Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
MKI67	4288	broad.mit.edu	36	10	129803486	129803486	+	Silent	SNP	G	T	T			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:129803486G>T	uc001lke.1	-	c.1176C>A	c.(1174-1176)CCC>CCA	p.P392P	MKI67_uc001lkf.1_Intron|MKI67_uc009yav.1_Intron|MKI67_uc009yaw.1_Intron	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	392					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(1)	5		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)												0.147059	8.255595	12.324183	5	29	GG		KEEP	---	---	---	---	capture			Silent	SNP	129803486	129803486	9988	10	G	T	T	47	47	MKI67	T	3	3
TUBGCP2	10844	broad.mit.edu	36	10	134957146	134957146	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:134957146G>C	uc009ybk.1	-	c.734C>G	c.(733-735)ACC>AGC	p.T245S	TUBGCP2_uc001lmf.1_5'Flank|TUBGCP2_uc001lmg.1_Missense_Mutation_p.T245S|TUBGCP2_uc001lmh.1_Non-coding_Transcript	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	245					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	cytoplasmic microtubule|cytosol|microtubule organizing center|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)										0.636364	16.319053	16.497271	7	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	134957146	134957146	17321	10	G	C	C	44	44	TUBGCP2	C	3	3
FAM13C	220965	broad.mit.edu	36	10	60792171	60792171	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1386-01	TCGA-19-1386-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:60792171A>T	uc001jkn.1	-	c.56T>A	c.(55-57)GTA>GAA	p.V19E	FAM13C_uc001jko.1_Missense_Mutation_p.V19E	NM_198215	NP_937858	Q8NE31	FA13C_HUMAN	hypothetical protein LOC220965 isoform 1	19										ovary(1)	1														0.28125	13.137953	14.532504	9	23	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60792171	60792171	5651	10	A	T	T	14	14	FAM13C	T	4	4
GATA3	2625	broad.mit.edu	36	10	8151564	8151564	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:8151564C>A	uc001ijz.1	+	c.1047C>A	c.(1045-1047)CAC>CAA	p.H349Q	GATA3_uc001ika.1_Missense_Mutation_p.H348Q	NM_001002295	NP_001002295	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 1	348					blood coagulation|cell fate determination|defense response|mesonephros development|negative regulation of cell proliferation|nephric duct formation|norepinephrine biosynthetic process|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of interleukin-4 production|regulation of cytokine biosynthetic process|response to estrogen stimulus|signal transduction|sympathetic nervous system development|transcription from RNA polymerase II promoter|ureteric bud formation	nuclear chromatin|nucleolus|nucleoplasm	E-box binding|HMG box domain binding|sequence-specific DNA binding transcription factor activity|transcription activator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(2)|central_nervous_system(2)	21														0.171429	12.427594	16.000559	6	29	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8151564	8151564	6519	10	C	A	A	17	17	GATA3	A	3	3
PAPSS2	9060	broad.mit.edu	36	10	89493241	89493241	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1386-01	TCGA-19-1386-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:89493241T>C	uc001kew.1	+	c.1354T>C	c.(1354-1356)TGG>CGG	p.W452R	PAPSS2_uc001kex.1_Missense_Mutation_p.W447R	NM_001015880	NP_001015880	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	447	Adenylyl-sulfate kinase.				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|protein binding|sulfate adenylyltransferase (ATP) activity			central_nervous_system(1)	1		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)										0.428571	18.160201	18.255326	9	12	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	89493241	89493241	11852	10	T	C	C	55	55	PAPSS2	C	4	4
CALCA	796	broad.mit.edu	36	11	14946955	14946955	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:14946955C>T	uc001mlv.1	-	c.392G>A	c.(391-393)CGC>CAC	p.R131H	CALCA_uc001mlt.1_Intron|CALCA_uc001mlu.1_Non-coding_Transcript|CALCA_uc001mlw.1_Missense_Mutation_p.R131H	NM_001741	NP_001732	P06881	CALCA_HUMAN	calcitonin isoform CALCA preproprotein	Error:Variant_position_missing_in_P06881_after_alignment					activation of adenylate cyclase activity|cell-cell signaling|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|endothelial cell migration|endothelial cell proliferation|leukocyte cell-cell adhesion|negative regulation of blood pressure|negative regulation of bone resorption|negative regulation of calcium ion transport into cytosol|negative regulation of osteoclast differentiation|neurological system process involved in regulation of systemic arterial blood pressure|positive regulation of interleukin-1 alpha production|positive regulation of interleukin-8 production|positive regulation of macrophage differentiation|positive regulation of vasodilation|regulation of blood pressure|vasculature development|vasodilation	cytoplasm|extracellular space	hormone activity			central_nervous_system(1)	1					Phentolamine(DB00692)									0.515152	147.805948	147.825208	51	48	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14946955	14946955	2691	11	C	T	T	27	27	CALCA	T	1	1
OR5L1	219437	broad.mit.edu	36	11	55335827	55335827	+	Silent	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55335827G>A	uc001nhw.1	+	c.309G>A	c.(307-309)TTG>TTA	p.L103L		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		all_epithelial(135;0.208)												0.122596	72.082286	130.052412	51	365	GG		KEEP	---	---	---	---	capture			Silent	SNP	55335827	55335827	11580	11	G	A	A	48	48	OR5L1	A	2	2
OR52N1	79473	broad.mit.edu	36	11	5766456	5766456	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:5766456G>T	uc001mbw.1	-	c.167C>A	c.(166-168)GCC>GAC	p.A56D	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001913	NP_001001913	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N,	56	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)										0.448276	36.76663	36.834692	13	16	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5766456	5766456	11537	11	G	T	T	42	42	OR52N1	T	3	3
NOS1	4842	broad.mit.edu	36	12	116202955	116202955	+	Silent	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:116202955G>A	uc001twm.1	-	c.1482C>T	c.(1480-1482)GAC>GAT	p.D494D		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1 (neuronal)	494					arginine catabolic process|multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|oxidation-reduction process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(2)|pancreas(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	Esophageal Squamous(162;1748 2599 51982 52956)								0.340909	36.299789	37.289414	15	29	GG		KEEP	---	---	---	---	capture			Silent	SNP	116202955	116202955	10944	12	G	A	A	40	40	NOS1	A	1	1
ZNF664	144348	broad.mit.edu	36	12	123063422	123063422	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:123063422G>A	uc001ufz.1	+	c.778G>A	c.(778-780)GTT>ATT	p.V260I	ZNF664_uc001uga.1_Missense_Mutation_p.V260I|ZNF664_uc001ugb.1_Missense_Mutation_p.V260I|ZNF664_uc009zyc.1_Missense_Mutation_p.V260I	NM_152437	NP_689650	Q8N3J9	ZN664_HUMAN	zinc finger protein 664	260					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.000239)|OV - Ovarian serous cystadenocarcinoma(86;0.000247)|all cancers(50;0.00155)|BRCA - Breast invasive adenocarcinoma(302;0.249)										0.5	49.224466	49.224466	15	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	123063422	123063422	18667	12	G	A	A	36	36	ZNF664	A	2	2
RIMBP2	23504	broad.mit.edu	36	12	129493001	129493001	+	Silent	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:129493001G>A	uc001uil.2	-	c.798C>T	c.(796-798)GAC>GAT	p.D266D	RIMBP2_uc001uim.2_Silent_p.D174D|RIMBP2_uc001uin.1_5'UTR	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	266						cell junction|synapse				ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	8	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)										0.667614	1451.301191	1468.815976	470	234	GG		KEEP	---	---	---	---	capture			Silent	SNP	129493001	129493001	13838	12	G	A	A	44	44	RIMBP2	A	2	2
RAPGEF3	10411	broad.mit.edu	36	12	46429518	46429518	+	Silent	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:46429518C>T	uc001rpz.2	-	c.963G>A	c.(961-963)CGG>CGA	p.R321R	RAPGEF3_uc001rpy.1_5'Flank|RAPGEF3_uc009zkp.1_Silent_p.R279R|RAPGEF3_uc009zkq.1_Silent_p.R279R|RAPGEF3_uc001rqa.2_5'Flank|RAPGEF3_uc009zkr.1_Non-coding_Transcript|RAPGEF3_uc009zks.1_Silent_p.R333R|RAPGEF3_uc001rqb.2_Silent_p.R321R	NM_001098531	NP_006096	A8K2G5	A8K2G5_HUMAN	Rap guanine nucleotide exchange factor 3 isoform	279					regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex	cAMP-dependent protein kinase regulator activity|guanyl-nucleotide exchange factor activity				0	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)										0.120482	11.310123	23.020136	10	73	CC		KEEP	---	---	---	---	capture			Silent	SNP	46429518	46429518	13505	12	C	T	T	22	22	RAPGEF3	T	2	2
SOAT2	8435	broad.mit.edu	36	12	51785275	51785275	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51785275C>T	uc001sbv.1	+	c.256C>T	c.(256-258)CCC>TCC	p.P86S	SOAT2_uc009zms.1_Non-coding_Transcript	NM_003578	NP_003569	O75908	SOAT2_HUMAN	acyl-CoA:cholesterol acyltransferase 2	86					cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|intestinal cholesterol absorption|macrophage derived foam cell differentiation|very-low-density lipoprotein particle assembly	brush border|endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			ovary(1)	1														0.272727	34.894401	37.460194	15	40	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51785275	51785275	15411	12	C	T	T	30	30	SOAT2	T	2	2
SRGAP1	57522	broad.mit.edu	36	12	62808023	62808023	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1386-01	TCGA-19-1386-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:62808023T>A	uc001sru.1	+	c.2656T>A	c.(2656-2658)TCC>ACC	p.S886T	SRGAP1_uc001srv.1_Missense_Mutation_p.S823T	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	886					axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)										0.179104	11.96801	18.475456	12	55	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	62808023	62808023	15659	12	T	A	A	58	58	SRGAP1	A	4	4
KLC1	3831	broad.mit.edu	36	14	103193636	103193636	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:103193636G>C	uc001yno.1	+	c.262G>C	c.(262-264)GTT>CTT	p.V88L	KLC1_uc001ynm.1_Missense_Mutation_p.V88L|KLC1_uc001ynn.1_Missense_Mutation_p.V84L	NM_182923	NP_891553	Q07866	KLC1_HUMAN	kinesin light chain 1 isoform 2	88					blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)												0.206897	15.656427	20.29499	12	46	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	103193636	103193636	8645	14	G	C	C	44	44	KLC1	C	3	3
ZFYVE26	23503	broad.mit.edu	36	14	67292541	67292541	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:67292541C>G	uc001xka.1	-	c.6663G>C	c.(6661-6663)GAG>GAC	p.E2221D	ZFYVE26_uc001xkb.2_Missense_Mutation_p.E67D	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2221					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	phosphatidylinositol-3-phosphate binding|protein binding|zinc ion binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)										0.333333	8.294181	8.5903	4	8	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	67292541	67292541	18258	14	C	G	G	32	32	ZFYVE26	G	3	3
TM2D3	80213	broad.mit.edu	36	15	100000268	100000268	+	Silent	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:100000268C>T	uc002bxi.1	-	c.681G>A	c.(679-681)CTG>CTA	p.L227L	TM2D3_uc002bxh.1_Silent_p.L162L|TM2D3_uc002bxj.1_Silent_p.L201L|TM2D3_uc002bxk.1_Silent_p.L162L	NM_078474	NP_510883	Q9BRN9	TM2D3_HUMAN	TM2 domain containing 3 isoform a	227	Helical; (Potential).					integral to membrane				ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)											0.477273	60.672729	60.69222	21	23	CC		KEEP	---	---	---	---	capture			Silent	SNP	100000268	100000268	16495	15	C	T	T	29	29	TM2D3	T	2	2
ADAMTS17	170691	broad.mit.edu	36	15	98620123	98620123	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1386-01	TCGA-19-1386-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr15:98620123A>T	uc002bvv.1	-	c.830T>A	c.(829-831)ATT>AAT	p.I277N	ADAMTS17_uc002bvx.1_Missense_Mutation_p.I34N	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	277	Peptidase M12B.				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)										0.25	8.358805	9.501907	5	15	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	98620123	98620123	263	15	A	T	T	4	4	ADAMTS17	T	4	4
PDXDC1	23042	broad.mit.edu	36	16	15033157	15033157	+	Silent	SNP	G	C	C			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:15033157G>C	uc002dda.2	+	c.1464G>C	c.(1462-1464)GTG>GTC	p.V488V	PDXDC1_uc002ddc.2_Intron|PDXDC1_uc002ddb.2_Silent_p.V461V	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain	488					carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)									0.195652	10.631304	14.629021	9	37	GG		KEEP	---	---	---	---	capture			Silent	SNP	15033157	15033157	12117	16	G	C	C	46	46	PDXDC1	C	3	3
MEFV	4210	broad.mit.edu	36	16	3239655	3239656	+	Missense_Mutation	DNP	CC	GA	GA			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:3239655_3239656CC>GA	uc002cun.1	-	c.1036_1037GG>TC	c.(1036-1038)GGC>TCC	p.G346S		NM_000243	NP_000234	O15553	MEFV_HUMAN	Mediterranean fever protein	346					inflammatory response	cytoplasm|microtubule|microtubule associated complex|nucleus	actin binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5					Colchicine(DB01394)									0.307692	6.829142	7.23971	4	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	3239655	3239656	9848	16	CC	GA	GA	26	26	MEFV	GA	3	3
TAT	6898	broad.mit.edu	36	16	70167785	70167785	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:70167785C>T	uc002fap.2	-	c.35G>A	c.(34-36)GGC>GAC	p.G12D	TAT_uc002faq.2_Missense_Mutation_p.G12D|TAT_uc002far.2_Missense_Mutation_p.G12D	NM_000353	NP_000344	P17735	ATTY_HUMAN	tyrosine aminotransferase	12					2-oxoglutarate metabolic process|glutamate metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-tyrosine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(2)	2		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Glutamic Acid(DB00142)|L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Pyridoxal Phosphate(DB00114)	Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)								0.142132	45.110826	69.418299	28	169	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70167785	70167785	16112	16	C	T	T	26	26	TAT	T	2	2
SMCR8	140775	broad.mit.edu	36	17	18160364	18160364	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:18160364C>A	uc002gsy.2	+	c.536C>A	c.(535-537)GCT>GAT	p.A179D	TOP3A_uc002gsx.1_5'Flank|TOP3A_uc010cqa.1_5'Flank	NM_144775	NP_658988	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region,	179										central_nervous_system(1)	1														0.132075	18.477697	32.426676	14	92	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18160364	18160364	15290	17	C	A	A	28	28	SMCR8	A	3	3
ERBB2	2064	broad.mit.edu	36	17	35137087	35137087	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1386-01	TCGA-19-1386-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:35137087A>C	uc002hso.1	+	c.3173A>C	c.(3172-3174)GAC>GCC	p.D1058A	ERBB2_uc002hsm.1_Missense_Mutation_p.D1028A|ERBB2_uc002hsp.1_Missense_Mutation_p.D861A|ERBB2_uc010cwb.1_Intron	NM_004448	NP_001005862	P04626	ERBB2_HUMAN	erbB-2 isoform a	1058	Cytoplasmic (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(71)|central_nervous_system(16)|ovary(13)|stomach(12)|breast(5)|upper_aerodigestive_tract(4)|large_intestine(3)|liver(3)|endometrium(2)|pancreas(1)	130	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)			1		271	TCGA GBM(5;<1E-8)			0.333333	9.502527	10.080032	7	14	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35137087	35137087	5399	17	A	C	C	10	10	ERBB2	C	4	4
PLEKHH3	79990	broad.mit.edu	36	17	38076909	38076909	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1386-01	TCGA-19-1386-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:38076909T>G	uc002iau.2	-	c.1270A>C	c.(1270-1272)ACC>CCC	p.T424P	PLEKHH3_uc010cyl.1_Non-coding_Transcript|PLEKHH3_uc002iat.1_Non-coding_Transcript|PLEKHH3_uc002iav.2_Non-coding_Transcript|PLEKHH3_uc010cym.1_Intron|PLEKHH3_uc002iaw.2_Missense_Mutation_p.T424P	NM_024927	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H	424	FERM.				signal transduction	cytoskeleton				large_intestine(1)|ovary(1)	2		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)										0.444444	7.994259	8.018823	4	5	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38076909	38076909	12504	17	T	G	G	59	59	PLEKHH3	G	4	4
ZBTB7C	201501	broad.mit.edu	36	18	43820276	43820277	+	Missense_Mutation	DNP	AG	CA	CA			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:43820276_43820277AG>CA	uc010dnv.1	-	c.1266_1267CT>TG	c.(1264-1269)CGCTTC>CGTGTC	p.F423V	ZBTB7C_uc010dnw.1_Missense_Mutation_p.F401V|ZBTB7C_uc010dny.1_Missense_Mutation_p.F401V|ZBTB7C_uc010dnz.1_Missense_Mutation_p.F423V|ZBTB7C_uc010doa.1_Missense_Mutation_p.F423V|ZBTB7C_uc010dob.1_Missense_Mutation_p.F401V|ZBTB7C_uc010doc.1_Missense_Mutation_p.F410V|ZBTB7C_uc010dod.1_Missense_Mutation_p.F423V|ZBTB7C_uc010doe.1_Missense_Mutation_p.F401V|ZBTB7C_uc010dof.1_Missense_Mutation_p.F401V|ZBTB7C_uc010dog.1_Missense_Mutation_p.F401V|ZBTB7C_uc010doh.1_Missense_Mutation_p.F410V|ZBTB7C_uc010doi.1_Missense_Mutation_p.F401V|ZBTB7C_uc010doj.1_Missense_Mutation_p.F410V|ZBTB7C_uc010dok.1_Missense_Mutation_p.F450V|ZBTB7C_uc010dol.1_Missense_Mutation_p.F410V|ZBTB7C_uc010dom.1_Missense_Mutation_p.F410V|ZBTB7C_uc010don.1_Missense_Mutation_p.F409V|ZBTB7C_uc010doo.1_Missense_Mutation_p.F401V|ZBTB7C_uc010dop.1_Missense_Mutation_p.F401V|ZBTB7C_uc010doq.1_Missense_Mutation_p.F410V|ZBTB7C_uc010dor.1_Missense_Mutation_p.F423V|ZBTB7C_uc010dos.1_Missense_Mutation_p.F401V|ZBTB7C_uc010dot.1_Missense_Mutation_p.F401V|ZBTB7C_uc010dou.1_Missense_Mutation_p.F410V|ZBTB7C_uc002ldb.1_Missense_Mutation_p.F401V|ZBTB7C_uc010dnu.1_Missense_Mutation_p.F410V|ZBTB7C_uc010dnx.1_Missense_Mutation_p.F401V|ZBTB7C_uc002lda.1_Missense_Mutation_p.F401V	NM_001039360	NP_001034449	A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	401	C2H2-type 2.					intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1														0.134146	7.364372	18.03809	11	71	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	43820276	43820277	18142	18	AG	CA	CA	3	3	ZBTB7C	CA	4	4
ATP8B1	5205	broad.mit.edu	36	18	53479663	53479663	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:53479663C>G	uc002lgw.1	-	c.2448G>C	c.(2446-2448)AAG>AAC	p.K816N		NM_005603	NP_005594	O43520	AT8B1_HUMAN	ATPase, class I, type 8B, member 1	816	Cytoplasmic (Potential).				ATP biosynthetic process|bile acid and bile salt transport|negative regulation of transcription, DNA-dependent	apical plasma membrane|integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			breast(4)|ovary(2)|central_nervous_system(2)	8		Colorectal(73;0.229)								950				0.396396	142.130737	143.185679	44	67	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53479663	53479663	1213	18	C	G	G	32	32	ATP8B1	G	3	3
YIPF2	78992	broad.mit.edu	36	19	10895826	10895827	+	Missense_Mutation	DNP	AC	GT	GT			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:10895826_10895827AC>GT	uc002mqb.1	-	c.409_410GT>AC	c.(409-411)GTC>ACC	p.V137T	YIPF2_uc002mqc.1_Missense_Mutation_p.V137T	NM_024029	NP_076934	Q9BWQ6	YIPF2_HUMAN	Yip1 domain family, member 2	137	Helical; (Potential).					integral to membrane|transport vesicle					0														0.321429	16.861746	17.656879	9	19	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	10895826	10895827	18061	19	AC	GT	GT	10	10	YIPF2	GT	4	4
KLK15	55554	broad.mit.edu	36	19	56022139	56022139	+	Silent	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:56022139C>T	uc002ptl.1	-	c.288G>A	c.(286-288)CCG>CCA	p.P96P	KLK15_uc002ptn.1_Silent_p.P96P|KLK15_uc002ptm.1_Silent_p.P96P|KLK15_uc002pto.1_Silent_p.P95P|KLK15_uc010eod.1_Non-coding_Transcript	NM_017509	NP_059979	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15 isoform 4	96	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)|breast(1)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		Pancreas(140;10 2513 7143 9246)								0.516129	43.795633	43.802648	16	15	CC		KEEP	---	---	---	---	capture			Silent	SNP	56022139	56022139	8717	19	C	T	T	27	27	KLK15	T	1	1
C19orf21	126353	broad.mit.edu	36	19	709480	709480	+	Silent	SNP	A	C	C			TCGA-19-1386-01	TCGA-19-1386-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:709480A>C	uc002lpo.1	+	c.1534A>C	c.(1534-1536)AGG>CGG	p.R512R		NM_173481	NP_775752	Q8IVT2	CS021_HUMAN	hypothetical protein LOC126353	512											0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000145)|all_lung(49;0.000236)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.363636	7.605995	7.781809	4	7	AA		KEEP	---	---	---	---	capture			Silent	SNP	709480	709480	1975	19	A	C	C	7	7	C19orf21	C	4	4
OR7G2	390882	broad.mit.edu	36	19	9074844	9074844	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:9074844C>T	uc002mkr.1	-	c.139G>A	c.(139-141)GTC>ATC	p.V47I		NM_001005193	NP_001005193	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G,	26	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						Esophageal Squamous(67;143 1448 28637 40648)								0.502814	810.167287	810.171268	268	265	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9074844	9074844	11634	19	C	T	T	19	19	OR7G2	T	1	1
MYBPHL	343263	broad.mit.edu	36	1	109651051	109651051	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1386-01	TCGA-19-1386-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:109651051T>A	uc001dxk.1	-	c.86A>T	c.(85-87)CAG>CTG	p.Q29L	MYBPHL_uc001dxl.2_Non-coding_Transcript	NM_001010985	NP_001010985	A2RUH7	MBPHL_HUMAN	myosin binding protein H-like	29										ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(203;0.00519)|all_epithelial(167;0.00575)|Lung NSC(277;0.00822)		Colorectal(144;0.0306)|Lung(183;0.0681)|COAD - Colon adenocarcinoma(174;0.117)|Epithelial(280;0.197)|all cancers(265;0.225)										0.8	9.147638	9.513502	4	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	109651051	109651051	10410	1	T	A	A	55	55	MYBPHL	A	4	4
HAO2	51179	broad.mit.edu	36	1	119727155	119727155	+	Missense_Mutation	SNP	G	A	A	rs41313995	unknown	TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:119727155G>A	uc001ehq.1	+	c.226G>A	c.(226-228)GCA>ACA	p.A76T	HAO2_uc001ehr.1_Missense_Mutation_p.A76T	NM_001005783	NP_057611	Q9NYQ3	HAOX2_HUMAN	hydroxyacid oxidase 2	76	FMN hydroxy acid dehydrogenase.				fatty acid alpha-oxidation	peroxisome	(S)-2-hydroxy-acid oxidase activity			ovary(1)	1	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.0155)|LUSC - Lung squamous cell carcinoma(189;0.0856)										0.347826	44.998942	45.933138	16	30	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	119727155	119727155	7234	1	G	A	A	38	38	HAO2	A	1	1
HNRNPCL1	343069	broad.mit.edu	36	1	12830199	12830199	+	Silent	SNP	A	T	T	rs2994091	by-cluster,by-2hit-2allele	TCGA-19-1386-01	TCGA-19-1386-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:12830199A>T	uc009vno.1	-	c.531T>A	c.(529-531)GGT>GGA	p.G177G	HNRNPCL1_uc001aul.1_Silent_p.G177G	NM_001013631	NP_001013653	O60812	HNRCL_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	177						ribonucleoprotein complex	nucleotide binding				0														0.427807	221.600203	222.461479	80	107	AA		KEEP	---	---	---	---	capture			Silent	SNP	12830199	12830199	7555	1	A	T	T	6	6	HNRNPCL1	T	4	4
HNRNPCL1	343069	broad.mit.edu	36	1	12830207	12830207	+	Silent	SNP	A	G	G	rs2994092	by-cluster,by-2hit-2allele	TCGA-19-1386-01	TCGA-19-1386-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:12830207A>G	uc009vno.1	-	c.523T>C	c.(523-525)TTG>CTG	p.L175L	HNRNPCL1_uc001aul.1_Silent_p.L175L	NM_001013631	NP_001013653	O60812	HNRCL_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	175						ribonucleoprotein complex	nucleotide binding				0														0.47	275.216165	275.372954	94	106	AA		KEEP	---	---	---	---	capture			Silent	SNP	12830207	12830207	7555	1	A	G	G	2	2	HNRNPCL1	G	4	4
HNRNPCL1	343069	broad.mit.edu	36	1	12830288	12830288	+	Missense_Mutation	SNP	G	T	T	rs2359484	by-hapmap	TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:12830288G>T	uc009vno.1	-	c.442C>A	c.(442-444)CTA>ATA	p.L148I	HNRNPCL1_uc001aul.1_Missense_Mutation_p.L148I	NM_001013631	NP_001013653	O60812	HNRCL_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	148						ribonucleoprotein complex	nucleotide binding				0														0.195312	40.803692	51.892499	25	103	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12830288	12830288	7555	1	G	T	T	33	33	HNRNPCL1	T	3	3
HNRNPCL1	343069	broad.mit.edu	36	1	12830292	12830292	+	Silent	SNP	T	C	C	rs2359482	unknown	TCGA-19-1386-01	TCGA-19-1386-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:12830292T>C	uc009vno.1	-	c.438A>G	c.(436-438)CAA>CAG	p.Q146Q	HNRNPCL1_uc001aul.1_Silent_p.Q146Q	NM_001013631	NP_001013653	O60812	HNRCL_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	146						ribonucleoprotein complex	nucleotide binding				0														0.193798	33.176126	44.508185	25	104	TT		KEEP	---	---	---	---	capture			Silent	SNP	12830292	12830292	7555	1	T	C	C	60	60	HNRNPCL1	C	4	4
FLG2	388698	broad.mit.edu	36	1	150597954	150597954	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150597954C>T	uc001ezw.2	-	c.31G>A	c.(31-33)GTA>ATA	p.V11I		NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	11	S-100-like (By similarity).|EF-hand 1.						calcium ion binding|structural molecule activity			ovary(9)|breast(1)	10	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.44186	61.3672	61.484225	19	24	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	150597954	150597954	6161	1	C	T	T	19	19	FLG2	T	1	1
NTRK1	4914	broad.mit.edu	36	1	155110279	155110281	+	Missense_Mutation	TNP	CTG	TAT	TAT			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:155110279_155110281CTG>TAT	uc001fqh.1	+	c.1081_1083CTG>TAT	c.(1081-1083)CTG>TAT	p.L361Y	NTRK1_uc001fqf.1_Missense_Mutation_p.L331Y|NTRK1_uc009wsi.1_Missense_Mutation_p.L66Y|NTRK1_uc001fqi.1_Missense_Mutation_p.L361Y|NTRK1_uc009wsk.1_Missense_Mutation_p.L361Y	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	361	Ig-like C2-type 2.|Extracellular (Potential).				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|stomach(1)|central_nervous_system(1)	16	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)					290	TSP Lung(10;0.080)			0.6	7.726241	7.770486	3	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	155110279	155110281	11111	1	CTG	TAT	TAT	28	28	NTRK1	TAT	2	2
RAB3GAP2	25782	broad.mit.edu	36	1	218397349	218397349	+	Silent	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:218397349C>T	uc001hme.1	-	c.3441G>A	c.(3439-3441)CAG>CAA	p.Q1147Q	RAB3GAP2_uc009xdv.1_Silent_p.Q1147Q|RAB3GAP2_uc001hmf.1_Non-coding_Transcript|RAB3GAP2_uc001hmg.1_Silent_p.Q727Q|RAB3GAP2_uc001hmh.1_Silent_p.Q91Q	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic	1147					intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)										0.148515	24.769868	36.738191	15	86	CC		KEEP	---	---	---	---	capture			Silent	SNP	218397349	218397349	13395	1	C	T	T	32	32	RAB3GAP2	T	2	2
GGT7	2686	broad.mit.edu	36	20	32903710	32903710	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:32903710C>T	uc002xay.1	-	c.1496G>A	c.(1495-1497)GGC>GAC	p.G499D	GGT7_uc010gex.1_5'Flank|GGT7_uc002xaz.1_Missense_Mutation_p.G516D	NM_178026	NP_821158	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	499	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(1)	1														0.483871	35.096599	35.104445	15	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32903710	32903710	6632	20	C	T	T	26	26	GGT7	T	2	2
TBC1D20	128637	broad.mit.edu	36	20	367481	367481	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:367481C>A	uc002wds.1	-	c.961G>T	c.(961-963)GCA>TCA	p.A321S	TBC1D20_uc002wdv.1_Missense_Mutation_p.A144S|TBC1D20_uc002wdt.2_Non-coding_Transcript|TBC1D20_uc002wdu.2_Non-coding_Transcript	NM_144628	NP_653229	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20	321					interspecies interaction between organisms	integral to membrane|intracellular	Rab GTPase activator activity			central_nervous_system(1)	1		all_epithelial(17;0.228)|Breast(17;0.231)												0.14	19.488154	31.926369	14	86	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	367481	367481	16131	20	C	A	A	26	26	TBC1D20	A	3	3
ETS2	2114	broad.mit.edu	36	21	39116659	39116659	+	Silent	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:39116659C>T	uc002yxf.1	+	c.1806C>T	c.(1804-1806)GGC>GGT	p.G602G	ETS2_uc002yxg.1_Silent_p.G462G	NM_005239	NP_005230	P15036	ETS2_HUMAN	v-ets erythroblastosis virus E26 oncogene	462					positive regulation of transcription, DNA-dependent|skeletal system development	nucleus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|pancreas(1)	3		Prostate(19;6.33e-08)|all_epithelial(19;0.123)												0.73913	50.573261	51.760322	17	6	CC		KEEP	---	---	---	---	capture			Silent	SNP	39116659	39116659	5469	21	C	T	T	27	27	ETS2	T	1	1
TRIOBP	11078	broad.mit.edu	36	22	36449545	36449545	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1386-01	TCGA-19-1386-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr22:36449545T>G	uc003att.1	+	c.1036T>G	c.(1036-1038)TCA>GCA	p.S346A	TRIOBP_uc003atq.1_Missense_Mutation_p.S346A|TRIOBP_uc003atr.1_Missense_Mutation_p.S346A|TRIOBP_uc003ats.1_Missense_Mutation_p.S174A|TRIOBP_uc003atu.1_Missense_Mutation_p.S174A	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	346					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)													0.26087	9.030276	10.229809	6	17	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36449545	36449545	17103	22	T	G	G	54	54	TRIOBP	G	4	4
CCNT2	905	broad.mit.edu	36	2	135428467	135428467	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:135428467C>T	uc002tuc.1	+	c.1972C>T	c.(1972-1974)CAC>TAC	p.H658Y	CCNT2_uc002tub.1_Intron|CCNT2_uc002tud.1_Missense_Mutation_p.H321Y	NM_058241	NP_490595	O60583	CCNT2_HUMAN	cyclin T2 isoform b	658					cell cycle|cell division|interspecies interaction between organisms|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm				ovary(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.107)										0.112903	11.160119	29.512866	14	110	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	135428467	135428467	3062	2	C	T	T	29	29	CCNT2	T	2	2
COL6A3	1293	broad.mit.edu	36	2	237968424	237968424	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:237968424C>A	uc002vwl.2	-	c.254G>T	c.(253-255)GGA>GTA	p.G85V	COL6A3_uc002vwk.2_Missense_Mutation_p.G85V|COL6A3_uc002vwm.2_Missense_Mutation_p.G85V|COL6A3_uc002vwn.2_Missense_Mutation_p.G85V|COL6A3_uc002vwo.2_Intron|COL6A3_uc002vwq.2_Intron|COL6A3_uc002vwr.2_Intron	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	85	VWFA 1.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|pancreas(1)	15		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)										0.121212	7.150503	16.446778	8	58	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	237968424	237968424	3839	2	C	A	A	30	30	COL6A3	A	3	3
ALMS1	7840	broad.mit.edu	36	2	73533084	73533084	+	Silent	SNP	A	G	G			TCGA-19-1386-01	TCGA-19-1386-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:73533084A>G	uc002sje.1	+	c.5925A>G	c.(5923-5925)GCA>GCG	p.A1975A	ALMS1_uc002sjf.1_Silent_p.A1931A|ALMS1_uc002sjg.2_Silent_p.A1361A|ALMS1_uc002sjh.1_Silent_p.A1361A	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	ALMS1	1973	34 X 47 AA approximate tandem repeat.|31.				G2/M transition of mitotic cell cycle|visual perception	centrosome|cilium|cytosol|microtubule basal body|spindle pole				ovary(2)|breast(2)|lung(1)|pancreas(1)	6														0.178947	71.743282	90.170223	34	156	AA		KEEP	---	---	---	---	capture			Silent	SNP	73533084	73533084	538	2	A	G	G	7	7	ALMS1	G	4	4
TMEM127	55654	broad.mit.edu	36	2	96283339	96283339	+	Silent	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:96283339G>A	uc002svq.1	-	c.651C>T	c.(649-651)AAC>AAT	p.N217N	TMEM127_uc002svr.1_Silent_p.N217N	NM_017849	NP_060319	O75204	TM127_HUMAN	transmembrane protein 127	217					negative regulation of cell proliferation|negative regulation of TOR signaling cascade	cytoplasm|integral to membrane|plasma membrane					0														0.793651	166.131695	171.149896	50	13	GG		KEEP	---	---	---	---	capture			Silent	SNP	96283339	96283339	16571	2	G	A	A	40	40	TMEM127	A	1	1
TMEM127	55654	broad.mit.edu	36	2	96283408	96283409	+	Missense_Mutation	DNP	GT	AC	AC			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:96283408_96283409GT>AC	uc002svq.1	-	c.581_582AC>GT	c.(580-582)AAC>AGT	p.N194S	TMEM127_uc002svr.1_Missense_Mutation_p.N194S	NM_017849	NP_060319	O75204	TM127_HUMAN	transmembrane protein 127	194					negative regulation of cell proliferation|negative regulation of TOR signaling cascade	cytoplasm|integral to membrane|plasma membrane					0														0.233333	8.320151	10.274691	7	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	96283408	96283409	16571	2	GT	AC	AC	44	44	TMEM127	AC	2	2
KBTBD5	131377	broad.mit.edu	36	3	42705188	42705188	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:42705188G>A	uc003clv.1	+	c.1396G>A	c.(1396-1398)GTA>ATA	p.V466I		NM_152393	NP_689606	Q2TBA0	KBTB5_HUMAN	kelch repeat and BTB (POZ) domain containing 5	466	Kelch 3.									ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.214)										0.310345	23.864306	24.793564	9	20	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42705188	42705188	8301	3	G	A	A	40	40	KBTBD5	A	1	1
TGM4	7047	broad.mit.edu	36	3	44926685	44926685	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:44926685C>T	uc003coc.2	+	c.1427C>T	c.(1426-1428)TCG>TTG	p.S476L		NM_003241	NP_003232	P49221	TGM4_HUMAN	transglutaminase 4 (prostate)	476					peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)									0.120172	41.68739	74.613836	28	205	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44926685	44926685	16360	3	C	T	T	31	31	TGM4	T	1	1
PRKCD	5580	broad.mit.edu	36	3	53201218	53201218	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:53201218C>T	uc003dgl.1	+	c.1927C>T	c.(1927-1929)CGC>TGC	p.R643C	PRKCD_uc003dgm.1_Missense_Mutation_p.R643C	NM_006254	NP_997704	Q05655	KPCD_HUMAN	protein kinase C, delta	643	AGC-kinase C-terminal.				activation of phospholipase C activity|cellular component disassembly involved in apoptosis|cellular senescence|interferon-gamma-mediated signaling pathway|intracellular signal transduction|mRNA metabolic process|negative regulation of insulin receptor signaling pathway|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein binding|nerve growth factor receptor signaling pathway|platelet activation|protein phosphorylation|protein stabilization|regulation of receptor activity	cytosol|endoplasmic reticulum|nucleoplasm	ATP binding|calcium-independent protein kinase C activity|enzyme activator activity|enzyme binding|insulin receptor substrate binding|metal ion binding|protein C-terminus binding			central_nervous_system(4)|lung(1)	5		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)						215				0.233333	71.831681	81.621771	35	115	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53201218	53201218	12952	3	C	T	T	27	27	PRKCD	T	1	1
PRMT10	90826	broad.mit.edu	36	4	148794715	148794715	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:148794715G>A	uc003ilc.1	-	c.1783C>T	c.(1783-1785)CCT>TCT	p.P595S	PRMT10_uc003ilb.1_Missense_Mutation_p.P239S|PRMT10_uc003ild.1_Missense_Mutation_p.P482S	NM_138364	NP_612373	Q6P2P2	ANM10_HUMAN	hypothetical protein LOC90826	595						cytoplasm	binding|protein methyltransferase activity			ovary(1)|central_nervous_system(1)	2														0.166667	11.208372	19.467663	13	65	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	148794715	148794715	12979	4	G	A	A	42	42	PRMT10	A	2	2
TUBB4Q	56604	broad.mit.edu	36	4	191141484	191141484	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1386-01	TCGA-19-1386-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:191141484T>G	uc003izt.1	-	c.490A>C	c.(490-492)AAC>CAC	p.N164H		NM_020040	NP_064424	Q99867	TBB4Q_HUMAN	tubulin, beta polypeptide 4, member Q	165					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;4.1e-31)|Epithelial(3;1.44e-30)|OV - Ovarian serous cystadenocarcinoma(60;2.03e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00839)|READ - Rectum adenocarcinoma(43;0.155)										0.228571	11.175008	13.550996	8	27	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	191141484	191141484	17314	4	T	G	G	64	64	TUBB4Q	G	4	4
EVC	2121	broad.mit.edu	36	4	5851220	5851220	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:5851220C>G	uc003gil.1	+	c.2104C>G	c.(2104-2106)CGT>GGT	p.R702G	EVC_uc003gim.1_Non-coding_Transcript|CRMP1_uc003gin.1_Intron	NM_153717	NP_714928	P57679	EVC_HUMAN	Ellis van Creveld syndrome protein	702					muscle organ development	integral to membrane				ovary(1)	1		Myeloproliferative disorder(84;0.117)												0.285714	6.587845	7.169631	4	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5851220	5851220	5478	4	C	G	G	27	27	EVC	G	3	3
EVC	2121	broad.mit.edu	36	4	5857462	5857462	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:5857462C>A	uc003gil.1	+	c.2554C>A	c.(2554-2556)CAC>AAC	p.H852N	EVC_uc003gim.1_Non-coding_Transcript|CRMP1_uc003gin.1_Intron	NM_153717	NP_714928	P57679	EVC_HUMAN	Ellis van Creveld syndrome protein	852					muscle organ development	integral to membrane				ovary(1)	1		Myeloproliferative disorder(84;0.117)												0.204082	11.602078	15.613115	10	39	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5857462	5857462	5478	4	C	A	A	21	21	EVC	A	3	3
SNCAIP	9627	broad.mit.edu	36	5	121814994	121814994	+	Silent	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:121814994C>T	uc003ksx.1	+	c.2694C>T	c.(2692-2694)AAC>AAT	p.N898N	SNCAIP_uc003ksw.1_Silent_p.N851N|SNCAIP_uc003ksy.1_Silent_p.N485N|SNCAIP_uc003ksz.1_Silent_p.N485N|SNCAIP_uc010jcu.1_Silent_p.N447N|SNCAIP_uc010jcv.1_Non-coding_Transcript|SNCAIP_uc010jcw.1_Silent_p.N545N|SNCAIP_uc010jcx.1_Silent_p.N791N|SNCAIP_uc003kta.1_Silent_p.N483N|SNCAIP_uc003ktc.1_Silent_p.N367N	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein	851					cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	protein binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)										0.586207	52.973727	53.161509	17	12	CC		KEEP	---	---	---	---	capture			Silent	SNP	121814994	121814994	15341	5	C	T	T	19	19	SNCAIP	T	1	1
PCDHB15	56121	broad.mit.edu	36	5	140606912	140606913	+	Missense_Mutation	DNP	GA	AC	AC			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140606912_140606913GA>AC	uc003lje.1	+	c.1582_1583GA>AC	c.(1582-1584)GAG>ACG	p.E528T		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	528	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)											0.24	15.205767	18.368603	12	38	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	140606912	140606913	11960	5	GA	AC	AC	37	37	PCDHB15	AC	1	1
PCDHGA6	56109	broad.mit.edu	36	5	140736186	140736186	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140736186C>A	uc003ljy.1	+	c.2352C>A	c.(2350-2352)AGC>AGA	p.S784R	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljx.1_Missense_Mutation_p.S784R	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	784	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.294118	8.661133	9.311127	5	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140736186	140736186	11978	5	C	A	A	28	28	PCDHGA6	A	3	3
PCDHGA12	26025	broad.mit.edu	36	5	140792276	140792276	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140792276C>T	uc003lkt.1	+	c.1766C>T	c.(1765-1767)ACC>ATC	p.T589I	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lks.1_Missense_Mutation_p.T589I	NM_003735	NP_003726	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12 isoform 1	589	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.333333	8.762203	9.135118	5	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140792276	140792276	11973	5	C	T	T	18	18	PCDHGA12	T	2	2
RNF217	154214	broad.mit.edu	36	6	125408142	125408142	+	Silent	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:125408142G>A	uc003pzs.1	+	c.93G>A	c.(91-93)ACG>ACA	p.T31T	RNF217_uc003pzr.1_Silent_p.T88T|RNF217_uc003pzt.1_Non-coding_Transcript	NM_152553	NP_689766	Q8TC41	RN217_HUMAN	ring finger protein 217	31					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)										0.127193	41.416503	72.329324	29	199	GG		KEEP	---	---	---	---	capture			Silent	SNP	125408142	125408142	13959	6	G	A	A	38	38	RNF217	A	1	1
ESR1	2099	broad.mit.edu	36	6	152374568	152374568	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:152374568G>A	uc010kio.1	+	c.1187G>A	c.(1186-1188)CGC>CAC	p.R396H	ESR1_uc003qom.2_Missense_Mutation_p.R394H|ESR1_uc010kin.1_Missense_Mutation_p.R394H|ESR1_uc010kip.1_Missense_Mutation_p.R393H|ESR1_uc003qon.2_Missense_Mutation_p.R394H|ESR1_uc003qoo.2_Missense_Mutation_p.R394H|ESR1_uc010kiq.1_Intron|ESR1_uc010kir.1_Intron|ESR1_uc010kis.1_Missense_Mutation_p.R63H|ESR1_uc010kit.1_Intron	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	394	Steroid-binding.|Interaction with AKAP13.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)	2		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)					249				0.433333	76.939901	77.172315	26	34	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	152374568	152374568	5449	6	G	A	A	38	38	ESR1	A	1	1
OPRM1	4988	broad.mit.edu	36	6	154454236	154454236	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:154454236G>A	uc003qpq.1	+	c.1286G>A	c.(1285-1287)CGA>CAA	p.R429Q	OPRM1_uc003qpn.1_Missense_Mutation_p.R367Q|OPRM1_uc003qpo.1_Missense_Mutation_p.R367Q|OPRM1_uc003qpp.1_Non-coding_Transcript|OPRM1_uc010kjf.1_Missense_Mutation_p.R429Q|OPRM1_uc003qpr.1_Missense_Mutation_p.R367Q|OPRM1_uc003qps.1_Non-coding_Transcript|OPRM1_uc003qpt.1_Missense_Mutation_p.R367Q|OPRM1_uc010kjg.1_Missense_Mutation_p.R267Q|OPRM1_uc003qpu.1_Missense_Mutation_p.R267Q	NM_001008504	NP_001008504	P35372	OPRM_HUMAN	opioid receptor, mu 1 isoform MOR-1A	367	Cytoplasmic (Potential).				behavior|negative regulation of cell proliferation|sensory perception	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	mu-opioid receptor activity|protein binding			ovary(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tramadol(DB00193)									0.395349	52.467716	52.87903	17	26	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	154454236	154454236	11293	6	G	A	A	37	37	OPRM1	A	1	1
JARID2	3720	broad.mit.edu	36	6	15576882	15576882	+	Silent	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:15576882G>A	uc003nbj.1	+	c.624G>A	c.(622-624)TCG>TCA	p.S208S		NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein	208					central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)								694				0.413793	184.267868	185.209468	60	85	GG		KEEP	---	---	---	---	capture			Silent	SNP	15576882	15576882	8249	6	G	A	A	37	37	JARID2	A	1	1
SYTL3	94120	broad.mit.edu	36	6	159098264	159098264	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:159098264C>G	uc003qrp.1	+	c.1171C>G	c.(1171-1173)CAG>GAG	p.Q391E	SYTL3_uc003qro.1_Missense_Mutation_p.Q323E|SYTL3_uc003qrq.1_Missense_Mutation_p.Q323E|SYTL3_uc003qrr.1_Missense_Mutation_p.Q391E|SYTL3_uc003qrs.1_Missense_Mutation_p.Q323E	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	391	C2 1.				intracellular protein transport	endomembrane system|membrane	Rab GTPase binding|zinc ion binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)										0.666667	8.289455	8.434241	4	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	159098264	159098264	16005	6	C	G	G	25	25	SYTL3	G	3	3
CENPQ	55166	broad.mit.edu	36	6	49567902	49567902	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:49567902G>A	uc003ozh.1	+	c.762G>A	c.(760-762)ATG>ATA	p.M254I		NM_018132	NP_060602	Q7L2Z9	CENPQ_HUMAN	centromere protein Q	254					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	chromosome, centromeric region|cytosol|nucleoplasm				ovary(2)	2	Lung NSC(77;0.0128)													0.2	7.219974	8.47281	3	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49567902	49567902	3374	6	G	A	A	48	48	CENPQ	A	2	2
C7orf43	55262	broad.mit.edu	36	7	99591360	99591360	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:99591360C>T	uc003utr.1	-	c.1265G>A	c.(1264-1266)CGC>CAC	p.R422H	C7orf43_uc010lgo.1_Missense_Mutation_p.R48H|C7orf43_uc010lgp.1_Missense_Mutation_p.R44H|C7orf43_uc003uts.1_Missense_Mutation_p.R153H	NM_018275	NP_060745	Q8WVR3	CG043_HUMAN	hypothetical protein LOC55262	422											0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)													0.52381	32.519135	32.529193	11	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99591360	99591360	2500	7	C	T	T	27	27	C7orf43	T	1	1
WISP1	8840	broad.mit.edu	36	8	134306906	134306906	+	Silent	SNP	C	G	G			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:134306906C>G	uc003yub.1	+	c.702C>G	c.(700-702)GTC>GTG	p.V234V	WISP1_uc003yuc.1_Silent_p.V147V|WISP1_uc010meb.1_Silent_p.V62V|WISP1_uc010mec.1_Intron|WISP1_uc010med.1_Intron|WISP1_uc003yud.1_Intron	NM_003882	NP_003873	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	234	TSP type-1.				cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding			central_nervous_system(1)|kidney(1)	2	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)											0.291667	36.840984	38.701523	14	34	CC		KEEP	---	---	---	---	capture			Silent	SNP	134306906	134306906	17946	8	C	G	G	32	32	WISP1	G	3	3
PAPPA	5069	broad.mit.edu	36	9	118009575	118009575	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:118009575G>A	uc004bjn.1	+	c.1498G>A	c.(1498-1500)GAG>AAG	p.E500K		NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	500	Metalloprotease.				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|pancreas(1)	5										611				0.092199	7.764073	31.38683	13	128	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118009575	118009575	11849	9	G	A	A	45	45	PAPPA	A	2	2
GARNL3	84253	broad.mit.edu	36	9	129191107	129191107	+	Silent	SNP	C	A	A			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:129191107C>A	uc004bqs.1	+	c.2577C>A	c.(2575-2577)ACC>ACA	p.T859T	GARNL3_uc010mxh.1_Non-coding_Transcript|GARNL3_uc010mxi.1_Silent_p.T107T	NM_032293	NP_115669	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	877					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity|small GTPase regulator activity			central_nervous_system(1)|skin(1)	2														0.238095	14.714226	17.363323	10	32	CC		KEEP	---	---	---	---	capture			Silent	SNP	129191107	129191107	6505	9	C	A	A	22	22	GARNL3	A	3	3
DBH	1621	broad.mit.edu	36	9	135491404	135491404	+	Silent	SNP	G	A	A			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:135491404G>A	uc004cel.1	+	c.90G>A	c.(88-90)CTG>CTA	p.L30L		NM_000787	NP_000778	P09172	DOPO_HUMAN	dopamine beta-hydroxylase precursor	30	Helical; Signal-anchor for type II membrane protein; (Potential).				hormone biosynthetic process|oxidation-reduction process	chromaffin granule lumen|chromaffin granule membrane|extracellular region|integral to membrane|membrane fraction|soluble fraction|transport vesicle membrane	dopamine beta-monooxygenase activity|L-ascorbic acid binding			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Dopamine(DB00988)|Vitamin C(DB00126)									0.241935	30.289732	34.062479	15	47	GG		KEEP	---	---	---	---	capture			Silent	SNP	135491404	135491404	4421	9	G	A	A	47	47	DBH	A	2	2
TLN1	7094	broad.mit.edu	36	9	35688167	35688167	+	Silent	SNP	A	C	C			TCGA-19-1386-01	TCGA-19-1386-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:35688167A>C	uc003zxt.1	-	c.7374T>G	c.(7372-7374)GCT>GCG	p.A2458A		NM_006289	NP_006280	Q9Y490	TLN1_HUMAN	talin 1	2458	I/LWEQ.				axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|cell-cell junction|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)							587				0.25	6.888773	7.80132	4	12	AA		KEEP	---	---	---	---	capture			Silent	SNP	35688167	35688167	16477	9	A	C	C	7	7	TLN1	C	4	4
TMC1	117531	broad.mit.edu	36	9	74620884	74620884	+	Silent	SNP	A	G	G			TCGA-19-1386-01	TCGA-19-1386-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:74620884A>G	uc004aiz.1	+	c.1701A>G	c.(1699-1701)TCA>TCG	p.S567S	TMC1_uc010moz.1_Silent_p.S525S|TMC1_uc004aja.1_Non-coding_Transcript|TMC1_uc004ajb.1_Non-coding_Transcript|TMC1_uc004ajc.1_Silent_p.S421S|TMC1_uc010mpa.1_Silent_p.S421S	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	567	Cytoplasmic (Potential).				sensory perception of sound	integral to membrane				ovary(1)	1						Pancreas(75;173 1345 14232 34245 43413)								0.389381	127.968017	129.180572	44	69	AA		KEEP	---	---	---	---	capture			Silent	SNP	74620884	74620884	16514	9	A	G	G	8	8	TMC1	G	4	4
TLE1	7088	broad.mit.edu	36	9	83389239	83389239	+	Nonsense_Mutation	SNP	C	A	A			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:83389239C>A	uc004alz.1	-	c.2179G>T	c.(2179-2181)GGA>TGA	p.G727*	TLE1_uc004aly.1_Nonsense_Mutation_p.G717*	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1	717	WD 5.				negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)	1						NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)				350				0.095238	7.246084	21.047991	8	76	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	83389239	83389239	16468	9	C	A	A	21	21	TLE1	A	5	3
NINJ1	4814	broad.mit.edu	36	9	94927051	94927051	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:94927051C>G	uc004atg.2	-	c.419G>C	c.(418-420)GGG>GCG	p.G140A	NINJ1_uc004ath.2_Missense_Mutation_p.G90A	NM_004148	NP_004139	Q92982	NINJ1_HUMAN	ninjurin 1	140	Helical; (Potential).				cell adhesion|nervous system development|tissue regeneration	integral to membrane				kidney(1)	1														0.25	13.190681	15.007735	8	24	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	94927051	94927051	10819	9	C	G	G	22	22	NINJ1	G	3	3
GPRASP2	114928	broad.mit.edu	36	X	101857404	101857404	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:101857404G>T	uc004ejk.1	+	c.951G>T	c.(949-951)AAG>AAT	p.K317N	GPRASP2_uc004ejl.1_Missense_Mutation_p.K317N|GPRASP2_uc004ejm.1_Missense_Mutation_p.K317N|GPRASP2_uc010nof.1_Missense_Mutation_p.K317N	NM_138437	NP_612446	Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting	317						cytoplasm	protein binding			ovary(1)	1														0.285714	6.888723	7.469682	4	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	101857404	101857404	6999	23	G	T	T	34	34	GPRASP2	T	3	3
DOCK11	139818	broad.mit.edu	36	X	117694608	117694608	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:117694608G>C	uc004eqp.2	+	c.5340G>C	c.(5338-5340)AAG>AAC	p.K1780N	DOCK11_uc004eqq.2_Missense_Mutation_p.K1559N	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1780	DHR-2.				blood coagulation	cytosol	GTP binding			ovary(3)	3														0.384615	8.863679	9.017657	5	8	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	117694608	117694608	4870	23	G	C	C	35	35	DOCK11	C	3	3
SMARCA1	6594	broad.mit.edu	36	X	128477648	128477648	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:128477648G>C	uc004eun.2	-	c.433C>G	c.(433-435)CGC>GGC	p.R145G	SMARCA1_uc004eup.2_Missense_Mutation_p.R145G	NM_003069	NP_003060	P28370	SMCA1_HUMAN	SWI/SNF-related matrix-associated	145					ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of gene-specific transcription|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding|transcription regulator activity			ovary(3)|skin(1)	4														0.18	8.741514	13.576522	9	41	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128477648	128477648	15266	23	G	C	C	39	39	SMARCA1	C	3	3
OR13H1	347468	broad.mit.edu	36	X	130505966	130505966	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1386-01	TCGA-19-1386-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:130505966C>T	uc004ewh.1	+	c.238C>T	c.(238-240)CAG>TAG	p.Q80*	IGSF1_uc004ewf.1_Intron	NM_001004486	NP_001004486	Q8NG92	O13H1_HUMAN	olfactory receptor, family 13, subfamily H,	80	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Acute lymphoblastic leukemia(192;0.000636)													0.536082	162.194364	162.303755	52	45	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	130505966	130505966	11349	23	C	T	T	21	21	OR13H1	T	5	2
SHROOM4	57477	broad.mit.edu	36	X	50393434	50393434	+	Silent	SNP	G	T	T			TCGA-19-1386-01	TCGA-19-1386-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:50393434G>T	uc004dpe.1	-	c.2379C>A	c.(2377-2379)ACC>ACA	p.T793T	SHROOM4_uc004dpf.1_Silent_p.T677T	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	793					actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding				0	Ovarian(276;0.236)													0.163934	9.599633	16.169828	10	51	GG		KEEP	---	---	---	---	capture			Silent	SNP	50393434	50393434	14791	23	G	T	T	47	47	SHROOM4	T	3	3
SYTL4	94121	broad.mit.edu	36	X	99827695	99827695	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1386-01	TCGA-19-1386-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:99827695T>C	uc004egd.2	-	c.1397A>G	c.(1396-1398)GAT>GGT	p.D466G	SYTL4_uc010nnb.1_Missense_Mutation_p.D138G|SYTL4_uc010nnc.1_Missense_Mutation_p.D466G|SYTL4_uc004ege.2_Missense_Mutation_p.D466G|SYTL4_uc004egf.2_Missense_Mutation_p.D466G|SYTL4_uc004egg.2_3'UTR	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	466					exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding			ovary(2)	2					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)									0.444444	7.390288	7.415452	4	5	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99827695	99827695	16006	23	T	C	C	50	50	SYTL4	C	4	4
FAM171A1	221061	broad.mit.edu	36	10	15296386	15296387	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:15296386_15296387delAC	uc001iob.1	-	c.1206_1207delGT	c.(1204-1209)ATGTCTfs	p.M402fs		NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061	402_403	Cytoplasmic (Potential).					integral to membrane				ovary(2)|breast(1)	3														0.30			29	67				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	15296386	15296387	5695	10	AC	-	-	10	10	FAM171A1	-	5	5
RAB26	25837	broad.mit.edu	36	16	2141573	2141583	+	Frame_Shift_Del	DEL	CAAAGTTCTGG	-	-			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:2141573_2141583delCAAAGTTCTGG	uc002cou.1	+	c.309_319delCAAAGTTCTGG	c.(307-321)AACAAAGTTCTGGACfs	p.N103fs	RAB26_uc010bsf.1_Frame_Shift_Del_p.N37fs	NM_014353	NP_055168	Q9ULW5	RAB26_HUMAN	RAB26, member RAS oncogene family	103_107					exocrine system development|protein transport|regulation of exocytosis|small GTPase mediated signal transduction	intrinsic to plasma membrane	GTP binding|protein binding				0														0.45			42	51				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	2141573	2141583	13372	16	CAAAGTTCTGG	-	-	17	17	RAB26	-	5	5
DPEP2	64174	broad.mit.edu	36	16	66583585	66583586	+	Frame_Shift_Ins	INS	-	TT	TT			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:66583585_66583586insTT	uc002evd.2	-	c.402_403insAA	c.(400-405)GCCTATfs	p.A134fs	DPEP2_uc010cey.1_Frame_Shift_Ins_p.A134fs|DPEP2_uc002eve.1_Frame_Shift_Ins_p.A134fs|DPEP2_uc002evf.1_Non-coding_Transcript	NM_022355	NP_071750	Q9H4A9	DPEP2_HUMAN	dipeptidase 2 precursor	134_135					hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|proteolysis	anchored to membrane|plasma membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)										0.56			14	11				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	66583585	66583586	4898	16	-	TT	TT	15	15	DPEP2	TT	5	5
PQLC1	80148	broad.mit.edu	36	18	75811822	75811841	+	Frame_Shift_Del	DEL	CACCACCCCTCCGAAGACCA	-	-			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:75811822_75811841delCACCACCCCTCCGAAGACCA	uc002lnl.1	-	c.74_93delTGGTCTTCGGAGGGGTGGTG	c.(73-93)ATGGTCTTCGGAGGGGTGGTGfs	p.M25fs	PQLC1_uc010dre.1_5'UTR	NM_025078	NP_079354	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1	25_31	PQ-loop 1.					integral to membrane				large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)										0.36			8	14				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	75811822	75811841	12854	18	CACCACCCCTCCGAAGACCA	-	-	25	25	PQLC1	-	5	5
UPF1	5976	broad.mit.edu	36	19	18825156	18825164	+	Splice_Site_Del	DEL	GATAGTATC	-	-			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:18825156_18825164delGATAGTATC	uc002nkg.1	+	c.e8_splice_site			UPF1_uc002nkf.1_Splice_Site_Del	NM_002911	NP_002902			regulator of nonsense transcripts 1						cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1														0.31			27	59				---	---	---	---	capture_indel			Splice_Site_Del	DEL	18825156	18825164	17563	19	GATAGTATC	-	-	45	45	UPF1	-	5	5
FLG2	388698	broad.mit.edu	36	1	150593106	150593106	+	Frame_Shift_Del	DEL	T	-	-			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:150593106_150593106delT	uc001ezw.2	-	c.3780_3780delA	c.(3778-3780)ACAfs	p.T1260fs		NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1260	Ser-rich.						calcium ion binding|structural molecule activity			ovary(9)|breast(1)	10	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.30			41	94				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	150593106	150593106	6161	1	T	-	-	55	55	FLG2	-	5	5
SYT11	23208	broad.mit.edu	36	1	154105077	154105077	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:154105077_154105077delC	uc001fmg.1	+	c.732_732delC	c.(730-732)TTCfs	p.F244fs		NM_152280	NP_689493	Q9BT88	SYT11_HUMAN	synaptotagmin XI	244	Cytoplasmic (Potential).|C2 1.					cell junction|synaptic vesicle membrane	protein binding|transporter activity			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)											0.35			34	64				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	154105077	154105077	15988	1	C	-	-	30	30	SYT11	-	5	5
CLCNKA	1187	broad.mit.edu	36	1	16229138	16229139	+	Frame_Shift_Ins	INS	-	G	G			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:16229138_16229139insG	uc001axu.1	+	c.1389_1390insG	c.(1387-1392)CCCGGGfs	p.P463fs	CLCNKB_uc001axw.2_Intron|CLCNKA_uc001axt.1_Non-coding_Transcript|CLCNKA_uc001axv.1_Frame_Shift_Ins_p.P463fs	NM_004070	NP_004061	P51800	CLCKA_HUMAN	chloride channel Ka isoform 1	463_464	Helical; (Potential).				excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)									0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	16229138	16229139	3605	1	-	G	G	23	23	CLCNKA	G	5	5
TMCC2	9911	broad.mit.edu	36	1	203477506	203477507	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:203477506_203477507delAG	uc001hbz.1	+	c.458_459delAG	c.(457-459)CAGfs	p.Q153fs		NM_014858	NP_055673	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	153						integral to membrane				pancreas(1)	1	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)											0.67			6	3				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	203477506	203477507	16523	1	AG	-	-	7	7	TMCC2	-	5	5
SLC8A1	6546	broad.mit.edu	36	2	40510200	40510202	+	In_Frame_Del	DEL	AAG	-	-			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:40510200_40510202delAAG	uc002rrx.1	-	c.723_725delCTT	c.(721-726)TTCTTT>TTT	p.241_242FF>F	SLC8A1_uc002rry.1_In_Frame_Del_p.241_242FF>F|SLC8A1_uc002rrz.1_In_Frame_Del_p.241_242FF>F|SLC8A1_uc002rsa.1_In_Frame_Del_p.241_242FF>F|SLC8A1_uc002rsd.2_In_Frame_Del_p.241_242FF>F|SLC8A1_uc002rsb.1_In_Frame_Del_p.241_242FF>F|SLC8A1_uc010fan.1_In_Frame_Del_p.241_242FF>F|SLC8A1_uc002rsc.1_In_Frame_Del_p.241_242FF>F	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	241_242	Poly-Phe.|Helical; (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)	3					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)									0.34			15	29				---	---	---	---	capture_indel			In_Frame_Del	DEL	40510200	40510202	15203	2	AAG	-	-	1	1	SLC8A1	-	5	5
ITGB1BP1	9270	broad.mit.edu	36	2	9476216	9476219	+	Frame_Shift_Del	DEL	GTAC	-	-			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:9476216_9476219delGTAC	uc002qzj.1	-	c.59_62delGTAC	c.(58-63)AGTACTfs	p.S20fs	ITGB1BP1_uc002qzk.1_Frame_Shift_Del_p.S20fs|ITGB1BP1_uc002qzl.1_Non-coding_Transcript|ITGB1BP1_uc002qzm.1_Non-coding_Transcript|ITGB1BP1_uc002qzn.1_Frame_Shift_Del_p.S20fs	NM_004763	NP_004754	O14713	ITBP1_HUMAN	integrin cytoplasmic domain-associated protein 1	20_21	Ser/Thr-rich.				cell migration|cell-matrix adhesion|intracellular protein kinase cascade	cytosol|lamellipodium|membrane|ruffle	protein binding|protein binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.23)										0.38			124	202				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	9476216	9476219	8195	2	GTAC	-	-	36	36	ITGB1BP1	-	5	5
ARPC4	10093	broad.mit.edu	36	3	9814418	9814419	+	In_Frame_Ins	INS	-	TAA	TAA			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:9814418_9814419insTAA	uc003bsz.1	+	c.79_80insTAA	c.(79-81)TCC>TTAACC	p.27_27S>LT	ARPC4_uc003btc.1_5'UTR|TTLL3_uc003btd.2_5'UTR|ARPC4_uc003bta.1_5'UTR|ARPC4_uc003btb.1_5'UTR	NM_005718	NP_005709	P59998	ARPC4_HUMAN	actin related protein 2/3 complex subunit 4	27					actin filament polymerization|actin nucleation	Arp2/3 protein complex|cell projection|cytoplasm	actin binding				0	Medulloblastoma(99;0.227)													0.36			32	58				---	---	---	---	capture_indel			In_Frame_Ins	INS	9814418	9814419	991	3	-	TAA	TAA	54	54	ARPC4	TAA	5	5
N4BP3	23138	broad.mit.edu	36	5	177479323	177479325	+	In_Frame_Del	DEL	CTC	-	-			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:177479323_177479325delCTC	uc003mik.1	+	c.133_135delCTC	c.(133-135)CTCdel	p.L46del	N4BP3_uc003mil.1_5'Flank	NM_015111	NP_055926	O15049	N4BP3_HUMAN	Nedd4 binding protein 3	46						cytoplasmic vesicle membrane					0	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)											0.33			3	6				---	---	---	---	capture_indel			In_Frame_Del	DEL	177479323	177479325	10508	5	CTC	-	-	28	28	N4BP3	-	5	5
DHX29	54505	broad.mit.edu	36	5	54608750	54608753	+	Frame_Shift_Del	DEL	AAAA	-	-			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:54608750_54608753delAAAA	uc003jpx.1	-	c.2224_2227delTTTT	c.(2224-2229)TTTTCTfs	p.F742fs	DHX29_uc010ivw.1_Non-coding_Transcript	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	742_743	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|translation initiation factor activity			ovary(2)|central_nervous_system(1)	3		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)												0.33			55	112				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	54608750	54608753	4682	5	AAAA	-	-	9	9	DHX29	-	5	5
ARID1B	57492	broad.mit.edu	36	6	157496005	157496006	+	Frame_Shift_Ins	INS	-	C	C			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:157496005_157496006insC	uc003qqn.1	+	c.2310_2311insC	c.(2308-2313)GGTCCAfs	p.G770fs	ARID1B_uc003qqo.1_Frame_Shift_Ins_p.G783fs|ARID1B_uc003qqp.1_Frame_Shift_Ins_p.G770fs|ARID1B_uc003qqq.1_Frame_Shift_Ins_p.G212fs	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	828_829					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			breast(1)	1		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)										0.50			4	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	157496005	157496006	929	6	-	C	C	58	58	ARID1B	C	5	5
EHMT1	79813	broad.mit.edu	36	9	139742701	139742703	+	In_Frame_Del	DEL	TTT	-	-			TCGA-19-1386-01	TCGA-19-1386-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:139742701_139742703delTTT	uc004coc.1	+	c.629_631delTTT	c.(628-633)ATTTCT>ACT	p.210_211IS>T	EHMT1_uc004coa.1_In_Frame_Del_p.241_242IS>T|EHMT1_uc004cob.1_In_Frame_Del_p.210_211IS>T	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase	241_242					DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)										0.43			83	108				---	---	---	---	capture_indel			In_Frame_Del	DEL	139742701	139742703	5172	9	TTT	-	-	52	52	EHMT1	-	5	5
