Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
GBF1	8729	broad.mit.edu	36	10	104110866	104110866	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:104110866A>G	uc001kux.1	+	c.1487A>G	c.(1486-1488)GAG>GGG	p.E496G	GBF1_uc001kuy.1_Missense_Mutation_p.E496G|GBF1_uc001kuz.1_Missense_Mutation_p.E497G	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	496					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)										0.363636	7.591175	7.773271	4	7	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	104110866	104110866	6537	10	A	G	G	11	11	GBF1	G	4	4
XPNPEP1	7511	broad.mit.edu	36	10	111632342	111632342	+	Silent	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:111632342G>A	uc009xxt.1	-	c.879C>T	c.(877-879)CAC>CAT	p.H293H	XPNPEP1_uc001kyp.1_Silent_p.H250H|XPNPEP1_uc001kyq.1_Silent_p.H179H	NM_020383	NP_065116	Q9NQW7	XPP1_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 1,	250					bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity			ovary(3)|pancreas(1)	4		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)										0.363636	7.085156	7.269543	4	7	GG		KEEP	---	---	---	---	capture			Silent	SNP	111632342	111632342	18025	10	G	A	A	44	44	XPNPEP1	A	2	2
TDRD1	56165	broad.mit.edu	36	10	115970492	115970492	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:115970492T>G	uc001lbg.1	+	c.2670T>G	c.(2668-2670)GAT>GAG	p.D890E	TDRD1_uc001lbf.2_Missense_Mutation_p.D767E|TDRD1_uc001lbh.1_Missense_Mutation_p.D881E|TDRD1_uc001lbi.1_Missense_Mutation_p.D881E|TDRD1_uc001lbj.2_Missense_Mutation_p.D599E	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	890					DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)										0.285714	6.488817	7.070075	4	10	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	115970492	115970492	16256	10	T	G	G	51	51	TDRD1	G	4	4
KCNK18	338567	broad.mit.edu	36	10	118959419	118959419	+	Silent	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:118959419G>A	uc001ldc.1	+	c.774G>A	c.(772-774)TTG>TTA	p.L258L		NM_181840	NP_862823	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	258	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0		Colorectal(252;0.19)		all cancers(201;0.0211)										0.25641	172.11827	186.815994	70	203	GG		KEEP	---	---	---	---	capture			Silent	SNP	118959419	118959419	8370	10	G	A	A	47	47	KCNK18	A	2	2
KCNK18	338567	broad.mit.edu	36	10	118959482	118959482	+	Silent	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:118959482G>A	uc001ldc.1	+	c.837G>A	c.(835-837)TTG>TTA	p.L279L		NM_181840	NP_862823	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	279	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0		Colorectal(252;0.19)		all cancers(201;0.0211)										0.250784	198.450774	216.459309	80	239	GG		KEEP	---	---	---	---	capture			Silent	SNP	118959482	118959482	8370	10	G	A	A	47	47	KCNK18	A	2	2
C10orf91	170393	broad.mit.edu	36	10	134111496	134111496	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:134111496G>A	uc001llm.1	+	c.379G>A	c.(379-381)GGC>AGC	p.G127S		NM_173541	NP_775812	Q5T1B1	CJ091_HUMAN	hypothetical protein LOC170393	127											0		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;6.95e-05)|Epithelial(32;0.000142)|all cancers(32;0.000162)										0.909091	22.740286	23.979352	10	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	134111496	134111496	1661	10	G	A	A	43	43	C10orf91	A	2	2
CYP2E1	1571	broad.mit.edu	36	10	135195653	135195653	+	Missense_Mutation	SNP	G	C	C	rs56040284	unknown	TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:135195653G>C	uc001lnj.1	+	c.523G>C	c.(523-525)GCG>CCG	p.A175P	CYP2E1_uc001lnk.1_Missense_Mutation_p.A38P|CYP2E1_uc009ybl.1_5'UTR|CYP2E1_uc009ybm.1_Intron|CYP2E1_uc001lnl.1_5'UTR	NM_000773	NP_000764	P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E,	175					drug metabolic process|heterocycle metabolic process|monoterpenoid metabolic process|oxidation-reduction process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding			central_nervous_system(3)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Dacarbazine(DB00851)|Dapsone(DB00250)|Enflurane(DB00228)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethosuximide(DB00593)|Fomepizole(DB01213)|Glutathione(DB00143)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Isoniazid(DB00951)|Menadione(DB00170)|Mephenytoin(DB00532)|Methoxyflurane(DB01028)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitrofurantoin(DB00698)|Orphenadrine(DB01173)|Phenelzine(DB00780)|Quinidine(DB00908)|S-Adenosylmethionine(DB00118)|Sevoflurane(DB01236)|Theophylline(DB00277)|Tolbutamide(DB01124)									0.189189	6.887853	10.257265	7	30	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	135195653	135195653	4335	10	G	C	C	38	38	CYP2E1	C	3	3
GPR158	57512	broad.mit.edu	36	10	25741194	25741194	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:25741194C>T	uc001isj.1	+	c.1121C>T	c.(1120-1122)CCG>CTG	p.P374L		NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	374	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)	7														0.156863	14.868625	20.601202	8	43	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	25741194	25741194	6938	10	C	T	T	23	23	GPR158	T	1	1
ARHGAP12	94134	broad.mit.edu	36	10	32141710	32141710	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:32141710T>C	uc001ivz.1	-	c.1882A>G	c.(1882-1884)AAA>GAA	p.K628E	ARHGAP12_uc001iwb.1_Missense_Mutation_p.K621E|ARHGAP12_uc001iwc.1_Missense_Mutation_p.K596E|ARHGAP12_uc009xlq.1_Missense_Mutation_p.K549E|ARHGAP12_uc001iwd.1_Missense_Mutation_p.K596E|ARHGAP12_uc001ivy.1_Missense_Mutation_p.K574E	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	628					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)												0.4	7.693418	7.781822	4	6	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32141710	32141710	876	10	T	C	C	62	62	ARHGAP12	C	4	4
SGPL1	8879	broad.mit.edu	36	10	72301727	72301727	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:72301727G>T	uc001jrm.1	+	c.1037G>T	c.(1036-1038)AGC>ATC	p.S346I	SGPL1_uc009xqk.1_Non-coding_Transcript	NM_003901	NP_003892	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	346	Cytoplasmic (Potential).				apoptosis|carboxylic acid metabolic process|ceramide metabolic process|sphingolipid catabolic process	integral to endoplasmic reticulum membrane	carboxy-lyase activity|pyridoxal phosphate binding|sphinganine-1-phosphate aldolase activity				0					Pyridoxal Phosphate(DB00114)	Colon(151;1054 2458 6676 40971)								0.222222	10.971315	13.540074	8	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	72301727	72301727	14709	10	G	T	T	34	34	SGPL1	T	3	3
TTC18	118491	broad.mit.edu	36	10	74704200	74704200	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:74704200T>A	uc009xrc.1	-	c.3042A>T	c.(3040-3042)AAA>AAT	p.K1014N	TTC18_uc001jtv.2_Missense_Mutation_p.K118N|TTC18_uc001jtw.2_Missense_Mutation_p.K118N|TTC18_uc001jtx.1_Missense_Mutation_p.K395N|TTC18_uc001jty.1_Missense_Mutation_p.K1014N	NM_145170	NP_660153	Q5T0N1	TTC18_HUMAN	tetratricopeptide repeat domain 18	1014	TPR 6.						binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)													0.206897	6.525108	8.85031	6	23	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74704200	74704200	17239	10	T	A	A	56	56	TTC18	A	4	4
ARCN1	372	broad.mit.edu	36	11	117959836	117959836	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:117959836G>A	uc009zag.1	+	c.673G>A	c.(673-675)GGC>AGC	p.G225S	ARCN1_uc001ptq.1_Missense_Mutation_p.G184S|ARCN1_uc009zah.1_Intron	NM_001655	NP_001646	P48444	COPD_HUMAN	archain isoform 1	184					COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	clathrin adaptor complex|COPI vesicle coat|cytosol					0	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)										0.2	13.83642	16.344966	6	24	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	117959836	117959836	853	11	G	A	A	47	47	ARCN1	A	2	2
IFITM3	10410	broad.mit.edu	36	11	310723	310723	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:310723C>T	uc001lpa.2	-	c.91G>A	c.(91-93)GTG>ATG	p.V31M		NM_021034	NP_066362	Q01628	IFM3_HUMAN	interferon-induced transmembrane protein 3	31	Extracellular (Potential).				response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane				central_nervous_system(7)	7		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)										0.371429	23.044402	23.559808	13	22	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	310723	310723	7829	11	C	T	T	17	17	IFITM3	T	2	2
ART5	116969	broad.mit.edu	36	11	3617663	3617663	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:3617663G>T	uc001lyb.1	-	c.572C>A	c.(571-573)GCC>GAC	p.A191D	ART5_uc001lyc.1_Missense_Mutation_p.A191D|ART5_uc001lyd.2_Missense_Mutation_p.A191D|ART5_uc009yea.1_Missense_Mutation_p.A191D	NM_053017	NP_443750	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5 precursor	191						extracellular region	NAD(P)+-protein-arginine ADP-ribosyltransferase activity			ovary(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)										0.263158	6.855878	7.830186	5	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3617663	3617663	1018	11	G	T	T	42	42	ART5	T	3	3
RAG1	5896	broad.mit.edu	36	11	36552845	36552845	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:36552845C>G	uc001mwu.2	+	c.1415C>G	c.(1414-1416)GCC>GGC	p.A472G	RAG1_uc001mwt.2_Non-coding_Transcript|RAG1_uc009ykl.1_Missense_Mutation_p.A472G	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	472					histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4	all_lung(20;0.226)	all_hematologic(20;0.107)				Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)				117				0.416667	9.060634	9.135819	5	7	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36552845	36552845	13463	11	C	G	G	26	26	RAG1	G	3	3
GYLTL1B	120071	broad.mit.edu	36	11	45904697	45904698	+	Missense_Mutation	DNP	CA	TG	TG			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:45904697_45904698CA>TG	uc001nbv.1	+	c.1137_1138CA>TG	c.(1135-1140)CCCAGC>CCTGGC	p.S380G	GYLTL1B_uc001nbw.1_Missense_Mutation_p.S349G|GYLTL1B_uc001nbx.1_Missense_Mutation_p.S380G|GYLTL1B_uc001nby.1_Missense_Mutation_p.S63G|GYLTL1B_uc001nbz.1_5'Flank	NM_152312	NP_689525	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	380	Lumenal (Potential).				muscle cell homeostasis	Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2				GBM - Glioblastoma multiforme(35;0.226)										0.192982	15.883064	20.91545	11	46	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	45904697	45904698	7187	11	CA	TG	TG	21	21	GYLTL1B	TG	2	2
MADD	8567	broad.mit.edu	36	11	47256398	47256398	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:47256398G>T	uc001ner.1	+	c.1202G>T	c.(1201-1203)AGC>ATC	p.S401I	MADD_uc001neq.1_Missense_Mutation_p.S401I|MADD_uc001nes.1_Missense_Mutation_p.S401I|MADD_uc001net.1_Missense_Mutation_p.S401I|MADD_uc001neu.1_Missense_Mutation_p.S401I|MADD_uc001nev.1_Missense_Mutation_p.S401I|MADD_uc009yln.1_Missense_Mutation_p.S401I|MADD_uc001ney.1_Missense_Mutation_p.S401I|MADD_uc001nez.1_Missense_Mutation_p.S401I|MADD_uc001new.1_Missense_Mutation_p.S401I|MADD_uc001nex.1_Missense_Mutation_p.S401I	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing	401	DENN.				activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(3)|central_nervous_system(2)	10				Lung(87;0.182)						5				0.318182	11.304049	11.958145	7	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47256398	47256398	9529	11	G	T	T	34	34	MADD	T	3	3
OR4C12	283093	broad.mit.edu	36	11	49960178	49960178	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:49960178C>G	uc001nhc.1	-	c.436G>C	c.(436-438)GCC>CCC	p.A146P		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	146	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2														0.170732	11.506678	15.709568	7	34	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49960178	49960178	11452	11	C	G	G	26	26	OR4C12	G	3	3
OR5J2	282775	broad.mit.edu	36	11	55701605	55701605	+	Silent	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55701605T>C	uc001nil.1	+	c.936T>C	c.(934-936)TGT>TGC	p.C312C		NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J,	312	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4	Esophageal squamous(21;0.00693)													0.75	6.562736	6.748554	3	1	TT		KEEP	---	---	---	---	capture			Silent	SNP	55701605	55701605	11575	11	T	C	C	60	60	OR5J2	C	4	4
CDHR5	53841	broad.mit.edu	36	11	609573	609574	+	Missense_Mutation	DNP	GG	TC	TC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:609573_609574GG>TC	uc001lqj.1	-	c.1193_1194CC>GA	c.(1192-1194)GCC>GGA	p.A398G	CDHR5_uc001lqk.1_Missense_Mutation_p.A398G|CDHR5_uc009ycc.1_Missense_Mutation_p.A232G|CDHR5_uc009ycd.1_Missense_Mutation_p.A398G|CDHR5_uc001lql.1_Missense_Mutation_p.A398G|CDHR5_uc001lqm.2_Missense_Mutation_p.A232G|CDHR5_uc009yce.1_Missense_Mutation_p.A367G	NM_021924	NP_068743	Q9HBB8	CDHR5_HUMAN	mucin and cadherin-like isoform 1	398	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0														0.571429	9.195582	9.226107	4	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	609573	609574	3251	11	GG	TC	TC	47	47	CDHR5	TC	3	3
SCGB2A2	4250	broad.mit.edu	36	11	61794312	61794312	+	Nonsense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:61794312C>A	uc001ntc.1	+	c.48C>A	c.(46-48)TGC>TGA	p.C16*	SCGB2A2_uc009ynx.1_Nonsense_Mutation_p.C16*	NM_002411	NP_002402	Q13296	SG2A2_HUMAN	secretoglobin, family 2A, member 2	16						extracellular region	steroid binding			ovary(1)	1														0.238095	7.958703	9.280697	5	16	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	61794312	61794312	14381	11	C	A	A	28	28	SCGB2A2	A	5	3
RTN3	10313	broad.mit.edu	36	11	63243215	63243215	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:63243215G>A	uc001nxq.1	+	c.665G>A	c.(664-666)GGC>GAC	p.G222D	RTN3_uc001nxo.1_Intron|RTN3_uc001nxm.1_Intron|RTN3_uc001nxn.1_Missense_Mutation_p.G203D|RTN3_uc001nxp.1_Intron|RTN3_uc009yov.1_Missense_Mutation_p.G110D	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b	222					apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1														0.21875	10.403375	12.743493	7	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	63243215	63243215	14207	11	G	A	A	42	42	RTN3	A	2	2
FLRT1	23769	broad.mit.edu	36	11	63640337	63640337	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:63640337G>C	uc001nyi.1	+	c.22G>C	c.(22-24)GCC>CCC	p.A8P	MACROD1_uc001nyh.1_Intron|FLRT1_uc009ypc.1_Missense_Mutation_p.A8P	NM_013280	NP_037412	Q9NZU1	FLRT1_HUMAN	fibronectin leucine rich transmembrane protein	Error:Variant_position_missing_in_Q9NZU1_after_alignment					cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity				0														0.363636	7.991389	8.173384	4	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	63640337	63640337	6180	11	G	C	C	38	38	FLRT1	C	3	3
SNX15	29907	broad.mit.edu	36	11	64551659	64551659	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:64551659A>G	uc001oci.2	+	c.74A>G	c.(73-75)TAC>TGC	p.Y25C	SNX15_uc009ypy.1_Missense_Mutation_p.Y25C|SNX15_uc001ocj.1_Missense_Mutation_p.Y25C|SNX15_uc001ock.1_Missense_Mutation_p.Y25C	NM_013306	NP_037438	Q9NRS6	SNX15_HUMAN	sorting nexin 15 isoform A	25	PX.				cell communication|intracellular protein transport	cytoplasmic vesicle membrane|cytosol	phosphatidylinositol binding|protein transporter activity			ovary(1)	1						Esophageal Squamous(56;269 1304 3324 8253)						OREG0021069	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.208333	8.258776	10.153927	5	19	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64551659	64551659	15386	11	A	G	G	14	14	SNX15	G	4	4
SAC3D1	29901	broad.mit.edu	36	11	64568294	64568294	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:64568294A>G	uc001ocl.1	+	c.596A>G	c.(595-597)GAG>GGG	p.E199G	SAC3D1_uc001ocm.1_Missense_Mutation_p.E199G	NM_013299	NP_037431			SAC3 domain containing 1												0														0.75	7.043856	7.249664	3	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64568294	64568294	14282	11	A	G	G	11	11	SAC3D1	G	4	4
GPR133	283383	broad.mit.edu	36	12	130022070	130022070	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:130022070G>A	uc001uit.2	+	c.302G>A	c.(301-303)GGC>GAC	p.G101D		NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	101	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)										0.214286	6.972848	9.064739	6	22	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130022070	130022070	6917	12	G	A	A	42	42	GPR133	A	2	2
IQSEC3	440073	broad.mit.edu	36	12	141370	141372	+	Missense_Mutation	TNP	GAC	TTT	TTT			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:141370_141372GAC>TTT	uc001qhw.1	+	c.1552_1554GAC>TTT	c.(1552-1554)GAC>TTT	p.D518F	IQSEC3_uc001qhu.1_Missense_Mutation_p.D518F	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	821	SEC7.				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)	3	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)										0.833333	10.971798	11.593604	5	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	141370	141372	8122	12	GAC	TTT	TTT	45	45	IQSEC3	TTT	3	3
MAP3K12	7786	broad.mit.edu	36	12	52162119	52162119	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:52162119T>C	uc001sdn.1	-	c.2453A>G	c.(2452-2454)GAT>GGT	p.D818G	MAP3K12_uc001sdm.1_Missense_Mutation_p.D785G	NM_006301	NP_006292	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase	785					histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			lung(2)|ovary(1)|breast(1)	4										178		OREG0021873	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.153846	9.903329	17.369048	10	55	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52162119	52162119	9629	12	T	C	C	50	50	MAP3K12	C	4	4
STAT6	6778	broad.mit.edu	36	12	55788300	55788301	+	Missense_Mutation	DNP	AT	GG	GG			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:55788300_55788301AT>GG	uc009zpg.1	-	c.175_176AT>CC	c.(175-177)ATG>CCG	p.M59P	STAT6_uc009zpe.1_Missense_Mutation_p.M10P|STAT6_uc009zpf.1_Missense_Mutation_p.M10P|STAT6_uc001sna.1_Missense_Mutation_p.M10P	NM_003153	NP_003144	P42226	STAT6_HUMAN	signal transducer and activator of transcription	10					regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(2)|lung(1)	3										241				0.333333	10.741175	11.185424	6	12	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	55788300	55788301	15790	12	AT	GG	GG	8	8	STAT6	GG	4	4
CPSF6	11052	broad.mit.edu	36	12	67937922	67937922	+	Nonsense_Mutation	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:67937922G>T	uc001suu.2	+	c.664G>T	c.(664-666)GGA>TGA	p.G222*	CPSF6_uc001sut.2_Nonsense_Mutation_p.G222*	NM_007007	NP_008938	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6,	222	Pro-rich.				mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)											0.277778	7.055272	7.864886	5	13	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	67937922	67937922	3968	12	G	T	T	35	35	CPSF6	T	5	3
ZFC3H1	196441	broad.mit.edu	36	12	70343084	70343084	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:70343084C>G	uc001swo.1	-	c.574G>C	c.(574-576)GAG>CAG	p.E192Q	ZFC3H1_uc001swp.2_Missense_Mutation_p.E192Q|THAP2_uc001swq.1_5'Flank	NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	192					RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)	4														0.2	6.72097	9.250788	6	24	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70343084	70343084	18221	12	C	G	G	32	32	ZFC3H1	G	3	3
BBS10	79738	broad.mit.edu	36	12	75263725	75263725	+	Silent	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:75263725T>C	uc001syd.1	-	c.2171A>G	c.(2170-2172)TAA>TGA	p.*724*		NM_024685	NP_078961	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	724					cellular protein metabolic process|photoreceptor cell maintenance|response to stimulus|retina homeostasis|sensory cilium assembly	cilium	ATP binding			ovary(1)	1														0.333333	10.434793	10.88222	6	12	TT		KEEP	---	---	---	---	capture			Silent	SNP	75263725	75263725	1357	12	T	C	C	61	61	BBS10	C	4	4
KLRG1	10219	broad.mit.edu	36	12	9039144	9039144	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:9039144A>T	uc001qvh.2	+	c.350A>T	c.(349-351)CAG>CTG	p.Q117L	KLRG1_uc001qvg.1_Missense_Mutation_p.Q117L	NM_005810	NP_005801	Q96E93	KLRG1_HUMAN	killer cell lectin-like receptor subfamily G,	117	C-type lectin.|Extracellular (Potential).				cell surface receptor linked signaling pathway|cellular defense response|inflammatory response|regulation of immune response	integral to membrane	receptor activity|sugar binding			central_nervous_system(1)	1														0.166667	7.220452	12.95321	9	45	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9039144	9039144	8735	12	A	T	T	7	7	KLRG1	T	4	4
TMTC4	84899	broad.mit.edu	36	13	100085072	100085072	+	Silent	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:100085072G>C	uc001vot.1	-	c.1494C>G	c.(1492-1494)CCC>CCG	p.P498P	TMTC4_uc001vou.1_Silent_p.P479P|TMTC4_uc001vov.1_Silent_p.P224P|TMTC4_uc001vow.1_Silent_p.P262P	NM_032813	NP_001073137	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat	479	TPR 1.					integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)													0.238095	7.356657	8.681012	5	16	GG		KEEP	---	---	---	---	capture			Silent	SNP	100085072	100085072	16804	13	G	C	C	43	43	TMTC4	C	3	3
ATP12A	479	broad.mit.edu	36	13	24172961	24172961	+	Silent	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:24172961G>A	uc010aaa.1	+	c.1800G>A	c.(1798-1800)CCG>CCA	p.P600P	ATP12A_uc001upp.1_Silent_p.P594P	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A	594	Cytoplasmic (Potential).				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	Pancreas(156;1582 1935 18898 22665 26498)								0.142857	9.823156	14.986164	6	36	GG		KEEP	---	---	---	---	capture			Silent	SNP	24172961	24172961	1141	13	G	A	A	37	37	ATP12A	A	1	1
EPSTI1	94240	broad.mit.edu	36	13	42426090	42426090	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:42426090T>G	uc001uyw.1	-	c.557A>C	c.(556-558)CAG>CCG	p.Q186P	EPSTI1_uc001uyx.1_Missense_Mutation_p.Q186P	NM_001002264	NP_001002264	Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 isoform 1	186	Potential.									ovary(1)	1		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)										0.6	6.620782	6.663669	3	2	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42426090	42426090	5391	13	T	G	G	55	55	EPSTI1	G	4	4
RB1	5925	broad.mit.edu	36	13	47928340	47928340	+	Splice_Site_SNP	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:47928340G>T	uc001vcb.1	+	c.e19_splice_site				NM_000321	NP_000312			retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|transcription repressor activity|ubiquitin protein ligase binding			lung(93)|eye(89)|central_nervous_system(47)|bone(22)|breast(20)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|soft_tissue(8)|prostate(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	355		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)			6		568	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.294118	7.959006	8.610478	5	12	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	47928340	47928340	13559	13	G	T	T	35	35	RB1	T	5	3
MLNR	2862	broad.mit.edu	36	13	48692649	48692649	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:48692649A>T	uc001vcr.1	+	c.175A>T	c.(175-177)ACC>TCC	p.T59S		NM_001507	NP_001498	O43193	MTLR_HUMAN	motilin receptor	59	Cytoplasmic (Potential).				digestion	integral to plasma membrane	growth hormone-releasing hormone receptor activity				0		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)										0.6	6.721607	6.764627	3	2	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48692649	48692649	10022	13	A	T	T	10	10	MLNR	T	4	4
RCBTB1	55213	broad.mit.edu	36	13	49038870	49038870	+	Silent	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:49038870T>C	uc001vde.1	-	c.162A>G	c.(160-162)CTA>CTG	p.L54L		NM_018191	NP_060661	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and	54	RCC1 1.				cell cycle|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus					0		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)										0.24	8.427739	9.981347	6	19	TT		KEEP	---	---	---	---	capture			Silent	SNP	49038870	49038870	13640	13	T	C	C	53	53	RCBTB1	C	4	4
PCDH20	64881	broad.mit.edu	36	13	60883717	60883717	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:60883717A>G	uc001vid.2	-	c.2516T>C	c.(2515-2517)GTG>GCG	p.V839A	PCDH20_uc001vie.1_Missense_Mutation_p.V812A	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	812	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)										0.15493	7.561549	15.685009	11	60	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60883717	60883717	11935	13	A	G	G	6	6	PCDH20	G	4	4
OR4K1	79544	broad.mit.edu	36	14	19474551	19474551	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:19474551G>T	uc001vwj.1	+	c.886G>T	c.(886-888)GCA>TCA	p.A296S		NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K,	296	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)										0.178571	21.820514	27.262592	10	46	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19474551	19474551	11477	14	G	T	T	34	34	OR4K1	T	3	3
OR4N5	390437	broad.mit.edu	36	14	19682598	19682598	+	Silent	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:19682598G>A	uc001vwp.1	+	c.864G>A	c.(862-864)ACG>ACA	p.T288T		NM_001004724	NP_001004724	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N,	288	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)										0.456693	159.507282	159.716689	58	69	GG		KEEP	---	---	---	---	capture			Silent	SNP	19682598	19682598	11489	14	G	A	A	38	38	OR4N5	A	1	1
TINF2	26277	broad.mit.edu	36	14	23780095	23780095	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:23780095T>C	uc001woa.2	-	c.575A>G	c.(574-576)TAT>TGT	p.Y192C	TINF2_uc010alm.1_Missense_Mutation_p.Y16C|TINF2_uc001wob.2_Missense_Mutation_p.Y192C|TINF2_uc001woc.2_Intron	NM_001099274	NP_001092744	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	192					negative regulation of epithelial cell proliferation|negative regulation of protein ADP-ribosylation|negative regulation of telomere maintenance via telomerase|positive regulation of telomere maintenance|protein localization to chromosome, telomeric region|telomere assembly|telomere maintenance via telomere lengthening	nuclear telomere cap complex|nucleoplasm|perinucleolar chromocenter	protein binding|protein binding|telomeric DNA binding				0				GBM - Glioblastoma multiforme(265;0.0185)										0.4375	12.906089	12.962941	7	9	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23780095	23780095	16452	14	T	C	C	49	49	TINF2	C	4	4
C14orf101	54916	broad.mit.edu	36	14	56155215	56155215	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:56155215C>T	uc001xcm.1	+	c.1207C>T	c.(1207-1209)CAA>TAA	p.Q403*	C14orf101_uc001xcj.1_Non-coding_Transcript|C14orf101_uc001xcl.1_Non-coding_Transcript|C14orf101_uc001xcn.1_Non-coding_Transcript|C14orf101_uc001xco.1_5'UTR	NM_017799	NP_060269	Q9NX78	CN101_HUMAN	hypothetical protein LOC54916	403						integral to membrane				breast(1)	1				OV - Ovarian serous cystadenocarcinoma(311;0.226)										0.171429	6.719207	10.307963	6	29	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	56155215	56155215	1782	14	C	T	T	21	21	C14orf101	T	5	2
C14orf37	145407	broad.mit.edu	36	14	57675512	57675512	+	Silent	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:57675512T>C	uc001xdc.1	-	c.318A>G	c.(316-318)ACA>ACG	p.T106T	C14orf37_uc001xdd.2_Silent_p.T106T|C14orf37_uc001xde.1_Silent_p.T106T	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407	106	Extracellular (Potential).					integral to membrane	binding				0														0.241379	9.797729	11.581174	7	22	TT		KEEP	---	---	---	---	capture			Silent	SNP	57675512	57675512	1820	14	T	C	C	55	55	C14orf37	C	4	4
MTHFD1	4522	broad.mit.edu	36	14	63985982	63985982	+	Silent	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:63985982C>T	uc010aqf.1	+	c.2346C>T	c.(2344-2346)GCC>GCT	p.A782A	MTHFD1_uc001xhb.1_Silent_p.A782A|ZBTB25_uc001xhc.2_3'UTR	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1	782	Formyltetrahydrofolate synthetase.				folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|oxidation-reduction process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)								0.217391	14.616797	18.016866	10	36	CC		KEEP	---	---	---	---	capture			Silent	SNP	63985982	63985982	10320	14	C	T	T	23	23	MTHFD1	T	1	1
SPTB	6710	broad.mit.edu	36	14	64340157	64340157	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:64340157T>C	uc001xhr.1	-	c.395A>G	c.(394-396)AAC>AGC	p.N132S	SPTB_uc001xhs.1_Missense_Mutation_p.N132S|SPTB_uc001xht.1_Missense_Mutation_p.N132S|SPTB_uc001xhu.1_Missense_Mutation_p.N132S	NM_001024858	NP_001020029	P11277	SPTB1_HUMAN	spectrin beta isoform a	132	CH 1.|Actin-binding.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|lung(1)|central_nervous_system(1)	9		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)										0.277778	8.259558	9.065569	5	13	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64340157	64340157	15632	14	T	C	C	60	60	SPTB	C	4	4
ZFYVE26	23503	broad.mit.edu	36	14	67343965	67343965	+	Silent	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:67343965C>A	uc001xka.1	-	c.789G>T	c.(787-789)CTG>CTT	p.L263L	ZFYVE26_uc001xkc.2_Silent_p.L263L	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	263					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	phosphatidylinositol-3-phosphate binding|protein binding|zinc ion binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)										0.444444	8.5947	8.619306	4	5	CC		KEEP	---	---	---	---	capture			Silent	SNP	67343965	67343965	18258	14	C	A	A	25	25	ZFYVE26	A	3	3
ACOT4	122970	broad.mit.edu	36	14	73131601	73131602	+	Missense_Mutation	DNP	TT	GA	GA			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:73131601_73131602TT>GA	uc001xoo.1	+	c.756_757TT>GA	c.(754-759)GTTTCC>GTGACC	p.S253T		NM_152331	NP_689544	Q8N9L9	ACOT4_HUMAN	peroxisomal acyl-CoA thioesterase 2B	253					acyl-CoA metabolic process|dicarboxylic acid metabolic process|long-chain fatty acid metabolic process|saturated monocarboxylic acid metabolic process|short-chain fatty acid metabolic process|succinyl-CoA metabolic process|unsaturated monocarboxylic acid metabolic process|very long-chain fatty acid metabolic process	peroxisome	carboxylesterase activity|palmitoyl-CoA hydrolase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00331)										0.307692	6.888627	7.321311	4	9	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	73131601	73131602	154	14	TT	GA	GA	64	64	ACOT4	GA	4	4
KIAA0317	9870	broad.mit.edu	36	14	74200222	74200222	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:74200222A>C	uc001xqb.1	-	c.2426T>G	c.(2425-2427)CTG>CGG	p.L809R		NM_001039479	NP_001034568	O15033	K0317_HUMAN	hypothetical protein LOC9870	809	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|intracellular	ubiquitin-protein ligase activity			ovary(2)|kidney(1)|central_nervous_system(1)|pancreas(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00404)										0.266667	6.38713	7.130211	4	11	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74200222	74200222	8474	14	A	C	C	7	7	KIAA0317	C	4	4
FLRT2	23768	broad.mit.edu	36	14	85157729	85157729	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:85157729T>C	uc001xvr.1	+	c.118T>C	c.(118-120)TGC>CGC	p.C40R	FLRT2_uc010atd.1_Missense_Mutation_p.C40R	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein	40	Extracellular (Potential).|LRRNT.				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(234;0.0319)										0.174603	9.171648	15.506439	11	52	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	85157729	85157729	6181	14	T	C	C	59	59	FLRT2	C	4	4
CASC5	57082	broad.mit.edu	36	15	38703208	38703208	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:38703208G>A	uc010bbs.1	+	c.3532G>A	c.(3532-3534)GAC>AAC	p.D1178N	CASC5_uc001zme.2_Missense_Mutation_p.D1152N|CASC5_uc010bbt.1_Missense_Mutation_p.D1152N|CASC5_uc010bbu.1_Missense_Mutation_p.D1002N	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	1178	2.|2 X 104 AA approximate repeats.				acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(1)|central_nervous_system(1)	2		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)						629				0.206897	15.94268	18.244696	6	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38703208	38703208	2782	15	G	A	A	41	41	CASC5	A	2	2
RTF1	23168	broad.mit.edu	36	15	39554143	39554143	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr15:39554143A>C	uc001zny.1	+	c.862A>C	c.(862-864)AAA>CAA	p.K288Q		NM_015138	NP_055953	Q92541	RTF1_HUMAN	Paf1/RNA polymerase II complex component	413	Plus3.				histone modification|regulation of transcription, DNA-dependent|transcription initiation, DNA-dependent	nucleoplasm	protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)										0.21875	9.195743	11.544299	7	25	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39554143	39554143	14201	15	A	C	C	5	5	RTF1	C	4	4
DUOX2	50506	broad.mit.edu	36	15	43191331	43191332	+	Missense_Mutation	DNP	TC	GA	GA			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:43191331_43191332TC>GA	uc010bea.1	-	c.439_440GA>TC	c.(439-441)GAC>TCC	p.D147S	DUOX2_uc001zun.1_Missense_Mutation_p.D147S|DUOXA2_uc001zuo.1_5'Flank|DUOXA2_uc010beb.1_5'Flank	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	147	Extracellular (Potential).|Peroxidase-like; mediates peroxidase activity (By similarity).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|oxidation-reduction process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|pancreas(1)	3		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)										0.333333	7.091198	7.388811	4	8	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	43191331	43191332	4986	15	TC	GA	GA	58	58	DUOX2	GA	4	4
VPS13C	54832	broad.mit.edu	36	15	60038949	60038949	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr15:60038949T>C	uc002agz.1	-	c.4046A>G	c.(4045-4047)GAT>GGT	p.D1349G	VPS13C_uc002aha.1_Missense_Mutation_p.D1306G|VPS13C_uc002ahb.1_Missense_Mutation_p.D1349G|VPS13C_uc002ahc.1_Missense_Mutation_p.D1306G	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	1349					protein localization					ovary(2)	2														0.444444	9.896772	9.921197	4	5	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60038949	60038949	17758	15	T	C	C	50	50	VPS13C	C	4	4
IGDCC3	9543	broad.mit.edu	36	15	63411409	63411409	+	Silent	SNP	T	G	G			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr15:63411409T>G	uc002aos.2	-	c.1071A>C	c.(1069-1071)CCA>CCC	p.P357P	IGDCC3_uc002aor.1_5'Flank	NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	357	Extracellular (Potential).|Ig-like C2-type 4.									ovary(3)	3														0.266667	7.388623	8.130749	4	11	TT		KEEP	---	---	---	---	capture			Silent	SNP	63411409	63411409	7869	15	T	G	G	59	59	IGDCC3	G	4	4
PLIN1	5346	broad.mit.edu	36	15	88014237	88014237	+	Silent	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:88014237G>T	uc002boh.1	-	c.576C>A	c.(574-576)CTC>CTA	p.L192L		NM_002666	NP_002657	O60240	PLIN1_HUMAN	perilipin	192					triglyceride catabolic process	lipid particle	lipid binding			central_nervous_system(1)|skin(1)	2														0.5	9.192809	9.192809	4	4	GG		KEEP	---	---	---	---	capture			Silent	SNP	88014237	88014237	12515	15	G	T	T	41	41	PLIN1	T	3	3
LRRC28	123355	broad.mit.edu	36	15	97743784	97743785	+	Missense_Mutation	DNP	AC	CA	CA			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:97743784_97743785AC>CA	uc002bva.1	+	c.1058_1059AC>CA	c.(1057-1059)TAC>TCA	p.Y353S	LRRC28_uc002bvb.1_Missense_Mutation_p.Y199S|LRRC28_uc002bvc.1_Missense_Mutation_p.T300H|LRRC28_uc002bvd.1_Missense_Mutation_p.Y79S	NM_144598	NP_653199	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	353											0	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)											0.5	10.97017	10.97017	5	5	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	97743784	97743785	9357	15	AC	CA	CA	14	14	LRRC28	CA	4	4
C16orf62	57020	broad.mit.edu	36	16	19618353	19618353	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:19618353T>G	uc002dgn.1	+	c.2675T>G	c.(2674-2676)CTT>CGT	p.L892R	C16orf62_uc002dgo.1_Missense_Mutation_p.L799R|C16orf62_uc002dgp.1_Missense_Mutation_p.L641R	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020	892						integral to membrane				ovary(1)	1														0.294118	7.555566	8.209385	5	12	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19618353	19618353	1878	16	T	G	G	56	56	C16orf62	G	4	4
DNAH3	55567	broad.mit.edu	36	16	20945878	20945878	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:20945878C>T	uc002did.1	-	c.5512G>A	c.(5512-5514)GAG>AAG	p.E1838K		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1838	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(10)|large_intestine(2)|central_nervous_system(2)	14				GBM - Glioblastoma multiforme(48;0.207)										0.25	62.605532	68.513322	26	78	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20945878	20945878	4786	16	C	T	T	31	31	DNAH3	T	1	1
ABCA3	21	broad.mit.edu	36	16	2287469	2287470	+	Missense_Mutation	DNP	GC	CT	CT			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:2287469_2287470GC>CT	uc002cpy.1	-	c.2124_2125GC>AG	c.(2122-2127)CAGCGG>CAAGGG	p.R709G	ABCA3_uc010bsk.1_Missense_Mutation_p.R651G|ABCA3_uc010bsl.1_Missense_Mutation_p.R709G	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	709	ABC transporter 1.				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|breast(3)|central_nervous_system(3)	10		Ovarian(90;0.17)							p.R709W(CL40-Tumor)|p.R709W(G361-Tumor)|p.R709W(KYSE180-Tumor)	701				1	14.307479	14.276495	5	0	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	2287469	2287470	34	16	GC	CT	CT	38	38	ABCA3	CT	3	3
ABCA3	21	broad.mit.edu	36	16	2287472	2287472	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:2287472G>C	uc002cpy.1	-	c.2122C>G	c.(2122-2124)CAG>GAG	p.Q708E	ABCA3_uc010bsk.1_Missense_Mutation_p.Q650E|ABCA3_uc010bsl.1_Missense_Mutation_p.Q708E	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	708	ABC transporter 1.				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|breast(3)|central_nervous_system(3)	10		Ovarian(90;0.17)								701				1	11.361636	11.300656	4	0	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2287472	2287472	34	16	G	C	C	45	45	ABCA3	C	3	3
ABCA3	21	broad.mit.edu	36	16	2287474	2287474	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:2287474A>T	uc002cpy.1	-	c.2120T>A	c.(2119-2121)CTT>CAT	p.L707H	ABCA3_uc010bsk.1_Missense_Mutation_p.L649H|ABCA3_uc010bsl.1_Missense_Mutation_p.L707H	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	707	ABC transporter 1.				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|breast(3)|central_nervous_system(3)	10		Ovarian(90;0.17)								701				1	10.657612	10.59644	4	0	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2287474	2287474	34	16	A	T	T	3	3	ABCA3	T	4	4
ZKSCAN2	342357	broad.mit.edu	36	16	25174128	25174128	+	Silent	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:25174128G>C	uc002dod.2	-	c.486C>G	c.(484-486)ACC>ACG	p.T162T	ZKSCAN2_uc002doe.2_Silent_p.T162T	NM_001012981	NP_001012999	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	162					regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|breast(1)	4				GBM - Glioblastoma multiforme(48;0.0378)										0.214286	7.858549	9.9592	6	22	GG		KEEP	---	---	---	---	capture			Silent	SNP	25174128	25174128	18278	16	G	C	C	43	43	ZKSCAN2	C	3	3
ZNF646	9726	broad.mit.edu	36	16	30996138	30996138	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:30996138C>A	uc002eap.1	+	c.992C>A	c.(991-993)CCC>CAC	p.P331H		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	331					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2														0.8	8.293478	8.704765	4	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30996138	30996138	18657	16	C	A	A	22	22	ZNF646	A	3	3
PRSS36	146547	broad.mit.edu	36	16	31057978	31057978	+	Silent	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:31057978A>C	uc002ebd.1	-	c.2550T>G	c.(2548-2550)ACT>ACG	p.T850T		NM_173502	NP_775773	Q5K4E3	POLS2_HUMAN	protease, serine, 36	850					proteolysis	cytoplasm|proteinaceous extracellular matrix	serine-type endopeptidase activity			ovary(1)	1														0.363636	8.108036	8.283069	4	7	AA		KEEP	---	---	---	---	capture			Silent	SNP	31057978	31057978	13075	16	A	C	C	11	11	PRSS36	C	4	4
CLUAP1	23059	broad.mit.edu	36	16	3522825	3522825	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:3522825G>A	uc002cvl.1	+	c.1075G>A	c.(1075-1077)GGA>AGA	p.G359R	CLUAP1_uc002cvk.1_Missense_Mutation_p.G359R|CLUAP1_uc002cvj.1_Missense_Mutation_p.G359R|CLUAP1_uc002cvm.1_Missense_Mutation_p.G193R	NM_015041	NP_055856	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1 isoform 1	359						nucleus	protein binding			ovary(1)|breast(1)|pancreas(1)	3														0.430168	240.705874	241.474021	77	102	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3522825	3522825	3707	16	G	A	A	47	47	CLUAP1	A	2	2
MYLK3	91807	broad.mit.edu	36	16	45320477	45320477	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:45320477C>A	uc002eei.2	-	c.1732G>T	c.(1732-1734)GCC>TCC	p.A578S	MYLK3_uc002eej.1_Missense_Mutation_p.A237S	NM_182493	NP_872299	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	578	Protein kinase.				cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|protein phosphorylation|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)								207				0.135678	44.82662	70.384186	27	172	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45320477	45320477	10453	16	C	A	A	27	27	MYLK3	A	3	3
NDRG4	65009	broad.mit.edu	36	16	57102924	57102924	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:57102924C>G	uc002enm.1	+	c.1119C>G	c.(1117-1119)CAC>CAG	p.H373Q	NDRG4_uc002enk.1_Missense_Mutation_p.H353Q|NDRG4_uc002enl.1_Non-coding_Transcript|NDRG4_uc002eno.1_Missense_Mutation_p.H334Q|NDRG4_uc002enp.1_Missense_Mutation_p.H321Q|NDRG4_uc010cdk.1_Missense_Mutation_p.H339Q|NDRG4_uc002enq.1_Intron	NM_022910	NP_075061	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 1	334					cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm					0														0.36	15.246233	15.686062	9	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57102924	57102924	10653	16	C	G	G	20	20	NDRG4	G	3	3
CDH1	999	broad.mit.edu	36	16	67401624	67401624	+	Silent	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:67401624C>A	uc002ewg.1	+	c.711C>A	c.(709-711)TCC>TCA	p.S237S	CDH1_uc010cfg.1_Silent_p.S237S	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	237	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|focal adhesion|integral to membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding|transcription activator activity	p.?(2)		breast(136)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	231		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)						231				0.3	7.120229	7.478259	3	7	CC		KEEP	---	---	---	---	capture			Silent	SNP	67401624	67401624	3224	16	C	A	A	21	21	CDH1	A	3	3
ZFHX3	463	broad.mit.edu	36	16	71549700	71549700	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:71549700A>C	uc002fck.1	-	c.1846T>G	c.(1846-1848)TTC>GTC	p.F616V	ZFHX3_uc002fcl.1_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	AT-binding transcription factor 1	616					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription repressor activity|transcription repressor activity|zinc ion binding			ovary(2)	2		Ovarian(137;0.13)												0.428571	11.642263	11.705009	6	8	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71549700	71549700	18222	16	A	C	C	3	3	ZFHX3	C	4	4
ZFHX3	463	broad.mit.edu	36	16	71551453	71551453	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:71551453G>T	uc002fck.1	-	c.93C>A	c.(91-93)CAC>CAA	p.H31Q	ZFHX3_uc002fcl.1_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	AT-binding transcription factor 1	31					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription repressor activity|transcription repressor activity|zinc ion binding			ovary(2)	2		Ovarian(137;0.13)												0.5	7.724436	7.724436	3	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71551453	71551453	18222	16	G	T	T	44	44	ZFHX3	T	3	3
MYH2	4620	broad.mit.edu	36	17	10367376	10367376	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:10367376T>A	uc010coi.1	-	c.5551A>T	c.(5551-5553)AGG>TGG	p.R1851W	MYH2_uc002gmp.2_Missense_Mutation_p.R1851W|MYH2_uc010coj.1_Intron	NM_001100112	NP_060004	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1851	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|lung(1)|kidney(1)	11														0.1875	8.629193	13.051541	9	39	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10367376	10367376	10430	17	T	A	A	54	54	MYH2	A	4	4
TOM1L2	146691	broad.mit.edu	36	17	17728711	17728711	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:17728711C>A	uc002grz.2	-	c.463G>T	c.(463-465)GAC>TAC	p.D155Y	TOM1L2_uc002gry.2_Missense_Mutation_p.D105Y|TOM1L2_uc010cpr.1_Intron	NM_001082968	NP_001076437	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 isoform 3	155					intracellular protein transport	intracellular					0	all_neural(463;0.228)					Melanoma(192;2505 2909 14455 25269)								0.285714	8.932826	9.805394	6	15	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17728711	17728711	16894	17	C	A	A	32	32	TOM1L2	A	3	3
MYO15A	51168	broad.mit.edu	36	17	17998209	17998209	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:17998209C>A	uc010cpt.1	+	c.8128C>A	c.(8128-8130)CTT>ATT	p.L2710I	MYO15A_uc010cpu.1_Missense_Mutation_p.L2710I	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	2710	Tail.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)|skin(1)	6	all_neural(463;0.228)													0.363636	8.493491	8.674774	4	7	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17998209	17998209	10458	17	C	A	A	28	28	MYO15A	A	3	3
NF1	4763	broad.mit.edu	36	17	26583263	26583263	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:26583263G>T	uc002hgg.1	+	c.3244G>T	c.(3244-3246)GGT>TGT	p.G1082C	NF1_uc002hgh.1_Missense_Mutation_p.G1082C|NF1_uc002hgi.1_Missense_Mutation_p.G115C|NF1_uc010csn.1_Missense_Mutation_p.G942C	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1082					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(3)		soft_tissue(155)|central_nervous_system(56)|large_intestine(27)|lung(19)|haematopoietic_and_lymphoid_tissue(13)|ovary(12)|autonomic_ganglia(7)|skin(3)|stomach(2)|breast(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	300		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)						847	TCGA GBM(6;<1E-8)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.172414	8.555175	11.498277	5	24	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26583263	26583263	10756	17	G	T	T	47	47	NF1	T	3	3
SLFN11	91607	broad.mit.edu	36	17	30705109	30705109	+	Silent	SNP	T	A	A			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:30705109T>A	uc010ctp.1	-	c.1281A>T	c.(1279-1281)ATA>ATT	p.I427I	SLFN11_uc010ctq.1_Silent_p.I427I|SLFN11_uc002hjh.2_Silent_p.I427I|SLFN11_uc002hjg.2_Silent_p.I427I|SLFN11_uc010ctr.1_Silent_p.I427I	NM_001104588	NP_689483	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	427						nucleus	ATP binding			large_intestine(1)|ovary(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)										0.163934	7.291434	13.883576	10	51	TT		KEEP	---	---	---	---	capture			Silent	SNP	30705109	30705109	15230	17	T	A	A	61	61	SLFN11	A	4	4
ASPA	443	broad.mit.edu	36	17	3349105	3349105	+	Silent	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:3349105A>G	uc010ckg.1	+	c.915A>G	c.(913-915)GCA>GCG	p.A305A	ASPA_uc002fvq.1_Silent_p.A305A	NM_001128085	NP_001121557	P45381	ACY2_HUMAN	aspartoacylase	305					aspartate catabolic process	cytoplasm|nucleus	aminoacylase activity|aspartoacylase activity|hydrolase activity, acting on ester bonds|metal ion binding				0					L-Aspartic Acid(DB00128)									0.225806	9.798429	11.952697	7	24	AA		KEEP	---	---	---	---	capture			Silent	SNP	3349105	3349105	1069	17	A	G	G	5	5	ASPA	G	4	4
ATP6V0A1	535	broad.mit.edu	36	17	37901222	37901222	+	Nonsense_Mutation	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:37901222G>T	uc002hzs.1	+	c.1543G>T	c.(1543-1545)GGA>TGA	p.G515*	ATP6V0A1_uc002hzq.1_Nonsense_Mutation_p.G508*|ATP6V0A1_uc002hzr.1_Nonsense_Mutation_p.G508*|ATP6V0A1_uc010cyg.1_Nonsense_Mutation_p.G154*	NM_005177	NP_005168	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	508	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)										0.125	18.999871	33.293642	13	91	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	37901222	37901222	1187	17	G	T	T	47	47	ATP6V0A1	T	5	3
SCRN2	90507	broad.mit.edu	36	17	43271025	43271025	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:43271025C>A	uc002imc.1	-	c.833G>T	c.(832-834)AGA>ATA	p.R278I	SCRN2_uc002imd.1_Missense_Mutation_p.R270I|SCRN2_uc002ime.1_Non-coding_Transcript|SCRN2_uc002imf.1_Missense_Mutation_p.R270I	NM_138355	NP_612364	Q96FV2	SCRN2_HUMAN	secernin 2 isoform 1	270					proteolysis		dipeptidase activity			ovary(1)	1														0.666667	7.88924	8.033579	4	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43271025	43271025	14421	17	C	A	A	32	32	SCRN2	A	3	3
MYCBPAP	84073	broad.mit.edu	36	17	45957269	45957270	+	Missense_Mutation	DNP	CG	TC	TC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:45957269_45957270CG>TC	uc002iqy.1	+	c.1686_1687CG>TC	c.(1684-1689)GTCGTT>GTTCTT	p.V563L	MYCBPAP_uc002iqz.1_Non-coding_Transcript	NM_032133	NP_115509	Q8TBZ2	MYBPP_HUMAN	Myc-binding protein-associated protein	563					cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|ovary(1)|pancreas(1)	4	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)											0.5	9.094988	9.094988	4	4	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	45957269	45957270	10414	17	CG	TC	TC	31	31	MYCBPAP	TC	1	1
OR4D1	26689	broad.mit.edu	36	17	53588002	53588002	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:53588002A>G	uc002ivm.1	+	c.489A>G	c.(487-489)ATA>ATG	p.I163M	MSX2P1_uc002ivn.1_5'Flank	NM_012374	NP_036506	Q15615	OR4D1_HUMAN	olfactory receptor, family 4, subfamily D,	163	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.220339	13.900888	18.20769	13	46	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53588002	53588002	11460	17	A	G	G	14	14	OR4D1	G	4	4
GDPD1	284161	broad.mit.edu	36	17	54652864	54652864	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:54652864T>C	uc002ixk.1	+	c.112T>C	c.(112-114)TTC>CTC	p.F38L	GDPD1_uc002ixj.2_Missense_Mutation_p.F38L	NM_182569	NP_872375	Q8N9F7	GDPD1_HUMAN	glycerophosphodiester phosphodiesterase domain	38	Cytoplasmic (Potential).				glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding				0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)											OREG0024617	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.315789	10.634943	11.213264	6	13	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54652864	54652864	6591	17	T	C	C	52	52	GDPD1	C	4	4
CLTC	1213	broad.mit.edu	36	17	55105825	55105825	+	Silent	SNP	T	A	A			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:55105825T>A	uc002ixr.1	+	c.2340T>A	c.(2338-2340)ATT>ATA	p.I780I	CLTC_uc002ixp.2_Silent_p.I776I|CLTC_uc002ixq.1_Silent_p.I776I	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	776	Heavy chain arm.|Proximal segment.				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)	47	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)									397				0.222222	6.386701	7.668956	4	14	TT		KEEP	---	---	---	---	capture			Silent	SNP	55105825	55105825	3704	17	T	A	A	63	63	CLTC	A	4	4
BRIP1	83990	broad.mit.edu	36	17	57117985	57117985	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:57117985C>T	uc002izk.1	-	c.2899G>A	c.(2899-2901)GAG>AAG	p.E967K	BRIP1_uc002izl.1_Missense_Mutation_p.E348K	NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	967	Interaction with BRCA1.				DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1										346				0.318182	38.226909	39.524069	14	30	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57117985	57117985	1545	17	C	T	T	30	30	BRIP1	T	2	2
DVL2	1856	broad.mit.edu	36	17	7070586	7070587	+	Nonsense_Mutation	DNP	AG	TA	TA			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:7070586_7070587AG>TA	uc002gez.1	-	c.1639_1640CT>TA	c.(1639-1641)CTG>TAG	p.L547*		NM_004422	NP_004413	O14641	DVL2_HUMAN	dishevelled 2	547					canonical Wnt receptor signaling pathway involved in regulation of cell proliferation|intracellular signal transduction|neural tube closure|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|segment specification|transcription from RNA polymerase II promoter	nucleus	frizzled binding|identical protein binding|signal transducer activity			kidney(1)	1														0.555556	10.260807	10.283454	5	4	AA		KEEP	---	---	---	---	capture			Nonsense_Mutation	DNP	7070586	7070587	5022	17	AG	TA	TA	7	7	DVL2	TA	5	4
CEP192	55125	broad.mit.edu	36	18	13046646	13046646	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:13046646G>A	uc002krt.1	+	c.2269G>A	c.(2269-2271)GGT>AGT	p.G757S	CEP192_uc002kru.1_Non-coding_Transcript|CEP192_uc002krv.1_5'UTR|CEP192_uc002krs.1_Missense_Mutation_p.G1094S|CEP192_uc010dlf.1_Non-coding_Transcript	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	1353										ovary(4)|pancreas(1)	5														0.81768	2048.554876	2117.175763	592	132	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	13046646	13046646	3384	18	G	A	A	47	47	CEP192	A	2	2
METTL4	64863	broad.mit.edu	36	18	2529072	2529072	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:2529072C>T	uc002klh.2	-	c.1346G>A	c.(1345-1347)TGG>TAG	p.W449*	METTL4_uc010dkj.1_3'UTR	NM_022840	NP_073751	Q8N3J2	METL4_HUMAN	methyltransferase like 4	449					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		methyltransferase activity|nucleic acid binding			kidney(1)|skin(1)	2														0.153846	14.96826	20.925869	8	44	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	2529072	2529072	9892	18	C	T	T	21	21	METTL4	T	5	2
SLC14A2	8170	broad.mit.edu	36	18	41506942	41506942	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:41506942C>A	uc010dnj.1	+	c.2309C>A	c.(2308-2310)GCT>GAT	p.A770D	SLC14A2_uc002lbe.1_Missense_Mutation_p.A770D	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	770	Helical; (Potential).					apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2														0.120643	50.925664	103.585516	45	328	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41506942	41506942	14892	18	C	A	A	28	28	SLC14A2	A	3	3
TYMS	7298	broad.mit.edu	36	18	660762	660762	+	Silent	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:660762C>A	uc010dka.1	+	c.627C>A	c.(625-627)TCC>TCA	p.S209S	TYMS_uc010dkb.1_Silent_p.S175S|TYMS_uc010dkc.1_Silent_p.S126S	NM_001071	NP_001062	P04818	TYSY_HUMAN	thymidylate synthetase	209					DNA repair|DNA replication|phosphatidylinositol-mediated signaling|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|regulation of transcription involved in G1/S phase of mitotic cell cycle|response to organophosphorus	cytosol	thymidylate synthase activity				0					Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Pemetrexed(DB00642)|Raltitrexed(DB00293)|Trifluridine(DB00432)									0.17029	90.479882	118.876905	47	229	CC		KEEP	---	---	---	---	capture			Silent	SNP	660762	660762	17369	18	C	A	A	24	24	TYMS	A	3	3
ZNF440	126070	broad.mit.edu	36	19	11803887	11803887	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:11803887T>G	uc002msp.1	+	c.896T>G	c.(895-897)GTT>GGT	p.V299G		NM_152357	NP_689570	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	299	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0														0.196078	11.716929	16.123887	10	41	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	11803887	11803887	18506	19	T	G	G	60	60	ZNF440	G	4	4
ZNF763	284390	broad.mit.edu	36	19	11949202	11949202	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:11949202C>A	uc002msv.1	+	c.156C>A	c.(154-156)GAC>GAA	p.D52E	ZNF763_uc002msw.1_Missense_Mutation_p.D49E	NM_001012753	NP_001012771	Q0D2J5	ZN763_HUMAN	zinc finger protein 440 like	49	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1														0.25	17.390071	19.90485	11	33	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	11949202	11949202	18735	19	C	A	A	18	18	ZNF763	A	3	3
CIRBP	1153	broad.mit.edu	36	19	1222447	1222447	+	Silent	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:1222447G>T	uc002lrt.2	+	c.330G>T	c.(328-330)CGG>CGT	p.R110R	CIRBP_uc010dsg.1_Silent_p.R99R|CIRBP_uc002lrr.2_Silent_p.R110R|CIRBP_uc002lrv.2_Silent_p.R110R|CIRBP_uc002lru.2_Non-coding_Transcript	NM_001280	NP_001271	Q14011	CIRBP_HUMAN	cold inducible RNA binding protein	110	Gly-rich.				mRNA stabilization|positive regulation of translation|response to cold|response to UV|stress granule assembly	nucleoplasm|stress granule	mRNA 3'-UTR binding|nucleotide binding|protein binding|SSU rRNA binding|translation repressor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										1	12.493709	12.46239	5	0	GG		KEEP	---	---	---	---	capture			Silent	SNP	1222447	1222447	3567	19	G	T	T	43	43	CIRBP	T	3	3
MUM1	84939	broad.mit.edu	36	19	1311209	1311209	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:1311209G>C	uc002lsa.1	+	c.292G>C	c.(292-294)GTT>CTT	p.V98L	MUM1_uc002lrz.1_Missense_Mutation_p.V97L|MUM1_uc010dsi.1_Missense_Mutation_p.V29L|MUM1_uc002lsb.1_Missense_Mutation_p.V29L|MUM1_uc002lsc.1_Missense_Mutation_p.V29L	NM_032853	NP_116242	Q2TAK8	MUM1_HUMAN	melanoma ubiquitous mutated protein	97					chromatin organization|DNA repair	nucleus	nucleosome binding|protein binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)								OREG0025088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.222222	8.224892	10.155432	6	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1311209	1311209	10379	19	G	C	C	40	40	MUM1	C	3	3
UPF1	5976	broad.mit.edu	36	19	18828018	18828018	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:18828018A>C	uc002nkg.1	+	c.1766A>C	c.(1765-1767)CAG>CCG	p.Q589P	UPF1_uc002nkf.1_Missense_Mutation_p.Q578P	NM_002911	NP_002902	Q92900	RENT1_HUMAN	regulator of nonsense transcripts 1	589					cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1														0.5	7.387949	7.387949	4	4	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18828018	18828018	17563	19	A	C	C	7	7	UPF1	C	4	4
WDR62	284403	broad.mit.edu	36	19	41274044	41274044	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:41274044G>C	uc002odd.2	+	c.2137G>C	c.(2137-2139)GGC>CGC	p.G713R	WDR62_uc002odc.2_Missense_Mutation_p.G713R	NM_001083961	NP_001077430	O43379	WDR62_HUMAN	WD repeat domain 62 isoform 1	713	WD 11.				cerebral cortex development	nucleus					0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)											0.428571	18.458187	18.55389	9	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41274044	41274044	17886	19	G	C	C	47	47	WDR62	C	3	3
SPTBN4	57731	broad.mit.edu	36	19	45717275	45717276	+	Missense_Mutation	DNP	GA	AG	AG			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:45717275_45717276GA>AG	uc002ony.1	+	c.3031_3032GA>AG	c.(3031-3033)GAG>AGG	p.E1011R	SPTBN4_uc002onx.1_Missense_Mutation_p.E1011R|SPTBN4_uc002onz.1_Missense_Mutation_p.E1011R|SPTBN4_uc010egx.1_5'UTR	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	1011					actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)	4			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)											1	10.857927	10.796769	4	0	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	45717275	45717276	15635	19	GA	AG	AG	41	41	SPTBN4	AG	2	2
IL4I1	259307	broad.mit.edu	36	19	55086178	55086179	+	Splice_Site_DNP	DNP	TG	AC	AC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:55086178_55086179TG>AC	uc002pqu.1	-	c.e9_splice_site			IL4I1_uc002pqw.1_Splice_Site_DNP|IL4I1_uc002pqv.1_Splice_Site_DNP|IL4I1_uc010eno.1_Splice_Site_DNP|IL4I1_uc002pqt.1_Splice_Site_DNP	NM_172374	NP_758962			interleukin 4 induced 1 isoform 2						oxidation-reduction process	lysosome	L-amino-acid oxidase activity			ovary(1)	1		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)										0.333333	7.288245	7.587337	4	8	TT		KEEP	---	---	---	---	capture			Splice_Site_DNP	DNP	55086178	55086179	7998	19	TG	AC	AC	55	55	IL4I1	AC	5	4
NCR1	9437	broad.mit.edu	36	19	60113238	60113238	+	Splice_Site_SNP	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:60113238G>A	uc002qib.1	+	c.e5_splice_site			NCR1_uc002qic.1_Splice_Site_SNP|NCR1_uc002qid.1_Splice_Site_SNP|NCR1_uc002qie.1_Splice_Site_SNP|NCR1_uc010esj.1_Splice_Site_SNP|NCR1_uc002qif.1_Splice_Site_SNP	NM_004829	NP_004820			natural cytotoxicity triggering receptor 1						cellular defense response|natural killer cell activation|regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane|SWI/SNF complex	receptor activity|receptor signaling protein activity			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(193;0.0449)										0.406375	306.685762	308.611269	102	149	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	60113238	60113238	10636	19	G	A	A	44	44	NCR1	A	5	2
ZNF329	79673	broad.mit.edu	36	19	63332608	63332608	+	Silent	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:63332608T>C	uc002qrn.1	-	c.75A>G	c.(73-75)ACA>ACG	p.T25T	ZNF329_uc010euk.1_Non-coding_Transcript|ZNF329_uc002qro.1_Non-coding_Transcript|ZNF329_uc002qrp.1_Non-coding_Transcript|ZNF329_uc010eul.1_Silent_p.T25T	NM_024620	NP_078896	Q86UD4	ZN329_HUMAN	zinc finger protein 329	25					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)										0.285714	7.593279	8.171274	4	10	TT		KEEP	---	---	---	---	capture			Silent	SNP	63332608	63332608	18439	19	T	C	C	63	63	ZNF329	C	4	4
KIF1B	23095	broad.mit.edu	36	1	10279665	10279665	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:10279665C>A	uc001aqz.2	+	c.1985C>A	c.(1984-1986)GCC>GAC	p.A662D	KIF1B_uc001aqv.2_Missense_Mutation_p.A616D|KIF1B_uc001aqw.2_Missense_Mutation_p.A616D|KIF1B_uc001aqx.2_Missense_Mutation_p.A662D|KIF1B_uc001aqy.2_Missense_Mutation_p.A636D|KIF1B_uc001ara.2_Missense_Mutation_p.A622D|KIF1B_uc001arb.2_Missense_Mutation_p.A648D	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	662					anterograde axon cargo transport|apoptosis|nerve-nerve synaptic transmission|neuromuscular synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)	2	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)										0.333333	8.761785	9.134908	5	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10279665	10279665	8595	1	C	A	A	26	26	KIF1B	A	3	3
KIAA1324	57535	broad.mit.edu	36	1	109536801	109536801	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:109536801G>T	uc001dwq.1	+	c.1729G>T	c.(1729-1731)GTC>TTC	p.V577F	KIAA1324_uc009wex.1_Missense_Mutation_p.V527F|KIAA1324_uc009wey.1_Missense_Mutation_p.V490F|KIAA1324_uc001dwr.1_Missense_Mutation_p.V227F	NM_020775	NP_065826	Q6UXG2	K1324_HUMAN	hypothetical protein LOC57535	577	Extracellular (Potential).					integral to membrane				ovary(2)|breast(1)	3		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)										0.227273	7.258128	8.767247	5	17	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	109536801	109536801	8532	1	G	T	T	48	48	KIAA1324	T	3	3
PTPN22	26191	broad.mit.edu	36	1	114182522	114182522	+	Silent	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:114182522T>C	uc001eds.1	-	c.1023A>G	c.(1021-1023)CAA>CAG	p.Q341Q	PTPN22_uc009wgq.1_Silent_p.Q286Q|PTPN22_uc001edt.1_Intron|PTPN22_uc009wgr.1_Silent_p.Q341Q|PTPN22_uc009wgs.1_Silent_p.Q214Q|PTPN22_uc001edu.1_Silent_p.Q341Q	NM_015967	NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type	341					negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of innate immune response|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)						661				0.431818	63.122503	63.299879	19	25	TT		KEEP	---	---	---	---	capture			Silent	SNP	114182522	114182522	13244	1	T	C	C	60	60	PTPN22	C	4	4
ATAD3A	55210	broad.mit.edu	36	1	1445453	1445453	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:1445453C>G	uc001afz.1	+	c.728C>G	c.(727-729)GCG>GGG	p.A243G	ATAD3A_uc001aga.1_Missense_Mutation_p.A195G|ATAD3A_uc001agb.1_Missense_Mutation_p.A116G	NM_018188	NP_060658	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A	243	Potential.						ATP binding|nucleoside-triphosphatase activity|protein binding				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)										0.6	13.242117	13.328287	6	4	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1445453	1445453	1092	1	C	G	G	27	27	ATAD3A	G	3	3
CREB3L4	148327	broad.mit.edu	36	1	152207657	152207657	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:152207657C>G	uc001fdn.2	+	c.32C>G	c.(31-33)GCG>GGG	p.A11G	SLC39A1_uc001fdl.1_5'Flank|CREB3L4_uc001fdo.2_Missense_Mutation_p.A11G|CREB3L4_uc001fdm.1_Missense_Mutation_p.A11G|CREB3L4_uc001fdp.1_Missense_Mutation_p.A11G|CREB3L4_uc001fdr.1_Missense_Mutation_p.A11G|CREB3L4_uc001fdq.1_Missense_Mutation_p.A11G	NM_130898	NP_570968	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like	11	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)											0.315789	10.332671	10.912252	6	13	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	152207657	152207657	3998	1	C	G	G	27	27	CREB3L4	G	3	3
BCAN	63827	broad.mit.edu	36	1	154883320	154883321	+	Missense_Mutation	DNP	GC	AT	AT			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:154883320_154883321GC>AT	uc001fpp.1	+	c.195_196GC>AT	c.(193-198)CCGCCG>CCATCG	p.P66S	BCAN_uc001fpo.1_Missense_Mutation_p.P66S	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1	66	Ig-like V-type.				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)													0.333333	8.878112	9.243144	5	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	154883320	154883321	1366	1	GC	AT	AT	38	38	BCAN	AT	1	1
C1orf66	51093	broad.mit.edu	36	1	154970662	154970662	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:154970662G>A	uc001fpu.1	+	c.874G>A	c.(874-876)GAC>AAC	p.D292N	C1orf66_uc001fpv.1_Intron	NM_015997	NP_057081	Q96FB5	RRNAD_HUMAN	hypothetical protein LOC51093 isoform 1	292						integral to membrane	rRNA (adenine-N6,N6-)-dimethyltransferase activity				0	all_hematologic(923;0.088)|Hepatocellular(266;0.158)													0.4	7.288772	7.378505	4	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	154970662	154970662	2130	1	G	A	A	45	45	C1orf66	A	2	2
EPHA2	1969	broad.mit.edu	36	1	16347722	16347722	+	Silent	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:16347722G>A	uc001aya.1	-	c.561C>T	c.(559-561)GCC>GCT	p.A187A		NM_004431	NP_004422	P29317	EPHA2_HUMAN	ephrin receptor EphA2	187	Extracellular (Potential).				activation of Rac GTPase activity|angiogenesis|apoptosis|cell chemotaxis|ephrin receptor signaling pathway|negative regulation of protein kinase B signaling cascade|positive regulation of establishment of protein localization in plasma membrane|protein kinase B signaling cascade|protein phosphorylation|regulation of blood vessel endothelial cell migration|regulation of cell adhesion mediated by integrin|regulation of lamellipodium assembly|response to growth factor stimulus	focal adhesion|integral to plasma membrane|leading edge membrane	ATP binding|ephrin receptor activity|protein binding			ovary(2)|central_nervous_system(2)|stomach(1)|lung(1)	6		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)					485				0.235294	10.274919	12.467061	8	26	GG		KEEP	---	---	---	---	capture			Silent	SNP	16347722	16347722	5360	1	G	A	A	35	35	EPHA2	A	2	2
ADCY10	55811	broad.mit.edu	36	1	166081642	166081642	+	Silent	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:166081642G>A	uc001ger.1	-	c.2790C>T	c.(2788-2790)AAC>AAT	p.N930N	ADCY10_uc009wvk.1_Silent_p.N838N|ADCY10_uc009wvl.1_Silent_p.N929N	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	soluble adenylyl cyclase	930					intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3														0.409836	143.539173	144.400506	50	72	GG		KEEP	---	---	---	---	capture			Silent	SNP	166081642	166081642	294	1	G	A	A	44	44	ADCY10	A	2	2
ATP13A2	23400	broad.mit.edu	36	1	17195151	17195151	+	Nonsense_Mutation	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:17195151G>C	uc001baa.1	-	c.1449C>G	c.(1447-1449)TAC>TAG	p.Y483*	ATP13A2_uc001bab.1_Nonsense_Mutation_p.Y478*|ATP13A2_uc001bac.1_Nonsense_Mutation_p.Y478*|ATP13A2_uc009vpa.1_Nonsense_Mutation_p.Y159*|ATP13A2_uc001bad.1_Nonsense_Mutation_p.Y196*	NM_022089	NP_071372	Q9NQ11	AT132_HUMAN	ATPase type 13A2 isoform 1	483	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)										0.444444	7.991851	8.016906	4	5	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	17195151	17195151	1143	1	G	C	C	40	40	ATP13A2	C	5	3
DISP1	84976	broad.mit.edu	36	1	221244500	221244500	+	Silent	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:221244500C>T	uc001hnu.1	+	c.3138C>T	c.(3136-3138)GTC>GTT	p.V1046V		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	1046	Helical; (Potential).				diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)										0.225979	301.7614	340.515125	127	435	CC		KEEP	---	---	---	---	capture			Silent	SNP	221244500	221244500	4718	1	C	T	T	31	31	DISP1	T	1	1
EPHA8	2046	broad.mit.edu	36	1	22775472	22775472	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:22775472C>G	uc001bfx.1	+	c.335C>G	c.(334-336)CCT>CGT	p.P112R	EPHA8_uc001bfw.1_Missense_Mutation_p.P112R	NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	112	Extracellular (Potential).				protein phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|lung(2)|breast(2)|large_intestine(1)|stomach(1)|skin(1)	12		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)						520				0.206897	8.027142	10.346821	6	23	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22775472	22775472	5366	1	C	G	G	24	24	EPHA8	G	3	3
ARV1	64801	broad.mit.edu	36	1	229181579	229181579	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:229181579C>G	uc009xfl.1	+	c.105C>G	c.(103-105)ATC>ATG	p.I35M	TTC13_uc001huf.2_5'Flank|TTC13_uc009xfi.1_5'Flank|TTC13_uc009xfj.1_5'Flank|TTC13_uc001hug.2_5'Flank|TTC13_uc009xfk.1_5'Flank|ARV1_uc001huh.1_Missense_Mutation_p.I35M	NM_022786	NP_073623	Q9H2C2	ARV1_HUMAN	ARV1 homolog	35					sphingolipid metabolic process	integral to membrane				breast(2)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)		COAD - Colon adenocarcinoma(196;0.211)|Colorectal(1306;0.233)										0.333333	6.587044	6.886737	4	8	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	229181579	229181579	1020	1	C	G	G	31	31	ARV1	G	3	3
FAM54B	56181	broad.mit.edu	36	1	26025696	26025696	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:26025696T>G	uc001bkq.2	+	c.243T>G	c.(241-243)AGT>AGG	p.S81R	FAM54B_uc001bkr.2_Missense_Mutation_p.S81R|FAM54B_uc009vrz.1_Missense_Mutation_p.S78R|FAM54B_uc001bks.2_Missense_Mutation_p.S81R|FAM54B_uc001bkt.2_Missense_Mutation_p.S81R|FAM54B_uc001bku.2_Missense_Mutation_p.S78R|FAM54B_uc001bkv.2_5'UTR	NM_001099625	NP_062457	Q9H019	FA54B_HUMAN	hypothetical protein LOC56181 isoform a	81										pancreas(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;1.96e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.00095)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0649)										0.333333	8.46082	8.834428	5	10	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26025696	26025696	5805	1	T	G	G	59	59	FAM54B	G	4	4
RPA2	6118	broad.mit.edu	36	1	28106035	28106035	+	Silent	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:28106035A>C	uc001bpd.1	-	c.348T>G	c.(346-348)GTT>GTG	p.V116V	RPA2_uc001bpe.1_Silent_p.V108V	NM_002946	NP_002937	P15927	RFA2_HUMAN	replication protein A2, 32kDa	108	Asp/Glu-rich (acidic).				cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor A complex|PML body	single-stranded DNA binding				0		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)										0.212121	10.412399	12.941862	7	26	AA		KEEP	---	---	---	---	capture			Silent	SNP	28106035	28106035	14016	1	A	C	C	5	5	RPA2	C	4	4
BAI2	576	broad.mit.edu	36	1	31978361	31978362	+	Missense_Mutation	DNP	GA	TG	TG			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:31978361_31978362GA>TG	uc001btn.1	-	c.1994_1995TC>CA	c.(1993-1995)TTC>TCA	p.F665S	BAI2_uc001bto.1_Missense_Mutation_p.F665S|BAI2_uc001btq.1_Missense_Mutation_p.F598S	NM_001703	NP_001694	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	665	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)	3		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)										0.375	10.833082	11.056917	6	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	31978361	31978362	1320	1	GA	TG	TG	33	33	BAI2	TG	3	3
TXLNA	200081	broad.mit.edu	36	1	32419662	32419662	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:32419662A>C	uc001bui.1	+	c.402A>C	c.(400-402)GAA>GAC	p.E134D	TXLNA_uc001buj.1_Missense_Mutation_p.E134D	NM_175852	NP_787048	P40222	TXLNA_HUMAN	taxilin	134					cell proliferation|exocytosis	cytoplasm|extracellular region	cytokine activity|high molecular weight B cell growth factor receptor binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)												0.75	6.432797	6.644876	3	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32419662	32419662	17343	1	A	C	C	2	2	TXLNA	C	4	4
KDM4A	9682	broad.mit.edu	36	1	43910076	43910076	+	Silent	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:43910076A>C	uc001cjx.1	+	c.1677A>C	c.(1675-1677)CCA>CCC	p.P559P		NM_014663	NP_055478	O75164	KDM4A_HUMAN	jumonji domain containing 2A	559					interspecies interaction between organisms|oxidation-reduction process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|transcription repressor activity|zinc ion binding				0														0.163934	7.90768	14.481606	10	51	AA		KEEP	---	---	---	---	capture			Silent	SNP	43910076	43910076	8434	1	A	C	C	8	8	KDM4A	C	4	4
MAST2	23139	broad.mit.edu	36	1	46267034	46267034	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:46267034G>T	uc001cov.1	+	c.2060G>T	c.(2059-2061)GGG>GTG	p.G687V	MAST2_uc001cow.1_Missense_Mutation_p.G687V|MAST2_uc001coy.1_Missense_Mutation_p.G361V|MAST2_uc001coz.1_Missense_Mutation_p.G572V|MAST2_uc001cpa.2_Non-coding_Transcript	NM_015112	NP_055927	Q6P0Q8	MAST2_HUMAN	microtubule associated serine/threonine kinase	687	Protein kinase.				protein phosphorylation|regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|breast(1)	9	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)									975				0.235294	6.689693	7.781737	4	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46267034	46267034	9709	1	G	T	T	43	43	MAST2	T	3	3
SLC1A7	6512	broad.mit.edu	36	1	53331750	53331750	+	Silent	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:53331750C>A	uc001cuy.1	-	c.768G>T	c.(766-768)TCG>TCT	p.S256S	SLC1A7_uc001cux.1_5'Flank	NM_006671	NP_006662	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter),	256						integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)	NSCLC(128;80 1811 21245 38490 51715)								1	8.277177	8.053996	2	0	CC		KEEP	---	---	---	---	capture			Silent	SNP	53331750	53331750	14933	1	C	A	A	23	23	SLC1A7	A	3	3
C1orf173	127254	broad.mit.edu	36	1	74827972	74827972	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:74827972T>C	uc001dgg.1	-	c.2107A>G	c.(2107-2109)AAG>GAG	p.K703E	C1orf173_uc001dgi.2_Missense_Mutation_p.K497E	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	703	Glu-rich.									ovary(3)|central_nervous_system(1)	4														0.25	8.631542	10.003622	6	18	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74827972	74827972	2081	1	T	C	C	61	61	C1orf173	C	4	4
CAMTA1	23261	broad.mit.edu	36	1	7646128	7646129	+	Missense_Mutation	DNP	AA	TG	TG			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:7646128_7646129AA>TG	uc001aoi.1	+	c.934_935AA>TG	c.(934-936)AAG>TGG	p.K312W		NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	312					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding|transcription regulator activity			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)										0.6875	24.006185	24.500894	11	5	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	7646128	7646129	2730	1	AA	TG	TG	5	5	CAMTA1	TG	4	4
DTD1	92675	broad.mit.edu	36	20	18522376	18522376	+	Silent	SNP	T	A	A			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:18522376T>A	uc002wrf.2	+	c.45T>A	c.(43-45)GTT>GTA	p.V15V		NM_080820	NP_543010	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1	15					D-amino acid catabolic process	cytoplasm	hydrolase activity, acting on ester bonds			ovary(2)	2														0.3	10.02967	10.752808	6	14	TT		KEEP	---	---	---	---	capture			Silent	SNP	18522376	18522376	4970	20	T	A	A	63	63	DTD1	A	4	4
CPXM1	56265	broad.mit.edu	36	20	2726674	2726674	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:2726674C>A	uc002wgu.1	-	c.621G>T	c.(619-621)CAG>CAT	p.Q207H	CPXM1_uc010gas.1_Missense_Mutation_p.Q207H	NM_019609	NP_062555	Q96SM3	CPXM1_HUMAN	carboxypeptidase X, member 1 precursor	207	F5/8 type C.				cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2														0.294118	7.456844	8.109954	5	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2726674	2726674	3976	20	C	A	A	20	20	CPXM1	A	3	3
KIF3B	9371	broad.mit.edu	36	20	30362182	30362182	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:30362182T>C	uc002wxq.1	+	c.941T>C	c.(940-942)GTG>GCG	p.V314A		NM_004798	NP_004789	O15066	KIF3B_HUMAN	kinesin family member 3B	314	Kinesin-motor.				anterograde axon cargo transport|blood coagulation|determination of left/right symmetry|mitotic centrosome separation|mitotic spindle organization|plus-end-directed vesicle transport along microtubule	centrosome|cytosol|kinesin II complex|plus-end kinesin complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|protein binding			central_nervous_system(3)|ovary(2)	5			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)											0.171875	11.675108	18.216371	11	53	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30362182	30362182	8612	20	T	C	C	59	59	KIF3B	C	4	4
ACSS2	55902	broad.mit.edu	36	20	32965895	32965896	+	Missense_Mutation	DNP	TG	CC	CC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:32965895_32965896TG>CC	uc010gey.1	+	c.828_829TG>CC	c.(826-831)GATGTG>GACCTG	p.V277L	ACSS2_uc002xbb.1_Missense_Mutation_p.V227L|ACSS2_uc002xbc.1_Missense_Mutation_p.V182L|ACSS2_uc002xbd.1_Missense_Mutation_p.V277L|ACSS2_uc002xbe.1_Intron|ACSS2_uc002xbf.1_Intron	NM_018677	NP_061147	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	277					ethanol oxidation|lipid biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	acetate-CoA ligase activity|AMP binding|ATP binding|protein binding				0					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)									0.178571	10.711727	16.175747	10	46	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	32965895	32965896	190	20	TG	CC	CC	51	51	ACSS2	CC	4	4
SLC32A1	140679	broad.mit.edu	36	20	36790027	36790027	+	Silent	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:36790027C>A	uc002xjc.1	+	c.909C>A	c.(907-909)GTC>GTA	p.V303V		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	303	Cytoplasmic (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)									0.375	16.854795	17.18873	9	15	CC		KEEP	---	---	---	---	capture			Silent	SNP	36790027	36790027	15062	20	C	A	A	29	29	SLC32A1	A	3	3
ZSWIM3	140831	broad.mit.edu	36	20	43939894	43939894	+	Silent	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:43939894C>G	uc002xqd.1	+	c.1290C>G	c.(1288-1290)GGC>GGG	p.G430G		NM_080752	NP_542790	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM domain containing 3	430							zinc ion binding			ovary(2)	2		Myeloproliferative disorder(115;0.0122)												0.315789	10.470259	11.030091	6	13	CC		KEEP	---	---	---	---	capture			Silent	SNP	43939894	43939894	18846	20	C	G	G	28	28	ZSWIM3	G	3	3
PRND	23627	broad.mit.edu	36	20	4653319	4653319	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:4653319C>T	uc002wkz.1	+	c.122C>T	c.(121-123)CCC>CTC	p.P41L	PRND_uc010gbg.1_Missense_Mutation_p.P41L	NM_012409	NP_036541	Q9UKY0	PRND_HUMAN	prion-like protein doppel preproprotein	41	Flexible tail.				protein homooligomerization	anchored to membrane|plasma membrane					0														0.173077	8.992955	14.219482	9	43	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4653319	4653319	12986	20	C	T	T	22	22	PRND	T	2	2
CCT8	10694	broad.mit.edu	36	21	29357561	29357561	+	Silent	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr21:29357561A>G	uc002ynb.1	-	c.924T>C	c.(922-924)TAT>TAC	p.Y308Y	CCT8_uc002yna.1_Silent_p.Y257Y|CCT8_uc002ync.1_Silent_p.Y307Y|CCT8_uc010glm.1_Silent_p.Y249Y|CCT8_uc002ymz.1_5'Flank	NM_006585	NP_006576	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	308					'de novo' posttranslational protein folding	aggresome|cytosol|intermediate filament cytoskeleton|microtubule organizing center	ATP binding|ATPase activity, coupled|unfolded protein binding				0														0.153846	6.68086	12.643858	8	44	AA		KEEP	---	---	---	---	capture			Silent	SNP	29357561	29357561	3087	21	A	G	G	16	16	CCT8	G	4	4
ZNF74	7625	broad.mit.edu	36	22	19090711	19090711	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:19090711G>A	uc010gsm.1	+	c.1388G>A	c.(1387-1389)CGG>CAG	p.R463Q	ZNF74_uc002zsg.1_Missense_Mutation_p.R392Q|ZNF74_uc002zsh.1_Missense_Mutation_p.R463Q|ZNF74_uc002zsi.1_Missense_Mutation_p.R392Q|ZNF74_uc010gsn.1_Missense_Mutation_p.R392Q	NM_003426	NP_003417	Q16587	ZNF74_HUMAN	zinc finger protein 74	463	C2H2-type 8.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)											0.833333	10.569359	11.185998	5	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19090711	19090711	18725	22	G	A	A	39	39	ZNF74	A	1	1
ZNF74	7625	broad.mit.edu	36	22	19090713	19090713	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:19090713C>A	uc010gsm.1	+	c.1390C>A	c.(1390-1392)CGC>AGC	p.R464S	ZNF74_uc002zsg.1_Missense_Mutation_p.R393S|ZNF74_uc002zsh.1_Missense_Mutation_p.R464S|ZNF74_uc002zsi.1_Missense_Mutation_p.R393S|ZNF74_uc010gsn.1_Missense_Mutation_p.R393S	NM_003426	NP_003417	Q16587	ZNF74_HUMAN	zinc finger protein 74	464	C2H2-type 8.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)											0.923077	29.978494	31.660803	12	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19090713	19090713	18725	22	C	A	A	27	27	ZNF74	A	3	3
ZNF74	7625	broad.mit.edu	36	22	19090715	19090716	+	Missense_Mutation	DNP	CA	GC	GC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:19090715_19090716CA>GC	uc010gsm.1	+	c.1392_1393CA>GC	c.(1390-1395)CGCATC>CGGCTC	p.I465L	ZNF74_uc002zsg.1_Missense_Mutation_p.I394L|ZNF74_uc002zsh.1_Missense_Mutation_p.I465L|ZNF74_uc002zsi.1_Missense_Mutation_p.I394L|ZNF74_uc010gsn.1_Missense_Mutation_p.I394L	NM_003426	NP_003417	Q16587	ZNF74_HUMAN	zinc finger protein 74	465	C2H2-type 8.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)											0.933333	36.640551	38.859935	14	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	19090715	19090716	18725	22	CA	GC	GC	25	25	ZNF74	GC	3	3
ZNF280A	129025	broad.mit.edu	36	22	21198434	21198434	+	Silent	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:21198434G>A	uc002zwe.1	-	c.1521C>T	c.(1519-1521)TCC>TCT	p.S507S	ZNF280A_uc010gtq.1_Silent_p.S507S	NM_080740	NP_542778	P59817	Z280A_HUMAN	zinc finger protein 280A	507					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)										0.25	33.884467	36.606341	12	36	GG		KEEP	---	---	---	---	capture			Silent	SNP	21198434	21198434	18406	22	G	A	A	39	39	ZNF280A	A	1	1
THOC5	8563	broad.mit.edu	36	22	28254446	28254446	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:28254446C>T	uc003afr.1	-	c.935G>A	c.(934-936)AGT>AAT	p.S312N	THOC5_uc003afq.1_De_novo_Start_OutOfFrame|THOC5_uc003afs.1_Missense_Mutation_p.S312N|THOC5_uc003aft.1_Missense_Mutation_p.S312N|THOC5_uc003afu.1_Missense_Mutation_p.S312N|THOC5_uc010gvo.1_Missense_Mutation_p.S56N	NM_001002878	NP_003669	Q13769	THOC5_HUMAN	THO complex 5	312					intronless viral mRNA export from host nucleus|monocyte differentiation|mRNA processing|primitive hemopoiesis|RNA splicing	cytoplasm|intermediate filament cytoskeleton|THO complex part of transcription export complex	protein binding|RNA binding			breast(2)	2														0.315789	12.037737	12.614364	6	13	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	28254446	28254446	16396	22	C	T	T	20	20	THOC5	T	2	2
TCF20	6942	broad.mit.edu	36	22	40939349	40939349	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr22:40939349T>A	uc003bcj.1	-	c.1907A>T	c.(1906-1908)CAA>CTA	p.Q636L	TCF20_uc003bck.1_Missense_Mutation_p.Q636L	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	636					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)	4														0.205882	7.689995	10.44196	7	27	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40939349	40939349	16216	22	T	A	A	63	63	TCF20	A	4	4
IL1RL2	8808	broad.mit.edu	36	2	102172130	102172130	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:102172130A>C	uc002tbs.1	+	c.221A>C	c.(220-222)CAC>CCC	p.H74P	IL1RL2_uc002tbt.1_Intron	NM_003854	NP_003845	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2 precursor	74	Extracellular (Potential).|Ig-like C2-type 1.				cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2														0.25	7.062267	8.203915	5	15	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	102172130	102172130	7965	2	A	C	C	6	6	IL1RL2	C	4	4
MARCO	8685	broad.mit.edu	36	2	119456405	119456405	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:119456405A>G	uc002tln.1	+	c.1012A>G	c.(1012-1014)AGC>GGC	p.S338G		NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	338	Collagen-like.|Extracellular (Potential).				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4						GBM(8;18 374 7467 11269 32796)								0.75	6.421943	6.644001	3	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	119456405	119456405	9694	2	A	G	G	11	11	MARCO	G	4	4
MCM6	4175	broad.mit.edu	36	2	136339136	136339136	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:136339136T>A	uc002tuw.1	-	c.995A>T	c.(994-996)AAA>ATA	p.K332I		NM_005915	NP_005906	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	332					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|identical protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.166)	Atorvastatin(DB01076)	Ovarian(196;141 2104 8848 24991 25939)								0.186047	9.365687	13.356382	8	35	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	136339136	136339136	9780	2	T	A	A	64	64	MCM6	A	4	4
NR4A2	4929	broad.mit.edu	36	2	156891632	156891633	+	Missense_Mutation	DNP	TG	GC	GC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:156891632_156891633TG>GC	uc002tyz.2	-	c.1204_1205CA>GC	c.(1204-1206)CAT>GCT	p.H402A	NR4A2_uc002tyx.2_Missense_Mutation_p.H339A|NR4A2_uc002tyy.2_Missense_Mutation_p.H402A|NR4A2_uc002tza.2_Missense_Mutation_p.H402A	NM_006186	NP_775265	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	402					cellular response to extracellular stimulus|dopaminergic neuron differentiation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus	nucleoplasm	sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3														0.285714	7.090212	7.670223	4	10	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	156891632	156891633	11038	2	TG	GC	GC	51	51	NR4A2	GC	4	4
MAP2	4133	broad.mit.edu	36	2	210269314	210269315	+	Missense_Mutation	DNP	CT	TG	TG			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:210269314_210269315CT>TG	uc002vde.1	+	c.4175_4176CT>TG	c.(4174-4176)ACT>ATG	p.T1392M	MAP2_uc002vdc.1_Missense_Mutation_p.T1392M|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.T1388M	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	1392					negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|large_intestine(2)|pancreas(2)|central_nervous_system(1)	14		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	Pancreas(27;423 979 28787 29963)								0.210526	6.390174	7.865043	4	15	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	210269314	210269315	9618	2	CT	TG	TG	20	20	MAP2	TG	2	2
DNPEP	23549	broad.mit.edu	36	2	219958990	219958990	+	Silent	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:219958990G>T	uc002vle.2	-	c.534C>A	c.(532-534)GCC>GCA	p.A178A	DNPEP_uc002vlf.1_Silent_p.A164A|DNPEP_uc002vlh.2_Silent_p.A125A|DNPEP_uc002vli.1_Silent_p.A125A|DNPEP_uc002vlj.2_Silent_p.A168A	NM_012100	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	168					peptide metabolic process|proteolysis	vacuole	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	L-Glutamic Acid(DB00142)									0.294118	9.966649	10.612977	5	12	GG		KEEP	---	---	---	---	capture			Silent	SNP	219958990	219958990	4862	2	G	T	T	47	47	DNPEP	T	3	3
WDFY1	57590	broad.mit.edu	36	2	224490965	224490965	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:224490965G>C	uc002vnq.1	-	c.144C>G	c.(142-144)ATC>ATG	p.I48M		NM_020830	NP_065881	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1	48	WD 1.					cytosol|early endosome|nucleus	1-phosphatidylinositol binding|zinc ion binding			lung(1)	1		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)										0.25	6.755383	7.902102	5	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	224490965	224490965	17840	2	G	C	C	41	41	WDFY1	C	3	3
UGT1A3	54659	broad.mit.edu	36	2	234302842	234302842	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:234302842T>A	uc002vuy.1	+	c.331T>A	c.(331-333)TTC>ATC	p.F111I	UGT1A8_uc002vup.1_Intron|UGT1A10_uc002vuq.2_Intron|UGT1A10_uc002vur.1_Intron|UGT1A9_uc002vus.1_Intron|UGT1A7_uc002vut.1_Intron|UGT1A6_uc002vuu.1_Intron|UGT1A6_uc002vuv.2_Intron|UGT1A5_uc002vuw.1_Intron|UGT1A4_uc002vux.1_Intron	NM_019093	NP_061966	P35503	UD13_HUMAN	UDP glycosyltransferase 1 family, polypeptide A3	111					flavonoid metabolic process|retinoic acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding			ovary(1)	1		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)										0.171875	9.66894	16.219572	11	53	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	234302842	234302842	17504	2	T	A	A	64	64	UGT1A3	A	4	4
ZNF513	130557	broad.mit.edu	36	2	27454472	27454472	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:27454472T>G	uc002rkk.1	-	c.1070A>C	c.(1069-1071)GAC>GCC	p.D357A	ZNF513_uc002rkj.1_Missense_Mutation_p.D295A	NM_144631	NP_653232	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	357					regulation of transcription, DNA-dependent|response to stimulus|retina development in camera-type eye|transcription, DNA-dependent|visual perception	nucleus	promoter binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)													0.5	11.299303	11.299303	4	4	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	27454472	27454472	18552	2	T	G	G	58	58	ZNF513	G	4	4
XPO1	7514	broad.mit.edu	36	2	61569364	61569364	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:61569364C>G	uc002sbi.1	-	c.2069G>C	c.(2068-2070)AGC>ACC	p.S690T	XPO1_uc010fcl.1_Missense_Mutation_p.S686T|XPO1_uc002sbj.1_Missense_Mutation_p.S690T|XPO1_uc002sbk.1_Missense_Mutation_p.S251T|XPO1_uc002sbg.1_5'Flank|XPO1_uc002sbh.1_Missense_Mutation_p.S337T	NM_003400	NP_003391	O14980	XPO1_HUMAN	exportin 1	690					intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)											0.227273	15.610401	18.634035	10	34	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61569364	61569364	18028	2	C	G	G	28	28	XPO1	G	3	3
SNRNP200	23020	broad.mit.edu	36	2	96313115	96313116	+	Missense_Mutation	DNP	TA	GT	GT			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:96313115_96313116TA>GT	uc002svu.1	-	c.4647_4648TA>AC	c.(4645-4650)GCTATC>GCACTC	p.I1550L	SNRNP200_uc002svt.1_Missense_Mutation_p.I160L|SNRNP200_uc002svv.1_Missense_Mutation_p.I77L	NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	1550	Helicase C-terminal 2.				cis assembly of pre-catalytic spliceosome|response to stimulus|visual perception	catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|large_intestine(1)|skin(1)	7														0.304348	13.826966	14.607066	7	16	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	96313115	96313116	15352	2	TA	GT	GT	49	49	SNRNP200	GT	4	4
COL8A1	1295	broad.mit.edu	36	3	100995880	100995880	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:100995880C>T	uc003dti.1	+	c.448C>T	c.(448-450)CCA>TCA	p.P150S	COL8A1_uc003dtg.1_Missense_Mutation_p.P149S|COL8A1_uc003dth.1_Missense_Mutation_p.P149S	NM_020351	NP_065084	P27658	CO8A1_HUMAN	alpha 1 type VIII collagen precursor	149	Triple-helical region (COL1).				angiogenesis|cell adhesion	basement membrane|collagen type VIII					0														0.5	7.993192	7.993192	4	4	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100995880	100995880	3843	3	C	T	T	18	18	COL8A1	T	2	2
ZBTB11	27107	broad.mit.edu	36	3	102857681	102857681	+	Silent	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:102857681A>G	uc003dve.2	-	c.2148T>C	c.(2146-2148)TTT>TTC	p.F716F		NM_014415	NP_055230	O95625	ZBT11_HUMAN	zinc finger protein ZNF-U69274	716	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0														0.2	7.020478	9.549883	6	24	AA		KEEP	---	---	---	---	capture			Silent	SNP	102857681	102857681	18110	3	A	G	G	5	5	ZBTB11	G	4	4
ARHGAP31	57514	broad.mit.edu	36	3	120615501	120615501	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:120615501A>G	uc003ecj.2	+	c.2035A>G	c.(2035-2037)ACC>GCC	p.T679A		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	679	Pro-rich.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						Pancreas(7;176 297 5394 51128 51241)								0.465438	309.48943	309.7187	101	116	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	120615501	120615501	892	3	A	G	G	10	10	ARHGAP31	G	4	4
ARHGAP31	57514	broad.mit.edu	36	3	120615990	120615990	+	Nonsense_Mutation	SNP	A	T	T			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:120615990A>T	uc003ecj.2	+	c.2524A>T	c.(2524-2526)AGA>TGA	p.R842*		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	842					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						Pancreas(7;176 297 5394 51128 51241)								0.291667	10.902718	11.845089	7	17	AA		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	120615990	120615990	892	3	A	T	T	3	3	ARHGAP31	T	5	4
MYLK	4638	broad.mit.edu	36	3	124828440	124828440	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:124828440C>T	uc003ego.1	-	c.5153G>A	c.(5152-5154)TGG>TAG	p.W1718*	MYLK_uc003egp.1_Nonsense_Mutation_p.W1649*|MYLK_uc003egq.1_Nonsense_Mutation_p.W1667*|MYLK_uc003egr.1_Nonsense_Mutation_p.W1598*|MYLK_uc003egs.1_Nonsense_Mutation_p.W1542*|MYLK_uc010hrr.1_Nonsense_Mutation_p.W153*|MYLK_uc003egn.1_Nonsense_Mutation_p.W909*	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	1718	Calmodulin-binding.|Protein kinase.				aorta smooth muscle tissue morphogenesis|muscle contraction|protein phosphorylation	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)	6		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)						766				0.265306	18.826813	21.289493	13	36	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	124828440	124828440	10451	3	C	T	T	21	21	MYLK	T	5	2
OSBPL11	114885	broad.mit.edu	36	3	126765250	126765250	+	Silent	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr3:126765250T>C	uc003eic.1	-	c.996A>G	c.(994-996)GAA>GAG	p.E332E		NM_022776	NP_073613	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	332					lipid transport		lipid binding			ovary(3)|breast(1)|kidney(1)	5														0.139785	6.698576	18.409048	13	80	TT		KEEP	---	---	---	---	capture			Silent	SNP	126765250	126765250	11687	3	T	C	C	52	52	OSBPL11	C	4	4
TRIM42	287015	broad.mit.edu	36	3	141884289	141884289	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:141884289C>T	uc003eto.1	+	c.637C>T	c.(637-639)CGT>TGT	p.R213C		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	213						intracellular	zinc ion binding			lung(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)|skin(1)	6										261				0.222222	7.8893	9.168712	4	14	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	141884289	141884289	17061	3	C	T	T	27	27	TRIM42	T	1	1
USP13	8975	broad.mit.edu	36	3	180909272	180909273	+	Missense_Mutation	DNP	GA	CT	CT			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:180909272_180909273GA>CT	uc003fkg.1	+	c.638_639GA>CT	c.(637-639)AGA>ACT	p.R213T	USP13_uc003fkf.1_Missense_Mutation_p.R213T	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin specific protease 13	213	UBP-type.				ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)											0.160714	9.232378	15.385937	9	47	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	180909272	180909273	17606	3	GA	CT	CT	33	33	USP13	CT	3	3
OPA1	4976	broad.mit.edu	36	3	194832116	194832116	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:194832116G>T	uc003ftg.1	+	c.811G>T	c.(811-813)GAC>TAC	p.D271Y	OPA1_uc003fth.1_Missense_Mutation_p.D235Y|OPA1_uc003fti.1_Missense_Mutation_p.D253Y|OPA1_uc003ftj.1_Missense_Mutation_p.D234Y|OPA1_uc003ftk.1_Missense_Mutation_p.D217Y|OPA1_uc003ftl.1_Missense_Mutation_p.D198Y|OPA1_uc003ftm.1_Missense_Mutation_p.D216Y|OPA1_uc003ftn.1_Missense_Mutation_p.D180Y	NM_130837	NP_570850	O60313	OPA1_HUMAN	optic atrophy 1 isoform 8	216	Mitochondrial intermembrane (By similarity).|Potential.				apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)										0.225	23.452947	26.23315	9	31	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	194832116	194832116	11277	3	G	T	T	45	45	OPA1	T	3	3
TFRC	7037	broad.mit.edu	36	3	197278875	197278875	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:197278875A>C	uc003fvz.2	-	c.951T>G	c.(949-951)AAT>AAG	p.N317K	TFRC_uc003fwa.2_Missense_Mutation_p.N317K|TFRC_uc010hzy.1_Missense_Mutation_p.N236K	NM_003234	NP_003225	P02786	TFR1_HUMAN	transferrin receptor	317	Extracellular (Potential).				cellular iron ion homeostasis|endocytosis|interspecies interaction between organisms|proteolysis|transferrin transport|transmembrane transport	coated pit|endosome|integral to plasma membrane|melanosome	peptidase activity|transferrin receptor activity			ovary(3)	3	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)						680				0.264706	13.243513	14.960032	9	25	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	197278875	197278875	16340	3	A	C	C	12	12	TFRC	C	4	4
TM4SF19	116211	broad.mit.edu	36	3	197535099	197535099	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:197535099G>C	uc003fwl.1	-	c.616C>G	c.(616-618)CTC>GTC	p.L206V	TM4SF19_uc003fwj.2_Non-coding_Transcript|TM4SF19_uc010iad.1_Silent_p.A204A	NM_138461	NP_612470	Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19	206	Cytoplasmic (Potential).					integral to membrane					0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)										0.258065	12.471407	14.129	8	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	197535099	197535099	16498	3	G	C	C	35	35	TM4SF19	C	3	3
SCN5A	6331	broad.mit.edu	36	3	38572158	38572158	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:38572158C>T	uc003cio.1	-	c.4535G>A	c.(4534-4536)CGG>CAG	p.R1512Q	SCN5A_uc010hhh.1_Missense_Mutation_p.R15Q|SCN5A_uc003cim.1_Missense_Mutation_p.R1324Q|SCN5A_uc003cin.1_Missense_Mutation_p.R1511Q|SCN5A_uc003cil.2_Missense_Mutation_p.R1512Q|SCN5A_uc010hhi.1_Missense_Mutation_p.R1494Q	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1512			R -> W (in BRS1; significantly affects cardiac sodium channel characteristics; associated with an increase in inward sodium current during the action potential upstroke).		blood circulation|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|central_nervous_system(1)	7	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)									0.732394	339.538083	346.461486	104	38	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38572158	38572158	14404	3	C	T	T	23	23	SCN5A	T	1	1
QARS	5859	broad.mit.edu	36	3	49112843	49112843	+	Silent	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49112843A>G	uc003cvx.1	-	c.1029T>C	c.(1027-1029)TAT>TAC	p.Y343Y	QARS_uc003cvy.1_Silent_p.Y198Y	NM_005051	NP_005042	P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	343					glutaminyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|glutamine-tRNA ligase activity|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)									0.181818	6.32071	9.477101	6	27	AA		KEEP	---	---	---	---	capture			Silent	SNP	49112843	49112843	13329	3	A	G	G	8	8	QARS	G	4	4
RBM15B	29890	broad.mit.edu	36	3	51405365	51405365	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:51405365C>G	uc003dbd.1	+	c.1495C>G	c.(1495-1497)CAG>GAG	p.Q499E		NM_013286	NP_037418	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	499					interspecies interaction between organisms|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nucleoplasm	nucleotide binding|protein binding|RNA binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)										0.26087	9.530581	10.729603	6	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51405365	51405365	13578	3	C	G	G	21	21	RBM15B	G	3	3
NISCH	11188	broad.mit.edu	36	3	52501404	52501404	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:52501404G>C	uc003ded.2	+	c.4381G>C	c.(4381-4383)GCC>CCC	p.A1461P	NISCH_uc003dee.2_Missense_Mutation_p.A950P|NISCH_uc003deg.1_Intron|NISCH_uc003deh.2_Missense_Mutation_p.A210P|STAB1_uc003dei.1_5'Flank|STAB1_uc003dej.1_5'Flank	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	1461					apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)										0.6	6.818354	6.861006	3	2	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52501404	52501404	10833	3	G	C	C	34	34	NISCH	C	3	3
INTS12	57117	broad.mit.edu	36	4	106823800	106823800	+	Silent	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:106823800A>G	uc003hxw.1	-	c.928T>C	c.(928-930)TTG>CTG	p.L310L	INTS12_uc010ilr.1_Silent_p.L310L	NM_020395	NP_065128	Q96CB8	INT12_HUMAN	integrator complex subunit 12	310	Ser-rich.				snRNA processing	integrator complex	protein binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)										0.28	94.674959	100.113852	35	90	AA		KEEP	---	---	---	---	capture			Silent	SNP	106823800	106823800	8078	4	A	G	G	4	4	INTS12	G	4	4
FHDC1	85462	broad.mit.edu	36	4	154108616	154108616	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:154108616T>A	uc003inf.2	+	c.1135T>A	c.(1135-1137)TTG>ATG	p.L379M		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	379	FH2.				actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)													0.171429	6.421223	10.00708	6	29	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	154108616	154108616	6114	4	T	A	A	56	56	FHDC1	A	4	4
ENPP6	133121	broad.mit.edu	36	4	185276026	185276026	+	Silent	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:185276026T>C	uc003iwc.1	-	c.555A>G	c.(553-555)GCA>GCG	p.A185A		NM_153343	NP_699174	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	185	Extracellular (Potential).				lipid catabolic process	extracellular region|integral to membrane|plasma membrane				central_nervous_system(1)	1		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)										0.384615	9.665468	9.81904	5	8	TT		KEEP	---	---	---	---	capture			Silent	SNP	185276026	185276026	5327	4	T	C	C	55	55	ENPP6	C	4	4
ZFYVE28	57732	broad.mit.edu	36	4	2311160	2311160	+	Silent	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:2311160G>A	uc003gex.1	-	c.339C>T	c.(337-339)ATC>ATT	p.I113I	ZFYVE28_uc003gez.2_Silent_p.I66I|ZFYVE28_uc003gew.1_5'UTR|ZFYVE28_uc003gey.2_Silent_p.I43I	NM_020972	NP_066023	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	113					negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	phosphatidylinositol-3-phosphate binding|protein binding|zinc ion binding			ovary(1)	1														0.875	17.335434	17.922295	7	1	GG		KEEP	---	---	---	---	capture			Silent	SNP	2311160	2311160	18260	4	G	A	A	45	45	ZFYVE28	A	2	2
ZFYVE28	57732	broad.mit.edu	36	4	2311162	2311164	+	Nonsense_Mutation	TNP	TGG	ATC	ATC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:2311162_2311164TGG>ATC	uc003gex.1	-	c.335_337CCA>GAT	c.(334-339)TCCATC>TGATTC	p.112_113SI>*F	ZFYVE28_uc003gez.2_Nonsense_Mutation_p.65_66SI>*F|ZFYVE28_uc003gew.1_5'UTR|ZFYVE28_uc003gey.2_Nonsense_Mutation_p.42_43SI>*F	NM_020972	NP_066023	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	112_113					negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	phosphatidylinositol-3-phosphate binding|protein binding|zinc ion binding			ovary(1)	1														1	13.302113	13.270999	5	0	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	TNP	2311162	2311164	18260	4	TGG	ATC	ATC	51	51	ZFYVE28	ATC	5	4
SHROOM3	57619	broad.mit.edu	36	4	77879799	77879799	+	Silent	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:77879799T>C	uc003hke.1	+	c.1446T>C	c.(1444-1446)CCT>CCC	p.P482P	SHROOM3_uc003hkf.1_Silent_p.P358P|SHROOM3_uc003hkg.1_Silent_p.P261P	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein	483					apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			ovary(1)	1			Lung(101;0.0903)											0.333333	6.78918	7.087805	4	8	TT		KEEP	---	---	---	---	capture			Silent	SNP	77879799	77879799	14790	4	T	C	C	56	56	SHROOM3	C	4	4
GK2	2712	broad.mit.edu	36	4	80548173	80548173	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:80548173G>A	uc003hlu.1	-	c.206C>T	c.(205-207)GCG>GTG	p.A69V		NM_033214	NP_149991	Q14410	GLPK2_HUMAN	glycerol kinase 2	69					glycerol-3-phosphate metabolic process	mitochondrial outer membrane	ATP binding|glycerol kinase activity			ovary(2)	2														0.268707	201.494033	215.696379	79	215	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	80548173	80548173	6689	4	G	A	A	38	38	GK2	A	1	1
HNRPDL	9987	broad.mit.edu	36	4	83567659	83567659	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:83567659G>T	uc003hmr.1	-	c.857C>A	c.(856-858)CCA>CAA	p.P286Q	HNRPDL_uc003hmq.1_Non-coding_Transcript|HNRPDL_uc003hms.1_Non-coding_Transcript|HNRPDL_uc003hmt.1_Missense_Mutation_p.P286Q|HNRPDL_uc003hmu.1_5'Flank	NM_031372	NP_112740	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	286	RRM 2.				regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	cytoplasm|heterogeneous nuclear ribonucleoprotein complex	double-stranded DNA binding|nucleotide binding|poly(A) RNA binding|protein binding|single-stranded DNA binding				0		Hepatocellular(203;0.114)												0.444444	23.594927	23.643675	8	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	83567659	83567659	7568	4	G	T	T	47	47	HNRPDL	T	3	3
AGPAT9	84803	broad.mit.edu	36	4	84676922	84676922	+	Silent	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:84676922C>A	uc003how.1	+	c.123C>A	c.(121-123)ATC>ATA	p.I41I	AGPAT9_uc003hox.1_Silent_p.I41I|AGPAT9_uc003hoy.1_Silent_p.I41I	NM_032717	NP_116106	Q53EU6	GPAT3_HUMAN	lysophosphatidic acid acyltransferase theta	41					phospholipid biosynthetic process|regulation of TOR signaling cascade|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	glycerol-3-phosphate O-acyltransferase activity				0		Hepatocellular(203;0.114)												0.201401	254.928022	302.239777	115	456	CC		KEEP	---	---	---	---	capture			Silent	SNP	84676922	84676922	395	4	C	A	A	30	30	AGPAT9	A	3	3
IRF1	3659	broad.mit.edu	36	5	131853049	131853049	+	Silent	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:131853049G>A	uc003kxa.1	-	c.21C>T	c.(19-21)CGC>CGT	p.R7R	IRF1_uc003kxb.1_Silent_p.R7R|IRF1_uc010jdt.1_Silent_p.R7R|IRF1_uc003kxd.1_Intron	NM_002198	NP_002189	P10914	IRF1_HUMAN	interferon regulatory factor 1	7	IRF tryptophan pentad repeat.				blood coagulation|cellular response to mechanical stimulus|interferon-gamma-mediated signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleoplasm					0		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)										0.5	6.550219	6.550218	2	2	GG		KEEP	---	---	---	---	capture			Silent	SNP	131853049	131853049	8130	5	G	A	A	46	46	IRF1	A	2	2
GRK6	2870	broad.mit.edu	36	5	176800542	176800542	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:176800542G>C	uc010jkm.1	+	c.1559G>C	c.(1558-1560)TGC>TCC	p.C520S	GRK6_uc003mgq.2_Missense_Mutation_p.C520S|GRK6_uc003mgs.1_Missense_Mutation_p.C490S	NM_002082	NP_002073	P43250	GRK6_HUMAN	G protein-coupled receptor kinase 6 isoform B	520					protein phosphorylation|regulation of G-protein coupled receptor protein signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			large_intestine(1)|stomach(1)|breast(1)	3	all_cancers(89;1.15e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)							141				0.333333	8.358892	8.733466	5	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	176800542	176800542	7072	5	G	C	C	46	46	GRK6	C	3	3
HS3ST5	222537	broad.mit.edu	36	6	114485700	114485700	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:114485700G>A	uc003pwg.2	-	c.455C>T	c.(454-456)ACA>ATA	p.T152I	HS3ST5_uc003pwh.2_Missense_Mutation_p.T152I	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)	152	Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)										0.329032	273.235422	281.273494	102	208	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	114485700	114485700	7662	6	G	A	A	48	48	HS3ST5	A	2	2
HIVEP1	3096	broad.mit.edu	36	6	12233981	12233981	+	Silent	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:12233981T>C	uc003nac.1	+	c.5967T>C	c.(5965-5967)CTT>CTC	p.L1989L		NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	1989					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)	5	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)												0.266667	6.991502	7.731296	4	11	TT		KEEP	---	---	---	---	capture			Silent	SNP	12233981	12233981	7477	6	T	C	C	61	61	HIVEP1	C	4	4
MOG	4340	broad.mit.edu	36	6	29741929	29741929	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:29741929C>A	uc003nmy.1	+	c.458C>A	c.(457-459)CCT>CAT	p.P153H	MOG_uc003nmz.1_3'UTR|MOG_uc003nna.1_Missense_Mutation_p.P37H|MOG_uc003nnd.1_3'UTR|MOG_uc003nne.1_Missense_Mutation_p.P153H|MOG_uc003nnf.1_Missense_Mutation_p.P153H|MOG_uc003nng.1_Missense_Mutation_p.P153H|MOG_uc003nni.1_Missense_Mutation_p.P153H|MOG_uc003nnh.1_Missense_Mutation_p.P153H|MOG_uc003nnj.1_Missense_Mutation_p.P153H|MOG_uc003nnk.1_Missense_Mutation_p.P153H	NM_206809	NP_996532	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein isoform	153	Extracellular (Potential).				cell adhesion|central nervous system development|positive regulation of MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)	1														0.333333	11.905389	12.42832	7	14	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29741929	29741929	10084	6	C	A	A	24	24	MOG	A	3	3
TUBB2A	7280	broad.mit.edu	36	6	3100912	3100913	+	Missense_Mutation	DNP	AG	TC	TC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:3100912_3100913AG>TC	uc003mvc.1	-	c.222_223CT>GA	c.(220-225)GACTCT>GAGACT	p.74_75DS>ET	TUBB2A_uc003mvb.1_Missense_Mutation_p.67_68DS>ET|TUBB2A_uc003mvd.1_Intron	NM_001069	NP_001060	Q13885	TBB2A_HUMAN	tubulin, beta 2	74_75					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			skin(1)	1	Ovarian(93;0.0386)	all_hematologic(90;0.0895)												0.586207	85.523368	85.895203	34	24	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	3100912	3100913	17309	6	AG	TC	TC	11	11	TUBB2A	TC	4	4
TNF	7124	broad.mit.edu	36	6	31652972	31652972	+	Silent	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:31652972A>G	uc003nui.1	+	c.381A>G	c.(379-381)CCA>CCG	p.P127P	TNF_uc003nuj.1_5'UTR	NM_000594	NP_000585	P01375	TNFA_HUMAN	tumor necrosis factor alpha	127	Extracellular (Potential).				activation of caspase activity|activation of MAPK activity|activation of MAPKKK activity|anti-apoptosis|cellular response to nicotine|chronic inflammatory response to antigenic stimulus|embryonic digestive tract development|induction of apoptosis via death domain receptors|induction of necroptosis by extracellular signals|leukocyte tethering or rolling|necrotic cell death|negative regulation of branching involved in lung morphogenesis|negative regulation of cytokine secretion involved in immune response|negative regulation of fat cell differentiation|negative regulation of gene-specific transcription|negative regulation of interleukin-6 production|negative regulation of lipid catabolic process|negative regulation of lipid storage|negative regulation of viral genome replication|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of chemokine biosynthetic process|positive regulation of chemokine production|positive regulation of cytokine secretion|positive regulation of ERK1 and ERK2 cascade|positive regulation of fever generation|positive regulation of gene-specific transcription|positive regulation of heterotypic cell-cell adhesion|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of membrane protein ectodomain proteolysis|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of NFAT protein import into nucleus|positive regulation of nitric oxide biosynthetic process|positive regulation of osteoclast differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of podosome assembly|positive regulation of protein complex disassembly|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D biosynthetic process|protein import into nucleus, translocation|receptor biosynthetic process|regulation of insulin secretion|response to glucocorticoid stimulus|response to salt stress|response to virus|sequestering of triglyceride|transformed cell apoptosis|tumor necrosis factor-mediated signaling pathway	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane raft|phagocytic cup|recycling endosome	cytokine activity|identical protein binding|promoter binding|protease binding|transcription activator activity|transcription repressor activity|tumor necrosis factor receptor binding			ovary(1)|pancreas(1)|skin(1)	3		Ovarian(999;0.00556)			Adalimumab(DB00051)|Adenosine(DB00640)|Amrinone(DB01427)|Atorvastatin(DB01076)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Etanercept(DB00005)|Glucosamine(DB01296)|Infliximab(DB00065)|Naltrexone(DB00704)|Pranlukast(DB01411)|Procaterol(DB01366)|Saquinavir(DB01232)|Simvastatin(DB00641)|Thalidomide(DB01041)					43				0.333333	6.688848	6.987641	4	8	AA		KEEP	---	---	---	---	capture			Silent	SNP	31652972	31652972	16812	6	A	G	G	8	8	TNF	G	4	4
HLA-DRB1	3123	broad.mit.edu	36	6	32656503	32656503	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:32656503T>G	uc003obp.2	-	c.761A>C	c.(760-762)AAA>ACA	p.K254T	HLA-DRB5_uc003obk.2_Intron|HLA-DRB1_uc003obl.2_Intron|HLA-DRB6_uc003obo.1_Intron	NM_002124	NP_002115	P01911	2B1F_HUMAN	major histocompatibility complex, class II, DR	254	Cytoplasmic (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0											Multiple Myeloma(14;0.17)			0.1875	6.926792	9.865589	6	26	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32656503	32656503	7499	6	T	G	G	64	64	HLA-DRB1	G	4	4
KLHL32	114792	broad.mit.edu	36	6	97668442	97668442	+	Nonsense_Mutation	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:97668442C>G	uc010kcm.1	+	c.690C>G	c.(688-690)TAC>TAG	p.Y230*	KLHL32_uc003poy.2_Nonsense_Mutation_p.Y230*|KLHL32_uc003poz.2_Intron|KLHL32_uc003ppa.2_Intron	NM_052904	NP_443136	Q96NJ5	KLH32_HUMAN	kelch-like 32	230										ovary(3)	3		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)										0.2	7.154931	9.256626	5	20	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	97668442	97668442	8699	6	C	G	G	17	17	KLHL32	G	5	3
SHH	6469	broad.mit.edu	36	7	155297499	155297499	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:155297499C>T	uc003wmk.1	-	c.79G>A	c.(79-81)GGC>AGC	p.G27S	SHH_uc003wmh.1_5'Flank|SHH_uc003wmi.1_5'Flank|SHH_uc003wmj.1_5'Flank	NM_000193	NP_000184	Q15465	SHH_HUMAN	sonic hedgehog preproprotein	27			G -> A (in HPE3).		androgen metabolic process|axon guidance|branching involved in ureteric bud morphogenesis|CD4-positive or CD8-positive, alpha-beta T cell lineage commitment|embryonic digit morphogenesis|hindbrain development|intein-mediated protein splicing|lymphoid progenitor cell differentiation|metanephric mesenchymal cell proliferation involved in metanephros development|midbrain development|negative regulation of cell migration|negative regulation of kidney smooth muscle cell differentiation|negative regulation of ureter smooth muscle cell differentiation|negative thymic T cell selection|neural crest cell migration|neuroblast proliferation|patterning of blood vessels|positive regulation of alpha-beta T cell differentiation|positive regulation of immature T cell proliferation in thymus|positive regulation of kidney smooth muscle cell differentiation|positive regulation of T cell differentiation in thymus|positive regulation of ureter smooth muscle cell differentiation|positive thymic T cell selection|proteolysis|regulation of mesenchymal cell proliferation involved in ureter development|sclerotome development|stem cell development|thymus development|vasculogenesis|ventral midline development	cell surface|extracellular space|membrane raft|plasma membrane	calcium ion binding|laminin-1 binding|peptidase activity|signal transducer activity|transcription activator activity|zinc ion binding			central_nervous_system(3)	3	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00882)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)						109				0.117647	10.217941	29.787921	16	120	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	155297499	155297499	14771	7	C	T	T	22	22	SHH	T	2	2
NCAPG2	54892	broad.mit.edu	36	7	158147724	158147724	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:158147724C>T	uc003wnv.1	-	c.1912G>A	c.(1912-1914)GAA>AAA	p.E638K	NCAPG2_uc010lqu.1_Missense_Mutation_p.E430K|NCAPG2_uc003wnw.1_Non-coding_Transcript|NCAPG2_uc003wnx.1_Missense_Mutation_p.E638K	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5	638					cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)										0.216216	10.36506	13.134724	8	29	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	158147724	158147724	10607	7	C	T	T	30	30	NCAPG2	T	2	2
WIPI2	26100	broad.mit.edu	36	7	5234272	5234272	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:5234272T>G	uc003snv.1	+	c.1025T>G	c.(1024-1026)ATC>AGC	p.I342S	WIPI2_uc003snw.1_Missense_Mutation_p.I342S|WIPI2_uc003snx.1_Missense_Mutation_p.I324S|WIPI2_uc003sny.1_Missense_Mutation_p.I324S|WIPI2_uc010ksv.1_Missense_Mutation_p.I198S|WIPI2_uc003soa.1_Missense_Mutation_p.I283S|WIPI2_uc003sob.1_Missense_Mutation_p.I85S	NM_015610	NP_056425	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2	342	WD 3.				autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding			ovary(2)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)										0.833333	10.867397	11.476616	5	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5234272	5234272	17945	7	T	G	G	50	50	WIPI2	G	4	4
GTF2IRD1	9569	broad.mit.edu	36	7	73599451	73599451	+	Silent	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:73599451A>G	uc010lbq.1	+	c.1911A>G	c.(1909-1911)GGA>GGG	p.G637G	GTF2IRD1_uc003uaq.1_Silent_p.G605G|GTF2IRD1_uc003uap.1_Silent_p.G605G|GTF2IRD1_uc003uar.1_Silent_p.G605G	NM_005685	NP_005676	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 2	605	GTF2I-like 3.				regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4														0.235294	7.392582	8.482798	4	13	AA		KEEP	---	---	---	---	capture			Silent	SNP	73599451	73599451	7148	7	A	G	G	10	10	GTF2IRD1	G	4	4
LPL	4023	broad.mit.edu	36	8	19855202	19855202	+	Silent	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:19855202C>T	uc003wzk.2	+	c.531C>T	c.(529-531)AAC>AAT	p.N177N		NM_000237	NP_000228	P06858	LIPL_HUMAN	lipoprotein lipase precursor	177					chylomicron remodeling|fatty acid biosynthetic process|lipoprotein metabolic process|phospholipid metabolic process|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|positive regulation of sequestering of triglyceride|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	anchored to membrane|chylomicron|plasma membrane|very-low-density lipoprotein particle	heparin binding|lipoprotein lipase activity|phospholipase activity|receptor binding|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	Clofibrate(DB00636)|Gemfibrozil(DB01241)|Orlistat(DB01083)									0.175439	10.30017	15.991367	10	47	CC		KEEP	---	---	---	---	capture			Silent	SNP	19855202	19855202	9294	8	C	T	T	17	17	LPL	T	2	2
UNC5D	137970	broad.mit.edu	36	8	35703280	35703280	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr8:35703280A>T	uc003xjr.1	+	c.1372A>T	c.(1372-1374)ATC>TTC	p.I458F	UNC5D_uc003xjs.1_Missense_Mutation_p.I453F|UNC5D_uc003xjt.1_Missense_Mutation_p.I216F|UNC5D_uc003xju.1_Missense_Mutation_p.I34F	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D	458	Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			ovary(2)|pancreas(1)	3				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)										0.189873	33.624621	47.905213	30	128	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35703280	35703280	17553	8	A	T	T	8	8	UNC5D	T	4	4
SGK3	23678	broad.mit.edu	36	8	67879173	67879173	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:67879173C>A	uc003xwr.1	+	c.190C>A	c.(190-192)CAG>AAG	p.Q64K	SGK3_uc003xwp.1_Missense_Mutation_p.Q58K|SGK3_uc003xwt.1_Missense_Mutation_p.Q64K|SGK3_uc003xwu.1_Missense_Mutation_p.Q64K	NM_001033578	NP_037389	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase 3 isoform	64	PX.				cell communication|protein phosphorylation|response to stress	cytoplasmic membrane-bounded vesicle|early endosome	ATP binding|phosphatidylinositol binding|protein serine/threonine kinase activity			ovary(1)|large_intestine(1)|lung(1)|breast(1)	4	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)							285				0.266667	6.693536	7.432453	4	11	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	67879173	67879173	14703	8	C	A	A	17	17	SGK3	A	3	3
TRPA1	8989	broad.mit.edu	36	8	73104715	73104715	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:73104715G>A	uc003xza.1	-	c.2912C>T	c.(2911-2913)GCA>GTA	p.A971V		NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	971	Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)									0.208333	6.754899	8.654887	5	19	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73104715	73104715	17128	8	G	A	A	46	46	TRPA1	A	2	2
PALM2-AKAP2	445815	broad.mit.edu	36	9	111939512	111939513	+	Missense_Mutation	DNP	AA	TC	TC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:111939512_111939513AA>TC	uc004bei.2	+	c.2563_2564AA>TC	c.(2563-2565)AAA>TCA	p.K855S	PALM2-AKAP2_uc004bek.2_Missense_Mutation_p.K623S|PALM2-AKAP2_uc004bej.2_Missense_Mutation_p.K623S|PALM2-AKAP2_uc004bel.1_Missense_Mutation_p.K433S|AKAP2_uc004bem.1_Missense_Mutation_p.K481S|PALM2-AKAP2_uc010mtw.1_Missense_Mutation_p.K441S|PALM2-AKAP2_uc004ben.1_Missense_Mutation_p.K392S	NM_001004065	NP_001004065	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 1	392							enzyme binding			ovary(3)|central_nervous_system(2)	5														0.307692	7.49112	7.922316	4	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	111939512	111939513	11826	9	AA	TC	TC	9	9	PALM2-AKAP2	TC	4	4
C9orf43	257169	broad.mit.edu	36	9	115215684	115215684	+	Silent	SNP	C	G	G			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:115215684C>G	uc004bho.2	+	c.90C>G	c.(88-90)CGC>CGG	p.R30R	POLE3_uc004bhn.1_5'Flank|C9orf43_uc004bhp.1_Silent_p.R30R	NM_152786	NP_689999	Q8TAL5	CI043_HUMAN	hypothetical protein LOC257169	30											0														0.22449	14.393398	17.826255	11	38	CC		KEEP	---	---	---	---	capture			Silent	SNP	115215684	115215684	2598	9	C	G	G	25	25	C9orf43	G	3	3
CDK5RAP2	55755	broad.mit.edu	36	9	122191346	122191347	+	Missense_Mutation	DNP	GT	CC	CC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:122191346_122191347GT>CC	uc004bkf.1	-	c.5670_5671AC>GG	c.(5668-5673)AGACCA>AGGGCA	p.P1891A	CDK5RAP2_uc004bkg.1_Missense_Mutation_p.P1812A|CDK5RAP2_uc010mvi.1_Missense_Mutation_p.P900A|CDK5RAP2_uc004bke.1_Missense_Mutation_p.P1176A	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1891	Interaction with PCNT and AKAP9.				brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|promoter binding			ovary(2)|lung(1)|skin(1)	4														0.478261	22.593206	22.60405	11	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	122191346	122191347	3275	9	GT	CC	CC	44	44	CDK5RAP2	CC	3	3
ST6GALNAC6	30815	broad.mit.edu	36	9	129689639	129689639	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:129689639C>T	uc004bso.1	-	c.757G>A	c.(757-759)GTG>ATG	p.V253M	ST6GALNAC6_uc004bsn.1_Missense_Mutation_p.V219M|ST6GALNAC6_uc004bsp.1_Missense_Mutation_p.V253M|ST6GALNAC6_uc004bsq.1_Missense_Mutation_p.V219M|ST6GALNAC6_uc004bsr.2_Missense_Mutation_p.V219M|ST6GALNAC6_uc010mxp.1_Non-coding_Transcript	NM_013443	NP_038471	Q969X2	SIA7F_HUMAN	ST6	253	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane|plasma membrane					0														0.375	11.133626	11.357279	6	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	129689639	129689639	15746	9	C	T	T	18	18	ST6GALNAC6	T	2	2
SH3GLB2	56904	broad.mit.edu	36	9	130810809	130810809	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:130810809A>C	uc004bww.1	-	c.1190T>G	c.(1189-1191)GTC>GGC	p.V397G	SH3GLB2_uc004bwv.1_Missense_Mutation_p.V388G|SH3GLB2_uc004bwx.1_Missense_Mutation_p.V388G	NM_020145	NP_064530	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	388	SH3.				filopodium assembly|signal transduction	cytoplasm|nucleus	cytoskeletal adaptor activity|SH3 domain binding				0												OREG0003926	type=REGULATORY REGION|Gene=SH3GLB2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	0.269231	11.602092	12.861638	7	19	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130810809	130810809	14746	9	A	C	C	10	10	SH3GLB2	C	4	4
TUBB2C	10383	broad.mit.edu	36	9	139257569	139257569	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:139257569G>C	uc004cmh.1	+	c.1078G>C	c.(1078-1080)GGG>CGG	p.G360R	TUBB2C_uc004cmg.1_Missense_Mutation_p.G214R	NM_006088	NP_006079	P68371	TBB2C_HUMAN	tubulin, beta, 2	360					'de novo' posttranslational protein folding|cellular component movement|G2/M transition of mitotic cell cycle|microtubule-based movement|natural killer cell mediated cytotoxicity|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|MHC class I protein binding|structural molecule activity|unfolded protein binding			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)										0.24	15.25115	18.3646	12	38	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	139257569	139257569	17311	9	G	C	C	43	43	TUBB2C	C	3	3
ARRDC1	92714	broad.mit.edu	36	9	139628941	139628941	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:139628941G>C	uc004cns.1	+	c.905G>C	c.(904-906)GGG>GCG	p.G302A	ARRDC1_uc004cnp.1_Missense_Mutation_p.G302A|ARRDC1_uc004cnq.1_Missense_Mutation_p.G284A|ARRDC1_uc004cnt.1_Missense_Mutation_p.G177A|ARRDC1_uc004cnu.1_Non-coding_Transcript|ARRDC1_uc004cnv.1_Missense_Mutation_p.G282A|ARRDC1_uc004cnw.1_Missense_Mutation_p.G177A|ARRDC1_uc004cnx.1_Missense_Mutation_p.G177A|ARRDC1_uc004cny.1_Non-coding_Transcript	NM_152285	NP_689498	Q8N5I2	ARRD1_HUMAN	arrestin domain containing 1	302	Pro-rich.										0	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000273)|Epithelial(140;0.000464)										0.461538	14.043589	14.060735	6	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	139628941	139628941	1000	9	G	C	C	43	43	ARRDC1	C	3	3
ZCCHC6	79670	broad.mit.edu	36	9	88130153	88130153	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:88130153C>A	uc004aoq.1	-	c.1705G>T	c.(1705-1707)GCT>TCT	p.A569S	ZCCHC6_uc004aor.1_Non-coding_Transcript|ZCCHC6_uc004aos.1_Non-coding_Transcript|ZCCHC6_uc004aot.1_Missense_Mutation_p.A446S|ZCCHC6_uc004aou.1_Missense_Mutation_p.A569S	NM_024617	NP_078893	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	569	PAP-associated 1.				RNA 3'-end processing		nucleic acid binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)	2														0.166667	6.39014	10.835933	7	35	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88130153	88130153	18180	9	C	A	A	26	26	ZCCHC6	A	3	3
XKRX	402415	broad.mit.edu	36	X	100056210	100056210	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:100056210A>T	uc004egn.1	-	c.1162T>A	c.(1162-1164)TTA>ATA	p.L388I		NM_212559	NP_997724	Q6PP77	XKR2_HUMAN	XK, Kell blood group complex subunit-related,	375	Helical; (Potential).					integral to membrane|plasma membrane				breast(1)	1														0.2	8.528429	12.330673	9	36	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100056210	100056210	18020	23	A	T	T	2	2	XKRX	T	4	4
CLCN4	1183	broad.mit.edu	36	X	10126032	10126032	+	Silent	SNP	G	T	T			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:10126032G>T	uc004csy.2	+	c.486G>T	c.(484-486)CTG>CTT	p.L162L		NM_001830	NP_001821	P51793	CLCN4_HUMAN	chloride channel 4	162	Helical; (By similarity).					early endosome membrane|integral to membrane|late endosome membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			ovary(2)|lung(2)	4						Melanoma(74;1050 1296 1576 30544 38374)								0.226277	78.757561	88.181481	31	106	GG		KEEP	---	---	---	---	capture			Silent	SNP	10126032	10126032	3601	23	G	T	T	48	48	CLCN4	T	3	3
DCAF12L2	340578	broad.mit.edu	36	X	125127328	125127329	+	Missense_Mutation	DNP	CA	AT	AT			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:125127328_125127329CA>AT	uc004euk.1	-	c.260_261TG>AT	c.(259-261)CTG>CAT	p.L87H		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	WD repeat domain 40C	87										lung(2)|large_intestine(1)|ovary(1)|pancreas(1)	5														0.8	8.223251	8.605411	4	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	125127328	125127329	4436	23	CA	AT	AT	29	29	DCAF12L2	AT	3	3
FAM127A	8933	broad.mit.edu	36	X	133994335	133994336	+	Missense_Mutation	DNP	AA	TT	TT			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:133994335_133994336AA>TT	uc004eyd.1	+	c.256_257AA>TT	c.(256-258)AAG>TTG	p.K86L		NM_001078171	NP_001071639	A6ZKI3	F127A_HUMAN	family with sequence similarity 127, member A	86											0	Acute lymphoblastic leukemia(192;0.000127)													0.25	7.36029	8.502738	5	15	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	133994335	133994336	5628	23	AA	TT	TT	9	9	FAM127A	TT	4	4
SLITRK4	139065	broad.mit.edu	36	X	142544914	142544914	+	Silent	SNP	T	C	C			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:142544914T>C	uc004fbx.1	-	c.1677A>G	c.(1675-1677)AAA>AAG	p.K559K	SLITRK4_uc004fby.1_Silent_p.K559K|SLITRK4_uc010nsn.1_Silent_p.K559K	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein	559	Extracellular (Potential).|LRRCT 2.					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)													0.206897	7.972503	10.260486	6	23	TT		KEEP	---	---	---	---	capture			Silent	SNP	142544914	142544914	15243	23	T	C	C	52	52	SLITRK4	C	4	4
MAGEA10	4109	broad.mit.edu	36	X	151054038	151054038	+	Silent	SNP	C	T	T			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:151054038C>T	uc004ffk.1	-	c.711G>A	c.(709-711)GAG>GAA	p.E237E	MAGEA10_uc004ffl.1_Silent_p.E237E|MAGEA10_uc010ntj.1_Silent_p.E237E	NM_001011543	NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	237	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)													0.210526	9.388875	10.862652	4	15	CC		KEEP	---	---	---	---	capture			Silent	SNP	151054038	151054038	9541	23	C	T	T	24	24	MAGEA10	T	2	2
MAGEA3	4102	broad.mit.edu	36	X	151686458	151686458	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:151686458A>C	uc004fgp.1	-	c.365T>G	c.(364-366)CTC>CGC	p.L122R	MAGEA3_uc010ntu.1_Missense_Mutation_p.L122R	NM_005362	NP_005353	P43357	MAGA3_HUMAN	melanoma antigen family A, 3	122	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)													0.344828	16.518195	17.145178	10	19	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	151686458	151686458	9546	23	A	C	C	11	11	MAGEA3	C	4	4
MAGEB1	4112	broad.mit.edu	36	X	30179265	30179265	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:30179265T>A	uc004dcc.1	+	c.734T>A	c.(733-735)ATC>AAC	p.I245N	MAGEB1_uc004dcd.1_Missense_Mutation_p.I245N|MAGEB1_uc004dce.1_Missense_Mutation_p.I245N|MAGEB1_uc010ngh.1_Missense_Mutation_p.I245N	NM_002363	NP_803134	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	245	MAGE.										0														0.333333	6.787624	7.087025	4	8	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30179265	30179265	9553	23	T	A	A	50	50	MAGEB1	A	4	4
AKAP4	8852	broad.mit.edu	36	X	49844174	49844174	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1389-01	TCGA-19-1389-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:49844174T>G	uc004dow.1	-	c.1930A>C	c.(1930-1932)AAA>CAA	p.K644Q	AKAP4_uc004dov.1_Missense_Mutation_p.K261Q|AKAP4_uc010njp.1_Missense_Mutation_p.K466Q|AKAP4_uc004dou.1_Missense_Mutation_p.K635Q	NM_003886	NP_647450	Q5JQC9	AKAP4_HUMAN	A-kinase anchor protein 4 isoform 1	644					cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding			kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)	7	Ovarian(276;0.236)									119				0.166667	12.175757	21.075911	14	70	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49844174	49844174	456	23	T	G	G	63	63	AKAP4	G	4	4
GNL3L	54552	broad.mit.edu	36	X	54594781	54594781	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:54594781A>C	uc004dth.1	+	c.919A>C	c.(919-921)ATT>CTT	p.I307L	GNL3L_uc004dti.2_Non-coding_Transcript	NM_019067	NP_061940	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3	307	G.				ribosome biogenesis	nucleolus	GTP binding			ovary(1)	1														0.196078	10.904508	15.323546	10	41	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54594781	54594781	6807	23	A	C	C	8	8	GNL3L	C	4	4
ERCC6L	54821	broad.mit.edu	36	X	71342567	71342567	+	Silent	SNP	A	G	G			TCGA-19-1389-01	TCGA-19-1389-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:71342567A>G	uc004eaq.1	-	c.2775T>C	c.(2773-2775)CAT>CAC	p.H925H	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Silent_p.H802H	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	925					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)													0.166667	6.420798	10.228381	6	30	AA		KEEP	---	---	---	---	capture			Silent	SNP	71342567	71342567	5411	23	A	G	G	16	16	ERCC6L	G	4	4
MAGEE1	57692	broad.mit.edu	36	X	75567597	75567597	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1389-01	TCGA-19-1389-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:75567597G>A	uc004ecm.1	+	c.2870G>A	c.(2869-2871)AGG>AAG	p.R957K		NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	957	Interaction with DTNA (By similarity).					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane				breast(3)|ovary(1)|pancreas(1)|skin(1)	6														0.444444	8.293022	8.317951	4	5	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75567597	75567597	9568	23	G	A	A	35	35	MAGEE1	A	2	2
SHROOM2	357	broad.mit.edu	36	X	9824455	9824457	+	Missense_Mutation	TNP	GTG	ACC	ACC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:9824455_9824457GTG>ACC	uc004csu.1	+	c.2507_2509GTG>ACC	c.(2506-2511)TGTGAG>TACCAG	p.836_837CE>YQ		NM_001649	NP_001640	Q13796	SHRM2_HUMAN	apical protein of Xenopus-like	836_837					apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	6		Hepatocellular(5;0.000888)												0.75	6.73169	6.94686	3	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	9824455	9824457	14789	23	GTG	ACC	ACC	48	48	SHROOM2	ACC	2	2
KDM5D	8284	broad.mit.edu	36	Y	20328138	20328138	+	Splice_Site_SNP	SNP	C	A	A			TCGA-19-1389-01	TCGA-19-1389-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrY:20328138C>A	uc004fug.1	-	c.e25_splice_site			KDM5D_uc004fuf.1_Splice_Site_SNP|KDM5D_uc010nwy.1_Splice_Site_SNP	NM_004653	NP_004644			jumonji, AT rich interactive domain 1D						chromatin modification|oxidation-reduction process|spermatogenesis	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1					Vitamin C(DB00126)									0.217391	6.855094	8.5592	5	18	CC		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	20328138	20328138	8442	24	C	A	A	24	24	KDM5D	A	5	3
XPNPEP1	7511	broad.mit.edu	36	10	111632317	111632318	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:111632317_111632318delCT	uc009xxt.1	-	c.903_904delAG	c.(901-906)GAAGCCfs	p.E301fs	XPNPEP1_uc001kyp.1_Frame_Shift_Del_p.E258fs|XPNPEP1_uc001kyq.1_Frame_Shift_Del_p.E187fs	NM_020383	NP_065116	Q9NQW7	XPP1_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 1,	258_259					bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity			ovary(3)|pancreas(1)	4		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)										0.44			18	23				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	111632317	111632318	18025	10	CT	-	-	28	28	XPNPEP1	-	5	5
RET	5979	broad.mit.edu	36	10	42939166	42939182	+	Frame_Shift_Del	DEL	GGGGAAACCCCTATCCT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:42939166_42939182delGGGGAAACCCCTATCCT	uc001jal.1	+	c.2843_2859delGGGGAAACCCCTATCCT	c.(2842-2859)GGGGGAAACCCCTATCCTfs	p.G948fs	RET_uc001jak.1_Frame_Shift_Del_p.G948fs	NM_020975	NP_066124	P07949	RET_HUMAN	ret proto-oncogene isoform a	948_953	Protein kinase.|Cytoplasmic (Potential).				homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development|protein phosphorylation	integral to membrane	ATP binding|calcium ion binding|transcription activator activity|transmembrane receptor protein tyrosine kinase activity			thyroid(381)|adrenal_gland(20)|lung(6)|large_intestine(5)|ovary(4)|central_nervous_system(3)|urinary_tract(1)	420		Ovarian(717;0.0423)			Sunitinib(DB01268)	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		1		536				0.84			118	23				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	42939166	42939182	13705	10	GGGGAAACCCCTATCCT	-	-	43	43	RET	-	5	5
GDF10	2662	broad.mit.edu	36	10	48048822	48048824	+	In_Frame_Del	DEL	AAG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:48048822_48048824delAAG	uc001jfb.1	-	c.1068_1070delCTT	c.(1066-1071)GACTTT>GAT	p.F357del	GDF10_uc009xnp.1_In_Frame_Del_p.F356del|GDF10_uc009xnq.1_In_Frame_Del_p.F357del	NM_004962	NP_004953	P55107	BMP3B_HUMAN	growth differentiation factor 10 precursor	357					growth|skeletal system development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity			lung(1)|central_nervous_system(1)	2														0.74			31	11				---	---	---	---	capture_indel			In_Frame_Del	DEL	48048822	48048824	6579	10	AAG	-	-	1	1	GDF10	-	5	5
TRPC6	7225	broad.mit.edu	36	11	100867574	100867578	+	Frame_Shift_Del	DEL	CAACA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:100867574_100867578delCAACA	uc001pgk.2	-	c.1047_1051delTGTTG	c.(1045-1053)GATGTTGAAfs	p.D349fs	TRPC6_uc009ywy.1_Intron|TRPC6_uc009ywz.1_Frame_Shift_Del_p.D349fs	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,	349_351	Cytoplasmic (Potential).				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		Colon(166;1315 1927 11094 12848 34731)								0.33			5	10				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	100867574	100867578	17134	11	CAACA	-	-	29	29	TRPC6	-	5	5
PHLDB1	23187	broad.mit.edu	36	11	118004470	118004478	+	In_Frame_Del	DEL	AGCGGAAAA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:118004470_118004478delAGCGGAAAA	uc001ptr.1	+	c.1721_1729delAGCGGAAAA	c.(1720-1731)GAGCGGAAAAAT>GAT	p.574_577ERKN>D	PHLDB1_uc001pts.1_In_Frame_Del_p.574_577ERKN>D|PHLDB1_uc001ptt.1_In_Frame_Del_p.574_577ERKN>D|PHLDB1_uc001ptu.1_Intron|PHLDB1_uc001ptv.1_In_Frame_Del_p.374_377ERKN>D|PHLDB1_uc001ptw.1_5'Flank	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B,	574_577											0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)										0.36			5	9				---	---	---	---	capture_indel			In_Frame_Del	DEL	118004470	118004478	12275	11	AGCGGAAAA	-	-	11	11	PHLDB1	-	5	5
HARBI1	283254	broad.mit.edu	36	11	46581919	46581928	+	Frame_Shift_Del	DEL	TCTTCTCAAT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:46581919_46581928delTCTTCTCAAT	uc001ncy.1	-	c.778_787delATTGAGAAGA	c.(778-789)ATTGAGAAGACTfs	p.I260fs		NM_173811	NP_776172	Q96MB7	HARB1_HUMAN	harbinger transposase derived 1	260_263						cytoplasm|nucleus	metal ion binding|nuclease activity				0														0.40			78	117				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	46581919	46581928	7240	11	TCTTCTCAAT	-	-	58	58	HARBI1	-	5	5
DPP3	10072	broad.mit.edu	36	11	66015351	66015353	+	In_Frame_Del	DEL	GGG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:66015351_66015353delGGG	uc001oig.1	+	c.719_721delGGG	c.(718-723)CGGGGA>CGA	p.G241del	DPP3_uc001oif.1_In_Frame_Del_p.G241del	NM_005700	NP_569710	Q9NY33	DPP3_HUMAN	dipeptidyl peptidase III	241					proteolysis	cytoplasm	aminopeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity			ovary(1)	1												OREG0021109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.79			73	19				---	---	---	---	capture_indel			In_Frame_Del	DEL	66015351	66015353	4912	11	GGG	-	-	39	39	DPP3	-	5	5
OAS2	4939	broad.mit.edu	36	12	111920586	111920593	+	Frame_Shift_Del	DEL	TTGGAATG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:111920586_111920593delTTGGAATG	uc001tuj.1	+	c.996_1003delTTGGAATG	c.(994-1005)TCTTGGAATGTTfs	p.S332fs	OAS2_uc001tui.1_Frame_Shift_Del_p.S332fs	NM_016817	NP_058197	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2 isoform 1	332_335	OAS domain 1.|Pro-rich (linker).				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|membrane|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(1)	1						Pancreas(199;709 2232 18410 33584 35052)								0.33			21	42				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	111920586	111920593	11205	12	TTGGAATG	-	-	56	56	OAS2	-	5	5
ABCB9	23457	broad.mit.edu	36	12	122010480	122010503	+	In_Frame_Del	DEL	TGACCAGCCACGAGGCCCGCAGCC	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:122010480_122010503delTGACCAGCCACGAGGCCCGCAGCC	uc001udm.2	-	c.233_256delGGCTGCGGGCCTCGTGGCTGGTCA	c.(232-258)CGGCTGCGGGCCTCGTGGCTGGTCATC>CTC	p.78_86RLRASWLVI>L	ABCB9_uc001udo.2_In_Frame_Del_p.78_86RLRASWLVI>L|ABCB9_uc009zxr.1_In_Frame_Del_p.78_86RLRASWLVI>L|ABCB9_uc001udp.1_In_Frame_Del_p.78_86RLRASWLVI>L|ABCB9_uc001udq.2_5'UTR|ABCB9_uc001udr.2_In_Frame_Del_p.78_86RLRASWLVI>L	NM_019625	NP_982269	Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	78_86	Helical; (Potential).				positive regulation of T cell mediated cytotoxicity|protein transport	lysosomal membrane|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		Ovarian(49;786 1333 9175 38236)								0.47			17	19				---	---	---	---	capture_indel			In_Frame_Del	DEL	122010480	122010503	49	12	TGACCAGCCACGAGGCCCGCAGCC	-	-	51	51	ABCB9	-	5	5
RIMBP2	23504	broad.mit.edu	36	12	129492820	129492828	+	In_Frame_Del	DEL	CCCATCCTG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:129492820_129492828delCCCATCCTG	uc001uil.2	-	c.971_979delCAGGATGGG	c.(970-981)CCAGGATGGGGA>CGA	p.324_327PGWG>R	RIMBP2_uc001uim.2_In_Frame_Del_p.232_235PGWG>R|RIMBP2_uc001uin.1_5'UTR	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	324_327	Fibronectin type-III 1.					cell junction|synapse				ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	8	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)										0.39			23	36				---	---	---	---	capture_indel			In_Frame_Del	DEL	129492820	129492828	13838	12	CCCATCCTG	-	-	22	22	RIMBP2	-	5	5
RARG	5916	broad.mit.edu	36	12	51893595	51893603	+	In_Frame_Del	DEL	CCATCTCCA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:51893595_51893603delCCATCTCCA	uc001sce.1	-	c.962_970delTGGAGATGG	c.(961-972)CTGGAGATGGAT>CAT	p.321_324LEMD>H	RARG_uc001scf.1_In_Frame_Del_p.321_324LEMD>H|RARG_uc001scg.1_In_Frame_Del_p.249_252LEMD>H|RARG_uc001scd.1_In_Frame_Del_p.310_313LEMD>H	NM_000966	NP_000957	P13631	RARG_HUMAN	retinoic acid receptor, gamma isoform 1	321_324	Ligand-binding.				canonical Wnt receptor signaling pathway|embryonic eye morphogenesis|embryonic hindlimb morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|regulation of cell size|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid	integral to membrane|transcription factor complex	retinoic acid receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			breast(2)|ovary(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)					80		OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.33			41	82				---	---	---	---	capture_indel			In_Frame_Del	DEL	51893595	51893603	13514	12	CCATCTCCA	-	-	30	30	RARG	-	5	5
STAT2	6773	broad.mit.edu	36	12	55030458	55030464	+	Splice_Site_Del	DEL	CCTACCC	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:55030458_55030464delCCTACCC	uc001slc.1	-	c.e12_splice_site			STAT2_uc001slb.1_5'Flank|STAT2_uc001sld.1_Splice_Site_Del	NM_005419	NP_005410			signal transducer and activator of transcription						interspecies interaction between organisms|JAK-STAT cascade|regulation of transcription from RNA polymerase II promoter|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	cytosol|nucleoplasm|plasma membrane	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3														0.46			141	166				---	---	---	---	capture_indel			Splice_Site_Del	DEL	55030458	55030464	15785	12	CCTACCC	-	-	18	18	STAT2	-	5	5
HSD17B6	8630	broad.mit.edu	36	12	55462265	55462274	+	Frame_Shift_Del	DEL	CCTTTTCAGA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:55462265_55462274delCCTTTTCAGA	uc001smg.1	+	c.554_563delCCTTTTCAGA	c.(553-564)GCCTTTTCAGATfs	p.A185fs		NM_003725	NP_003716	O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	185_188					androgen biosynthetic process|androgen catabolic process|oxidation-reduction process	early endosome membrane|endoplasmic reticulum|microsome	binding|electron carrier activity|estradiol 17-beta-dehydrogenase activity|retinol dehydrogenase activity|testosterone 17-beta-dehydrogenase activity			pancreas(1)	1					Succinic acid(DB00139)									0.35			22	41				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	55462265	55462274	7682	12	CCTTTTCAGA	-	-	26	26	HSD17B6	-	5	5
PZP	5858	broad.mit.edu	36	12	9240193	9240194	+	Frame_Shift_Ins	INS	-	A	A			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:9240193_9240194insA	uc001qvl.1	-	c.1091_1092insT	c.(1090-1092)CAGfs	p.Q364fs	PZP_uc009zgl.1_Frame_Shift_Ins_p.Q233fs	NM_002864	NP_002855			pregnancy-zone protein											ovary(3)|large_intestine(1)	4						Melanoma(125;1402 1695 4685 34487 38571)								0.59			49	34				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	9240193	9240194	13327	12	-	A	A	24	24	PZP	A	5	5
CCDC38	120935	broad.mit.edu	36	12	94835049	94835049	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:94835049_94835049delC	uc001tek.1	-	c.293_293delG	c.(292-294)AGAfs	p.R98fs		NM_182496	NP_872302	Q502W7	CCD38_HUMAN	coiled-coil domain containing 38	98											0														0.56			98	78				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	94835049	94835049	2932	12	C	-	-	32	32	CCDC38	-	5	5
SYNE2	23224	broad.mit.edu	36	14	63610496	63610500	+	Frame_Shift_Del	DEL	ACATT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:63610496_63610500delACATT	uc001xgl.1	+	c.10755_10759delACATT	c.(10753-10761)AGACATTCCfs	p.R3585fs	SYNE2_uc001xgm.1_Frame_Shift_Del_p.R3585fs|SYNE2_uc010apy.1_5'Flank|SYNE2_uc010apw.1_Frame_Shift_Del_p.R291fs|SYNE2_uc010apx.1_5'UTR	NM_182914	NP_878918	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3585_3587	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)										0.68			39	18				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	63610496	63610500	15967	14	ACATT	-	-	10	10	SYNE2	-	5	5
SYNE2	23224	broad.mit.edu	36	14	63706869	63706870	+	Frame_Shift_Ins	INS	-	A	A			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:63706869_63706870insA	uc001xgl.1	+	c.17171_17172insA	c.(17170-17172)TCTfs	p.S5724fs	SYNE2_uc001xgm.1_Frame_Shift_Ins_p.S5724fs|SYNE2_uc010apy.1_Frame_Shift_Ins_p.S2109fs|SYNE2_uc001xgn.1_Frame_Shift_Ins_p.S686fs|SYNE2_uc001xgo.1_Non-coding_Transcript|SYNE2_uc010aqa.1_De_novo_Start_OutOfFrame|SYNE2_uc001xgq.1_Frame_Shift_Ins_p.S89fs	NM_182914	NP_878918	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5724	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)										0.43			13	17				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	63706869	63706870	15967	14	-	A	A	32	32	SYNE2	A	5	5
KIAA1409	57578	broad.mit.edu	36	14	93158716	93158725	+	Frame_Shift_Del	DEL	AGAACCCCAC	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:93158716_93158725delAGAACCCCAC	uc001ybv.1	+	c.4919_4928delAGAACCCCAC	c.(4918-4929)GAGAACCCCACAfs	p.E1640fs	KIAA1409_uc001ybs.1_Frame_Shift_Del_p.E1618fs	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1795_1798						integral to membrane				ovary(10)|large_intestine(3)	13		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)						1186				0.53			19	17				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	93158716	93158725	8539	14	AGAACCCCAC	-	-	11	11	KIAA1409	-	5	5
C15orf33	196951	broad.mit.edu	36	15	47450871	47450874	+	Frame_Shift_Del	DEL	TAAT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:47450871_47450874delTAAT	uc001zxl.2	-	c.1027_1030delATTA	c.(1027-1032)ATTATAfs	p.I343fs		NM_152647	NP_689860	Q96M60	CO033_HUMAN	hypothetical protein LOC196951	343_344										ovary(1)	1		all_lung(180;0.00187)		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)										0.37			7	12				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	47450871	47450874	1841	15	TAAT	-	-	49	49	C15orf33	-	5	5
CHRNA3	1136	broad.mit.edu	36	15	76680986	76681002	+	Frame_Shift_Del	DEL	GGGGAGCAGGTTCAAGA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:76680986_76681002delGGGGAGCAGGTTCAAGA	uc002bec.1	-	c.1037_1053delTCTTGAACCTGCTCCCC	c.(1036-1053)TTCTTGAACCTGCTCCCCfs	p.F346fs	CHRNA3_uc002bea.2_Non-coding_Transcript|CHRNA3_uc002beb.2_Frame_Shift_Del_p.F346fs	NM_000743	NP_000734	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3	346_351	Cytoplasmic (Potential).				activation of transmembrane receptor protein tyrosine kinase activity|behavioral response to nicotine|locomotory behavior|regulation of acetylcholine secretion|regulation of dendrite morphogenesis|regulation of excitatory postsynaptic membrane potential|regulation of smooth muscle contraction|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|dendrite|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic density|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	p.P351S(1)		central_nervous_system(3)|ovary(1)	4										173				0.48			87	93				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	76680986	76681002	3518	15	GGGGAGCAGGTTCAAGA	-	-	47	47	CHRNA3	-	5	5
SRRM2	23524	broad.mit.edu	36	16	2754371	2754374	+	Frame_Shift_Del	DEL	TCTT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:2754371_2754374delTCTT	uc002crk.1	+	c.3841_3844delTCTT	c.(3841-3846)TCTTTGfs	p.S1281fs	SRRM2_uc002crj.1_Frame_Shift_Del_p.S1185fs|SRRM2_uc002crl.1_Frame_Shift_Del_p.S1281fs|SRRM2_uc010bsu.1_Frame_Shift_Del_p.S1185fs	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	1281_1282	Ser-rich.				nuclear mRNA splicing, via spliceosome	Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3														0.70			71	30				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	2754371	2754374	15683	16	TCTT	-	-	58	58	SRRM2	-	5	5
KIAA0556	23247	broad.mit.edu	36	16	27669087	27669091	+	Frame_Shift_Del	DEL	TTGAA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:27669087_27669091delTTGAA	uc002dow.1	+	c.3305_3309delTTGAA	c.(3304-3309)TTTGAAfs	p.F1102fs		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	1102_1103										ovary(4)|large_intestine(2)	6														0.42			31	43				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	27669087	27669091	8490	16	TTGAA	-	-	64	64	KIAA0556	-	5	5
ZNF263	10127	broad.mit.edu	36	16	3275156	3275157	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:3275156_3275157delGA	uc002cuq.1	+	c.484_485delGA	c.(484-486)GAGfs	p.E162fs	ZNF263_uc002cup.1_Intron	NM_005741	NP_005732	O14978	ZN263_HUMAN	zinc finger protein 263	162					regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1														0.39			22	35				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	3275156	3275157	18395	16	GA	-	-	41	41	ZNF263	-	5	5
PRPF8	10594	broad.mit.edu	36	17	1528859	1528883	+	Frame_Shift_Del	DEL	GCTTAGTCAAACGCAGAACTTCCCG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:1528859_1528883delGCTTAGTCAAACGCAGAACTTCCCG	uc002fte.1	-	c.1642_1666delCGGGAAGTTCTGCGTTTGACTAAGC	c.(1642-1668)CGGGAAGTTCTGCGTTTGACTAAGCTGfs	p.R548fs		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	548_556					nuclear mRNA splicing, via spliceosome|response to stimulus|visual perception	catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			ovary(2)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)										0.45			30	36				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	1528859	1528883	13018	17	GCTTAGTCAAACGCAGAACTTCCCG	-	-	34	34	PRPF8	-	5	5
TOP3A	7156	broad.mit.edu	36	17	18149147	18149149	+	Splice_Site_Del	DEL	TTA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:18149147_18149149delTTA	uc002gsx.1	-	c.e5_splice_site			TOP3A_uc002gsw.1_Splice_Site_Del|TOP3A_uc010cqa.1_Splice_Site_Del	NM_004618	NP_004609			topoisomerase (DNA) III alpha						DNA topological change|DNA unwinding involved in replication|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(2)	2														0.66			33	17				---	---	---	---	capture_indel			Splice_Site_Del	DEL	18149147	18149149	16909	17	TTA	-	-	56	56	TOP3A	-	5	5
VAT1	10493	broad.mit.edu	36	17	38423588	38423601	+	Frame_Shift_Del	DEL	AAATCTTCTTGATC	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:38423588_38423601delAAATCTTCTTGATC	uc002icm.1	-	c.744_757delGATCAAGAAGATTT	c.(742-759)GAGATCAAGAAGATTTCCfs	p.E248fs	VAT1_uc010cyw.1_Frame_Shift_Del_p.E114fs	NM_006373	NP_006364	Q99536	VAT1_HUMAN	vesicle amine transport protein 1	248_253					oxidation-reduction process	cytoplasm|integral to membrane	oxidoreductase activity|zinc ion binding				0		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)										0.53			39	34				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	38423588	38423601	17694	17	AAATCTTCTTGATC	-	-	9	9	VAT1	-	5	5
DBF4B	80174	broad.mit.edu	36	17	40174342	40174345	+	Frame_Shift_Del	DEL	ACCA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:40174342_40174345delACCA	uc002ihf.1	+	c.826_829delACCA	c.(826-831)ACCAGAfs	p.T276fs	DBF4B_uc002ihe.2_Frame_Shift_Del_p.T90fs	NM_145663	NP_663696	Q8NFT6	DBF4B_HUMAN	DBF4 homolog B isoform 1	276_277					cell cycle	nucleus	nucleic acid binding|zinc ion binding				0		Prostate(33;0.0322)												0.47			55	62				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	40174342	40174345	4420	17	ACCA	-	-	14	14	DBF4B	-	5	5
ABCC3	8714	broad.mit.edu	36	17	46088248	46088253	+	In_Frame_Del	DEL	CTCCCT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:46088248_46088253delCTCCCT	uc002isl.1	+	c.102_107delCTCCCT	c.(100-108)AACTCCCTG>AAG	p.34_36NSL>K	ABCC3_uc002isk.2_In_Frame_Del_p.34_36NSL>K	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3	34_36	Helical; Name=1; (By similarity).				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			central_nervous_system(1)	1			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)					438				0.79			141	37				---	---	---	---	capture_indel			In_Frame_Del	DEL	46088248	46088253	55	17	CTCCCT	-	-	20	20	ABCC3	-	5	5
NME1-NME2	654364	broad.mit.edu	36	17	46599196	46599197	+	Frame_Shift_Ins	INS	-	T	T			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:46599196_46599197insT	uc002itk.1	+	c.426_427insT	c.(424-429)GCCAACfs	p.A142fs	NME1-NME2_uc002itj.1_Frame_Shift_Ins_p.A117fs|NME2_uc002itl.1_Frame_Shift_Ins_p.A2fs|NME2_uc002itm.1_Frame_Shift_Ins_p.A2fs|NME2_uc002itn.1_Frame_Shift_Ins_p.A2fs|NME2_uc002ito.1_Frame_Shift_Ins_p.A2fs	NM_002512	NP_002503	P22392	NDKB_HUMAN	non-metastatic cells 2, protein (NM23B)	2_3	Interaction with AKAP13.				cell adhesion|CTP biosynthetic process|GTP biosynthetic process|negative regulation of apoptosis|nucleobase, nucleoside and nucleotide interconversion|positive regulation of epithelial cell proliferation|positive regulation of keratinocyte differentiation|regulation of transcription, DNA-dependent|UTP biosynthetic process	cytosol|lamellipodium|nucleus|ruffle	ATP binding|DNA binding|metal ion binding|nucleoside diphosphate kinase activity|protein binding|protein histidine kinase activity|sequence-specific DNA binding transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)											0.41			34	49				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	46599196	46599197	10893	17	-	T	T	21	21	NME1-NME2	T	5	5
HSF5	124535	broad.mit.edu	36	17	53912253	53912263	+	Frame_Shift_Del	DEL	CTGTTGGATAG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:53912253_53912263delCTGTTGGATAG	uc002iwi.1	-	c.915_925delCTATCCAACAG	c.(913-927)TACTATCCAACAGCTfs	p.Y305fs		NM_001080439	NP_001073908	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	305_309					regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Medulloblastoma(34;0.127)|all_neural(34;0.237)													0.34			72	139				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	53912253	53912263	7694	17	CTGTTGGATAG	-	-	24	24	HSF5	-	5	5
MRPL12	6182	broad.mit.edu	36	17	77284387	77284393	+	Frame_Shift_Del	DEL	CCGTCCG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:77284387_77284393delCCGTCCG	uc002kbh.1	+	c.392_398delCCGTCCG	c.(391-399)ACCGTCCGCfs	p.T131fs		NM_002949	NP_002940	P52815	RM12_HUMAN	mitochondrial ribosomal protein L12	131_133					positive regulation of transcription, DNA-dependent|transcription from mitochondrial promoter|translation	mitochondrial large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)											0.85			33	6				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	77284387	77284393	10170	17	CCGTCCG	-	-	18	18	MRPL12	-	5	5
ANAPC11	51529	broad.mit.edu	36	17	77450460	77450461	+	Frame_Shift_Del	DEL	CC	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:77450460_77450461delCC	uc002kby.1	+	c.160_161delCC	c.(160-162)CCTfs	p.P54fs	ANAPC11_uc002kbv.1_Intron|ANAPC11_uc002kbx.1_Intron|ANAPC11_uc002kbw.1_Intron|ANAPC11_uc002kbz.1_Intron|ANAPC11_uc002kca.1_Intron|ANAPC11_uc002kcb.1_Intron|ANAPC11_uc002kcc.1_Intron|ANAPC11_uc010dih.1_Intron|NPB_uc002kcd.1_5'Flank	NM_001002244	NP_001002244	Q9NYG5	APC11_HUMAN	APC11 anaphase promoting complex subunit 11	Error:Variant_position_missing_in_Q9NYG5_after_alignment					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	zinc ion binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)											0.48			10	11				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	77450460	77450461	603	17	CC	-	-	26	26	ANAPC11	-	5	5
MC5R	4161	broad.mit.edu	36	18	13815911	13815920	+	Frame_Shift_Del	DEL	CAGCCTCTTG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:13815911_13815920delCAGCCTCTTG	uc002kso.1	+	c.147_156delCAGCCTCTTG	c.(145-156)ATCAGCCTCTTGfs	p.I49fs		NM_005913	NP_005904	P33032	MC5R_HUMAN	melanocortin 5 receptor	49_52	Helical; Name=1; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding			ovary(3)	3														0.32			95	206				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	13815911	13815920	9756	18	CAGCCTCTTG	-	-	29	29	MC5R	-	5	5
KIAA1468	57614	broad.mit.edu	36	18	58070962	58070971	+	Splice_Site_Del	DEL	GAACAGGTAA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:58070962_58070971delGAACAGGTAA	uc002lil.1	+	c.e12_splice_site			KIAA1468_uc002lik.1_Splice_Site_Del|KIAA1468_uc002lim.1_Splice_Site_Del|KIAA1468_uc010dpu.1_Splice_Site_Del	NM_020854	NP_065905			hypothetical protein LOC57614								binding			ovary(2)|breast(2)|large_intestine(1)	5		Colorectal(73;0.186)												0.65			30	16				---	---	---	---	capture_indel			Splice_Site_Del	DEL	58070962	58070971	8545	18	GAACAGGTAA	-	-	41	41	KIAA1468	-	5	5
ASNA1	439	broad.mit.edu	36	19	12710440	12710441	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:12710440_12710441delAA	uc002muv.1	+	c.277_278delAA	c.(277-279)AAGfs	p.K93fs	ASNA1_uc002muw.1_Frame_Shift_Del_p.K93fs	NM_004317	NP_004308	O43681	ASNA_HUMAN	arsA arsenite transporter, ATP-binding, homolog	93					cellular metal ion homeostasis	endoplasmic reticulum|nucleolus|soluble fraction	arsenite transmembrane transporter activity|ATP binding|hydrolase activity|metal ion binding			ovary(2)	2					Adenosine triphosphate(DB00171)									0.47			129	147				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	12710440	12710441	1066	19	AA	-	-	5	5	ASNA1	-	5	5
GADD45GIP1	90480	broad.mit.edu	36	19	12928803	12928805	+	In_Frame_Del	DEL	AAC	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:12928803_12928805delAAC	uc002mwb.1	-	c.222_224delGTT	c.(220-225)TCGTTA>TCA	p.L75del		NM_052850	NP_443082	Q8TAE8	G45IP_HUMAN	growth arrest and DNA-damage-inducible, gamma	75					cell cycle|interspecies interaction between organisms	nucleus	protein binding			ovary(1)	1														0.71			10	4				---	---	---	---	capture_indel			In_Frame_Del	DEL	12928803	12928805	6435	19	AAC	-	-	13	13	GADD45GIP1	-	5	5
PSG7	5676	broad.mit.edu	36	19	48125482	48125483	+	In_Frame_Ins	INS	-	TCGGTC	TCGGTC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:48125482_48125483insTCGGTC	uc002ovl.2	-	c.660_661insGACCGA	c.(658-663)insGACCGA	p.220_221insDR	PSG10_uc002ouv.1_Intron|PSG6_uc002ovi.2_Intron|PSG3_uc002ouf.1_Intron|PSG7_uc002ous.1_5'Flank|PSG7_uc002out.1_In_Frame_Ins_p.39_40insDR|PSG11_uc002ouw.1_Intron|PSG6_uc002ovh.1_Intron|PSG11_uc002ovk.1_Intron	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7	220_221	Ig-like C2-type 1.				female pregnancy	extracellular region					0		Prostate(69;0.00682)												0.32			62	131				---	---	---	---	capture_indel			In_Frame_Ins	INS	48125482	48125483	13113	19	-	TCGGTC	TCGGTC	62	62	PSG7	TCGGTC	5	5
MARK4	57787	broad.mit.edu	36	19	50497512	50497513	+	Frame_Shift_Ins	INS	-	A	A			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:50497512_50497513insA	uc002pba.1	+	c.2043_2044insA	c.(2041-2046)GGCTGCfs	p.G681fs	MARK4_uc002pbb.1_Frame_Shift_Ins_p.L655fs	NM_031417	NP_113605	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	Error:Variant_position_missing_in_Q96L34_after_alignment					microtubule bundle formation|nervous system development|positive regulation of programmed cell death|protein phosphorylation	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)						167				0.52			33	30				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	50497512	50497513	9698	19	-	A	A	28	28	MARK4	A	5	5
EML2	24139	broad.mit.edu	36	19	50829541	50829568	+	Frame_Shift_Del	DEL	CCCGGCAGTCTCGGCCACGGTAGCCATA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:50829541_50829568delCCCGGCAGTCTCGGCCACGGTAGCCATA	uc002pcq.1	-	c.784_811delTATGGCTACCGTGGCCGAGACTGCCGGG	c.(784-813)TATGGCTACCGTGGCCGAGACTGCCGGGCCfs	p.Y262fs	EML2_uc002pcn.1_Frame_Shift_Del_p.Y61fs|EML2_uc002pco.1_Non-coding_Transcript|EML2_uc002pcp.1_Intron|EML2_uc010ekj.1_Frame_Shift_Del_p.Y61fs|EML2_uc010ekk.1_5'Flank	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like	61_70					sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)										0.75			42	14				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	50829541	50829568	5289	19	CCCGGCAGTCTCGGCCACGGTAGCCATA	-	-	26	26	EML2	-	5	5
PPP5C	5536	broad.mit.edu	36	19	51542232	51542233	+	Frame_Shift_Ins	INS	-	C	C			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:51542232_51542233insC	uc002pem.1	+	c.39_40insC	c.(37-42)GAGCCCfs	p.E13fs	PPP5C_uc002pen.1_Frame_Shift_Ins_p.E13fs|PPP5C_uc002peo.2_Non-coding_Transcript	NM_006247	NP_006238	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	13_14					mitosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein dephosphorylation|transcription, DNA-dependent	Golgi apparatus|nucleus	metal ion binding|protein binding|protein serine/threonine phosphatase activity|signal transducer activity			lung(1)|pancreas(1)	2		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)								OREG0025570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.33			3	6				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	51542232	51542233	12842	19	-	C	C	34	34	PPP5C	C	5	5
KCNC4	3749	broad.mit.edu	36	1	110570149	110570150	+	Frame_Shift_Del	DEL	GT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:110570149_110570150delGT	uc009wfr.1	+	c.1645_1646delGT	c.(1645-1647)GTGfs	p.V549fs	KCNC4_uc001dzg.1_Frame_Shift_Del_p.V549fs|KCNC4_uc001dzh.1_Frame_Shift_Del_p.V549fs|KCNC4_uc001dzi.1_Non-coding_Transcript	NM_001039574	NP_001034663	Q03721	KCNC4_HUMAN	Shaw-related voltage-gated potassium channel	549	Cytoplasmic (Potential).				synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)										0.76			34	11				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	110570149	110570150	8322	1	GT	-	-	36	36	KCNC4	-	5	5
POLR3GL	84265	broad.mit.edu	36	1	144168355	144168361	+	Frame_Shift_Del	DEL	TGTTCTT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:144168355_144168361delTGTTCTT	uc001enp.1	-	c.557_563delAAGAACA	c.(556-564)GAAGAACATfs	p.E186fs		NM_032305	NP_115681	Q9BT43	RPC7L_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	186_188	Glu-rich.										0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)													0.32			11	23				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	144168355	144168361	12663	1	TGTTCTT	-	-	51	51	POLR3GL	-	5	5
FLG2	388698	broad.mit.edu	36	1	150591351	150591352	+	Frame_Shift_Ins	INS	-	C	C			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:150591351_150591352insC	uc001ezw.2	-	c.5534_5535insG	c.(5533-5535)GGAfs	p.G1845fs		NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1845							calcium ion binding|structural molecule activity			ovary(9)|breast(1)	10	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.30			60	138				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	150591351	150591352	6161	1	-	C	C	62	62	FLG2	C	5	5
LCE3D	84648	broad.mit.edu	36	1	150818916	150818919	+	Frame_Shift_Del	DEL	AGCT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:150818916_150818919delAGCT	uc001fab.1	-	c.118_121delAGCT	c.(118-123)AGCTCTfs	p.S40fs	LCE3D_uc009wni.1_Frame_Shift_Del_p.S40fs	NM_032563	NP_115952	Q9BYE3	LCE3D_HUMAN	late cornified envelope 3D	40_41					keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)										0.40			34	51				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	150818916	150818919	8995	1	AGCT	-	-	11	11	LCE3D	-	5	5
PKLR	5313	broad.mit.edu	36	1	153530739	153530739	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:153530739_153530739delC	uc001fkb.2	-	c.1027_1027delG	c.(1027-1029)GAGfs	p.E343fs	PKLR_uc001fka.2_Frame_Shift_Del_p.E312fs	NM_000298	NP_000289	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC isoform 1	343					endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity			skin(3)|ovary(1)	4	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)									0.63			62	36				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	153530739	153530739	12401	1	C	-	-	31	31	PKLR	-	5	5
ASTN1	460	broad.mit.edu	36	1	175260415	175260415	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:175260415_175260415delC	uc001glc.1	-	c.1197_1197delG	c.(1195-1197)GTGfs	p.V399fs	ASTN1_uc001glb.1_Frame_Shift_Del_p.V399fs|ASTN1_uc001gld.1_Frame_Shift_Del_p.V399fs|ASTN1_uc009wwx.1_Frame_Shift_Del_p.V399fs|ASTN1_uc001gle.2_Non-coding_Transcript	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	399	Helical; (Potential).				cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	11										849				0.56			35	28				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	175260415	175260415	1083	1	C	-	-	17	17	ASTN1	-	5	5
SUSD4	55061	broad.mit.edu	36	1	221463353	221463359	+	Frame_Shift_Del	DEL	GCCTGAG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:221463353_221463359delGCCTGAG	uc001hnx.1	-	c.1299_1305delCTCAGGC	c.(1297-1305)GTCTCAGGCfs	p.V433fs	SUSD4_uc001hny.2_Frame_Shift_Del_p.V433fs	NM_017982	NP_060452	Q5VX71	SUSD4_HUMAN	sushi domain containing 4 isoform a	433_435	Cytoplasmic (Potential).					integral to membrane					0				GBM - Glioblastoma multiforme(131;0.0611)										0.58			56	41				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	221463353	221463359	15930	1	GCCTGAG	-	-	34	34	SUSD4	-	5	5
OR6F1	343169	broad.mit.edu	36	1	245941915	245941915	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:245941915_245941915delC	uc001idj.1	-	c.766_766delG	c.(766-768)GTTfs	p.V256fs		NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F,	256	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)											0.42			56	76				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	245941915	245941915	11611	1	C	-	-	20	20	OR6F1	-	5	5
CDC7	8317	broad.mit.edu	36	1	91739952	91739957	+	In_Frame_Del	DEL	AACGAG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:91739952_91739957delAACGAG	uc001doe.1	+	c.91_96delAACGAG	c.(91-96)AACGAGdel	p.NE31del	CDC7_uc001dof.1_In_Frame_Del_p.NE31del|CDC7_uc009wdc.1_In_Frame_Del_p.NE31del	NM_003503	NP_003494	O00311	CDC7_HUMAN	cell division cycle 7	31_32					cell cycle checkpoint|cell division|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|positive regulation of cell proliferation|protein phosphorylation|regulation of S phase	cytoplasm|nucleoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.N31fs*51(3)		stomach(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	5		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)						154				0.53			19	17				---	---	---	---	capture_indel			In_Frame_Del	DEL	91739952	91739957	3213	1	AACGAG	-	-	1	1	CDC7	-	5	5
SNAI1	6615	broad.mit.edu	36	20	48034210	48034210	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:48034210_48034210delC	uc002xuz.1	+	c.525_525delC	c.(523-525)AGCfs	p.S175fs		NM_005985	NP_005976	O95863	SNAI1_HUMAN	snail 1 homolog	175	C2H2-type 1.				epithelial to mesenchymal transition|mesoderm formation|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription activator activity|zinc ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)											0.36			20	36				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	48034210	48034210	15326	20	C	-	-	26	26	SNAI1	-	5	5
PARVG	64098	broad.mit.edu	36	22	42917872	42917892	+	Splice_Site_Del	DEL	CTATCGAGGTAGCAGCCTGGG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:42917872_42917892delCTATCGAGGTAGCAGCCTGGG	uc003bep.1	+	c.e7_splice_site			PARVG_uc003beq.1_Splice_Site_Del|PARVG_uc003ber.1_Splice_Site_Del	NM_022141	NP_071424			parvin, gamma						cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)												0.57			159	118				---	---	---	---	capture_indel			Splice_Site_Del	DEL	42917872	42917892	11887	22	CTATCGAGGTAGCAGCCTGGG	-	-	20	20	PARVG	-	5	5
NBAS	51594	broad.mit.edu	36	2	15533356	15533357	+	Frame_Shift_Ins	INS	-	G	G			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:15533356_15533357insG	uc002rcc.1	-	c.1246_1247insC	c.(1246-1248)AAAfs	p.K416fs	NBAS_uc002rcd.1_Non-coding_Transcript	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	416										ovary(2)|liver(1)	3														0.49			19	20				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	15533356	15533357	10582	2	-	G	G	64	64	NBAS	G	5	5
LRP2	4036	broad.mit.edu	36	2	169770353	169770360	+	Frame_Shift_Del	DEL	CGATTTTG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:169770353_169770360delCGATTTTG	uc002ues.1	-	c.7590_7597delCAAAATCG	c.(7588-7599)GCCAAAATCGAGfs	p.A2530fs		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	2530_2533	LDL-receptor class B 27.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	23				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)					2055				0.45			47	57				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	169770353	169770360	9329	2	CGATTTTG	-	-	31	31	LRP2	-	5	5
GORASP2	26003	broad.mit.edu	36	2	171513156	171513157	+	Frame_Shift_Ins	INS	-	A	A			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:171513156_171513157insA	uc002ugk.1	+	c.114_115insA	c.(112-117)GATTTTfs	p.D38fs	GORASP2_uc002ugj.1_5'UTR|GORASP2_uc002ugl.1_5'UTR	NM_015530	NP_056345	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2	38_39	PDZ.					Golgi membrane				breast(1)|central_nervous_system(1)	2														0.38			8	13				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	171513156	171513157	6849	2	-	A	A	52	52	GORASP2	A	5	5
TTN	7273	broad.mit.edu	36	2	179347390	179347391	+	Frame_Shift_Del	DEL	AT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:179347390_179347391delAT	uc002umr.1	-	c.6845_6846delAT	c.(6844-6846)TATfs	p.Y2282fs	TTN_uc002ums.1_Frame_Shift_Del_p.Y2236fs|TTN_uc010frc.1_Frame_Shift_Del_p.Y2236fs|TTN_uc010frd.1_Frame_Shift_Del_p.Y2236fs|TTN_uc002unb.1_Frame_Shift_Del_p.Y2282fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2282										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)							8722				0.38			24	40				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	179347390	179347391	17290	2	AT	-	-	4	4	TTN	-	5	5
RNF25	64320	broad.mit.edu	36	2	219237215	219237215	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:219237215_219237215delA	uc002vit.1	-	c.1089_1089delT	c.(1087-1089)CCTfs	p.P363fs	RNF25_uc010fvw.1_Frame_Shift_Del_p.P251fs	NM_022453	NP_071898	Q96BH1	RNF25_HUMAN	ring finger protein 25	363					positive regulation of NF-kappaB transcription factor activity	cytosol|nucleus	NF-kappaB binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.43			79	105				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	219237215	219237215	13964	2	A	-	-	15	15	RNF25	-	5	5
COLEC11	78989	broad.mit.edu	36	2	3669001	3669007	+	Splice_Site_Del	DEL	AATGGTA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:3669001_3669007delAATGGTA	uc002qya.1	+	c.e6_splice_site			COLEC11_uc002qxz.1_Splice_Site_Del|COLEC11_uc002qyb.1_Splice_Site_Del|COLEC11_uc002qyc.1_Splice_Site_Del|COLEC11_uc010ewo.1_Splice_Site_Del|COLEC11_uc010ewp.1_Splice_Site_Del|COLEC11_uc010ewq.1_Splice_Site_Del|COLEC11_uc010ewr.1_Splice_Site_Del|COLEC11_uc010ews.1_Splice_Site_Del	NM_024027	NP_076932			collectin sub-family member 11 isoform a							collagen	mannose binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)										0.76			29	9				---	---	---	---	capture_indel			Splice_Site_Del	DEL	3669001	3669007	3849	2	AATGGTA	-	-	9	9	COLEC11	-	5	5
GOLIM4	27333	broad.mit.edu	36	3	169295708	169295710	+	In_Frame_Del	DEL	CAG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:169295708_169295710delCAG	uc003ffe.2	-	c.58_60delCTG	c.(58-60)CTGdel	p.L20del		NM_014498	NP_055313	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	20	Helical; Signal-anchor for type II membrane protein; (Potential).				transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus				breast(4)	4														0.33			2	4				---	---	---	---	capture_indel			In_Frame_Del	DEL	169295708	169295710	6839	3	CAG	-	-	29	29	GOLIM4	-	5	5
UBE2E2	7325	broad.mit.edu	36	3	23225282	23225292	+	Frame_Shift_Del	DEL	GAACCAGAAAG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:23225282_23225292delGAACCAGAAAG	uc003ccg.1	+	c.88_98delGAACCAGAAAG	c.(88-99)GAACCAGAAAGAfs	p.E30fs	UBE2E2_uc010hfc.1_Non-coding_Transcript	NM_152653	NP_689866	Q96LR5	UB2E2_HUMAN	ubiquitin-conjugating enzyme E2E 2 (UBC4/5	30_33					ISG15-protein conjugation|post-translational protein modification|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination	nucleolus	ATP binding|ISG15 ligase activity|ubiquitin-protein ligase activity				0						GBM(85;1941 2083 9456)								0.55			29	24				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	23225282	23225292	17410	3	GAACCAGAAAG	-	-	33	33	UBE2E2	-	5	5
MCC	4163	broad.mit.edu	36	5	112446577	112446592	+	Frame_Shift_Del	DEL	CCAGGTGTTCAGCCAC	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:112446577_112446592delCCAGGTGTTCAGCCAC	uc003kql.2	-	c.1648_1663delGTGGCTGAACACCTGG	c.(1648-1665)GTGGCTGAACACCTGGCCfs	p.V550fs	MCC_uc003kqj.2_Frame_Shift_Del_p.V360fs|MCC_uc003kqk.2_Non-coding_Transcript|MCC_uc010jcd.1_Frame_Shift_Del_p.V322fs	NM_001085377	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 1	360_365					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)						12				0.69			51	23				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	112446577	112446592	9762	5	CCAGGTGTTCAGCCAC	-	-	26	26	MCC	-	5	5
ACSL6	23305	broad.mit.edu	36	5	131375116	131375117	+	Frame_Shift_Ins	INS	-	C	C			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:131375116_131375117insC	uc003kvx.1	-	c.29_30insG	c.(28-30)GGCfs	p.G10fs	ACSL6_uc003kvy.1_Frame_Shift_Ins_p.G10fs|ACSL6_uc010jdo.1_Intron|ACSL6_uc003kvz.1_Intron|ACSL6_uc003kwa.1_Intron|ACSL6_uc003kwc.1_Intron|ACSL6_uc003kwd.1_Intron	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	Error:Variant_position_missing_in_Q9UKU0_after_alignment					fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)							264				0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	131375116	131375117	182	5	-	C	C	34	34	ACSL6	C	5	5
GZMA	3001	broad.mit.edu	36	5	54437101	54437102	+	Frame_Shift_Ins	INS	-	C	C			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:54437101_54437102insC	uc003jpm.1	+	c.113_114insC	c.(112-114)CATfs	p.H38fs		NM_006144	NP_006135	P12544	GRAA_HUMAN	granzyme A precursor	38	Peptidase S1.				cleavage of lamin|cytolysis|immune response|negative regulation of DNA binding|negative regulation of endodeoxyribonuclease activity|negative regulation of oxidoreductase activity|positive regulation of apoptosis	extracellular region|immunological synapse|nucleus	protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|pancreas(1)	3		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)												0.50			56	57				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	54437101	54437102	7195	5	-	C	C	8	8	GZMA	C	5	5
HTR1A	3350	broad.mit.edu	36	5	63293097	63293114	+	In_Frame_Del	DEL	TTCTGCAGGGAGCGCTCC	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:63293097_63293114delTTCTGCAGGGAGCGCTCC	uc003jtg.1	-	c.189_206delGGAGCGCTCCCTGCAGAA	c.(187-207)TTGGAGCGCTCCCTGCAGAAC>TTC	p.63_69LERSLQN>F		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	63_69	Cytoplasmic (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)									0.78			39	11				---	---	---	---	capture_indel			In_Frame_Del	DEL	63293097	63293114	7736	5	TTCTGCAGGGAGCGCTCC	-	-	60	60	HTR1A	-	5	5
BEND3	57673	broad.mit.edu	36	6	107498396	107498400	+	Frame_Shift_Del	DEL	ACCTG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:107498396_107498400delACCTG	uc003prs.1	-	c.688_692delCAGGT	c.(688-693)CAGGTGfs	p.Q230fs		NM_001080450	NP_001073919	Q5T5X7	BEND3_HUMAN	BEN domain containing 3	230_231										ovary(3)	3														0.89			51	6				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	107498396	107498400	1422	6	ACCTG	-	-	6	6	BEND3	-	5	5
KBTBD2	25948	broad.mit.edu	36	7	32876172	32876173	+	Frame_Shift_Ins	INS	-	CC	CC			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:32876172_32876173insCC	uc003tdb.1	-	c.1181_1182insGG	c.(1180-1182)CTTfs	p.L394fs		NM_015483	NP_056298	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	394	Kelch 2.										0			GBM - Glioblastoma multiforme(11;0.0499)											0.46			63	75				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	32876172	32876173	8298	7	-	CC	CC	13	13	KBTBD2	CC	5	5
CYP2W1	54905	broad.mit.edu	36	7	994545	994553	+	In_Frame_Del	DEL	TTGTGAAGC	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:994545_994553delTTGTGAAGC	uc003sjq.1	+	c.1250_1258delTTGTGAAGC	c.(1249-1260)TTTGTGAAGCGG>TGG	p.417_420FVKR>W	CYP2W1_uc003sjr.1_In_Frame_Del_p.417_420FVKR>W	NM_017781	NP_060251	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W,	417_420					oxidation-reduction process|xenobiotic metabolic process	endoplasmic reticulum membrane	electron carrier activity|heme binding|monooxygenase activity				0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)										0.75			9	3				---	---	---	---	capture_indel			In_Frame_Del	DEL	994545	994553	4341	7	TTGTGAAGC	-	-	64	64	CYP2W1	-	5	5
OSR2	116039	broad.mit.edu	36	8	100030936	100030939	+	Frame_Shift_Del	DEL	CACA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:100030936_100030939delCACA	uc010mbn.1	+	c.580_583delCACA	c.(580-585)CACACGfs	p.H194fs	OSR2_uc003yiq.1_Frame_Shift_Del_p.H194fs|OSR2_uc003yir.1_Frame_Shift_Del_p.H194fs	NM_053001	NP_443727	Q8N2R0	OSR2_HUMAN	odd-skipped related 2 isoform b	194_195					bone morphogenesis|embryonic skeletal system morphogenesis|eyelid development in camera-type eye|mesonephros development|metanephros development|middle ear morphogenesis|odontogenesis|osteoblast proliferation|palate development|positive regulation of epithelial cell proliferation|positive regulation of gene expression	nucleus	sequence-specific DNA binding|transcription activator activity|zinc ion binding			central_nervous_system(1)	1	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)											0.50			6	6				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	100030936	100030939	11705	8	CACA	-	-	21	21	OSR2	-	5	5
NFKBIL2	4796	broad.mit.edu	36	8	145634921	145634927	+	Splice_Site_Del	DEL	CGTCCTC	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:145634921_145634927delCGTCCTC	uc003zcu.2	-	c.e12_splice_site				NM_013432	NP_038460			NF-kappa-B inhibitor-like protein 2						cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)											0.95			19	1				---	---	---	---	capture_indel			Splice_Site_Del	DEL	145634921	145634927	10782	8	CGTCCTC	-	-	31	31	NFKBIL2	-	5	5
RAB11FIP1	80223	broad.mit.edu	36	8	37851784	37851785	+	Frame_Shift_Ins	INS	-	T	T			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:37851784_37851785insT	uc003xkm.1	-	c.1028_1029insA	c.(1027-1029)TCCfs	p.S343fs	RAB11FIP1_uc010lvz.1_Frame_Shift_Ins_p.S191fs|RAB11FIP1_uc003xkl.1_5'Flank|RAB11FIP1_uc003xkn.1_Frame_Shift_Ins_p.S343fs|RAB11FIP1_uc003xko.1_5'Flank|RAB11FIP1_uc003xkp.1_Frame_Shift_Ins_p.S191fs	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	343					protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)	1		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)											0.39			42	66				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	37851784	37851785	13352	8	-	T	T	43	43	RAB11FIP1	T	5	5
MYST3	7994	broad.mit.edu	36	8	41909044	41909062	+	Frame_Shift_Del	DEL	TAGGATACTGTGCTGTCTG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:41909044_41909062delTAGGATACTGTGCTGTCTG	uc010lxb.1	-	c.5833_5851delCAGACAGCACAGTATCCTA	c.(5833-5853)CAGACAGCACAGTATCCTATGfs	p.Q1945fs	MYST3_uc010lxc.1_Frame_Shift_Del_p.Q1945fs|MYST3_uc003xon.2_Frame_Shift_Del_p.Q1945fs	NM_001099412	NP_006757	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	1945_1951	Met-rich.				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription activator activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)							476				0.78			52	15				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	41909044	41909062	10499	8	TAGGATACTGTGCTGTCTG	-	-	49	49	MYST3	-	5	5
NDUFA8	4702	broad.mit.edu	36	9	123954469	123954473	+	Frame_Shift_Del	DEL	GATGG	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:123954469_123954473delGATGG	uc004blv.1	-	c.87_91delCCATC	c.(85-93)GCCCATCACfs	p.A29fs		NM_014222	NP_055037	P51970	NDUA8_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	29_31	CHCH 1.				mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			breast(1)	1					NADH(DB00157)									0.31			30	66				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	123954469	123954473	10670	9	GATGG	-	-	45	45	NDUFA8	-	5	5
CIZ1	25792	broad.mit.edu	36	9	129992930	129992932	+	In_Frame_Del	DEL	GCT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:129992930_129992932delGCT	uc004btt.1	-	c.26_28delAGC	c.(25-30)CAGCTC>CTC	p.Q9del	CIZ1_uc004btr.1_In_Frame_Del_p.Q9del|CIZ1_uc004bts.1_In_Frame_Del_p.Q9del|CIZ1_uc004btu.1_In_Frame_Del_p.Q9del|CIZ1_uc004btv.1_In_Frame_Del_p.Q9del|CIZ1_uc004btw.1_In_Frame_Del_p.Q9del|CIZ1_uc004btx.1_In_Frame_Del_p.Q9del	NM_012127	NP_036259	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1 isoform	9	Gln-rich.			Missing (in Ref. 7; AAF23231).		nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4														0.38			5	8				---	---	---	---	capture_indel			In_Frame_Del	DEL	129992930	129992932	3577	9	GCT	-	-	34	34	CIZ1	-	5	5
ELF4	2000	broad.mit.edu	36	X	129032825	129032832	+	Frame_Shift_Del	DEL	TTGGGACA	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:129032825_129032832delTTGGGACA	uc004evd.2	-	c.673_680delTGTCCCAA	c.(673-681)TGTCCCAAGfs	p.C225fs	ELF4_uc004eve.2_Frame_Shift_Del_p.C225fs	NM_001421	NP_001412	Q99607	ELF4_HUMAN	E74-like factor 4	225_227	ETS.				natural killer cell proliferation|NK T cell proliferation|positive regulation of transcription from RNA polymerase II promoter	PML body	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription activator activity			ovary(1)	1										86				0.44			23	29				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	129032825	129032832	5247	23	TTGGGACA	-	-	56	56	ELF4	-	5	5
PRKX	5613	broad.mit.edu	36	X	3540257	3540266	+	Frame_Shift_Del	DEL	ATTTCTAAAT	-	-			TCGA-19-1389-01	TCGA-19-1389-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:3540257_3540266delATTTCTAAAT	uc010nde.1	-	c.1052_1061delATTTAGAAAT	c.(1051-1062)GATTTAGAAATCfs	p.D351fs		NM_005044	NP_005035	P51817	PRKX_HUMAN	protein kinase, X-linked	351_354	AGC-kinase C-terminal.				protein phosphorylation		ATP binding|cAMP-dependent protein kinase activity			lung(1)	1		all_lung(23;0.000396)|Lung NSC(23;0.00123)								166				0.40			85	130				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	3540257	3540266	12970	23	ATTTCTAAAT	-	-	12	12	PRKX	-	5	5
