis, clone PLACE1001484.																		caaacaaggaTTTTTTTTTAT	0.124													4	2	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	40788777	40788778	+	Intron	INS	-	A	A	rs74791151		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40788777_40788778insA	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron|PTPRT_uc010ggi.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGCATGTGAAGAAAAAAAAAAG	0.277													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	42921165	42921169	+	IGR	DEL	AGAGG	-	-	rs72113476		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42921165_42921169delAGAGG								GDAP1L1 (12154 upstream) : FITM2 (14028 downstream)																							gagagagaaaagaggagaggagagg	0.044													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	43787978	43787979	+	IGR	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43787978_43787979insA								WFDC12 (34872 upstream) : PI3 (15561 downstream)																							taagccaaaggaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	43854032	43854033	+	IGR	DEL	AA	-	-	rs71339832		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43854032_43854033delAA								SEMG2 (934 upstream) : SLPI (26846 downstream)																							agaaagaaagaaagagaaagaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	44729909	44729909	+	IGR	DEL	T	-	-	rs67533692		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44729909delT								NCOA5 (11329 upstream) : CD40 (16997 downstream)																							CATAGATGCATTTTTTTTTTT	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	45480696	45480699	+	IGR	DEL	TGAA	-	-	rs113813578		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45480696_45480699delTGAA								SLC2A10 (115713 upstream) : EYA2 (42564 downstream)																							AACATTTTTCtgaatgaatgaatg	0.412													6	3	---	---	---	---	
ZMYND8	23613	broad.mit.edu	37	20	45866060	45866060	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45866060delT	uc002xta.1	-						ZMYND8_uc010ghq.1_Intron|ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xsr.1_Intron	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			agttttttgcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	47031019	47031023	+	IGR	DEL	TTTTG	-	-	rs141495579		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47031019_47031023delTTTTG								LOC284749 (31638 upstream) : PREX1 (209770 downstream)																							ttgttttgttttttgttttgttttg	0.078													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48236206	48236207	+	IGR	INS	-	GGAT	GGAT	rs141199932	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48236206_48236207insGGAT								PTGIS (51499 upstream) : B4GALT5 (13278 downstream)																							atagatggatgggatggatgga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48916104	48916105	+	Intron	INS	-	A	A			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48916104_48916105insA	uc002xvk.2	+											Homo sapiens cDNA FLJ33286 fis, clone ASTRO2014174.																		ctctgCAGGTTAAAAAAAAAAA	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	52158588	52158589	+	IGR	INS	-	A	A	rs150281076	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52158588_52158589insA								TSHZ2 (54623 upstream) : ZNF217 (25023 downstream)																							GATGTTTTTCCaaaaaaaatat	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54077016	54077017	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54077016_54077017insT								DOK5 (809307 upstream) : CBLN4 (495480 downstream)																							attcttgtgtcttttctagtag	0.104													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56527026	56527026	+	IGR	DEL	A	-	-	rs73628145		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56527026delA								PMEPA1 (240485 upstream) : C20orf85 (198957 downstream)																							TACAACTCCTAAAAAAAAAAT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56771904	56771907	+	IGR	DEL	ACAG	-	-	rs76713246		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56771904_56771907delACAG								C20orf85 (35723 upstream) : PPP4R1L (34282 downstream)																							acagacacacacagacacacacac	0.093													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58840632	58840633	+	Intron	INS	-	T	T	rs143872229	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58840632_58840633insT	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																		ATTCTCCTGCCTTTTTTTTGTC	0.431													4	2	---	---	---	---	
EEF1A2	1917	broad.mit.edu	37	20	62123710	62123713	+	Intron	DEL	GATG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62123710_62123713delGATG	uc002yfd.1	-						EEF1A2_uc002yfe.1_Intron|EEF1A2_uc010gkg.1_Intron	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha							nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			tgggtcaatagatggatggataga	0.000													4	2	---	---	---	---	
SRMS	6725	broad.mit.edu	37	20	62175342	62175343	+	Intron	INS	-	AGTG	AGTG	rs149440921	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62175342_62175343insAGTG	uc002yfi.1	-							NM_080823	NP_543013	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory								ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(1)|lung(1)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			atgagtgaattagtgaggaatg	0.069													2	5	---	---	---	---	
GMEB2	26205	broad.mit.edu	37	20	62248331	62248332	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62248331_62248332insT	uc002yfp.1	-						GMEB2_uc002yfq.1_Intron	NM_012384	NP_036516	Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding				0	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			ccttctggtggttttttttttt	0.000													4	2	---	---	---	---	
DNAJC5	80331	broad.mit.edu	37	20	62553139	62553139	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62553139delT	uc002yhf.2	+						DNAJC5_uc002yhg.1_Intron|DNAJC5_uc002yhh.2_Intron	NM_025219	NP_079495	Q9H3Z4	DNJC5_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5						neurotransmitter secretion|protein folding	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|melanosome|plasma membrane	heat shock protein binding|unfolded protein binding			pancreas(1)	1	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					cccttgaaagttttttttttg	0.229													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9577625	9577627	+	IGR	DEL	AAT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9577625_9577627delAAT								None (None upstream) : None (None downstream)																							attctaagacaataagtttatgt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9832163	9832165	+	IGR	DEL	TTG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9832163_9832165delTTG								None (None upstream) : None (None downstream)																							tttagtatacttgttgttgtgca	0.118													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9841261	9841261	+	IGR	DEL	G	-	-	rs80192786	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9841261delG								None (None upstream) : None (None downstream)																							TTCCCTGGACGTGAAGAGATT	0.403													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9845623	9845630	+	IGR	DEL	CTCCTGAG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9845623_9845630delCTCCTGAG								None (None upstream) : None (None downstream)																							gaataaaagcctcctgaggcctcaccag	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9856378	9856380	+	IGR	DEL	CTC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9856378_9856380delCTC								None (None upstream) : None (None downstream)																							CCTCTGCCTTCTCCTCCAGGGCA	0.581													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10137113	10137113	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10137113delT								None (None upstream) : TPTE (769630 downstream)																							tttgctgaagttttttttatc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10517531	10517531	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10517531delA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		ctaaaaatacaaaaaattagc	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10606360	10606360	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10606360delG								None (None upstream) : TPTE (300383 downstream)																							AGTGTTCACTGGGGGCCTAGT	0.572													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10745377	10745379	+	IGR	DEL	TCT	-	-	rs143093237		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10745377_10745379delTCT								None (None upstream) : TPTE (161364 downstream)																							aatctgaaaatcttctctctgat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10782495	10782495	+	IGR	DEL	A	-	-	rs148563094		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10782495delA								None (None upstream) : TPTE (124248 downstream)																							gaatggattgaaatggaatgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10810211	10810225	+	IGR	DEL	AATCAAATGGAATGC	-	-	rs28684921		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10810211_10810225delAATCAAATGGAATGC								None (None upstream) : TPTE (96518 downstream)																							gatgaaatggaatcaaatggaatgcaatcaaatgg	0.000													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10815001	10815010	+	IGR	DEL	GAATGGAATG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10815001_10815010delGAATGGAATG								None (None upstream) : TPTE (91733 downstream)																							aaatgtactcgaatggaatggaatggaatg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10830986	10831005	+	IGR	DEL	GAACGGAATGGAATGTACTT	-	-	rs57093114		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10830986_10831005delGAACGGAATGGAATGTACTT								None (None upstream) : TPTE (75738 downstream)																							gaatggaatggaacggaatggaatgtacttgaatggaatg	0.000													7	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11061063	11061066	+	Intron	DEL	TGGC	-	-	rs143743126		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11061063_11061066delTGGC	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gtaggcatggtggctggcatgcac	0.000													5	7	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11063202	11063206	+	Intron	DEL	TAAAC	-	-	rs139717610		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11063202_11063206delTAAAC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		aaacagaatttaaactaaaaagcag	0.020													3	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11068516	11068516	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11068516delA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAATTGAAGCAAAAACAATAA	0.239													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11114232	11114232	+	IGR	DEL	T	-	-	rs71914052		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11114232delT								BAGE (15295 upstream) : None (None downstream)																							aaaaaaaaaaTATCACAGTCA	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11149249	11149249	+	IGR	DEL	C	-	-	rs55718578		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11149249delC								BAGE (50312 upstream) : None (None downstream)																							tcactgcaagctctgcctcct	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11184758	11184759	+	IGR	INS	-	A	A	rs138233859		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11184758_11184759insA								BAGE (85821 upstream) : None (None downstream)																							tctcaaaaaacaaaaaacaaaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	21527045	21527046	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21527045_21527046insT								None (None upstream) : C21orf131 (587868 downstream)																							TCACATCGCTGTTTTTTTTTTT	0.381													4	2	---	---	---	---	
JAM2	58494	broad.mit.edu	37	21	27053142	27053144	+	Intron	DEL	AGG	-	-	rs66489024		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27053142_27053144delAGG	uc002ylp.1	+						JAM2_uc011ace.1_Intron|JAM2_uc002ylq.1_Intron|JAM2_uc011acf.1_Intron|JAM2_uc010glh.1_Intron|JAM2_uc002ylr.1_Intron|JAM2_uc010gli.1_Intron	NM_021219	NP_067042	P57087	JAM2_HUMAN	junctional adhesion molecule 2 precursor						blood coagulation|cell-cell adhesion|leukocyte migration	integral to plasma membrane|tight junction					0						gggcagaacaaggaggaggaaga	0.000													3	4	---	---	---	---	
APP	351	broad.mit.edu	37	21	27259086	27259087	+	Intron	INS	-	C	C	rs146774801	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27259086_27259087insC	uc002ylz.2	-						APP_uc011acg.1_Intron|APP_uc010glk.2_Intron|APP_uc002yma.2_Intron|APP_uc011ach.1_Intron|APP_uc002ymb.2_Intron|APP_uc010glj.2_Intron|APP_uc011aci.1_Intron	NM_000484	NP_000475	P05067	A4_HUMAN	amyloid beta A4 protein isoform a precursor						adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		Breast(209;0.00295)				TAGGTTCTGCACCCCCCCTCAC	0.431													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	29750105	29750106	+	IGR	INS	-	A	A	rs146291711	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29750105_29750106insA								C21orf94 (354577 upstream) : NCRNA00161 (161534 downstream)																							ATAGCTTTATTGCCCCTGGAAA	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	36091896	36091897	+	IGR	DEL	AC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36091896_36091897delAC								CLIC6 (1377 upstream) : NCRNA00160 (4208 downstream)																							TTCCTTAAGAACACAGAATGTC	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	37477954	37477955	+	Intron	DEL	AG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37477954_37477955delAG	uc011aea.1	-											Homo sapiens cDNA FLJ59082 complete cds.																		aaagagaggcagagagagagag	0.000													4	2	---	---	---	---	
KCNJ15	3772	broad.mit.edu	37	21	39630927	39630928	+	Intron	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39630927_39630928delGT	uc002ywv.2	+						KCNJ15_uc002yww.2_Intron	NM_002243	NP_002234	Q99712	IRK15_HUMAN	potassium inwardly-rectifying channel J15						synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity			ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	6						TTCTTGGGGCgtgtgtgtgtgt	0.351													4	3	---	---	---	---	
B3GALT5	10317	broad.mit.edu	37	21	41000448	41000448	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41000448delA	uc002yyb.1	+						B3GALT5_uc002yyf.1_Intron|B3GALT5_uc002yye.2_Intron|B3GALT5_uc002yyg.1_5'Flank|B3GALT5_uc010gol.1_5'Flank	NM_033173	NP_149363	Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta						protein glycosylation	endoplasmic reticulum|Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			skin(1)	1		Prostate(19;2.55e-06)				CTTGTAGCACAAAACGGTGCC	0.343													4	2	---	---	---	---	
DSCAM	1826	broad.mit.edu	37	21	41442322	41442326	+	Intron	DEL	GAAAA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41442322_41442326delGAAAA	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				aggaaggaaggaaaagaaaagaaaa	0.083													4	2	---	---	---	---	
BACE2	25825	broad.mit.edu	37	21	42558024	42558025	+	Intron	INS	-	AA	AA			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42558024_42558025insAA	uc002yyw.2	+						BACE2_uc002yyx.2_Intron|BACE2_uc002yyy.2_Intron|PLAC4_uc002yyz.2_5'Flank	NM_012105	NP_036237	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2 isoform A						membrane protein ectodomain proteolysis|negative regulation of amyloid precursor protein biosynthetic process|peptide hormone processing	cell surface|endoplasmic reticulum|endosome|Golgi apparatus|integral to membrane	aspartic-type endopeptidase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				gaccgcttagccaaaggctttt	0.000													4	2	---	---	---	---	
FAM3B	54097	broad.mit.edu	37	21	42686690	42686690	+	5'Flank	DEL	A	-	-	rs111426952		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42686690delA	uc002yzb.1	+						FAM3B_uc002yza.2_Intron|FAM3B_uc002yzc.1_5'Flank|FAM3B_uc011aeq.1_Intron	NM_058186	NP_478066	P58499	FAM3B_HUMAN	family with sequence similarity 3, member B						apoptosis|insulin secretion	extracellular space	cytokine activity				0		Prostate(19;1.57e-07)|all_epithelial(19;0.0404)				ggctactattaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	42933996	42933996	+	IGR	DEL	A	-	-	rs71752596		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42933996delA								TMPRSS2 (30953 upstream) : NCRNA00111 (165466 downstream)																							AAAATAAACTAAAAAAAAAAA	0.438													4	2	---	---	---	---	
PDE9A	5152	broad.mit.edu	37	21	44145283	44145283	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44145283delC	uc002zbm.2	+						PDE9A_uc002zbn.2_Intron|PDE9A_uc002zbo.2_Intron|PDE9A_uc002zbp.2_Intron|PDE9A_uc002zbq.2_Intron|PDE9A_uc002zbs.2_Intron|PDE9A_uc002zbr.2_Intron|PDE9A_uc002zbt.2_Intron|PDE9A_uc002zbu.2_Intron|PDE9A_uc002zbv.2_Intron|PDE9A_uc002zbw.2_Intron|PDE9A_uc002zbx.2_Intron|PDE9A_uc002zby.2_Intron|PDE9A_uc002zbz.2_Intron|PDE9A_uc002zca.2_Intron|PDE9A_uc002zcb.2_Intron|PDE9A_uc002zcc.2_Intron|PDE9A_uc002zcd.2_Intron|PDE9A_uc002zce.2_Intron|PDE9A_uc002zcf.2_Intron|PDE9A_uc002zcg.2_Intron	NM_002606	NP_002597	O76083	PDE9A_HUMAN	phosphodiesterase 9A isoform a						platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|skin(1)	2						cacgctgcttcccttccattc	0.000													4	3	---	---	---	---	
PDXK	8566	broad.mit.edu	37	21	45170664	45170665	+	Intron	INS	-	GT	GT	rs142693057	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45170664_45170665insGT	uc002zdm.3	+						PDXK_uc010gpj.2_Intron|PDXK_uc002zdn.3_Intron|PDXK_uc002zdq.3_Intron	NM_003681	NP_003672	O00764	PDXK_HUMAN	pyridoxal kinase						cell proliferation|pyridoxal 5'-phosphate salvage	cytosol	ATP binding|lithium ion binding|magnesium ion binding|potassium ion binding|protein homodimerization activity|pyridoxal kinase activity|pyridoxal phosphate binding|sodium ion binding|zinc ion binding				0				Colorectal(79;0.109)|READ - Rectum adenocarcinoma(84;0.161)|STAD - Stomach adenocarcinoma(101;0.18)	Pyridoxal(DB00147)|Pyridoxine(DB00165)	attgtgtgtgggtgtgtgtgtg	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	46649221	46649221	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46649221delA								ADARB1 (2743 upstream) : POFUT2 (34623 downstream)																							GACCACATGGAAAAGGAGAGG	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	47555409	47555410	+	IGR	DEL	CA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47555409_47555410delCA								COL6A2 (2646 upstream) : FTCD (767 downstream)																							AGTGTCCCCTCACAAATGTCCC	0.535													5	3	---	---	---	---	
POTEH	23784	broad.mit.edu	37	22	16285195	16285196	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16285195_16285196insT	uc010gqp.2	-						POTEH_uc002zlg.1_Intron|POTEH_uc002zlh.1_Intron|POTEH_uc002zlj.1_Intron	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3											skin(1)	1						gtatttcatgcttttttttttt	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16407346	16407346	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16407346delC								POTEH (119409 upstream) : OR11H1 (41480 downstream)																							ttgctcttgtcccccccaggc	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16487825	16487826	+	IGR	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16487825_16487826insT								OR11H1 (38021 upstream) : CCT8L2 (583822 downstream)																							ACTTACTACTGTTTTTTTTTTG	0.342													8	5	---	---	---	---	
GAB4	128954	broad.mit.edu	37	22	17474992	17474992	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17474992delC	uc002zlw.2	-						GAB4_uc010gqs.1_Intron	NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member											large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				gcattctcttccaactatggc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	18889967	18889967	+	IGR	DEL	C	-	-	rs116267673	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18889967delC								GGT3P (96975 upstream) : DGCR6 (3574 downstream)																							cagtgaggaacagtcttggga	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	21022099	21022099	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21022099delC								MED15 (80181 upstream) : POM121L4P (21744 downstream)																							CCGGTTGGGGCCCGCCGCTAG	0.741													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	21253619	21253619	+	IGR	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21253619delC								SNAP29 (8120 upstream) : CRKL (18095 downstream)																							CTGTCATAGACCCAGCTAAGA	0.408													4	2	---	---	---	---	
LRP5L	91355	broad.mit.edu	37	22	25757748	25757749	+	5'UTR	INS	-	G	G	rs143200681	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25757748_25757749insG	uc003abs.2	-	1					LRP5L_uc011ajz.1_Intron|LRP5L_uc010guw.1_Intron	NM_182492	NP_872298	A4QPB2	LRP5L_HUMAN	low density lipoprotein receptor-related protein												0						CTATGACCCCCCAGTTGGGATT	0.589											OREG0026425	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	26804756	26804759	+	IGR	DEL	CCTT	-	-	rs142712777		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26804756_26804759delCCTT								SEZ6L (28322 upstream) : ASPHD2 (20521 downstream)																							ctccttcctaccttccttccttcc	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27793453	27793453	+	IGR	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27793453delT								MIAT (678504 upstream) : MN1 (350813 downstream)																							AGACAGATCCTTCCAATTTCT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	32364097	32364097	+	IGR	DEL	A	-	-	rs67839140		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32364097delA								YWHAH (10508 upstream) : SLC5A1 (74940 downstream)																							actccttctcaaaaaaaaaaa	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35336906	35336906	+	IGR	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35336906delG								None (None upstream) : ISX (125223 downstream)																							aaaggcagatggggctacagt	0.000													4	2	---	---	---	---	
TOM1	10043	broad.mit.edu	37	22	35739362	35739363	+	Intron	INS	-	CT	CT			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35739362_35739363insCT	uc003ann.2	+						TOM1_uc011ami.1_Intron|TOM1_uc011amj.1_Intron|TOM1_uc003ans.2_Intron|TOM1_uc011amk.1_Intron|TOM1_uc003anp.2_Intron|TOM1_uc011aml.1_Intron|TOM1_uc003ano.2_Intron|TOM1_uc003anq.2_Intron|TOM1_uc003anr.2_Intron	NM_005488	NP_005479	O60784	TOM1_HUMAN	target of myb1 isoform 1						endocytosis|endosome transport|intracellular protein transport	cytosol|early endosome|membrane	protein binding			ovary(1)	1						ccaccacacacctccacacaca	0.000													4	3	---	---	---	---	
RBM9	23543	broad.mit.edu	37	22	36391187	36391187	+	Intron	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36391187delC	uc003aon.3	-						RBM9_uc003aoo.3_Intron	NM_001082578	NP_001076047	O43251	RFOX2_HUMAN	RNA binding motif protein 9 isoform 5						estrogen receptor signaling pathway|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of cell proliferation|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding|transcription corepressor activity|transcription factor binding				0						ACTAATACTTCCTACAAAACA	0.373													4	2	---	---	---	---	
RAC2	5880	broad.mit.edu	37	22	37628483	37628483	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37628483delG	uc003arc.2	-							NM_002872	NP_002863	P15153	RAC2_HUMAN	ras-related C3 botulinum toxin substrate 2						axon guidance|platelet activation|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|protein binding			breast(2)|central_nervous_system(1)|skin(1)	4						GCAGCCACCTGCAGGCATCCT	0.567													4	2	---	---	---	---	
LOC646851	646851	broad.mit.edu	37	22	39044613	39044614	+	Intron	INS	-	AAAC	AAAC	rs140724140	by1000genomes	TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39044613_39044614insAAAC	uc011anx.1	-						LOC646851_uc011anw.1_Intron			B7Z7C6	B7Z7C6_HUMAN	SubName: Full=Putative uncharacterized protein ENSP00000348086;												0						ctctgtctcagaaacaaacaaa	0.000													4	2	---	---	---	---	
WBP2NL	164684	broad.mit.edu	37	22	42345247	42345248	+	Intron	INS	-	A	A	rs112906061		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42345247_42345248insA	uc011ape.1	+						LOC339674_uc003bba.1_Intron|CENPM_uc003bbm.2_5'Flank|CENPM_uc003bbn.2_5'Flank|CENPM_uc003bbo.2_5'Flank|CENPM_uc003bbp.1_5'Flank|LOC339674_uc003bbq.3_5'Flank	NM_152613	NP_689826	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like						egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding			ovary(2)	2						gactccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	43785092	43785093	+	IGR	DEL	GT	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43785092_43785093delGT								SCUBE1 (45737 upstream) : MPPED1 (22927 downstream)																							CTACCCAGGGgtgtgtgtgtgt	0.460											OREG0026617	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45128894	45128899	+	Intron	DEL	TGCACA	-	-	rs66597708		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45128894_45128899delTGCACA	uc003bfd.2	+						PRR5_uc003bew.1_Intron|PRR5_uc003bex.1_Intron|PRR5_uc010gzt.1_Intron|PRR5_uc010gzu.1_Intron|PRR5_uc003bey.1_Intron|PRR5_uc003bez.1_Intron|PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|PRR5_uc003bfa.1_Intron|PRR5_uc003bfb.1_Intron|PRR5_uc003bfe.1_Intron|PRR5-ARHGAP8_uc003bfg.1_Intron|PRR5_uc003bfh.1_Intron	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2						actacacacgtgcacatgcacataca	0.204													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	46538371	46538371	+	IGR	DEL	A	-	-	rs76005572		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46538371delA								LOC400931 (28565 upstream) : PPARA (8128 downstream)																							ccgcaccaggaaaaaaaaaaa	0.174													3	3	---	---	---	---	
CELSR1	9620	broad.mit.edu	37	22	46844928	46844928	+	Intron	DEL	T	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46844928delT	uc003bhw.1	-							NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1						central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		tccttccatatacccacccac	0.114													4	2	---	---	---	---	
SLC25A6	293	broad.mit.edu	37	X	1513364	1513365	+	5'Flank	INS	-	CCTT	CCTT			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1513364_1513365insCCTT	uc004cpt.2	-						SLC25A6_uc004cpu.2_5'Flank	NM_001636	NP_001627	P12236	ADT3_HUMAN	adenine nucleotide translocator 3						active induction of host immune response by virus|apoptosis|energy reserve metabolic process|regulation of insulin secretion|viral infectious cycle	integral to membrane|mitochondrial inner membrane presequence translocase complex	ATP:ADP antiporter activity|protein binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Clodronate(DB00720)	ccctgcctctctctttcctgcc	0.030													4	4	---	---	---	---	
MID1	4281	broad.mit.edu	37	X	10618584	10618584	+	Intron	DEL	G	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10618584delG	uc004ctk.3	-						MID1_uc004cti.3_Intron|MID1_uc004ctj.3_Intron|MID1_uc011mie.1_Intron	NM_001098624	NP_001092094	O15344	TRI18_HUMAN	midline 1						microtubule cytoskeleton organization|pattern specification process|positive regulation of stress-activated MAPK cascade	cytoplasm|microtubule|microtubule associated complex|spindle	ligase activity|ubiquitin protein ligase binding|zinc ion binding			ovary(2)|pancreas(1)	3						gacagattttgtcacaaacca	0.000													4	2	---	---	---	---	
SSX4	6759	broad.mit.edu	37	X	48243983	48243984	+	Intron	INS	-	T	T			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48243983_48243984insT	uc004djf.1	+						SSX4_uc004djg.1_Intron	NM_005636	NP_005627	O60224	SSX4_HUMAN	synovial sarcoma, X breakpoint 4 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding		SS18/SSX4(12)	soft_tissue(12)	12						GCCATAATTCCTTTTTTTTTTT	0.441			T	SS18	synovial sarcoma								6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	77324654	77324655	+	IGR	DEL	CC	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77324654_77324655delCC								ATP7A (18763 upstream) : PGK1 (35011 downstream)																							gaaccgagctccccaaagaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	79354574	79354575	+	IGR	DEL	TG	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79354574_79354575delTG								TBX22 (67306 upstream) : FAM46D (236428 downstream)																							acatccaagatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
BRWD3	254065	broad.mit.edu	37	X	79991591	79991591	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79991591delA	uc004edt.2	-						BRWD3_uc004edo.2_Intron|BRWD3_uc004edp.2_Intron|BRWD3_uc004edq.2_Intron|BRWD3_uc010nmj.1_Intron|BRWD3_uc004edr.2_Intron|BRWD3_uc004eds.2_Intron|BRWD3_uc004edu.2_Intron|BRWD3_uc004edv.2_Intron|BRWD3_uc004edw.2_Intron|BRWD3_uc004edx.2_Intron|BRWD3_uc004edy.2_Intron|BRWD3_uc004edz.2_Intron|BRWD3_uc004eea.2_Intron|BRWD3_uc004eeb.2_Intron	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3											ovary(4)	4						GACAAAACTTAAAAAAAAAAA	0.303													9	4	---	---	---	---	
HS6ST2	90161	broad.mit.edu	37	X	131926428	131926428	+	Intron	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131926428delA	uc011mve.1	-						HS6ST2_uc011mvb.1_Intron|HS6ST2_uc011mvc.1_Intron|HS6ST2_uc011mvd.1_Intron	NM_147175	NP_671704	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2 isoform							integral to membrane	sulfotransferase activity				0	Acute lymphoblastic leukemia(192;0.000127)					GTTAGGAGCCAAAACTAAGGT	0.368													4	2	---	---	---	---	
CXorf1	9142	broad.mit.edu	37	X	144909203	144909203	+	Frame_Shift_Del	DEL	C	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144909203delC	uc004fch.2	+	1	276	c.8delC	c.(7-9)TCCfs	p.S3fs		NM_004709	NP_004700	O96002	CX001_HUMAN	hypothetical protein LOC9142	3											0	Acute lymphoblastic leukemia(192;6.56e-05)					TGAATGTATTCCAGACTATTT	0.244													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9980815	9980816	+	IGR	INS	-	GAGA	GAGA			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9980815_9980816insGAGA								TTTY22 (329961 upstream) : None (None downstream)																							aaggatggagggaaagatgggg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10020755	10020758	+	IGR	DEL	CTAA	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10020755_10020758delCTAA								TTTY22 (369901 upstream) : None (None downstream)																							tgtctgtcttctaactctctttct	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13270122	13270122	+	IGR	DEL	T	-	-	rs75692746		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13270122delT								None (None upstream) : None (None downstream)																							atttcttttctttttcttttg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13271205	13271205	+	IGR	DEL	A	-	-	rs141186848		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13271205delA								None (None upstream) : None (None downstream)																							attgtatcttaaaaaaaaaaa	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13285777	13285777	+	IGR	DEL	T	-	-	rs113216904		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13285777delT								None (None upstream) : None (None downstream)																							cattctctcctcctctggata	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13448360	13448360	+	IGR	DEL	T	-	-	rs112282772		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13448360delT								None (None upstream) : None (None downstream)																							cactcccccctatcccattcc	0.000													14	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13508907	13508907	+	IGR	DEL	A	-	-			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13508907delA								None (None upstream) : None (None downstream)																							atagaaactgaaaaaaaaagg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59009845	59009846	+	IGR	INS	-	CCAG	CCAG			TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59009845_59009846insCCAG								None (None upstream) : None (None downstream)																							ctgaaaagtaaccagcagacag	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59030174	59030174	+	IGR	DEL	T	-	-	rs67740623		TCGA-18-3419-01	TCGA-18-3419-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59030174delT								None (None upstream) : None (None downstream)																							aaaaaaaaGGTGGGGGGCAGA	0.050													5	3	---	---	---	---	
