Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
LOXL4	84171	broad.mit.edu	36	10	100007856	100007856	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1387-01	TCGA-19-1387-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:100007856A>C	uc001kpa.1	-	c.977T>G	c.(976-978)GTG>GGG	p.V326G		NM_032211	NP_115587	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4 precursor	326	SRCR 3.				oxidation-reduction process	extracellular space|membrane	copper ion binding|protein binding|scavenger receptor activity			ovary(3)|breast(1)	4		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)										0.333333	7.043896	7.254474	3	6	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100007856	100007856	9275	10	A	C	C	6	6	LOXL4	C	4	4
TACC2	10579	broad.mit.edu	36	10	123837408	123837408	+	Silent	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:123837408C>T	uc001lfv.1	+	c.5403C>T	c.(5401-5403)GAC>GAT	p.D1801D	TACC2_uc001lfw.1_Intron|TACC2_uc009xzx.1_Silent_p.D1801D	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	1801						microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)												0.818182	93.743034	96.880881	27	6	CC		KEEP	---	---	---	---	capture			Silent	SNP	123837408	123837408	16023	10	C	T	T	19	19	TACC2	T	1	1
PTEN	5728	broad.mit.edu	36	10	89701926	89701926	+	Nonsense_Mutation	SNP	T	G	G			TCGA-19-1387-01	TCGA-19-1387-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:89701926T>G	uc001kfb.1	+	c.564T>G	c.(562-564)TAT>TAG	p.Y188*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	188					apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.V166fs*17(3)|p.G165fs*9(3)|p.Y27_N212>Y(2)|p.G165_K342del(1)|p.G165_*404del(1)|p.Y188*(1)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)				31		264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.735577	543.404965	553.911694	153	55	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	89701926	89701926	13192	10	T	G	G	49	49	PTEN	G	5	4
SORBS1	10580	broad.mit.edu	36	10	97164280	97164280	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1387-01	TCGA-19-1387-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:97164280T>G	uc001kkp.1	-	c.771A>C	c.(769-771)AGA>AGC	p.R257S	SORBS1_uc001kkl.1_5'UTR|SORBS1_uc001kkm.1_Intron|SORBS1_uc001kkn.1_Intron|SORBS1_uc001kko.1_Missense_Mutation_p.R257S|SORBS1_uc001kkq.1_Missense_Mutation_p.R188S|SORBS1_uc001kkr.1_Intron|SORBS1_uc001kks.1_Intron|SORBS1_uc001kkt.1_Non-coding_Transcript|SORBS1_uc001kku.1_Intron|SORBS1_uc001kkv.1_Missense_Mutation_p.R225S|SORBS1_uc001kkw.1_Missense_Mutation_p.R257S|SORBS1_uc001kkx.1_Missense_Mutation_p.R225S	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3	257					focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)										0.428571	9.725203	9.756042	3	4	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	97164280	97164280	15427	10	T	G	G	54	54	SORBS1	G	4	4
HYOU1	10525	broad.mit.edu	36	11	118428614	118428614	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:118428614C>A	uc001puu.2	-	c.932G>T	c.(931-933)CGT>CTT	p.R311L	HYOU1_uc001put.2_Missense_Mutation_p.R276L|HYOU1_uc001puw.1_Missense_Mutation_p.R311L	NM_006389	NP_006380	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1 precursor	311						endoplasmic reticulum lumen	ATP binding|protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)										0.282051	28.409924	30.073731	11	28	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118428614	118428614	7770	11	C	A	A	19	19	HYOU1	A	3	3
LRRC4C	57689	broad.mit.edu	36	11	40093391	40093391	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1387-01	TCGA-19-1387-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:40093391T>G	uc001mxa.1	-	c.1028A>C	c.(1027-1029)GAG>GCG	p.E343A	LRRC4C_uc001mxc.1_Missense_Mutation_p.E339A|LRRC4C_uc001mxd.1_Missense_Mutation_p.E339A|LRRC4C_uc001mxb.1_Missense_Mutation_p.E339A|LRRC4C_uc009ykn.1_Missense_Mutation_p.E343A	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand	343	LRRCT.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5		all_lung(304;0.0575)|Lung NSC(402;0.138)												0.144654	24.005004	43.369327	23	136	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40093391	40093391	9383	11	T	G	G	54	54	LRRC4C	G	4	4
DDB2	1643	broad.mit.edu	36	11	47212999	47212999	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:47212999G>A	uc001neb.2	+	c.818G>A	c.(817-819)CGC>CAC	p.R273H	DDB2_uc001nec.2_Intron|DDB2_uc009yli.1_Missense_Mutation_p.R209H|DDB2_uc001ned.2_Intron|DDB2_uc001nee.2_Intron|DDB2_uc001nef.2_Intron|DDB2_uc001neg.2_Missense_Mutation_p.R132H|DDB2_uc001neh.2_Non-coding_Transcript	NM_000107	NP_000098	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2	273	DWD box.|WD 3.		R -> H (in XP-E; impairs interaction with DDB1 and CUL4A).	R->A: Impairs interaction with DDB1.	nucleotide-excision repair, DNA damage removal|protein autoubiquitination|protein polyubiquitination|response to UV	nucleoplasm|protein complex	damaged DNA binding|protein binding			kidney(2)|ovary(1)	3										171				0.611765	337.72948	339.59819	104	66	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47212999	47212999	4495	11	G	A	A	38	38	DDB2	A	1	1
OR4P4	81300	broad.mit.edu	36	11	55163234	55163234	+	Silent	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55163234C>T	uc001nhr.1	+	c.825C>T	c.(823-825)ATC>ATT	p.I275I		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	275	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1														0.397163	163.565976	164.871525	56	85	CC		KEEP	---	---	---	---	capture			Silent	SNP	55163234	55163234	11490	11	C	T	T	29	29	OR4P4	T	2	2
P2RX7	5027	broad.mit.edu	36	12	120087575	120087575	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:120087575C>T	uc001tzm.1	+	c.566C>T	c.(565-567)ACT>ATT	p.T189I	P2RX7_uc001tzn.1_Missense_Mutation_p.T99I|P2RX7_uc001tzo.1_Non-coding_Transcript|P2RX7_uc001tzp.1_5'UTR|P2RX7_uc001tzq.1_Missense_Mutation_p.T19I	NM_002562	NP_002553	A8K2Z0	A8K2Z0_HUMAN	purinergic receptor P2X7	189						integral to membrane	ATP binding|ion channel activity|receptor activity			large_intestine(2)|lung(1)|breast(1)	4	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)									719				0.288136	49.952385	52.326047	17	42	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	120087575	120087575	11758	12	C	T	T	20	20	P2RX7	T	2	2
PRKAG1	5571	broad.mit.edu	36	12	47685194	47685194	+	Nonsense_Mutation	SNP	C	A	A			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:47685194C>A	uc001rsz.1	-	c.358G>T	c.(358-360)GAA>TAA	p.E120*	PRKAG1_uc001rsx.1_Nonsense_Mutation_p.E27*|PRKAG1_uc001rsy.1_Nonsense_Mutation_p.E111*|PRKAG1_uc009zlb.1_Intron	NM_212461	NP_997626	P54619	AAKG1_HUMAN	AMP-activated protein kinase, noncatalytic	111					cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|positive regulation of protein kinase activity|protein phosphorylation|regulation of fatty acid oxidation|regulation of glycolysis|spermatogenesis	cytosol	cAMP-dependent protein kinase activity|cAMP-dependent protein kinase regulator activity|protein kinase binding			kidney(1)	1														0.130872	63.518602	103.003388	39	259	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	47685194	47685194	12943	12	C	A	A	32	32	PRKAG1	A	5	3
POU6F1	5463	broad.mit.edu	36	12	49876854	49876854	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:49876854C>T	uc001rxy.1	-	c.40G>A	c.(40-42)GGA>AGA	p.G14R	POU6F1_uc001rxz.1_Missense_Mutation_p.G14R|POU6F1_uc001rya.1_Missense_Mutation_p.G14R	NM_002702	NP_002693	Q14863	PO6F1_HUMAN	POU class 6 homeobox 1	14	Gln/Pro-rich.				brain development|heart development|muscle organ development|regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1														0.404255	60.916392	61.292764	19	28	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49876854	49876854	12714	12	C	T	T	22	22	POU6F1	T	2	2
NAV3	89795	broad.mit.edu	36	12	76924989	76924989	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:76924989G>A	uc001syp.1	+	c.1540G>A	c.(1540-1542)GCA>ACA	p.A514T	NAV3_uc001syo.1_Missense_Mutation_p.A514T	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	514						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|kidney(1)|pancreas(1)	16										1091				0.445455	152.95316	153.239223	49	61	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	76924989	76924989	10581	12	G	A	A	34	34	NAV3	A	2	2
SLC2A14	144195	broad.mit.edu	36	12	7865118	7865118	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:7865118G>A	uc001qtk.1	-	c.1004C>T	c.(1003-1005)GCG>GTG	p.A335V	SLC2A14_uc001qtl.1_Missense_Mutation_p.A312V|SLC2A14_uc001qtm.1_Missense_Mutation_p.A312V|SLC2A14_uc001qtn.1_Missense_Mutation_p.A335V|SLC2A14_uc001qto.1_5'UTR	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14	335	Helical; Name=8; (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)										0.399083	280.245067	282.166148	87	131	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7865118	7865118	15040	12	G	A	A	38	38	SLC2A14	A	1	1
TNFAIP2	7127	broad.mit.edu	36	14	102671380	102671381	+	Missense_Mutation	DNP	GC	CT	CT			TCGA-19-1387-01	TCGA-19-1387-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:102671380_102671381GC>CT	uc001ymm.1	+	c.1895_1896GC>CT	c.(1894-1896)AGC>ACT	p.S632T	TNFAIP2_uc010awo.1_Missense_Mutation_p.S292T	NM_006291	NP_006282	Q03169	TNAP2_HUMAN	tumor necrosis factor, alpha-induced protein 2	632					angiogenesis|cell differentiation	extracellular space				central_nervous_system(1)	1		Melanoma(154;0.155)	Epithelial(46;0.191)											0.175	7.198803	11.197785	7	33	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	102671380	102671381	16814	14	GC	CT	CT	34	34	TNFAIP2	CT	3	3
C14orf181	400223	broad.mit.edu	36	14	68332632	68332632	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:68332632C>A	uc001xkj.1	-	c.133G>T	c.(133-135)GCG>TCG	p.A45S		NM_207442	NP_997325	Q8N8A1	CD181_HUMAN	hypothetical protein LOC400223	45											0				all cancers(60;0.002)|BRCA - Breast invasive adenocarcinoma(234;0.00204)|OV - Ovarian serous cystadenocarcinoma(108;0.0399)										0.24	9.028179	10.581621	6	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	68332632	68332632	1813	14	C	A	A	27	27	C14orf181	A	3	3
ARHGAP11A	9824	broad.mit.edu	36	15	30703861	30703861	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:30703861G>T	uc001zgy.1	+	c.493G>T	c.(493-495)GAC>TAC	p.D165Y	ARHGAP11A_uc001zgw.1_Missense_Mutation_p.D165Y|ARHGAP11A_uc001zgx.1_Missense_Mutation_p.D165Y	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A isoform 1	165	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			breast(2)|urinary_tract(1)|skin(1)	4		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		Colon(45;757 1134 30003 36652)								0.621622	155.260351	156.219145	46	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30703861	30703861	874	15	G	T	T	45	45	ARHGAP11A	T	3	3
NEO1	4756	broad.mit.edu	36	15	71377874	71377874	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:71377874G>A	uc002avm.2	+	c.4034G>A	c.(4033-4035)GGC>GAC	p.G1345D	NEO1_uc002avn.2_Missense_Mutation_p.G983D	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1	1345	Cytoplasmic (Potential).				axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1														0.112245	10.988888	25.514641	11	87	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71377874	71377874	10735	15	G	A	A	42	42	NEO1	A	2	2
RPGRIP1L	23322	broad.mit.edu	36	16	52244382	52244382	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:52244382G>A	uc002ehp.1	-	c.1718C>T	c.(1717-1719)GCC>GTC	p.A573V	RPGRIP1L_uc002ehn.1_5'UTR|RPGRIP1L_uc002eho.2_Missense_Mutation_p.A573V|RPGRIP1L_uc010cbx.1_Missense_Mutation_p.A573V	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	573					negative regulation of G-protein coupled receptor protein signaling pathway	centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)												0.337838	70.050535	71.772264	25	49	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52244382	52244382	14029	16	G	A	A	42	42	RPGRIP1L	A	2	2
HYDIN	54768	broad.mit.edu	36	16	69609781	69609781	+	Silent	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:69609781G>A	uc002ezr.1	-	c.3396C>T	c.(3394-3396)AAC>AAT	p.N1132N		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	1132										ovary(1)	1		Ovarian(137;0.0654)												0.193084	160.858568	191.345958	67	280	GG		KEEP	---	---	---	---	capture			Silent	SNP	69609781	69609781	7767	16	G	A	A	40	40	HYDIN	A	1	1
PMFBP1	83449	broad.mit.edu	36	16	70711242	70711242	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:70711242C>T	uc002fcc.2	-	c.3031G>A	c.(3031-3033)GCC>ACC	p.A1011T	PMFBP1_uc002fcd.1_Intron|PMFBP1_uc002fce.1_Intron|PMFBP1_uc002fcf.1_Intron	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	1011										ovary(1)	1		Ovarian(137;0.179)												0.133903	48.430972	94.217104	47	304	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70711242	70711242	12560	16	C	T	T	25	25	PMFBP1	T	2	2
GABARAPL2	11345	broad.mit.edu	36	16	74168689	74168689	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:74168689G>A	uc002fen.1	+	c.275G>A	c.(274-276)GGA>GAA	p.G92E	GABARAPL2_uc010cgy.1_Non-coding_Transcript	NM_007285	NP_009216	P60520	GBRL2_HUMAN	GABA(A) receptor-associated protein-like 2	92					autophagy|intra-Golgi vesicle-mediated transport|positive regulation of ATPase activity|protein transport	autophagic vacuole membrane|cytosol|Golgi membrane|membrane fraction	ATPase binding|beta-tubulin binding|GABA receptor binding|microtubule binding|SNARE binding			ovary(1)	1														0.44	204.625007	205.095962	66	84	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74168689	74168689	6405	16	G	A	A	41	41	GABARAPL2	A	2	2
ALDH3A2	224	broad.mit.edu	36	17	19515734	19515734	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:19515734G>A	uc002gwa.1	+	c.1316G>A	c.(1315-1317)AGA>AAA	p.R439K	ALDH3A2_uc002gwb.1_Missense_Mutation_p.R439K|ALDH3A2_uc010cqr.1_Missense_Mutation_p.R246K|ALDH3A2_uc002gwc.1_Missense_Mutation_p.R439K|ALDH3A2_uc002gwd.1_Missense_Mutation_p.R246K	NM_001031806	NP_001026976	P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3A2 isoform 1	439	Cytoplasmic.				cellular aldehyde metabolic process|central nervous system development|epidermis development|lipid metabolic process|oxidation-reduction process|peripheral nervous system development	endoplasmic reticulum membrane|integral to membrane	3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity			ovary(2)	2	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)				NADH(DB00157)									0.225806	70.838863	79.399682	28	96	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19515734	19515734	501	17	G	A	A	33	33	ALDH3A2	A	2	2
SGSM2	9905	broad.mit.edu	36	17	2227975	2227975	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:2227975G>T	uc002fum.2	+	c.2877G>T	c.(2875-2877)TGG>TGT	p.W959C	SGSM2_uc002fun.2_Missense_Mutation_p.W914C|SGSM2_uc002fup.1_Missense_Mutation_p.W92C|SGSM2_uc002fuq.1_Missense_Mutation_p.W76C	NM_014853	NP_055668	O43147	SGSM2_HUMAN	RUN and TBC1 domain containing 1 isoform 1	914	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)										0.477273	70.47677	70.496197	21	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2227975	2227975	14714	17	G	T	T	44	44	SGSM2	T	3	3
KRTAP4-1	85285	broad.mit.edu	36	17	36594197	36594197	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1387-01	TCGA-19-1387-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:36594197A>C	uc002hwe.2	-	c.379T>G	c.(379-381)TGT>GGT	p.C127G		NM_033060	NP_149049	Q9BYQ7	KRA41_HUMAN	keratin associated protein 4-1	146						keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)											0.4375	23.123945	23.17817	7	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36594197	36594197	8870	17	A	C	C	5	5	KRTAP4-1	C	4	4
KRT33A	3883	broad.mit.edu	36	17	36756281	36756281	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:36756281G>A	uc002hwk.1	-	c.1042C>T	c.(1042-1044)CGG>TGG	p.R348W		NM_004138	NP_004129	O76009	KT33A_HUMAN	keratin 33A	348	Coil 2.|Rod.					intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)												0.316547	120.965367	125.117699	44	95	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36756281	36756281	8784	17	G	A	A	38	38	KRT33A	A	1	1
NACA2	342538	broad.mit.edu	36	17	57023314	57023314	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:57023314C>T	uc002izj.1	-	c.10G>A	c.(10-12)GAA>AAA	p.E4K		NM_199290	NP_954984	Q9H009	NACA2_HUMAN	nascent-polypeptide-associated complex alpha	4					protein transport	cytoplasm|nucleus				ovary(1)	1	all_epithelial(1;3.12e-14)													0.296296	68.573279	71.576722	24	57	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57023314	57023314	10529	17	C	T	T	31	31	NACA2	T	1	1
EFCAB3	146779	broad.mit.edu	36	17	57838131	57838131	+	Silent	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:57838131C>T	uc002izu.1	+	c.693C>T	c.(691-693)TCC>TCT	p.S231S		NM_173503	NP_775774	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3 isoform b	231							calcium ion binding				0			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)											0.26971	186.270185	197.800722	65	176	CC		KEEP	---	---	---	---	capture			Silent	SNP	57838131	57838131	5122	17	C	T	T	23	23	EFCAB3	T	1	1
TCEB3B	51224	broad.mit.edu	36	18	42815271	42815271	+	Silent	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:42815271G>A	uc002lcr.1	-	c.363C>T	c.(361-363)AGC>AGT	p.S121S	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.1_Intron|KATNAL2_uc002lcp.2_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	121					transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding|transcription elongation regulator activity			ovary(2)|large_intestine(1)|pancreas(1)	4														0.55	27.315212	27.357718	11	9	GG		KEEP	---	---	---	---	capture			Silent	SNP	42815271	42815271	16208	18	G	A	A	42	42	TCEB3B	A	2	2
ZNF443	10224	broad.mit.edu	36	19	12402257	12402257	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:12402257G>A	uc002mtu.1	-	c.1729C>T	c.(1729-1731)CGA>TGA	p.R577*		NM_005815	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	577	C2H2-type 16.				induction of apoptosis|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1														0.459119	230.858799	231.08946	73	86	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	12402257	12402257	18509	19	G	A	A	40	40	ZNF443	A	5	1
ZNF229	7772	broad.mit.edu	36	19	49625968	49625968	+	Silent	SNP	G	A	A	rs61742026	unknown	TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:49625968G>A	uc002oze.1	-	c.828C>T	c.(826-828)GAC>GAT	p.D276D	ZNF229_uc010ejk.1_De_novo_Start_OutOfFrame|ZNF229_uc010ejl.1_Silent_p.D270D	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	276					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Prostate(69;0.0352)												0.595238	173.700565	174.383161	50	34	GG		KEEP	---	---	---	---	capture			Silent	SNP	49625968	49625968	18373	19	G	A	A	40	40	ZNF229	A	1	1
KDM4B	23030	broad.mit.edu	36	19	5022069	5022069	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:5022069C>G	uc002mbq.2	+	c.675C>G	c.(673-675)ATC>ATG	p.I225M	KDM4B_uc002mbr.2_De_novo_Start_InFrame	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B	225	JmjC.				chromatin modification|oxidation-reduction process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1														0.176471	6.31653	7.992016	3	14	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5022069	5022069	8435	19	C	G	G	31	31	KDM4B	G	3	3
PTPRS	5802	broad.mit.edu	36	19	5195124	5195124	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:5195124G>A	uc002mbv.1	-	c.1358C>T	c.(1357-1359)CCC>CTC	p.P453L	PTPRS_uc002mbu.1_Missense_Mutation_p.P440L|PTPRS_uc002mbw.1_Missense_Mutation_p.P440L|PTPRS_uc002mbx.1_Missense_Mutation_p.P444L|PTPRS_uc002mby.1_Missense_Mutation_p.P440L	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	453	Extracellular (Potential).|Fibronectin type-III 2.				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)										0.156627	24.223454	33.562591	13	70	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5195124	5195124	13269	19	G	A	A	43	43	PTPRS	A	2	2
TNN	63923	broad.mit.edu	36	1	173329871	173329871	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:173329871G>C	uc001gkl.1	+	c.1447G>C	c.(1447-1449)GAC>CAC	p.D483H		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N	483	Fibronectin type-III 3.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)						470				0.136364	24.080037	38.145444	15	95	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	173329871	173329871	16864	1	G	C	C	41	41	TNN	C	3	3
HSPG2	3339	broad.mit.edu	36	1	22050754	22050754	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:22050754G>A	uc009vqd.1	-	c.7033C>T	c.(7033-7035)CGC>TGC	p.R2345C	HSPG2_uc001bfj.1_Missense_Mutation_p.R2344C	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2344	Ig-like C2-type 9.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)	8		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)									0.153846	9.12313	13.597332	6	33	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22050754	22050754	7730	1	G	A	A	39	39	HSPG2	A	1	1
OR2M5	127059	broad.mit.edu	36	1	246375760	246375760	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1387-01	TCGA-19-1387-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:246375760T>A	uc001idz.1	+	c.688T>A	c.(688-690)TCT>ACT	p.S230T		NM_001004690	NP_001004690	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M,	230	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|kidney(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)											0.152012	164.710188	242.463001	102	569	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	246375760	246375760	11419	1	T	A	A	50	50	OR2M5	A	4	4
HPDL	84842	broad.mit.edu	36	1	45566391	45566391	+	Silent	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:45566391G>A	uc001cne.1	+	c.984G>A	c.(982-984)AAG>AAA	p.K328K		NM_032756	NP_116145	Q96IR7	HPDL_HUMAN	glyoxalase domain containing 1	328					aromatic amino acid family metabolic process|oxidation-reduction process		4-hydroxyphenylpyruvate dioxygenase activity|metal ion binding				0	Acute lymphoblastic leukemia(166;0.155)													0.120301	20.401588	39.217825	16	117	GG		KEEP	---	---	---	---	capture			Silent	SNP	45566391	45566391	7625	1	G	A	A	36	36	HPDL	A	2	2
CYP4B1	1580	broad.mit.edu	36	1	47049077	47049077	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:47049077C>T	uc001cqn.2	+	c.191C>T	c.(190-192)ACG>ATG	p.T64M	CYP4B1_uc001cqm.2_Missense_Mutation_p.T64M|CYP4B1_uc009vym.1_Missense_Mutation_p.T64M|CYP4B1_uc009vyl.1_De_novo_Start_OutOfFrame	NM_001099772	NP_001093242	P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B,	64					oxidation-reduction process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)													0.263636	76.938976	82.487347	29	81	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47049077	47049077	4350	1	C	T	T	19	19	CYP4B1	T	1	1
NCOA6	23054	broad.mit.edu	36	20	32792084	32792084	+	Silent	SNP	T	G	G			TCGA-19-1387-01	TCGA-19-1387-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:32792084T>G	uc002xav.1	-	c.5637A>C	c.(5635-5637)CCA>CCC	p.P1879P	NCOA6_uc002xaw.1_Silent_p.P1879P	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1879	EP300/CRSP3-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding|transcription activator activity			ovary(3)|breast(3)|central_nervous_system(1)	7														0.333333	66.029863	67.7135	23	46	TT		KEEP	---	---	---	---	capture			Silent	SNP	32792084	32792084	10632	20	T	G	G	63	63	NCOA6	G	4	4
ZHX3	23051	broad.mit.edu	36	20	39265427	39265427	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:39265427C>T	uc010ggg.1	-	c.1544G>A	c.(1543-1545)CGG>CAG	p.R515Q	ZHX3_uc002xjq.1_Intron|ZHX3_uc002xjr.1_Missense_Mutation_p.R515Q|ZHX3_uc002xjs.1_Missense_Mutation_p.R515Q|ZHX3_uc002xjt.1_Missense_Mutation_p.R515Q|ZHX3_uc002xju.1_Missense_Mutation_p.R515Q|ZHX3_uc002xjv.1_Missense_Mutation_p.R515Q|ZHX3_uc002xjw.1_Missense_Mutation_p.R515Q	NM_015035	NP_055850	Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	515	Required for nuclear localization.|Homeobox 2.				negative regulation of transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1		Myeloproliferative disorder(115;0.00425)												0.571429	110.404039	110.684592	36	27	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39265427	39265427	18268	20	C	T	T	23	23	ZHX3	T	1	1
SLC23A2	9962	broad.mit.edu	36	20	4798672	4798672	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:4798672G>A	uc002wlg.1	-	c.1130C>T	c.(1129-1131)GCG>GTG	p.A377V	SLC23A2_uc002wlh.1_Missense_Mutation_p.A377V|SLC23A2_uc002wli.2_Missense_Mutation_p.A376V	NM_005116	NP_976072	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase	377	Helical; (Potential).				L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2														0.295918	67.584864	71.210715	29	69	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4798672	4798672	14960	20	G	A	A	38	38	SLC23A2	A	1	1
SALL4	57167	broad.mit.edu	36	20	49841892	49841892	+	Silent	SNP	A	T	T			TCGA-19-1387-01	TCGA-19-1387-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr20:49841892A>T	uc002xwh.2	-	c.537T>A	c.(535-537)ACT>ACA	p.T179T	SALL4_uc010gii.1_Silent_p.T179T|SALL4_uc002xwi.2_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	179					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2														0.170732	10.897095	15.106811	7	34	AA		KEEP	---	---	---	---	capture			Silent	SNP	49841892	49841892	14293	20	A	T	T	15	15	SALL4	T	4	4
KRTAP19-2	337969	broad.mit.edu	36	21	30781422	30781422	+	Silent	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:30781422G>A	uc002yof.1	-	c.117C>T	c.(115-117)TGC>TGT	p.C39C		NM_181608	NP_853639	Q3LHN2	KR192_HUMAN	keratin associated protein 19-2	39						intermediate filament					0														0.1875	20.787274	25.14536	9	39	GG		KEEP	---	---	---	---	capture			Silent	SNP	30781422	30781422	8844	21	G	A	A	42	42	KRTAP19-2	A	2	2
MCM5	4174	broad.mit.edu	36	22	34136884	34136884	+	Silent	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:34136884G>A	uc003anu.2	+	c.900G>A	c.(898-900)CAG>CAA	p.Q300Q	MCM5_uc010gwr.1_Silent_p.Q109Q|MCM5_uc003anv.2_Silent_p.Q257Q|MCM5_uc010gws.1_Non-coding_Transcript|MCM5_uc003anw.1_Silent_p.Q84Q	NM_006739	NP_006730	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	300					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)	1														0.116505	13.626883	28.534539	12	91	GG		KEEP	---	---	---	---	capture			Silent	SNP	34136884	34136884	9779	22	G	A	A	35	35	MCM5	A	2	2
IMP4	92856	broad.mit.edu	36	2	130819504	130819504	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1387-01	TCGA-19-1387-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:130819504T>G	uc002tra.1	+	c.282T>G	c.(280-282)AGT>AGG	p.S94R		NM_033416	NP_219484	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein,	94	Brix.				rRNA processing|translation	nucleolus|ribonucleoprotein complex	aminoacyl-tRNA ligase activity|ATP binding|protein binding			central_nervous_system(2)	2	Colorectal(110;0.1)													0.325581	41.537653	42.69702	14	29	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130819504	130819504	8021	2	T	G	G	60	60	IMP4	G	4	4
MYCN	4613	broad.mit.edu	36	2	15999768	15999768	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:15999768C>T	uc002rci.1	+	c.131C>T	c.(130-132)CCC>CTC	p.P44L	MYCNOS_uc002rcg.1_5'Flank|MYCNOS_uc002rch.1_5'Flank|MYCN_uc002rcj.1_Missense_Mutation_p.P44L	NM_005378	NP_005369	P04198	MYCN_HUMAN	v-myc myelocytomatosis viral related oncogene,	44					regulation of transcription from RNA polymerase II promoter	chromatin|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity	p.P44L(1)		central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)						p.P44L(LOUCY-Tumor)	50				0.391304	25.469498	25.707442	9	14	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15999768	15999768	10416	2	C	T	T	22	22	MYCN	T	2	2
CERKL	375298	broad.mit.edu	36	2	182139074	182139074	+	Silent	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:182139074G>A	uc002unx.1	-	c.633C>T	c.(631-633)CAC>CAT	p.H211H	CERKL_uc010frk.1_Intron|CERKL_uc002uny.1_Silent_p.H211H|CERKL_uc002unz.1_Intron|CERKL_uc002uob.1_Intron|CERKL_uc002uoa.1_Intron|CERKL_uc002uoc.1_Intron|CERKL_uc002uod.1_Silent_p.H6H|CERKL_uc002uoe.1_Silent_p.H211H	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b	211	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|visual perception	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)											0.410714	154.233151	155.012151	46	66	GG		KEEP	---	---	---	---	capture			Silent	SNP	182139074	182139074	3401	2	G	A	A	40	40	CERKL	A	1	1
ADCY3	109	broad.mit.edu	36	2	24899655	24899655	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:24899655G>A	uc002rfs.2	-	c.2810C>T	c.(2809-2811)ACA>ATA	p.T937I	ADCY3_uc002rfr.2_Missense_Mutation_p.T524I	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3	937	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)													0.141414	22.084003	34.365225	14	85	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	24899655	24899655	296	2	G	A	A	48	48	ADCY3	A	2	2
SENP7	57337	broad.mit.edu	36	3	102660526	102660526	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:102660526G>A	uc003dut.1	-	c.247C>T	c.(247-249)CGA>TGA	p.R83*	SENP7_uc003duu.1_Nonsense_Mutation_p.R83*|SENP7_uc003duv.1_Nonsense_Mutation_p.R50*|SENP7_uc003duw.1_Nonsense_Mutation_p.R83*|SENP7_uc003dux.1_Nonsense_Mutation_p.R50*	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1	83					proteolysis	nucleus	cysteine-type peptidase activity			ovary(2)|lung(1)	3														0.345679	352.911498	359.720202	112	212	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	102660526	102660526	14537	3	G	A	A	39	39	SENP7	A	5	1
NPRL2	10641	broad.mit.edu	36	3	50360608	50360608	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:50360608G>C	uc003daj.1	-	c.883C>G	c.(883-885)CGA>GGA	p.R295G	ZMYND10_uc003dag.1_5'Flank|ZMYND10_uc010hll.1_5'Flank|ZMYND10_uc003dah.1_5'Flank|ZMYND10_uc010hlm.1_5'Flank|NPRL2_uc003dai.1_Missense_Mutation_p.R175G|CYB561D2_uc003dak.1_5'Flank|CYB561D2_uc003dal.1_5'Flank|CYB561D2_uc003dam.1_5'Flank	NM_006545	NP_006536	Q8WTW4	NPRL2_HUMAN	tumor suppressor candidate 4	295					negative regulation of kinase activity		protein binding|protein kinase activity			lung(1)	1										248				0.236364	30.846061	34.342656	13	42	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	50360608	50360608	11002	3	G	C	C	38	38	NPRL2	C	3	3
STAB1	23166	broad.mit.edu	36	3	52516687	52516687	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:52516687C>A	uc003dej.1	+	c.2008C>A	c.(2008-2010)CAA>AAA	p.Q670K	STAB1_uc003dei.1_Missense_Mutation_p.Q670K	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	670	Extracellular (Potential).				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|pancreas(1)|breast(1)|central_nervous_system(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)										0.235294	6.588262	7.681508	4	13	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52516687	52516687	15755	3	C	A	A	21	21	STAB1	A	3	3
SRGAP3	9901	broad.mit.edu	36	3	9081235	9081235	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:9081235C>T	uc003brf.1	-	c.517G>A	c.(517-519)GAG>AAG	p.E173K	SRGAP3_uc003brg.1_Missense_Mutation_p.E173K|SRGAP3_uc003bri.1_Non-coding_Transcript|SRGAP3_uc003brk.2_Missense_Mutation_p.E173K|SRGAP3_uc003brj.1_Missense_Mutation_p.E33K	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	173					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|urinary_tract(1)|breast(1)	6				OV - Ovarian serous cystadenocarcinoma(96;0.0563)										0.162437	65.270515	86.616536	32	165	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9081235	9081235	15661	3	C	T	T	32	32	SRGAP3	T	2	2
ADAMTS3	9508	broad.mit.edu	36	4	73373398	73373398	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:73373398C>A	uc003hgk.1	-	c.2983G>T	c.(2983-2985)GCT>TCT	p.A995S		NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	995	TSP type-1 4.				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			NSCLC(168;1941 2048 2918 13048 43078)								0.301887	85.411175	89.09948	32	74	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73373398	73373398	268	4	C	A	A	26	26	ADAMTS3	A	3	3
SLCO6A1	133482	broad.mit.edu	36	5	101841323	101841323	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1387-01	TCGA-19-1387-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:101841323A>G	uc003knn.2	-	c.758T>C	c.(757-759)TTT>TCT	p.F253S	SLCO6A1_uc003kno.2_Intron|SLCO6A1_uc003knp.1_Missense_Mutation_p.F253S|SLCO6A1_uc003knq.1_Intron	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	253	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|central_nervous_system(1)	4		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)										0.561644	710.202071	711.409163	205	160	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	101841323	101841323	15229	5	A	G	G	1	1	SLCO6A1	G	4	4
PPIP5K2	23262	broad.mit.edu	36	5	102554512	102554512	+	Silent	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:102554512G>A	uc003kod.2	+	c.3423G>A	c.(3421-3423)AAG>AAA	p.K1141K	PPIP5K2_uc003koe.1_Silent_p.K1120K|PPIP5K2_uc003kof.1_Silent_p.K323K	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1	1141					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)	1														0.33871	123.710988	126.563708	42	82	GG		KEEP	---	---	---	---	capture			Silent	SNP	102554512	102554512	12768	5	G	A	A	34	34	PPIP5K2	A	2	2
TERT	7015	broad.mit.edu	36	5	1308458	1308458	+	Missense_Mutation	SNP	C	T	T	rs62331332	unknown	TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:1308458C>T	uc003jcb.1	-	c.3101G>A	c.(3100-3102)CGC>CAC	p.R1034H	TERT_uc003jbz.1_Missense_Mutation_p.R230H|TERT_uc003jca.1_Missense_Mutation_p.R1022H|TERT_uc003jcc.1_Missense_Mutation_p.R971H|TERT_uc003jcd.1_Non-coding_Transcript|TERT_uc003jce.1_Non-coding_Transcript	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1	1034	CTE.				anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase	cytoplasm|nuclear telomere cap complex|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(6)|central_nervous_system(2)|ovary(1)|skin(1)	10	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)							563				0.34375	27.71036	28.402683	11	21	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1308458	1308458	16291	5	C	T	T	27	27	TERT	T	1	1
PCDHA13	56136	broad.mit.edu	36	5	140243477	140243477	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140243477G>C	uc003lif.1	+	c.1440G>C	c.(1438-1440)CAG>CAC	p.Q480H	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA4_uc003lhi.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.1_Intron|PCDHA6_uc003lho.1_Intron|PCDHA6_uc003lhn.1_Intron|PCDHA7_uc003lhq.1_Intron|PCDHA8_uc003lhs.1_Intron|PCDHA9_uc003lhu.1_Intron|PCDHA10_uc003lhx.1_Intron|PCDHA10_uc003lhw.1_Intron|PCDHA11_uc003lia.1_Intron|PCDHA12_uc003lic.1_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.Q480H|PCDHA13_uc003lid.1_Missense_Mutation_p.Q480H	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	480	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|central_nervous_system(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			Melanoma(147;1739 1852 5500 27947 37288)								0.397059	75.177117	75.816424	27	41	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140243477	140243477	11943	5	G	C	C	35	35	PCDHA13	C	3	3
KCTD16	57528	broad.mit.edu	36	5	143566496	143566496	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:143566496G>A	uc003lnm.1	+	c.26G>A	c.(25-27)CGT>CAT	p.R9H	KCTD16_uc003lnn.1_Missense_Mutation_p.R9H	NM_020768	NP_065819	Q68DU8	KCD16_HUMAN	potassium channel tetramerisation domain	9						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(2)|ovary(1)	3		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)											0.201794	107.259334	125.67811	45	178	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	143566496	143566496	8409	5	G	A	A	40	40	KCTD16	A	1	1
ARHGEF37	389337	broad.mit.edu	36	5	148986841	148986841	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:148986841C>A	uc003lra.1	+	c.1474C>A	c.(1474-1476)CCA>ACA	p.P492T		NM_001001669	NP_001001669	A1IGU5	ARH37_HUMAN	hypothetical protein LOC389337	492					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0														0.421053	16.285789	16.39114	8	11	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	148986841	148986841	921	5	C	A	A	30	30	ARHGEF37	A	3	3
KIF4B	285643	broad.mit.edu	36	5	154374538	154374538	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1387-01	TCGA-19-1387-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:154374538T>G	uc010jih.1	+	c.926T>G	c.(925-927)ATG>AGG	p.M309R		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	309	Kinesin-motor.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)											0.191617	75.101929	89.943339	32	135	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	154374538	154374538	8615	5	T	G	G	51	51	KIF4B	G	4	4
CDHR2	54825	broad.mit.edu	36	5	175930828	175930828	+	Silent	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:175930828G>A	uc003mem.1	+	c.324G>A	c.(322-324)AGG>AGA	p.R108R	CDHR2_uc003men.1_Silent_p.R108R	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor	108	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2														0.155172	15.633227	22.23159	9	49	GG		KEEP	---	---	---	---	capture			Silent	SNP	175930828	175930828	3248	5	G	A	A	43	43	CDHR2	A	2	2
ECT2L	345930	broad.mit.edu	36	6	139216866	139216866	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1387-01	TCGA-19-1387-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:139216866T>G	uc003qif.1	+	c.1080T>G	c.(1078-1080)ATT>ATG	p.I360M		NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	hypothetical protein LOC345930	360					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0														0.588235	109.560581	109.907731	30	21	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	139216866	139216866	5089	6	T	G	G	63	63	ECT2L	G	4	4
HIST1H2AG	8969	broad.mit.edu	36	6	27208981	27208981	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1387-01	TCGA-19-1387-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:27208981A>T	uc003niw.1	+	c.152A>T	c.(151-153)TAT>TTT	p.Y51F	HIST1H2BJ_uc003niu.1_5'Flank|HIST1H2BJ_uc003niv.1_5'Flank	NM_021064	NP_066408	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	51					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding				0														0.439024	49.147482	49.279212	18	23	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	27208981	27208981	7418	6	A	T	T	16	16	HIST1H2AG	T	4	4
BMP5	653	broad.mit.edu	36	6	55847485	55847485	+	Silent	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:55847485G>A	uc003pcq.1	-	c.138C>T	c.(136-138)CAC>CAT	p.H46H		NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein	46					cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)											0.44	246.960089	247.506645	77	98	GG		KEEP	---	---	---	---	capture			Silent	SNP	55847485	55847485	1488	6	G	A	A	40	40	BMP5	A	1	1
PIK3CG	5294	broad.mit.edu	36	7	106295909	106295909	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:106295909G>A	uc003vdv.2	+	c.667G>A	c.(667-669)GTC>ATC	p.V223I	PIK3CG_uc003vdu.1_Missense_Mutation_p.V223I|PIK3CG_uc003vdw.1_Missense_Mutation_p.V223I	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	223					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			central_nervous_system(8)|lung(7)|pancreas(3)|ovary(2)|skin(1)	21										292				0.127273	20.385864	35.279928	14	96	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	106295909	106295909	12340	7	G	A	A	40	40	PIK3CG	A	1	1
IGF2BP3	10643	broad.mit.edu	36	7	23476148	23476148	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1387-01	TCGA-19-1387-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:23476148T>C	uc003swg.1	-	c.107A>G	c.(106-108)AAG>AGG	p.K36R	IGF2BP3_uc003swh.1_Non-coding_Transcript	NM_006547	NP_006538	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding	36	RRM 1.				anatomical structure morphogenesis|negative regulation of translation|regulation of cytokine biosynthetic process|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			ovary(2)	2														0.208333	11.961949	13.852468	5	19	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23476148	23476148	7876	7	T	C	C	56	56	IGF2BP3	C	4	4
OSBPL3	26031	broad.mit.edu	36	7	24877884	24877884	+	Splice_Site_SNP	SNP	A	T	T			TCGA-19-1387-01	TCGA-19-1387-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:24877884A>T	uc003sxf.1	-	c.e4_splice_site			OSBPL3_uc003sxg.1_Splice_Site_SNP|OSBPL3_uc003sxh.1_Splice_Site_SNP|OSBPL3_uc003sxi.1_Splice_Site_SNP|OSBPL3_uc003sxd.1_Splice_Site_SNP|OSBPL3_uc003sxe.1_Splice_Site_SNP	NM_015550	NP_056365			oxysterol-binding protein-like protein 3 isoform						lipid transport		lipid binding|protein binding			skin(1)	1														0.132576	51.249532	85.865248	35	229	AA		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	24877884	24877884	11690	7	A	T	T	14	14	OSBPL3	T	5	4
ZFAT	57623	broad.mit.edu	36	8	135681963	135681963	+	Silent	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:135681963C>T	uc003yup.1	-	c.2373G>A	c.(2371-2373)CAG>CAA	p.Q791Q	ZFAT_uc003yun.1_Silent_p.Q779Q|ZFAT_uc003yuo.1_Silent_p.Q779Q|ZFAT_uc010meh.1_Silent_p.Q779Q|ZFAT_uc010mei.1_Non-coding_Transcript|ZFAT_uc003yuq.1_Silent_p.Q779Q|ZFAT_uc003yur.1_Silent_p.Q779Q|ZFAT-AS_uc003yus.1_Non-coding_Transcript	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1	791	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)											0.280488	257.448061	271.666582	92	236	CC		KEEP	---	---	---	---	capture			Silent	SNP	135681963	135681963	18220	8	C	T	T	32	32	ZFAT	T	2	2
RNF20	56254	broad.mit.edu	36	9	103354352	103354352	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1387-01	TCGA-19-1387-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:103354352C>T	uc004bbn.1	+	c.1517C>T	c.(1516-1518)TCT>TTT	p.S506F		NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20	506	Potential.				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|regulation of gene-specific transcription|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)	7		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)										0.302326	154.080014	160.117422	52	120	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	103354352	103354352	13951	9	C	T	T	32	32	RNF20	T	2	2
KCNT1	57582	broad.mit.edu	36	9	137801986	137801986	+	Silent	SNP	G	A	A			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:137801986G>A	uc004cgn.1	+	c.1641G>A	c.(1639-1641)GAG>GAA	p.E547E	KCNT1_uc010nbf.1_Silent_p.E502E|KCNT1_uc004cgo.1_Silent_p.E296E	NM_020822	NP_065873	B9EGP2	B9EGP2_HUMAN	potassium channel, subfamily T, member 1	547						membrane	binding|calcium-activated potassium channel activity|catalytic activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)										0.222222	9.09073	10.368678	4	14	GG		KEEP	---	---	---	---	capture			Silent	SNP	137801986	137801986	8396	9	G	A	A	34	34	KCNT1	A	2	2
RASEF	158158	broad.mit.edu	36	9	84814464	84814464	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1387-01	TCGA-19-1387-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:84814464A>C	uc004amo.1	-	c.871T>G	c.(871-873)TTA>GTA	p.L291V		NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	291	Potential.				protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			lung(1)|breast(1)	2														0.462963	166.843957	166.972403	50	58	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	84814464	84814464	13529	9	A	C	C	1	1	RASEF	C	4	4
FBP2	8789	broad.mit.edu	36	9	96389442	96389443	+	Missense_Mutation	DNP	TA	GG	GG			TCGA-19-1387-01	TCGA-19-1387-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:96389442_96389443TA>GG	uc004auv.1	-	c.300_301TA>CC	c.(298-303)AATAAG>AACCAG	p.K101Q		NM_003837	NP_003828	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	101					fructose metabolic process|gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|metal ion binding				0		Acute lymphoblastic leukemia(62;0.136)												0.153846	15.865419	29.308666	18	99	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	96389442	96389443	5942	9	TA	GG	GG	61	61	FBP2	GG	4	4
CXorf22	170063	broad.mit.edu	36	X	35879914	35879914	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1387-01	TCGA-19-1387-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:35879914A>G	uc004ddj.1	+	c.959A>G	c.(958-960)GAT>GGT	p.D320G	CXorf22_uc010ngv.1_Non-coding_Transcript	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	320										large_intestine(1)|lung(1)|ovary(1)	3														0.861538	195.536373	203.745738	56	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35879914	35879914	4262	23	A	G	G	12	12	CXorf22	G	4	4
WNK3	65267	broad.mit.edu	36	X	54281567	54281567	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1387-01	TCGA-19-1387-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:54281567G>C	uc004dtc.1	-	c.3947C>G	c.(3946-3948)ACA>AGA	p.T1316R	WNK3_uc004dtd.1_Missense_Mutation_p.T1269R	NM_020922	NP_065973	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 1	1269					intracellular protein kinase cascade|protein phosphorylation		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11										290				0.145833	7.8892	13.687193	7	41	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54281567	54281567	17953	23	G	C	C	48	48	WNK3	C	3	3
MED12	9968	broad.mit.edu	36	X	70257921	70257921	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1387-01	TCGA-19-1387-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:70257921A>G	uc004dyy.1	+	c.755A>G	c.(754-756)CAT>CGT	p.H252R	MED12_uc004dyz.1_Missense_Mutation_p.H252R|MED12_uc004dza.1_Missense_Mutation_p.H99R	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	252					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription mediator activity|thyroid hormone receptor binding|transcription activator activity|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)													0.781726	510.413044	524.810796	154	43	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70257921	70257921	9817	23	A	G	G	8	8	MED12	G	4	4
SYTL4	94121	broad.mit.edu	36	X	99827764	99827764	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1387-01	TCGA-19-1387-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:99827764T>C	uc004egd.2	-	c.1328A>G	c.(1327-1329)CAG>CGG	p.Q443R	SYTL4_uc010nnb.1_Missense_Mutation_p.Q115R|SYTL4_uc010nnc.1_Missense_Mutation_p.Q443R|SYTL4_uc004ege.2_Missense_Mutation_p.Q443R|SYTL4_uc004egf.2_Missense_Mutation_p.Q443R|SYTL4_uc004egg.2_3'UTR	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	443	C2 1.				exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding			ovary(2)	2					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)									0.544118	120.170678	120.284951	37	31	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99827764	99827764	16006	23	T	C	C	55	55	SYTL4	C	4	4
DNAH9	1770	broad.mit.edu	36	17	11625107	11625122	+	Frame_Shift_Del	DEL	AACAAGAAACTCATCT	-	-			TCGA-19-1387-01	TCGA-19-1387-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:11625107_11625122delAACAAGAAACTCATCT	uc002gne.1	+	c.7609_7624delAACAAGAAACTCATCT	c.(7609-7626)AACAAGAAACTCATCTATfs	p.N2537fs	DNAH9_uc010coo.1_Frame_Shift_Del_p.N1831fs	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2537_2542	AAA 3 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	10		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)										0.50			168	169				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	11625107	11625122	4791	17	AACAAGAAACTCATCT	-	-	9	9	DNAH9	-	5	5
POLD1	5424	broad.mit.edu	36	19	55598249	55598254	+	In_Frame_Del	DEL	CAAGGT	-	-			TCGA-19-1387-01	TCGA-19-1387-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:55598249_55598254delCAAGGT	uc010eny.1	+	c.1098_1103delCAAGGT	c.(1096-1104)GCCAAGGTG>GCG	p.KV367del	POLD1_uc002psb.2_In_Frame_Del_p.KV367del|POLD1_uc002psc.2_In_Frame_Del_p.KV367del|POLD1_uc010enx.1_Non-coding_Transcript	NM_002691	NP_002682	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic	367_368					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			central_nervous_system(1)	1		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)										0.71			5	2				---	---	---	---	capture_indel			In_Frame_Del	DEL	55598249	55598254	12618	19	CAAGGT	-	-	21	21	POLD1	-	5	5
LENG9	94059	broad.mit.edu	36	19	59665957	59665958	+	Frame_Shift_Ins	INS	-	G	G			TCGA-19-1387-01	TCGA-19-1387-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:59665957_59665958insG	uc002qfy.1	-	c.564_565insC	c.(562-567)CCCAAGfs	p.P188fs		NM_198988	NP_945339	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	210_211					RNA metabolic process	intracellular	catalytic activity|nucleic acid binding|zinc ion binding				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	59665957	59665958	9049	19	-	G	G	63	63	LENG9	G	5	5
GGT7	2686	broad.mit.edu	36	20	32911508	32911509	+	Splice_Site_Ins	INS	-	G	G			TCGA-19-1387-01	TCGA-19-1387-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:32911508_32911509insG	uc002xay.1	-	c.e6_splice_site			GGT7_uc002xaz.1_Splice_Site_Ins|GGT7_uc002xba.1_3'UTR	NM_178026	NP_821158			gamma-glutamyltransferase 7						glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(1)	1														0.43			3	4				---	---	---	---	capture_indel			Splice_Site_Ins	INS	32911508	32911509	6632	20	-	G	G	55	55	GGT7	G	5	5
IRAK2	3656	broad.mit.edu	36	3	10255627	10255637	+	Frame_Shift_Del	DEL	CCCACAGAGAA	-	-			TCGA-19-1387-01	TCGA-19-1387-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:10255627_10255637delCCCACAGAGAA	uc003bve.1	+	c.1669_1679delCCCACAGAGAA	c.(1669-1680)CCCACAGAGAATfs	p.P557fs		NM_001570	NP_001561	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	557_560					activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8										288				0.30			66	153				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	10255627	10255637	8126	3	CCCACAGAGAA	-	-	22	22	IRAK2	-	5	5
BRPF1	7862	broad.mit.edu	36	3	9756117	9756130	+	Frame_Shift_Del	DEL	ACGGGCGCTGGGCC	-	-			TCGA-19-1387-01	TCGA-19-1387-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:9756117_9756130delACGGGCGCTGGGCC	uc003bsf.1	+	c.1034_1047delACGGGCGCTGGGCC	c.(1033-1047)GACGGGCGCTGGGCCfs	p.D345fs	BRPF1_uc003bse.1_Frame_Shift_Del_p.D345fs|BRPF1_uc003bsg.1_Frame_Shift_Del_p.D345fs	NM_001003694	NP_001003694	P55201	BRPF1_HUMAN	bromodomain and PHD finger-containing protein 1	345_349					histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|transcription activator activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Medulloblastoma(99;0.227)													0.34			53	101				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	9756117	9756130	1551	3	ACGGGCGCTGGGCC	-	-	10	10	BRPF1	-	5	5
TRAM1L1	133022	broad.mit.edu	36	4	118225666	118225690	+	Frame_Shift_Del	DEL	AACTGCATTCTCTTGTTAATTTTAT	-	-			TCGA-19-1387-01	TCGA-19-1387-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:118225666_118225690delAACTGCATTCTCTTGTTAATTTTAT	uc003ibv.2	-	c.308_332delATAAAATTAACAAGAGAATGCAGTT	c.(307-333)GATAAAATTAACAAGAGAATGCAGTTCfs	p.D103fs		NM_152402	NP_689615	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like	103_111	Cytoplasmic (Potential).				protein transport|transmembrane transport	endoplasmic reticulum membrane|integral to membrane				central_nervous_system(1)	1														0.32			33	70				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	118225666	118225690	16996	4	AACTGCATTCTCTTGTTAATTTTAT	-	-	9	9	TRAM1L1	-	5	5
