Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
SEMA4G	57715	broad.mit.edu	36	10	102722890	102722890	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:102722890C>T	uc001krw.1	+	c.139C>T	c.(139-141)CGG>TGG	p.R47W	SEMA4G_uc001krv.2_Non-coding_Transcript|SEMA4G_uc001krx.2_Missense_Mutation_p.R47W	NM_017893	NP_060363	Q9NTN9	SEM4G_HUMAN	semaphorin 4G	47	Extracellular (Potential).|Sema.				cell differentiation|nervous system development	integral to membrane	receptor activity			breast(1)	1		Colorectal(252;0.234)												0.782609	184.787061	189.869663	54	15	CC		KEEP	---	---	---	---	capture		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)	Missense_Mutation	SNP	102722890	102722890	14522	10	C	T	T	23	23	SEMA4G	T	1	1
PSD	5662	broad.mit.edu	36	10	104154666	104154666	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:104154666C>T	uc001kvg.1	-	c.2534G>A	c.(2533-2535)CGG>CAG	p.R845Q	PSD_uc001kve.1_Missense_Mutation_p.R53Q|PSD_uc001kvf.1_Missense_Mutation_p.R214Q|PSD_uc001kvh.1_Missense_Mutation_p.R466Q|PSD_uc009xxd.1_Missense_Mutation_p.R845Q	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	845	PH.				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3														0.787879	85.25547	87.778924	26	7	CC		KEEP	---	---	---	---	capture		Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)	Missense_Mutation	SNP	104154666	104154666	13099	10	C	T	T	23	23	PSD	T	1	1
COL17A1	1308	broad.mit.edu	36	10	105790145	105790145	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:105790145G>A	uc001kxr.1	-	c.2715C>T	c.(2713-2715)TCC>TCT	p.S905S		NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	905	Extracellular (Potential).|Triple-helical region.			S -> F (in Ref. 1; AAA35605 and 2; AAB51499).	cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane				ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)												0.80315	355.321157	366.192217	102	25	GG		KEEP	---	---	---	---	capture		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	Silent	SNP	105790145	105790145	3812	10	G	A	A	39	39	COL17A1	A	1	1
C10orf120	399814	broad.mit.edu	36	10	124447427	124447427	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:124447427G>A	uc001lgn.1	-	c.820C>T	c.(820-822)CGG>TGG	p.R274W		NM_001010912	NP_001010912	Q5SQS8	CJ120_HUMAN	hypothetical protein LOC399814	274										kidney(1)	1		all_neural(114;0.169)|Glioma(114;0.222)												0.754098	448.526817	459.28032	138	45	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	124447427	124447427	1625	10	G	A	A	40	40	C10orf120	A	1	1
CTBP2	1488	broad.mit.edu	36	10	126705006	126705006	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:126705006C>T	uc001lie.2	-	c.1313G>A	c.(1312-1314)GGG>GAG	p.G438E	CTBP2_uc009yak.1_Intron|CTBP2_uc009yal.1_Intron|CTBP2_uc001lif.2_Intron|CTBP2_uc001lih.2_Intron	NM_022802	NP_073713	P56545	CTBP2_HUMAN	C-terminal binding protein 2 isoform 2	Error:Variant_position_missing_in_P56545_after_alignment					negative regulation of cell proliferation|oxidation-reduction process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding|transcription repressor activity				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)								463				0.764706	126.245157	129.511168	39	12	CC		KEEP	---	---	---	---	capture		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)	Missense_Mutation	SNP	126705006	126705006	4157	10	C	T	T	22	22	CTBP2	T	2	2
DOCK1	1793	broad.mit.edu	36	10	128741047	128741047	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:128741047C>T	uc001ljt.1	+	c.2251C>T	c.(2251-2253)CGC>TGC	p.R751C		NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	751					apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)												0.777778	91.817178	94.372895	28	8	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)	Missense_Mutation	SNP	128741047	128741047	4868	10	C	T	T	27	27	DOCK1	T	1	1
DOCK1	1793	broad.mit.edu	36	10	129073081	129073081	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:129073081G>A	uc001ljt.1	+	c.3782G>A	c.(3781-3783)CGG>CAG	p.R1261Q	DOCK1_uc009yaq.1_Missense_Mutation_p.R256Q	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1261	DHR-2.				apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)												0.736111	179.107013	182.738032	53	19	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)	Missense_Mutation	SNP	129073081	129073081	4868	10	G	A	A	39	39	DOCK1	A	1	1
MGMT	4255	broad.mit.edu	36	10	131455090	131455090	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:131455090G>A	uc001lkh.1	+	c.463G>A	c.(463-465)GTG>ATG	p.V155M		NM_002412	NP_002403	P16455	MGMT_HUMAN	O-6-methylguanine-DNA methyltransferase	155										ovary(1)	1		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)												0.627907	85.63362	86.251467	27	16	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(35;0.00291)	Missense_Mutation	SNP	131455090	131455090	9947	10	G	A	A	40	40	MGMT	A	1	1
BNIP3	664	broad.mit.edu	36	10	133634227	133634227	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:133634227C>T	uc001lkv.1	-	c.444G>A	c.(442-444)ACG>ACA	p.T148T	BNIP3_uc001lku.1_5'Flank	NM_004052	NP_004043	Q12983	BNIP3_HUMAN	BCL2/adenovirus E1B 19kD-interacting protein 3	148					cellular response to cobalt ion|cellular response to hypoxia|cellular response to mechanical stimulus|chromatin remodeling|defense response to virus|DNA fragmentation involved in apoptotic nuclear change|induction of apoptosis|interspecies interaction between organisms|mitochondrial fragmentation involved in apoptosis|negative regulation of membrane potential|negative regulation of mitochondrial fusion|negative regulation of survival gene product expression|neuron apoptosis|positive regulation of mitochondrial fission|positive regulation of protein complex disassembly|positive regulation of release of cytochrome c from mitochondria|reactive oxygen species metabolic process|regulation of mitochondrial membrane permeability	dendrite|integral to mitochondrial outer membrane|nuclear envelope|nucleoplasm	GTPase binding|protein heterodimerization activity|protein homodimerization activity			lung(1)|skin(1)	2		all_cancers(35;4e-11)|all_epithelial(44;5.07e-08)|Ovarian(717;2.61e-05)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Breast(234;0.023)|all_neural(114;0.0299)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)								137				0.442308	67.114439	67.265661	23	29	CC		KEEP	---	---	---	---	capture		Epithelial(32;1.59e-12)|all cancers(32;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(35;2.57e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)	Silent	SNP	133634227	133634227	1503	10	C	T	T	31	31	BNIP3	T	1	1
NMT2	9397	broad.mit.edu	36	10	15201360	15201360	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:15201360C>T	uc001inz.1	-	c.1158G>A	c.(1156-1158)ACG>ACA	p.T386T	NMT2_uc001ioa.1_Silent_p.T373T|NMT2_uc009xjo.1_Silent_p.T386T	NM_004808	NP_004799	O60551	NMT2_HUMAN	N-myristoyltransferase 2	386					N-terminal protein myristoylation|protein lipoylation	Golgi apparatus|plasma membrane	glycylpeptide N-tetradecanoyltransferase activity			ovary(1)	1						Melanoma(117;1345 1645 4130 12688 30625)								0.668508	385.031205	389.591442	121	60	CC		KEEP	---	---	---	---	capture			Silent	SNP	15201360	15201360	10907	10	C	T	T	19	19	NMT2	T	1	1
SVIL	6840	broad.mit.edu	36	10	29802868	29802868	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:29802868C>T	uc001iut.1	-	c.5434G>A	c.(5434-5436)GTC>ATC	p.V1812I	LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc001iuu.1_Missense_Mutation_p.V1386I	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1812	Gelsolin-like 3.				cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)	5		Breast(68;0.103)												0.770833	118.698924	121.93499	37	11	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29802868	29802868	15941	10	C	T	T	19	19	SVIL	T	1	1
ANKRD30A	91074	broad.mit.edu	36	10	37530234	37530234	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:37530234G>A	uc001iza.1	+	c.2676G>A	c.(2674-2676)ATG>ATA	p.M892I		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	948					regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)	8														0.802632	214.018326	220.499231	61	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37530234	37530234	663	10	G	A	A	47	47	ANKRD30A	A	2	2
BMS1	9790	broad.mit.edu	36	10	42612680	42612680	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:42612680C>T	uc001jaj.1	+	c.1982C>T	c.(1981-1983)ACG>ATG	p.T661M		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	661					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)	2														0.680851	103.813322	105.178599	32	15	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42612680	42612680	1497	10	C	T	T	19	19	BMS1	T	1	1
GDF2	2658	broad.mit.edu	36	10	48034163	48034163	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:48034163G>A	uc001jfa.1	-	c.711C>T	c.(709-711)TGC>TGT	p.C237C		NM_016204	NP_057288	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	237					activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(2)	2														0.349593	117.184598	119.641066	43	80	GG		KEEP	---	---	---	---	capture			Silent	SNP	48034163	48034163	6582	10	G	A	A	38	38	GDF2	A	1	1
FRMPD2	143162	broad.mit.edu	36	10	49065240	49065240	+	Splice_Site_SNP	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:49065240C>T	uc001jgi.1	-	c.2266_splice	c.e17+1	p.G756_splice	FRMPD2_uc001jgj.1_Splice_Site_SNP_p.G734_splice|FRMPD2_uc001jgh.1_Splice_Site_SNP_p.G724_splice	NM_001018071	NP_001018081			FERM and PDZ domain containing 2 isoform 3						tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1														0.166667	7.553963	10.717942	5	25	CC		KEEP	---	---	---	---	capture		Kidney(211;0.201)	Splice_Site_SNP	SNP	49065240	49065240	6308	10	C	T	T	18	18	FRMPD2	T	5	2
C10orf71	118461	broad.mit.edu	36	10	50200853	50200853	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:50200853C>T	uc001jhp.1	+	c.257C>T	c.(256-258)CCG>CTG	p.P86L		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	86											0														0.795699	253.49688	261.045699	74	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	50200853	50200853	1651	10	C	T	T	23	23	C10orf71	T	1	1
ZWINT	11130	broad.mit.edu	36	10	57788428	57788428	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:57788428C>A	uc001jjx.1	-	c.687G>T	c.(685-687)GAG>GAT	p.E229D	ZWINT_uc001jjy.1_Missense_Mutation_p.E182D|ZWINT_uc001jka.1_Missense_Mutation_p.E229D|ZWINT_uc001jjz.1_Missense_Mutation_p.E109D|ZWINT_uc009xoy.1_Missense_Mutation_p.E109D	NM_007057	NP_127490	O95229	ZWINT_HUMAN	ZW10 interactor isoform a	229					cell division|establishment of localization in cell|mitotic cell cycle checkpoint|mitotic prometaphase|mitotic sister chromatid segregation|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytosol|nucleus	protein N-terminus binding				0														0.767442	202.670528	208.302153	66	20	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57788428	57788428	18854	10	C	A	A	24	24	ZWINT	A	3	3
REEP3	221035	broad.mit.edu	36	10	65028969	65028969	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:65028969C>T	uc001jmt.1	+	c.337C>T	c.(337-339)CGA>TGA	p.R113*	REEP3_uc009xpl.1_Nonsense_Mutation_p.R113*	NM_001001330	NP_001001330	Q6NUK4	REEP3_HUMAN	receptor accessory protein 3	113						integral to membrane					0	Prostate(12;0.0119)|all_hematologic(501;0.191)													0.735849	124.945721	127.610644	39	14	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	65028969	65028969	13675	10	C	T	T	19	19	REEP3	T	5	1
RUFY2	55680	broad.mit.edu	36	10	69813584	69813584	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:69813584G>A	uc001job.1	-	c.1021C>T	c.(1021-1023)CGA>TGA	p.R341*	RUFY2_uc001jnz.1_Non-coding_Transcript|RUFY2_uc001joc.1_Nonsense_Mutation_p.R272*|RUFY2_uc001jod.1_Nonsense_Mutation_p.R306*	NM_017987	NP_060457	Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain-containing 2 isoform a	355	Potential.					nucleus	zinc ion binding			ovary(1)	1														0.673203	330.911849	334.964513	103	50	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	69813584	69813584	14219	10	G	A	A	37	37	RUFY2	A	5	1
ADAMTS14	140766	broad.mit.edu	36	10	72168714	72168714	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:72168714C>T	uc001jrg.1	+	c.1719C>T	c.(1717-1719)GGC>GGT	p.G573G	ADAMTS14_uc001jrh.1_Silent_p.G570G|ADAMTS14_uc001jri.1_Silent_p.G93G	NM_139155	NP_631894	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	570	TSP type-1 1.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)	5														0.603774	88.17859	88.673047	32	21	CC		KEEP	---	---	---	---	capture			Silent	SNP	72168714	72168714	260	10	C	T	T	27	27	ADAMTS14	T	1	1
MYST4	23522	broad.mit.edu	36	10	76460292	76460292	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:76460292G>A	uc001jwn.1	+	c.5704G>A	c.(5704-5706)GCA>ACA	p.A1902T	MYST4_uc001jwo.1_Missense_Mutation_p.A1610T|MYST4_uc001jwp.1_Missense_Mutation_p.A1719T	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic	1902	Interaction with RUNX1 and RUNX2.				histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription activator activity|transcription factor binding|transcription repressor activity|zinc ion binding			central_nervous_system(5)|ovary(3)|breast(1)	9	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)									319				0.759825	542.528492	556.621593	174	55	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	76460292	76460292	10500	10	G	A	A	46	46	MYST4	A	2	2
KCNMA1	3778	broad.mit.edu	36	10	78321422	78321422	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:78321422G>A	uc001jxn.1	-	c.3209C>T	c.(3208-3210)CCG>CTG	p.P1070L	KCNMA1_uc001jxj.1_Missense_Mutation_p.P1016L|KCNMA1_uc009xrt.1_Missense_Mutation_p.P861L|KCNMA1_uc001jxm.1_Missense_Mutation_p.P1012L|KCNMA1_uc001jxo.1_Missense_Mutation_p.P1053L|KCNMA1_uc001jxk.1_Missense_Mutation_p.P688L|KCNMA1_uc001jxl.1_Missense_Mutation_p.P695L|KCNMA1_uc001jxq.1_Missense_Mutation_p.P124L	NM_002247	NP_002238	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium	1070	Cytoplasmic (Potential).				cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|catalytic activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)				Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)									0.7	167.903087	170.406167	49	21	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Missense_Mutation	SNP	78321422	78321422	8378	10	G	A	A	39	39	KCNMA1	A	1	1
KCNMA1	3778	broad.mit.edu	36	10	78833698	78833698	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:78833698G>A	uc001jxn.1	-	c.468C>T	c.(466-468)GTC>GTT	p.V156V	KCNMA1_uc001jxj.1_Silent_p.V156V|KCNMA1_uc001jxm.1_Silent_p.V156V|KCNMA1_uc001jxo.1_Silent_p.V156V	NM_002247	NP_002238	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium	156	Cytoplasmic (Potential).				cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|catalytic activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)				Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)									0.697368	163.398291	166.046741	53	23	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Silent	SNP	78833698	78833698	8378	10	G	A	A	37	37	KCNMA1	A	1	1
MMRN2	79812	broad.mit.edu	36	10	88693191	88693191	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:88693191G>A	uc001kea.1	-	c.1330C>T	c.(1330-1332)CGT>TGT	p.R444C	MMRN2_uc009xtb.1_Missense_Mutation_p.R401C	NM_024756	NP_079032	Q9H8L6	MMRN2_HUMAN	multimerin 2 precursor	444	Potential.					extracellular space				large_intestine(1)	1														0.74026	186.906972	190.933198	57	20	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88693191	88693191	10062	10	G	A	A	39	39	MMRN2	A	1	1
HTR7	3363	broad.mit.edu	36	10	92499016	92499016	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:92499016G>A	uc001kha.1	-	c.855C>T	c.(853-855)AGC>AGT	p.S285S	HTR7_uc001kgz.1_Silent_p.S285S|HTR7_uc001khb.1_Silent_p.S285S	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d	285	Cytoplasmic (By similarity).				blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)									0.697674	93.963628	95.464884	30	13	GG		KEEP	---	---	---	---	capture			Silent	SNP	92499016	92499016	7752	10	G	A	A	38	38	HTR7	A	1	1
TLL2	7093	broad.mit.edu	36	10	98163018	98163018	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:98163018G>A	uc001kml.1	-	c.969C>T	c.(967-969)GGC>GGT	p.G323G	TLL2_uc009xvf.1_Silent_p.G271G	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	323	Metalloprotease (By similarity).				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	p.G323G(1)		ovary(1)|pancreas(1)	2		Colorectal(252;0.0846)												0.114754	6.581156	15.505944	7	54	GG		KEEP	---	---	---	---	capture		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)	Silent	SNP	98163018	98163018	16476	10	G	A	A	38	38	TLL2	A	1	1
AMPD3	272	broad.mit.edu	36	11	10456738	10456738	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:10456738C>T	uc001min.1	+	c.338C>T	c.(337-339)CCG>CTG	p.P113L	AMPD3_uc009yfw.1_Non-coding_Transcript|AMPD3_uc009yfx.1_Missense_Mutation_p.P104L|AMPD3_uc001mio.1_Missense_Mutation_p.P104L|AMPD3_uc001mip.1_Missense_Mutation_p.P111L|AMPD3_uc009yfy.1_Missense_Mutation_p.P104L	NM_000480	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1A	104					AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2														0.158974	54.567152	76.125401	31	164	CC		KEEP	---	---	---	---	capture		all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)	Missense_Mutation	SNP	10456738	10456738	590	11	C	T	T	23	23	AMPD3	T	1	1
NCAM1	4684	broad.mit.edu	36	11	112631891	112631891	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:112631891C>T	uc001pns.1	+	c.51C>T	c.(49-51)GAC>GAT	p.D17D				P13591	NCAM1_HUMAN	Homo sapiens mRNA for Neural cell adhesion molecule 1, 120 kDa isoform precursor variant protein.	637	Extracellular (Potential).|Fibronectin type-III 2.				axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)								700				0.789474	46.732088	48.204232	15	4	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)	Silent	SNP	112631891	112631891	10601	11	C	T	T	19	19	NCAM1	T	1	1
MUC5B	727897	broad.mit.edu	36	11	1204501	1204501	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:1204501C>T	uc001ltb.2	+	c.280C>T	c.(280-282)CGC>TGC	p.R94C	MUC5B_uc009yct.1_Missense_Mutation_p.R94C	NM_002458	NP_002449	Q9HC84	MUC5B_HUMAN	mucin 5, subtype B, tracheobronchial	94	VWFD 1.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)												0.833333	85.092625	88.252908	25	5	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	Missense_Mutation	SNP	1204501	1204501	10373	11	C	T	T	23	23	MUC5B	T	1	1
CTSD	1509	broad.mit.edu	36	11	1731411	1731411	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:1731411G>A	uc001luc.1	-	c.1137C>T	c.(1135-1137)AGC>AGT	p.S379S	CTSD_uc009yda.1_Non-coding_Transcript	NM_001909	NP_001900	P07339	CATD_HUMAN	cathepsin D preproprotein	379					cell death|proteolysis	extracellular space|lysosome|melanosome	aspartic-type endopeptidase activity				0		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)			Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)									0.72	219.023966	223.374044	72	28	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	Silent	SNP	1731411	1731411	4191	11	G	A	A	38	38	CTSD	A	1	1
CTSD	1509	broad.mit.edu	36	11	1737329	1737329	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:1737329G>A	uc001luc.1	-	c.345C>T	c.(343-345)ATC>ATT	p.I115I	CTSD_uc009yda.1_Non-coding_Transcript	NM_001909	NP_001900	P07339	CATD_HUMAN	cathepsin D preproprotein	115					cell death|proteolysis	extracellular space|lysosome|melanosome	aspartic-type endopeptidase activity				0		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)			Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)									0.686869	220.128152	223.203198	68	31	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	Silent	SNP	1737329	1737329	4191	11	G	A	A	37	37	CTSD	A	1	1
ABCC8	6833	broad.mit.edu	36	11	17392707	17392707	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:17392707G>A	uc001mnc.1	-	c.2318C>T	c.(2317-2319)TCG>TTG	p.S773L		NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	773	ABC transporter 1.|Cytoplasmic (By similarity).				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)									0.141762	58.391411	90.702268	37	224	GG		KEEP	---	---	---	---	capture		READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Missense_Mutation	SNP	17392707	17392707	59	11	G	A	A	37	37	ABCC8	A	1	1
GAS2	2620	broad.mit.edu	36	11	22715878	22715878	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:22715878G>A	uc009yie.1	+	c.461G>A	c.(460-462)CGG>CAG	p.R154Q	GAS2_uc001mqm.1_Missense_Mutation_p.R154Q|GAS2_uc001mqn.1_Non-coding_Transcript|GAS2_uc001mqo.1_Missense_Mutation_p.R154Q	NM_177553	NP_808221	O43903	GAS2_HUMAN	growth arrest-specific 2	154	CH.				cell cycle arrest|cellular component disassembly involved in apoptosis|regulation of cell shape	actin filament|cytosol|membrane				ovary(1)	1														0.706522	221.106696	224.617653	65	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22715878	22715878	6509	11	G	A	A	39	39	GAS2	A	1	1
TTC17	55761	broad.mit.edu	36	11	43374922	43374922	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:43374922C>T	uc001mxi.1	+	c.751C>T	c.(751-753)CGA>TGA	p.R251*	TTC17_uc001mxh.2_Nonsense_Mutation_p.R251*|TTC17_uc001mxj.2_Nonsense_Mutation_p.R21*	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	251							binding			ovary(5)	5														0.759259	134.498679	137.809694	41	13	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	43374922	43374922	17238	11	C	T	T	27	27	TTC17	T	5	1
OR52M1	119772	broad.mit.edu	36	11	4523022	4523022	+	Nonsense_Mutation	SNP	C	A	A	rs7112010	by-cluster,by-frequency,by-hapmap,by-1000genomes	TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:4523022C>A	uc001lzb.1	+	c.26C>A	c.(25-27)TCA>TAA	p.S9*		NM_001004137	NP_001004137	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M,	9	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)												0.74359	179.673031	183.864616	58	20	CC		KEEP	---	---	---	---	capture		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)	Nonsense_Mutation	SNP	4523022	4523022	11536	11	C	A	A	29	29	OR52M1	A	5	3
SYT13	57586	broad.mit.edu	36	11	45264323	45264323	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:45264323C>T	uc001myq.2	-	c.12G>A	c.(10-12)TCG>TCA	p.S4S	SYT13_uc009yku.1_5'UTR	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	4	Vesicular (Potential).					transport vesicle				ovary(1)	1														1	25.545423	25.537628	7	0	CC		KEEP	---	---	---	---	capture			Silent	SNP	45264323	45264323	15990	11	C	T	T	23	23	SYT13	T	1	1
CREB3L1	90993	broad.mit.edu	36	11	46295592	46295592	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:46295592C>T	uc001ncf.1	+	c.1236C>T	c.(1234-1236)GAC>GAT	p.D412D	CREB3L1_uc001ncg.1_Silent_p.D46D	NM_052854	NP_443086	Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like	412	Lumenal (Potential).				regulation of transcription, DNA-dependent|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L1(6)	soft_tissue(6)|ovary(2)	8						Pancreas(3;159 194 19597 26278 47995)								0.685185	114.191812	115.842779	37	17	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(35;0.0285)	Silent	SNP	46295592	46295592	3995	11	C	T	T	19	19	CREB3L1	T	1	1
DGKZ	8525	broad.mit.edu	36	11	46353121	46353121	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:46353121C>T	uc001ncn.1	+	c.2224C>T	c.(2224-2226)CGG>TGG	p.R742W	DGKZ_uc001nch.1_Missense_Mutation_p.R570W|DGKZ_uc001ncj.1_Missense_Mutation_p.R520W|DGKZ_uc001nck.1_Missense_Mutation_p.R332W|DGKZ_uc001ncl.2_Missense_Mutation_p.R554W|DGKZ_uc001ncm.2_Missense_Mutation_p.R553W|DGKZ_uc009yky.1_Missense_Mutation_p.R554W	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4	742					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3														0.705882	76.111078	77.400526	24	10	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)	Missense_Mutation	SNP	46353121	46353121	4653	11	C	T	T	27	27	DGKZ	T	1	1
OR51T1	401665	broad.mit.edu	36	11	4860049	4860049	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:4860049C>T	uc001lzp.1	+	c.425C>T	c.(424-426)TCG>TTG	p.S142L		NM_001004759	NP_001004759	Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T,	115	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)												0.691275	334.876995	339.739051	103	46	CC		KEEP	---	---	---	---	capture		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)	Missense_Mutation	SNP	4860049	4860049	11516	11	C	T	T	31	31	OR51T1	T	1	1
GIF	2694	broad.mit.edu	36	11	59367136	59367136	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:59367136C>T	uc001noi.1	-	c.311G>A	c.(310-312)CGA>CAA	p.R104Q		NM_005142	NP_005133	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	104					cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding			ovary(1)|liver(1)	2						NSCLC(53;1139 1245 16872 38474 42853)								0.716418	158.22515	161.042707	48	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	59367136	59367136	6644	11	C	T	T	31	31	GIF	T	1	1
VWCE	220001	broad.mit.edu	36	11	60783121	60783121	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:60783121G>A	uc001nra.1	-	c.2470C>T	c.(2470-2472)CAC>TAC	p.H824Y	VWCE_uc001nrb.1_Non-coding_Transcript	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	824						extracellular region	calcium ion binding			ovary(1)	1														0.77551	114.463057	117.87645	38	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60783121	60783121	17816	11	G	A	A	48	48	VWCE	A	2	2
FADS1	3992	broad.mit.edu	36	11	61327785	61327785	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:61327785G>A	uc001nsi.1	-	c.913C>T	c.(913-915)CGC>TGC	p.R305C	FADS1_uc001nsh.1_Missense_Mutation_p.R221C	NM_013402	NP_037534	O60427	FADS1_HUMAN	fatty acid desaturase 1	305	Lumenal (Potential).				cell-cell signaling|cellular response to starvation|electron transport chain|icosanoid biosynthetic process|phospholipid biosynthetic process|regulation of cell differentiation|regulation of transcription, DNA-dependent|transport	endoplasmic reticulum membrane|integral to membrane|microsome	C-5 sterol desaturase activity|heme binding|protein binding			central_nervous_system(1)	1					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)									0.717949	193.437578	196.775117	56	22	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61327785	61327785	5562	11	G	A	A	39	39	FADS1	A	1	1
AHNAK	79026	broad.mit.edu	36	11	62041255	62041255	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:62041255G>C	uc001ntl.1	-	c.17210C>G	c.(17209-17211)TCT>TGT	p.S5737C	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	5737					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)	14		Melanoma(852;0.155)												0.088757	10.490981	39.369529	15	154	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	62041255	62041255	417	11	G	C	C	33	33	AHNAK	C	3	3
TUT1	64852	broad.mit.edu	36	11	62100192	62100192	+	Silent	SNP	G	C	C			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:62100192G>C	uc001nto.1	-	c.1575C>G	c.(1573-1575)GGC>GGG	p.G525G	EEF1G_uc001ntm.1_5'Flank|TUT1_uc001ntp.1_Silent_p.G59G	NM_022830	NP_073741	Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6	525	PAP-associated.				mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2														0.217391	7.434148	9.193811	5	18	GG		KEEP	---	---	---	---	capture			Silent	SNP	62100192	62100192	17336	11	G	C	C	42	42	TUT1	C	3	3
NRXN2	9379	broad.mit.edu	36	11	64172825	64172825	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:64172825G>A	uc001oar.1	-	c.3240C>T	c.(3238-3240)GCC>GCT	p.A1080A	NRXN2_uc001oas.1_Silent_p.A1040A|NRXN2_uc001oaq.1_Silent_p.A747A	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:Variant_position_missing_in_P58401_after_alignment					cell adhesion	integral to membrane				ovary(2)|pancreas(1)|kidney(1)|central_nervous_system(1)|skin(1)	6														0.781022	363.999187	373.976547	107	30	GG		KEEP	---	---	---	---	capture			Silent	SNP	64172825	64172825	11071	11	G	A	A	39	39	NRXN2	A	1	1
DNHD1	144132	broad.mit.edu	36	11	6480722	6480722	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:6480722C>T	uc001mdp.1	+	c.910C>T	c.(910-912)CGG>TGG	p.R304W		NM_173589	NP_775860	Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1 isoform 2	304					microtubule-based movement	dynein complex	microtubule motor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)												0.639344	128.142405	129.186495	39	22	CC		KEEP	---	---	---	---	capture		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)	Missense_Mutation	SNP	6480722	6480722	4851	11	C	T	T	23	23	DNHD1	T	1	1
EHBP1L1	254102	broad.mit.edu	36	11	65107149	65107149	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:65107149G>A	uc001oeo.2	+	c.2430G>A	c.(2428-2430)GCG>GCA	p.A810A	EHBP1L1_uc009yqm.1_Intron|EHBP1L1_uc001oep.1_Intron	NM_001099409	NP_001092879	Q8N3D4	EH1L1_HUMAN	tangerin	810	Glu-rich.									central_nervous_system(1)	1														0.744681	116.745382	119.297114	35	12	GG		KEEP	---	---	---	---	capture			Silent	SNP	65107149	65107149	5165	11	G	A	A	37	37	EHBP1L1	A	1	1
TMEM151A	256472	broad.mit.edu	36	11	65819057	65819057	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:65819057C>T	uc001ohl.1	+	c.764C>T	c.(763-765)GCG>GTG	p.A255V		NM_153266	NP_694998	Q8N4L1	T151A_HUMAN	transmembrane protein 151A	255						integral to membrane				central_nervous_system(1)	1														0.5	29.422297	29.422297	11	11	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	65819057	65819057	16602	11	C	T	T	27	27	TMEM151A	T	1	1
CD248	57124	broad.mit.edu	36	11	65839800	65839800	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:65839800C>T	uc001ohm.1	-	c.1275G>A	c.(1273-1275)CCG>CCA	p.P425P		NM_020404	NP_065137	Q9HCU0	CD248_HUMAN	tumor endothelial marker 1 precursor	425	Pro-rich.|Extracellular (Potential).					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding			large_intestine(3)	3					Cefalotin(DB00456)									0.732323	476.844088	486.496816	145	53	CC		KEEP	---	---	---	---	capture			Silent	SNP	65839800	65839800	3117	11	C	T	T	23	23	CD248	T	1	1
RBM14	10432	broad.mit.edu	36	11	66148743	66148743	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:66148743C>T	uc001oit.1	+	c.820C>T	c.(820-822)CGC>TGC	p.R274C	RBM14_uc009yrh.1_Intron|RBM14_uc009yri.1_Intron|RBM4_uc009yrj.1_Intron|RBM4_uc009yrk.1_Intron|RBM14_uc001oiu.2_5'Flank	NM_006328	NP_006319	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	274	Ala-rich.				DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|histone deacetylation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription, DNA-dependent	mediator complex|ribonucleoprotein complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|protein binding, bridging|RNA binding|RNA polymerase II transcription mediator activity			ovary(2)|central_nervous_system(1)	3														0.273292	115.229589	122.686706	44	117	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66148743	66148743	13576	11	C	T	T	23	23	RBM14	T	1	1
RBM4	5936	broad.mit.edu	36	11	66168103	66168103	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:66168103C>T	uc009yrj.1	+	c.1019C>T	c.(1018-1020)GCG>GTG	p.A340V	RBM4_uc009yrk.1_Missense_Mutation_p.A315V|RBM4_uc001oiw.1_Missense_Mutation_p.A340V|RBM4_uc001oix.1_Intron|RBM4_uc001oiy.1_Missense_Mutation_p.A340V|RBM4_uc001oiz.1_Missense_Mutation_p.A340V	NM_002896	NP_002887	Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4	340	Interaction with TNPO3.				mRNA processing|RNA splicing	cytoplasm|nucleolus	nucleotide binding|RNA binding|zinc ion binding			ovary(1)	1														0.716981	245.940851	250.425546	76	30	CC		KEEP	---	---	---	---	capture		Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)	Missense_Mutation	SNP	66168103	66168103	13596	11	C	T	T	27	27	RBM4	T	1	1
LRFN4	78999	broad.mit.edu	36	11	66382437	66382437	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:66382437C>T	uc001ojr.1	+	c.646C>T	c.(646-648)CGT>TGT	p.R216C	PC_uc001ojo.1_Intron|PC_uc001ojp.1_Intron|PC_uc001ojn.1_Intron|LRFN4_uc001ojq.1_Missense_Mutation_p.R216C|LRFN4_uc001ojs.2_Missense_Mutation_p.R216C	NM_024036	NP_076941	Q6PJG9	LRFN4_HUMAN	leucine rich repeat and fibronectin type III	216	Extracellular (Potential).					integral to membrane					0														0.846154	35.22442	36.710057	11	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66382437	66382437	9313	11	C	T	T	31	31	LRFN4	T	1	1
OR2AG2	338755	broad.mit.edu	36	11	6746748	6746748	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:6746748G>A	uc001meq.1	-	c.17C>T	c.(16-18)TCC>TTC	p.S6F		NM_001004490	NP_001004490	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG,	6	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)												0.140625	15.1322	23.109447	9	55	GG		KEEP	---	---	---	---	capture		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	Missense_Mutation	SNP	6746748	6746748	11391	11	G	A	A	41	41	OR2AG2	A	2	2
IGHMBP2	3508	broad.mit.edu	36	11	68457414	68457414	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:68457414G>A	uc001ook.1	+	c.1307G>A	c.(1306-1308)CGG>CAG	p.R436Q	IGHMBP2_uc001ool.1_Missense_Mutation_p.R60Q|IGHMBP2_uc001oom.1_Missense_Mutation_p.R14Q	NM_002180	NP_002171	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	436					cell death|DNA recombination|DNA repair|DNA replication|protein homooligomerization|transcription, DNA-dependent|translation	axon|growth cone|nucleus|ribonucleoprotein complex	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' RNA helicase activity|ribosome binding|single-stranded DNA binding|transcription factor binding|tRNA binding|zinc ion binding				0														0.787879	88.367175	90.894947	26	7	GG		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)		Missense_Mutation	SNP	68457414	68457414	7892	11	G	A	A	39	39	IGHMBP2	A	1	1
INPPL1	3636	broad.mit.edu	36	11	71620254	71620254	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:71620254G>A	uc001osf.1	+	c.1562G>A	c.(1561-1563)CGT>CAT	p.R521H	INPPL1_uc001osg.1_Missense_Mutation_p.R279H	NM_001567	NP_001558	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	521					actin filament organization|cell adhesion|endocytosis	actin cortical patch|cytosol	actin binding|SH2 domain binding|SH3 domain binding			skin(2)|ovary(1)	3														0.71028	245.238108	249.479799	76	31	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71620254	71620254	8062	11	G	A	A	40	40	INPPL1	A	1	1
P2RY6	5031	broad.mit.edu	36	11	72685731	72685731	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:72685731C>T	uc001otm.1	+	c.520C>T	c.(520-522)CGC>TGC	p.R174C	P2RY6_uc001otn.1_Missense_Mutation_p.R174C|P2RY6_uc001oto.1_Missense_Mutation_p.R174C|P2RY6_uc001otp.1_Missense_Mutation_p.R174C|P2RY6_uc001otq.1_Missense_Mutation_p.R174C|P2RY6_uc001otr.1_Missense_Mutation_p.R174C|P2RY6_uc001ots.1_Missense_Mutation_p.R174C|P2RY6_uc009ytn.1_Missense_Mutation_p.R174C	NM_176796	NP_789768	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y6	174	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1														0.678161	394.602715	399.507969	118	56	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	72685731	72685731	11767	11	C	T	T	23	23	P2RY6	T	1	1
LRDD	55367	broad.mit.edu	36	11	790563	790563	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:790563C>T	uc001lro.1	-	c.2021G>A	c.(2020-2022)CGC>CAC	p.R674H	SLC25A22_uc009yci.1_5'Flank|SLC25A22_uc001lrj.1_5'Flank|LRDD_uc009yck.1_Non-coding_Transcript|LRDD_uc001lrk.1_Missense_Mutation_p.R674H|LRDD_uc001lrl.1_Missense_Mutation_p.R517H|LRDD_uc001lrm.1_Missense_Mutation_p.R361H|LRDD_uc001lrn.1_Missense_Mutation_p.R517H|LRDD_uc001lrp.1_Missense_Mutation_p.R336H	NM_145886	NP_665893	Q9HB75	PIDD_HUMAN	leucine rich repeat and death domain containing	674					apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)												0.775862	142.493577	146.547989	45	13	CC		KEEP	---	---	---	---	capture		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Missense_Mutation	SNP	790563	790563	9309	11	C	T	T	27	27	LRDD	T	1	1
EFCAB4A	283229	broad.mit.edu	36	11	818887	818887	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:818887G>A	uc009ycm.1	+	c.201G>A	c.(199-201)CAG>CAA	p.Q67Q	EFCAB4A_uc001lrv.2_Silent_p.Q67Q|EFCAB4A_uc001lrw.2_5'Flank	NM_173584	NP_775855	Q8N4Y2	EFC4A_HUMAN	EF-hand calcium binding domain 4A	67	EF-hand 2.				store-operated calcium entry		calcium ion binding				0		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)												0.735849	383.035731	391.026517	117	42	GG		KEEP	---	---	---	---	capture		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Silent	SNP	818887	818887	5123	11	G	A	A	34	34	EFCAB4A	A	2	2
TMEM135	65084	broad.mit.edu	36	11	86698360	86698360	+	Nonsense_Mutation	SNP	A	T	T			TCGA-19-1787-01	TCGA-19-1787-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:86698360A>T	uc001pch.1	+	c.934A>T	c.(934-936)AAG>TAG	p.K312*	TMEM135_uc001pci.1_Nonsense_Mutation_p.K290*	NM_022918	NP_075069	Q86UB9	TM135_HUMAN	transmembrane protein 135	312	Helical; (Potential).					integral to membrane					0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)												0.763636	265.64047	272.627122	84	26	AA		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	86698360	86698360	16583	11	A	T	T	5	5	TMEM135	T	5	4
MAML2	84441	broad.mit.edu	36	11	95352502	95352502	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:95352502C>T	uc001pfw.1	-	c.2729G>A	c.(2728-2730)CGG>CAG	p.R910Q		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	910					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			lung(2)|ovary(1)	3		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)								501				0.682692	236.252907	239.338564	71	33	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	95352502	95352502	9589	11	C	T	T	23	23	MAML2	T	1	1
AP2A2	161	broad.mit.edu	36	11	978608	978608	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:978608C>T	uc001lss.1	+	c.1188C>T	c.(1186-1188)TGC>TGT	p.C396C	AP2A2_uc001lst.1_Silent_p.C397C|AP2A2_uc009yco.1_Non-coding_Transcript	NM_012305	NP_036437	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2	396					axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|cytosol	lipid binding|protein transporter activity				0		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)												0.722772	467.819656	476.841883	146	56	CC		KEEP	---	---	---	---	capture		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)	Silent	SNP	978608	978608	750	11	C	T	T	27	27	AP2A2	T	1	1
CNTN5	53942	broad.mit.edu	36	11	99332929	99332929	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:99332929G>A	uc001pga.1	+	c.855G>A	c.(853-855)ACG>ACA	p.T285T	CNTN5_uc009ywv.1_Silent_p.T285T|CNTN5_uc001pfz.2_Silent_p.T285T|CNTN5_uc001pgb.1_Silent_p.T211T	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	285					cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)								1117				0.146341	9.222224	14.152344	6	35	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	Silent	SNP	99332929	99332929	3782	11	G	A	A	38	38	CNTN5	A	1	1
MYBPC1	4604	broad.mit.edu	36	12	100564789	100564789	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:100564789C>T	uc001tih.1	+	c.1083C>T	c.(1081-1083)TTC>TTT	p.F361F	MYBPC1_uc001tif.1_Silent_p.F349F|MYBPC1_uc001tig.1_Silent_p.F361F|MYBPC1_uc001tii.1_Silent_p.F336F|MYBPC1_uc001tij.1_Silent_p.F336F|MYBPC1_uc001tik.1_Silent_p.F310F	NM_002465	NP_002456	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 1	336	Ig-like C2-type 2.			F -> L (in Ref. 1; CAA46987).	cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)	3														0.525862	194.279045	194.346405	61	55	CC		KEEP	---	---	---	---	capture			Silent	SNP	100564789	100564789	10406	12	C	T	T	31	31	MYBPC1	T	1	1
GNPTAB	79158	broad.mit.edu	36	12	100689037	100689037	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:100689037C>T	uc001tit.1	-	c.801G>A	c.(799-801)GCG>GCA	p.A267A	GNPTAB_uc001tiu.1_Silent_p.A267A	NM_024312	NP_077288	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase	267					cell differentiation	Golgi membrane|integral to membrane|nucleus	metal ion binding|transcription factor binding|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity			ovary(1)	1														0.457143	134.374192	134.543039	48	57	CC		KEEP	---	---	---	---	capture			Silent	SNP	100689037	100689037	6814	12	C	T	T	27	27	GNPTAB	T	1	1
CLEC1A	51267	broad.mit.edu	36	12	10117216	10117216	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:10117216C>T	uc001qxb.1	-	c.605G>A	c.(604-606)CGC>CAC	p.R202H	CLEC1A_uc009zhf.1_Missense_Mutation_p.R114H|CLEC1A_uc001qxc.1_Missense_Mutation_p.R114H|CLEC1A_uc001qxd.1_Missense_Mutation_p.R159H	NM_016511	NP_057595	Q8NC01	CLC1A_HUMAN	C-type lectin-like receptor-1	202	C-type lectin.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane|intracellular	sugar binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2														0.373016	125.386834	127.172997	47	79	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10117216	10117216	3642	12	C	T	T	27	27	CLEC1A	T	1	1
HSP90B1	7184	broad.mit.edu	36	12	102861006	102861006	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:102861006C>T	uc001tkb.1	+	c.1669C>T	c.(1669-1671)CGA>TGA	p.R557*	HSP90B1_uc009zui.1_Intron	NM_003299	NP_003290	P14625	ENPL_HUMAN	heat shock protein 90kDa beta, member 1	557					actin rod assembly|anti-apoptosis|cellular response to ATP|ER-associated protein catabolic process|protein folding|protein transport|regulation of phosphoprotein phosphatase activity|response to hypoxia|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|melanosome|microsome|midbody|perinuclear region of cytoplasm	ATP binding|calcium ion binding|low-density lipoprotein particle receptor binding|protein phosphatase binding|RNA binding|unfolded protein binding|virion binding			ovary(1)	1					Rifabutin(DB00615)				p.R557*(HEC265-Tumor)	1171				0.422727	277.836555	278.982876	93	127	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	102861006	102861006	7702	12	C	T	T	27	27	HSP90B1	T	5	1
KIAA1033	23325	broad.mit.edu	36	12	104062334	104062334	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:104062334G>A	uc001tld.1	+	c.2150G>A	c.(2149-2151)CGG>CAG	p.R717Q	KIAA1033_uc001tle.1_Missense_Mutation_p.R529Q	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	717					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2														0.454545	242.611459	242.90782	75	90	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	104062334	104062334	8513	12	G	A	A	39	39	KIAA1033	A	1	1
CCDC63	160762	broad.mit.edu	36	12	109829601	109829601	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:109829601C>T	uc001trv.1	+	c.1630C>T	c.(1630-1632)CGC>TGC	p.R544C	CCDC63_uc001trw.1_Missense_Mutation_p.R459C	NM_152591	NP_689804	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	544										ovary(1)|pancreas(1)	2														0.433962	67.715969	67.91764	23	30	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	109829601	109829601	2957	12	C	T	T	27	27	CCDC63	T	1	1
ACAD10	80724	broad.mit.edu	36	12	110627937	110627937	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:110627937G>A	uc009zvx.1	+	c.349G>A	c.(349-351)GTG>ATG	p.V117M	ACAD10_uc009zvw.1_Missense_Mutation_p.V117M|ACAD10_uc001tso.2_Missense_Mutation_p.V117M|ACAD10_uc001tsp.1_Missense_Mutation_p.V117M|ACAD10_uc001tsq.1_Missense_Mutation_p.V117M	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10	117					oxidation-reduction process		acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity			ovary(2)	2														0.276786	81.376507	86.399301	31	81	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	110627937	110627937	109	12	G	A	A	40	40	ACAD10	A	1	1
ACAD10	80724	broad.mit.edu	36	12	110676034	110676034	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:110676034G>A	uc009zvx.1	+	c.2986G>A	c.(2986-2988)GTG>ATG	p.V996M	ACAD10_uc001tsq.1_Missense_Mutation_p.V965M|ACAD10_uc001tss.1_Intron	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10	965					oxidation-reduction process		acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity			ovary(2)	2												OREG0022130	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.114035	10.788449	27.54478	13	101	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	110676034	110676034	109	12	G	A	A	40	40	ACAD10	A	1	1
DDX54	79039	broad.mit.edu	36	12	112099107	112099107	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:112099107C>T	uc001tuq.2	-	c.673G>A	c.(673-675)GGA>AGA	p.G225R	DDX54_uc001tup.1_Missense_Mutation_p.G225R	NM_001111322	NP_001104792	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	225	Helicase ATP-binding.				estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nucleolus	ATP binding|ATP-dependent RNA helicase activity|estrogen receptor binding|RNA binding|transcription corepressor activity			central_nervous_system(1)|skin(1)	2														0.230337	98.982333	110.850127	41	137	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	112099107	112099107	4543	12	C	T	T	23	23	DDX54	T	1	1
FBXW8	26259	broad.mit.edu	36	12	115871835	115871835	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:115871835G>A	uc001twg.1	+	c.618G>A	c.(616-618)GAG>GAA	p.E206E	FBXW8_uc001twf.1_Silent_p.E140E|FBXW8_uc009zwp.1_Non-coding_Transcript	NM_153348	NP_699179	Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8 isoform	206	WD 1.						protein binding			ovary(2)|pancreas(1)	3	all_neural(191;0.117)|Medulloblastoma(191;0.163)													0.267857	119.47324	127.669151	45	123	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(302;0.0353)	Silent	SNP	115871835	115871835	6007	12	G	A	A	34	34	FBXW8	A	2	2
NOS1	4842	broad.mit.edu	36	12	116169692	116169692	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:116169692G>A	uc001twm.1	-	c.2667C>T	c.(2665-2667)CTC>CTT	p.L889L		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1 (neuronal)	889	FMN (By similarity).|Flavodoxin-like.				arginine catabolic process|multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|oxidation-reduction process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(2)|pancreas(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)				L-Citrulline(DB00155)	Esophageal Squamous(162;1748 2599 51982 52956)								0.324324	66.072188	68.100237	24	50	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(302;0.0561)	Silent	SNP	116169692	116169692	10944	12	G	A	A	37	37	NOS1	A	1	1
KSR2	283455	broad.mit.edu	36	12	116447096	116447096	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:116447096G>A	uc001two.2	-	c.2076C>T	c.(2074-2076)AAC>AAT	p.N692N		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	721	Protein kinase.				intracellular signal transduction|protein phosphorylation	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(7)|central_nervous_system(2)|large_intestine(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)									623				0.378049	86.011394	87.078835	31	51	GG		KEEP	---	---	---	---	capture			Silent	SNP	116447096	116447096	8905	12	G	A	A	40	40	KSR2	A	1	1
KSR2	283455	broad.mit.edu	36	12	116447158	116447158	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:116447158C>T	uc001two.2	-	c.2014G>A	c.(2014-2016)GAG>AAG	p.E672K		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	701	Protein kinase.				intracellular signal transduction|protein phosphorylation	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(7)|central_nervous_system(2)|large_intestine(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)									623				0.508475	93.950695	93.954394	30	29	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116447158	116447158	8905	12	C	T	T	31	31	KSR2	T	1	1
TAOK3	51347	broad.mit.edu	36	12	117084145	117084145	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:117084145C>T	uc001twx.1	-	c.1970G>A	c.(1969-1971)CGA>CAA	p.R657Q	TAOK3_uc001twy.2_Missense_Mutation_p.R657Q|TAOK3_uc001twv.1_Missense_Mutation_p.R197Q|TAOK3_uc001tww.1_Missense_Mutation_p.R487Q	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	657					MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)									500				0.256684	122.322296	132.353114	48	139	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	117084145	117084145	16070	12	C	T	T	31	31	TAOK3	T	1	1
SRRM4	84530	broad.mit.edu	36	12	118078694	118078694	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:118078694G>A	uc001txa.1	+	c.1544G>A	c.(1543-1545)CGC>CAC	p.R515H		NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein	515	Ser-rich.|Arg-rich.				cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2														0.139535	9.624943	15.018626	6	37	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118078694	118078694	15685	12	G	A	A	38	38	SRRM4	A	1	1
CCDC60	160777	broad.mit.edu	36	12	118410948	118410948	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:118410948G>A	uc001txe.1	+	c.451G>A	c.(451-453)GAG>AAG	p.E151K		NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	151										ovary(2)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)													0.478261	168.541403	168.586705	55	60	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(302;0.207)	Missense_Mutation	SNP	118410948	118410948	2954	12	G	A	A	37	37	CCDC60	A	1	1
GCN1L1	10985	broad.mit.edu	36	12	119067127	119067127	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:119067127C>T	uc001txo.1	-	c.5138G>A	c.(5137-5139)CGC>CAC	p.R1713H		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	1713					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(3)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)													0.283465	91.749397	97.095918	36	91	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	119067127	119067127	6565	12	C	T	T	27	27	GCN1L1	T	1	1
P2RX4	5025	broad.mit.edu	36	12	120154644	120154644	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:120154644C>T	uc001tzs.1	+	c.977C>T	c.(976-978)ACG>ATG	p.T326M	P2RX4_uc001tzr.1_Missense_Mutation_p.T310M|P2RX4_uc009zxb.1_Non-coding_Transcript|P2RX4_uc009zxc.1_Missense_Mutation_p.T283M	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4	310	Extracellular (Potential).				endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|integral to plasma membrane|perinuclear region of cytoplasm	ATP binding|cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)													0.24	43.919484	48.542365	18	57	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	120154644	120154644	11755	12	C	T	T	19	19	P2RX4	T	1	1
CAMKK2	10645	broad.mit.edu	36	12	120196499	120196499	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:120196499G>A	uc001tzu.1	-	c.214C>T	c.(214-216)CGG>TGG	p.R72W	CAMKK2_uc001tzt.1_Missense_Mutation_p.R72W|CAMKK2_uc001tzv.1_Missense_Mutation_p.R72W|CAMKK2_uc001tzw.1_Missense_Mutation_p.R72W|CAMKK2_uc001tzx.1_Missense_Mutation_p.R72W|CAMKK2_uc001tzy.1_Missense_Mutation_p.R72W|CAMKK2_uc001uaa.1_Missense_Mutation_p.R72W|CAMKK2_uc001uab.1_Missense_Mutation_p.R72W|CAMKK2_uc001uac.1_Missense_Mutation_p.R72W|CAMKK2_uc001uad.1_Missense_Mutation_p.R72W	NM_006549	NP_006540	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase	72					calcium-mediated signaling|MAPKKK cascade|positive regulation of transcription, DNA-dependent|protein autophosphorylation|regulation of protein kinase activity	cytoplasm	ATP binding|calcium ion binding|calmodulin binding|calmodulin-dependent protein kinase activity|protein tyrosine kinase activity			large_intestine(1)|lung(1)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)									369				0.539474	125.683037	125.786942	41	35	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	120196499	120196499	2724	12	G	A	A	39	39	CAMKK2	A	1	1
MLXIP	22877	broad.mit.edu	36	12	121192203	121192203	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:121192203C>T	uc001ubq.1	+	c.2651C>T	c.(2650-2652)ACG>ATG	p.T884M	MLXIP_uc001ubt.1_Missense_Mutation_p.T491M	NM_014938	NP_055753	Q9HAP2	MLXIP_HUMAN	MLX interacting protein	884					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial outer membrane|nucleus	DNA binding|transcription regulator activity			ovary(2)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)				Esophageal Squamous(105;787 1493 16200 18566 52466)								0.369048	83.611691	84.873519	31	53	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)	Missense_Mutation	SNP	121192203	121192203	10026	12	C	T	T	19	19	MLXIP	T	1	1
DNAH10	196385	broad.mit.edu	36	12	122834625	122834625	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:122834625C>T	uc001uft.2	+	c.995C>T	c.(994-996)ACG>ATG	p.T332M	DNAH10_uc009zyb.1_Missense_Mutation_p.T150M	NM_001083900	NP_001077369	Q8IVF4	DYH10_HUMAN	DNAH10 variant protein (Fragment).	332	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|central_nervous_system(1)|skin(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)													0.5	144.034381	144.034381	49	49	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	Missense_Mutation	SNP	122834625	122834625	4780	12	C	T	T	19	19	DNAH10	T	1	1
DNAH10	196385	broad.mit.edu	36	12	122871220	122871220	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:122871220G>A	uc001uft.2	+	c.3787G>A	c.(3787-3789)GGG>AGG	p.G1263R		NM_001083900	NP_001077369	Q8IVF4	DYH10_HUMAN	DNAH10 variant protein (Fragment).	1263	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|central_nervous_system(1)|skin(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)													0.352113	144.903359	147.644237	50	92	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	Missense_Mutation	SNP	122871220	122871220	4780	12	G	A	A	47	47	DNAH10	A	2	2
DNAH10	196385	broad.mit.edu	36	12	122896143	122896143	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:122896143G>A	uc001uft.2	+	c.5050G>A	c.(5050-5052)GCT>ACT	p.A1684T		NM_001083900	NP_001077369	Q8IVF4	DYH10_HUMAN	DNAH10 variant protein (Fragment).	1684	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|central_nervous_system(1)|skin(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)													0.315789	30.494352	31.637058	12	26	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	Missense_Mutation	SNP	122896143	122896143	4780	12	G	A	A	38	38	DNAH10	A	1	1
AACS	65985	broad.mit.edu	36	12	124192623	124192623	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:124192623C>T	uc001uhc.1	+	c.1914C>T	c.(1912-1914)GCC>GCT	p.A638A	AACS_uc001uhd.1_Missense_Mutation_p.R571C|AACS_uc009zyh.1_Non-coding_Transcript|AACS_uc009zyi.1_Silent_p.A236A	NM_023928	NP_076417	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	638					fatty acid metabolic process	cytosol	acetoacetate-CoA ligase activity|ATP binding			ovary(1)|liver(1)|central_nervous_system(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)													0.289941	131.907179	138.590646	49	120	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)	Silent	SNP	124192623	124192623	10	12	C	T	T	23	23	AACS	T	1	1
TMEM132D	121256	broad.mit.edu	36	12	128750589	128750589	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:128750589G>A	uc009zyl.1	-	c.687C>T	c.(685-687)ACC>ACT	p.T229T		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D	229	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)	12	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)												0.548387	224.62562	224.881599	68	56	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	Silent	SNP	128750589	128750589	16579	12	G	A	A	39	39	TMEM132D	A	1	1
PIWIL1	9271	broad.mit.edu	36	12	129411777	129411777	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:129411777C>T	uc001uik.1	+	c.1765C>T	c.(1765-1767)CGA>TGA	p.R589*	PIWIL1_uc001uij.1_Nonsense_Mutation_p.R589*	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	589	RNA-binding (By similarity).|Piwi.				gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)													0.523256	141.499696	141.54233	45	41	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)	Nonsense_Mutation	SNP	129411777	129411777	12381	12	C	T	T	23	23	PIWIL1	T	5	1
RIMBP2	23504	broad.mit.edu	36	12	129458232	129458232	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:129458232C>T	uc001uil.2	-	c.2917G>A	c.(2917-2919)GAT>AAT	p.D973N		NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	973	SH3 3.					cell junction|synapse				ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	8	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)												0.481781	720.911823	721.054579	238	256	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)	Missense_Mutation	SNP	129458232	129458232	13838	12	C	T	T	31	31	RIMBP2	T	1	1
RIMBP2	23504	broad.mit.edu	36	12	129492928	129492928	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:129492928C>T	uc001uil.2	-	c.871G>A	c.(871-873)GAC>AAC	p.D291N	RIMBP2_uc001uim.2_Missense_Mutation_p.D199N|RIMBP2_uc001uin.1_5'UTR	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	291						cell junction|synapse				ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	8	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)												0.507752	401.20316	401.216374	131	127	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)	Missense_Mutation	SNP	129492928	129492928	13838	12	C	T	T	31	31	RIMBP2	T	1	1
EP400	57634	broad.mit.edu	36	12	131032617	131032617	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:131032617G>A	uc001ujn.1	+	c.1570G>A	c.(1570-1572)GCG>ACG	p.A524T	EP400_uc001ujl.1_Missense_Mutation_p.A523T|EP400_uc001ujm.1_Missense_Mutation_p.A524T|EP400_uc001ujj.1_Missense_Mutation_p.A487T|EP400_uc001ujk.2_Missense_Mutation_p.A560T	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	560					histone H2A acetylation|histone H4 acetylation	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)												0.294455	395.037708	414.815622	154	369	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)	Missense_Mutation	SNP	131032617	131032617	5342	12	G	A	A	38	38	EP400	A	1	1
EP400	57634	broad.mit.edu	36	12	131056698	131056698	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:131056698C>T	uc001ujn.1	+	c.3024C>T	c.(3022-3024)GCC>GCT	p.A1008A	EP400_uc001ujl.1_Silent_p.A1007A|EP400_uc001ujm.1_Silent_p.A1008A	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	1044	Interactions with RUVBL1 and RUVBL2.				histone H2A acetylation|histone H4 acetylation	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)												0.44697	185.247328	185.563495	59	73	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)	Silent	SNP	131056698	131056698	5342	12	C	T	T	23	23	EP400	T	1	1
POLE	5426	broad.mit.edu	36	12	131762087	131762087	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:131762087G>A	uc001uks.1	-	c.1196C>T	c.(1195-1197)GCG>GTG	p.A399V	POLE_uc009zyu.1_Missense_Mutation_p.A372V	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA polymerase epsilon catalytic subunit	399					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|lung(1)|central_nervous_system(1)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)												0.44697	167.702422	168.025736	59	73	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Missense_Mutation	SNP	131762087	131762087	12624	12	G	A	A	38	38	POLE	A	1	1
GRIN2B	2904	broad.mit.edu	36	12	13659861	13659861	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:13659861T>C	uc001rbt.2	-	c.1333A>G	c.(1333-1335)AAA>GAA	p.K445E		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	445	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|lung(2)|skin(1)	10					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)					371				0.445902	469.392516	470.164871	136	169	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	13659861	13659861	7059	12	T	C	C	61	61	GRIN2B	C	4	4
EPS8	2059	broad.mit.edu	36	12	15691421	15691421	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:15691421G>A	uc009zif.1	-	c.1475C>T	c.(1474-1476)GCG>GTG	p.A492V	EPS8_uc001rdb.1_Missense_Mutation_p.A492V|EPS8_uc009zig.1_Missense_Mutation_p.A232V	NM_004447	NP_004438	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway	492					cell proliferation|epidermal growth factor receptor signaling pathway		SH3/SH2 adaptor activity			ovary(2)	2		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)												0.377358	170.258566	172.358194	60	99	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)	Missense_Mutation	SNP	15691421	15691421	5387	12	G	A	A	38	38	EPS8	A	1	1
WNT5B	81029	broad.mit.edu	36	12	1619394	1619394	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:1619394C>T	uc009zdq.1	+	c.612C>T	c.(610-612)GCC>GCT	p.A204A	WNT5B_uc001qjj.1_Silent_p.A204A|WNT5B_uc001qjk.1_Silent_p.A204A|WNT5B_uc001qjl.1_Silent_p.A204A	NM_032642	NP_116031	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family,	204					angiogenesis|anterior/posterior pattern formation|cell migration involved in gastrulation|cellular response to retinoic acid|chondrocyte differentiation|convergent extension involved in axis elongation|convergent extension involved in gastrulation|dorsal/ventral axis specification|endocrine pancreas development|fat cell differentiation|lens fiber cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of gene-specific transcription from RNA polymerase II promoter|neuron differentiation|positive regulation of cell migration|positive regulation of fat cell differentiation|respiratory system development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding			skin(1)	1	Ovarian(42;0.107)													0.444444	48.095649	48.192354	16	20	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(31;0.00109)		Silent	SNP	1619394	1619394	17966	12	C	T	T	23	23	WNT5B	T	1	1
SLC6A13	6540	broad.mit.edu	36	12	200899	200899	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:200899G>A	uc001qic.1	-	c.1590C>T	c.(1588-1590)GGC>GGT	p.G530G	SLC6A13_uc009zdj.1_Silent_p.G520G	NM_016615	NP_057699	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter	530	Helical; Name=12; (Potential).				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)													0.125	10.169793	18.950836	8	56	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)		Silent	SNP	200899	200899	15173	12	G	A	A	38	38	SLC6A13	A	1	1
IPO8	10526	broad.mit.edu	36	12	30676108	30676108	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:30676108G>A	uc001rjd.1	-	c.3004C>T	c.(3004-3006)CGG>TGG	p.R1002W	IPO8_uc001rje.1_Missense_Mutation_p.R491W	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8	1002					intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)													0.3	104.591445	109.597822	42	98	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30676108	30676108	8099	12	G	A	A	40	40	IPO8	A	1	1
C12orf35	55196	broad.mit.edu	36	12	32027156	32027156	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:32027156G>A	uc001rks.1	+	c.2000G>A	c.(1999-2001)AGC>AAC	p.S667N		NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196	667										ovary(1)	1	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)													0.413333	93.409187	93.901762	31	44	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(6;0.0114)		Missense_Mutation	SNP	32027156	32027156	1726	12	G	A	A	34	34	C12orf35	A	2	2
TSPAN9	10867	broad.mit.edu	36	12	3259886	3259886	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:3259886C>T	uc001qlp.1	+	c.408C>T	c.(406-408)AAC>AAT	p.N136N		NM_006675	NP_006666	O75954	TSN9_HUMAN	tetraspanin 9	136	Extracellular (Potential).					integral to plasma membrane|membrane fraction				ovary(1)	1														0.213115	30.2426	34.880499	13	48	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)		Silent	SNP	3259886	3259886	17205	12	C	T	T	19	19	TSPAN9	T	1	1
LRRK2	120892	broad.mit.edu	36	12	38984069	38984069	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:38984069G>A	uc001rmg.2	+	c.3643G>A	c.(3643-3645)GCA>ACA	p.A1215T	LRRK2_uc001rmh.1_Missense_Mutation_p.A837T|LRRK2_uc009zjw.1_Missense_Mutation_p.A53T|LRRK2_uc001rmi.2_Missense_Mutation_p.A48T	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1215	LRR 9.				activation of MAPKK activity|determination of adult lifespan|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(11)|lung(2)|upper_aerodigestive_tract(1)|large_intestine(1)|stomach(1)|urinary_tract(1)|pancreas(1)	18	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)								1771				0.493151	110.197194	110.200179	36	37	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38984069	38984069	9409	12	G	A	A	38	38	LRRK2	A	1	1
ADAMTS20	80070	broad.mit.edu	36	12	42107392	42107392	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:42107392C>T	uc001rnn.1	-	c.4093G>A	c.(4093-4095)GGA>AGA	p.G1365R	ADAMTS20_uc001rno.1_Missense_Mutation_p.G483R	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1365	TSP type-1 10.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)							p.G1365R(LK2-Tumor)|p.G1365R(SNU520-Tumor)|p.G1365R(SNU620-Tumor)|p.G1365R(LC1F-Tumor)|p.G1365R(SNU213-Tumor)|p.G1365R(LC1SQSF-Tumor)|p.G1365R(JK1-Tumor)|p.G1365R(JHH2-Tumor)	2149				0.420455	115.95518	116.442082	37	51	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(48;0.0473)	Missense_Mutation	SNP	42107392	42107392	267	12	C	T	T	23	23	ADAMTS20	T	1	1
FGF6	2251	broad.mit.edu	36	12	4424684	4424684	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:4424684C>T	uc001qmr.1	-	c.314G>A	c.(313-315)CGG>CAG	p.R105Q		NM_020996	NP_066276	P10767	FGF6_HUMAN	fibroblast growth factor 6 precursor	105					angiogenesis|cell proliferation|cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell division|positive regulation of cell proliferation	extracellular space	growth factor activity			ovary(1)	1														0.414634	54.36793	54.628826	17	24	CC		KEEP	---	---	---	---	capture	Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)		Missense_Mutation	SNP	4424684	4424684	6093	12	C	T	T	23	23	FGF6	T	1	1
DDX23	9416	broad.mit.edu	36	12	47512534	47512534	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:47512534G>A	uc001rsm.1	-	c.1893C>T	c.(1891-1893)TCC>TCT	p.S631S		NM_004818	NP_004809	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	631					cis assembly of pre-catalytic spliceosome	catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent RNA helicase activity|nucleic acid binding|protein binding			kidney(3)|ovary(1)|lung(1)	5														0.5	161.698445	161.698445	52	52	GG		KEEP	---	---	---	---	capture			Silent	SNP	47512534	47512534	4521	12	G	A	A	39	39	DDX23	A	1	1
DDX23	9416	broad.mit.edu	36	12	47517614	47517614	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:47517614C>T	uc001rsm.1	-	c.713G>A	c.(712-714)CGG>CAG	p.R238Q		NM_004818	NP_004809	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	238	Glu-rich.				cis assembly of pre-catalytic spliceosome	catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent RNA helicase activity|nucleic acid binding|protein binding			kidney(3)|ovary(1)|lung(1)	5														0.521951	336.049217	336.137073	107	98	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47517614	47517614	4521	12	C	T	T	23	23	DDX23	T	1	1
KRT84	3890	broad.mit.edu	36	12	51058145	51058145	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51058145G>A	uc001sah.1	-	c.1743C>T	c.(1741-1743)GGC>GGT	p.G581G		NM_033045	NP_149034	Q9NSB2	KRT84_HUMAN	keratin, hair, basic, 4	581	Tail.					keratin filament	structural constituent of epidermis				0	all_hematologic(5;0.12)													0.25	8.792163	9.701652	4	12	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(357;0.189)	Silent	SNP	51058145	51058145	8813	12	G	A	A	38	38	KRT84	A	1	1
ESPL1	9700	broad.mit.edu	36	12	51968255	51968255	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51968255G>A	uc001sck.2	+	c.4409G>A	c.(4408-4410)CGT>CAT	p.R1470H	ESPL1_uc001scj.2_Missense_Mutation_p.R1145H	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	extra spindle poles like 1	1470					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)	2						Colon(53;1069 1201 2587 5382)						OREG0021863	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.392857	31.718608	32.000106	11	17	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51968255	51968255	5446	12	G	A	A	40	40	ESPL1	A	1	1
ESPL1	9700	broad.mit.edu	36	12	51971822	51971822	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51971822C>T	uc001sck.2	+	c.5602C>T	c.(5602-5604)CGA>TGA	p.R1868*	ESPL1_uc001scj.2_Nonsense_Mutation_p.R1543*	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	extra spindle poles like 1	1868					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)	2						Colon(53;1069 1201 2587 5382)								0.468023	478.619721	478.916486	161	183	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	51971822	51971822	5446	12	C	T	T	27	27	ESPL1	T	5	1
SILV	6490	broad.mit.edu	36	12	54637700	54637700	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:54637700G>A	uc001sis.1	-	c.720C>T	c.(718-720)AGC>AGT	p.S240S	SILV_uc001sip.1_Silent_p.S218S|SILV_uc001siq.1_Silent_p.S218S|SILV_uc001sir.1_Silent_p.S218S	NM_006928	NP_008859	P40967	PMEL_HUMAN	silver homolog	218					melanin biosynthetic process|melanosome organization	endoplasmic reticulum membrane|extracellular region|Golgi apparatus|integral to membrane|melanosome|multivesicular body membrane|plasma membrane	protein binding				0														0.293785	130.416922	137.162452	52	125	GG		KEEP	---	---	---	---	capture			Silent	SNP	54637700	54637700	14817	12	G	A	A	38	38	SILV	A	1	1
ERBB3	2065	broad.mit.edu	36	12	54774487	54774487	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:54774487G>A	uc001sjh.1	+	c.1739G>A	c.(1738-1740)CGA>CAA	p.R580Q	ERBB3_uc009zoj.1_Intron|ERBB3_uc009zok.1_Missense_Mutation_p.R22Q|ERBB3_uc001sjk.1_5'Flank	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor	580	Extracellular (Potential).				cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|protein phosphorylation|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8										322				0.570796	405.655656	406.636981	129	97	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(18;0.112)		Missense_Mutation	SNP	54774487	54774487	5401	12	G	A	A	37	37	ERBB3	A	1	1
SPRYD4	283377	broad.mit.edu	36	12	55149134	55149134	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:55149134G>A	uc001sli.2	+	c.130G>A	c.(130-132)GCA>ACA	p.A44T		NM_207344	NP_997227	Q8WW59	SPRY4_HUMAN	SPRY domain containing 4	44	B30.2/SPRY.					nucleus					0														0.335714	130.291695	133.629929	47	93	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55149134	55149134	15624	12	G	A	A	42	42	SPRYD4	A	2	2
NXPH4	11247	broad.mit.edu	36	12	55905723	55905723	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1787-01	TCGA-19-1787-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:55905723A>G	uc001sne.1	+	c.853A>G	c.(853-855)AGC>GGC	p.S285G	NXPH4_uc009zpj.1_Silent_p.S48S	NM_007224	NP_009155	O95158	NXPH4_HUMAN	neurexophilin 4	285	V (Cys-rich).				neuropeptide signaling pathway	extracellular region					0														0.398437	159.096244	160.251939	51	77	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55905723	55905723	11198	12	A	G	G	7	7	NXPH4	G	4	4
GLI1	2735	broad.mit.edu	36	12	56149659	56149659	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:56149659G>A	uc001snx.1	+	c.1487G>A	c.(1486-1488)CGC>CAC	p.R496H		NM_005269	NP_005260	P08151	GLI1_HUMAN	glioma-associated oncogene homolog 1	496					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of gene-specific transcription|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	promoter binding|transcription activator activity|zinc ion binding			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	14						Pancreas(157;841 1936 10503 41495 50368)				277				0.497561	289.621386	289.622463	102	103	GG		KEEP	---	---	---	---	capture	GBM - Glioblastoma multiforme(3;3.99e-32)		Missense_Mutation	SNP	56149659	56149659	6705	12	G	A	A	38	38	GLI1	A	1	1
GLI1	2735	broad.mit.edu	36	12	56150652	56150652	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:56150652G>A	uc001snx.1	+	c.1862G>A	c.(1861-1863)AGA>AAA	p.R621K		NM_005269	NP_005260	P08151	GLI1_HUMAN	glioma-associated oncogene homolog 1	621					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of gene-specific transcription|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	promoter binding|transcription activator activity|zinc ion binding			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	14						Pancreas(157;841 1936 10503 41495 50368)				277				0.474227	144.446245	144.501949	46	51	GG		KEEP	---	---	---	---	capture	GBM - Glioblastoma multiforme(3;3.99e-32)		Missense_Mutation	SNP	56150652	56150652	6705	12	G	A	A	33	33	GLI1	A	2	2
B4GALNT1	2583	broad.mit.edu	36	12	56307704	56307704	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:56307704C>T	uc001spg.1	-	c.1348G>A	c.(1348-1350)GGT>AGT	p.G450S		NM_001478	NP_001469	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	450	Lumenal (Potential).				lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity				0	Melanoma(17;0.122)													0.492958	106.542328	106.544832	35	36	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(9;0.109)		Missense_Mutation	SNP	56307704	56307704	1287	12	C	T	T	23	23	B4GALNT1	T	1	1
ANO2	57101	broad.mit.edu	36	12	5902204	5902204	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:5902204C>T	uc001qnm.1	-	c.38G>A	c.(37-39)CGC>CAC	p.R13H		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	17	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7														0.611111	65.730929	66.115957	22	14	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5902204	5902204	705	12	C	T	T	27	27	ANO2	T	1	1
HELB	92797	broad.mit.edu	36	12	65011529	65011529	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:65011529G>A	uc001sti.2	+	c.2999G>A	c.(2998-3000)TGG>TAG	p.W1000*	HELB_uc009zqt.1_Non-coding_Transcript	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	1000					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2														0.572816	187.533774	188.008905	59	44	GG		KEEP	---	---	---	---	capture	GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)	Nonsense_Mutation	SNP	65011529	65011529	7328	12	G	A	A	47	47	HELB	A	5	2
USP5	8078	broad.mit.edu	36	12	6834860	6834860	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:6834860C>T	uc001qri.2	+	c.146C>T	c.(145-147)ACG>ATG	p.T49M	USP5_uc001qrh.2_Missense_Mutation_p.T49M	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1	49					positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding				0														0.346369	345.992879	353.452268	124	234	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6834860	6834860	17645	12	C	T	T	19	19	USP5	T	1	1
USP5	8078	broad.mit.edu	36	12	6840885	6840885	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:6840885G>A	uc001qri.2	+	c.1516G>A	c.(1516-1518)GAG>AAG	p.E506K	USP5_uc001qrh.2_Missense_Mutation_p.E506K	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1	506					positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding				0														0.481481	158.897205	158.92912	52	56	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6840885	6840885	17645	12	G	A	A	37	37	USP5	A	1	1
TSPAN8	7103	broad.mit.edu	36	12	69819859	69819859	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:69819859C>T	uc009zrt.1	-	c.160G>A	c.(160-162)GTT>ATT	p.V54I	TSPAN8_uc001swk.1_Missense_Mutation_p.V54I|TSPAN8_uc001swj.1_Missense_Mutation_p.V54I	NM_004616	NP_004607	P19075	TSN8_HUMAN	transmembrane 4 superfamily member 3	54	Extracellular (Potential).				protein glycosylation	integral to membrane|lysosome	signal transducer activity			lung(1)|central_nervous_system(1)	2										6				0.233918	96.315385	107.393046	40	131	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)		Missense_Mutation	SNP	69819859	69819859	17204	12	C	T	T	19	19	TSPAN8	T	1	1
ACSM4	341392	broad.mit.edu	36	12	7364626	7364626	+	Silent	SNP	T	C	C			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:7364626T>C	uc001qsx.1	+	c.960T>C	c.(958-960)CCT>CCC	p.P320P		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member	320					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0														0.277778	44.599587	47.000603	15	39	TT		KEEP	---	---	---	---	capture			Silent	SNP	7364626	7364626	187	12	T	C	C	54	54	ACSM4	C	4	4
E2F7	144455	broad.mit.edu	36	12	75964122	75964122	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1787-01	TCGA-19-1787-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:75964122A>G	uc001sym.2	-	c.656T>C	c.(655-657)CTG>CCG	p.L219P	E2F7_uc001syn.2_Missense_Mutation_p.L219P	NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	219					cell cycle|regulation of transcription, DNA-dependent	transcription factor complex	DNA binding|identical protein binding			ovary(1)|kidney(1)	2														0.272727	115.38571	123.084863	45	120	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75964122	75964122	5058	12	A	G	G	7	7	E2F7	G	4	4
FAM90A1	55138	broad.mit.edu	36	12	8266577	8266577	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:8266577C>T	uc001qui.2	-	c.503G>A	c.(502-504)CGC>CAC	p.R168H	FAM90A1_uc001quh.2_Missense_Mutation_p.R168H	NM_018088	NP_060558	Q86YD7	F90A1_HUMAN	hypothetical protein LOC55138	168							nucleic acid binding|zinc ion binding			ovary(1)	1														0.484848	144.992778	145.01259	48	51	CC		KEEP	---	---	---	---	capture		Kidney(36;0.0866)	Missense_Mutation	SNP	8266577	8266577	5876	12	C	T	T	27	27	FAM90A1	T	1	1
A2ML1	144568	broad.mit.edu	36	12	8894091	8894091	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:8894091C>T	uc001quz.2	+	c.2188C>T	c.(2188-2190)CGC>TGC	p.R730C	A2ML1_uc001qva.1_Missense_Mutation_p.R310C	NM_144670	NP_653271	B3KVV6	B3KVV6_HUMAN	alpha-2-macroglobulin-like 1	574						extracellular space	endopeptidase inhibitor activity			ovary(2)	2														0.089431	9.064338	50.930174	22	224	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8894091	8894091	6	12	C	T	T	23	23	A2ML1	T	1	1
DCN	1634	broad.mit.edu	36	12	90076371	90076371	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:90076371G>A	uc001tbs.1	-	c.371C>T	c.(370-372)GCA>GTA	p.A124V	DCN_uc001tbo.1_Intron|DCN_uc001tbp.1_Intron|DCN_uc001tbq.1_Intron|DCN_uc001tbr.1_Intron|DCN_uc001tbt.1_Missense_Mutation_p.A124V|DCN_uc001tbu.1_Missense_Mutation_p.A124V	NM_133503	NP_598010	P07585	PGS2_HUMAN	decorin isoform a preproprotein	124	LRR 3.				organ morphogenesis	extracellular space				central_nervous_system(2)|ovary(1)|lung(1)	4														0.426396	231.649668	232.583708	84	113	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	90076371	90076371	4468	12	G	A	A	46	46	DCN	A	2	2
ELK3	2004	broad.mit.edu	36	12	95165347	95165347	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:95165347G>A	uc001teo.1	+	c.706G>A	c.(706-708)GCC>ACC	p.A236T		NM_005230	NP_005221	P41970	ELK3_HUMAN	ELK3 protein	236					negative regulation of transcription, DNA-dependent|signal transduction	mitochondrion|nucleus	protein binding|purine-rich negative regulatory element binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	all_cancers(2;0.00173)													0.511628	322.3486	322.374291	110	105	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	95165347	95165347	5252	12	G	A	A	38	38	ELK3	A	1	1
TUBA3C	7278	broad.mit.edu	36	13	18649480	18649480	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:18649480G>A	uc009zzj.1	-	c.643C>T	c.(643-645)CGC>TGC	p.R215C		NM_006001	NP_525125	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	215					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)	3		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)												0.674877	428.715131	434.218878	137	66	GG		KEEP	---	---	---	---	capture		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)	Missense_Mutation	SNP	18649480	18649480	17301	13	G	A	A	38	38	TUBA3C	A	1	1
STOML3	161003	broad.mit.edu	36	13	38442347	38442347	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:38442347C>T	uc001uwx.1	-	c.491G>A	c.(490-492)CGA>CAA	p.R164Q		NM_145286	NP_660329	Q8TAV4	STML3_HUMAN	stomatin-like 3 isoform 1	164	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(1)	1		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)												0.748201	343.557624	351.331111	104	35	CC		KEEP	---	---	---	---	capture		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)	Missense_Mutation	SNP	38442347	38442347	15835	13	C	T	T	31	31	STOML3	T	1	1
KCNRG	283518	broad.mit.edu	36	13	49492390	49492390	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:49492390C>T	uc001vdu.1	+	c.618C>T	c.(616-618)AAC>AAT	p.N206N	DLEU2_uc001vdn.1_Intron|DLEU2_uc001vdo.1_Intron|KCNRG_uc001vdt.1_3'UTR	NM_173605	NP_775876	Q8N5I3	KCNRG_HUMAN	potassium channel regulator isoform 1	206						voltage-gated potassium channel complex	identical protein binding|voltage-gated potassium channel activity				0		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)												0.148148	13.96335	20.381457	8	46	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(99;1.48e-10)|COAD - Colon adenocarcinoma(199;0.204)	Silent	SNP	49492390	49492390	8392	13	C	T	T	19	19	KCNRG	T	1	1
MYCBP2	23077	broad.mit.edu	36	13	76534788	76534788	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:76534788C>T	uc001vkf.1	-	c.12604G>A	c.(12604-12606)GTA>ATA	p.V4202I	MYCBP2_uc001vke.1_Missense_Mutation_p.V819I|MYCBP2_uc010aev.1_Missense_Mutation_p.V3606I	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	4202					regulation of mitotic metaphase/anaphase transition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	anaphase-promoting complex	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|lung(2)|pancreas(1)	11		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)												0.808219	198.265899	204.743737	59	14	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(99;0.109)	Missense_Mutation	SNP	76534788	76534788	10413	13	C	T	T	19	19	MYCBP2	T	1	1
HS6ST3	266722	broad.mit.edu	36	13	96283388	96283388	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1787-01	TCGA-19-1787-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:96283388A>G	uc001vmw.1	+	c.1351A>G	c.(1351-1353)AAA>GAA	p.K451E		NM_153456	NP_703157	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	451	Lumenal (Potential).				carbohydrate biosynthetic process	integral to membrane	sulfotransferase activity			ovary(1)	1	all_neural(89;0.0878)|Medulloblastoma(90;0.163)													0.1875	50.313836	60.550897	21	91	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	96283388	96283388	7666	13	A	G	G	5	5	HS6ST3	G	4	4
FARP1	10160	broad.mit.edu	36	13	97836003	97836003	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:97836003G>A	uc001vnh.1	+	c.693G>A	c.(691-693)CCG>CCA	p.P231P	FARP1_uc001vnj.1_Silent_p.P231P	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1	231	FERM.				regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)													0.862857	522.04132	544.338736	151	24	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(86;0.233)		Silent	SNP	97836003	97836003	5912	13	G	A	A	39	39	FARP1	A	1	1
SLC15A1	6564	broad.mit.edu	36	13	98176656	98176656	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1787-01	TCGA-19-1787-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:98176656A>T	uc001vno.1	-	c.70T>A	c.(70-72)TTT>ATT	p.F24I	SLC15A1_uc001vnp.1_5'UTR	NM_005073	NP_005064	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide	24	Extracellular (Potential).				digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)									0.6875	142.419782	144.422061	44	20	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	98176656	98176656	14893	13	A	T	T	2	2	SLC15A1	T	4	4
RAGE	5891	broad.mit.edu	36	14	101765700	101765700	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:101765700C>T	uc001ylm.1	-	c.1029G>A	c.(1027-1029)CCG>CCA	p.P343P	RAGE_uc001ylh.2_Intron|RAGE_uc001yli.1_Non-coding_Transcript|RAGE_uc001ylj.1_Non-coding_Transcript|RAGE_uc001ylk.1_Non-coding_Transcript|RAGE_uc001yll.1_Non-coding_Transcript|RAGE_uc001yln.1_Silent_p.P161P	NM_014226	NP_055041	Q9UQ07	MOK_HUMAN	MAPK/MAK/MRK overlapping kinase	343					protein phosphorylation|signal transduction	Golgi apparatus	ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4									p.P343P(SW1116-Tumor)	361				0.671233	163.797117	165.694188	49	24	CC		KEEP	---	---	---	---	capture			Silent	SNP	101765700	101765700	13466	14	C	T	T	23	23	RAGE	T	1	1
AHNAK2	113146	broad.mit.edu	36	14	104483803	104483803	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:104483803G>A	uc010axc.1	-	c.9030C>T	c.(9028-9030)GCC>GCT	p.A3010A	AHNAK2_uc001ypx.2_Silent_p.A2910A	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3010						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)												0.740157	932.12204	952.053063	282	99	GG		KEEP	---	---	---	---	capture	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		Silent	SNP	104483803	104483803	418	14	G	A	A	39	39	AHNAK2	A	1	1
TGM1	7051	broad.mit.edu	36	14	23800824	23800824	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:23800824C>T	uc001wod.1	-	c.425G>A	c.(424-426)CGC>CAC	p.R142H		NM_000359	NP_000350	P22735	TGM1_HUMAN	transglutaminase 1	142			R -> H (in LI1).|R -> P (in ARCI-TGM1).|R -> C (in ARCI-TGM1).		cell envelope organization|keratinization|peptide cross-linking	cornified envelope|intrinsic to membrane	acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(2)|ovary(1)	3					L-Glutamine(DB00130)									0.72619	376.903107	384.654674	122	46	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(265;0.0186)	Missense_Mutation	SNP	23800824	23800824	16357	14	C	T	T	27	27	TGM1	T	1	1
TRIM9	114088	broad.mit.edu	36	14	50518304	50518304	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:50518304C>T	uc001wyy.2	-	c.2114G>A	c.(2113-2115)CGG>CAG	p.R705Q	TRIM9_uc001wyx.2_Missense_Mutation_p.R624Q	NM_052978	NP_443210	Q9C026	TRIM9_HUMAN	tripartite motif protein 9 isoform 2	624	B30.2/SPRY.				proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			lung(1)|skin(1)	2	all_epithelial(31;0.00418)|Breast(41;0.148)													0.736842	438.129296	446.806559	126	45	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	50518304	50518304	17099	14	C	T	T	23	23	TRIM9	T	1	1
ZFYVE26	23503	broad.mit.edu	36	14	67319625	67319625	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:67319625T>C	uc001xka.1	-	c.3997A>G	c.(3997-3999)AGC>GGC	p.S1333G	ZFYVE26_uc001xkc.2_Missense_Mutation_p.S1333G	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1333					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	phosphatidylinositol-3-phosphate binding|protein binding|zinc ion binding			ovary(9)|breast(2)	11														0.647799	362.467155	365.529044	103	56	TT		KEEP	---	---	---	---	capture		all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)	Missense_Mutation	SNP	67319625	67319625	18258	14	T	C	C	55	55	ZFYVE26	C	4	4
DCAF5	8816	broad.mit.edu	36	14	68590637	68590637	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:68590637C>T	uc001xkp.1	-	c.2519G>A	c.(2518-2520)CGT>CAT	p.R840H	DCAF5_uc001xkq.1_Missense_Mutation_p.R839H	NM_003861	NP_003852	Q96JK2	DCAF5_HUMAN	WD repeat domain 22	840				RLHPRP -> TLHLS (in Ref. 5; AAC08965).	protein ubiquitination	CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)	2														0.625	141.991672	142.981146	45	27	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	68590637	68590637	4444	14	C	T	T	19	19	DCAF5	T	1	1
SLC8A3	6547	broad.mit.edu	36	14	69703232	69703232	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:69703232C>T	uc001xly.1	-	c.1661G>A	c.(1660-1662)CGG>CAG	p.R554Q	SLC8A3_uc001xlw.1_Missense_Mutation_p.R554Q|SLC8A3_uc001xlx.1_Missense_Mutation_p.R554Q|SLC8A3_uc001xlz.1_Missense_Mutation_p.R554Q|SLC8A3_uc010ara.1_Non-coding_Transcript	NM_183002	NP_892114	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium	554	Calx-beta 2.|Cytoplasmic (Potential).				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			ovary(2)|breast(2)	4														0.776471	223.891541	229.865051	66	19	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)	Missense_Mutation	SNP	69703232	69703232	15205	14	C	T	T	23	23	SLC8A3	T	1	1
ZFYVE1	53349	broad.mit.edu	36	14	72512047	72512047	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:72512047C>T	uc001xnm.1	-	c.1771G>A	c.(1771-1773)GCC>ACC	p.A591T	ZFYVE1_uc001xnl.1_Missense_Mutation_p.A176T|ZFYVE1_uc010arj.1_Missense_Mutation_p.A577T	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1 isoform 1	591						endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding				0		all_lung(585;1.33e-09)												0.726415	245.313057	250.211838	77	29	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)	Missense_Mutation	SNP	72512047	72512047	18253	14	C	T	T	27	27	ZFYVE1	T	1	1
PAPLN	89932	broad.mit.edu	36	14	72797236	72797236	+	Silent	SNP	G	A	A	rs11850245	by-cluster,by-frequency,by-hapmap	TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:72797236G>A	uc001xnw.2	+	c.1971G>A	c.(1969-1971)TCG>TCA	p.S657S	PAPLN_uc010arm.1_5'UTR|PAPLN_uc010arn.1_5'Flank	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	684						proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2														0.774194	152.926848	157.206575	48	14	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)	Silent	SNP	72797236	72797236	11845	14	G	A	A	40	40	PAPLN	A	1	1
YLPM1	56252	broad.mit.edu	36	14	74300249	74300249	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:74300249C>G	uc001xqj.2	+	c.304C>G	c.(304-306)CCG>GCG	p.P102A		NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	102	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3														0.333333	6.567707	7.21552	7	14	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)	Missense_Mutation	SNP	74300249	74300249	18069	14	C	G	G	26	26	YLPM1	G	3	3
AHSA1	10598	broad.mit.edu	36	14	77005275	77005275	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:77005275G>A	uc001xtw.1	+	c.947G>A	c.(946-948)CGA>CAA	p.R316Q	AHSA1_uc001xtx.1_Non-coding_Transcript	NM_012111	NP_036243	O95433	AHSA1_HUMAN	activator of heat shock 90kDa protein ATPase	316					protein folding|response to stress	cytosol|endoplasmic reticulum	ATPase activator activity|chaperone binding				0														0.746667	549.479788	561.901663	168	57	GG		KEEP	---	---	---	---	capture	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)	Missense_Mutation	SNP	77005275	77005275	421	14	G	A	A	37	37	AHSA1	A	1	1
C14orf102	55051	broad.mit.edu	36	14	89815159	89815159	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:89815159C>T	uc001xyi.1	-	c.3369G>A	c.(3367-3369)AAG>AAA	p.K1123K	C14orf102_uc010atp.1_Silent_p.K628K|C14orf102_uc001xyj.1_Silent_p.K892K|C14orf102_uc001xyk.1_Silent_p.K315K	NM_017970	NP_950244	Q9H7Z3	CN102_HUMAN	hypothetical protein LOC55051 isoform 1	1123							protein binding			ovary(2)|lung(1)	3		all_cancers(154;0.118)												0.721254	727.044154	739.67733	207	80	CC		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(157;0.218)	Silent	SNP	89815159	89815159	1783	14	C	T	T	24	24	C14orf102	T	2	2
KIAA1409	57578	broad.mit.edu	36	14	93122740	93122740	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:93122740C>T	uc001ybv.1	+	c.2318C>T	c.(2317-2319)CCG>CTG	p.P773L	KIAA1409_uc001ybs.1_Missense_Mutation_p.P773L	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	950						integral to membrane				ovary(10)|large_intestine(3)	13		all_cancers(154;0.0354)|all_epithelial(191;0.216)								1186				0.704918	150.149324	152.441089	43	18	CC		KEEP	---	---	---	---	capture		Epithelial(152;0.188)	Missense_Mutation	SNP	93122740	93122740	8539	14	C	T	T	23	23	KIAA1409	T	1	1
KIAA1409	57578	broad.mit.edu	36	14	93189862	93189862	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:93189862G>A	uc001ybv.1	+	c.5757G>A	c.(5755-5757)GCG>GCA	p.A1919A	KIAA1409_uc001ybs.1_Silent_p.A1897A	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	2074						integral to membrane				ovary(10)|large_intestine(3)	13		all_cancers(154;0.0354)|all_epithelial(191;0.216)								1186				0.746269	1166.421139	1192.231879	350	119	GG		KEEP	---	---	---	---	capture		Epithelial(152;0.188)	Silent	SNP	93189862	93189862	8539	14	G	A	A	39	39	KIAA1409	A	1	1
SERPINA5	5104	broad.mit.edu	36	14	94123526	94123526	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:94123526G>A	uc001ydm.1	+	c.74G>A	c.(73-75)CGG>CAG	p.R25Q	SERPINA5_uc010ave.1_Missense_Mutation_p.R25Q|SERPINA5_uc001ydn.1_Missense_Mutation_p.R25Q	NM_000624	NP_000615	P05154	IPSP_HUMAN	serine (or cysteine) proteinase inhibitor, clade	25					fusion of sperm to egg plasma membrane|regulation of proteolysis|spermatogenesis	extracellular region|membrane|protein complex	acrosin binding|heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(2)	2					Drotrecogin alfa(DB00055)|Urokinase(DB00013)									0.094828	7.238162	26.35892	11	105	GG		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(157;0.21)	Missense_Mutation	SNP	94123526	94123526	14580	14	G	A	A	39	39	SERPINA5	A	1	1
BCL11B	64919	broad.mit.edu	36	14	98711229	98711229	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:98711229C>T	uc001yga.1	-	c.1697G>A	c.(1696-1698)CGC>CAC	p.R566H	BCL11B_uc001ygb.1_Missense_Mutation_p.R495H	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B isoform 1	566						nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)	9		Melanoma(154;0.0866)|all_epithelial(191;0.241)								98				0.733333	70.158036	71.632818	22	8	CC		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(157;0.103)	Missense_Mutation	SNP	98711229	98711229	1385	14	C	T	T	27	27	BCL11B	T	1	1
TUBGCP5	114791	broad.mit.edu	36	15	20415789	20415789	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:20415789G>A	uc001yuq.2	+	c.2306G>A	c.(2305-2307)CGT>CAT	p.R769H	TUBGCP5_uc001yur.2_Missense_Mutation_p.R769H	NM_001102610	NP_001096080	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	769					G2/M transition of mitotic cell cycle|microtubule nucleation	cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding				0		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)												0.686047	189.948145	192.595308	59	27	GG		KEEP	---	---	---	---	capture		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)	Missense_Mutation	SNP	20415789	20415789	17324	15	G	A	A	40	40	TUBGCP5	A	1	1
APBA2	321	broad.mit.edu	36	15	27184955	27184955	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:27184955G>A	uc001zck.1	+	c.1606G>A	c.(1606-1608)GAA>AAA	p.E536K	APBA2_uc010azj.1_Missense_Mutation_p.E524K|APBA2_uc001zcl.1_Missense_Mutation_p.E524K	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	536	PID.				nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)												0.689655	130.918402	132.776407	40	18	GG		KEEP	---	---	---	---	capture		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)	Missense_Mutation	SNP	27184955	27184955	767	15	G	A	A	37	37	APBA2	A	1	1
GCNT3	9245	broad.mit.edu	36	15	57697939	57697939	+	Silent	SNP	T	C	C			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr15:57697939T>C	uc002agd.1	+	c.210T>C	c.(208-210)TGT>TGC	p.C70C	GCNT3_uc002age.1_Silent_p.C70C|GCNT3_uc002agf.1_Silent_p.C70C|GCNT3_uc010bgf.1_Silent_p.C70C	NM_004751	NP_004742	O95395	GCNT3_HUMAN	glucosaminyl (N-acetyl) transferase 3, mucin	70	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane|membrane fraction	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)	2														0.705394	647.250993	656.351401	170	71	TT		KEEP	---	---	---	---	capture			Silent	SNP	57697939	57697939	6568	15	T	C	C	60	60	GCNT3	C	4	4
PIAS1	8554	broad.mit.edu	36	15	66267047	66267047	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:66267047G>A	uc002aqz.1	+	c.1776G>A	c.(1774-1776)CAG>CAA	p.Q592Q	PIAS1_uc002ara.1_Silent_p.Q200Q	NM_016166	NP_057250	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	592	Ser-rich.|4 X 4 AA repeats of N-T-S-L.				androgen receptor signaling pathway|interferon-gamma-mediated signaling pathway|JAK-STAT cascade|positive regulation of protein sumoylation|positive regulation of transcription, DNA-dependent|regulation of interferon-gamma-mediated signaling pathway|transcription, DNA-dependent	nuclear speck	androgen receptor binding|DNA binding|enzyme binding|SUMO ligase activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)	1														0.7375	193.652908	197.731551	59	21	GG		KEEP	---	---	---	---	capture			Silent	SNP	66267047	66267047	12299	15	G	A	A	36	36	PIAS1	A	2	2
ITGA11	22801	broad.mit.edu	36	15	66436570	66436570	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:66436570C>T	uc010bib.1	-	c.722G>A	c.(721-723)CGG>CAG	p.R241Q	ITGA11_uc002ari.1_Missense_Mutation_p.R241Q	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor	241	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)									0.684211	134.644414	136.364152	39	18	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66436570	66436570	8178	15	C	T	T	23	23	ITGA11	T	1	1
ISLR2	57611	broad.mit.edu	36	15	72212211	72212211	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:72212211G>A	uc002axd.1	+	c.63G>A	c.(61-63)CCG>CCA	p.P21P	ISLR2_uc002axe.1_Silent_p.P21P|ISLR2_uc010bjf.1_Silent_p.P21P|ISLR2_uc002axf.1_Silent_p.P21P|ISLR2_uc010bjg.1_Silent_p.P21P	NM_020851	NP_065902	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing	21	Extracellular (Potential).|LRRNT.				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane					0														0.695122	181.053484	183.826599	57	25	GG		KEEP	---	---	---	---	capture			Silent	SNP	72212211	72212211	8163	15	G	A	A	39	39	ISLR2	A	1	1
PSTPIP1	9051	broad.mit.edu	36	15	75097573	75097573	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:75097573C>T	uc002bcf.2	+	c.66C>T	c.(64-66)TAC>TAT	p.Y22Y	PSTPIP1_uc010bkt.1_Non-coding_Transcript|PSTPIP1_uc010bku.1_Silent_p.Y13Y|PSTPIP1_uc002bcg.2_Silent_p.Y22Y|PSTPIP1_uc010bkv.1_Non-coding_Transcript|PSTPIP1_uc010bkw.1_Silent_p.Y22Y	NM_003978	NP_003969	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting	22	FCH.				cell adhesion|signal transduction	cleavage furrow|lamellipodium|perinuclear region of cytoplasm	catalytic activity			ovary(1)	1														0.666667	18.852163	19.073296	6	3	CC		KEEP	---	---	---	---	capture			Silent	SNP	75097573	75097573	13175	15	C	T	T	19	19	PSTPIP1	T	1	1
LINGO1	84894	broad.mit.edu	36	15	75694900	75694900	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:75694900G>A	uc002bct.1	-	c.404C>T	c.(403-405)CCG>CTG	p.P135L	LINGO1_uc002bcu.1_Missense_Mutation_p.P129L	NM_032808	NP_116197	Q96FE5	LIGO1_HUMAN	leucine-rich repeat neuronal 6A	135	Extracellular (Potential).|LRR 3.				negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane		p.P129L(1)		ovary(1)|lung(1)	2														0.150943	15.864554	22.051158	8	45	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75694900	75694900	9141	15	G	A	A	39	39	LINGO1	A	1	1
CHRNB4	1143	broad.mit.edu	36	15	76708620	76708620	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:76708620G>A	uc002bed.1	-	c.1082C>T	c.(1081-1083)CCG>CTG	p.P361L	CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_Missense_Mutation_p.P179L	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	361	Cytoplasmic (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0										152				0.660377	113.670722	114.905649	35	18	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	76708620	76708620	3527	15	G	A	A	39	39	CHRNB4	A	1	1
CHRNB4	1143	broad.mit.edu	36	15	76709248	76709248	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:76709248C>T	uc002bed.1	-	c.454G>A	c.(454-456)GCC>ACC	p.A152T	CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_5'UTR	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	152	Extracellular (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0										152				0.745098	114.559924	117.334812	38	13	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	76709248	76709248	3527	15	C	T	T	27	27	CHRNB4	T	1	1
ZNF592	9640	broad.mit.edu	36	15	83146136	83146136	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:83146136C>T	uc002bld.1	+	c.3312C>T	c.(3310-3312)GAC>GAT	p.D1104D		NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	1104					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4														0.63871	312.625241	315.241774	99	56	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(143;0.0587)		Silent	SNP	83146136	83146136	18617	15	C	T	T	19	19	ZNF592	T	1	1
C15orf42	90381	broad.mit.edu	36	15	87927088	87927088	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:87927088G>A	uc002boe.1	+	c.822G>A	c.(820-822)CCG>CCA	p.P274P		NM_152259	NP_689472	Q7Z2Z1	TICRR_HUMAN	leucine-rich repeat kinase 1	274					cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|response to ionizing radiation|S-M checkpoint	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)	6	Lung NSC(78;0.0237)|all_lung(78;0.0478)													0.782946	333.939446	343.462391	101	28	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(143;0.128)		Silent	SNP	87927088	87927088	1846	15	G	A	A	40	40	C15orf42	A	1	1
IDH2	3418	broad.mit.edu	36	15	88429063	88429063	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:88429063G>A	uc002box.1	-	c.1260C>T	c.(1258-1260)CAC>CAT	p.H420H	IDH2_uc010bnu.1_Intron	NM_002168	NP_002159	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+),	420					2-oxoglutarate metabolic process|glyoxylate cycle|isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding			haematopoietic_and_lymphoid_tissue(445)|central_nervous_system(77)|skin(3)	525	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)									387				0.762431	447.510938	458.893307	138	43	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)		Silent	SNP	88429063	88429063	7795	15	G	A	A	40	40	IDH2	A	1	1
IGF1R	3480	broad.mit.edu	36	15	97282913	97282913	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:97282913C>T	uc002bul.1	+	c.2215C>T	c.(2215-2217)CGG>TGG	p.R739W	IGF1R_uc010bon.1_Missense_Mutation_p.R739W|IGF1R_uc010boo.1_5'Flank	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor	739			R -> Q (in IGF1RES; leads to failure of processing of the IGF1R proreceptor to mature IGF1R).		anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	integral to plasma membrane|microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)				Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)				p.R739W(DND41-Tumor)	471				0.666667	94.359699	95.465497	30	15	CC		KEEP	---	---	---	---	capture	Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Missense_Mutation	SNP	97282913	97282913	7872	15	C	T	T	27	27	IGF1R	T	1	1
CIITA	4261	broad.mit.edu	36	16	10923598	10923598	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:10923598C>T	uc002daj.2	+	c.3226C>T	c.(3226-3228)CGG>TGG	p.R1076W	CIITA_uc002dai.2_Missense_Mutation_p.R1075W|CIITA_uc002dak.2_Missense_Mutation_p.R491W	NM_000246	NP_000237	P33076	C2TA_HUMAN	class II transactivator	1075	LRR 4.				interferon-gamma-mediated signaling pathway|negative regulation of collagen biosynthetic process|negative regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of MHC class II biosynthetic process|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|promoter binding|protein C-terminus binding|protein complex binding|RNA polymerase II transcription factor activity|transcription activator activity|transcription coactivator activity|transcription repressor activity			central_nervous_system(1)	1										532				0.688312	517.892278	525.185698	159	72	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10923598	10923598	3562	16	C	T	T	23	23	CIITA	T	1	1
CACNA1H	8912	broad.mit.edu	36	16	1210465	1210465	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:1210465G>A	uc002cks.1	+	c.6532G>A	c.(6532-6534)GCT>ACT	p.A2178T	CACNA1H_uc002ckt.1_Missense_Mutation_p.A2172T|CACNA1H_uc002cku.1_Missense_Mutation_p.A873T|CACNA1H_uc010brj.1_Missense_Mutation_p.A889T|CACNA1H_uc002ckv.1_Missense_Mutation_p.A867T	NM_021098	NP_066921	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type,	2178	Cytoplasmic (Potential).				axon guidance|muscle contraction|muscle organ development|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(2)	2		Hepatocellular(780;0.00369)			Flunarizine(DB04841)|Mibefradil(DB01388)									0.731183	216.733328	221.221123	68	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1210465	1210465	2661	16	G	A	A	38	38	CACNA1H	A	1	1
TELO2	9894	broad.mit.edu	36	16	1490587	1490587	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:1490587G>A	uc002cly.1	+	c.1167G>A	c.(1165-1167)GCG>GCA	p.A389A		NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog	389						chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)												0.647059	69.958575	70.60762	22	12	GG		KEEP	---	---	---	---	capture			Silent	SNP	1490587	1490587	16284	16	G	A	A	39	39	TELO2	A	1	1
MAPK8IP3	23162	broad.mit.edu	36	16	1752884	1752884	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:1752884C>T	uc002cmk.1	+	c.1771C>T	c.(1771-1773)CGC>TGC	p.R591C	MAPK8IP3_uc002cml.1_Missense_Mutation_p.R585C	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	591					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			central_nervous_system(1)	1														0.107143	7.148023	24.323926	12	100	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1752884	1752884	9669	16	C	T	T	27	27	MAPK8IP3	T	1	1
C16orf88	400506	broad.mit.edu	36	16	19625795	19625795	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:19625795C>T	uc002dgq.1	-	c.1315G>A	c.(1315-1317)GCC>ACC	p.A439T		NM_001012991	NP_001013009	Q1ED39	CP088_HUMAN	hypothetical protein LOC400506	439	Interaction with ZFP106 (By similarity).					nucleolus					0														0.698276	473.32048	481.478445	162	70	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19625795	19625795	1894	16	C	T	T	27	27	C16orf88	T	1	1
IQCK	124152	broad.mit.edu	36	16	19652525	19652525	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:19652525C>T	uc002dgr.1	+	c.251C>T	c.(250-252)GCG>GTG	p.A84V	IQCK_uc002dgs.1_Non-coding_Transcript|IQCK_uc010bwc.1_Non-coding_Transcript	NM_153208	NP_694940	Q8N0W5	IQCK_HUMAN	IQ motif containing K	84											0														0.74359	477.058521	487.548263	145	50	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19652525	19652525	8116	16	C	T	T	27	27	IQCK	T	1	1
GPRC5B	51704	broad.mit.edu	36	16	19791141	19791141	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:19791141G>A	uc002dgt.1	-	c.528C>T	c.(526-528)ATC>ATT	p.I176I		NM_016235	NP_057319	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, family C, group 5,	176	Helical; Name=4; (Potential).										0														0.686441	258.649924	262.281352	81	37	GG		KEEP	---	---	---	---	capture			Silent	SNP	19791141	19791141	7001	16	G	A	A	37	37	GPRC5B	A	1	1
ACSM3	6296	broad.mit.edu	36	16	20715211	20715211	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:20715211G>A	uc002dhr.1	+	c.1573G>A	c.(1573-1575)GTT>ATT	p.V525I	ERI2_uc002dhs.1_Intron|ERI2_uc002dhu.1_3'UTR|ERI2_uc010bwh.1_3'UTR|ERI2_uc002dht.2_3'UTR	NM_005622	NP_005613	Q53FZ2	ACSM3_HUMAN	SA hypertension-associated homolog isoform 1	525					regulation of blood pressure	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			ovary(1)	1														0.730769	127.07225	129.571303	38	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20715211	20715211	186	16	G	A	A	40	40	ACSM3	A	1	1
PKD1	5310	broad.mit.edu	36	16	2099535	2099535	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:2099535C>T	uc002cos.1	-	c.5634G>A	c.(5632-5634)ACG>ACA	p.T1878T	PKD1_uc002cot.1_Silent_p.T1878T	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	1878	PKD 14.|Extracellular (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(1)	1														0.730769	59.133133	60.383091	19	7	CC		KEEP	---	---	---	---	capture			Silent	SNP	2099535	2099535	12387	16	C	T	T	19	19	PKD1	T	1	1
TMEM159	57146	broad.mit.edu	36	16	21089378	21089378	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:21089378C>T	uc002dif.2	+	c.216C>T	c.(214-216)ATC>ATT	p.I72I	TMEM159_uc002dig.2_Non-coding_Transcript|TMEM159_uc002dih.2_Silent_p.I72I	NM_020422	NP_065155	Q96B96	TM159_HUMAN	transmembrane protein 159	72	Helical; (Potential).					integral to membrane				ovary(1)	1														0.693431	309.278197	313.858174	95	42	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(48;0.0972)	Silent	SNP	21089378	21089378	16608	16	C	T	T	31	31	TMEM159	T	1	1
OTOA	146183	broad.mit.edu	36	16	21679305	21679305	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:21679305G>A	uc002djh.1	+	c.3363G>A	c.(3361-3363)TCG>TCA	p.S1121S	OTOA_uc002dji.1_Silent_p.S797S|OTOA_uc010bwx.1_Silent_p.S343S	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1	1135					sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)	1														0.517647	138.400737	138.42366	44	41	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(48;0.0414)	Silent	SNP	21679305	21679305	11714	16	G	A	A	40	40	OTOA	A	1	1
ZG16B	124220	broad.mit.edu	36	16	2820432	2820432	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:2820432C>T	uc002cru.1	+	c.97C>T	c.(97-99)CGG>TGG	p.R33W		NM_145252	NP_660295	Q96DA0	ZG16B_HUMAN	hypothetical protein LOC124220	33						extracellular region	sugar binding			ovary(1)	1														0.8	68.113966	70.206632	20	5	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2820432	2820432	18263	16	C	T	T	23	23	ZG16B	T	1	1
RABEP2	79874	broad.mit.edu	36	16	28829999	28829999	+	Silent	SNP	G	C	C			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:28829999G>C	uc002drq.1	-	c.897C>G	c.(895-897)GGC>GGG	p.G299G	RABEP2_uc010byn.1_Intron|RABEP2_uc002drr.2_Silent_p.G299G	NM_024816	NP_079092	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	299	Potential.				endocytosis|protein transport	early endosome	growth factor activity|GTPase activator activity			ovary(1)|breast(1)	2						Pancreas(66;639 1284 10093 31061 49099)								0.210526	7.037744	8.477699	4	15	GG		KEEP	---	---	---	---	capture			Silent	SNP	28829999	28829999	13421	16	G	C	C	42	42	RABEP2	C	3	3
LAT	27040	broad.mit.edu	36	16	28905513	28905513	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:28905513C>T	uc002dsd.1	+	c.462C>T	c.(460-462)GAC>GAT	p.D154D	LAT_uc002dse.1_Silent_p.D125D|LAT_uc002dsb.1_Silent_p.D125D|LAT_uc002dsc.1_Silent_p.D124D	NM_014387	NP_055202	O43561	LAT_HUMAN	linker for activation of T cells isoform a	154	Cytoplasmic (Potential).				calcium-mediated signaling|integrin-mediated signaling pathway|mast cell degranulation|platelet activation|Ras protein signal transduction|regulation of T cell activation|T cell receptor signaling pathway	immunological synapse|integral to membrane|membrane raft	SH3/SH2 adaptor activity				0		Hepatocellular(780;0.244)												0.644068	122.067765	123.14923	38	21	CC		KEEP	---	---	---	---	capture			Silent	SNP	28905513	28905513	8967	16	C	T	T	19	19	LAT	T	1	1
ZNF48	197407	broad.mit.edu	36	16	30317258	30317258	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:30317258G>A	uc002dya.1	+	c.1186G>A	c.(1186-1188)GCT>ACT	p.A396T	ZNF48_uc002dxz.1_Missense_Mutation_p.A273T	NM_152652	NP_689865	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	396	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0														0.753846	145.97608	149.780655	49	16	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30317258	30317258	18528	16	G	A	A	38	38	ZNF48	A	1	1
PRSS36	146547	broad.mit.edu	36	16	31059476	31059476	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:31059476G>A	uc002ebd.1	-	c.2005C>T	c.(2005-2007)CGG>TGG	p.R669W		NM_173502	NP_775773	Q5K4E3	POLS2_HUMAN	protease, serine, 36	669	Peptidase S1 3.				proteolysis	cytoplasm|proteinaceous extracellular matrix	serine-type endopeptidase activity			ovary(1)	1														0.767857	139.735245	143.40878	43	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31059476	31059476	13075	16	G	A	A	39	39	PRSS36	A	1	1
TRIM72	493829	broad.mit.edu	36	16	31138317	31138317	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:31138317C>A	uc002ebn.1	+	c.693C>A	c.(691-693)GAC>GAA	p.D231E	PYDC1_uc002ebo.1_5'Flank|PYDC1_uc010cal.1_5'Flank	NM_001008274	NP_001008275	Q6ZMU5	TRI72_HUMAN	tripartite motif-containing 72	231					exocytosis|muscle organ development|muscle system process|plasma membrane repair|protein homooligomerization	cytoplasmic vesicle membrane|sarcolemma	phosphatidylserine binding|zinc ion binding				0														0.4	14.985022	15.217081	10	15	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31138317	31138317	17094	16	C	A	A	17	17	TRIM72	A	3	3
CREBBP	1387	broad.mit.edu	36	16	3721356	3721356	+	Silent	SNP	G	A	A	rs62037853	unknown	TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:3721356G>A	uc002cvv.1	-	c.5010C>T	c.(5008-5010)CTC>CTT	p.L1670L	CREBBP_uc002cvw.1_Silent_p.L1632L	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1670	Interaction with TRERF1.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			ovary(6)|skin(2)|pancreas(1)|lung(1)	10		Ovarian(90;0.0266)								748				0.72	57.959247	59.047192	18	7	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)	Silent	SNP	3721356	3721356	4000	16	G	A	A	37	37	CREBBP	A	1	1
SRL	6345	broad.mit.edu	36	16	4182171	4182171	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:4182171C>T	uc002cvz.2	-	c.1406G>A	c.(1405-1407)CGC>CAC	p.R469H	SRL_uc002cvy.2_Non-coding_Transcript	NM_001098814	NP_001092284	Q86TD4	SRCA_HUMAN	sarcalumenin	928						sarcoplasmic reticulum lumen	GTP binding|GTPase activity			ovary(3)	3														0.676259	300.70265	304.547651	94	45	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4182171	4182171	15664	16	C	T	T	27	27	SRL	T	1	1
CCL22	6367	broad.mit.edu	36	16	55951921	55951921	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:55951921G>A	uc002elh.1	+	c.145G>A	c.(145-147)GTG>ATG	p.V49M		NM_002990	NP_002981	O00626	CCL22_HUMAN	small inducible cytokine A22 precursor	49					cell-cell signaling|chemotaxis|immune response|inflammatory response|response to virus|signal transduction	extracellular space	chemokine activity				0														0.766355	252.382016	259.329167	82	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55951921	55951921	3019	16	G	A	A	40	40	CCL22	A	1	1
ZNF319	57567	broad.mit.edu	36	16	56588996	56588996	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:56588996G>A	uc002emx.1	-	c.675C>T	c.(673-675)ACC>ACT	p.T225T	ZNF319_uc010cdi.1_Silent_p.T225T	NM_020807	NP_065858	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	225					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0														0.78866	505.706113	520.640321	153	41	GG		KEEP	---	---	---	---	capture			Silent	SNP	56588996	56588996	18429	16	G	A	A	39	39	ZNF319	A	1	1
WDR90	197335	broad.mit.edu	36	16	649014	649014	+	Splice_Site_SNP	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:649014C>T	uc002cii.1	+	c.3011_splice	c.e24+2	p.S1004_splice	WDR90_uc002cij.1_Intron|WDR90_uc002cil.1_Splice_Site_SNP|WDR90_uc002cin.1_5'Flank|WDR90_uc002cik.1_Splice_Site_SNP_p.S531_splice|WDR90_uc002cim.1_Splice_Site_SNP_p.S178_splice	NM_145294	NP_660337			WD repeat domain 90											ovary(1)	1		Hepatocellular(780;0.0218)												0.669291	248.879969	252.09554	85	42	CC		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	649014	649014	17911	16	C	T	T	25	25	WDR90	T	5	2
CES3	23491	broad.mit.edu	36	16	65561149	65561149	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:65561149G>A	uc002eqt.1	+	c.1129G>A	c.(1129-1131)GTC>ATC	p.V377I	CES3_uc010cdz.1_Missense_Mutation_p.V377I|CES3_uc010cea.1_Intron|CES3_uc002equ.1_Missense_Mutation_p.V8I	NM_024922	NP_079198	Q6UWW8	EST3_HUMAN	carboxylesterase 3	377					regulation of synaptic transmission	endoplasmic reticulum lumen	methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity			ovary(3)|central_nervous_system(2)	5		Ovarian(137;0.0563)												0.791667	60.634989	62.524201	19	5	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)	Missense_Mutation	SNP	65561149	65561149	3404	16	G	A	A	40	40	CES3	A	1	1
C16orf70	80262	broad.mit.edu	36	16	65725629	65725629	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:65725629C>T	uc002erc.1	+	c.508C>T	c.(508-510)CGA>TGA	p.R170*	C16orf70_uc002erd.1_Nonsense_Mutation_p.R170*|C16orf70_uc002ere.1_Nonsense_Mutation_p.R245*	NM_025187	NP_079463	Q9BSU1	CP070_HUMAN	lin-10	170										ovary(1)	1		Ovarian(137;0.192)												0.774648	353.51257	363.348575	110	32	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)	Nonsense_Mutation	SNP	65725629	65725629	1882	16	C	T	T	19	19	C16orf70	T	5	1
ESRP2	80004	broad.mit.edu	36	16	66823432	66823432	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:66823432G>A	uc010cfa.1	-	c.1103C>T	c.(1102-1104)TCG>TTG	p.S368L	ESRP2_uc002evp.1_Non-coding_Transcript|ESRP2_uc002evq.1_Missense_Mutation_p.S358L	NM_024939	NP_079215	Q9H6T0	ESRP2_HUMAN	RNA binding motif protein 35B	368	RRM 2.				mRNA processing|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding|nucleotide binding			ovary(1)	1														0.773585	130.296121	133.936127	41	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66823432	66823432	5452	16	G	A	A	37	37	ESRP2	A	1	1
PRMT7	54496	broad.mit.edu	36	16	66930852	66930852	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:66930852G>A	uc002evy.1	+	c.631G>A	c.(631-633)GTC>ATC	p.V211I	PRMT7_uc002evx.1_Missense_Mutation_p.V211I|PRMT7_uc002evz.1_Missense_Mutation_p.V57I	NM_019023	NP_061896	Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	211					cell differentiation|DNA methylation involved in gamete generation|regulation of gene expression by genetic imprinting|regulation of protein binding|regulation of transcription, DNA-dependent|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	[myelin basic protein]-arginine N-methyltransferase activity|histone binding|histone methyltransferase activity (H4-R3 specific)|protein-arginine omega-N monomethyltransferase activity|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding				0		Ovarian(137;0.192)												0.738095	296.11812	302.57862	93	33	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)	Missense_Mutation	SNP	66930852	66930852	12984	16	G	A	A	40	40	PRMT7	A	1	1
HYDIN	54768	broad.mit.edu	36	16	69500175	69500175	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:69500175G>A	uc002ezr.1	-	c.8092C>T	c.(8092-8094)CGT>TGT	p.R2698C	HYDIN_uc002ezs.1_Missense_Mutation_p.R230C	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	2699										ovary(1)	1		Ovarian(137;0.0654)												0.346847	218.01459	222.608332	77	145	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69500175	69500175	7767	16	G	A	A	38	38	HYDIN	A	1	1
CA5A	763	broad.mit.edu	36	16	86518023	86518023	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:86518023C>T	uc002fkn.1	-	c.172G>A	c.(172-174)GTG>ATG	p.V58M		NM_001739	NP_001730	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial precursor	58					one-carbon metabolic process	mitochondrial matrix	carbonate dehydratase activity|zinc ion binding				0														0.65	42.492875	42.900299	13	7	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(80;0.0513)	Missense_Mutation	SNP	86518023	86518023	2635	16	C	T	T	19	19	CA5A	T	1	1
SPATA2L	124044	broad.mit.edu	36	16	88291468	88291468	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:88291468C>T	uc002foj.1	-	c.1050G>A	c.(1048-1050)TCG>TCA	p.S350S	SPATA2L_uc002fok.1_Intron	NM_152339	NP_689552	Q8IUW3	SPA2L_HUMAN	spermatogenesis associated 2-like	350											0		Lung NSC(15;0.00043)|all_lung(18;0.000665)|all_hematologic(23;0.0355)												0.702703	170.71332	173.428965	52	22	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(80;0.0272)	Silent	SNP	88291468	88291468	15518	16	C	T	T	23	23	SPATA2L	T	1	1
SPIRE2	84501	broad.mit.edu	36	16	88457414	88457414	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:88457414G>A	uc002foz.1	+	c.1605G>A	c.(1603-1605)GCG>GCA	p.A535A	SPIRE2_uc010ciw.1_Silent_p.A535A|SPIRE2_uc002fpa.1_Silent_p.A487A|SPIRE2_uc010cix.1_Silent_p.A402A	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2	535	Spir-box.				transport	cytoplasm|cytoskeleton	actin binding|zinc ion binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)												0.790323	159.801868	164.645452	49	13	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(80;0.0286)	Silent	SNP	88457414	88457414	15585	16	G	A	A	38	38	SPIRE2	A	1	1
GRIN2A	2903	broad.mit.edu	36	16	9851281	9851281	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:9851281G>A	uc002czp.1	-	c.1161C>T	c.(1159-1161)CAC>CAT	p.H387H	GRIN2A_uc002czq.1_Silent_p.H387H|GRIN2A_uc002czr.2_Silent_p.H387H	NM_000833	NP_000824	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	387	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)					324				0.745455	259.091704	265.104367	82	28	GG		KEEP	---	---	---	---	capture			Silent	SNP	9851281	9851281	7058	16	G	A	A	40	40	GRIN2A	A	1	1
MYH3	4621	broad.mit.edu	36	17	10473669	10473669	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:10473669G>A	uc002gmq.1	-	c.5766C>T	c.(5764-5766)CGC>CGT	p.R1922R		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1922	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(1)|pancreas(1)	6														0.744444	214.846346	219.71679	67	23	GG		KEEP	---	---	---	---	capture			Silent	SNP	10473669	10473669	10431	17	G	A	A	38	38	MYH3	A	1	1
INPP5K	51763	broad.mit.edu	36	17	1348094	1348094	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:1348094G>A	uc002fsr.1	-	c.849C>T	c.(847-849)CCC>CCT	p.P283P	INPP5K_uc002fsq.1_Silent_p.P207P|INPP5K_uc002fss.1_Silent_p.P207P|INPP5K_uc010cjr.1_Silent_p.P207P	NM_016532	NP_570122	Q9BT40	INP5K_HUMAN	inositol polyphosphate-5-phosphatase K isoform	283	Catalytic (Potential).				actin cytoskeleton organization	cytosol|endoplasmic reticulum|membrane fraction|neuron projection|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol bisphosphate phosphatase activity|inositol bisphosphate phosphatase activity|inositol trisphosphate phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|lipid phosphatase activity|protein binding				0														0.753012	392.810323	402.474203	125	41	GG		KEEP	---	---	---	---	capture			Silent	SNP	1348094	1348094	8061	17	G	A	A	39	39	INPP5K	A	1	1
FLCN	201163	broad.mit.edu	36	17	17059324	17059324	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:17059324G>A	uc002gra.2	-	c.1332C>T	c.(1330-1332)GCC>GCT	p.A444A	PLD6_uc010cpn.1_Non-coding_Transcript	NM_144997	NP_659434	Q8NFG4	FLCN_HUMAN	folliculin isoform 1	444			A -> S (in a primary clear-cell renal cell carcinoma; somatic mutation).		regulation of protein phosphorylation	cytoplasm|nucleus|plasma membrane	protein binding			thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	3										287				0.701587	751.479046	762.917033	221	94	GG		KEEP	---	---	---	---	capture			Silent	SNP	17059324	17059324	6159	17	G	A	A	39	39	FLCN	A	1	1
TOM1L2	146691	broad.mit.edu	36	17	17694980	17694980	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:17694980C>T	uc002grz.2	-	c.1290G>A	c.(1288-1290)GCG>GCA	p.A430A	TOM1L2_uc002grv.2_Silent_p.A163A|TOM1L2_uc002gry.2_Silent_p.A380A	NM_001082968	NP_001076437	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 isoform 3	430					intracellular protein transport	intracellular					0	all_neural(463;0.228)					Melanoma(192;2505 2909 14455 25269)								0.792683	212.444353	219.029887	65	17	CC		KEEP	---	---	---	---	capture			Silent	SNP	17694980	17694980	16894	17	C	T	T	27	27	TOM1L2	T	1	1
MYO15A	51168	broad.mit.edu	36	17	18017872	18017872	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:18017872G>A	uc010cpt.1	+	c.10403G>A	c.(10402-10404)CGG>CAG	p.R3468Q	MYO15A_uc010cpu.1_Missense_Mutation_p.R3468Q|MYO15A_uc002gsl.1_Silent_p.A500A|MYO15A_uc010cpv.1_Intron	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	3468	Tail.|FERM.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)|skin(1)	6	all_neural(463;0.228)													0.703704	251.959706	255.994634	76	32	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18017872	18017872	10458	17	G	A	A	39	39	MYO15A	A	1	1
ALDH3A2	224	broad.mit.edu	36	17	19500312	19500312	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:19500312G>A	uc002gwa.1	+	c.513G>A	c.(511-513)ACG>ACA	p.T171T	ALDH3A2_uc002gwb.1_Silent_p.T171T|ALDH3A2_uc010cqr.1_5'UTR|ALDH3A2_uc002gwc.1_Silent_p.T171T|ALDH3A2_uc002gwd.1_5'UTR	NM_001031806	NP_001026976	P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3A2 isoform 1	171	Cytoplasmic.				cellular aldehyde metabolic process|central nervous system development|epidermis development|lipid metabolic process|oxidation-reduction process|peripheral nervous system development	endoplasmic reticulum membrane|integral to membrane	3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity			ovary(2)	2	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)				NADH(DB00157)									0.815385	180.712036	186.779484	53	12	GG		KEEP	---	---	---	---	capture			Silent	SNP	19500312	19500312	501	17	G	A	A	39	39	ALDH3A2	A	1	1
LGALS9	3965	broad.mit.edu	36	17	22993432	22993432	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:22993432C>T	uc002gzp.1	+	c.375C>T	c.(373-375)CGC>CGT	p.R125R	LGALS9_uc002gzq.1_Silent_p.R125R|LGALS9_uc002gzr.1_Silent_p.R68R|LGALS9_uc002gzs.1_Silent_p.R125R	NM_009587	NP_033665	O00182	LEG9_HUMAN	galectin-9 isoform long	125	Galectin 1.				positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|extracellular region	galactose binding|signal transducer activity				0	Lung NSC(42;0.0103)					Melanoma(106;677 1527 28724 29571 46552)|Ovarian(193;263 2088 2118 29005 43023)								0.690476	91.83495	93.244469	29	13	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(3;0.0141)	UCEC - Uterine corpus endometrioid carcinoma (53;0.155)	Silent	SNP	22993432	22993432	9074	17	C	T	T	27	27	LGALS9	T	1	1
MYO18A	399687	broad.mit.edu	36	17	24472720	24472720	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:24472720G>A	uc002hdt.1	-	c.1342C>T	c.(1342-1344)CGT>TGT	p.R448C	MYO18A_uc010csa.1_Missense_Mutation_p.R448C|MYO18A_uc002hdu.1_Missense_Mutation_p.R448C|MYO18A_uc002hds.1_5'UTR	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	448	Myosin head-like.				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0						Esophageal Squamous(182;472 2015 7001 15270 22562)								0.529412	27.973303	27.985968	9	8	GG		KEEP	---	---	---	---	capture	Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		Missense_Mutation	SNP	24472720	24472720	10460	17	G	A	A	39	39	MYO18A	A	1	1
KIAA0664	23277	broad.mit.edu	36	17	2542448	2542448	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:2542448T>C	uc002fuy.1	-	c.3400A>G	c.(3400-3402)AGC>GGC	p.S1134G	KIAA0664_uc002fux.1_Missense_Mutation_p.S1067G|KIAA0664_uc010ckc.1_Missense_Mutation_p.S120G	NM_015229	NP_056044	O75153	K0664_HUMAN	hypothetical protein LOC23277	1134	TPR 3.			S -> N (in Ref. 2; CAH10532).			binding			breast(2)	2														0.806452	89.692292	92.409042	25	6	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2542448	2542448	8496	17	T	C	C	55	55	KIAA0664	C	4	4
PSMD3	5709	broad.mit.edu	36	17	35394124	35394124	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:35394124C>A	uc002htn.1	+	c.272C>A	c.(271-273)CCG>CAG	p.P91Q		NM_002809	NP_002800	O43242	PSMD3_HUMAN	proteasome 26S non-ATPase subunit 3	91					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	enzyme regulator activity|protein binding			ovary(1)|pancreas(1)	2	Colorectal(19;0.000442)					Ovarian(186;531 2051 6385 19668 48409)								0.172414	20.013808	25.894789	10	48	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35394124	35394124	13152	17	C	A	A	23	23	PSMD3	A	3	3
BRCA1	672	broad.mit.edu	36	17	38499587	38499587	+	Missense_Mutation	SNP	C	T	T	rs28897677	by-cluster	TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:38499587C>T	uc002ict.1	-	c.1487G>A	c.(1486-1488)CGT>CAT	p.R496H	BRCA1_uc002ico.1_Missense_Mutation_p.R496H|BRCA1_uc002icp.2_Missense_Mutation_p.R425H|BRCA1_uc002icq.1_Missense_Mutation_p.R496H|BRCA1_uc002icr.1_Missense_Mutation_p.R496H|BRCA1_uc002ics.1_Missense_Mutation_p.R200H|BRCA1_uc002icu.1_Intron|BRCA1_uc010cyx.1_Missense_Mutation_p.R449H|BRCA1_uc002icw.1_Missense_Mutation_p.R496H|BRCA1_uc002icv.1_Intron|BRCA1_uc002icx.1_Intron|BRCA1_uc002icy.1_Missense_Mutation_p.R455H|BRCA1_uc002icz.1_Intron|BRCA1_uc002ida.1_Intron|BRCA1_uc002idb.1_Missense_Mutation_p.R496H|BRCA1_uc002idc.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.R496H|BRCA1_uc002ide.1_Missense_Mutation_p.R327H|BRCA1_uc010cyy.1_Missense_Mutation_p.R496H|BRCA1_uc010cyz.1_Missense_Mutation_p.R449H|BRCA1_uc010cza.1_Missense_Mutation_p.R470H	NM_007296	NP_009227	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	496					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of protein ubiquitination|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription activator activity|transcription coactivator activity|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(17)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)|lung(1)	45		Breast(137;0.000717)							p.R496L(NCIH23-Tumor)	296	TCGA Ovarian(2;0.000030)			0.802721	379.616389	392.156603	118	29	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(366;0.126)	Missense_Mutation	SNP	38499587	38499587	1529	17	C	T	T	19	19	BRCA1	T	1	1
UBTF	7343	broad.mit.edu	36	17	39640220	39640220	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:39640220G>A	uc002igb.1	-	c.2211C>T	c.(2209-2211)GAC>GAT	p.D737D	UBTF_uc002igc.1_Silent_p.D700D|UBTF_uc010czs.1_Silent_p.D737D|UBTF_uc002igd.1_Silent_p.D700D|UBTF_uc010czt.1_Silent_p.D737D	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA	737	Asp/Glu/Ser-rich (acidic).				positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding|RNA polymerase I transcription factor activity				0		Breast(137;0.00765)|Prostate(33;0.0181)												0.733333	68.859307	70.333509	22	8	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(366;0.114)	Silent	SNP	39640220	39640220	17467	17	G	A	A	40	40	UBTF	A	1	1
SLC25A39	51629	broad.mit.edu	36	17	39752999	39752999	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:39752999G>A	uc002ign.1	-	c.976C>T	c.(976-978)CGG>TGG	p.R326W	SLC25A39_uc002igm.1_Missense_Mutation_p.R318W|SLC25A39_uc002igo.1_Missense_Mutation_p.R318W|SLC25A39_uc010czu.1_Missense_Mutation_p.R194W	NM_016016	NP_057100	Q9BZJ4	S2539_HUMAN	solute carrier family 25, member 39 isoform b	326	Solcar 3.|Helical; Name=6; (Potential).				heme biosynthetic process|transport	integral to membrane|mitochondrial inner membrane					0		Prostate(33;0.0233)												0.670213	197.946912	200.359081	63	31	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(366;0.189)	Missense_Mutation	SNP	39752999	39752999	15000	17	G	A	A	37	37	SLC25A39	A	1	1
WNT3	7473	broad.mit.edu	36	17	42201174	42201174	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:42201174C>T	uc002ikv.1	-	c.749G>A	c.(748-750)CGT>CAT	p.R250H		NM_030753	NP_110380	P56703	WNT3_HUMAN	wingless-type MMTV integration site family,	250					canonical Wnt receptor signaling pathway involved in mesenchymal stem cell differentiation|canonical Wnt receptor signaling pathway involved in osteoblast differentiation|cellular response to retinoic acid|dorsal/ventral axis specification|embryonic forelimb morphogenesis|embryonic hindlimb morphogenesis|embryonic pattern specification|head morphogenesis|hemopoietic stem cell proliferation|inner ear morphogenesis|limb bud formation|mammary gland epithelium development|mesoderm formation|midbrain-hindbrain boundary development|negative regulation of fat cell differentiation|negative regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of cell proliferation|positive regulation of gene-specific transcription from RNA polymerase II promoter|Spemann organizer formation at the anterior end of the primitive streak|Wnt receptor signaling pathway, calcium modulating pathway	early endosome|extracellular space|late endosome|membrane fraction|membrane raft|plasma membrane|proteinaceous extracellular matrix	frizzled binding|frizzled-2 binding|signal transducer activity				0														0.773109	295.251331	303.39824	92	27	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(9;0.0257)		Missense_Mutation	SNP	42201174	42201174	17962	17	C	T	T	19	19	WNT3	T	1	1
GOSR2	9570	broad.mit.edu	36	17	42361916	42361916	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:42361916C>T	uc002ikz.1	+	c.61C>T	c.(61-63)CGC>TGC	p.R21C	GOSR2_uc002iky.1_Missense_Mutation_p.R21C|GOSR2_uc002ila.1_Missense_Mutation_p.R21C	NM_054022	NP_473363	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2 isoform B	21	Cytoplasmic (Potential).				cellular membrane fusion|ER to Golgi vesicle-mediated transport|protein transport	Golgi membrane|integral to membrane	transporter activity			ovary(1)	1														0.765625	157.399485	161.531608	49	15	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(9;0.102)		Missense_Mutation	SNP	42361916	42361916	6851	17	C	T	T	19	19	GOSR2	T	1	1
IGF2BP1	10642	broad.mit.edu	36	17	44472453	44472453	+	Splice_Site_SNP	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:44472453G>A	uc002iom.1	+	c.818_splice	c.e7+1	p.T273_splice	IGF2BP1_uc010dbj.1_Intron	NM_006546	NP_006537			insulin-like growth factor 2 mRNA binding						CRD-mediated mRNA stabilization|negative regulation of translation|regulation of cytokine biosynthetic process|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			kidney(1)	1						Esophageal Squamous(198;1041 2123 8248 37119 38268)								0.751445	416.003163	425.939603	130	43	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	44472453	44472453	7874	17	G	A	A	40	40	IGF2BP1	A	5	1
CACNA1G	8913	broad.mit.edu	36	17	46038351	46038351	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:46038351C>T	uc002irk.1	+	c.4390C>T	c.(4390-4392)CGG>TGG	p.R1464W	CACNA1G_uc002iri.1_Missense_Mutation_p.R1464W|CACNA1G_uc002irj.1_Missense_Mutation_p.R1441W|CACNA1G_uc002irl.1_Missense_Mutation_p.R1441W|CACNA1G_uc002irm.1_Missense_Mutation_p.R1441W|CACNA1G_uc002irn.1_Missense_Mutation_p.R1441W|CACNA1G_uc002iro.1_Missense_Mutation_p.R1441W|CACNA1G_uc002irp.1_Missense_Mutation_p.R1464W|CACNA1G_uc002irq.1_Missense_Mutation_p.R1441W|CACNA1G_uc002irr.1_Missense_Mutation_p.R1464W|CACNA1G_uc002irs.1_Missense_Mutation_p.R1464W|CACNA1G_uc002irt.1_Missense_Mutation_p.R1464W|CACNA1G_uc002irv.1_Missense_Mutation_p.R1464W|CACNA1G_uc002irw.1_Missense_Mutation_p.R1441W|CACNA1G_uc002iru.1_Missense_Mutation_p.R1441W|CACNA1G_uc002irx.1_Missense_Mutation_p.R1377W|CACNA1G_uc002iry.1_Missense_Mutation_p.R1377W|CACNA1G_uc002irz.1_Missense_Mutation_p.R1377W|CACNA1G_uc002isa.1_Missense_Mutation_p.R1377W|CACNA1G_uc002isb.1_Missense_Mutation_p.R1377W|CACNA1G_uc002isc.1_Missense_Mutation_p.R1377W|CACNA1G_uc002isd.1_Missense_Mutation_p.R1377W|CACNA1G_uc002ise.1_Missense_Mutation_p.R1377W|CACNA1G_uc002isf.1_Missense_Mutation_p.R1377W|CACNA1G_uc002isg.1_Missense_Mutation_p.R1377W|CACNA1G_uc002ish.1_Missense_Mutation_p.R1377W|CACNA1G_uc002isi.1_Missense_Mutation_p.R1354W|CACNA1G_uc002isj.2_Missense_Mutation_p.R188W	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G	1464	Extracellular (Potential).|III.				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)				Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)									0.651515	133.514193	134.847474	43	23	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Missense_Mutation	SNP	46038351	46038351	2660	17	C	T	T	23	23	CACNA1G	T	1	1
MINK1	50488	broad.mit.edu	36	17	4738163	4738163	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:4738163G>A	uc002fzf.1	+	c.2669G>A	c.(2668-2670)CGC>CAC	p.R890H	MINK1_uc002fze.1_Missense_Mutation_p.R861H|MINK1_uc002fzg.1_Missense_Mutation_p.R870H|MINK1_uc002fzh.1_Missense_Mutation_p.R853H|MINK1_uc002fzi.1_Missense_Mutation_p.R331H|MINK1_uc002fzj.1_Missense_Mutation_p.R351H	NM_153827	NP_722549	Q8N4C8	MINK1_HUMAN	misshapen/NIK-related kinase isoform 3	890	Mediates interaction with RAP2A.				JNK cascade|protein phosphorylation	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)|skin(1)	6										511				0.321429	24.369445	25.160215	9	19	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4738163	4738163	9977	17	G	A	A	38	38	MINK1	A	1	1
CA4	762	broad.mit.edu	36	17	55591552	55591552	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:55591552C>T	uc002iym.2	+	c.924C>T	c.(922-924)GCC>GCT	p.A308A		NM_000717	NP_000708	P22748	CAH4_HUMAN	carbonic anhydrase IV precursor	308					bicarbonate transport|one-carbon metabolic process|visual perception	anchored to external side of plasma membrane|apical plasma membrane|brush border membrane|ER-Golgi intermediate compartment|membrane fraction|perinuclear region of cytoplasm|rough endoplasmic reticulum|secretory granule membrane|trans-Golgi network|transport vesicle membrane	carbonate dehydratase activity|protein binding|zinc ion binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)				Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)									0.765957	115.516473	118.560136	36	11	CC		KEEP	---	---	---	---	capture	Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Silent	SNP	55591552	55591552	2634	17	C	T	T	23	23	CA4	T	1	1
HELZ	9931	broad.mit.edu	36	17	62536132	62536132	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:62536132C>T	uc002jfx.2	-	c.4051G>A	c.(4051-4053)GCA>ACA	p.A1351T	HELZ_uc002jfv.2_Non-coding_Transcript|HELZ_uc010der.1_5'UTR	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)													0.866667	335.85703	351.508104	104	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	62536132	62536132	7332	17	C	T	T	27	27	HELZ	T	1	1
AIPL1	23746	broad.mit.edu	36	17	6279056	6279056	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:6279056G>A	uc002gcp.1	-	c.93C>T	c.(91-93)TCC>TCT	p.S31S	AIPL1_uc002gcq.1_Silent_p.S31S|AIPL1_uc002gcr.1_Silent_p.S31S|AIPL1_uc010clk.1_Silent_p.S31S|AIPL1_uc010cll.1_Silent_p.S31S|AIPL1_uc002gcs.1_Silent_p.S31S	NM_014336	NP_055151	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting	31					protein farnesylation|protein folding|visual perception	cytoplasm|nucleus	farnesylated protein binding|unfolded protein binding				0														0.647059	109.887918	110.859784	33	18	GG		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(228;0.141)	Silent	SNP	6279056	6279056	439	17	G	A	A	43	43	AIPL1	A	2	2
KIAA0753	9851	broad.mit.edu	36	17	6434602	6434602	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:6434602C>T	uc002gde.2	-	c.2513G>A	c.(2512-2514)CGC>CAC	p.R838H	KIAA0753_uc010clo.1_Missense_Mutation_p.R539H	NM_014804	NP_055619	Q2KHM9	K0753_HUMAN	hypothetical protein LOC9851	838											0														0.191011	34.536607	42.468674	17	72	CC		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(228;0.157)	Missense_Mutation	SNP	6434602	6434602	8498	17	C	T	T	27	27	KIAA0753	T	1	1
CDC42EP4	23580	broad.mit.edu	36	17	68793426	68793426	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:68793426C>T	uc002jjn.1	-	c.809G>A	c.(808-810)GGC>GAC	p.G270D	CDC42EP4_uc002jjo.1_Missense_Mutation_p.G270D|CDC42EP4_uc002jjp.1_Missense_Mutation_p.G200D|CDC42EP4_uc010dfl.1_Missense_Mutation_p.G270D	NM_012121	NP_036253	Q9H3Q1	BORG4_HUMAN	Cdc42 effector protein 4	270					positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|cytoplasm|endomembrane system|membrane|microtubule cytoskeleton	GTP-Rho binding				0														0.625	44.827631	45.156342	15	9	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)		Missense_Mutation	SNP	68793426	68793426	3206	17	C	T	T	26	26	CDC42EP4	T	2	2
DVL2	1856	broad.mit.edu	36	17	7070196	7070196	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7070196G>A	uc002gez.1	-	c.1923C>T	c.(1921-1923)AGC>AGT	p.S641S	MIR324_hsa-mir-324|MI0000813_5'Flank	NM_004422	NP_004413	O14641	DVL2_HUMAN	dishevelled 2	641					canonical Wnt receptor signaling pathway involved in regulation of cell proliferation|intracellular signal transduction|neural tube closure|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|segment specification|transcription from RNA polymerase II promoter	nucleus	frizzled binding|identical protein binding|signal transducer activity			kidney(1)	1														0.443299	122.332289	122.599266	43	54	GG		KEEP	---	---	---	---	capture			Silent	SNP	7070196	7070196	5022	17	G	A	A	38	38	DVL2	A	1	1
C17orf81	23587	broad.mit.edu	36	17	7096598	7096598	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7096598T>G	uc002gfg.1	+	c.53T>G	c.(52-54)TTG>TGG	p.L18W	CTDNEP1_uc002gfc.1_5'Flank|CTDNEP1_uc002gfd.1_5'Flank|CTDNEP1_uc002gfe.1_5'Flank|CTDNEP1_uc002gff.1_5'Flank|C17orf81_uc002gfh.1_Missense_Mutation_p.L18W|C17orf81_uc002gfi.1_Missense_Mutation_p.L18W|C17orf81_uc002gfj.1_Missense_Mutation_p.L18W|C17orf81_uc010cmb.1_Missense_Mutation_p.L18W|C17orf81_uc002gfk.1_Missense_Mutation_p.L18W|C17orf81_uc002gfl.1_Missense_Mutation_p.L18W	NM_203415	NP_981960	Q8TE02	DERP6_HUMAN	S-phase 2 protein isoform 4	18					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding				0														0.692308	65.959514	66.817139	18	8	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7096598	7096598	1944	17	T	G	G	63	63	C17orf81	G	4	4
EVPL	2125	broad.mit.edu	36	17	71515254	71515254	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71515254C>T	uc002jqi.2	-	c.5627G>A	c.(5626-5628)CGC>CAC	p.R1876H		NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	1876	Globular 2.|Plectin 4.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)	3														0.655844	312.30678	315.608201	101	53	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71515254	71515254	5485	17	C	T	T	27	27	EVPL	T	1	1
EVPL	2125	broad.mit.edu	36	17	71515470	71515470	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71515470G>A	uc002jqi.2	-	c.5411C>T	c.(5410-5412)CCG>CTG	p.P1804L		NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	1804	Globular 2.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)	3														0.796407	436.668202	450.352478	133	34	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71515470	71515470	5485	17	G	A	A	39	39	EVPL	A	1	1
EVPL	2125	broad.mit.edu	36	17	71531796	71531796	+	Silent	SNP	C	A	A			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71531796C>A	uc002jqi.2	-	c.99G>T	c.(97-99)CGG>CGT	p.R33R		NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	33	Globular 1.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)	3														0.666667	53.054085	53.717356	18	9	CC		KEEP	---	---	---	---	capture			Silent	SNP	71531796	71531796	5485	17	C	A	A	22	22	EVPL	A	3	3
TP53	7157	broad.mit.edu	36	17	7519131	7519131	+	Missense_Mutation	SNP	C	T	T	rs28934578	unknown	TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7519131C>T	uc002gim.2	-	c.524G>A	c.(523-525)CGC>CAC	p.R175H	TP53_uc002gig.1_Missense_Mutation_p.R175H|TP53_uc002gih.1_Missense_Mutation_p.R175H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R43H|TP53_uc010cng.1_Missense_Mutation_p.R43H|TP53_uc002gii.1_Missense_Mutation_p.R43H|TP53_uc010cnh.1_Missense_Mutation_p.R175H|TP53_uc010cni.1_Missense_Mutation_p.R175H|TP53_uc002gij.2_Missense_Mutation_p.R175H|TP53_uc010cnj.1_Non-coding_Transcript|TP53_uc002gin.2_Missense_Mutation_p.R82H|TP53_uc002gio.2_Missense_Mutation_p.R43H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	175	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.R175H(709)|p.R175L(19)|p.0?(6)|p.R175P(5)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R174_E180>K(1)|p.R174fs*3(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)				Pancreas(47;798 1329 9957 10801)	R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(HCC1395_BREAST)|R175H(KLE_ENDOMETRIUM)|R175H(NCIH196_LUNG)|R175H(AU565_BREAST)|R175H(TYKNU_OVARY)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(SKUT1_SOFT_TISSUE)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(LS123_LARGE_INTESTINE)|R175H(SKBR3_BREAST)|R175H(RKN_OVARY)|R175H(HUCCT1_BILIARY_TRACT)	111	p.R175L(LS123-Tumor)|p.R175L(VMRCLCD-Tumor)|p.R175L(DETROIT562-Tumor)|p.R175L(KMS26-Tumor)|p.R175L(KLE-Tumor)|p.R175L(SNU245-Tumor)|p.R175L(SKBR3-Tumor)|p.R175L(RKN-Tumor)|p.R174fs(THP1-Tumor)|p.R175L(HCC1395-Tumor)|p.R175L(VMCUB1-Tumor)|p.R175L(RT11284-Tumor)|p.R175L(AU565-Tumor)|p.R175L(SKUT1-Tumor)|p.R175L(HS571.T-Tumor)|p.R175L(HUCCT1-Tumor)|p.R175L(TYKNU-Tumor)|p.R175L(LMSU-Tumor)|p.R175L(CAL33-Tumor)|p.R175L(SNU1197-Tumor)|p.R175L(NCIH196-Tumor)|p.R175H(HCC44-Tumor)|p.R175L(OPM2-Tumor)	690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.768293	196.855789	202.260463	63	19	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Missense_Mutation	SNP	7519131	7519131	16923	17	C	T	T	27	27	TP53	T	1	1
CBX8	57332	broad.mit.edu	36	17	75383660	75383660	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:75383660C>T	uc002jxd.1	-	c.539G>A	c.(538-540)CGG>CAG	p.R180Q		NM_020649	NP_065700	Q9HC52	CBX8_HUMAN	chromobox homolog 8	180					chromatin assembly or disassembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent		chromatin binding|methylated histone residue binding				0														0.64	51.303998	51.73543	16	9	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		Missense_Mutation	SNP	75383660	75383660	2843	17	C	T	T	23	23	CBX8	T	1	1
WRAP53	55135	broad.mit.edu	36	17	7545797	7545797	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7545797G>A	uc002gip.1	+	c.920G>A	c.(919-921)CGG>CAG	p.R307Q	WRAP53_uc002giq.1_Non-coding_Transcript|WRAP53_uc002gir.1_Missense_Mutation_p.R307Q|WRAP53_uc010cnl.1_Missense_Mutation_p.R274Q	NM_018081	NP_060551	Q9BUR4	WAP53_HUMAN	WD repeat domain 79	307	WD 3.				positive regulation of telomerase activity|telomere formation via telomerase	Cajal body|cytoplasm|telomerase holoenzyme complex	protein binding|RNA binding				0														0.725	86.369139	88.185971	29	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7545797	7545797	17974	17	G	A	A	39	39	WRAP53	A	1	1
NPTX1	4884	broad.mit.edu	36	17	76060178	76060178	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:76060178C>T	uc002jyp.1	-	c.1026G>A	c.(1024-1026)GCG>GCA	p.A342A		NM_002522	NP_002513	Q15818	NPTX1_HUMAN	neuronal pentraxin I precursor	342	Pentaxin.				central nervous system development|synaptic transmission|transport	transport vesicle	metal ion binding				0	all_neural(118;0.0538)													0.725806	140.090827	142.938074	45	17	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)		Silent	SNP	76060178	76060178	11007	17	C	T	T	27	27	NPTX1	T	1	1
RPTOR	57521	broad.mit.edu	36	17	76511169	76511169	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:76511169G>A	uc002jyt.1	+	c.2571G>A	c.(2569-2571)ACG>ACA	p.T857T		NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor	857					cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)	5									p.T857T(NALM6-Tumor)	1368				0.818182	26.877618	27.922888	9	2	GG		KEEP	---	---	---	---	capture			Silent	SNP	76511169	76511169	14145	17	G	A	A	38	38	RPTOR	A	1	1
ROCK1	6093	broad.mit.edu	36	18	16803100	16803100	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:16803100G>C	uc002kte.1	-	c.2888C>G	c.(2887-2889)ACA>AGA	p.T963R		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	963	Glu-rich.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|protein phosphorylation|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)									408				0.253333	58.689369	62.831286	19	56	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16803100	16803100	13996	18	G	C	C	48	48	ROCK1	C	3	3
MCART2	147407	broad.mit.edu	36	18	27594251	27594251	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:27594251C>T	uc002kxa.2	-	c.372G>A	c.(370-372)GCG>GCA	p.A124A		NM_001034172	NP_001029344	Q3SY17	MCAR2_HUMAN	mitochondrial carrier triple repeat 2	124	Helical; Name=3; (Potential).|Solcar 2.				transport	integral to membrane|mitochondrial inner membrane					0														0.418502	296.309336	297.619039	95	132	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(10;0.0539)		Silent	SNP	27594251	27594251	9759	18	C	T	T	23	23	MCART2	T	1	1
MYOM1	8736	broad.mit.edu	36	18	3084280	3084280	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:3084280G>A	uc002klp.1	-	c.3752C>T	c.(3751-3753)GCA>GTA	p.A1251V	MYOM1_uc002klq.1_Missense_Mutation_p.A1155V	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	1251						striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5														0.380952	64.981999	65.766048	24	39	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3084280	3084280	10486	18	G	A	A	46	46	MYOM1	A	2	2
FHOD3	80206	broad.mit.edu	36	18	32594716	32594716	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:32594716G>A	uc002kzs.1	+	c.4048G>A	c.(4048-4050)GTC>ATC	p.V1350I	FHOD3_uc002kzt.1_Missense_Mutation_p.V1333I|FHOD3_uc010dmz.1_Missense_Mutation_p.V1065I|FHOD3_uc010dnb.1_Intron	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1333					actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			large_intestine(2)|breast(2)|ovary(1)	5		all_epithelial(2;0.0181)|Colorectal(2;0.0195)												0.493671	113.955091	113.956994	39	40	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32594716	32594716	6121	18	G	A	A	40	40	FHOD3	A	1	1
SLC14A2	8170	broad.mit.edu	36	18	41461000	41461000	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:41461000C>T	uc010dnj.1	+	c.411C>T	c.(409-411)AGC>AGT	p.S137S	SLC14A2_uc002lbb.2_Silent_p.S137S|SLC14A2_uc002lbe.1_Silent_p.S137S	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	137						apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2														0.399015	228.934126	230.744062	81	122	CC		KEEP	---	---	---	---	capture			Silent	SNP	41461000	41461000	14892	18	C	T	T	27	27	SLC14A2	T	1	1
KATNAL2	83473	broad.mit.edu	36	18	42849968	42849968	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:42849968G>A	uc002lco.1	+	c.791G>A	c.(790-792)CGG>CAG	p.R264Q	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lcp.2_Missense_Mutation_p.R191Q	NM_031303	NP_112593	Q8IYT4	KATL2_HUMAN	katanin p60 subunit A-like 2	336						cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3														0.389474	114.657051	115.672582	37	58	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42849968	42849968	8290	18	G	A	A	39	39	KATNAL2	A	1	1
CXXC1	30827	broad.mit.edu	36	18	46063644	46063644	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:46063644G>A	uc002ler.2	-	c.1672C>T	c.(1672-1674)CGG>TGG	p.R558W	MBD1_uc010dow.1_5'Flank|MBD1_uc002leg.2_5'Flank|MBD1_uc002leh.2_5'Flank|MBD1_uc002lei.2_5'Flank|MBD1_uc002lej.2_5'Flank|MBD1_uc002lek.2_5'Flank|MBD1_uc002lel.2_5'Flank|MBD1_uc002lem.2_5'Flank|MBD1_uc002len.2_5'Flank|MBD1_uc002leo.2_5'Flank|CXXC1_uc002lep.2_Missense_Mutation_p.R411W|CXXC1_uc002leq.2_Missense_Mutation_p.R554W|CXXC1_uc010doy.1_Silent_p.H541H	NM_001101654	NP_001095124	Q9P0U4	CXXC1_HUMAN	CXXC finger 1 (PHD domain) isoform 1	554					histone H3-K4 methylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck|Set1C/COMPASS complex	protein binding|transcription activator activity|unmethylated CpG binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2														0.328205	171.131774	176.235823	64	131	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46063644	46063644	4257	18	G	A	A	40	40	CXXC1	A	1	1
SMAD4	4089	broad.mit.edu	36	18	46829214	46829214	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr18:46829214T>C	uc002lfa.2	+	c.410T>C	c.(409-411)GTA>GCA	p.V137A		NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	137	MH1.				BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|promoter binding|protein homodimerization activity|R-SMAD binding|transcription activator activity|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)		pancreas(169)|large_intestine(108)|thyroid(19)|lung(10)|small_intestine(9)|biliary_tract(8)|upper_aerodigestive_tract(7)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	364		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)								233				0.473684	230.027701	230.106994	63	70	TT		KEEP	---	---	---	---	capture		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)	Missense_Mutation	SNP	46829214	46829214	15258	18	T	C	C	57	57	SMAD4	C	4	4
C18orf54	162681	broad.mit.edu	36	18	50152918	50152918	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:50152918C>T	uc002lfo.2	+	c.1411C>T	c.(1411-1413)CGT>TGT	p.R471C	C18orf54_uc002lfn.2_Missense_Mutation_p.R310C	NM_173529	NP_775800	Q8IYD9	CR054_HUMAN	hypothetical protein LOC162681	310						extracellular region				ovary(1)	1														0.33913	107.491362	110.121759	39	76	CC		KEEP	---	---	---	---	capture		Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)	Missense_Mutation	SNP	50152918	50152918	1965	18	C	T	T	19	19	C18orf54	T	1	1
PHLPP1	23239	broad.mit.edu	36	18	58796976	58796976	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:58796976G>A	uc002lis.1	+	c.2950G>A	c.(2950-2952)GAT>AAT	p.D984N		NM_194449	NP_919431	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein	1496					apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0														0.392857	61.232003	61.796203	22	34	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	58796976	58796976	12278	18	G	A	A	37	37	PHLPP1	A	1	1
SERPINB3	6317	broad.mit.edu	36	18	59474074	59474074	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:59474074C>T	uc002lji.1	-	c.970G>A	c.(970-972)GTG>ATG	p.V324M	SERPINB4_uc002ljg.1_Intron|SERPINB4_uc002ljh.1_Intron|SERPINB3_uc010dqa.1_Missense_Mutation_p.V272M	NM_006919	NP_008850	P29508	SPB3_HUMAN	serine (or cysteine) proteinase inhibitor, clade	324					regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)|central_nervous_system(1)	2														0.353211	213.71741	217.855818	77	141	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	59474074	59474074	14590	18	C	T	T	19	19	SERPINB3	T	1	1
LAMA1	284217	broad.mit.edu	36	18	7003831	7003831	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:7003831C>T	uc002knm.1	-	c.3346G>A	c.(3346-3348)GGG>AGG	p.G1116R		NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1116	Laminin EGF-like 13.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|breast(2)|pancreas(2)|central_nervous_system(1)	17		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)					1597				0.555556	62.701507	62.798006	20	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7003831	7003831	8928	18	C	T	T	23	23	LAMA1	T	1	1
ZNF516	9658	broad.mit.edu	36	18	72282895	72282895	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:72282895C>T	uc010dqx.1	-	c.1104G>A	c.(1102-1104)CCG>CCA	p.P368P	ZNF516_uc002lme.2_Non-coding_Transcript	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	368					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)												0.533333	103.602556	103.660465	32	28	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)	Silent	SNP	72282895	72282895	18554	18	C	T	T	23	23	ZNF516	T	1	1
SALL3	27164	broad.mit.edu	36	18	74853213	74853213	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:74853213C>T	uc002lmt.1	+	c.234C>T	c.(232-234)CCC>CCT	p.P78P	SALL3_uc010dra.1_5'Flank	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	78					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)												0.328571	66.610608	68.429679	23	47	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)	Silent	SNP	74853213	74853213	14292	18	C	T	T	23	23	SALL3	T	1	1
NFATC1	4772	broad.mit.edu	36	18	75347480	75347480	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:75347480C>T	uc002lnf.1	+	c.2298C>T	c.(2296-2298)GGC>GGT	p.G766G	NFATC1_uc002lnd.1_Silent_p.G779G|NFATC1_uc002lne.1_Silent_p.G307G|NFATC1_uc002lng.1_Silent_p.G766G	NM_172387	NP_765975	O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytosolic	779	Trans-activation domain B (TAD-B).				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|promoter binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription activator activity			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)				GBM(151;1210 2593 28719 45011)				1639				0.442478	145.637653	145.962368	50	63	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Silent	SNP	75347480	75347480	10761	18	C	T	T	27	27	NFATC1	T	1	1
PRKACA	5566	broad.mit.edu	36	19	14065488	14065488	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:14065488G>A	uc002myc.1	-	c.882C>T	c.(880-882)AAC>AAT	p.N294N	PRKACA_uc002myb.1_Silent_p.N286N	NM_002730	NP_002721	P17612	KAPCA_HUMAN	cAMP-dependent protein kinase catalytic subunit	294	Protein kinase.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|cytosol|nucleoplasm	ATP binding|cAMP-dependent protein kinase activity|cAMP-dependent protein kinase inhibitor activity|protein kinase binding			lung(1)	1										162				0.703883	463.638777	471.290638	145	61	GG		KEEP	---	---	---	---	capture			Silent	SNP	14065488	14065488	12940	19	G	A	A	44	44	PRKACA	A	2	2
LPHN1	22859	broad.mit.edu	36	19	14123161	14123161	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:14123161C>T	uc002myg.1	-	c.3949G>A	c.(3949-3951)GGG>AGG	p.G1317R	LPHN1_uc002myh.1_Missense_Mutation_p.G1312R	NM_001008701	NP_001008701	O94910	LPHN1_HUMAN	latrophilin 1 isoform 1 precursor	1317	Poly-Gly.|Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			ovary(1)|central_nervous_system(1)	2														0.875	46.661107	48.857632	14	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14123161	14123161	9288	19	C	T	T	23	23	LPHN1	T	1	1
PCSK4	54760	broad.mit.edu	36	19	1438203	1438203	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:1438203G>A	uc002ltb.1	-	c.792C>T	c.(790-792)GAC>GAT	p.D264D	PCSK4_uc002lta.2_Silent_p.D76D	NM_017573	NP_060043	Q6UW60	PCSK4_HUMAN	proprotein convertase subtilisin/kexin type 4	264	Catalytic (By similarity).				proteolysis	integral to membrane	serine-type endopeptidase activity				0		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)												0.791667	58.927129	60.814403	19	5	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Silent	SNP	1438203	1438203	12023	19	G	A	A	40	40	PCSK4	A	1	1
ADAMTSL5	339366	broad.mit.edu	36	19	1457625	1457625	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:1457625C>T	uc002ltd.1	-	c.1078G>A	c.(1078-1080)GCC>ACC	p.A360T	ADAMTSL5_uc010dsl.1_Missense_Mutation_p.A129T	NM_213604	NP_998769	Q6ZMM2	ATL5_HUMAN	ADAMTS-like 5	360	NTR.					proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)												0.470588	22.800081	22.812647	8	9	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Missense_Mutation	SNP	1457625	1457625	279	19	C	T	T	27	27	ADAMTSL5	T	1	1
WIZ	58525	broad.mit.edu	36	19	15397277	15397277	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:15397277G>A	uc002nba.2	-	c.1507C>T	c.(1507-1509)CGG>TGG	p.R503W	WIZ_uc002nbb.2_Missense_Mutation_p.R462W	NM_021241	NP_067064	O95785	WIZ_HUMAN	widely-interspaced zinc finger motifs	1319						nucleus	zinc ion binding				0														0.714286	32.154243	32.730911	10	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15397277	15397277	17949	19	G	A	A	39	39	WIZ	A	1	1
HAUS8	93323	broad.mit.edu	36	19	17021791	17021791	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:17021791C>T	uc002nfe.1	-	c.1125G>A	c.(1123-1125)TCG>TCA	p.S375S	HAUS8_uc002nff.1_Silent_p.S374S|HAUS8_uc002nfg.1_Silent_p.S313S|HAUS8_uc002nfh.1_Silent_p.S374S	NM_033417	NP_219485	Q9BT25	HAUS8_HUMAN	sarcoma antigen NY-SAR-48 isoform a	375					cell division|centrosome organization|mitosis|spindle assembly	HAUS complex|microtubule|microtubule organizing center|spindle pole					0														0.71028	248.941099	253.183542	76	31	CC		KEEP	---	---	---	---	capture			Silent	SNP	17021791	17021791	7254	19	C	T	T	19	19	HAUS8	T	1	1
PLVAP	83483	broad.mit.edu	36	19	17337458	17337458	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:17337458G>A	uc002ngk.1	-	c.816C>T	c.(814-816)TGC>TGT	p.C272C		NM_031310	NP_112600	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	272	Extracellular (Potential).					caveola|integral to membrane|perinuclear region of cytoplasm					0														0.721649	221.175386	225.458553	70	27	GG		KEEP	---	---	---	---	capture			Silent	SNP	17337458	17337458	12542	19	G	A	A	38	38	PLVAP	A	1	1
GLT25D1	79709	broad.mit.edu	36	19	17539226	17539226	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:17539226G>A	uc002nhc.1	+	c.501G>A	c.(499-501)GCG>GCA	p.A167A	GLT25D1_uc010eax.1_5'Flank	NM_024656	NP_078932	Q8NBJ5	GT251_HUMAN	glycosyltransferase 25 domain containing 1	167					lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity				0														0.64	160.71865	162.012514	48	27	GG		KEEP	---	---	---	---	capture			Silent	SNP	17539226	17539226	6734	19	G	A	A	39	39	GLT25D1	A	1	1
MAP1S	55201	broad.mit.edu	36	19	17699443	17699443	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:17699443G>A	uc002nhe.1	+	c.2250G>A	c.(2248-2250)GCG>GCA	p.A750A	MAP1S_uc010eba.1_Intron|MAP1S_uc002nhf.1_5'UTR	NM_018174	NP_060644	Q66K74	MAP1S_HUMAN	BPY2 interacting protein 1	750	Pro-rich.|Necessary for the microtubule-organizing center localization.|Necessary for association with microtubules.|Necessary for interaction with RASSF1 isoform A and isoform C.				apoptosis|brain development|microtubule bundle formation|mitochondrion transport along microtubule|neuron projection morphogenesis	cytosol|dendrite|microtubule|neuronal cell body|nucleus|perinuclear region of cytoplasm|spindle|synapse	actin filament binding|beta-tubulin binding|DNA binding|microtubule binding			central_nervous_system(1)	1														0.645161	67.308445	67.884073	20	11	GG		KEEP	---	---	---	---	capture			Silent	SNP	17699443	17699443	9617	19	G	A	A	39	39	MAP1S	A	1	1
RPL18A	6142	broad.mit.edu	36	19	17833168	17833168	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:17833168C>T	uc002nhp.1	+	c.85C>T	c.(85-87)CGC>TGC	p.R29C	SNORA68_uc002nhq.1_5'Flank	NM_000980	NP_000971	Q02543	RL18A_HUMAN	ribosomal protein L18a	29					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0														0.71875	74.236254	75.612514	23	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17833168	17833168	14044	19	C	T	T	23	23	RPL18A	T	1	1
PIK3R2	5296	broad.mit.edu	36	19	18134296	18134296	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:18134296C>T	uc002nia.1	+	c.1089C>T	c.(1087-1089)GGC>GGT	p.G363G	PIK3R2_uc002nib.1_Non-coding_Transcript|PIK3R2_uc010ebi.1_Non-coding_Transcript	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	363	SH2 1.				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|central_nervous_system(1)|pancreas(1)	4										186				0.763636	134.973393	138.469923	42	13	CC		KEEP	---	---	---	---	capture			Silent	SNP	18134296	18134296	12343	19	C	T	T	27	27	PIK3R2	T	1	1
FKBP8	23770	broad.mit.edu	36	19	18510094	18510094	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:18510094C>T	uc002njj.1	-	c.704G>A	c.(703-705)CGG>CAG	p.R235Q	FKBP8_uc002nji.1_Missense_Mutation_p.R72Q|FKBP8_uc002njk.1_Missense_Mutation_p.R234Q|FKBP8_uc002njl.1_Missense_Mutation_p.R235Q|FKBP8_uc002njm.1_Missense_Mutation_p.R234Q|FKBP8_uc010ebr.1_Missense_Mutation_p.R73Q|FKBP8_uc002njn.1_Non-coding_Transcript	NM_012181	NP_036313	Q14318	FKBP8_HUMAN	FK506-binding protein 8	234	TPR 1.				apoptosis|interspecies interaction between organisms|intracellular signal transduction|protein folding	integral to endoplasmic reticulum membrane|mitochondrial membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1														0.724138	274.546359	279.795129	84	32	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18510094	18510094	6152	19	C	T	T	23	23	FKBP8	T	1	1
TSSK6	83983	broad.mit.edu	36	19	19486929	19486929	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:19486929C>T	uc002nmr.1	-	c.308G>A	c.(307-309)CGC>CAC	p.R103H	TSSK6_uc002nmq.2_Non-coding_Transcript|NDUFA13_uc002nms.2_5'Flank	NM_032037	NP_114426	Q9BXA6	TSSK6_HUMAN	serine/threonine protein kinase SSTK	103	Protein kinase.				multicellular organismal development|protein phosphorylation|sperm chromatin condensation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0										1				0.755102	230.49008	236.323168	74	24	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19486929	19486929	17225	19	C	T	T	27	27	TSSK6	T	1	1
GMIP	51291	broad.mit.edu	36	19	19607260	19607260	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:19607260G>A	uc002nnd.1	-	c.1524C>T	c.(1522-1524)TGC>TGT	p.C508C		NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein	508	Phorbol-ester/DAG-type.				negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1														0.588235	143.940675	144.515198	50	35	GG		KEEP	---	---	---	---	capture			Silent	SNP	19607260	19607260	6760	19	G	A	A	38	38	GMIP	A	1	1
GMIP	51291	broad.mit.edu	36	19	19610090	19610090	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:19610090G>A	uc002nnd.1	-	c.667C>T	c.(667-669)CGC>TGC	p.R223C		NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein	223					negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1														0.714286	77.174857	78.614705	25	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19610090	19610090	6760	19	G	A	A	40	40	GMIP	A	1	1
ATP13A1	57130	broad.mit.edu	36	19	19624485	19624485	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:19624485G>A	uc002nnh.2	-	c.2145C>T	c.(2143-2145)TTC>TTT	p.F715F	ATP13A1_uc002nne.1_5'Flank|ATP13A1_uc002nnf.2_Silent_p.F83F|ATP13A1_uc002nng.1_Silent_p.F597F	NM_020410	NP_065143	Q9HD20	AT131_HUMAN	ATPase type 13A1	715	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(3)|large_intestine(2)|central_nervous_system(1)	6						Esophageal Squamous(142;920 1789 9047 14684 24777)								0.173913	8.285881	10.594129	4	19	GG		KEEP	---	---	---	---	capture			Silent	SNP	19624485	19624485	1142	19	G	A	A	37	37	ATP13A1	A	1	1
BTBD2	55643	broad.mit.edu	36	19	1966358	1966358	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:1966358C>T	uc002lup.1	-	c.345G>A	c.(343-345)GTG>GTA	p.V115V		NM_017797	NP_060267	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2	115						cytoplasmic mRNA processing body	protein binding			ovary(1)	1		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)												0.666667	29.552015	29.920159	10	5	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Silent	SNP	1966358	1966358	1577	19	C	T	T	25	25	BTBD2	T	2	2
DOT1L	84444	broad.mit.edu	36	19	2177351	2177351	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:2177351C>T	uc002lvb.2	+	c.3831C>T	c.(3829-3831)CCC>CCT	p.P1277P	DOT1L_uc002lvc.1_Silent_p.P571P	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	1277						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)												1	33.693497	33.691542	9	0	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Silent	SNP	2177351	2177351	4893	19	C	T	T	23	23	DOT1L	T	1	1
NCLN	56926	broad.mit.edu	36	19	3156942	3156942	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:3156942G>A	uc002lxi.1	+	c.1214G>A	c.(1213-1215)CGG>CAG	p.R405Q	NCLN_uc002lxh.1_Non-coding_Transcript|NCLN_uc002lxj.1_Non-coding_Transcript|NCLN_uc002lxk.1_Missense_Mutation_p.R50Q	NM_020170	NP_064555	Q969V3	NCLN_HUMAN	nicalin	405	Lumenal (Potential).				proteolysis|regulation of signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	peptidase activity|protein binding				0		Hepatocellular(1079;0.137)												0.525253	167.411496	167.467457	52	47	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.83e-113)|Epithelial(107;1.65e-111)|all cancers(105;1.53e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00139)|STAD - Stomach adenocarcinoma(1328;0.18)	Missense_Mutation	SNP	3156942	3156942	10626	19	G	A	A	39	39	NCLN	A	1	1
TSHZ3	57616	broad.mit.edu	36	19	36461816	36461816	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:36461816G>A	uc002nsy.2	-	c.723C>T	c.(721-723)GAC>GAT	p.D241D		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	241					regulation of respiratory gaseous exchange by neurological system process|regulation of transcription, DNA-dependent	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription repressor activity|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|skin(1)	7	Esophageal squamous(110;0.226)													0.745763	704.614477	720.781754	220	75	GG		KEEP	---	---	---	---	capture			Silent	SNP	36461816	36461816	17176	19	G	A	A	40	40	TSHZ3	A	1	1
LRP3	4037	broad.mit.edu	36	19	38388181	38388181	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:38388181C>T	uc010edh.1	+	c.665C>T	c.(664-666)GCG>GTG	p.A222V	LRP3_uc002nuk.2_Missense_Mutation_p.A96V	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	222	Extracellular (Potential).|LDL-receptor class A 2.				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)													0.764706	69.168726	71.425565	26	8	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38388181	38388181	9331	19	C	T	T	27	27	LRP3	T	1	1
FFAR2	2867	broad.mit.edu	36	19	40632951	40632951	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:40632951C>T	uc002nzg.2	+	c.495C>T	c.(493-495)TAC>TAT	p.Y165Y	FFAR2_uc010eea.1_Silent_p.Y165Y	NM_005306	NP_005297	O15552	FFAR2_HUMAN	free fatty acid receptor 2	165	Extracellular (Potential).					integral to plasma membrane	G-protein coupled receptor activity|lipid binding			central_nervous_system(1)	1	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)					GBM(40;139 809 9833 23358 48736)				34				0.672727	238.981993	241.891401	74	36	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(66;0.0724)		Silent	SNP	40632951	40632951	6065	19	C	T	T	19	19	FFAR2	T	1	1
ACTN4	81	broad.mit.edu	36	19	43908276	43908276	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:43908276C>T	uc002oja.1	+	c.2083C>T	c.(2083-2085)CGC>TGC	p.R695C	ACTN4_uc002ojb.1_Missense_Mutation_p.R17C	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	695	Spectrin 4.				platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)					Colon(168;199 1940 10254 46213 46384)								0.729412	190.357777	194.383781	62	23	CC		KEEP	---	---	---	---	capture	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Missense_Mutation	SNP	43908276	43908276	208	19	C	T	T	19	19	ACTN4	T	1	1
PAF1	54623	broad.mit.edu	36	19	44568809	44568809	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:44568809G>A	uc002old.1	-	c.1258C>T	c.(1258-1260)CGG>TGG	p.R420W	PAF1_uc002ole.1_Intron	NM_019088	NP_061961	Q8N7H5	PAF1_HUMAN	Paf1, RNA polymerase II associated factor,	420	Glu-rich.				histone H2B ubiquitination|histone monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding			pancreas(1)	1	all_cancers(60;9.14e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)													0.768595	600.449208	616.438476	186	56	GG		KEEP	---	---	---	---	capture	Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)		Missense_Mutation	SNP	44568809	44568809	11799	19	G	A	A	40	40	PAF1	A	1	1
CIC	23152	broad.mit.edu	36	19	47483938	47483938	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:47483938C>T	uc002otf.1	+	c.902C>T	c.(901-903)TCG>TTG	p.S301L		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	301					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)	8		Prostate(69;0.00682)								241				1	50.674893	50.674832	14	0	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47483938	47483938	3558	19	C	T	T	31	31	CIC	T	1	1
CIC	23152	broad.mit.edu	36	19	47488428	47488428	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:47488428G>A	uc002otf.1	+	c.3145G>A	c.(3145-3147)GGC>AGC	p.G1049S		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	1049	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)	8		Prostate(69;0.00682)								241				0.721519	188.319669	191.834809	57	22	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47488428	47488428	3558	19	G	A	A	39	39	CIC	A	1	1
ZNF226	7769	broad.mit.edu	36	19	49368102	49368102	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:49368102G>A	uc002oyp.1	+	c.37G>A	c.(37-39)GTG>ATG	p.V13M	ZNF226_uc002oyn.1_Missense_Mutation_p.V13M|ZNF226_uc002oyo.1_Missense_Mutation_p.V13M|ZNF226_uc010ejg.1_Missense_Mutation_p.V13M|ZNF226_uc002oyq.2_De_novo_Start_OutOfFrame|ZNF226_uc002oyr.2_De_novo_Start_OutOfFrame|ZNF226_uc002oys.1_Missense_Mutation_p.V13M|ZNF226_uc002oyt.1_Missense_Mutation_p.V13M	NM_001032373	NP_001027545	Q9NYT6	ZN226_HUMAN	zinc finger protein 226 isoform a	13	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)|all_neural(266;0.202)				Pancreas(115;581 1665 13228 19278 50070)								0.619355	309.43276	311.370259	96	59	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49368102	49368102	18371	19	G	A	A	40	40	ZNF226	A	1	1
BCL3	602	broad.mit.edu	36	19	49946350	49946350	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:49946350C>T	uc002ozr.2	+	c.259C>T	c.(259-261)CGG>TGG	p.R87W		NM_005178	NP_005169	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	95	Pro-rich.				DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|I-kappaB kinase/NF-kappaB cascade|maintenance of protein location in nucleus|negative regulation of apoptosis|negative regulation of interleukin-8 biosynthetic process|negative regulation of transcription, DNA-dependent|positive regulation of translation|protein import into nucleus, translocation|regulation of DNA binding|regulation of NF-kappaB import into nucleus|response to UV-C|response to virus	Bcl3-Bcl10 complex|Bcl3/NF-kappaB2 complex|nucleus|perinuclear region of cytoplasm	protein binding, bridging|transcription factor binding|transcription regulator activity			ovary(1)|lung(1)	2	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)								117				0.243902	72.993348	80.342215	30	93	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49946350	49946350	1396	19	C	T	T	31	31	BCL3	T	1	1
HIF3A	64344	broad.mit.edu	36	19	51516886	51516886	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:51516886C>T	uc002peh.1	+	c.1158C>T	c.(1156-1158)CCC>CCT	p.P386P	HIF3A_uc002peg.2_Silent_p.P386P|HIF3A_uc002pei.2_Silent_p.P330P|HIF3A_uc002pej.1_Silent_p.P317P|HIF3A_uc002pek.1_Silent_p.P330P|HIF3A_uc002pel.1_Silent_p.P384P	NM_152795	NP_690008	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	386					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity|transcription regulator activity			central_nervous_system(1)|skin(1)	2		Ovarian(192;0.00965)|all_neural(266;0.0887)												0.15493	41.255603	57.413319	22	120	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)	Silent	SNP	51516886	51516886	7390	19	C	T	T	22	22	HIF3A	T	2	2
PTPRS	5802	broad.mit.edu	36	19	5237082	5237082	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:5237082C>T	uc002mbv.1	-	c.70G>A	c.(70-72)GTT>ATT	p.V24I	PTPRS_uc002mbu.1_Missense_Mutation_p.V24I|PTPRS_uc002mbw.1_Missense_Mutation_p.V24I|PTPRS_uc002mbx.1_Missense_Mutation_p.V24I|PTPRS_uc002mby.1_Missense_Mutation_p.V24I|PTPRS_uc002mbz.1_Missense_Mutation_p.V24I	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	24					cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4														0.518519	43.551732	43.559873	14	13	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Missense_Mutation	SNP	5237082	5237082	13269	19	C	T	T	19	19	PTPRS	T	1	1
CCDC9	26093	broad.mit.edu	36	19	52453655	52453655	+	Splice_Site_SNP	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:52453655G>A	uc002pgh.1	+	c.4_splice	c.e3-1	p.A2_splice		NM_015603	NP_056418			coiled-coil domain containing 9												0		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)												0.731481	260.849859	266.065588	79	29	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(262;8.51e-95)|Epithelial(262;1.15e-92)|all cancers(93;7.67e-84)|GBM - Glioblastoma multiforme(486;0.024)|STAD - Stomach adenocarcinoma(1328;0.183)	Splice_Site_SNP	SNP	52453655	52453655	2992	19	G	A	A	35	35	CCDC9	A	5	2
FAM71E1	112703	broad.mit.edu	36	19	55670414	55670414	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:55670414G>A	uc002psh.1	-	c.519C>T	c.(517-519)AAC>AAT	p.N173N	FAM71E1_uc002psg.1_Silent_p.N157N|FAM71E1_uc002psi.1_Non-coding_Transcript|C19orf63_uc002psj.1_5'Flank|C19orf63_uc002psk.1_5'Flank|C19orf63_uc002psl.1_5'Flank	NM_138411	NP_612420	Q6IPT2	F71E1_HUMAN	hypothetical protein LOC112703	173										breast(1)	1		all_neural(266;0.131)												0.821429	70.133758	72.854851	23	5	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)	Silent	SNP	55670414	55670414	5834	19	G	A	A	40	40	FAM71E1	A	1	1
LRRC4B	94030	broad.mit.edu	36	19	55713383	55713383	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:55713383C>T	uc002pss.1	-	c.1399G>A	c.(1399-1401)GGC>AGC	p.G467S		NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	467	Gly-rich.|Extracellular (Potential).					cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)	1		all_neural(266;0.131)												0.162791	12.796853	17.451631	7	36	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)	Missense_Mutation	SNP	55713383	55713383	9382	19	C	T	T	23	23	LRRC4B	T	1	1
KLK6	5653	broad.mit.edu	36	19	56158475	56158475	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:56158475G>A	uc002puh.1	-	c.367C>T	c.(367-369)CGC>TGC	p.R123C	KLK6_uc010eoj.1_Intron|KLK6_uc002puj.1_Missense_Mutation_p.R7C|KLK6_uc002puk.1_Silent_p.H16H|KLK6_uc002pul.1_Missense_Mutation_p.R114C|KLK6_uc002pum.1_Missense_Mutation_p.R7C|KLK6_uc002pui.1_Missense_Mutation_p.R114C	NM_001012965	NP_001012983	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6 isoform B	114	Peptidase S1.				amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)												0.693878	103.457105	105.100666	34	15	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)	Missense_Mutation	SNP	56158475	56158475	8722	19	G	A	A	40	40	KLK6	A	1	1
ETFB	2109	broad.mit.edu	36	19	56545452	56545452	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:56545452G>A	uc002pwg.1	-	c.654C>T	c.(652-654)ATC>ATT	p.I218I	ETFB_uc002pwh.1_Silent_p.I127I	NM_001014763	NP_001014763	P38117	ETFB_HUMAN	electron-transfer-flavoprotein, beta polypeptide	127					respiratory electron transport chain|transport	mitochondrial matrix	electron carrier activity				0		all_neural(266;0.0199)												0.904762	64.361714	67.790834	19	2	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(134;0.000226)|OV - Ovarian serous cystadenocarcinoma(262;0.00661)	Silent	SNP	56545452	56545452	5463	19	G	A	A	37	37	ETFB	A	1	1
HCN2	610	broad.mit.edu	36	19	566954	566954	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:566954C>T	uc002lpe.1	+	c.2150C>T	c.(2149-2151)CCG>CTG	p.P717L		NM_001194	NP_001185	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic	717	Pro-rich.|Cytoplasmic (Potential).				cell-cell signaling|muscle contraction	voltage-gated potassium channel complex	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)				Melanoma(145;1175 2427 8056 36306)								0.333333	7.925894	8.145355	3	6	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Missense_Mutation	SNP	566954	566954	7279	19	C	T	T	23	23	HCN2	T	1	1
POLRMT	5442	broad.mit.edu	36	19	568605	568605	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:568605G>A	uc002lpf.1	-	c.3546C>T	c.(3544-3546)GAC>GAT	p.D1182D		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	1182	Mediates interaction with TEFM.				transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			pancreas(1)	1		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)												0.548387	49.467935	49.530231	17	14	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Silent	SNP	568605	568605	12666	19	G	A	A	44	44	POLRMT	A	2	2
CAPS	828	broad.mit.edu	36	19	5866268	5866268	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:5866268G>A	uc002mdt.1	+	c.505G>A	c.(505-507)GTG>ATG	p.V169M	CAPS_uc002mdu.1_Missense_Mutation_p.V142M	NM_004058	NP_004049	Q13938	CAYP1_HUMAN	calcyphosine isoform a	169	EF-hand 4.				intracellular signal transduction	cytoplasm	calcium ion binding				0														0.547619	67.607572	67.688705	23	19	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5866268	5866268	2756	19	G	A	A	40	40	CAPS	A	1	1
PRPF31	26121	broad.mit.edu	36	19	59321770	59321770	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:59321770G>A	uc002qdh.1	+	c.911G>A	c.(910-912)CGT>CAT	p.R304H		NM_015629	NP_056444	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31 homolog	304	Nop.				assembly of spliceosomal tri-snRNP	Cajal body|MLL1 complex|nuclear speck|U2-type spliceosomal complex|U4 snRNP|U4/U6 x U5 tri-snRNP complex|U4atac snRNP	RNA binding|snRNP binding			ovary(1)	1	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)													0.787879	80.957018	83.480705	26	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	59321770	59321770	13009	19	G	A	A	40	40	PRPF31	A	1	1
LILRB2	10288	broad.mit.edu	36	19	59474163	59474163	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:59474163C>T	uc002qfb.1	-	c.1021G>A	c.(1021-1023)GTG>ATG	p.V341M	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.1_Missense_Mutation_p.V341M|LILRB2_uc010erj.1_Non-coding_Transcript|LILRB2_uc002qfc.1_Missense_Mutation_p.V341M	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	341	Extracellular (Potential).|Ig-like C2-type 4.				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity				0	Ovarian(34;0.19)													0.282051	56.817538	60.146767	22	56	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(193;0.105)	Missense_Mutation	SNP	59474163	59474163	9117	19	C	T	T	19	19	LILRB2	T	1	1
PTPRH	5794	broad.mit.edu	36	19	60405399	60405399	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:60405399G>A	uc002qjq.1	-	c.990C>T	c.(988-990)TAC>TAT	p.Y330Y	PTPRH_uc010esv.1_Silent_p.Y152Y|PTPRH_uc002qjs.1_Silent_p.Y337Y	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	330	Extracellular (Potential).|Fibronectin type-III 4.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)	3		Renal(1328;0.245)												0.655738	250.598253	253.203294	80	42	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)	Silent	SNP	60405399	60405399	13260	19	G	A	A	40	40	PTPRH	A	1	1
ISOC2	79763	broad.mit.edu	36	19	60658439	60658439	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:60658439C>T	uc002qla.1	-	c.467G>A	c.(466-468)AGC>AAC	p.S156N	ISOC2_uc002qlb.1_Missense_Mutation_p.S140N|ISOC2_uc002qlc.1_Missense_Mutation_p.S70N	NM_024710	NP_078986	Q96AB3	ISOC2_HUMAN	isochorismatase domain containing 2 isoform 2	140					protein destabilization	mitochondrion|nucleus	catalytic activity|protein binding			ovary(1)	1	Breast(117;0.155)													0.619048	42.370542	42.629661	13	8	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)	Missense_Mutation	SNP	60658439	60658439	8167	19	C	T	T	24	24	ISOC2	T	2	2
ZNF787	126208	broad.mit.edu	36	19	61291915	61291915	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:61291915G>A	uc010eth.1	-	c.438C>T	c.(436-438)GGC>GGT	p.G146G		NM_001002836	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	146					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)												0.578947	33.326853	33.430107	11	8	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(193;0.0559)	Silent	SNP	61291915	61291915	18757	19	G	A	A	38	38	ZNF787	A	1	1
ZNF71	58491	broad.mit.edu	36	19	61825083	61825083	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:61825083C>T	uc002qnm.2	+	c.616C>T	c.(616-618)CGC>TGC	p.R206C	ZNF71_uc010eto.1_Missense_Mutation_p.R206C	NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	206	C2H2-type 3.				regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0														0.666667	104.363738	105.619871	34	17	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)	Missense_Mutation	SNP	61825083	61825083	18710	19	C	T	T	27	27	ZNF71	T	1	1
ZNF551	90233	broad.mit.edu	36	19	62890995	62890995	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:62890995C>T	uc002qpw.2	+	c.1492C>T	c.(1492-1494)CGC>TGC	p.R498C	ZNF776_uc002qpx.2_Intron|ZNF551_uc002qpv.2_Missense_Mutation_p.R441C	NM_138347	NP_612356	Q7Z340	ZN551_HUMAN	zinc finger protein 551	514	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)												0.75	162.629313	166.265283	48	16	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	Missense_Mutation	SNP	62890995	62890995	18578	19	C	T	T	23	23	ZNF551	T	1	1
CHMP2A	27243	broad.mit.edu	36	19	63755575	63755575	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:63755575G>A	uc002qti.1	-	c.211C>T	c.(211-213)CGC>TGC	p.R71C	CHMP2A_uc002qtj.1_Missense_Mutation_p.R71C|CHMP2A_uc002qtk.1_Missense_Mutation_p.R71C	NM_198426	NP_940818	O43633	CHM2A_HUMAN	chromatin modifying protein 2A	71	Interaction with VPS4B.				cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein domain specific binding				0		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)												0.707317	266.055783	270.784463	87	36	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)	Missense_Mutation	SNP	63755575	63755575	3488	19	G	A	A	38	38	CHMP2A	A	1	1
SH2D3A	10045	broad.mit.edu	36	19	6711907	6711907	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:6711907C>T	uc002mft.1	-	c.161G>A	c.(160-162)CGG>CAG	p.R54Q		NM_005490	NP_005481	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	54	SH2.				JNK cascade|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			breast(2)	2														0.77027	189.003415	193.956758	57	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6711907	6711907	14724	19	C	T	T	23	23	SH2D3A	T	1	1
LASS4	79603	broad.mit.edu	36	19	8232949	8232949	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:8232949C>T	uc002mjg.1	+	c.1141C>T	c.(1141-1143)CGG>TGG	p.R381W	LASS4_uc002mjh.1_Missense_Mutation_p.R330W|LASS4_uc002mji.1_Missense_Mutation_p.R217W|LASS4_uc010dvz.1_Missense_Mutation_p.R293W	NM_024552	NP_078828	Q9HA82	LASS4_HUMAN	LAG1 homolog, ceramide synthase 4	381					regulation of transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(1)	1														0.7	60.96666	62.040658	21	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8232949	8232949	8964	19	C	T	T	23	23	LASS4	T	1	1
ZNF266	10781	broad.mit.edu	36	19	9385083	9385083	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:9385083C>T	uc002mll.1	-	c.1518G>A	c.(1516-1518)TCG>TCA	p.S506S	ZNF266_uc002mlm.1_Silent_p.S506S|ZNF266_uc002mln.1_Silent_p.S506S|ZNF266_uc002mlo.1_Silent_p.S506S|ZNF266_uc010dwp.1_Silent_p.S506S|ZNF266_uc010dwq.1_Silent_p.S506S	NM_198058	NP_932175	Q14584	ZN266_HUMAN	zinc finger protein 266	506	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1														0.697368	174.102802	176.747224	53	23	CC		KEEP	---	---	---	---	capture			Silent	SNP	9385083	9385083	18397	19	C	T	T	19	19	ZNF266	T	1	1
KIF1B	23095	broad.mit.edu	36	1	10259009	10259009	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:10259009G>A	uc001aqz.2	+	c.1002G>A	c.(1000-1002)GCG>GCA	p.A334A	KIF1B_uc001aqv.2_Silent_p.A328A|KIF1B_uc001aqw.2_Silent_p.A328A|KIF1B_uc001aqx.2_Silent_p.A334A|KIF1B_uc001aqy.2_Silent_p.A334A|KIF1B_uc001ara.2_Silent_p.A334A|KIF1B_uc001arb.2_Silent_p.A334A	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	334	Kinesin-motor.|Interaction with KBP.				anterograde axon cargo transport|apoptosis|nerve-nerve synaptic transmission|neuromuscular synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)	2	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)												0.666667	81.52335	82.420441	24	12	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)	Silent	SNP	10259009	10259009	8595	1	G	A	A	39	39	KIF1B	A	1	1
KIF1B	23095	broad.mit.edu	36	1	10344358	10344358	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:10344358G>T	uc001aqz.2	+	c.4192G>T	c.(4192-4194)GCT>TCT	p.A1398S	KIF1B_uc001aqw.2_Missense_Mutation_p.A1352S|KIF1B_uc001aqx.2_Missense_Mutation_p.A1398S|KIF1B_uc001aqy.2_Missense_Mutation_p.A1372S|KIF1B_uc001ara.2_Missense_Mutation_p.A1358S|KIF1B_uc001arb.2_Missense_Mutation_p.A1384S	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	1398					anterograde axon cargo transport|apoptosis|nerve-nerve synaptic transmission|neuromuscular synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)	2	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)												0.116505	26.289203	56.070202	24	182	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)	Missense_Mutation	SNP	10344358	10344358	8595	1	G	T	T	42	42	KIF1B	T	3	3
CASZ1	54897	broad.mit.edu	36	1	10642983	10642983	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:10642983G>A	uc001aro.1	-	c.703C>T	c.(703-705)CGG>TGG	p.R235W	CASZ1_uc001arp.1_Missense_Mutation_p.R235W|CASZ1_uc001arq.1_Missense_Mutation_p.R94W|CASZ1_uc009vmx.1_Missense_Mutation_p.R259W	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a	235					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)												0.747475	230.291953	235.821061	74	25	GG		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)	Missense_Mutation	SNP	10642983	10642983	2804	1	G	A	A	38	38	CASZ1	A	1	1
GSTM1	2944	broad.mit.edu	36	1	110034626	110034626	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:110034626G>T	uc001dyk.1	+	c.484G>T	c.(484-486)GAT>TAT	p.D162Y	GSTM1_uc001dyl.1_Intron	NM_000561	NP_000552	P09488	GSTM1_HUMAN	glutathione S-transferase mu 1 isoform 1	162	GST C-terminal.				xenobiotic metabolic process	cytosol	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)			Glutathione(DB00143)									0.867647	1732.959107	1813.257114	531	81	GG		KEEP	---	---	---	---	capture		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Missense_Mutation	SNP	110034626	110034626	7117	1	G	T	T	45	45	GSTM1	T	3	3
MASP2	10747	broad.mit.edu	36	1	11017482	11017482	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:11017482G>A	uc001aru.1	-	c.1077C>T	c.(1075-1077)CCC>CCT	p.P359P		NM_006610	NP_006601	O00187	MASP2_HUMAN	mannan-binding lectin serine protease 2 isoform	359	Sushi 1.				complement activation, classical pathway|complement activation, lectin pathway|proteolysis	extracellular region	calcium ion binding|calcium-dependent protein binding|serine-type endopeptidase activity			ovary(2)|pancreas(1)	3	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)				GBM(35;611 746 20780 22741 36496)								0.7	94.914646	96.344315	28	12	GG		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)	Silent	SNP	11017482	11017482	9707	1	G	A	A	39	39	MASP2	A	1	1
CD53	963	broad.mit.edu	36	1	111239134	111239134	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:111239134C>T	uc001dzw.1	+	c.357C>T	c.(355-357)ACC>ACT	p.T119T	CD53_uc001dzx.1_Silent_p.T119T|CD53_uc001dzy.1_Silent_p.T119T	NM_001040033	NP_001035122	P19397	CD53_HUMAN	CD53 antigen	119	Extracellular (Potential).				signal transduction	integral to membrane|plasma membrane					0		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)												0.8125	311.27949	321.536312	91	21	CC		KEEP	---	---	---	---	capture		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)	Silent	SNP	111239134	111239134	3151	1	C	T	T	23	23	CD53	T	1	1
PTCHD2	57540	broad.mit.edu	36	1	11518229	11518229	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:11518229G>A	uc001ash.2	+	c.3757G>A	c.(3757-3759)GTC>ATC	p.V1253I		NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1253	Extracellular (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)												0.797386	381.69029	394.262263	122	31	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)	Missense_Mutation	SNP	11518229	11518229	13187	1	G	A	A	40	40	PTCHD2	A	1	1
CASQ2	845	broad.mit.edu	36	1	116049351	116049351	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:116049351C>T	uc001efx.2	-	c.924G>A	c.(922-924)CCG>CCA	p.P308P		NM_001232	NP_001223	O14958	CASQ2_HUMAN	cardiac calsequestrin 2 precursor	308					heart development|striated muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding				0	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)												0.803279	165.611388	170.846941	49	12	CC		KEEP	---	---	---	---	capture		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)	Silent	SNP	116049351	116049351	2800	1	C	T	T	23	23	CASQ2	T	1	1
ZNF697	90874	broad.mit.edu	36	1	119968129	119968129	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:119968129G>A	uc001ehy.1	-	c.360C>T	c.(358-360)GAC>GAT	p.D120D		NM_001080470	NP_001073939	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	120					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)												0.875	91.215194	95.610066	28	4	GG		KEEP	---	---	---	---	capture		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)	Silent	SNP	119968129	119968129	18695	1	G	A	A	40	40	ZNF697	A	1	1
NOTCH2	4853	broad.mit.edu	36	1	120260690	120260690	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:120260690G>A	uc001eik.1	-	c.6178C>T	c.(6178-6180)CGC>TGC	p.R2060C		NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	2060	Cytoplasmic (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(7)|ovary(4)|lung(3)|central_nervous_system(2)|kidney(2)|breast(1)	19	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)							p.R2060C(NCIH520-Tumor)|p.R2060C(IMR32-Tumor)	581				0.766667	150.076948	153.98225	46	14	GG		KEEP	---	---	---	---	capture		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)	Missense_Mutation	SNP	120260690	120260690	10951	1	G	A	A	38	38	NOTCH2	A	1	1
AADACL4	343066	broad.mit.edu	36	1	12649206	12649206	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:12649206G>A	uc001auf.1	+	c.1097G>A	c.(1096-1098)CGC>CAC	p.R366H		NM_001013630	NP_001013652	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	366	Lumenal (Potential).					integral to membrane	carboxylesterase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)												0.823256	575.483866	596.643342	177	38	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)	Missense_Mutation	SNP	12649206	12649206	14	1	G	A	A	38	38	AADACL4	A	1	1
HNRNPCL1	343069	broad.mit.edu	36	1	12830381	12830381	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:12830381G>A	uc009vno.1	-	c.349C>T	c.(349-351)CGG>TGG	p.R117W	HNRNPCL1_uc001aul.1_Missense_Mutation_p.R117W	NM_001013631	NP_001013653	O60812	HNRCL_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	117						ribonucleoprotein complex	nucleotide binding				0														0.772059	337.434043	346.667123	105	31	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12830381	12830381	7555	1	G	A	A	40	40	HNRNPCL1	A	1	1
SNX27	81609	broad.mit.edu	36	1	149897494	149897494	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:149897494C>T	uc001eyn.1	+	c.703C>T	c.(703-705)CGA>TGA	p.R235*	SNX27_uc001eyo.1_Nonsense_Mutation_p.R142*|SNX27_uc001eyp.2_Nonsense_Mutation_p.R49*	NM_030918	NP_112180	Q96L92	SNX27_HUMAN	sorting nexin family member 27	235	PX.				cell communication|protein transport|signal transduction	cytosol|early endosome	phosphatidylinositol binding|protein binding			ovary(2)|central_nervous_system(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)					Colon(46;291 966 40145 41237 41888)								0.755396	354.838944	363.098866	105	34	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(543;0.181)		Nonsense_Mutation	SNP	149897494	149897494	15397	1	C	T	T	23	23	SNX27	T	5	1
LINGO4	339398	broad.mit.edu	36	1	150041594	150041594	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150041594G>A	uc001ezf.1	-	c.211C>T	c.(211-213)CGC>TGC	p.R71C	LINGO4_uc009wnc.1_Missense_Mutation_p.R71C	NM_001004432	NP_001004432	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	71	Extracellular (Potential).|LRR 1.					integral to membrane				large_intestine(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)													0.785714	74.410303	76.623726	22	6	GG		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(543;0.181)		Missense_Mutation	SNP	150041594	150041594	9144	1	G	A	A	39	39	LINGO4	A	1	1
FLG	2312	broad.mit.edu	36	1	150550142	150550142	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150550142C>T	uc001ezu.1	-	c.3844G>A	c.(3844-3846)GAC>AAC	p.D1282N		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1282	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)	9	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)													0.700326	689.998812	701.002564	215	92	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(543;0.206)		Missense_Mutation	SNP	150550142	150550142	6160	1	C	T	T	31	31	FLG	T	1	1
DENND4B	9909	broad.mit.edu	36	1	152180147	152180147	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:152180147C>T	uc001fdd.1	-	c.1183G>A	c.(1183-1185)GGT>AGT	p.G395S		NM_014856	NP_055671	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	395	DENN.									ovary(1)	1	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)													0.625	29.849981	30.068566	10	6	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(543;0.151)		Missense_Mutation	SNP	152180147	152180147	4613	1	C	T	T	21	21	DENND4B	T	2	2
IQGAP3	128239	broad.mit.edu	36	1	154784625	154784625	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:154784625C>T	uc001fpf.1	-	c.2168G>A	c.(2167-2169)CGC>CAC	p.R723H		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	723					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)	5	all_hematologic(923;0.088)|Hepatocellular(266;0.158)													0.714286	90.754978	92.481922	30	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	154784625	154784625	8119	1	C	T	T	27	27	IQGAP3	T	1	1
INSRR	3645	broad.mit.edu	36	1	155078667	155078667	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:155078667C>A	uc001fqg.1	-	c.3258G>T	c.(3256-3258)CAG>CAT	p.Q1086H	NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron	NM_014215	NP_055030	P14616	INSRR_HUMAN	insulin receptor-related receptor precursor	1086	Cytoplasmic (Potential).|Protein kinase.				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity			lung(7)|ovary(4)|kidney(1)|central_nervous_system(1)|skin(1)	14	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)									299				0.652174	94.659343	95.598113	30	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	155078667	155078667	8075	1	C	A	A	28	28	INSRR	A	3	3
NTRK1	4914	broad.mit.edu	36	1	155104596	155104596	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:155104596G>A	uc001fqh.1	+	c.505G>A	c.(505-507)GGA>AGA	p.G169R	NTRK1_uc001fqf.1_Missense_Mutation_p.G139R|NTRK1_uc009wsi.1_5'UTR|NTRK1_uc001fqi.1_Missense_Mutation_p.G169R|NTRK1_uc009wsk.1_Missense_Mutation_p.G169R	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	169	LRRCT.|Extracellular (Potential).				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|stomach(1)|central_nervous_system(1)	16	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)					290	TSP Lung(10;0.080)			0.777778	397.851963	408.691893	119	34	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	155104596	155104596	11111	1	G	A	A	39	39	NTRK1	A	1	1
SPTA1	6708	broad.mit.edu	36	1	156902790	156902790	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:156902790G>A	uc001fst.1	-	c.2160C>T	c.(2158-2160)GCC>GCT	p.A720A		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	720	Spectrin 8.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|breast(1)	5	all_hematologic(112;0.0378)													0.666667	105.409847	106.588994	32	16	GG		KEEP	---	---	---	---	capture			Silent	SNP	156902790	156902790	15630	1	G	A	A	39	39	SPTA1	A	1	1
FCGR3A	2214	broad.mit.edu	36	1	159785431	159785431	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:159785431G>A	uc001gar.1	-	c.163C>T	c.(163-165)CGG>TGG	p.R55W	FCGR3A_uc001gas.1_Missense_Mutation_p.R55W|FCGR3A_uc001gat.2_Missense_Mutation_p.R19W|FCGR3A_uc009wuh.1_Missense_Mutation_p.R19W|FCGR3A_uc009wui.1_Missense_Mutation_p.R19W	NM_000569	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor	19	Extracellular (Potential).				immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)									0.6	9.225598	9.269248	3	2	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(70;0.00376)		Missense_Mutation	SNP	159785431	159785431	6021	1	G	A	A	38	38	FCGR3A	A	1	1
DUSP27	92235	broad.mit.edu	36	1	165361704	165361704	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:165361704G>A	uc001geb.1	+	c.712G>A	c.(712-714)GCC>ACC	p.A238T		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	238	Tyrosine-protein phosphatase.				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3														0.77551	239.149644	246.009949	76	22	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	165361704	165361704	5009	1	G	A	A	38	38	DUSP27	A	1	1
CROCC	9696	broad.mit.edu	36	1	17168949	17168949	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:17168949G>A	uc001azt.2	+	c.5384G>A	c.(5383-5385)CGA>CAA	p.R1795Q	CROCC_uc001azu.2_Missense_Mutation_p.R1098Q|CROCC_uc001azv.2_Missense_Mutation_p.R131Q	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil, rootletin	1795					cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)	4		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)												0.785714	319.767063	329.257039	99	27	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)	Missense_Mutation	SNP	17168949	17168949	4032	1	G	A	A	37	37	CROCC	A	1	1
CACYBP	27101	broad.mit.edu	36	1	173240572	173240572	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:173240572C>T	uc001gkj.1	+	c.215C>T	c.(214-216)ACG>ATG	p.T72M	CACYBP_uc001gki.1_Missense_Mutation_p.T29M	NM_014412	NP_001007215	Q9HB71	CYBP_HUMAN	calcyclin binding protein isoform 1	72	Interaction with SIAH1.					beta-catenin destruction complex	protein homodimerization activity				0														0.726027	176.005708	179.366645	53	20	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	173240572	173240572	2680	1	C	T	T	19	19	CACYBP	T	1	1
CEP350	9857	broad.mit.edu	36	1	178269815	178269815	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:178269815G>A	uc001gnt.1	+	c.3921G>A	c.(3919-3921)ACG>ACA	p.T1307T	CEP350_uc001gnu.1_Silent_p.T1140T	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	1307						centrosome|nucleus|spindle				ovary(4)	4														0.777778	69.687892	71.603381	21	6	GG		KEEP	---	---	---	---	capture			Silent	SNP	178269815	178269815	3387	1	G	A	A	37	37	CEP350	A	1	1
KIF21B	23046	broad.mit.edu	36	1	199226026	199226026	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:199226026G>C	uc001gvs.1	-	c.2893C>G	c.(2893-2895)CAG>GAG	p.Q965E	KIF21B_uc001gvr.1_Missense_Mutation_p.Q965E|KIF21B_uc009wzl.1_Missense_Mutation_p.Q965E	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	965	Potential.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3														0.21875	8.045575	10.582144	7	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	199226026	199226026	8600	1	G	C	C	46	46	KIF21B	C	3	3
TMCC2	9911	broad.mit.edu	36	1	203477323	203477323	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:203477323G>A	uc001hbz.1	+	c.275G>A	c.(274-276)CGT>CAT	p.R92H		NM_014858	NP_055673	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	92						integral to membrane				pancreas(1)	1	Breast(84;0.0871)													0.722222	81.860372	83.459624	26	10	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(75;0.117)		Missense_Mutation	SNP	203477323	203477323	16523	1	G	A	A	40	40	TMCC2	A	1	1
SLC41A1	254428	broad.mit.edu	36	1	204031193	204031193	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:204031193C>T	uc001hdh.1	-	c.1109G>A	c.(1108-1110)CGC>CAC	p.R370H	SLC41A1_uc001hdg.1_5'UTR	NM_173854	NP_776253	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 member 1	370						integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity				0	Breast(84;0.0799)													0.78125	80.186915	82.517698	25	7	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(75;0.0252)		Missense_Mutation	SNP	204031193	204031193	15126	1	C	T	T	27	27	SLC41A1	T	1	1
AVPR1B	553	broad.mit.edu	36	1	204391171	204391171	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:204391171G>A	uc001hds.2	+	c.108G>A	c.(106-108)GTG>GTA	p.V36V		NM_000707	NP_000698	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	36	Helical; Name=1; (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity			ovary(2)|large_intestine(1)	3					Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)									0.772727	744.012059	763.559198	221	65	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(75;0.0312)		Silent	SNP	204391171	204391171	1253	1	G	A	A	47	47	AVPR1B	A	2	2
CD34	947	broad.mit.edu	36	1	206127714	206127714	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:206127714C>T	uc001hgw.1	-	c.1150G>A	c.(1150-1152)GAA>AAA	p.E384K	CD34_uc001hgv.1_Missense_Mutation_p.E226K|CD34_uc001hgx.1_3'UTR	NM_001025109	NP_001020280	P28906	CD34_HUMAN	CD34 antigen isoform a	384	Cytoplasmic (Potential).				cell-cell adhesion|leukocyte migration|regulation of immune response	external side of plasma membrane|integral to membrane	carbohydrate binding			ovary(1)	1														0.710526	172.972812	175.99034	54	22	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	206127714	206127714	3134	1	C	T	T	31	31	CD34	T	1	1
PINK1	65018	broad.mit.edu	36	1	20843697	20843697	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:20843697C>T	uc001bdm.1	+	c.904C>T	c.(904-906)CGC>TGC	p.R302C	PINK1_uc001bdn.1_5'Flank	NM_032409	NP_115785	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1 precursor	302	Protein kinase.|Cytoplasmic (Potential).				cell death|intracellular protein kinase cascade|mitochondrion degradation|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of release of cytochrome c from mitochondria|regulation of protein complex assembly|regulation of protein ubiquitination|response to stress	cytosol|integral to membrane|mitochondrial outer membrane	ATP binding|C3HC4-type RING finger domain binding|calcium-dependent protein kinase activity|magnesium ion binding|protein serine/threonine kinase activity|ubiquitin protein ligase binding			ovary(2)|central_nervous_system(1)	3		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)				Esophageal Squamous(145;853 1803 8146 34412 35011)			p.R302C(SKNFI-Tumor)	367				0.782051	398.825389	410.265464	122	34	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	Missense_Mutation	SNP	20843697	20843697	12356	1	C	T	T	19	19	PINK1	T	1	1
KCNH1	3756	broad.mit.edu	36	1	209343508	209343508	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:209343508T>C	uc001hib.1	-	c.263A>G	c.(262-264)GAG>GGG	p.E88G	KCNH1_uc001hic.1_Missense_Mutation_p.E88G	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	88	Cytoplasmic (Potential).|PAS.				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5														0.691176	178.452841	180.668047	47	21	TT		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)	Missense_Mutation	SNP	209343508	209343508	8336	1	T	C	C	54	54	KCNH1	C	4	4
PROX1	5629	broad.mit.edu	36	1	212237184	212237184	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:212237184G>A	uc001hkh.1	+	c.683G>A	c.(682-684)CGA>CAA	p.R228Q	PROX1_uc001hkg.1_Missense_Mutation_p.R228Q	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	228					aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of gene-specific transcription|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of gene-specific transcription|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|promoter binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulator activity			ovary(3)|lung(1)|central_nervous_system(1)	5														0.766667	149.182468	153.10703	46	14	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)	Missense_Mutation	SNP	212237184	212237184	13003	1	G	A	A	37	37	PROX1	A	1	1
HSPG2	3339	broad.mit.edu	36	1	22043278	22043278	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:22043278C>T	uc009vqd.1	-	c.8569G>A	c.(8569-8571)GCC>ACC	p.A2857T	HSPG2_uc001bfj.1_Missense_Mutation_p.A2856T	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2856	Ig-like C2-type 14.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)	8		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)			Becaplermin(DB00102)|Palifermin(DB00039)									0.770186	383.110258	393.859591	124	37	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Missense_Mutation	SNP	22043278	22043278	7730	1	C	T	T	27	27	HSPG2	T	1	1
OBSCN	84033	broad.mit.edu	36	1	226528733	226528733	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:226528733G>A	uc009xez.1	+	c.5648G>A	c.(5647-5649)CGT>CAT	p.R1883H	OBSCN_uc001hsn.1_Missense_Mutation_p.R1883H	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	1883	Ig-like 18.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			large_intestine(7)|breast(5)|ovary(4)|skin(2)|stomach(1)|central_nervous_system(1)|pancreas(1)	21		Prostate(94;0.0405)								4006				0.666667	123.606581	125.079248	40	20	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	226528733	226528733	11217	1	G	A	A	40	40	OBSCN	A	1	1
PEX10	5192	broad.mit.edu	36	1	2327896	2327896	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:2327896C>T	uc001ajg.1	-	c.859G>A	c.(859-861)GTT>ATT	p.V287I	PEX10_uc001ajh.1_Missense_Mutation_p.V267I	NM_153818	NP_722540	O60683	PEX10_HUMAN	peroxisome biogenesis factor 10 isoform 1	267					protein import into peroxisome matrix|protein import into peroxisome matrix	integral to peroxisomal membrane|peroxisomal membrane	protein binding|protein C-terminus binding|zinc ion binding|zinc ion binding			central_nervous_system(1)	1	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)				GBM(12;9 508 1649 13619)								0.830508	161.108063	167.209355	49	10	CC		KEEP	---	---	---	---	capture		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00102)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0169)|Lung(427;0.199)	Missense_Mutation	SNP	2327896	2327896	12158	1	C	T	T	19	19	PEX10	T	1	1
HTR1D	3352	broad.mit.edu	36	1	23392345	23392345	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:23392345C>T	uc001bgn.1	-	c.955G>A	c.(955-957)GTG>ATG	p.V319M		NM_000864	NP_000855	P28221	5HT1D_HUMAN	5-hydroxytryptamine (serotonin) receptor 1D	319	Helical; Name=6; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|intestine smooth muscle contraction|synaptic transmission	integral to plasma membrane	serotonin receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000779)|all_lung(284;0.00135)|Breast(348;0.0385)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)			Almotriptan(DB00918)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Tegaserod(DB01079)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)									0.79375	404.963134	417.941224	127	33	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.69e-27)|Colorectal(126;4.86e-08)|COAD - Colon adenocarcinoma(152;2.86e-06)|GBM - Glioblastoma multiforme(114;0.00012)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(1967;0.00122)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.083)|LUSC - Lung squamous cell carcinoma(448;0.185)	Missense_Mutation	SNP	23392345	23392345	7738	1	C	T	T	19	19	HTR1D	T	1	1
MAP3K6	9064	broad.mit.edu	36	1	27563005	27563005	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:27563005C>T	uc001bny.1	-	c.854G>A	c.(853-855)CGC>CAC	p.R285H	MAP3K6_uc009vsw.1_Missense_Mutation_p.R277H|MAP3K6_uc001bnz.1_5'Flank	NM_004672	NP_004663	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase	285					activation of JUN kinase activity		ATP binding|magnesium ion binding|MAP kinase kinase kinase activity			breast(4)|lung(3)|ovary(1)|central_nervous_system(1)	9		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)								422				0.763158	93.191676	95.596554	29	9	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)	Missense_Mutation	SNP	27563005	27563005	9637	1	C	T	T	27	27	MAP3K6	T	1	1
PTPRU	10076	broad.mit.edu	36	1	29491032	29491032	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:29491032G>A	uc001bru.1	+	c.2413G>A	c.(2413-2415)GCC>ACC	p.A805T	PTPRU_uc001brv.1_Missense_Mutation_p.A795T|PTPRU_uc001brw.1_Missense_Mutation_p.A795T|PTPRU_uc009vtq.1_Missense_Mutation_p.A795T|PTPRU_uc009vtr.1_Missense_Mutation_p.A795T	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	805	Mediates interaction with CTNNB1 (By similarity).|Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)								874				0.873563	247.95073	259.797424	76	11	GG		KEEP	---	---	---	---	capture		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)	Missense_Mutation	SNP	29491032	29491032	13271	1	G	A	A	38	38	PTPRU	A	1	1
COL16A1	1307	broad.mit.edu	36	1	31909803	31909803	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:31909803G>A	uc001btk.1	-	c.3150C>T	c.(3148-3150)ATC>ATT	p.I1050I	COL16A1_uc001bti.1_5'Flank|COL16A1_uc001btj.1_Silent_p.I863I	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	1050	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)				Colon(143;498 1786 21362 25193 36625)								0.890625	191.218981	200.890862	57	7	GG		KEEP	---	---	---	---	capture		STAD - Stomach adenocarcinoma(196;0.059)	Silent	SNP	31909803	31909803	3811	1	G	A	A	37	37	COL16A1	A	1	1
BAI2	576	broad.mit.edu	36	1	31973838	31973838	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:31973838C>T	uc001btn.1	-	c.3283G>A	c.(3283-3285)GGA>AGA	p.G1095R	BAI2_uc001bto.1_Missense_Mutation_p.G1095R|BAI2_uc001btm.1_5'UTR|BAI2_uc001btp.1_5'UTR	NM_001703	NP_001694	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1095	Helical; Name=5; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)	3		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)												0.674699	192.128653	194.376753	56	27	CC		KEEP	---	---	---	---	capture		STAD - Stomach adenocarcinoma(196;0.0557)	Missense_Mutation	SNP	31973838	31973838	1320	1	C	T	T	23	23	BAI2	T	1	1
KIAA1522	57648	broad.mit.edu	36	1	33009069	33009069	+	Silent	SNP	C	A	A			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:33009069C>A	uc001bvu.1	+	c.1702C>A	c.(1702-1704)CGG>AGG	p.R568R	KIAA1522_uc001bvv.1_Silent_p.R509R	NM_020888	NP_065939	Q9P206	K1522_HUMAN	hypothetical protein LOC57648	509	Pro-rich.										0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)												0.175439	16.817924	22.480944	10	47	CC		KEEP	---	---	---	---	capture			Silent	SNP	33009069	33009069	8547	1	C	A	A	23	23	KIAA1522	A	3	3
YARS	8565	broad.mit.edu	36	1	33049202	33049202	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:33049202C>T	uc001bvy.1	-	c.101G>A	c.(100-102)CGG>CAG	p.R34Q		NM_003680	NP_003671	P54577	SYYC_HUMAN	tyrosyl-tRNA synthetase	34					apoptosis|tyrosyl-tRNA aminoacylation	cytosol|extracellular space|nucleus|soluble fraction	ATP binding|interleukin-8 receptor binding|signal transducer activity|tRNA binding|tyrosine-tRNA ligase activity				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)			L-Tyrosine(DB00135)									0.47874	977.979008	978.227654	304	331	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33049202	33049202	18050	1	C	T	T	23	23	YARS	T	1	1
CSMD2	114784	broad.mit.edu	36	1	34030654	34030654	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:34030654C>T	uc001bxm.1	-	c.1507G>A	c.(1507-1509)GGT>AGT	p.G503S	CSMD2_uc001bxn.1_Missense_Mutation_p.G463S	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	463	CUB 3.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(5)|pancreas(1)	6		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)												0.75	398.844465	407.706341	117	39	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	34030654	34030654	4086	1	C	T	T	23	23	CSMD2	T	1	1
GJB3	2707	broad.mit.edu	36	1	35023428	35023428	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:35023428C>T	uc001bxx.1	+	c.478C>T	c.(478-480)CGC>TGC	p.R160C	GJB3_uc001bxy.1_Missense_Mutation_p.R160C|GJB3_uc001bxz.2_Missense_Mutation_p.R160C	NM_024009	NP_076872	O75712	CXB3_HUMAN	connexin 31	160	Extracellular (Potential).				cell communication	connexon complex|integral to membrane	gap junction channel activity				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)												0.137931	33.400576	55.450334	24	150	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35023428	35023428	6677	1	C	T	T	27	27	GJB3	T	1	1
NCDN	23154	broad.mit.edu	36	1	35801519	35801519	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:35801519C>T	uc001bza.1	+	c.1515C>T	c.(1513-1515)CAC>CAT	p.H505H	NCDN_uc001bzb.1_Silent_p.H505H|NCDN_uc001bzc.1_Silent_p.H488H	NM_001014839	NP_001014841	Q9UBB6	NCDN_HUMAN	neurochondrin isoform 1	505					neuron projection development	cytosol|dendrite|neuronal cell body				large_intestine(2)|pancreas(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)												0.767857	551.373763	566.086594	172	52	CC		KEEP	---	---	---	---	capture			Silent	SNP	35801519	35801519	10613	1	C	T	T	19	19	NCDN	T	1	1
ADPRHL2	54936	broad.mit.edu	36	1	36330193	36330193	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:36330193C>T	uc001bzt.1	+	c.612C>T	c.(610-612)GGC>GGT	p.G204G	ADPRHL2_uc001bzu.1_Silent_p.G50G	NM_017825	NP_060295	Q9NX46	ARHL2_HUMAN	ADP-ribosylhydrolase like 2	204						cytoplasm|nucleus	metal ion binding|poly(ADP-ribose) glycohydrolase activity			pancreas(1)	1		Myeloproliferative disorder(586;0.0393)												0.854545	298.400372	311.691788	94	16	CC		KEEP	---	---	---	---	capture			Silent	SNP	36330193	36330193	334	1	C	T	T	27	27	ADPRHL2	T	1	1
CCDC27	148870	broad.mit.edu	36	1	3660559	3660559	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:3660559C>T	uc001akv.1	+	c.336C>T	c.(334-336)GCC>GCT	p.A112A		NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	112											0	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)												0.116822	29.881031	60.740811	25	189	CC		KEEP	---	---	---	---	capture		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)	Silent	SNP	3660559	3660559	2923	1	C	T	T	23	23	CCDC27	T	1	1
DFFB	1677	broad.mit.edu	36	1	3774461	3774461	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:3774461G>A	uc001alc.1	+	c.494G>A	c.(493-495)CGG>CAG	p.R165Q	DFFB_uc001ale.1_Non-coding_Transcript|DFFB_uc009vlp.1_Non-coding_Transcript|DFFB_uc001alb.1_Non-coding_Transcript|DFFB_uc009vlq.1_Non-coding_Transcript|DFFB_uc009vlr.1_Missense_Mutation_p.R116Q|DFFB_uc001ald.1_Missense_Mutation_p.R101Q	NM_004402	NP_004393	O76075	DFFB_HUMAN	DNA fragmentation factor, 40 kD, beta	165					apoptotic chromosome condensation|DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction	cytosol|nucleoplasm	deoxyribonuclease activity|enzyme binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)								1253				0.811075	854.791297	882.735896	249	58	GG		KEEP	---	---	---	---	capture		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)	Missense_Mutation	SNP	3774461	3774461	4632	1	G	A	A	39	39	DFFB	A	1	1
NT5C1A	84618	broad.mit.edu	36	1	39903856	39903856	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:39903856G>A	uc001cdq.1	-	c.357C>T	c.(355-357)GAC>GAT	p.D119D		NM_032526	NP_115915	Q9BXI3	5NT1A_HUMAN	5'-nucleotidase, cytosolic IA	119					purine base metabolic process|purine nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			ovary(1)	1	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)												0.8	261.954474	270.335076	80	20	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)		Silent	SNP	39903856	39903856	11090	1	G	A	A	40	40	NT5C1A	A	1	1
MFSD2A	84879	broad.mit.edu	36	1	40206617	40206617	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:40206617C>T	uc001cev.1	+	c.1272C>T	c.(1270-1272)GAC>GAT	p.D424D	MFSD2A_uc001ceu.1_Silent_p.D411D|MFSD2A_uc009vvy.1_Non-coding_Transcript|MFSD2A_uc001cex.1_Silent_p.D75D	NM_032793	NP_116182	Q8NA29	MFS2A_HUMAN	major facilitator superfamily domain containing	424					transmembrane transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)|pancreas(1)	2										141				0.726027	167.499569	170.857357	53	20	CC		KEEP	---	---	---	---	capture			Silent	SNP	40206617	40206617	9920	1	C	T	T	19	19	MFSD2A	T	1	1
PTPRF	5792	broad.mit.edu	36	1	43858034	43858034	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:43858034G>A	uc001cjr.1	+	c.5029G>A	c.(5029-5031)GAA>AAA	p.E1677K	PTPRF_uc001cjs.1_Missense_Mutation_p.E1668K|PTPRF_uc001cju.1_Missense_Mutation_p.E1066K|PTPRF_uc009vwt.1_Missense_Mutation_p.E1237K|PTPRF_uc001cjv.1_Missense_Mutation_p.E1148K|PTPRF_uc001cjw.1_Missense_Mutation_p.E903K	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1677	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|lung(1)|kidney(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)												0.811881	264.285982	273.497067	82	19	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43858034	43858034	13258	1	G	A	A	37	37	PTPRF	A	1	1
IPO13	9670	broad.mit.edu	36	1	44194582	44194582	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:44194582C>T	uc001ckx.1	+	c.825C>T	c.(823-825)TAC>TAT	p.Y275Y		NM_014652	NP_055467	O94829	IPO13_HUMAN	importin 13	275	HEAT 3.				protein import into nucleus	cytoplasm|nucleus	protein binding|protein transporter activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)												0.82	131.600174	136.415238	41	9	CC		KEEP	---	---	---	---	capture			Silent	SNP	44194582	44194582	8095	1	C	T	T	19	19	IPO13	T	1	1
DPH2	1802	broad.mit.edu	36	1	44210006	44210006	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:44210006G>A	uc001ckz.1	+	c.845G>A	c.(844-846)CGC>CAC	p.R282H	DPH2_uc001cla.1_Intron|DPH2_uc001clb.1_Missense_Mutation_p.R206H	NM_001384	NP_001375	Q9BQC3	DPH2_HUMAN	diphthamide biosynthesis protein 2 isoform a	282					peptidyl-diphthamide biosynthetic process from peptidyl-histidine	cytoplasm				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)												0.259259	86.562777	93.649618	35	100	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44210006	44210006	4904	1	G	A	A	38	38	DPH2	A	1	1
GLIS1	148979	broad.mit.edu	36	1	53768119	53768119	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:53768119G>A	uc001cvr.1	-	c.890C>T	c.(889-891)CCG>CTG	p.P297L		NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1	297	C2H2-type 4.				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|specific RNA polymerase II transcription factor activity|zinc ion binding				0														0.106061	11.354593	31.709384	14	118	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53768119	53768119	6713	1	G	A	A	39	39	GLIS1	A	1	1
HOOK1	51361	broad.mit.edu	36	1	60098518	60098518	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:60098518C>T	uc009wad.1	+	c.1462C>T	c.(1462-1464)CGT>TGT	p.R488C	HOOK1_uc001czo.1_Missense_Mutation_p.R488C|HOOK1_uc001czp.1_Non-coding_Transcript	NM_015888	NP_056972	Q9UJC3	HOOK1_HUMAN	hook homolog 1	488	Sufficient for interaction with microtubules.|Potential.				early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding			ovary(1)|breast(1)	2	all_cancers(7;0.000129)													0.841667	328.734733	342.080494	101	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60098518	60098518	7574	1	C	T	T	19	19	HOOK1	T	1	1
PHF13	148479	broad.mit.edu	36	1	6604111	6604111	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:6604111C>T	uc001aob.2	+	c.730C>T	c.(730-732)CGC>TGC	p.R244C		NM_153812	NP_722519	Q86YI8	PHF13_HUMAN	PHD finger protein 13	244	Interaction with trimethylated histone H3 (H3K4).|PHD-type.				cell division|chromatin modification|mitotic chromosome condensation	nucleoplasm	chromatin binding|methylated histone residue binding|zinc ion binding				0	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;1.46e-33)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)												0.846154	229.016124	238.017057	66	12	CC		KEEP	---	---	---	---	capture		Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|STAD - Stomach adenocarcinoma(132;0.0165)|READ - Rectum adenocarcinoma(331;0.0642)	Missense_Mutation	SNP	6604111	6604111	12247	1	C	T	T	23	23	PHF13	T	1	1
NEGR1	257194	broad.mit.edu	36	1	71831105	71831105	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:71831105G>A	uc001dfw.1	-	c.923C>T	c.(922-924)GCG>GTG	p.A308V	NEGR1_uc001dfv.1_Missense_Mutation_p.A180V	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	308	Ig-like C2-type 3.				cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)												0.127778	30.526569	54.815652	23	157	GG		KEEP	---	---	---	---	capture		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)	Missense_Mutation	SNP	71831105	71831105	10716	1	G	A	A	38	38	NEGR1	A	1	1
NOC2L	26155	broad.mit.edu	36	1	870337	870337	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:870337G>A	uc009vjq.1	-	c.2106C>T	c.(2104-2106)GAC>GAT	p.D702D	NOC2L_uc009vjp.1_Silent_p.D164D|NOC2L_uc001aby.2_Silent_p.D499D|NOC2L_uc001abz.2_Silent_p.D702D	NM_015658	NP_056473	Q9Y3T9	NOC2L_HUMAN	nucleolar complex associated 2 homolog	702	Asp/Glu-rich (acidic).					nucleolus	protein binding			ovary(1)|skin(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)												0.75	73.91142	75.729301	24	8	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.86e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.08e-23)|Colorectal(212;0.000161)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(365;0.000475)|Kidney(185;0.00231)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Silent	SNP	870337	870337	10916	1	G	A	A	40	40	NOC2L	A	1	1
DR1	1810	broad.mit.edu	36	1	93598744	93598744	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:93598744C>T	uc001dpu.1	+	c.491C>T	c.(490-492)GCG>GTG	p.A164V		NM_001938	NP_001929	Q01658	NC2B_HUMAN	down-regulator of transcription 1	164	Ala/Gln-rich.				histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Ada2/Gcn5/Ada3 transcription activator complex	sequence-specific DNA binding|TBP-class protein binding|transcription corepressor activity				0		all_lung(203;0.00252)|Lung NSC(277;0.011)|Melanoma(281;0.155)												0.111111	12.219133	28.370059	12	96	CC		KEEP	---	---	---	---	capture		all cancers(265;0.0032)|GBM - Glioblastoma multiforme(16;0.0165)|Epithelial(280;0.0977)	Missense_Mutation	SNP	93598744	93598744	4936	1	C	T	T	27	27	DR1	T	1	1
CLSTN1	22883	broad.mit.edu	36	1	9718626	9718626	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:9718626G>A	uc001aqh.1	-	c.1638C>T	c.(1636-1638)TCC>TCT	p.S546S	CLSTN1_uc001aqf.1_5'Flank|CLSTN1_uc001aqg.1_Silent_p.S179S|CLSTN1_uc001aqi.1_Silent_p.S536S	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN	calsyntenin 1 isoform 1	546	Extracellular (Potential).				homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding				0	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)												0.781095	527.800482	542.515382	157	44	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)	Silent	SNP	9718626	9718626	3699	1	G	A	A	39	39	CLSTN1	A	1	1
SNAP25	6616	broad.mit.edu	36	20	10221820	10221820	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:10221820C>T	uc002wnq.1	+	c.175C>T	c.(175-177)CGC>TGC	p.R59C	SNAP25_uc002wnr.1_Intron|SNAP25_uc002wns.1_De_novo_Start_OutOfFrame|SNAP25_uc010gca.1_Intron|SNAP25_uc010gcb.1_De_novo_Start_OutOfFrame|SNAP25_uc010gcc.1_Intron	NM_130811	NP_570824	P60880	SNP25_HUMAN	synaptosomal-associated protein 25 isoform	59	Interaction with CENPF (By similarity).|t-SNARE coiled-coil homology 1.				energy reserve metabolic process|glutamate secretion|neurotransmitter uptake|synaptic vesicle docking involved in exocytosis	cell junction|growth cone|perinuclear region of cytoplasm|synapse|synaptosome					0					Botulinum Toxin Type A(DB00083)									0.728155	244.764891	249.59819	75	28	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10221820	10221820	15330	20	C	T	T	19	19	SNAP25	T	1	1
STK35	140901	broad.mit.edu	36	20	2045458	2045458	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:2045458G>A	uc010gak.1	+	c.640G>A	c.(640-642)GCC>ACC	p.A214T	STK35_uc002wfw.2_Missense_Mutation_p.A214T	NM_080836	NP_543026	Q8TDR2	STK35_HUMAN	serine/threonine kinase 35	347	Protein kinase.				protein phosphorylation	cytoplasm|nucleolus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1										88				0.745902	283.7645	290.453912	91	31	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2045458	2045458	15821	20	G	A	A	38	38	STK35	A	1	1
TM9SF4	9777	broad.mit.edu	36	20	30209402	30209402	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:30209402G>A	uc002wxj.2	+	c.1474G>A	c.(1474-1476)GAG>AAG	p.E492K	TM9SF4_uc002wxk.2_Missense_Mutation_p.E475K|TM9SF4_uc010gdz.1_Missense_Mutation_p.E371K	NM_014742	NP_055557	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	492						integral to membrane				central_nervous_system(1)|pancreas(1)	2														0.777778	334.175934	343.731332	105	30	GG		KEEP	---	---	---	---	capture	UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		Missense_Mutation	SNP	30209402	30209402	16510	20	G	A	A	37	37	TM9SF4	A	1	1
POFUT1	23509	broad.mit.edu	36	20	30266853	30266853	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:30266853G>A	uc002wxp.1	+	c.367G>A	c.(367-369)GTG>ATG	p.V123M	POFUT1_uc002wxo.1_Missense_Mutation_p.V123M	NM_015352	NP_056167	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1 isoform 1	123					fucose metabolic process|Notch signaling pathway|O-glycan processing|regulation of transcription, DNA-dependent	endoplasmic reticulum|membrane	peptide-O-fucosyltransferase activity			breast(1)	1														0.70303	361.938153	368.020843	116	49	GG		KEEP	---	---	---	---	capture	UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		Missense_Mutation	SNP	30266853	30266853	12611	20	G	A	A	44	44	POFUT1	A	2	2
C20orf112	140688	broad.mit.edu	36	20	30499149	30499149	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:30499149G>A	uc002wxu.2	-	c.1222C>T	c.(1222-1224)CGG>TGG	p.R408W	C20orf112_uc010gec.1_Missense_Mutation_p.R233W	NM_080616	NP_542183	Q96MY1	CT112_HUMAN	hypothetical protein LOC140688	408											0														0.767857	133.354019	137.051296	43	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30499149	30499149	2157	20	G	A	A	38	38	C20orf112	A	1	1
C20orf117	140710	broad.mit.edu	36	20	34877835	34877835	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:34877835C>T	uc002xgd.1	-	c.710G>A	c.(709-711)CGG>CAG	p.R237Q	C20orf117_uc002xge.1_Non-coding_Transcript	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710	237											0		Myeloproliferative disorder(115;0.00874)												0.690476	97.495475	98.860701	29	13	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	34877835	34877835	2159	20	C	T	T	23	23	C20orf117	T	1	1
TOX2	84969	broad.mit.edu	36	20	42113401	42113401	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:42113401G>A	uc010ggo.1	+	c.453G>A	c.(451-453)TCG>TCA	p.S151S	TOX2_uc002xle.2_Silent_p.S109S|TOX2_uc010ggp.1_Silent_p.S109S|TOX2_uc002xlf.2_Silent_p.S160S|TOX2_uc002xlg.1_Silent_p.S109S	NM_001098797	NP_001092267	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	160					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)												0.788462	135.457883	139.593803	41	11	GG		KEEP	---	---	---	---	capture	COAD - Colon adenocarcinoma(18;0.00189)		Silent	SNP	42113401	42113401	16920	20	G	A	A	39	39	TOX2	A	1	1
KCNS1	3787	broad.mit.edu	36	20	43159825	43159825	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:43159825G>A	uc002xnc.1	-	c.1002C>T	c.(1000-1002)TTC>TTT	p.F334F	KCNS1_uc002xnd.1_Silent_p.F334F	NM_002251	NP_002242	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel	334						voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity|protein binding				0		Myeloproliferative disorder(115;0.0122)												0.852941	96.195432	100.264191	29	5	GG		KEEP	---	---	---	---	capture			Silent	SNP	43159825	43159825	8393	20	G	A	A	37	37	KCNS1	A	1	1
SPATA2	9825	broad.mit.edu	36	20	47955724	47955724	+	Missense_Mutation	SNP	C	T	T	rs36105169	unknown	TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:47955724C>T	uc010gie.1	-	c.1402G>A	c.(1402-1404)GCC>ACC	p.A468T	SPATA2_uc002xuw.1_Missense_Mutation_p.A468T	NM_006038	NP_006029	Q9UM82	SPAT2_HUMAN	spermatogenesis associated 2	468					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm|nucleus				central_nervous_system(1)	1	Hepatocellular(150;0.133)													0.754545	244.239599	250.741172	83	27	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(9;4.03e-06)		Missense_Mutation	SNP	47955724	47955724	15513	20	C	T	T	27	27	SPATA2	T	1	1
CABLES2	81928	broad.mit.edu	36	20	60402680	60402680	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:60402680C>T	uc002ycv.2	-	c.642G>A	c.(640-642)CCG>CCA	p.P214P		NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	214					cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)													0.642857	141.185392	142.443388	45	25	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Silent	SNP	60402680	60402680	2646	20	C	T	T	19	19	CABLES2	T	1	1
C20orf11	54994	broad.mit.edu	36	20	61046635	61046635	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:61046635G>A	uc002ydy.1	+	c.613G>A	c.(613-615)GAG>AAG	p.E205K		NM_017896	NP_060366	Q9NWU2	CT011_HUMAN	chromosome 20 open reading frame 11	205						nucleus	protein binding				0	Breast(26;5.68e-08)													0.762712	149.602551	153.322375	45	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61046635	61046635	2155	20	G	A	A	37	37	C20orf11	A	1	1
ARFGAP1	55738	broad.mit.edu	36	20	61380732	61380732	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:61380732G>A	uc002yel.1	+	c.567G>A	c.(565-567)ACG>ACA	p.T189T	ARFGAP1_uc002yem.1_Silent_p.T189T|ARFGAP1_uc002yen.1_Silent_p.T189T	NM_175609	NP_783202	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating	189					COPI coating of Golgi vesicle|protein transport|regulation of ARF GTPase activity|retrograde vesicle-mediated transport, Golgi to ER	cytosol|Golgi-associated vesicle membrane	ARF GTPase activator activity|zinc ion binding			pancreas(1)	1	all_cancers(38;1.59e-09)													0.761468	259.252893	266.06864	83	26	GG		KEEP	---	---	---	---	capture			Silent	SNP	61380732	61380732	860	20	G	A	A	38	38	ARFGAP1	A	1	1
KCNQ2	3785	broad.mit.edu	36	20	61547055	61547055	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:61547055C>T	uc002yey.1	-	c.494G>A	c.(493-495)CGG>CAG	p.R165Q	KCNQ2_uc002yfa.1_Missense_Mutation_p.R165Q|KCNQ2_uc002yez.1_Missense_Mutation_p.R165Q|KCNQ2_uc002yfb.1_Missense_Mutation_p.R165Q|KCNQ2_uc002yfc.1_Missense_Mutation_p.R165Q	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein	165	Cytoplasmic (Potential).				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	all_cancers(38;1.24e-11)				Amitriptyline(DB00321)									0.655172	124.060752	125.2946	38	20	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Missense_Mutation	SNP	61547055	61547055	8388	20	C	T	T	23	23	KCNQ2	T	1	1
GMEB2	26205	broad.mit.edu	36	20	61699635	61699635	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:61699635G>A	uc002yfp.1	-	c.380C>T	c.(379-381)CCA>CTA	p.P127L	GMEB2_uc002yfo.1_Missense_Mutation_p.P49L|GMEB2_uc002yfq.1_Missense_Mutation_p.P127L	NM_012384	NP_036516	Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding	127	SAND.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding|RNA polymerase II transcription factor activity				0	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)													0.666667	194.474681	196.61333	58	29	GG		KEEP	---	---	---	---	capture	Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)		Missense_Mutation	SNP	61699635	61699635	6757	20	G	A	A	47	47	GMEB2	A	2	2
MYT1	4661	broad.mit.edu	36	20	62313920	62313920	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:62313920G>A	uc002yii.1	+	c.1502G>A	c.(1501-1503)CGC>CAC	p.R501H	MYT1_uc002yih.2_Missense_Mutation_p.R203H|MYT1_uc002yij.1_Missense_Mutation_p.R133H	NM_004535	NP_004526	Q01538	MYT1_HUMAN	myelin transcription factor 1	501	C2HC-type 3.				cell differentiation|nervous system development|regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GBM(59;481 1041 20555 21139 33705)				1819				0.097436	8.76669	40.431866	19	176	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	62313920	62313920	10501	20	G	A	A	38	38	MYT1	A	1	1
PAK7	57144	broad.mit.edu	36	20	9509030	9509030	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:9509030G>A	uc002wnl.2	-	c.752C>T	c.(751-753)GCG>GTG	p.A251V	PAK7_uc002wnk.2_Missense_Mutation_p.A251V|PAK7_uc002wnj.2_Missense_Mutation_p.A251V|PAK7_uc010gby.1_Missense_Mutation_p.A251V	NM_020341	NP_817127	Q9P286	PAK7_HUMAN	p21-activated kinase 7	251	Linker.				protein phosphorylation		ATP binding|protein binding|protein serine/threonine kinase activity			lung(7)|skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	15										177				0.721154	234.788336	239.405557	75	29	GG		KEEP	---	---	---	---	capture	COAD - Colon adenocarcinoma(9;0.194)		Missense_Mutation	SNP	9509030	9509030	11821	20	G	A	A	38	38	PAK7	A	1	1
CXADR	1525	broad.mit.edu	36	21	17841221	17841221	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:17841221G>A	uc002yki.1	+	c.49G>A	c.(49-51)GCC>ACC	p.A17T	CXADR_uc002ykh.1_Missense_Mutation_p.A17T|CXADR_uc010gld.1_Missense_Mutation_p.A17T|CXADR_uc010gle.1_Missense_Mutation_p.A17T|CXADR_uc002ykj.1_5'UTR	NM_001338	NP_001329	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor	17					blood coagulation|cell adhesion|interspecies interaction between organisms|leukocyte migration|regulation of immune response	adherens junction|basolateral plasma membrane|extracellular region|integral to plasma membrane|nucleus|tight junction	receptor activity			ovary(1)	1														0.335616	135.143511	138.627416	49	97	GG		KEEP	---	---	---	---	capture		Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)	Missense_Mutation	SNP	17841221	17841221	4236	21	G	A	A	38	38	CXADR	A	1	1
CYYR1	116159	broad.mit.edu	36	21	26774518	26774518	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:26774518G>A	uc002yme.2	-	c.278C>T	c.(277-279)GCG>GTG	p.A93V	CYYR1_uc002ymd.1_Missense_Mutation_p.A93V	NM_052954	NP_443186	Q96J86	CYYR1_HUMAN	cysteine and tyrosine-rich 1 protein precursor	93	Cytoplasmic (Potential).					integral to membrane					0														0.400763	297.429225	299.682267	105	157	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26774518	26774518	4376	21	G	A	A	38	38	CYYR1	A	1	1
ADAMTS5	11096	broad.mit.edu	36	21	27224206	27224206	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:27224206C>T	uc002ymg.1	-	c.2095G>A	c.(2095-2097)GTC>ATC	p.V699I		NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1	699	Cys-rich.				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						Esophageal Squamous(53;683 1080 10100 14424 45938)								0.402036	461.40537	464.691768	158	235	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	27224206	27224206	270	21	C	T	T	19	19	ADAMTS5	T	1	1
KRTAP13-1	140258	broad.mit.edu	36	21	30690717	30690717	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:30690717C>T	uc002yoa.1	+	c.442C>T	c.(442-444)CGC>TGC	p.R148C		NM_181599	NP_853630	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	148						intermediate filament				ovary(1)	1														0.435484	78.880065	79.090545	27	35	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30690717	30690717	8837	21	C	T	T	23	23	KRTAP13-1	T	1	1
DYRK1A	1859	broad.mit.edu	36	21	37714545	37714545	+	De_novo_Start_InFrame	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:37714545C>T	uc002ywk.1	+	c.-1C>T	c.(-3-1)GACGA>GATGA		DYRK1A_uc010gno.1_Non-coding_Transcript|DYRK1A_uc002ywg.1_Non-coding_Transcript|DYRK1A_uc002ywh.1_Intron|DYRK1A_uc002ywi.1_De_novo_Start_InFrame|DYRK1A_uc002ywj.1_De_novo_Start_InFrame|DYRK1A_uc002ywm.1_De_novo_Start_InFrame|DYRK1A_uc002ywl.1_De_novo_Start_InFrame	NM_001396	NP_001387			dual-specificity tyrosine-(Y)-phosphorylation						nervous system development|peptidyl-tyrosine phosphorylation|protein autophosphorylation	nuclear speck	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein self-association|protein serine/threonine kinase activity			ovary(1)	1						Melanoma(114;464 1602 31203 43785 45765)				141				0.273684	66.904537	71.291884	26	69	CC		KEEP	---	---	---	---	capture			De_novo_Start_InFrame	SNP	37714545	37714545	5040	21	C	T	T	19	19	DYRK1A	T	5	1
BRWD1	54014	broad.mit.edu	36	21	39509037	39509037	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr21:39509037T>C	uc002yxk.1	-	c.3781A>G	c.(3781-3783)ATC>GTC	p.I1261V	BRWD1_uc002yxl.1_Missense_Mutation_p.I1261V|BRWD1_uc010goc.1_5'UTR|BRWD1_uc010god.1_Missense_Mutation_p.I227V	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1261					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(1)	1		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				Melanoma(170;988 1986 4794 16843 39731)								0.432099	120.618997	120.943424	35	46	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39509037	39509037	1556	21	T	C	C	49	49	BRWD1	C	4	4
ZNF295	49854	broad.mit.edu	36	21	42285240	42285240	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:42285240C>T	uc002zab.2	-	c.2034G>A	c.(2032-2034)GCG>GCA	p.A678A	ZNF295_uc002yzz.2_Intron|ZNF295_uc002yzy.2_Silent_p.A678A|ZNF295_uc002zaa.2_Silent_p.A678A|ZNF295_uc010gou.1_Silent_p.A678A	NM_001098402	NP_065778	Q9ULJ3	ZN295_HUMAN	zinc finger protein 295 isoform L	678	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	methyl-CpG binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2														0.420875	373.42509	375.046774	125	172	CC		KEEP	---	---	---	---	capture			Silent	SNP	42285240	42285240	18419	21	C	T	T	19	19	ZNF295	T	1	1
UMODL1	89766	broad.mit.edu	36	21	42414270	42414270	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:42414270C>T	uc002zag.1	+	c.3078C>T	c.(3076-3078)TAC>TAT	p.Y1026Y	UMODL1_uc002zad.1_Silent_p.Y826Y|UMODL1_uc002zae.1_Silent_p.Y954Y|UMODL1_uc002zaf.1_Silent_p.Y898Y|UMODL1_uc002zal.1_De_novo_Start_OutOfFrame	NM_173568	NP_775839	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 2 precursor	898	Extracellular (Potential).|EGF-like 3; calcium-binding (Potential).					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)	2						Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)								0.402597	268.92542	270.842354	93	138	CC		KEEP	---	---	---	---	capture			Silent	SNP	42414270	42414270	17538	21	C	T	T	19	19	UMODL1	T	1	1
PWP2	5822	broad.mit.edu	36	21	44366621	44366621	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:44366621G>A	uc002zeb.1	+	c.1772G>A	c.(1771-1773)AGG>AAG	p.R591K		NM_005049	NP_005040	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog	591						cytoplasm|nucleolus	signal transducer activity			pancreas(1)	1														0.237037	79.518753	88.06281	32	103	GG		KEEP	---	---	---	---	capture		STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)	Missense_Mutation	SNP	44366621	44366621	13302	21	G	A	A	35	35	PWP2	A	2	2
DNMT3L	29947	broad.mit.edu	36	21	44495132	44495132	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:44495132G>A	uc002zeh.1	-	c.898C>T	c.(898-900)CGC>TGC	p.R300C	DNMT3L_uc002zeg.1_Missense_Mutation_p.R300C	NM_013369	NP_037501	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein	300					DNA methylation|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|transcription repressor activity|zinc ion binding				0														0.477064	309.876365	309.976135	104	114	GG		KEEP	---	---	---	---	capture		Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)	Missense_Mutation	SNP	44495132	44495132	4861	21	G	A	A	37	37	DNMT3L	A	1	1
KRTAP10-11	386678	broad.mit.edu	36	21	44891030	44891030	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:44891030C>T	uc002zfr.2	+	c.227C>T	c.(226-228)ACG>ATG	p.T76M	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198692	NP_941965	P60412	KR10B_HUMAN	keratin associated protein 10-11	76	25 X 5 AA repeats of C-C-X(3).					keratin filament				ovary(1)	1														0.396694	263.944128	266.204479	96	146	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44891030	44891030	8822	21	C	T	T	19	19	KRTAP10-11	T	1	1
PCNT	5116	broad.mit.edu	36	21	46680482	46680482	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:46680482G>A	uc002zji.2	+	c.8989G>A	c.(8989-8991)GTG>ATG	p.V2997M	PCNT_uc002zjj.1_Missense_Mutation_p.V2800M	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	2997	Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)													0.47619	115.488424	115.530142	40	44	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46680482	46680482	12010	21	G	A	A	40	40	PCNT	A	1	1
CCT8L2	150160	broad.mit.edu	36	22	15452055	15452055	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:15452055G>A	uc002zlp.1	-	c.1386C>T	c.(1384-1386)GAC>GAT	p.D462D		NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1	462					cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)												0.751351	447.799826	458.425248	139	46	GG		KEEP	---	---	---	---	capture			Silent	SNP	15452055	15452055	3088	22	G	A	A	40	40	CCT8L2	A	1	1
CLTCL1	8218	broad.mit.edu	36	22	17568929	17568929	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:17568929G>A	uc002zpb.1	-	c.3676C>T	c.(3676-3678)CGC>TGC	p.R1226C	CLTCL1_uc002zpc.1_Non-coding_Transcript|CLTCL1_uc010grm.1_Silent_p.P6P|CLTCL1_uc002zpd.1_Missense_Mutation_p.R133C|CLTCL1_uc002zpe.1_Silent_p.P185P	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1	1226	Involved in binding clathrin light chain (By similarity).|Proximal segment.|Heavy chain arm.				anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)								p.R1226C(SKNAS-Tumor)	1206				0.73913	112.771023	115.156614	34	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17568929	17568929	3705	22	G	A	A	39	39	CLTCL1	A	1	1
HIRA	7290	broad.mit.edu	36	22	17745465	17745465	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:17745465C>T	uc002zpf.1	-	c.1540G>A	c.(1540-1542)GCC>ACC	p.A514T	HIRA_uc010grn.1_Missense_Mutation_p.A514T|HIRA_uc010gro.1_Missense_Mutation_p.A470T	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective	514	Interaction with CCNA1.				chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulator activity			ovary(1)	1	Colorectal(54;0.0993)													0.758427	426.990983	437.844879	135	43	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17745465	17745465	7405	22	C	T	T	27	27	HIRA	T	1	1
PPIL2	23759	broad.mit.edu	36	22	20369094	20369094	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:20369094C>T	uc002zvh.2	+	c.606C>T	c.(604-606)GCC>GCT	p.A202A	PPIL2_uc010gtj.1_Silent_p.A202A|PPIL2_uc002zvi.2_Silent_p.A202A|PPIL2_uc002zvg.2_Silent_p.A202A|PPIL2_uc002zvk.2_5'Flank	NM_148176	NP_680481	Q13356	PPIL2_HUMAN	peptidylprolyl isomerase-like 2 isoform b	202	Potential.				blood coagulation|leukocyte migration|protein folding|protein polyubiquitination	Golgi lumen|nucleus|ubiquitin ligase complex	peptidyl-prolyl cis-trans isomerase activity|ubiquitin-protein ligase activity			ovary(2)	2	Colorectal(54;0.105)													0.714286	119.344052	121.362997	35	14	CC		KEEP	---	---	---	---	capture			Silent	SNP	20369094	20369094	12762	22	C	T	T	23	23	PPIL2	T	1	1
YPEL1	29799	broad.mit.edu	36	22	20387711	20387711	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:20387711G>A	uc002zvl.1	-	c.218C>T	c.(217-219)GCG>GTG	p.A73V	YPEL1_uc002zvm.1_Non-coding_Transcript	NM_013313	NP_037445	O60688	YPEL1_HUMAN	yippee-like 1	73						nucleus					0	Colorectal(54;0.105)													0.779221	393.075376	404.138991	120	34	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20387711	20387711	18072	22	G	A	A	38	38	YPEL1	A	1	1
MYO18B	84700	broad.mit.edu	36	22	24495284	24495284	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:24495284C>T	uc003abz.1	+	c.1401C>T	c.(1399-1401)AGC>AGT	p.S467S	MYO18B_uc003aca.1_Silent_p.S348S|MYO18B_uc010guy.1_Silent_p.S348S|MYO18B_uc010guz.1_Silent_p.S348S	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	467						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12										968				0.857143	19.061857	19.91308	6	1	CC		KEEP	---	---	---	---	capture			Silent	SNP	24495284	24495284	10461	22	C	T	T	26	26	MYO18B	T	2	2
MN1	4330	broad.mit.edu	36	22	26524188	26524188	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:26524188C>T	uc003adj.1	-	c.2344G>A	c.(2344-2346)GGG>AGG	p.G782R		NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1	782							binding			central_nervous_system(3)|large_intestine(1)|ovary(1)	5										140				0.6	16.449142	16.536241	6	4	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26524188	26524188	10064	22	C	T	T	23	23	MN1	T	1	1
ZNRF3	84133	broad.mit.edu	36	22	27772829	27772829	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:27772829G>A	uc003aeg.2	+	c.570G>A	c.(568-570)ACG>ACA	p.T190T	ZNRF3_uc003aeh.1_Silent_p.T190T	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	290	Cytoplasmic (Potential).					integral to membrane	zinc ion binding			ovary(1)	1														0.724444	504.469696	514.663166	163	62	GG		KEEP	---	---	---	---	capture			Silent	SNP	27772829	27772829	18817	22	G	A	A	40	40	ZNRF3	A	1	1
ZNRF3	84133	broad.mit.edu	36	22	27775207	27775207	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:27775207G>A	uc003aeg.2	+	c.738G>A	c.(736-738)GCG>GCA	p.A246A	ZNRF3_uc003aeh.1_Silent_p.A246A	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	346	Cytoplasmic (Potential).					integral to membrane	zinc ion binding			ovary(1)	1														0.697248	247.833174	251.618097	76	33	GG		KEEP	---	---	---	---	capture			Silent	SNP	27775207	27775207	18817	22	G	A	A	39	39	ZNRF3	A	1	1
NEFH	4744	broad.mit.edu	36	22	28216678	28216678	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:28216678G>A	uc003afo.1	+	c.3049G>A	c.(3049-3051)GCC>ACC	p.A1017T	NEFH_uc003afp.2_Silent_p.P82P	NM_021076	NP_066554	P12036	NFH_HUMAN	neurofilament, heavy polypeptide 200kDa	1023	Tail.				cell death|nervous system development	neurofilament					0														0.697674	93.860528	95.359198	30	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	28216678	28216678	10713	22	G	A	A	38	38	NEFH	A	1	1
MORC2	22880	broad.mit.edu	36	22	29658675	29658675	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:29658675G>A	uc003aje.1	-	c.2418C>T	c.(2416-2418)GGC>GGT	p.G806G		NM_014941	NP_055756	Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	868							ATP binding|zinc ion binding			ovary(1)|pancreas(1)	2														0.719512	167.428776	170.987533	59	23	GG		KEEP	---	---	---	---	capture			Silent	SNP	29658675	29658675	10093	22	G	A	A	38	38	MORC2	A	1	1
MORC2	22880	broad.mit.edu	36	22	29672377	29672377	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:29672377G>A	uc003aje.1	-	c.191C>T	c.(190-192)ACG>ATG	p.T64M		NM_014941	NP_055756	Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	126							ATP binding|zinc ion binding			ovary(1)|pancreas(1)	2														0.75969	325.40857	333.345635	98	31	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29672377	29672377	10093	22	G	A	A	44	44	MORC2	A	2	2
MORC2	22880	broad.mit.edu	36	22	29675738	29675738	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:29675738G>A	uc003aje.1	-	c.131C>T	c.(130-132)TCG>TTG	p.S44L		NM_014941	NP_055756	Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	106							ATP binding|zinc ion binding			ovary(1)|pancreas(1)	2														0.377049	134.106429	135.729525	46	76	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29675738	29675738	10093	22	G	A	A	37	37	MORC2	A	1	1
SMTN	6525	broad.mit.edu	36	22	29822874	29822874	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:29822874G>A	uc003ajm.1	+	c.2017G>A	c.(2017-2019)GTC>ATC	p.V673I	SMTN_uc003ajk.1_Missense_Mutation_p.V673I|SMTN_uc003ajl.1_Missense_Mutation_p.V673I|SMTN_uc003ajn.1_Missense_Mutation_p.V696I|SMTN_uc003ajo.1_Intron|SMTN_uc010gwe.1_Intron	NM_134270	NP_599032	P53814	SMTN_HUMAN	smoothelin isoform a	673					muscle organ development|smooth muscle contraction	actin cytoskeleton|cytoplasm	actin binding|structural constituent of muscle			large_intestine(2)|pancreas(1)	3														0.858407	309.83799	323.836696	97	16	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29822874	29822874	15314	22	G	A	A	40	40	SMTN	A	1	1
INPP5J	27124	broad.mit.edu	36	22	29853496	29853496	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:29853496G>A	uc003aju.2	+	c.1765G>A	c.(1765-1767)GCA>ACA	p.A589T	INPP5J_uc003ajw.2_Missense_Mutation_p.A25T|INPP5J_uc003ajv.2_Missense_Mutation_p.A222T|INPP5J_uc003ajs.2_Missense_Mutation_p.A222T|INPP5J_uc010gwg.1_Missense_Mutation_p.A154T|INPP5J_uc003ajt.2_Missense_Mutation_p.A221T|INPP5J_uc003ajx.1_5'Flank|INPP5J_uc003ajy.1_5'Flank|INPP5J_uc003ajz.1_5'Flank	NM_001002837	NP_001002837	Q15735	PI5PA_HUMAN	phosphatidylinositol (4,5) bisphosphate	589	Catalytic (Potential).					cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding			skin(1)	1														0.7	66.083029	67.154236	21	9	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29853496	29853496	8060	22	G	A	A	38	38	INPP5J	A	1	1
SFI1	9814	broad.mit.edu	36	22	30328716	30328716	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:30328716C>T	uc003ale.1	+	c.1750C>T	c.(1750-1752)CGG>TGG	p.R584W	SFI1_uc003ald.1_Missense_Mutation_p.R560W|SFI1_uc003alf.1_Missense_Mutation_p.R553W|SFI1_uc003alg.1_Missense_Mutation_p.R502W|SFI1_uc003alh.1_Non-coding_Transcript|SFI1_uc010gwi.1_Non-coding_Transcript	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform	584					G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1														0.217822	48.383785	55.821477	22	79	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30328716	30328716	14645	22	C	T	T	27	27	SFI1	T	1	1
TOM1	10043	broad.mit.edu	36	22	34049503	34049503	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:34049503G>A	uc003anp.1	+	c.381G>A	c.(379-381)GCG>GCA	p.A127A	TOM1_uc003ann.1_Silent_p.A127A|TOM1_uc003ano.1_Non-coding_Transcript|TOM1_uc003anq.1_Silent_p.A121A|TOM1_uc003anr.1_5'UTR|TOM1_uc003ans.1_5'UTR	NM_005488	NP_005479	O60784	TOM1_HUMAN	target of myb1 isoform 1	127	VHS.				endocytosis|endosome transport|intracellular protein transport	cytosol|early endosome|membrane	protein binding			ovary(1)	1														0.703704	470.81178	478.807061	152	64	GG		KEEP	---	---	---	---	capture			Silent	SNP	34049503	34049503	16892	22	G	A	A	40	40	TOM1	A	1	1
RASD2	23551	broad.mit.edu	36	22	34273010	34273010	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:34273010G>A	uc003anx.1	+	c.208G>A	c.(208-210)GAC>AAC	p.D70N	RASD2_uc003any.1_Missense_Mutation_p.D70N	NM_014310	NP_055125	Q96D21	RHES_HUMAN	RASD family, member 2	70					locomotory behavior|positive regulation of protein kinase B signaling cascade|positive regulation of protein sumoylation|regulation of cAMP-mediated signaling|small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|GTPase activity			skin(1)	1														0.613208	206.00272	207.19838	65	41	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	34273010	34273010	13528	22	G	A	A	37	37	RASD2	A	1	1
MFNG	4242	broad.mit.edu	36	22	36205437	36205437	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:36205437C>T	uc003ass.1	-	c.453G>A	c.(451-453)GCG>GCA	p.A151A	CARD10_uc003ast.1_Non-coding_Transcript	NM_002405	NP_002396	O00587	MFNG_HUMAN	O-fucosylpeptide	151	Lumenal (Potential).				pattern specification process	extracellular space|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity				0	Melanoma(58;0.0574)													0.8	164.524082	169.975845	52	13	CC		KEEP	---	---	---	---	capture			Silent	SNP	36205437	36205437	9915	22	C	T	T	27	27	MFNG	T	1	1
L3MBTL2	83746	broad.mit.edu	36	22	39939865	39939865	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:39939865C>T	uc003azo.1	+	c.285C>T	c.(283-285)ATC>ATT	p.I95I	L3MBTL2_uc010gyi.1_Silent_p.I4I|L3MBTL2_uc003azn.1_Non-coding_Transcript	NM_031488	NP_113676	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2	95	FCS-type.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	methylated histone residue binding|transcription corepressor activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3														0.721519	371.200335	378.170948	114	44	CC		KEEP	---	---	---	---	capture			Silent	SNP	39939865	39939865	8915	22	C	T	T	31	31	L3MBTL2	T	1	1
EFCAB6	64800	broad.mit.edu	36	22	42262006	42262006	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:42262006G>A	uc003bdy.1	-	c.4128C>T	c.(4126-4128)AAC>AAT	p.N1376N	EFCAB6_uc003bdz.1_Silent_p.N1224N|EFCAB6_uc010gzi.1_Silent_p.N1224N	NM_022785	NP_942153	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	1376	EF-hand 15.|Interaction with PARK7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|pancreas(1)	4		Ovarian(80;0.0247)|all_neural(38;0.025)												0.772277	259.297261	266.16688	78	23	GG		KEEP	---	---	---	---	capture			Silent	SNP	42262006	42262006	5126	22	G	A	A	40	40	EFCAB6	A	1	1
PHF21B	112885	broad.mit.edu	36	22	43665891	43665891	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:43665891G>C	uc003bfn.1	-	c.974C>G	c.(973-975)GCC>GGC	p.A325G	PHF21B_uc003bfm.1_Missense_Mutation_p.A121G|PHF21B_uc003bfo.1_Missense_Mutation_p.A283G	NM_138415	NP_612424	Q96EK2	PF21B_HUMAN	PHD finger protein 21B isoform 1	325							zinc ion binding			ovary(2)|skin(1)	3		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)												0.2	6.516176	8.172598	4	16	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)	Missense_Mutation	SNP	43665891	43665891	12257	22	G	C	C	42	42	PHF21B	C	3	3
GRAMD4	23151	broad.mit.edu	36	22	45432822	45432822	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:45432822C>T	uc003bhx.1	+	c.358C>T	c.(358-360)CGG>TGG	p.R120W	GRAMD4_uc010had.1_Missense_Mutation_p.R59W	NM_015124	NP_055939	Q6IC98	GRAM4_HUMAN	death-inducing-protein	120	Potential.				apoptosis	integral to membrane|mitochondrial membrane				ovary(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)												0.875	91.011677	95.405234	28	4	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)	Missense_Mutation	SNP	45432822	45432822	7028	22	C	T	T	27	27	GRAMD4	T	1	1
TBC1D22A	25771	broad.mit.edu	36	22	45748917	45748917	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:45748917C>T	uc003bib.1	+	c.1083C>T	c.(1081-1083)GCC>GCT	p.A361A	TBC1D22A_uc010haf.1_Silent_p.A331A|TBC1D22A_uc003bic.1_Silent_p.A302A|TBC1D22A_uc003bie.1_Silent_p.A283A|TBC1D22A_uc003bid.1_Non-coding_Transcript|TBC1D22A_uc010hag.1_Intron|TBC1D22A_uc003bif.1_Silent_p.A314A	NM_014346	NP_055161	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	361	Rab-GAP TBC.					intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)												0.428571	18.648007	18.710265	6	8	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)	Silent	SNP	45748917	45748917	16133	22	C	T	T	23	23	TBC1D22A	T	1	1
BRD1	23774	broad.mit.edu	36	22	48573791	48573791	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:48573791G>A	uc003biu.2	-	c.2254C>T	c.(2254-2256)CGA>TGA	p.R752*	BRD1_uc010hah.1_Non-coding_Transcript|BRD1_uc003biv.1_Nonsense_Mutation_p.R752*	NM_014577	NP_055392	O95696	BRD1_HUMAN	bromodomain containing protein 1	752					histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)												0.666667	153.234471	155.022061	48	24	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)	Nonsense_Mutation	SNP	48573791	48573791	1532	22	G	A	A	39	39	BRD1	A	5	1
SELO	83642	broad.mit.edu	36	22	48991202	48991202	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:48991202C>T	uc003bjx.1	+	c.1086C>T	c.(1084-1086)CAC>CAT	p.H362H	SELO_uc010hap.1_Silent_p.H173H|SELO_uc003bjy.1_Silent_p.H42H|SELO_uc003bjz.1_Silent_p.H42H|SELO_uc010haq.1_5'Flank	NM_031454		Q9BVL4	SELO_HUMAN	selenoprotein O	362											0		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)										OREG0026676	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.714286	176.611083	180.077305	60	24	CC		KEEP	---	---	---	---	capture		LUAD - Lung adenocarcinoma(64;0.105)	Silent	SNP	48991202	48991202	14504	22	C	T	T	19	19	SELO	T	1	1
NPAS2	4862	broad.mit.edu	36	2	100976244	100976244	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:100976244C>T	uc002tap.1	+	c.2115C>T	c.(2113-2115)TAC>TAT	p.Y705Y	NPAS2_uc010fit.1_Missense_Mutation_p.R123C	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	705					central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription regulator activity			ovary(3)	3														0.803922	129.396558	133.784578	41	10	CC		KEEP	---	---	---	---	capture			Silent	SNP	100976244	100976244	10967	2	C	T	T	19	19	NPAS2	T	1	1
NCK2	8440	broad.mit.edu	36	2	105864760	105864760	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:105864760C>T	uc002tdg.1	+	c.771C>T	c.(769-771)GAC>GAT	p.D257D	NCK2_uc002tdh.1_Intron|NCK2_uc002tdi.1_Silent_p.D257D	NM_003581	NP_003572	O43639	NCK2_HUMAN	NCK adaptor protein 2 isoform A	257	SH3 3.				axon guidance|epidermal growth factor receptor signaling pathway|negative regulation of cell proliferation|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of epidermal growth factor receptor activity|regulation of translation|signal complex assembly|T cell activation	cytosol|endoplasmic reticulum	cytoskeletal adaptor activity|receptor signaling complex scaffold activity			ovary(1)|lung(1)	2														0.702703	167.42492	170.142707	52	22	CC		KEEP	---	---	---	---	capture			Silent	SNP	105864760	105864760	10619	2	C	T	T	19	19	NCK2	T	1	1
GLI2	2736	broad.mit.edu	36	2	121452545	121452545	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:121452545G>A	uc010flp.1	+	c.1434G>A	c.(1432-1434)ACG>ACA	p.T478T	GLI2_uc002tmq.1_Silent_p.T150T|GLI2_uc002tmr.1_Silent_p.T133T|GLI2_uc002tmt.2_Silent_p.T150T|GLI2_uc002tmu.2_Silent_p.T133T|GLI2_uc002tmw.1_Silent_p.T461T	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	478	C2H2-type 2; degenerate.				axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription activator activity|zinc ion binding			ovary(7)|central_nervous_system(1)	8	Renal(3;0.0496)	Prostate(154;0.0623)								376				0.716578	420.30809	428.179453	134	53	GG		KEEP	---	---	---	---	capture			Silent	SNP	121452545	121452545	6706	2	G	A	A	38	38	GLI2	A	1	1
TFCP2L1	29842	broad.mit.edu	36	2	121705969	121705969	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1787-01	TCGA-19-1787-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:121705969A>G	uc002tmx.1	-	c.1244T>C	c.(1243-1245)ATT>ACT	p.I415T	TFCP2L1_uc010flq.1_Intron|TFCP2L1_uc010flr.1_Intron	NM_014553	NP_055368	Q9NZI6	TF2L1_HUMAN	LBP-9	415					female pregnancy|steroid biosynthetic process	mitochondrion|nucleolus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			pancreas(2)|ovary(1)	3	Renal(3;0.01)													0.706349	317.517229	322.31741	89	37	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	121705969	121705969	16324	2	A	G	G	4	4	TFCP2L1	G	4	4
ERCC3	2071	broad.mit.edu	36	2	127731687	127731687	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:127731687C>T	uc002toh.1	-	c.2304G>A	c.(2302-2304)GCG>GCA	p.A768A	ERCC3_uc002toe.1_Silent_p.A523A|ERCC3_uc002tof.1_Silent_p.A704A|ERCC3_uc002tog.1_Silent_p.A704A	NM_000122	NP_000113	P19447	ERCC3_HUMAN	excision repair cross-complementing rodent	768					cell cycle checkpoint|DNA topological change|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA duplex unwinding|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein localization|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	3'-5' DNA helicase activity|ATP binding|damaged DNA binding|protein C-terminus binding|protein N-terminus binding|transcription factor binding			ovary(1)|lung(1)|breast(1)|kidney(1)	4	Colorectal(110;0.1)									281				0.325581	109.797419	113.283881	42	87	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(221;0.073)	Silent	SNP	127731687	127731687	5407	2	C	T	T	27	27	ERCC3	T	1	1
POLR2D	5433	broad.mit.edu	36	2	128327014	128327014	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:128327014C>T	uc002tpj.1	-	c.209G>A	c.(208-210)CGT>CAT	p.R70H	POLR2D_uc002tpk.1_Missense_Mutation_p.R70H	NM_004805	NP_004796	O15514	RPB4_HUMAN	DNA directed RNA polymerase II polypeptide D	70					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA-directed RNA polymerase activity|nucleotide binding				0	Colorectal(110;0.1)													0.740088	549.289715	561.134099	168	59	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(221;0.0675)	Missense_Mutation	SNP	128327014	128327014	12645	2	C	T	T	19	19	POLR2D	T	1	1
FAM168B	130074	broad.mit.edu	36	2	131545918	131545918	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:131545918G>A	uc002tsd.1	-	c.134C>T	c.(133-135)GCG>GTG	p.A45V		NM_001009993	NP_001009993	A1KXE4	F168B_HUMAN	hypothetical protein LOC130074	45											0														0.75	146.495964	149.905059	45	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	131545918	131545918	5690	2	G	A	A	38	38	FAM168B	A	1	1
NCKAP5	344148	broad.mit.edu	36	2	133256813	133256813	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:133256813G>A	uc002ttp.1	-	c.4041C>T	c.(4039-4041)TCC>TCT	p.S1347S	NCKAP5_uc002ttq.1_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	1347							protein binding				0														0.586957	90.533535	90.837531	27	19	GG		KEEP	---	---	---	---	capture			Silent	SNP	133256813	133256813	10622	2	G	A	A	39	39	NCKAP5	A	1	1
TPO	7173	broad.mit.edu	36	2	1438953	1438953	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:1438953C>T	uc002qwr.1	+	c.711C>T	c.(709-711)ATC>ATT	p.I237I	TPO_uc010ewj.1_Intron|TPO_uc002qwt.1_Silent_p.I237I|TPO_uc002qwu.1_Silent_p.I237I|TPO_uc002qwv.1_Silent_p.I237I|TPO_uc002qww.1_Silent_p.I237I|TPO_uc002qwx.1_Silent_p.I237I	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	237	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process|oxidation-reduction process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(6)|pancreas(6)|skin(3)|lung(1)|kidney(1)	17	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)			Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)					723				0.787879	173.933807	178.988485	52	14	CC		KEEP	---	---	---	---	capture		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Silent	SNP	1438953	1438953	16954	2	C	T	T	31	31	TPO	T	1	1
MBD5	55777	broad.mit.edu	36	2	148932822	148932822	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:148932822G>A	uc002twm.2	+	c.25G>A	c.(25-27)GGA>AGA	p.G9R	MBD5_uc010fns.1_Missense_Mutation_p.G9R	NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	9						chromosome|nucleus	chromatin binding|DNA binding			ovary(2)	2														0.672414	126.442741	127.972299	39	19	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(221;0.0569)	Missense_Mutation	SNP	148932822	148932822	9735	2	G	A	A	39	39	MBD5	A	1	1
KIF5C	3800	broad.mit.edu	36	2	149576372	149576372	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:149576372C>T	uc002twr.1	+	c.2810C>T	c.(2809-2811)ACG>ATG	p.T937M	KIF5C_uc002tws.1_Non-coding_Transcript|KIF5C_uc002twu.1_Missense_Mutation_p.T219M	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C	937	Globular.				microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1														0.666667	136.715005	138.33675	44	22	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(221;0.108)	Missense_Mutation	SNP	149576372	149576372	8618	2	C	T	T	19	19	KIF5C	T	1	1
ACVR1	90	broad.mit.edu	36	2	158330735	158330735	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1787-01	TCGA-19-1787-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:158330735A>G	uc002tzm.2	-	c.1010T>C	c.(1009-1011)TTA>TCA	p.L337S	ACVR1_uc002tzn.2_Missense_Mutation_p.L337S|ACVR1_uc010fog.1_Missense_Mutation_p.L337S	NM_001111067	NP_001104537	Q04771	ACVR1_HUMAN	activin A type I receptor precursor	337	Cytoplasmic (Potential).|Protein kinase.				BMP signaling pathway|G1/S transition of mitotic cell cycle|negative regulation of activin receptor signaling pathway|negative regulation of apoptosis|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|protein phosphorylation|transforming growth factor beta receptor signaling pathway	activin receptor complex	activin binding|ATP binding|follistatin binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta binding			ovary(2)|skin(1)	3					Adenosine triphosphate(DB00171)					185				0.738462	185.43458	188.782346	48	17	AA		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(221;0.104)	Missense_Mutation	SNP	158330735	158330735	221	2	A	G	G	13	13	ACVR1	G	4	4
PXDN	7837	broad.mit.edu	36	2	1631825	1631825	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:1631825C>T	uc002qxa.1	-	c.2734G>A	c.(2734-2736)GCA>ACA	p.A912T		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin homolog	912					extracellular matrix organization|hydrogen peroxide catabolic process|immune response|oxidation-reduction process	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)								2093				0.261905	25.707794	27.861456	11	31	CC		KEEP	---	---	---	---	capture		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)	Missense_Mutation	SNP	1631825	1631825	13305	2	C	T	T	27	27	PXDN	T	1	1
ABCB11	8647	broad.mit.edu	36	2	169492073	169492073	+	Missense_Mutation	SNP	G	A	A	rs72549395	unknown	TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:169492073G>A	uc002ueo.1	-	c.3457C>T	c.(3457-3459)CGC>TGC	p.R1153C		NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	1153	Cytoplasmic (Potential).|ABC transporter 2.		R -> C (in PFIC2).		bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)									0.795699	260.103167	267.649732	74	19	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	169492073	169492073	43	2	G	A	A	39	39	ABCB11	A	1	1
GAD1	2571	broad.mit.edu	36	2	171386844	171386844	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:171386844G>A	uc002ugi.1	+	c.84G>A	c.(82-84)ACG>ACA	p.T28T	GAD1_uc002ugh.1_Silent_p.T28T	NM_000817	NP_000808	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 isoform GAD67	28					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion|protein-pyridoxal-5-phosphate linkage	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|plasma membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)									0.25	12.61138	13.71753	5	15	GG		KEEP	---	---	---	---	capture			Silent	SNP	171386844	171386844	6430	2	G	A	A	40	40	GAD1	A	1	1
GPR155	151556	broad.mit.edu	36	2	175046096	175046096	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:175046096G>A	uc002uit.1	-	c.703C>T	c.(703-705)CGA>TGA	p.R235*	GPR155_uc002uiu.1_Nonsense_Mutation_p.R235*|GPR155_uc002uiv.1_Nonsense_Mutation_p.R235*|GPR155_uc010fqs.1_Nonsense_Mutation_p.R235*	NM_001033045	NP_689742	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155 isoform 9	235					intracellular signal transduction|transmembrane transport	integral to membrane				ovary(1)	1														0.746479	177.106845	181.022015	53	18	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	175046096	175046096	6935	2	G	A	A	37	37	GPR155	A	5	1
ATF2	1386	broad.mit.edu	36	2	175687673	175687673	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:175687673C>A	uc002ujl.1	-	c.617G>T	c.(616-618)AGG>ATG	p.R206M	ATF2_uc002ujv.1_De_novo_Start_OutOfFrame|ATF2_uc002ujm.1_Missense_Mutation_p.R148M|ATF2_uc002uju.1_Non-coding_Transcript|ATF2_uc002ujn.1_Non-coding_Transcript|ATF2_uc002ujo.1_Intron|ATF2_uc002ujp.1_Non-coding_Transcript|ATF2_uc002ujq.1_Missense_Mutation_p.R206M|ATF2_uc010fqu.1_Missense_Mutation_p.R188M|ATF2_uc002ujr.1_Non-coding_Transcript|ATF2_uc002ujs.1_Missense_Mutation_p.R148M|ATF2_uc002ujt.1_Non-coding_Transcript|ATF2_uc010fqv.1_Missense_Mutation_p.R157M|ATF2_uc002ujw.1_Missense_Mutation_p.R148M|ATF2_uc002ujx.1_Non-coding_Transcript|ATF2_uc002ujy.1_Missense_Mutation_p.R206M	NM_001880	NP_001871	P15336	ATF2_HUMAN	activating transcription factor 2	206					innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nucleoplasm	protein dimerization activity|RNA polymerase II transcription factor activity|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			breast(1)|pancreas(1)	2						Pancreas(17;87 705 4534 15538 30988)				377				0.322034	157.7091	162.68943	57	120	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.125)		Missense_Mutation	SNP	175687673	175687673	1099	2	C	A	A	24	24	ATF2	A	3	3
RBM45	129831	broad.mit.edu	36	2	178698976	178698976	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:178698976G>A	uc002ulv.1	+	c.1252G>A	c.(1252-1254)GAA>AAA	p.E418K		NM_152945	NP_694453	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	420	RRM 3.				cell differentiation|nervous system development	cytoplasm|nucleus	nucleotide binding|RNA binding				0														0.681319	205.279005	207.937501	62	29	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)		Missense_Mutation	SNP	178698976	178698976	13601	2	G	A	A	37	37	RBM45	A	1	1
HECW2	57520	broad.mit.edu	36	2	196865620	196865620	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:196865620C>T	uc002utm.1	-	c.2914G>A	c.(2914-2916)GAC>AAC	p.D972N	HECW2_uc002utl.1_Missense_Mutation_p.D616N	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	972	Interaction with TP73.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			ovary(5)|pancreas(1)|kidney(1)|central_nervous_system(1)|skin(1)	9														0.314286	89.17266	92.376148	33	72	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	196865620	196865620	7326	2	C	T	T	31	31	HECW2	T	1	1
ATG9A	79065	broad.mit.edu	36	2	219797780	219797780	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:219797780C>T	uc002vke.1	-	c.557G>A	c.(556-558)CGG>CAG	p.R186Q	ATG9A_uc002vkd.1_Non-coding_Transcript|ATG9A_uc002vkf.1_Missense_Mutation_p.R186Q	NM_001077198	NP_076990	Q7Z3C6	ATG9A_HUMAN	APG9 autophagy 9-like 1	186	Cytoplasmic (By similarity).				autophagic vacuole assembly|protein transport	autophagic vacuole membrane|cytoplasmic vesicle|Golgi apparatus|integral to membrane|late endosome membrane				skin(1)	1		Renal(207;0.0474)												0.683544	176.674282	179.041959	54	25	CC		KEEP	---	---	---	---	capture		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Missense_Mutation	SNP	219797780	219797780	1121	2	C	T	T	23	23	ATG9A	T	1	1
SPHKAP	80309	broad.mit.edu	36	2	228589424	228589424	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:228589424T>C	uc002vpq.1	-	c.4390A>G	c.(4390-4392)AAC>GAC	p.N1464D	SPHKAP_uc002vpp.1_Missense_Mutation_p.N1464D	NM_030623	NP_085126	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1464						cytoplasm	protein binding			ovary(4)|lung(1)	5		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)												0.138462	34.966193	51.39181	18	112	TT		KEEP	---	---	---	---	capture		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	Missense_Mutation	SNP	228589424	228589424	15560	2	T	C	C	64	64	SPHKAP	C	4	4
DIS3L2	129563	broad.mit.edu	36	2	232603020	232603020	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:232603020G>A	uc010fxz.1	+	c.352G>A	c.(352-354)GAG>AAG	p.E118K	DIS3L2_uc002vsm.2_Non-coding_Transcript|DIS3L2_uc002vso.2_Non-coding_Transcript|DIS3L2_uc002vsn.1_Missense_Mutation_p.E118K	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.	118							exonuclease activity|ribonuclease activity|RNA binding			breast(1)|central_nervous_system(1)	2		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)												0.722892	198.832165	202.541257	60	23	GG		KEEP	---	---	---	---	capture		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)	Missense_Mutation	SNP	232603020	232603020	4716	2	G	A	A	37	37	DIS3L2	A	1	1
RAB17	64284	broad.mit.edu	36	2	238159449	238159449	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:238159449C>T	uc002vwz.1	-	c.88G>A	c.(88-90)GTG>ATG	p.V30M	RAB17_uc002vxa.1_Non-coding_Transcript|RAB17_uc002vxb.1_Non-coding_Transcript	NM_022449	NP_071894	Q9H0T7	RAB17_HUMAN	RAB17, member RAS oncogene family	30	GTP (By similarity).				protein transport|small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|protein binding				0		Renal(207;0.00272)|Breast(86;0.00297)|all_hematologic(139;0.182)|Ovarian(221;0.221)				Colon(56;987 1029 6466 13943 27336)								0.7375	178.920984	182.991531	59	21	CC		KEEP	---	---	---	---	capture		Epithelial(121;9.36e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.26e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000354)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.026)	Missense_Mutation	SNP	238159449	238159449	13361	2	C	T	T	19	19	RAB17	T	1	1
ILKAP	80895	broad.mit.edu	36	2	238757087	238757087	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:238757087C>T	uc002vxv.1	-	c.660G>A	c.(658-660)ACG>ACA	p.T220T	ILKAP_uc002vxw.1_Silent_p.T100T	NM_030768	NP_110395	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated protein	220	PP2C-like.					cytoplasm|protein serine/threonine phosphatase complex	metal ion binding|protein binding	p.T220T(1)		ovary(3)	3		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)												0.340426	44.484487	45.542884	16	31	CC		KEEP	---	---	---	---	capture		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)	Silent	SNP	238757087	238757087	8015	2	C	T	T	19	19	ILKAP	T	1	1
ASXL2	55252	broad.mit.edu	36	2	25820820	25820820	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:25820820C>T	uc002rgs.2	-	c.1890G>A	c.(1888-1890)CCG>CCA	p.P630P	ASXL2_uc002rgt.1_Silent_p.P370P	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	630					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)													0.762712	148.401245	152.121498	45	14	CC		KEEP	---	---	---	---	capture			Silent	SNP	25820820	25820820	1086	2	C	T	T	19	19	ASXL2	T	1	1
OTOF	9381	broad.mit.edu	36	2	26538146	26538146	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:26538146C>T	uc002rhk.1	-	c.5455G>A	c.(5455-5457)GAG>AAG	p.E1819K	OTOF_uc002rhh.1_Missense_Mutation_p.E1052K|OTOF_uc002rhi.1_Missense_Mutation_p.E1129K|OTOF_uc002rhj.1_Missense_Mutation_p.E1052K	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	1819	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GBM(102;732 1451 20652 24062 31372)								0.70303	376.850592	382.936709	116	49	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26538146	26538146	11715	2	C	T	T	31	31	OTOF	T	1	1
GCKR	2646	broad.mit.edu	36	2	27573627	27573627	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:27573627G>A	uc002rky.1	+	c.73G>A	c.(73-75)GAG>AAG	p.E25K	FNDC4_uc002rkx.1_5'Flank|GCKR_uc010ezd.1_Missense_Mutation_p.E25K	NM_001486	NP_001477	Q14397	GCKR_HUMAN	glucokinase regulatory protein	25					carbohydrate metabolic process|glucose transport|negative regulation of glucokinase activity|positive regulation of gene expression|protein import into nucleus, translocation|regulation of glucose transport|response to fructose stimulus|transmembrane transport|triglyceride homeostasis|urate metabolic process	cytosol|nucleoplasm	fructose-6-phosphate binding|protein binding			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)													0.641304	192.745119	194.361862	59	33	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	27573627	27573627	6560	2	G	A	A	37	37	GCKR	A	1	1
FOSL2	2355	broad.mit.edu	36	2	28488438	28488438	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:28488438G>A	uc002rma.1	+	c.600G>A	c.(598-600)TCG>TCA	p.S200S		NM_005253	NP_005244	P15408	FOSL2_HUMAN	FOS-like antigen 2	200					cell death|regulation of transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)													0.793651	313.244589	323.349039	100	26	GG		KEEP	---	---	---	---	capture			Silent	SNP	28488438	28488438	6230	2	G	A	A	38	38	FOSL2	A	1	1
HEATR5B	54497	broad.mit.edu	36	2	37146516	37146516	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:37146516C>T	uc002rpp.1	-	c.1219G>A	c.(1219-1221)GCA>ACA	p.A407T		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	407							binding			ovary(5)|breast(1)	6		all_hematologic(82;0.21)												0.648148	111.241903	112.290386	35	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37146516	37146516	7315	2	C	T	T	27	27	HEATR5B	T	1	1
GALM	130589	broad.mit.edu	36	2	38762042	38762042	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:38762042C>T	uc002rqy.1	+	c.462C>T	c.(460-462)GGC>GGT	p.G154G		NM_138801	NP_620156	Q96C23	GALM_HUMAN	galactose mutarotase (aldose 1-epimerase)	154					hexose metabolic process	cytoplasm	aldose 1-epimerase activity|carbohydrate binding				0		all_hematologic(82;0.248)												0.734043	214.925011	219.609698	69	25	CC		KEEP	---	---	---	---	capture			Silent	SNP	38762042	38762042	6469	2	C	T	T	27	27	GALM	T	1	1
PLEKHH2	130271	broad.mit.edu	36	2	43810314	43810314	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:43810314G>T	uc010fau.1	+	c.2756G>T	c.(2755-2757)GGA>GTA	p.G919V	PLEKHH2_uc002rtf.2_Missense_Mutation_p.G918V	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	919	PH 2.					cytoplasm|cytoskeleton|integral to membrane	binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)												0.871795	109.673813	114.924676	34	5	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43810314	43810314	12503	2	G	T	T	41	41	PLEKHH2	T	3	3
ABCG5	64240	broad.mit.edu	36	2	43904569	43904569	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:43904569G>A	uc002rtn.1	-	c.1311C>T	c.(1309-1311)AAC>AAT	p.N437N	ABCG5_uc002rto.1_Silent_p.N266N|ABCG5_uc002rtp.1_Silent_p.N42N|ABCG5_uc002rtm.1_Silent_p.N42N	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5	437	Helical; Name=2; (Potential).|ABC transmembrane type-2.		N -> K (in SITOST).		cholesterol efflux|cholesterol homeostasis|excretion|intestinal cholesterol absorption|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)												0.698113	121.994439	123.852493	37	16	GG		KEEP	---	---	---	---	capture			Silent	SNP	43904569	43904569	72	2	G	A	A	40	40	ABCG5	A	1	1
SFXN5	94097	broad.mit.edu	36	2	73041816	73041816	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:73041816G>A	uc002siq.1	-	c.897C>T	c.(895-897)TTC>TTT	p.F299F	SFXN5_uc002sio.1_Silent_p.F191F|SFXN5_uc002sip.1_Intron|SFXN5_uc010fet.1_Missense_Mutation_p.S232L|SFXN5_uc010feq.1_Silent_p.F81F|SFXN5_uc010fer.1_Intron|SFXN5_uc010fes.1_Silent_p.F81F	NM_144579	NP_653180	Q8TD22	SFXN5_HUMAN	sideroflexin 5	299	Helical; (Potential).				iron ion homeostasis	integral to membrane	cation transmembrane transporter activity			ovary(1)	1														0.704545	96.331852	97.975801	31	13	GG		KEEP	---	---	---	---	capture			Silent	SNP	73041816	73041816	14689	2	G	A	A	37	37	SFXN5	A	1	1
RMND5A	64795	broad.mit.edu	36	2	86852243	86852243	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:86852243C>A	uc002srr.1	+	c.1009C>A	c.(1009-1011)CCC>ACC	p.P337T	RMND5A_uc002srs.2_Intron	NM_022780	NP_073617	Q9H871	RMD5A_HUMAN	required for meiotic nuclear division 5 homolog	337										ovary(1)	1														0.637931	234.87009	236.809404	74	42	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	86852243	86852243	13874	2	C	A	A	22	22	RMND5A	A	3	3
C2orf55	343990	broad.mit.edu	36	2	98805190	98805190	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:98805190C>T	uc002szf.1	-	c.1978G>A	c.(1978-1980)GCG>ACG	p.A660T		NM_207362	NP_997245	Q6NV74	CB055_HUMAN	hypothetical protein LOC343990	660											0														0.913043	70.278209	73.566088	21	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	98805190	98805190	2264	2	C	T	T	27	27	C2orf55	T	1	1
IRAK2	3656	broad.mit.edu	36	3	10194680	10194680	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:10194680C>T	uc003bve.1	+	c.253C>T	c.(253-255)CGG>TGG	p.R85W		NM_001570	NP_001561	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	85	Death.				activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8										288				0.675325	172.324725	174.425728	52	25	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10194680	10194680	8126	3	C	T	T	23	23	IRAK2	T	1	1
UPK1B	7348	broad.mit.edu	36	3	120400628	120400628	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:120400628G>A	uc003ecc.1	+	c.683G>A	c.(682-684)CGA>CAA	p.R228Q	UPK1B_uc003ecd.1_Missense_Mutation_p.R220Q	NM_006952	NP_008883	O75841	UPK1B_HUMAN	uroplakin 1B	228	Extracellular (Potential).				epithelial cell differentiation	integral to membrane	structural molecule activity				0														0.660377	113.337458	114.541834	35	18	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(114;0.222)	Missense_Mutation	SNP	120400628	120400628	17568	3	G	A	A	37	37	UPK1B	A	1	1
MYLK	4638	broad.mit.edu	36	3	124954071	124954071	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:124954071C>T	uc003ego.1	-	c.170G>A	c.(169-171)CGG>CAG	p.R57Q	MYLK_uc003egp.1_Missense_Mutation_p.R57Q|MYLK_uc003egq.1_Missense_Mutation_p.R57Q|MYLK_uc003egr.1_Missense_Mutation_p.R57Q|MYLK_uc003egs.1_Intron|MYLK_uc010hrs.1_Missense_Mutation_p.R57Q|MYLK_uc003egu.1_Missense_Mutation_p.R67Q	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	57	Ig-like C2-type 1.				aorta smooth muscle tissue morphogenesis|muscle contraction|protein phosphorylation	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)	6		Lung NSC(201;0.0496)								766				0.783784	94.293709	97.044846	29	8	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(114;0.0736)	Missense_Mutation	SNP	124954071	124954071	10451	3	C	T	T	23	23	MYLK	T	1	1
KALRN	8997	broad.mit.edu	36	3	125643498	125643498	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:125643498G>A	uc003ehg.1	+	c.3209G>A	c.(3208-3210)CGG>CAG	p.R1070Q	KALRN_uc010hrv.1_Missense_Mutation_p.R1061Q|KALRN_uc003ehf.1_Missense_Mutation_p.R1070Q|KALRN_uc003ehh.1_Missense_Mutation_p.R416Q	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	1070					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|protein phosphorylation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)	5										1865				0.155844	20.8127	29.472675	12	65	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	125643498	125643498	8279	3	G	A	A	39	39	KALRN	A	1	1
SNX4	8723	broad.mit.edu	36	3	126699456	126699456	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:126699456C>T	uc003eib.1	-	c.461G>A	c.(460-462)CGA>CAA	p.R154Q		NM_003794	NP_003785	O95219	SNX4_HUMAN	sorting nexin 4	154	PX.	Phosphatidylinositol 3-phosphate (By similarity).			cell communication|endocytic recycling|endocytosis|protein transport	cytoplasmic dynein complex|early endosome membrane	phosphatidylinositol binding|protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4														0.715596	257.191756	261.739743	78	31	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	126699456	126699456	15404	3	C	T	T	31	31	SNX4	T	1	1
SLC41A3	54946	broad.mit.edu	36	3	127217036	127217036	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:127217036C>T	uc003eij.1	-	c.961G>A	c.(961-963)GTC>ATC	p.V321I	SLC41A3_uc003eil.1_Missense_Mutation_p.V321I|SLC41A3_uc003eik.1_Missense_Mutation_p.V285I|SLC41A3_uc003eii.1_Missense_Mutation_p.V295I	NM_001008485	NP_001008485	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3 isoform 1	321	Helical; (Potential).					integral to membrane|plasma membrane	cation transmembrane transporter activity				0														0.746835	194.660009	199.03018	59	20	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(114;0.167)	Missense_Mutation	SNP	127217036	127217036	15128	3	C	T	T	19	19	SLC41A3	T	1	1
MGLL	11343	broad.mit.edu	36	3	128922690	128922690	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:128922690C>T	uc003ejw.1	-	c.406G>A	c.(406-408)GCC>ACC	p.A136T	MGLL_uc010hsn.1_Missense_Mutation_p.A126T|MGLL_uc010hso.1_Intron|MGLL_uc003ejx.1_Missense_Mutation_p.A126T|MGLL_uc010hsp.1_Missense_Mutation_p.A126T|MGLL_uc003ejv.1_Missense_Mutation_p.A100T	NM_007283	NP_009214	Q99685	MGLL_HUMAN	monoglyceride lipase isoform 1	126					arachidonic acid metabolic process|fatty acid biosynthetic process|inflammatory response|platelet activation|regulation of endocannabinoid signaling pathway|regulation of inflammatory response|regulation of sensory perception of pain|triglyceride catabolic process	plasma membrane	acylglycerol lipase activity|lysophospholipase activity|protein homodimerization activity				0														0.731707	191.831176	195.818023	60	22	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128922690	128922690	9946	3	C	T	T	27	27	MGLL	T	1	1
TOPBP1	11073	broad.mit.edu	36	3	134856965	134856965	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:134856965G>A	uc003eps.1	-	c.340C>T	c.(340-342)CTT>TTT	p.L114F		NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	201	BRCT 2.				DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						Ovarian(21;193 658 4424 15423 17362)				428				0.698113	122.893397	124.749674	37	16	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	134856965	134856965	16911	3	G	A	A	33	33	TOPBP1	A	2	2
EPHB1	2047	broad.mit.edu	36	3	136442721	136442721	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:136442721C>T	uc003eqt.1	+	c.2388C>T	c.(2386-2388)ATC>ATT	p.I796I	EPHB1_uc003equ.1_Silent_p.I357I	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	796	Cytoplasmic (Potential).|Protein kinase.				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(7)|ovary(4)|stomach(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	18										376				0.795	525.819336	541.962254	159	41	CC		KEEP	---	---	---	---	capture			Silent	SNP	136442721	136442721	5367	3	C	T	T	31	31	EPHB1	T	1	1
FBLN2	2199	broad.mit.edu	36	3	13645667	13645667	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:13645667G>A	uc003bya.1	+	c.2716G>A	c.(2716-2718)GTG>ATG	p.V906M	FBLN2_uc003byb.1_Missense_Mutation_p.V859M	NM_001004019	NP_001004019	P98095	FBLN2_HUMAN	fibulin 2 isoform a precursor	902	EGF-like 7; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1														0.775862	146.202323	150.259174	45	13	GG		KEEP	---	---	---	---	capture	UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)		Missense_Mutation	SNP	13645667	13645667	5935	3	G	A	A	40	40	FBLN2	A	1	1
FOXL2	668	broad.mit.edu	36	3	140148053	140148053	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:140148053G>A	uc003esw.1	-	c.202C>T	c.(202-204)CGC>TGC	p.R68C	C3orf72_uc003esx.1_5'Flank	NM_023067	NP_075555	P58012	FOXL2_HUMAN	forkhead box L2	68	Fork-head.				convergent extension|DNA fragmentation involved in apoptotic nuclear change|embryonic eye morphogenesis|extraocular skeletal muscle development|female somatic sex determination|induction of apoptosis|menstruation|negative regulation of gene-specific transcription from RNA polymerase II promoter|ovarian follicle development|pattern specification process|positive regulation of caspase activity|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	caspase regulator activity|DNA bending activity|double-stranded DNA binding|estrogen receptor binding|promoter binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin conjugating enzyme binding			ovary(226)|large_intestine(1)|skin(1)	228														0.176991	42.035142	53.139118	20	93	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140148053	140148053	6263	3	G	A	A	39	39	FOXL2	A	1	1
CHST2	9435	broad.mit.edu	36	3	144322806	144322806	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:144322806G>A	uc003evm.1	+	c.458G>A	c.(457-459)GGC>GAC	p.G153D	CHST2_uc010huw.1_Missense_Mutation_p.G153D	NM_004267	NP_004258	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O)	153	Lumenal (Potential).				inflammatory response|multicellular organismal development|N-acetylglucosamine metabolic process|sulfur compound metabolic process	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity			ovary(3)	3														0.730769	62.235275	63.484374	19	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	144322806	144322806	3538	3	G	A	A	42	42	CHST2	A	2	2
NR2C2	7182	broad.mit.edu	36	3	15045177	15045177	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:15045177C>T	uc003bzi.1	+	c.936C>T	c.(934-936)AAC>AAT	p.N312N	NR2C2_uc003bzj.2_Silent_p.N293N	NM_003298	NP_003289	P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	293					cell differentiation|nervous system development|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding				0														0.725	93.790832	95.61502	29	11	CC		KEEP	---	---	---	---	capture			Silent	SNP	15045177	15045177	11028	3	C	T	T	19	19	NR2C2	T	1	1
SH3BP5	9467	broad.mit.edu	36	3	15275447	15275447	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:15275447G>A	uc003bzp.1	-	c.784C>T	c.(784-786)CGC>TGC	p.R262C	SH3BP5_uc010hem.1_Intron|SH3BP5_uc003bzq.1_Missense_Mutation_p.R105C|SH3BP5_uc003bzr.1_Missense_Mutation_p.R105C	NM_004844	NP_001018009	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)	262					intracellular signal transduction	mitochondrion	protein kinase inhibitor activity|SH3 domain binding				0														0.716049	171.950654	175.337361	58	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15275447	15275447	14738	3	G	A	A	38	38	SH3BP5	A	1	1
FNDC3B	64778	broad.mit.edu	36	3	173451848	173451848	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:173451848C>T	uc010hwt.1	+	c.613C>T	c.(613-615)CGA>TGA	p.R205*	FNDC3B_uc003fhy.1_Missense_Mutation_p.R201C|FNDC3B_uc003fhz.2_Missense_Mutation_p.R201C|FNDC3B_uc003fia.2_Missense_Mutation_p.R136C	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	205						endoplasmic reticulum|integral to membrane				ovary(1)|breast(1)	2	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)													0.75	112.496137	114.997488	33	11	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)	Nonsense_Mutation	SNP	173451848	173451848	6212	3	C	T	T	23	23	FNDC3B	T	5	1
CCDC39	339829	broad.mit.edu	36	3	181862414	181862414	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:181862414G>A	uc010hxe.1	-	c.286C>T	c.(286-288)CGA>TGA	p.R96*	CCDC39_uc003fkn.1_Non-coding_Transcript	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	96	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)													0.833333	15.89933	16.510408	5	1	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)		Nonsense_Mutation	SNP	181862414	181862414	2933	3	G	A	A	40	40	CCDC39	A	5	1
TMEM44	93109	broad.mit.edu	36	3	195825632	195825632	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:195825632G>A	uc010hzn.1	-	c.440C>T	c.(439-441)CCG>CTG	p.P147L	TMEM44_uc003fud.1_Missense_Mutation_p.P147L|TMEM44_uc003fue.1_Missense_Mutation_p.P147L|TMEM44_uc003fuf.1_Missense_Mutation_p.P147L|TMEM44_uc003fuh.1_Non-coding_Transcript	NM_001011655	NP_001011655	Q2T9K0	TMM44_HUMAN	transmembrane protein 44 isoform b	147	Helical; (Potential).					integral to membrane					0	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)													0.802083	254.425351	262.584492	77	19	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)	Missense_Mutation	SNP	195825632	195825632	16707	3	G	A	A	39	39	TMEM44	A	1	1
ACAP2	23527	broad.mit.edu	36	3	196504099	196504099	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:196504099G>A	uc003fun.2	-	c.1210C>T	c.(1210-1212)CGG>TGG	p.R404W		NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2	404	Arf-GAP.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2														0.749091	663.64918	679.146101	206	69	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	196504099	196504099	120	3	G	A	A	38	38	ACAP2	A	1	1
EOMES	8320	broad.mit.edu	36	3	27734150	27734150	+	Silent	SNP	G	A	A	rs62253095	unknown	TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:27734150G>A	uc003cdy.2	-	c.1533C>T	c.(1531-1533)GGC>GGT	p.G511G	EOMES_uc003cdx.1_Silent_p.G492G|EOMES_uc010hfn.1_3'UTR	NM_005442	NP_005433	O95936	EOMES_HUMAN	eomesodermin	492					CD8-positive, alpha-beta T cell differentiation involved in immune response|cell differentiation involved in embryonic placenta development|endoderm formation|mesoderm formation|mesodermal to mesenchymal transition involved in gastrulation|regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription activator activity			ovary(3)|breast(1)	4														0.776536	438.161584	450.728413	139	40	GG		KEEP	---	---	---	---	capture			Silent	SNP	27734150	27734150	5340	3	G	A	A	38	38	EOMES	A	1	1
IL5RA	3568	broad.mit.edu	36	3	3114615	3114615	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:3114615G>A	uc003bph.1	-	c.648C>T	c.(646-648)AAC>AAT	p.N216N	IL5RA_uc010hbq.1_Silent_p.N216N|IL5RA_uc010hbr.1_Intron|IL5RA_uc010hbs.1_Silent_p.N216N|IL5RA_uc003bpi.1_Silent_p.N216N|IL5RA_uc010hbt.1_Silent_p.N216N|IL5RA_uc003bpj.1_Silent_p.N216N|IL5RA_uc010hbu.1_Silent_p.N216N	NM_000564	NP_783853	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha isoform 1	216	Extracellular (Potential).				cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity			ovary(1)	1						GBM(169;430 2801 24955 28528)								0.807018	151.477726	156.492266	46	11	GG		KEEP	---	---	---	---	capture		Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)	Silent	SNP	3114615	3114615	8001	3	G	A	A	40	40	IL5RA	A	1	1
SCN5A	6331	broad.mit.edu	36	3	38620395	38620395	+	Missense_Mutation	SNP	G	A	A	rs45600438	unknown	TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:38620395G>A	uc003cio.1	-	c.1702C>T	c.(1702-1704)CGC>TGC	p.R568C	SCN5A_uc003cim.1_Missense_Mutation_p.R434C|SCN5A_uc003cin.1_Missense_Mutation_p.R568C|SCN5A_uc003cil.2_Missense_Mutation_p.R568C|SCN5A_uc010hhi.1_Missense_Mutation_p.R568C|SCN5A_uc010hhj.1_Missense_Mutation_p.R179C|SCN5A_uc010hhk.1_Missense_Mutation_p.R434C	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	568					blood circulation|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|central_nervous_system(1)	7	Medulloblastoma(35;0.163)				Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)									0.725806	281.692794	287.39114	90	34	GG		KEEP	---	---	---	---	capture		KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Missense_Mutation	SNP	38620395	38620395	14404	3	G	A	A	38	38	SCN5A	A	1	1
ULK4	54986	broad.mit.edu	36	3	41932539	41932539	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:41932539C>T	uc003ckv.2	-	c.737G>A	c.(736-738)CGT>CAT	p.R246H	ULK4_uc003ckw.2_Missense_Mutation_p.R246H|ULK4_uc003ckx.1_Missense_Mutation_p.R246H	NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4	246	Protein kinase.				protein phosphorylation		ATP binding|protein serine/threonine kinase activity				0										538				0.622642	108.787236	109.486908	33	20	CC		KEEP	---	---	---	---	capture		KIRC - Kidney renal clear cell carcinoma(284;0.214)	Missense_Mutation	SNP	41932539	41932539	17536	3	C	T	T	19	19	ULK4	T	1	1
KIF9	64147	broad.mit.edu	36	3	47259568	47259568	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:47259568C>T	uc003cqx.1	-	c.1686G>A	c.(1684-1686)CCG>CCA	p.P562P	KIF9_uc003cqy.1_Intron|KIF9_uc010hjp.1_Silent_p.P562P|KIF9_uc003cqz.1_Silent_p.P562P	NM_182902	NP_878905	Q9HAQ2	KIF9_HUMAN	kinesin family member 9 isoform 2	562					blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0		Acute lymphoblastic leukemia(5;0.164)				Colon(44;962 1147 15977 24541)								0.333333	95.617425	98.125977	34	68	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)	Silent	SNP	47259568	47259568	8621	3	C	T	T	31	31	KIF9	T	1	1
PLXNB1	5364	broad.mit.edu	36	3	48436486	48436486	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:48436486G>A	uc003csv.1	-	c.2213C>T	c.(2212-2214)CCA>CTA	p.P738L	PLXNB1_uc003csu.1_Intron|PLXNB1_uc003csw.1_Missense_Mutation_p.P738L|PLXNB1_uc003csx.1_Missense_Mutation_p.P738L|PLXNB1_uc010hjx.1_Intron	NM_002673	NP_002664	O43157	PLXB1_HUMAN	plexin B1	738	Extracellular (Potential).|Pro-rich.				axon guidance|cell migration|intracellular signal transduction|regulation of cell shape|regulation of cytoskeleton organization|regulation of small GTPase mediated signal transduction|semaphorin-plexin signaling pathway	extracellular region|integral to plasma membrane|intracellular|semaphorin receptor complex	GTPase activator activity|semaphorin receptor activity|semaphorin receptor binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5														0.689655	63.608179	64.536382	20	9	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	Missense_Mutation	SNP	48436486	48436486	12549	3	G	A	A	47	47	PLXNB1	A	2	2
CELSR3	1951	broad.mit.edu	36	3	48645999	48645999	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:48645999G>A	uc003cuf.1	-	c.10279C>T	c.(10279-10281)CGG>TGG	p.R3427W	SLC26A6_uc003cug.1_Missense_Mutation_p.R12W|SLC26A6_uc003cuh.1_Missense_Mutation_p.R33W|SLC26A6_uc003cuk.1_Missense_Mutation_p.R33W|SLC26A6_uc003cui.1_Missense_Mutation_p.R33W|SLC26A6_uc003cuj.1_Missense_Mutation_p.R33W|SLC26A6_uc010hke.1_De_novo_Start_InFrame	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	Error:Variant_position_missing_in_Q9NYQ7_after_alignment					homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7														0.731481	503.016868	513.473454	158	58	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	Missense_Mutation	SNP	48645999	48645999	3356	3	G	A	A	40	40	CELSR3	A	1	1
NCKIPSD	51517	broad.mit.edu	36	3	48692071	48692071	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:48692071G>A	uc003cun.1	-	c.1430C>T	c.(1429-1431)ACG>ATG	p.T477M	NCKIPSD_uc003cum.1_Missense_Mutation_p.T470M	NM_016453	NP_057537	Q9NZQ3	SPN90_HUMAN	NCK interacting protein with SH3 domain isoform	477	Leu-rich.				cytoskeleton organization|NLS-bearing substrate import into nucleus|signal transduction	intermediate filament|nucleus	cytoskeletal protein binding|SH3 domain binding				0										56				0.679612	220.074357	223.023313	70	33	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	Missense_Mutation	SNP	48692071	48692071	10624	3	G	A	A	40	40	NCKIPSD	A	1	1
P4HTM	54681	broad.mit.edu	36	3	49013883	49013883	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49013883G>A	uc003cvh.1	+	c.445G>A	c.(445-447)GGC>AGC	p.G149S	P4HTM_uc003cvg.1_Missense_Mutation_p.G149S|P4HTM_uc010hkm.1_Missense_Mutation_p.G35S	NM_177938	NP_808807	Q9NXG6	P4HTM_HUMAN	hypoxia-inducible factor prolyl 4-hydroxylase	149	Lumenal (Potential).				oxidation-reduction process	endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)									0.666667	106.113151	107.293731	32	16	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49013883	49013883	11773	3	G	A	A	39	39	P4HTM	A	1	1
BSN	8927	broad.mit.edu	36	3	49673774	49673774	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49673774C>T	uc003cxe.2	+	c.9492C>T	c.(9490-9492)ATC>ATT	p.I3164I		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	3164					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	zinc ion binding			ovary(5)|central_nervous_system(1)|pancreas(1)	7														0.712766	213.051587	216.865991	67	27	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)	Silent	SNP	49673774	49673774	1561	3	C	T	T	31	31	BSN	T	1	1
CACNA2D2	9254	broad.mit.edu	36	3	50380106	50380106	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:50380106G>A	uc003daq.1	-	c.2289C>T	c.(2287-2289)GAC>GAT	p.D763D	CACNA2D2_uc003dap.1_Silent_p.D756D|CACNA2D2_uc003dao.1_5'Flank	NM_006030	NP_006021	Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha	763	Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1					Gabapentin(DB00996)									0.2	33.629369	40.744195	17	68	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Silent	SNP	50380106	50380106	2665	3	G	A	A	40	40	CACNA2D2	A	1	1
DNAH1	25981	broad.mit.edu	36	3	52375914	52375914	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:52375914C>T	uc003dds.1	+	c.5736C>T	c.(5734-5736)TAC>TAT	p.Y1912Y		NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1912	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3														0.657895	232.139352	234.653009	75	39	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	Silent	SNP	52375914	52375914	4779	3	C	T	T	19	19	DNAH1	T	1	1
STAB1	23166	broad.mit.edu	36	3	52528576	52528576	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:52528576G>A	uc003dej.1	+	c.5191G>A	c.(5191-5193)GCC>ACC	p.A1731T	STAB1_uc003dek.1_5'UTR|STAB1_uc003del.1_5'Flank	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	1731	Extracellular (Potential).|FAS1 6.				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|pancreas(1)|breast(1)|central_nervous_system(1)|skin(1)	7														0.75	234.851624	240.525551	75	25	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)	Missense_Mutation	SNP	52528576	52528576	15755	3	G	A	A	38	38	STAB1	A	1	1
ITIH4	3700	broad.mit.edu	36	3	52828460	52828460	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:52828460C>T	uc003dfz.1	-	c.2066G>A	c.(2065-2067)CGT>CAT	p.R689H	ITIH4_uc003dfx.1_Missense_Mutation_p.R389H|ITIH4_uc003dfy.1_Missense_Mutation_p.R523H	NM_002218	NP_002209	Q14624	ITIH4_HUMAN	inter-alpha (globulin) inhibitor H4	689					acute-phase response|hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)	2														0.784314	255.545382	263.151325	80	22	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)	Missense_Mutation	SNP	52828460	52828460	8210	3	C	T	T	19	19	ITIH4	T	1	1
TKT	7086	broad.mit.edu	36	3	53244226	53244226	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:53244226G>A	uc003dgo.1	-	c.442C>T	c.(442-444)CGA>TGA	p.R148*	TKT_uc003dgq.1_Nonsense_Mutation_p.R148*|TKT_uc010hmu.1_Non-coding_Transcript	NM_001064	NP_001055	P29401	TKT_HUMAN	transketolase isoform 1	148					energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|transketolase activity			ovary(2)	2		Prostate(884;0.0959)			Thiamine(DB00152)	Colon(133;1506 2347 35238 42177)								0.146067	22.651619	33.341591	13	76	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)	Nonsense_Mutation	SNP	53244226	53244226	16463	3	G	A	A	39	39	TKT	A	5	1
FOXP1	27086	broad.mit.edu	36	3	71330093	71330093	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:71330093C>T	uc003dol.1	-	c.130G>A	c.(130-132)GTG>ATG	p.V44M	FOXP1_uc003dom.1_Missense_Mutation_p.V44M|FOXP1_uc003don.1_Non-coding_Transcript|FOXP1_uc003doo.1_Missense_Mutation_p.V44M|FOXP1_uc003dop.1_Missense_Mutation_p.V44M|FOXP1_uc003doq.1_Missense_Mutation_p.V44M|FOXP1_uc003dos.1_Missense_Mutation_p.V44M	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN	forkhead box P1 isoform 1	44					cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|negative regulation of gene-specific transcription from RNA polymerase II promoter|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)								261				0.777027	352.561603	362.995649	115	33	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)	Missense_Mutation	SNP	71330093	71330093	6272	3	C	T	T	19	19	FOXP1	T	1	1
CNTN3	5067	broad.mit.edu	36	3	74501045	74501045	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:74501045G>A	uc003dpm.1	-	c.931C>T	c.(931-933)CGT>TGT	p.R311C		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3	311	Ig-like C2-type 3.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)	4		Lung NSC(201;0.138)|Lung SC(41;0.21)												0.36	49.736476	50.599017	18	32	GG		KEEP	---	---	---	---	capture		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)	Missense_Mutation	SNP	74501045	74501045	3780	3	G	A	A	38	38	CNTN3	A	1	1
LMCD1	29995	broad.mit.edu	36	3	8582236	8582236	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:8582236C>T	uc003bqq.1	+	c.842C>T	c.(841-843)CCG>CTG	p.P281L		NM_014583	NP_055398	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1	281	LIM zinc-binding 1.				positive regulation of calcineurin-NFAT signaling pathway|regulation of cardiac muscle hypertrophy|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus	transcription corepressor activity|zinc ion binding			ovary(1)	1														0.72093	197.264091	201.034934	62	24	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(96;0.124)	Missense_Mutation	SNP	8582236	8582236	9173	3	C	T	T	23	23	LMCD1	T	1	1
OGG1	4968	broad.mit.edu	36	3	9773261	9773261	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:9773261C>T	uc003bsm.1	+	c.854C>T	c.(853-855)ACG>ATG	p.T285M	OGG1_uc003bsh.1_Missense_Mutation_p.T285M|OGG1_uc003bsj.1_Missense_Mutation_p.T285M|OGG1_uc003bsi.1_Missense_Mutation_p.T285M|OGG1_uc003bsl.1_Missense_Mutation_p.T285M|OGG1_uc003bsk.1_Missense_Mutation_p.T285M|OGG1_uc003bsn.1_Intron|OGG1_uc003bso.1_Intron|OGG1_uc003bsr.1_Missense_Mutation_p.T50M|OGG1_uc010hcm.1_Intron|OGG1_uc003bsq.1_Intron|OGG1_uc003bsp.1_Missense_Mutation_p.T50M	NM_016821	NP_058214	O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase isoform 2a	285					depurination|nucleotide-excision repair|regulation of protein import into nucleus, translocation|regulation of transcription, DNA-dependent|response to oxidative stress|response to radiation	mitochondrion|nuclear matrix|nuclear speck	damaged DNA binding|endonuclease activity|oxidized purine base lesion DNA N-glycosylase activity|protein binding				0	Medulloblastoma(99;0.227)									40				0.673913	97.427721	98.659475	31	15	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9773261	9773261	11250	3	C	T	T	19	19	OGG1	T	1	1
INTS12	57117	broad.mit.edu	36	4	106823664	106823664	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:106823664G>A	uc003hxw.1	-	c.1064C>T	c.(1063-1065)ACG>ATG	p.T355M	INTS12_uc010ilr.1_Missense_Mutation_p.T355M	NM_020395	NP_065128	Q96CB8	INT12_HUMAN	integrator complex subunit 12	355	Ser-rich.				snRNA processing	integrator complex	protein binding|zinc ion binding				0														0.700483	463.527616	470.95424	145	62	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)	Missense_Mutation	SNP	106823664	106823664	8078	4	G	A	A	40	40	INTS12	A	1	1
ENPEP	2028	broad.mit.edu	36	4	111617366	111617366	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:111617366C>T	uc003iab.2	+	c.347C>T	c.(346-348)ACG>ATG	p.T116M		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	116	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(203;0.217)			L-Glutamic Acid(DB00142)									0.716157	512.758089	522.356062	164	65	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	Missense_Mutation	SNP	111617366	111617366	5321	4	C	T	T	19	19	ENPEP	T	1	1
EXOSC9	5393	broad.mit.edu	36	4	122950584	122950584	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:122950584G>A	uc003idz.1	+	c.618G>A	c.(616-618)TTG>TTA	p.L206L	EXOSC9_uc003iea.1_Silent_p.L206L|EXOSC9_uc003ieb.1_Silent_p.L190L|EXOSC9_uc010inp.1_Non-coding_Transcript	NM_001034194	NP_001029366	Q06265	EXOS9_HUMAN	exosome component 9 isoform 1	206	ARE binding.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|immune response|nuclear mRNA surveillance|nuclear polyadenylation-dependent rRNA catabolic process|positive regulation of cell growth|rRNA processing	cytosol|nuclear exosome (RNase complex)|nucleolus|nucleolus|nucleus	3'-5'-exoribonuclease activity|AU-rich element binding|protein binding				0														0.128205	24.77997	45.808076	20	136	GG		KEEP	---	---	---	---	capture			Silent	SNP	122950584	122950584	5515	4	G	A	A	47	47	EXOSC9	A	2	2
KIAA0922	23240	broad.mit.edu	36	4	154736865	154736865	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:154736865G>A	uc003inm.2	+	c.1998G>A	c.(1996-1998)ACG>ACA	p.T666T	KIAA0922_uc010ipp.1_Silent_p.T667T|KIAA0922_uc010ipq.1_Silent_p.T435T|KIAA0922_uc010ipr.1_Silent_p.T519T	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2	666	Extracellular (Potential).					integral to membrane				ovary(1)	1	all_hematologic(180;0.093)	Renal(120;0.118)												0.728395	385.814199	393.433116	118	44	GG		KEEP	---	---	---	---	capture			Silent	SNP	154736865	154736865	8508	4	G	A	A	38	38	KIAA0922	A	1	1
ACCN5	51802	broad.mit.edu	36	4	157004215	157004215	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:157004215C>T	uc003ipe.1	-	c.182G>A	c.(181-183)CGC>CAC	p.R61H		NM_017419	NP_059115	Q9NY37	ACCN5_HUMAN	amiloride-sensitive cation channel 5,	61	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(2)	2	all_hematologic(180;0.24)	Renal(120;0.0458)												0.752475	241.931301	247.784497	76	25	CC		KEEP	---	---	---	---	capture		KIRC - Kidney renal clear cell carcinoma(143;0.0464)|Kidney(143;0.058)|COAD - Colon adenocarcinoma(41;0.141)	Missense_Mutation	SNP	157004215	157004215	133	4	C	T	T	27	27	ACCN5	T	1	1
STOX2	56977	broad.mit.edu	36	4	185168270	185168270	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:185168270G>A	uc003ivz.1	+	c.1285G>A	c.(1285-1287)GTG>ATG	p.V429M	STOX2_uc003iwa.1_Missense_Mutation_p.V118M	NM_020225	NP_064610	Q9P2F5	STOX2_HUMAN	storkhead box 2	429					embryo development|maternal placenta development						0		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)												0.666667	24.902713	25.197495	8	4	GG		KEEP	---	---	---	---	capture		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)	Missense_Mutation	SNP	185168270	185168270	15840	4	G	A	A	40	40	STOX2	A	1	1
SNX25	83891	broad.mit.edu	36	4	186478912	186478912	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:186478912C>T	uc003ixh.1	+	c.884C>T	c.(883-885)ACG>ATG	p.T295M	SNX25_uc010ish.1_Missense_Mutation_p.T66M|SNX25_uc003ixi.2_De_novo_Start_OutOfFrame	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25	295	RGS.				cell communication|protein transport		phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)												0.344262	117.612614	120.226248	42	80	CC		KEEP	---	---	---	---	capture		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)	Missense_Mutation	SNP	186478912	186478912	15396	4	C	T	T	19	19	SNX25	T	1	1
FAT1	2195	broad.mit.edu	36	4	187758108	187758108	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:187758108G>A	uc003izf.1	-	c.12041C>T	c.(12040-12042)ACG>ATG	p.T4014M	FAT1_uc003ize.1_5'Flank	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	4014	Extracellular (Potential).|EGF-like 2.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						Colon(197;1040 2055 4143 4984 49344)								0.63	200.652044	202.141291	63	37	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	187758108	187758108	5925	4	G	A	A	40	40	FAT1	A	1	1
FAT1	2195	broad.mit.edu	36	4	187864811	187864811	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:187864811C>T	uc003izf.1	-	c.3165G>A	c.(3163-3165)ACG>ACA	p.T1055T	FAT1_uc010iso.1_Silent_p.T1055T	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	1055	Extracellular (Potential).|Cadherin 9.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						Colon(197;1040 2055 4143 4984 49344)								0.74026	389.42207	397.476666	114	40	CC		KEEP	---	---	---	---	capture			Silent	SNP	187864811	187864811	5925	4	C	T	T	23	23	FAT1	T	1	1
ADRA2C	152	broad.mit.edu	36	4	3738504	3738504	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:3738504G>A	uc003ghm.1	+	c.373G>A	c.(373-375)GGC>AGC	p.G125S	ADRA2C_uc010icx.1_Missense_Mutation_p.G125S	NM_000683	NP_000674	P18825	ADA2C_HUMAN	alpha-2C-adrenergic receptor	125	Helical; Name=3; (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|energy reserve metabolic process|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation|regulation of insulin secretion	endosome|integral to plasma membrane	alpha-2A adrenergic receptor binding|alpha2-adrenergic receptor activity|epinephrine binding|protein heterodimerization activity|protein homodimerization activity				0					Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)	Esophageal Squamous(12;454 628 4517 14479)								0.714286	99.565306	101.295894	30	12	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (64;0.163)	Missense_Mutation	SNP	3738504	3738504	340	4	G	A	A	39	39	ADRA2C	A	1	1
RHOH	399	broad.mit.edu	36	4	39921900	39921900	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:39921900G>A	uc003guz.2	+	c.499G>A	c.(499-501)GTC>ATC	p.V167I	RHOH_uc010ifs.1_Missense_Mutation_p.V167I	NM_004310	NP_004301	Q15669	RHOH_HUMAN	ras homolog gene family, member H	167					negative regulation of I-kappaB kinase/NF-kappaB cascade|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|T cell differentiation	cytosol|mitochondrion|plasma membrane	GTP binding|GTPase inhibitor activity|kinase inhibitor activity|Rho GTPase binding			ovary(1)	1										33				0.692308	141.693439	143.83561	45	20	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39921900	39921900	13815	4	G	A	A	40	40	RHOH	A	1	1
FRYL	285527	broad.mit.edu	36	4	48217832	48217832	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:48217832C>T	uc003gyh.1	-	c.7679G>A	c.(7678-7680)CGG>CAG	p.R2560Q	FRYL_uc003gyg.1_Missense_Mutation_p.R1256Q|FRYL_uc003gyi.1_Missense_Mutation_p.R1448Q|FRYL_uc003gyj.1_Missense_Mutation_p.R855Q|FRYL_uc003gyf.1_5'Flank	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	2560					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1														0.240741	31.872345	35.168112	13	41	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48217832	48217832	6314	4	C	T	T	23	23	FRYL	T	1	1
EXOC1	55763	broad.mit.edu	36	4	56429398	56429398	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:56429398G>A	uc003hbe.1	+	c.555G>A	c.(553-555)GCG>GCA	p.A185A	EXOC1_uc003hbf.1_Silent_p.A185A|EXOC1_uc003hbg.1_Silent_p.A185A	NM_018261	NP_060731	Q9NV70	EXOC1_HUMAN	exocyst complex component 1 isoform 1	185					exocytosis|protein transport	exocyst				ovary(2)|central_nervous_system(1)|skin(1)	4	Glioma(25;0.08)|all_neural(26;0.101)													0.722222	134.848712	137.248895	39	15	GG		KEEP	---	---	---	---	capture			Silent	SNP	56429398	56429398	5494	4	G	A	A	39	39	EXOC1	A	1	1
PPEF2	5470	broad.mit.edu	36	4	77006463	77006463	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:77006463C>T	uc003hix.1	-	c.1823G>A	c.(1822-1824)CGG>CAG	p.R608Q	PPEF2_uc003hiy.1_Non-coding_Transcript|PPEF2_uc003hiz.1_3'UTR	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	608					detection of stimulus involved in sensory perception|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4						NSCLC(105;1359 1603 15961 44567 47947)								0.759398	330.635766	338.806017	101	32	CC		KEEP	---	---	---	---	capture	Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)		Missense_Mutation	SNP	77006463	77006463	12738	4	C	T	T	23	23	PPEF2	T	1	1
SORCS2	57537	broad.mit.edu	36	4	7779438	7779438	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:7779438C>T	uc003gkb.2	+	c.2777C>T	c.(2776-2778)ACG>ATG	p.T926M		NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2	926	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2														0.654971	356.044138	359.671827	112	59	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7779438	7779438	15431	4	C	T	T	19	19	SORCS2	T	1	1
GPR78	27201	broad.mit.edu	36	4	8639709	8639709	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:8639709G>A	uc003glk.1	+	c.811G>A	c.(811-813)GTG>ATG	p.V271M	CPZ_uc003gll.1_Intron	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	271	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6														0.675	83.033339	84.119037	27	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8639709	8639709	6985	4	G	A	A	40	40	GPR78	A	1	1
TMEM175	84286	broad.mit.edu	36	4	942132	942132	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:942132G>A	uc003gbq.1	+	c.1363G>A	c.(1363-1365)GTG>ATG	p.V455M	TMEM175_uc003gbr.1_Missense_Mutation_p.V373M|TMEM175_uc003gbs.1_Missense_Mutation_p.V338M|TMEM175_uc003gbt.1_Missense_Mutation_p.V338M|TMEM175_uc003gbu.1_Missense_Mutation_p.V373M|TMEM175_uc003gbv.1_Missense_Mutation_p.V338M|TMEM175_uc010ibm.1_Missense_Mutation_p.V271M	NM_032326	NP_115702	Q9BSA9	TM175_HUMAN	transmembrane protein 175	455	Helical; (Potential).					integral to membrane					0														0.714286	155.887726	158.798592	50	20	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(23;0.0158)		Missense_Mutation	SNP	942132	942132	16625	4	G	A	A	40	40	TMEM175	A	1	1
WDR36	134430	broad.mit.edu	36	5	110467511	110467511	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:110467511G>A	uc003kpd.1	+	c.893G>A	c.(892-894)CGC>CAC	p.R298H	WDR36_uc010jbu.1_Non-coding_Transcript	NM_139281	NP_644810	Q8NI36	WDR36_HUMAN	WD repeat domain 36	298	WD 3.				response to stimulus|rRNA processing|visual perception	small-subunit processome				ovary(1)	1		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)												0.596774	115.783084	116.290101	37	25	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)	Missense_Mutation	SNP	110467511	110467511	17863	5	G	A	A	38	38	WDR36	A	1	1
SEMA6A	57556	broad.mit.edu	36	5	115810349	115810349	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:115810349C>T	uc003krx.2	-	c.3003G>A	c.(3001-3003)TCG>TCA	p.S1001S	SEMA6A_uc010jck.1_Silent_p.S984S|SEMA6A_uc003krv.2_Silent_p.S411S|SEMA6A_uc003krw.2_Silent_p.S461S|SEMA6A_uc010jcj.1_Silent_p.S528S	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and	984	Cytoplasmic (Potential).				apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)												0.409091	25.16928	25.328498	9	13	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)	Silent	SNP	115810349	115810349	14525	5	C	T	T	31	31	SEMA6A	T	1	1
PRR16	51334	broad.mit.edu	36	5	120050004	120050004	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:120050004C>T	uc003ksq.1	+	c.616C>T	c.(616-618)CGG>TGG	p.R206W	PRR16_uc003ksp.1_Missense_Mutation_p.R183W|PRR16_uc003ksr.1_Missense_Mutation_p.R136W	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	proline rich 16	206	Pro-rich.									pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)												0.172414	19.219379	25.096784	10	48	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)	Missense_Mutation	SNP	120050004	120050004	13032	5	C	T	T	31	31	PRR16	T	1	1
ADAMTS19	171019	broad.mit.edu	36	5	129065178	129065178	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:129065178G>A	uc003kvb.1	+	c.3135G>A	c.(3133-3135)TGG>TGA	p.W1045*	ADAMTS19_uc010jdh.1_Non-coding_Transcript	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1045	TSP type-1 4.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)	8		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)								425				0.217949	38.532055	44.252846	17	61	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)	Nonsense_Mutation	SNP	129065178	129065178	265	5	G	A	A	44	44	ADAMTS19	A	5	2
TRPC7	57113	broad.mit.edu	36	5	135720719	135720719	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:135720719C>T	uc003lbn.1	-	c.253G>A	c.(253-255)GTG>ATG	p.V85M	TRPC7_uc010jef.1_Missense_Mutation_p.V77M|TRPC7_uc010jeg.1_Non-coding_Transcript|TRPC7_uc010jeh.1_Missense_Mutation_p.V77M|TRPC7_uc010jei.1_Missense_Mutation_p.V77M|TRPC7_uc010jej.1_De_novo_Start_OutOfFrame	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	86	Cytoplasmic (Potential).|ANK 2.				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0														0.141975	30.608183	50.648238	23	139	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		Missense_Mutation	SNP	135720719	135720719	17135	5	C	T	T	19	19	TRPC7	T	1	1
KLHL3	26249	broad.mit.edu	36	5	137002612	137002612	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:137002612C>T	uc010jek.1	-	c.1148G>A	c.(1147-1149)CGC>CAC	p.R383H	KLHL3_uc003lbr.2_Missense_Mutation_p.R301H|KLHL3_uc010jel.1_Missense_Mutation_p.R152H|KLHL3_uc010jem.1_Missense_Mutation_p.R343H	NM_017415	NP_059111	Q9UH77	KLHL3_HUMAN	kelch-like 3	383	Kelch 2.					cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)												0.130435	7.717794	13.83034	6	40	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)	Missense_Mutation	SNP	137002612	137002612	8696	5	C	T	T	27	27	KLHL3	T	1	1
KIF20A	10112	broad.mit.edu	36	5	137546041	137546041	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:137546041C>T	uc003lcj.1	+	c.506C>T	c.(505-507)ACG>ATG	p.T169M	KIF20A_uc003lck.1_Missense_Mutation_p.T169M	NM_005733	NP_005724	O95235	KI20A_HUMAN	kinesin family member 20A	169	Kinesin-motor.				cytokinesis|M phase of mitotic cell cycle|microtubule-based movement|protein transport|vesicle-mediated transport	Golgi apparatus|microtubule|nucleoplasm	ATP binding|microtubule motor activity|protein binding|transporter activity				0														0.637363	186.870761	188.381043	58	33	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		Missense_Mutation	SNP	137546041	137546041	8597	5	C	T	T	19	19	KIF20A	T	1	1
KIF20A	10112	broad.mit.edu	36	5	137548134	137548134	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:137548134C>T	uc003lcj.1	+	c.1553C>T	c.(1552-1554)CCA>CTA	p.P518L	KIF20A_uc003lck.1_Missense_Mutation_p.P518L	NM_005733	NP_005724	O95235	KI20A_HUMAN	kinesin family member 20A	518					cytokinesis|M phase of mitotic cell cycle|microtubule-based movement|protein transport|vesicle-mediated transport	Golgi apparatus|microtubule|nucleoplasm	ATP binding|microtubule motor activity|protein binding|transporter activity				0														0.125475	40.977316	77.022084	33	230	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		Missense_Mutation	SNP	137548134	137548134	8597	5	C	T	T	21	21	KIF20A	T	2	2
ANKHD1-EIF4EBP3	404734	broad.mit.edu	36	5	139897307	139897307	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:139897307G>A	uc003lfs.1	+	c.7177G>A	c.(7177-7179)GCT>ACT	p.A2393T	ANKHD1_uc003lfr.1_Missense_Mutation_p.A2393T|ANKHD1_uc003lfw.1_Missense_Mutation_p.A1048T|ANKHD1_uc010jfl.1_Missense_Mutation_p.A769T|ANKHD1-EIF4EBP3_uc003lfx.1_Missense_Mutation_p.A547T	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	2393						cytoplasm|nucleus	RNA binding			ovary(6)	6														0.555556	150.462152	150.7057	50	40	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Missense_Mutation	SNP	139897307	139897307	632	5	G	A	A	38	38	ANKHD1-EIF4EBP3	A	1	1
IK	3550	broad.mit.edu	36	5	140018872	140018872	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140018872G>A	uc003lgq.1	+	c.1115G>A	c.(1114-1116)CGA>CAA	p.R372Q		NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein	372	16.|17 X 2 AA tandem repeats of R-[ED].				cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)												0.210526	8.289298	9.7626	4	15	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Missense_Mutation	SNP	140018872	140018872	7909	5	G	A	A	37	37	IK	A	1	1
PCDHA2	56146	broad.mit.edu	36	5	140156232	140156232	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140156232G>T	uc003lhd.1	+	c.1499G>T	c.(1498-1500)GGC>GTC	p.G500V	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.G500V	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	500	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4														0.158333	29.849584	43.207224	19	101	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Missense_Mutation	SNP	140156232	140156232	11944	5	G	T	T	42	42	PCDHA2	T	3	3
PCDHA4	56144	broad.mit.edu	36	5	140168627	140168627	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140168627C>T	uc003lhi.1	+	c.1671C>T	c.(1669-1671)GAC>GAT	p.D557D	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Silent_p.D557D|PCDHA4_uc003lhg.1_Silent_p.D557D	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	557	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)	4														0.625	319.198406	321.501749	105	63	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Silent	SNP	140168627	140168627	11946	5	C	T	T	19	19	PCDHA4	T	1	1
PCDHA7	56141	broad.mit.edu	36	5	140195527	140195527	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140195527G>A	uc003lhq.1	+	c.1375G>A	c.(1375-1377)GAG>AAG	p.E459K	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA4_uc003lhi.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.1_Intron|PCDHA6_uc003lho.1_Intron|PCDHA6_uc003lhn.1_Intron|PCDHA7_uc003lhp.1_Missense_Mutation_p.E459K	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	459	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)	1						NSCLC(160;258 2013 5070 22440 28951)								0.658537	257.004504	259.736443	81	42	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Missense_Mutation	SNP	140195527	140195527	11949	5	G	A	A	37	37	PCDHA7	A	1	1
PCDHA7	56141	broad.mit.edu	36	5	140196044	140196044	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140196044T>G	uc003lhq.1	+	c.1892T>G	c.(1891-1893)ATC>AGC	p.I631S	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA4_uc003lhi.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.1_Intron|PCDHA6_uc003lho.1_Intron|PCDHA6_uc003lhn.1_Intron|PCDHA7_uc003lhp.1_Missense_Mutation_p.I631S	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	631	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)	1						NSCLC(160;258 2013 5070 22440 28951)								0.113333	23.674946	45.79422	17	133	TT		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Missense_Mutation	SNP	140196044	140196044	11949	5	T	G	G	50	50	PCDHA7	G	4	4
PCDHA8	56140	broad.mit.edu	36	5	140201229	140201229	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140201229C>T	uc003lhs.1	+	c.139C>T	c.(139-141)CGG>TGG	p.R47W	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA4_uc003lhi.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.1_Intron|PCDHA6_uc003lho.1_Intron|PCDHA6_uc003lhn.1_Intron|PCDHA7_uc003lhq.1_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.R47W	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	47	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding				0														0.179348	71.373912	89.163582	33	151	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Missense_Mutation	SNP	140201229	140201229	11950	5	C	T	T	23	23	PCDHA8	T	1	1
PCDHA9	9752	broad.mit.edu	36	5	140208403	140208403	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140208403C>T	uc003lhu.1	+	c.139C>T	c.(139-141)CGC>TGC	p.R47C	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA4_uc003lhi.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.1_Intron|PCDHA6_uc003lho.1_Intron|PCDHA6_uc003lhn.1_Intron|PCDHA7_uc003lhq.1_Intron|PCDHA8_uc003lhs.1_Intron|PCDHA9_uc003lht.1_Missense_Mutation_p.R47C	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	47	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			large_intestine(2)|ovary(2)	4						Melanoma(55;1800 1972 14909)								0.106061	25.127607	65.744703	28	236	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Missense_Mutation	SNP	140208403	140208403	11951	5	C	T	T	23	23	PCDHA9	T	1	1
PCDHB3	56132	broad.mit.edu	36	5	140462149	140462149	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140462149C>T	uc003lio.1	+	c.1732C>T	c.(1732-1734)CGG>TGG	p.R578W		NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3 precursor	578	Extracellular (Potential).|Cadherin 6.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2														0.133333	35.210758	62.507245	28	182	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		Missense_Mutation	SNP	140462149	140462149	11963	5	C	T	T	23	23	PCDHB3	T	1	1
PCDHB15	56121	broad.mit.edu	36	5	140606919	140606919	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140606919G>A	uc003lje.1	+	c.1589G>A	c.(1588-1590)CGC>CAC	p.R530H		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	530	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)	4														0.289256	87.977759	92.794022	35	86	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		Missense_Mutation	SNP	140606919	140606919	11960	5	G	A	A	38	38	PCDHB15	A	1	1
PCDHGA2	56113	broad.mit.edu	36	5	140700729	140700729	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140700729C>T	uc003ljk.1	+	c.2007C>T	c.(2005-2007)CCC>CCT	p.P669P	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljj.1_Silent_p.P669P	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	669	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1														0.104938	14.390923	39.500915	17	145	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Silent	SNP	140700729	140700729	11974	5	C	T	T	23	23	PCDHGA2	T	1	1
PCDHGB1	56104	broad.mit.edu	36	5	140712132	140712132	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140712132C>T	uc003ljo.1	+	c.2121C>T	c.(2119-2121)ATC>ATT	p.I707I	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA4_uc003ljq.1_5'Flank|PCDHGB1_uc003ljn.1_Silent_p.I707I|PCDHGA4_uc003ljp.1_5'Flank	NM_018922	NP_061745	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1 isoform 1	707	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0														0.172269	74.245745	98.401208	41	197	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Silent	SNP	140712132	140712132	11982	5	C	T	T	31	31	PCDHGB1	T	1	1
PCDHGB2	56103	broad.mit.edu	36	5	140721856	140721856	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140721856C>T	uc003ljs.1	+	c.1970C>T	c.(1969-1971)ACG>ATG	p.T657M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc003ljr.1_Missense_Mutation_p.T657M|PCDHGA5_uc003ljt.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	657	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0														0.162162	21.452248	29.48471	12	62	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Missense_Mutation	SNP	140721856	140721856	11983	5	C	T	T	19	19	PCDHGB2	T	1	1
PCDHGA6	56109	broad.mit.edu	36	5	140735781	140735781	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140735781C>T	uc003ljy.1	+	c.1947C>T	c.(1945-1947)CAC>CAT	p.H649H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljx.1_Silent_p.H649H	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	649	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1														0.125	8.94425	22.142461	12	84	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Silent	SNP	140735781	140735781	11978	5	C	T	T	19	19	PCDHGA6	T	1	1
PCDHGA8	9708	broad.mit.edu	36	5	140754853	140754853	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140754853G>A	uc003lkd.1	+	c.2289G>A	c.(2287-2289)TCG>TCA	p.S763S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.2_Silent_p.S763S	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	763	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0														0.173469	33.719869	43.581082	17	81	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Silent	SNP	140754853	140754853	11980	5	G	A	A	38	38	PCDHGA8	A	1	1
PCDHGB6	56100	broad.mit.edu	36	5	140769869	140769869	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140769869G>A	uc003lkj.1	+	c.1916G>A	c.(1915-1917)CGC>CAC	p.R639H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lki.1_Missense_Mutation_p.R639H	NM_018926	NP_061749	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6 isoform 1	639	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0														0.145455	11.473078	18.118581	8	47	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Missense_Mutation	SNP	140769869	140769869	11987	5	G	A	A	38	38	PCDHGB6	A	1	1
ARAP3	64411	broad.mit.edu	36	5	141040087	141040087	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:141040087C>T	uc003llm.1	-	c.151G>A	c.(151-153)GCC>ACC	p.A51T	ARAP3_uc003lln.1_5'UTR|ARAP3_uc003llo.1_Missense_Mutation_p.A51T	NM_022481	NP_071926	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	51	SAM.				cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding			breast(5)|ovary(1)|large_intestine(1)	7														0.630303	319.625505	322.087707	104	61	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	141040087	141040087	851	5	C	T	T	27	27	ARAP3	T	1	1
PCDH1	5097	broad.mit.edu	36	5	141223735	141223735	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:141223735C>T	uc003llp.1	-	c.2345G>A	c.(2344-2346)CGG>CAG	p.R782Q	PCDH1_uc003llq.1_Missense_Mutation_p.R782Q	NM_032420	NP_115796	Q08174	PCDH1_HUMAN	protocadherin 1 isoform 2 precursor	782	Extracellular (Potential).|Cadherin 7.				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding			ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)				Ovarian(132;1609 1739 4190 14731 45037)								0.122449	12.62609	26.339753	12	86	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)	Missense_Mutation	SNP	141223735	141223735	11926	5	C	T	T	23	23	PCDH1	T	1	1
PCDH12	51294	broad.mit.edu	36	5	141316679	141316679	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:141316679G>A	uc003llx.1	-	c.922C>T	c.(922-924)CGA>TGA	p.R308*		NM_016580	NP_057664	Q9NPG4	PCD12_HUMAN	protocadherin 12 precursor	308	Extracellular (Potential).|Cadherin 3.				neuron recognition	integral to plasma membrane	calcium ion binding			ovary(3)	3		all_hematologic(541;0.0999)												0.11828	12.464601	25.775497	11	82	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Nonsense_Mutation	SNP	141316679	141316679	11930	5	G	A	A	37	37	PCDH12	A	5	1
TRIO	7204	broad.mit.edu	36	5	14411419	14411419	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:14411419G>A	uc003jff.1	+	c.2179G>A	c.(2179-2181)GTG>ATG	p.V727M	TRIO_uc003jfg.1_Non-coding_Transcript|TRIO_uc003jfh.1_Missense_Mutation_p.V376M	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	727					apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|breast(2)|stomach(1)|kidney(1)	16	Lung NSC(4;0.000742)									1300				0.274112	138.165199	147.220699	54	143	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14411419	14411419	17102	5	G	A	A	40	40	TRIO	A	1	1
TRIO	7204	broad.mit.edu	36	5	14459712	14459712	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:14459712C>T	uc003jff.1	+	c.4890C>T	c.(4888-4890)GAC>GAT	p.D1630D	TRIO_uc003jfg.1_Non-coding_Transcript|TRIO_uc003jfh.1_Silent_p.D1279D	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	1630					apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|breast(2)|stomach(1)|kidney(1)	16	Lung NSC(4;0.000742)								p.D1630D(NCIH2228-Tumor)	1300				0.324324	174.46624	180.527232	72	150	CC		KEEP	---	---	---	---	capture			Silent	SNP	14459712	14459712	17102	5	C	T	T	19	19	TRIO	T	1	1
LARS	51520	broad.mit.edu	36	5	145532465	145532465	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:145532465G>A	uc003lnx.1	-	c.191C>T	c.(190-192)ACG>ATG	p.T64M		NM_020117	NP_064502	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	64					leucyl-tRNA aminoacylation	cytosol	ATP binding|leucine-tRNA ligase activity|protein binding				0					L-Leucine(DB00149)									0.75	118.019733	120.745839	36	12	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Missense_Mutation	SNP	145532465	145532465	8957	5	G	A	A	40	40	LARS	A	1	1
CDX1	1044	broad.mit.edu	36	5	149542565	149542565	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:149542565G>A	uc003lrq.1	+	c.487G>A	c.(487-489)GAC>AAC	p.D163N		NM_001804	NP_001795	P47902	CDX1_HUMAN	caudal type homeobox 1	163	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.224)												0.147059	54.980733	83.457109	35	203	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Missense_Mutation	SNP	149542565	149542565	3311	5	G	A	A	37	37	CDX1	A	1	1
TIMD4	91937	broad.mit.edu	36	5	156311216	156311216	+	Silent	SNP	A	G	G			TCGA-19-1787-01	TCGA-19-1787-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:156311216A>G	uc003lwh.1	-	c.564T>C	c.(562-564)ATT>ATC	p.I188I	TIMD4_uc010jii.1_Silent_p.I188I	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain	188	Extracellular (Potential).|Thr-rich.					integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)												0.099174	14.820513	53.694003	24	218	AA		KEEP	---	---	---	---	capture	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Silent	SNP	156311216	156311216	16432	5	A	G	G	5	5	TIMD4	G	4	4
LSM11	134353	broad.mit.edu	36	5	157111098	157111098	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:157111098G>A	uc003lxe.1	+	c.571G>A	c.(571-573)GAC>AAC	p.D191N		NM_173491	NP_775762	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated	191	SM 1.				histone mRNA 3'-end processing|S phase of mitotic cell cycle|termination of RNA polymerase II transcription	histone pre-mRNA 3'end processing complex|nucleoplasm|U7 snRNP	protein binding|U7 snRNA binding				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)												0.143678	36.553515	57.841171	25	149	GG		KEEP	---	---	---	---	capture	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Missense_Mutation	SNP	157111098	157111098	9428	5	G	A	A	37	37	LSM11	A	1	1
ATP10B	23120	broad.mit.edu	36	5	159929232	159929232	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:159929232G>C	uc003lym.1	-	c.3787C>G	c.(3787-3789)CTG>GTG	p.L1263V	ATP10B_uc010jit.1_Missense_Mutation_p.L513V	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1263	Helical; (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)												0.455882	81.083639	81.202282	31	37	GG		KEEP	---	---	---	---	capture	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Missense_Mutation	SNP	159929232	159929232	1136	5	G	C	C	35	35	ATP10B	C	3	3
GABRA1	2554	broad.mit.edu	36	5	161232842	161232842	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1787-01	TCGA-19-1787-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:161232842A>G	uc010jiw.1	+	c.397A>G	c.(397-399)AAG>GAG	p.K133E	GABRA1_uc010jix.1_Missense_Mutation_p.K133E|GABRA1_uc010jiy.1_Missense_Mutation_p.K133E|GABRA1_uc003lyx.2_Missense_Mutation_p.K133E|GABRA1_uc010jiz.1_Missense_Mutation_p.K133E|GABRA1_uc010jja.1_Missense_Mutation_p.K133E|GABRA1_uc010jjb.1_Missense_Mutation_p.K133E	NM_000806	NP_001121120	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	133	Extracellular (Probable).			Missing (in Ref. 4; CAA31925).	gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)			Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)									0.522388	126.331072	126.360462	35	32	AA		KEEP	---	---	---	---	capture	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Missense_Mutation	SNP	161232842	161232842	6411	5	A	G	G	9	9	GABRA1	G	4	4
SLIT3	6586	broad.mit.edu	36	5	168113559	168113559	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:168113559G>A	uc010jjg.1	-	c.1717C>T	c.(1717-1719)CGA>TGA	p.R573*	SLIT3_uc003mab.1_Nonsense_Mutation_p.R573*	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3	573	LRR 13.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)	3	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)				Ovarian(29;311 847 10864 17279 24903)								0.238095	10.462009	11.780234	5	16	GG		KEEP	---	---	---	---	capture	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Nonsense_Mutation	SNP	168113559	168113559	15239	5	G	A	A	38	38	SLIT3	A	5	1
FYB	2533	broad.mit.edu	36	5	39238232	39238232	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:39238232G>A	uc003jlt.1	-	c.588C>T	c.(586-588)CCC>CCT	p.P196P	FYB_uc003jls.1_Silent_p.P196P|FYB_uc003jlu.1_Silent_p.P196P	NM_001465	NP_001456	O15117	FYB_HUMAN	FYN binding protein (FYB-120/130) isoform 1	196					cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding			ovary(2)	2	all_lung(31;0.000343)													0.522613	316.989615	317.078063	104	95	GG		KEEP	---	---	---	---	capture	Epithelial(62;0.235)		Silent	SNP	39238232	39238232	6375	5	G	A	A	39	39	FYB	A	1	1
C7	730	broad.mit.edu	36	5	40981153	40981153	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:40981153C>T	uc003jmh.1	+	c.664C>T	c.(664-666)CGC>TGC	p.R222C		NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	222	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)												0.285714	24.544886	25.981996	10	25	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40981153	40981153	2482	5	C	T	T	27	27	C7	T	1	1
C6	729	broad.mit.edu	36	5	41195046	41195046	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:41195046G>A	uc003jml.1	-	c.1778C>T	c.(1777-1779)TCG>TTG	p.S593L	C6_uc003jmk.2_Missense_Mutation_p.S584L	NM_001115131	NP_001108603	P13671	CO6_HUMAN	complement component 6 precursor	584	TSP type-1 3.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)	5		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)												0.294964	110.416994	115.647309	41	98	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41195046	41195046	2416	5	G	A	A	37	37	C6	A	1	1
PARP8	79668	broad.mit.edu	36	5	50126609	50126609	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:50126609C>T	uc003jon.2	+	c.1029C>T	c.(1027-1029)TCC>TCT	p.S343S	PARP8_uc003joo.1_Silent_p.S343S|PARP8_uc003jop.1_Silent_p.S343S	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	343						intracellular	NAD+ ADP-ribosyltransferase activity			large_intestine(1)|ovary(1)	2		Lung NSC(810;0.0305)|Breast(144;0.222)												0.51049	245.881347	245.895136	73	70	CC		KEEP	---	---	---	---	capture			Silent	SNP	50126609	50126609	11882	5	C	T	T	24	24	PARP8	T	2	2
ITGA2	3673	broad.mit.edu	36	5	52396583	52396583	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:52396583G>A	uc003joy.1	+	c.1687G>A	c.(1687-1689)GAC>AAC	p.D563N		NM_002203	NP_002194	P17301	ITA2_HUMAN	integrin alpha 2 precursor	563	Potential.|Extracellular (Potential).|FG-GAP 6.				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity			lung(1)	1		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)												0.575581	325.84228	326.697532	99	73	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52396583	52396583	8179	5	G	A	A	33	33	ITGA2	A	2	2
KIAA0947	23379	broad.mit.edu	36	5	5516363	5516363	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:5516363C>T	uc003jdm.2	+	c.3916C>T	c.(3916-3918)CGG>TGG	p.R1306W		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1306										ovary(1)|central_nervous_system(1)	2														0.73913	56.48499	57.675586	17	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5516363	5516363	8509	5	C	T	T	31	31	KIAA0947	T	1	1
PDE4D	5144	broad.mit.edu	36	5	58307946	58307946	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:58307946G>A	uc003jsa.2	-	c.1818C>T	c.(1816-1818)TCC>TCT	p.S606S	PDE4D_uc003jrx.2_Silent_p.S470S|PDE4D_uc003jry.2_Silent_p.S304S|PDE4D_uc003jrz.2_Silent_p.S542S|PDE4D_uc003jsb.2_Silent_p.S545S|PDE4D_uc003jrs.2_Silent_p.S315S|PDE4D_uc003jrt.2_Silent_p.S304S|PDE4D_uc003jru.2_Silent_p.S382S|PDE4D_uc003jrv.2_Silent_p.S476S|PDE4D_uc003jrw.2_Silent_p.S484S	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	cAMP-specific phosphodiesterase 4D isoform 1	606					signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)			Adenosine monophosphate(DB00131)|Dyphylline(DB00651)									0.263158	13.466022	14.430127	5	14	GG		KEEP	---	---	---	---	capture		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Silent	SNP	58307946	58307946	12063	5	G	A	A	39	39	PDE4D	A	1	1
PDE4D	5144	broad.mit.edu	36	5	58370442	58370442	+	Splice_Site_SNP	SNP	C	A	A			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:58370442C>A	uc003jsa.2	-	c.921_splice	c.e6+1	p.K307_splice	PDE4D_uc003jrx.2_Splice_Site_SNP_p.K171_splice|PDE4D_uc003jry.2_Splice_Site_SNP_p.K5_splice|PDE4D_uc003jrz.2_Splice_Site_SNP_p.K243_splice|PDE4D_uc003jsb.2_Splice_Site_SNP_p.K246_splice|PDE4D_uc003jrt.2_Splice_Site_SNP_p.K5_splice|PDE4D_uc003jru.2_Intron|PDE4D_uc003jrv.2_Splice_Site_SNP_p.K177_splice|PDE4D_uc003jrw.2_Splice_Site_SNP_p.K185_splice|PDE4D_uc010iwi.1_Intron	NM_001104631	NP_001098101			cAMP-specific phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)			Adenosine monophosphate(DB00131)|Dyphylline(DB00651)									0.230769	15.537028	17.263587	6	20	CC		KEEP	---	---	---	---	capture		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Splice_Site_SNP	SNP	58370442	58370442	12063	5	C	A	A	18	18	PDE4D	A	5	3
TMEM174	134288	broad.mit.edu	36	5	72505348	72505348	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:72505348C>T	uc003kco.1	+	c.522C>T	c.(520-522)GCC>GCT	p.A174A	TMEM174_uc010izc.1_Silent_p.A174A	NM_153217	NP_694949	Q8WUU8	TM174_HUMAN	transmembrane protein 174	174						integral to membrane				ovary(1)	1		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)												0.101266	11.487421	36.549636	16	142	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)	Silent	SNP	72505348	72505348	16624	5	C	T	T	23	23	TMEM174	T	1	1
NSA2	10412	broad.mit.edu	36	5	74100539	74100539	+	Missense_Mutation	SNP	C	T	T	rs3733793	by-cluster,by-frequency,by-hapmap	TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:74100539C>T	uc003kdk.1	+	c.31C>T	c.(31-33)CGT>TGT	p.R11C	GFM2_uc003kdh.1_5'Flank|GFM2_uc003kdi.1_5'Flank|GFM2_uc010izj.1_5'Flank|GFM2_uc010izk.1_5'Flank|GFM2_uc003kdj.1_5'Flank|GFM2_uc010izl.1_5'Flank	NM_014886	NP_055701	O95478	NSA2_HUMAN	TGF beta-inducible nuclear protein 1	11					rRNA processing	nucleolus|ribonucleoprotein complex				ovary(1)	1														0.263158	28.732548	30.66025	10	28	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74100539	74100539	11073	5	C	T	T	23	23	NSA2	T	1	1
IQGAP2	10788	broad.mit.edu	36	5	75996676	75996676	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:75996676G>A	uc003kek.1	+	c.2599G>A	c.(2599-2601)GAC>AAC	p.D867N	IQGAP2_uc003kel.1_Missense_Mutation_p.D363N	NM_006633	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	867					small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)												0.548077	183.985401	184.194875	57	47	GG		KEEP	---	---	---	---	capture		all cancers(79;1.38e-36)	Missense_Mutation	SNP	75996676	75996676	8118	5	G	A	A	37	37	IQGAP2	A	1	1
WDR41	55255	broad.mit.edu	36	5	76785484	76785484	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:76785484T>A	uc003kff.1	-	c.437A>T	c.(436-438)GAT>GTT	p.D146V		NM_018268	NP_060738	Q9HAD4	WDR41_HUMAN	WD repeat domain 41	146	WD 3.										0		all_lung(232;0.000961)|Lung NSC(167;0.0011)|Ovarian(174;0.0105)|Prostate(461;0.059)												0.23	52.169906	58.856549	23	77	TT		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(54;6.3e-50)|Epithelial(54;2.04e-44)|all cancers(79;6.84e-40)	Missense_Mutation	SNP	76785484	76785484	17867	5	T	A	A	50	50	WDR41	A	4	4
SEMA5A	9037	broad.mit.edu	36	5	9277814	9277814	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:9277814C>T	uc003jek.2	-	c.618G>A	c.(616-618)ACG>ACA	p.T206T		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A	206	Sema.|Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2														0.711111	109.618234	111.416197	32	13	CC		KEEP	---	---	---	---	capture			Silent	SNP	9277814	9277814	14523	5	C	T	T	23	23	SEMA5A	T	1	1
ARSK	153642	broad.mit.edu	36	5	94944391	94944391	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:94944391G>A	uc003kld.1	+	c.432G>A	c.(430-432)GCG>GCA	p.A144A	ARSK_uc010jbg.1_De_novo_Start_OutOfFrame	NM_198150	NP_937793	Q6UWY0	ARSK_HUMAN	arylsulfatase K	144						extracellular region	arylsulfatase activity|metal ion binding			pancreas(1)	1		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)												0.306273	225.324646	234.393942	83	188	GG		KEEP	---	---	---	---	capture		all cancers(79;6.5e-16)	Silent	SNP	94944391	94944391	1014	5	G	A	A	40	40	ARSK	A	1	1
LAMA4	3910	broad.mit.edu	36	6	112548351	112548351	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:112548351C>T	uc003pvu.2	-	c.4493G>A	c.(4492-4494)CGT>CAT	p.R1498H	LAMA4_uc003pvv.2_Missense_Mutation_p.R1491H|LAMA4_uc003pvt.2_Missense_Mutation_p.R1491H	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	1498	Laminin G-like 4.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)												0.7	69.386442	70.459215	21	9	CC		KEEP	---	---	---	---	capture		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)	Missense_Mutation	SNP	112548351	112548351	8931	6	C	T	T	19	19	LAMA4	T	1	1
HS3ST5	222537	broad.mit.edu	36	6	114485269	114485269	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:114485269G>A	uc003pwg.2	-	c.886C>T	c.(886-888)CGG>TGG	p.R296W	HS3ST5_uc003pwh.2_Missense_Mutation_p.R296W	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)	296	Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)												0.764706	211.812887	217.257719	65	20	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)	Missense_Mutation	SNP	114485269	114485269	7662	6	G	A	A	38	38	HS3ST5	A	1	1
ROS1	6098	broad.mit.edu	36	6	117837467	117837467	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:117837467G>A	uc003pxp.1	-	c.260C>T	c.(259-261)GCG>GTG	p.A87V	GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	87	Extracellular (Potential).				protein phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(5)|central_nervous_system(3)|stomach(2)|large_intestine(1)|lung(1)	12		all_cancers(87;0.00846)|all_epithelial(87;0.0242)								1038				0.666667	141.016584	142.639404	44	22	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)	Missense_Mutation	SNP	117837467	117837467	14010	6	G	A	A	38	38	ROS1	A	1	1
PERP	64065	broad.mit.edu	36	6	138454941	138454941	+	Nonsense_Mutation	SNP	G	T	T			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:138454941G>T	uc003qht.1	-	c.513C>A	c.(511-513)TGC>TGA	p.C171*		NM_022121	NP_071404	Q96FX8	PERP_HUMAN	PERP, TP53 apoptosis effector	171	Helical; (Potential).				apoptosis|cell adhesion	desmosome|Golgi apparatus|integral to membrane|nucleus					0	Breast(32;0.0799)|Colorectal(23;0.24)													0.695652	101.113761	102.683948	32	14	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(68;0.000878)|OV - Ovarian serous cystadenocarcinoma(155;0.000997)	Nonsense_Mutation	SNP	138454941	138454941	12153	6	G	T	T	34	34	PERP	T	5	3
SHPRH	257218	broad.mit.edu	36	6	146306424	146306424	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:146306424C>T	uc003qld.1	-	c.1786G>A	c.(1786-1788)GAT>AAT	p.D596N	SHPRH_uc010kht.1_Missense_Mutation_p.D429N|SHPRH_uc003qle.1_Missense_Mutation_p.D596N|SHPRH_uc003qlf.1_Missense_Mutation_p.D596N|SHPRH_uc003qlg.1_Missense_Mutation_p.D152N|SHPRH_uc003qlj.1_Missense_Mutation_p.D485N	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	596					DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)	2		Ovarian(120;0.0365)												0.737705	441.002592	450.362248	135	48	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)	Missense_Mutation	SNP	146306424	146306424	14786	6	C	T	T	31	31	SHPRH	T	1	1
SYNE1	23345	broad.mit.edu	36	6	152569037	152569037	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:152569037G>A	uc010kiw.1	-	c.22978C>T	c.(22978-22980)CGG>TGG	p.R7660W	SYNE1_uc003qor.2_Missense_Mutation_p.R560W|SYNE1_uc010kiv.1_Missense_Mutation_p.R2184W|SYNE1_uc003qos.2_Missense_Mutation_p.R2184W|SYNE1_uc003qot.2_Missense_Mutation_p.R7589W|SYNE1_uc003qou.2_Missense_Mutation_p.R7660W	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7660	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|ovary(8)|large_intestine(5)|pancreas(2)	30		Ovarian(120;0.0955)												0.214286	34.486651	39.763607	15	55	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	Missense_Mutation	SNP	152569037	152569037	15966	6	G	A	A	38	38	SYNE1	A	1	1
JARID2	3720	broad.mit.edu	36	6	15625472	15625472	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:15625472C>T	uc003nbj.1	+	c.3552C>T	c.(3550-3552)TAC>TAT	p.Y1184Y		NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein	1184					central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)								694				0.777778	298.579731	306.884439	91	26	CC		KEEP	---	---	---	---	capture			Silent	SNP	15625472	15625472	8249	6	C	T	T	19	19	JARID2	T	1	1
TULP4	56995	broad.mit.edu	36	6	158754153	158754153	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:158754153C>T	uc003qrf.1	+	c.321C>T	c.(319-321)TTC>TTT	p.F107F	TULP4_uc003qrg.1_Silent_p.F107F	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1	107	WD 1.				intracellular signal transduction|regulation of transcription, DNA-dependent|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)												0.12069	8.583082	16.765986	7	51	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)	Silent	SNP	158754153	158754153	17331	6	C	T	T	31	31	TULP4	T	1	1
TULP4	56995	broad.mit.edu	36	6	158843645	158843645	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:158843645C>T	uc003qrf.1	+	c.2962C>T	c.(2962-2964)CGG>TGG	p.R988W	TULP4_uc003qrg.1_Intron	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1	988					intracellular signal transduction|regulation of transcription, DNA-dependent|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)												0.666667	93.061552	94.170695	30	15	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)	Missense_Mutation	SNP	158843645	158843645	17331	6	C	T	T	27	27	TULP4	T	1	1
FNDC1	84624	broad.mit.edu	36	6	159555997	159555997	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:159555997C>T	uc010kjv.1	+	c.493C>T	c.(493-495)CGT>TGT	p.R165C	FNDC1_uc010kjw.1_Missense_Mutation_p.R113C	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	165	Fibronectin type-III 2.					extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)												0.71875	144.845371	147.590751	46	18	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)	Missense_Mutation	SNP	159555997	159555997	6210	6	C	T	T	27	27	FNDC1	T	1	1
T	6862	broad.mit.edu	36	6	166491870	166491870	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:166491870C>T	uc003qut.1	-	c.1234G>A	c.(1234-1236)GTG>ATG	p.V412M	T_uc003quu.1_Missense_Mutation_p.V411M|T_uc003quv.1_Missense_Mutation_p.V353M	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T	411					anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)												0.795775	347.977574	359.490646	113	29	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)	Missense_Mutation	SNP	166491870	166491870	16009	6	C	T	T	19	19	T	T	1	1
MLLT4	4301	broad.mit.edu	36	6	168109324	168109324	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:168109324C>T	uc003qwd.1	+	c.5016C>T	c.(5014-5016)GCC>GCT	p.A1672A		NM_001040001	NP_001035090	E9PHS7	E9PHS7_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1448					signal transduction					ovary(2)|kidney(1)|central_nervous_system(1)	4		Breast(66;1.07e-05)|Ovarian(120;0.024)								1250				0.5	11.799162	11.799162	4	4	CC		KEEP	---	---	---	---	capture		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)	Silent	SNP	168109324	168109324	10019	6	C	T	T	23	23	MLLT4	T	1	1
NUP153	9972	broad.mit.edu	36	6	17777680	17777680	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:17777680C>T	uc003ncd.1	-	c.929G>A	c.(928-930)CGA>CAA	p.R310Q	NUP153_uc010jpl.1_Missense_Mutation_p.R310Q	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	310					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(2)|ovary(1)|skin(1)	4	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)								1004				0.728571	165.746425	169.041674	51	19	CC		KEEP	---	---	---	---	capture	all cancers(50;0.0981)|Epithelial(50;0.112)		Missense_Mutation	SNP	17777680	17777680	11160	6	C	T	T	31	31	NUP153	T	1	1
KDM1B	221656	broad.mit.edu	36	6	18305402	18305402	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:18305402G>A	uc003nco.1	+	c.496G>A	c.(496-498)GTG>ATG	p.V166M	KDM1B_uc003ncn.1_Missense_Mutation_p.V237M|KDM1B_uc010jpn.1_Missense_Mutation_p.V105M	NM_153042	NP_694587	Q8NB78	KDM1B_HUMAN	amine oxidase (flavin containing) domain 1	369	SWIRM.				multicellular organismal development|oxidation-reduction process|regulation of DNA methylation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-monomethyl-K4 specific)|oxidoreductase activity|zinc ion binding				0														0.732143	127.988645	130.709364	41	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18305402	18305402	8429	6	G	A	A	40	40	KDM1B	A	1	1
KIAA1949	170954	broad.mit.edu	36	6	30761410	30761410	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:30761410C>T	uc003nrb.2	-	c.365G>A	c.(364-366)CGG>CAG	p.R122Q	KIAA1949_uc003nra.1_Missense_Mutation_p.R122Q	NM_133471	NP_597728	Q6NYC8	PHTNS_HUMAN	phostensin	122						cytoplasm|cytoskeleton	actin binding				0														0.679426	469.296219	475.26766	142	67	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30761410	30761410	8574	6	C	T	T	23	23	KIAA1949	T	1	1
CCHCR1	54535	broad.mit.edu	36	6	31220930	31220930	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:31220930C>T	uc003nsp.2	-	c.1868G>A	c.(1867-1869)CGG>CAG	p.R623Q	CCHCR1_uc003nsq.2_Missense_Mutation_p.R587Q|CCHCR1_uc003nsr.2_Missense_Mutation_p.R534Q|CCHCR1_uc010jsk.1_Missense_Mutation_p.R534Q	NM_001105564	NP_061925	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1 isoform	534	Potential.				cell differentiation|multicellular organismal development	cytoplasm|nucleus	protein binding				0														0.184615	26.566222	32.6261	12	53	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31220930	31220930	3002	6	C	T	T	23	23	CCHCR1	T	1	1
HLA-DOA	3111	broad.mit.edu	36	6	33083315	33083315	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:33083315G>A	uc003ocr.1	-	c.364C>T	c.(364-366)CGG>TGG	p.R122W	HLA-DOA_uc010jui.1_Missense_Mutation_p.R122W	NM_002119	NP_002110	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO	122	Extracellular (Potential).|Alpha-2.|Ig-like C1-type.				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endosome membrane|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0														0.764228	307.003533	314.853268	94	29	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33083315	33083315	7491	6	G	A	A	37	37	HLA-DOA	A	1	1
SYNGAP1	8831	broad.mit.edu	36	6	33513971	33513971	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:33513971C>T	uc003oep.1	+	c.1266C>T	c.(1264-1266)CCC>CCT	p.P422P	SYNGAP1_uc003oeo.1_Silent_p.P422P|SYNGAP1_uc010juy.1_Silent_p.P422P|SYNGAP1_uc010juz.1_Silent_p.P149P	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	437					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4														0.704545	402.855161	409.439756	124	52	CC		KEEP	---	---	---	---	capture			Silent	SNP	33513971	33513971	15968	6	C	T	T	23	23	SYNGAP1	T	1	1
ANKS1A	23294	broad.mit.edu	36	6	35060841	35060841	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:35060841C>T	uc003ojx.2	+	c.1017C>T	c.(1015-1017)GAC>GAT	p.D339D	ANKS1A_uc010jvp.1_De_novo_Start_OutOfFrame	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain	339						cytoplasm	protein binding			ovary(3)	3														0.685393	190.798031	193.517357	61	28	CC		KEEP	---	---	---	---	capture			Silent	SNP	35060841	35060841	696	6	C	T	T	19	19	ANKS1A	T	1	1
FGD2	221472	broad.mit.edu	36	6	37103239	37103239	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:37103239C>T	uc010jwp.1	+	c.1662C>T	c.(1660-1662)ATC>ATT	p.I554I	FGD2_uc003ong.2_Silent_p.I276I|FGD2_uc003onj.1_Silent_p.I131I	NM_173558	NP_775829	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	554	PH 2.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	Rho guanyl-nucleotide exchange factor activity|small GTPase binding|zinc ion binding			lung(1)|pancreas(1)	2														0.790576	499.310204	514.232808	151	40	CC		KEEP	---	---	---	---	capture			Silent	SNP	37103239	37103239	6070	6	C	T	T	31	31	FGD2	T	1	1
PPP2R5D	5528	broad.mit.edu	36	6	43082741	43082741	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:43082741G>A	uc003oth.1	+	c.437G>A	c.(436-438)CGG>CAG	p.R146Q	MEA1_uc010jyc.1_Intron|PPP2R5D_uc003otg.1_Missense_Mutation_p.R114Q|PPP2R5D_uc010jyd.1_Missense_Mutation_p.R40Q|PPP2R5D_uc003oti.1_5'UTR|PPP2R5D_uc003otj.1_5'UTR	NM_006245	NP_006236	Q14738	2A5D_HUMAN	delta isoform of regulatory subunit B56, protein	146					nervous system development|signal transduction	cytoplasm|nucleus|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			central_nervous_system(1)	1						Melanoma(63;587 1613 29742 31770)								0.801105	494.366996	509.636642	145	36	GG		KEEP	---	---	---	---	capture	Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)		Missense_Mutation	SNP	43082741	43082741	12831	6	G	A	A	39	39	PPP2R5D	A	1	1
GPR116	221395	broad.mit.edu	36	6	46955666	46955666	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:46955666T>C	uc003oyo.2	-	c.884A>G	c.(883-885)AAG>AGG	p.K295R	GPR116_uc003oyp.2_Intron|GPR116_uc003oyq.2_Missense_Mutation_p.K295R|GPR116_uc010jzi.1_5'UTR|GPR116_uc003oyr.2_Missense_Mutation_p.K295R	NM_001098518	NP_056049	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116	295	Ig-like 1.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)	1						NSCLC(59;410 1274 8751 36715 50546)								0.135135	29.747999	44.068088	15	96	TT		KEEP	---	---	---	---	capture	Lung(136;0.192)		Missense_Mutation	SNP	46955666	46955666	6907	6	T	C	C	56	56	GPR116	C	4	4
F13A1	2162	broad.mit.edu	36	6	6119938	6119938	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:6119938G>A	uc003mwv.1	-	c.1621C>T	c.(1621-1623)CGG>TGG	p.R541W		NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor	541					peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)									0.75	264.171973	269.851634	75	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6119938	6119938	5534	6	G	A	A	39	39	F13A1	A	1	1
DSP	1832	broad.mit.edu	36	6	7516753	7516753	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:7516753G>A	uc003mxp.1	+	c.1840G>A	c.(1840-1842)GAT>AAT	p.D614N	DSP_uc003mxq.1_Missense_Mutation_p.D614N	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	614	Globular 1.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)	8	Ovarian(93;0.0584)	all_hematologic(90;0.236)												0.685393	394.80266	400.243521	122	56	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(45;0.000508)	Missense_Mutation	SNP	7516753	7516753	4965	6	G	A	A	37	37	DSP	A	1	1
PGM3	5238	broad.mit.edu	36	6	83936796	83936796	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:83936796G>A	uc003pjv.1	-	c.1486C>T	c.(1486-1488)CGG>TGG	p.R496W	DOPEY1_uc003pjt.2_Non-coding_Transcript|PGM3_uc003pjw.1_Missense_Mutation_p.R415W	NM_015599	NP_056414	O95394	AGM1_HUMAN	phosphoglucomutase 3	496					dolichol-linked oligosaccharide biosynthetic process|embryo development ending in birth or egg hatching|glucose 1-phosphate metabolic process|hemopoiesis|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	magnesium ion binding|phosphoacetylglucosamine mutase activity|phosphoglucomutase activity				0		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)												0.321918	134.775405	138.886373	47	99	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(397;0.0478)	Missense_Mutation	SNP	83936796	83936796	12223	6	G	A	A	39	39	PGM3	A	1	1
ZNF292	23036	broad.mit.edu	36	6	88027351	88027351	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:88027351C>T	uc003plm.2	+	c.7285C>T	c.(7285-7287)CGG>TGG	p.R2429W		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	2429					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)												0.75	48.533289	49.66894	15	5	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(108;0.0199)	Missense_Mutation	SNP	88027351	88027351	18418	6	C	T	T	19	19	ZNF292	T	1	1
GABRR1	2569	broad.mit.edu	36	6	89946865	89946865	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:89946865G>A	uc003pna.1	-	c.993C>T	c.(991-993)CGC>CGT	p.R331R		NM_002042	NP_002033	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 1	337					gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)			Picrotoxin(DB00466)									0.714286	112.741099	114.758516	35	14	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Silent	SNP	89946865	89946865	6427	6	G	A	A	38	38	GABRR1	A	1	1
ZAN	7455	broad.mit.edu	36	7	100202709	100202709	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100202709G>A	uc003uwj.1	+	c.4753G>A	c.(4753-4755)GCC>ACC	p.A1585T	ZAN_uc003uwk.1_Missense_Mutation_p.A1585T|ZAN_uc003uwl.1_Non-coding_Transcript|ZAN_uc010lhh.1_Non-coding_Transcript|ZAN_uc010lhi.1_Non-coding_Transcript	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	1585	Extracellular (Potential).|VWFD 2.				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)													0.496296	195.118912	195.120493	67	68	GG		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(171;0.19)		Missense_Mutation	SNP	100202709	100202709	18096	7	G	A	A	38	38	ZAN	A	1	1
ZAN	7455	broad.mit.edu	36	7	100211254	100211254	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100211254G>A	uc003uwj.1	+	c.6055G>A	c.(6055-6057)GCC>ACC	p.A2019T	ZAN_uc003uwk.1_Missense_Mutation_p.A2019T|ZAN_uc003uwl.1_Non-coding_Transcript|ZAN_uc010lhh.1_Non-coding_Transcript|ZAN_uc010lhi.1_Non-coding_Transcript	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	2019	Extracellular (Potential).|VWFD 3.				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)													0.480769	147.939326	147.972981	50	54	GG		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(171;0.19)		Missense_Mutation	SNP	100211254	100211254	18096	7	G	A	A	38	38	ZAN	A	1	1
SH2B2	10603	broad.mit.edu	36	7	101747669	101747669	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:101747669G>A	uc003uza.1	+	c.1547G>A	c.(1546-1548)CGG>CAG	p.R516Q		NM_020979	NP_066189	O14492	SH2B2_HUMAN	SH2B adaptor protein 2	516					blood coagulation|insulin receptor signaling pathway	cytosol|plasma membrane	JAK pathway signal transduction adaptor activity|SH3/SH2 adaptor activity|signal transducer activity				0														0.375	70.290667	71.165897	24	40	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	101747669	101747669	14719	7	G	A	A	39	39	SH2B2	A	1	1
LRWD1	222229	broad.mit.edu	36	7	101896384	101896384	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:101896384G>A	uc003uzn.1	+	c.1098G>A	c.(1096-1098)GCG>GCA	p.A366A	LRWD1_uc003uzo.1_Silent_p.A214A	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain	366					chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding				0														0.385965	63.134683	63.784898	22	35	GG		KEEP	---	---	---	---	capture			Silent	SNP	101896384	101896384	9423	7	G	A	A	39	39	LRWD1	A	1	1
RELN	5649	broad.mit.edu	36	7	102963066	102963066	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:102963066G>A	uc003vca.1	-	c.7282C>T	c.(7282-7284)CGG>TGG	p.R2428W	RELN_uc010liz.1_Missense_Mutation_p.R2428W	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2428					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|large_intestine(2)|central_nervous_system(2)|pancreas(1)|skin(1)	14						NSCLC(146;835 1944 15585 22231 52158)								0.508929	174.673035	174.680743	57	55	GG		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	Missense_Mutation	SNP	102963066	102963066	13689	7	G	A	A	40	40	RELN	A	1	1
CDHR3	222256	broad.mit.edu	36	7	105452180	105452180	+	Missense_Mutation	SNP	G	A	A	rs11505886	by-hapmap	TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:105452180G>A	uc003vdl.2	+	c.2194G>A	c.(2194-2196)GTC>ATC	p.V732I	CDHR3_uc003vdk.1_Missense_Mutation_p.R163H|CDHR3_uc003vdm.2_Missense_Mutation_p.V719I|CDHR3_uc003vdn.1_Missense_Mutation_p.R232H	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256	732	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1														0.3875	87.742022	88.616393	31	49	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	105452180	105452180	3249	7	G	A	A	40	40	CDHR3	A	1	1
LAMB4	22798	broad.mit.edu	36	7	107456837	107456837	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:107456837C>T	uc010ljo.1	-	c.5033G>A	c.(5032-5034)CGT>CAT	p.R1678H	LAMB4_uc003vey.2_Missense_Mutation_p.R1678H|LAMB4_uc010ljp.1_Missense_Mutation_p.R647H	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1678	Potential.|Domain I.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)	7														0.514925	214.074793	214.100662	69	65	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	107456837	107456837	8936	7	C	T	T	19	19	LAMB4	T	1	1
DOCK4	9732	broad.mit.edu	36	7	111205618	111205618	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:111205618C>T	uc003vfy.1	-	c.3737G>A	c.(3736-3738)CGC>CAC	p.R1246H	DOCK4_uc003vfw.1_Missense_Mutation_p.R651H|DOCK4_uc003vfx.1_Missense_Mutation_p.R1201H	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1201	DHR-2.				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(1;0.0441)												0.363636	136.966701	139.125086	48	84	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	111205618	111205618	4873	7	C	T	T	27	27	DOCK4	T	1	1
THSD7A	221981	broad.mit.edu	36	7	11642654	11642654	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:11642654C>T	uc003ssf.2	-	c.650G>A	c.(649-651)CGG>CAG	p.R217Q		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	217	Extracellular (Potential).|TSP type-1 2.					integral to membrane				ovary(3)	3														0.162162	10.62648	14.644513	6	31	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (126;0.163)	Missense_Mutation	SNP	11642654	11642654	16407	7	C	T	T	23	23	THSD7A	T	1	1
POT1	25913	broad.mit.edu	36	7	124256569	124256569	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:124256569C>T	uc003vlm.1	-	c.1569G>A	c.(1567-1569)TCG>TCA	p.S523S	POT1_uc003vlk.1_Non-coding_Transcript|POT1_uc003vll.1_Non-coding_Transcript|POT1_uc003vlo.1_Silent_p.S392S|POT1_uc003vln.1_Intron	NM_015450	NP_001036059	Q9NUX5	POTE1_HUMAN	protection of telomeres 1 isoform 1	523					DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity			central_nervous_system(1)	1						Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)								0.378378	164.064511	165.985202	56	92	CC		KEEP	---	---	---	---	capture			Silent	SNP	124256569	124256569	12689	7	C	T	T	19	19	POT1	T	1	1
SND1	27044	broad.mit.edu	36	7	127271706	127271706	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:127271706G>A	uc003vmi.1	+	c.1336G>A	c.(1336-1338)GGA>AGA	p.G446R	SND1_uc010lle.1_Missense_Mutation_p.G99R	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1	446	TNase-like 3.				gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)	2														0.3	41.896589	43.68938	15	35	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	127271706	127271706	15344	7	G	A	A	47	47	SND1	A	2	2
IMPDH1	3614	broad.mit.edu	36	7	127820315	127820315	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:127820315G>A	uc003vmu.2	-	c.1782C>T	c.(1780-1782)TAC>TAT	p.Y594Y	IMPDH1_uc003vmt.1_Silent_p.Y484Y|IMPDH1_uc003vmw.2_Silent_p.Y584Y|IMPDH1_uc003vmv.2_Silent_p.Y558Y|IMPDH1_uc003vmx.2_Silent_p.Y517Y|IMPDH1_uc003vmy.2_Silent_p.Y525Y	NM_000883	NP_000874	P20839	IMDH1_HUMAN	inosine monophosphate dehydrogenase 1 isoform a	509					GMP biosynthetic process|oxidation-reduction process|purine base metabolic process|response to stimulus|visual perception	cytosol	IMP dehydrogenase activity|metal ion binding			lung(1)|central_nervous_system(1)	2					Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)|Ribavirin(DB00811)|Thioguanine(DB00352)									0.5	166.023046	166.023046	55	55	GG		KEEP	---	---	---	---	capture			Silent	SNP	127820315	127820315	8027	7	G	A	A	40	40	IMPDH1	A	1	1
FLNC	2318	broad.mit.edu	36	7	128279999	128279999	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:128279999C>T	uc003vnz.2	+	c.5961C>T	c.(5959-5961)AAC>AAT	p.N1987N	FLNC_uc003voa.2_Silent_p.N1954N	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1987	Filamin 18.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)	10										892				0.427083	229.819625	230.707039	82	110	CC		KEEP	---	---	---	---	capture			Silent	SNP	128279999	128279999	6177	7	C	T	T	19	19	FLNC	T	1	1
BPGM	669	broad.mit.edu	36	7	133997264	133997264	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:133997264G>A	uc003vrv.1	+	c.465G>A	c.(463-465)TCG>TCA	p.S155S	BPGM_uc003vrw.1_Silent_p.S155S|BPGM_uc003vrx.1_Silent_p.S155S	NM_199186	NP_954655	P07738	PMGE_HUMAN	2,3-bisphosphoglycerate mutase	155					glycolysis|respiratory gaseous exchange		2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity|phosphoglycerate mutase activity				0														0.350427	118.640653	120.949485	41	76	GG		KEEP	---	---	---	---	capture			Silent	SNP	133997264	133997264	1516	7	G	A	A	39	39	BPGM	A	1	1
WDR91	29062	broad.mit.edu	36	7	134522394	134522394	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:134522394G>A	uc003vsp.1	-	c.1949C>T	c.(1948-1950)ACG>ATG	p.T650M	WDR91_uc010lmq.1_Missense_Mutation_p.T239M|WDR91_uc010lmr.1_Non-coding_Transcript	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	650										breast(2)|ovary(1)	3														0.355263	211.48818	215.705538	81	147	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	134522394	134522394	17912	7	G	A	A	40	40	WDR91	A	1	1
CNTNAP2	26047	broad.mit.edu	36	7	146456810	146456810	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:146456810C>T	uc003weu.1	+	c.1032C>T	c.(1030-1032)GGC>GGT	p.G344G		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	344	Laminin G-like 1.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)												0.462617	296.311807	296.570875	99	115	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		Silent	SNP	146456810	146456810	3785	7	C	T	T	27	27	CNTNAP2	T	1	1
ZNF282	8427	broad.mit.edu	36	7	148552630	148552630	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:148552630C>T	uc003wfm.1	+	c.1974C>T	c.(1972-1974)CCC>CCT	p.P658P	ZNF282_uc003wfo.2_3'UTR	NM_003575	NP_003566	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	658					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription repressor activity|zinc ion binding				0	Melanoma(164;0.15)													0.444444	10.042884	10.057624	4	5	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)	Silent	SNP	148552630	148552630	18411	7	C	T	T	23	23	ZNF282	T	1	1
SSPO	23145	broad.mit.edu	36	7	149129839	149129839	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:149129839C>T	uc010lpk.1	+	c.7358C>T	c.(7357-7359)GCC>GTC	p.A2453V		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin	2453					cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)													0.43662	79.166066	79.421814	31	40	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		Missense_Mutation	SNP	149129839	149129839	15705	7	C	T	T	26	26	SSPO	T	2	2
REPIN1	29803	broad.mit.edu	36	7	149700128	149700128	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:149700128G>A	uc010lpr.1	+	c.1036G>A	c.(1036-1038)GAG>AAG	p.E346K	REPIN1_uc003whd.2_Missense_Mutation_p.E278K|REPIN1_uc010lpq.1_Missense_Mutation_p.E289K|REPIN1_uc003whc.2_Missense_Mutation_p.E289K|REPIN1_uc003whe.2_Missense_Mutation_p.E289K	NM_001099695	NP_001093165	Q9BWE0	REPI1_HUMAN	replication initiator 1 isoform 3	289					DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)													0.440678	77.741673	77.922568	26	33	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.011)		Missense_Mutation	SNP	149700128	149700128	13696	7	G	A	A	37	37	REPIN1	A	1	1
ABCB8	11194	broad.mit.edu	36	7	150363746	150363746	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:150363746G>A	uc003wil.2	+	c.962G>A	c.(961-963)CGC>CAC	p.R321H	ABCB8_uc003wii.2_Missense_Mutation_p.R341H|ABCB8_uc003wij.2_Missense_Mutation_p.R304H|ABCB8_uc010lpw.1_Missense_Mutation_p.R123H|ABCB8_uc010lpx.1_Missense_Mutation_p.R304H|ABCB8_uc003wim.2_Missense_Mutation_p.R99H|ABCB8_uc003wik.2_Missense_Mutation_p.R304H	NM_007188	NP_009119	Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B, member 8	321	ABC transmembrane type-1.					ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(2)	2														0.384146	167.887233	169.815674	63	101	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Missense_Mutation	SNP	150363746	150363746	48	7	G	A	A	38	38	ABCB8	A	1	1
HTR5A	3361	broad.mit.edu	36	7	154506901	154506901	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:154506901G>A	uc003wlu.1	+	c.845G>A	c.(844-846)CGG>CAG	p.R282Q		NM_024012	NP_076917	P47898	5HT5A_HUMAN	5-hydroxytryptamine receptor 5A	282	Cytoplasmic (By similarity).					integral to plasma membrane	serotonin receptor activity			ovary(2)|large_intestine(1)	3	all_neural(206;0.119)	all_hematologic(28;0.0592)												0.335821	121.040467	124.232685	45	89	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Missense_Mutation	SNP	154506901	154506901	7750	7	G	A	A	39	39	HTR5A	A	1	1
RNF32	140545	broad.mit.edu	36	7	156143680	156143680	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:156143680G>A	uc003wmo.1	+	c.548G>A	c.(547-549)CGC>CAC	p.R183H	RNF32_uc010lql.1_Non-coding_Transcript|RNF32_uc010lqm.1_Missense_Mutation_p.R183H|RNF32_uc003wmq.2_Missense_Mutation_p.R183H|RNF32_uc003wmr.1_Missense_Mutation_p.R183H|RNF32_uc003wms.2_Missense_Mutation_p.R183H|RNF32_uc003wmu.1_Non-coding_Transcript|RNF32_uc003wmt.2_Missense_Mutation_p.R183H	NM_030936	NP_112198	Q9H0A6	RNF32_HUMAN	ring finger protein 32	183						aggresome|endosome	protein binding|zinc ion binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)												0.474359	108.265425	108.310204	37	41	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)	Missense_Mutation	SNP	156143680	156143680	13967	7	G	A	A	38	38	RNF32	A	1	1
PTPRN2	5799	broad.mit.edu	36	7	157566781	157566781	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:157566781C>T	uc003wno.1	-	c.1693G>A	c.(1693-1695)GTG>ATG	p.V565M	PTPRN2_uc003wnp.1_Missense_Mutation_p.V548M|PTPRN2_uc003wnq.1_Missense_Mutation_p.V536M|PTPRN2_uc003wnr.1_Missense_Mutation_p.V527M	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	565	Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)	6	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)												0.346821	168.150958	171.732892	60	113	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)	Missense_Mutation	SNP	157566781	157566781	13265	7	C	T	T	19	19	PTPRN2	T	1	1
VIPR2	7434	broad.mit.edu	36	7	158521453	158521453	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:158521453C>T	uc003woh.1	-	c.760G>A	c.(760-762)GTC>ATC	p.V254I	VIPR2_uc010lqx.1_Non-coding_Transcript|VIPR2_uc010lqy.1_Non-coding_Transcript	NM_003382	NP_003373	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	254	Helical; Name=4; (Potential).				cell-cell signaling	integral to plasma membrane				lung(1)|central_nervous_system(1)	2	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)				Pancreas(154;1876 1931 2329 17914 20079)								0.333333	37.641233	38.67185	14	28	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)	Missense_Mutation	SNP	158521453	158521453	17737	7	C	T	T	19	19	VIPR2	T	1	1
SNX13	23161	broad.mit.edu	36	7	17857029	17857029	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:17857029T>G	uc003stv.1	-	c.921A>C	c.(919-921)AGA>AGC	p.R307S	SNX13_uc010kuc.1_Missense_Mutation_p.R104S|SNX13_uc003stw.1_Missense_Mutation_p.R307S	NM_015132	NP_055947	Q9Y5W8	SNX13_HUMAN	sorting nexin 13	307					cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)													0.285714	16.339645	17.206194	6	15	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17857029	17857029	15384	7	T	G	G	54	54	SNX13	G	4	4
FERD3L	222894	broad.mit.edu	36	7	19151411	19151411	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:19151411C>T	uc003suo.1	-	c.100G>A	c.(100-102)GCA>ACA	p.A34T		NM_152898	NP_690862	Q96RJ6	FER3L_HUMAN	nephew of atonal 3	34					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription repressor activity			large_intestine(1)	1														0.564103	266.405167	266.962229	88	68	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19151411	19151411	6053	7	C	T	T	27	27	FERD3L	T	1	1
DNAH11	8701	broad.mit.edu	36	7	21741814	21741814	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:21741814G>A	uc003svc.1	+	c.7493G>A	c.(7492-7494)CGT>CAT	p.R2498H		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2498	AAA 3 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15														0.431818	56.919426	57.09749	19	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	21741814	21741814	4781	7	G	A	A	40	40	DNAH11	A	1	1
GLI3	2737	broad.mit.edu	36	7	41971854	41971854	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:41971854G>A	uc003thu.2	-	c.3342C>T	c.(3340-3342)AGC>AGT	p.S1114S		NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	1114					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of gene-specific transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|transcription activator activity|transcription repressor activity|zinc ion binding			large_intestine(2)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)|pancreas(1)	8										806				0.443983	308.388602	309.047049	107	134	GG		KEEP	---	---	---	---	capture			Silent	SNP	41971854	41971854	6707	7	G	A	A	38	38	GLI3	A	1	1
POLM	27434	broad.mit.edu	36	7	44082711	44082711	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:44082711G>A	uc003tjt.1	-	c.757C>T	c.(757-759)CGG>TGG	p.R253W	POLM_uc003tju.1_Missense_Mutation_p.R253W|POLM_uc003tjv.1_Non-coding_Transcript|POLM_uc003tjw.1_5'UTR|POLM_uc003tjx.1_Intron|POLM_uc003tka.1_Non-coding_Transcript|POLM_uc003tjz.2_3'UTR	NM_013284	NP_037416	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	253					DNA recombination|DNA repair	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3														0.105263	18.971125	48.388657	20	170	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44082711	44082711	12634	7	G	A	A	39	39	POLM	A	1	1
AEBP1	165	broad.mit.edu	36	7	44119794	44119794	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:44119794G>A	uc003tkb.1	+	c.2886G>A	c.(2884-2886)CCG>CCA	p.P962P	AEBP1_uc003tkc.2_Silent_p.P537P|AEBP1_uc003tkd.1_Silent_p.P212P	NM_001129	NP_001120	Q8IUX7	AEBP1_HUMAN	adipocyte enhancer binding protein 1 precursor	962	Interaction with PTEN (By similarity).|Required for transcriptional repression (By similarity).				cell adhesion|muscle organ development|proteolysis|regulation of transcription, DNA-dependent|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0														0.508197	374.796609	374.811344	124	120	GG		KEEP	---	---	---	---	capture			Silent	SNP	44119794	44119794	350	7	G	A	A	37	37	AEBP1	A	1	1
ZMIZ2	83637	broad.mit.edu	36	7	44769429	44769429	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:44769429C>T	uc003tlr.1	+	c.1752C>T	c.(1750-1752)AAC>AAT	p.N584N	ZMIZ2_uc003tlq.1_Silent_p.N526N|ZMIZ2_uc003tls.1_Silent_p.N558N|ZMIZ2_uc003tlt.1_Silent_p.N207N|ZMIZ2_uc010kyj.1_Silent_p.N106N|ZMIZ2_uc003tlu.1_5'Flank	NM_031449	NP_113637	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2 isoform 1	584					positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear replication fork	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|zinc ion binding			ovary(2)|large_intestine(2)|breast(1)	5						NSCLC(20;604 852 1948 16908 50522)								0.441989	473.826982	474.891121	160	202	CC		KEEP	---	---	---	---	capture			Silent	SNP	44769429	44769429	18288	7	C	T	T	19	19	ZMIZ2	T	1	1
ADCY1	107	broad.mit.edu	36	7	45720042	45720042	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:45720042G>A	uc003tne.2	+	c.3283G>A	c.(3283-3285)GTC>ATC	p.V1095I		NM_021116	NP_066939	Q08828	ADCY1_HUMAN	brain adenylate cyclase 1	1095	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|central_nervous_system(1)	4					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)									0.470149	186.411784	186.515135	63	71	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45720042	45720042	293	7	G	A	A	40	40	ADCY1	A	1	1
TNS3	64759	broad.mit.edu	36	7	47309601	47309601	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:47309601C>T	uc003tnv.1	-	c.2929G>A	c.(2929-2931)GGT>AGT	p.G977S	TNS3_uc003tnw.1_Missense_Mutation_p.G977S	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3	977						focal adhesion	protein binding			ovary(4)	4														0.322581	53.775412	55.510046	20	42	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47309601	47309601	16885	7	C	T	T	23	23	TNS3	T	1	1
FIGNL1	63979	broad.mit.edu	36	7	50480571	50480571	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:50480571G>A	uc003tpd.1	-	c.1909C>T	c.(1909-1911)CGA>TGA	p.R637*	FIGNL1_uc003tpc.1_Nonsense_Mutation_p.R637*|FIGNL1_uc003tpe.1_Nonsense_Mutation_p.R637*|FIGNL1_uc010kyy.1_Nonsense_Mutation_p.R637*|FIGNL1_uc003tpb.2_Nonsense_Mutation_p.R526*|FIGNL1_uc010kyz.1_Nonsense_Mutation_p.R637*	NM_022116	NP_071399	Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	637					ATP metabolic process|negative regulation of apoptosis|osteoblast differentiation|osteoblast proliferation|regulation of cell cycle	cytoplasm|nucleus	ATP binding|magnesium ion binding|nucleoside-triphosphatase activity			ovary(3)	3	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)												0.508772	183.749867	183.757452	58	56	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	50480571	50480571	6130	7	G	A	A	37	37	FIGNL1	A	5	1
CLDN4	1364	broad.mit.edu	36	7	72883884	72883884	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:72883884G>A	uc003tzi.2	+	c.417G>A	c.(415-417)ACG>ACA	p.T139T	CLDN4_uc003tzh.1_Non-coding_Transcript	NM_001305	NP_001296	O14493	CLD4_HUMAN	claudin 4	139	Extracellular (Potential).				calcium-independent cell-cell adhesion	integral to plasma membrane|tight junction	identical protein binding|structural molecule activity|transmembrane receptor activity				0		Lung NSC(55;0.159)												0.340206	93.058976	95.241707	33	64	GG		KEEP	---	---	---	---	capture			Silent	SNP	72883884	72883884	3624	7	G	A	A	39	39	CLDN4	A	1	1
ELN	2006	broad.mit.edu	36	7	73097502	73097502	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:73097502G>A	uc003tzw.1	+	c.484G>A	c.(484-486)GGT>AGT	p.G162S	ELN_uc003tzm.1_Intron|ELN_uc003tzn.1_Missense_Mutation_p.G162S|ELN_uc003tzz.1_Missense_Mutation_p.G150S|ELN_uc003tzo.1_Missense_Mutation_p.G162S|ELN_uc003tzp.1_Intron|ELN_uc003tzq.1_Intron|ELN_uc003tzr.1_Non-coding_Transcript|ELN_uc003tzs.1_Missense_Mutation_p.G162S|ELN_uc003tzt.1_Missense_Mutation_p.G167S|ELN_uc003tzu.1_Missense_Mutation_p.G167S|ELN_uc003tzv.1_Missense_Mutation_p.G152S|ELN_uc010lbk.1_Non-coding_Transcript|ELN_uc003tzx.1_Missense_Mutation_p.G152S|ELN_uc003tzy.1_Missense_Mutation_p.G157S	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor	162					blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding	p.G157E(1)		ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)					434				0.333333	162.949705	167.312554	59	118	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73097502	73097502	5263	7	G	A	A	39	39	ELN	A	1	1
EIF4H	7458	broad.mit.edu	36	7	73241958	73241958	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:73241958C>T	uc003uad.1	+	c.267C>T	c.(265-267)TTC>TTT	p.F89F	EIF4H_uc010lbm.1_Silent_p.F89F|EIF4H_uc003uae.1_Silent_p.F89F|EIF4H_uc003uaf.1_Non-coding_Transcript	NM_022170	NP_071496	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	89	RRM.				interspecies interaction between organisms|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex|perinuclear region of cytoplasm	nucleotide binding|protein binding|translation initiation factor activity				0														0.468254	183.31349	183.424172	59	67	CC		KEEP	---	---	---	---	capture			Silent	SNP	73241958	73241958	5230	7	C	T	T	31	31	EIF4H	T	1	1
CLIP2	7461	broad.mit.edu	36	7	73428413	73428413	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:73428413C>T	uc003uam.1	+	c.1746C>T	c.(1744-1746)CGC>CGT	p.R582R	CLIP2_uc003uan.1_Silent_p.R547R|CLIP2_uc003uao.2_5'UTR	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	582	Potential.					microtubule associated complex					0														0.541176	137.087687	137.219506	46	39	CC		KEEP	---	---	---	---	capture			Silent	SNP	73428413	73428413	3671	7	C	T	T	27	27	CLIP2	T	1	1
PTPN12	5782	broad.mit.edu	36	7	77099656	77099656	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:77099656G>A	uc003ugh.1	+	c.2052G>A	c.(2050-2052)TCG>TCA	p.S684S	PTPN12_uc010lds.1_Silent_p.S416S	NM_002835	NP_002826	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type	684						soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding			ovary(1)|breast(1)|pancreas(1)	3														0.334906	202.154769	207.270355	71	141	GG		KEEP	---	---	---	---	capture			Silent	SNP	77099656	77099656	13236	7	G	A	A	40	40	PTPN12	A	1	1
GLCCI1	113263	broad.mit.edu	36	7	8028694	8028694	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:8028694G>A	uc003srk.1	+	c.666G>A	c.(664-666)GCG>GCA	p.A222A		NM_138426	NP_612435	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	222											0		Ovarian(82;0.0608)												0.711111	107.918164	109.716736	32	13	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)	Silent	SNP	8028694	8028694	6699	7	G	A	A	40	40	GLCCI1	A	1	1
PCLO	27445	broad.mit.edu	36	7	82383005	82383005	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:82383005C>T	uc003uhx.2	-	c.12233G>A	c.(12232-12234)CGT>CAT	p.R4078H	PCLO_uc003uhv.2_Missense_Mutation_p.R4078H|PCLO_uc010lec.1_Missense_Mutation_p.R1043H	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	4009					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity|zinc ion binding			ovary(7)	7														0.361111	35.86532	36.47643	13	23	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	82383005	82383005	12003	7	C	T	T	19	19	PCLO	T	1	1
ABCB4	5244	broad.mit.edu	36	7	86873690	86873690	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:86873690G>A	uc003uiv.1	-	c.3357C>T	c.(3355-3357)CTC>CTT	p.L1119L	ABCB4_uc003uiw.1_Silent_p.L1112L|ABCB4_uc003uix.1_Silent_p.L1065L	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	1119	ABC transporter 2.|Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|pancreas(1)	5	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)													0.422886	247.438847	248.481633	85	116	GG		KEEP	---	---	---	---	capture			Silent	SNP	86873690	86873690	44	7	G	A	A	37	37	ABCB4	A	1	1
DYNC1I1	1780	broad.mit.edu	36	7	95564762	95564762	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:95564762G>A	uc003uoc.2	+	c.1859G>A	c.(1858-1860)CGA>CAA	p.R620Q	DYNC1I1_uc003uod.2_Missense_Mutation_p.R603Q|DYNC1I1_uc003uoe.2_Missense_Mutation_p.R600Q|DYNC1I1_uc010lfl.1_Missense_Mutation_p.R609Q	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	620					vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)													0.392857	98.359531	99.202786	33	51	GG		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(171;0.0957)		Missense_Mutation	SNP	95564762	95564762	5028	7	G	A	A	37	37	DYNC1I1	A	1	1
TRRAP	8295	broad.mit.edu	36	7	98378576	98378576	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:98378576C>T	uc003upp.1	+	c.4473C>T	c.(4471-4473)AAC>AAT	p.N1491N	TRRAP_uc003upq.1_Silent_p.N1491N|TRRAP_uc003upr.1_Silent_p.N1183N	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	1491					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|stomach(2)|lung(1)|liver(1)	27	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)									1847				0.306452	49.118918	51.180625	19	43	CC		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(171;0.215)		Silent	SNP	98378576	98378576	17152	7	C	T	T	19	19	TRRAP	T	1	1
TRRAP	8295	broad.mit.edu	36	7	98385746	98385746	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:98385746C>T	uc003upp.1	+	c.5238C>T	c.(5236-5238)ATC>ATT	p.I1746I	TRRAP_uc003upq.1_Silent_p.I1728I|TRRAP_uc003upr.1_Silent_p.I1445I	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	1746					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|stomach(2)|lung(1)|liver(1)	27	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)									1847				0.380682	195.181096	197.379462	67	109	CC		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(171;0.215)		Silent	SNP	98385746	98385746	17152	7	C	T	T	31	31	TRRAP	T	1	1
TRRAP	8295	broad.mit.edu	36	7	98424403	98424403	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:98424403G>A	uc003upp.1	+	c.9481G>A	c.(9481-9483)GAC>AAC	p.D3161N	TRRAP_uc003upq.1_Missense_Mutation_p.D3132N|TRRAP_uc003upr.1_Missense_Mutation_p.D2849N	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	3161	FAT.				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|stomach(2)|lung(1)|liver(1)	27	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)									1847				0.42446	175.016143	175.704207	59	80	GG		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(171;0.215)		Missense_Mutation	SNP	98424403	98424403	17152	7	G	A	A	37	37	TRRAP	A	1	1
ZNF498	221785	broad.mit.edu	36	7	99064932	99064932	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:99064932G>A	uc003url.1	+	c.988G>A	c.(988-990)GGT>AGT	p.G330S	ZNF498_uc003urn.2_Intron|ZNF498_uc003urm.1_Missense_Mutation_p.G166S|ZNF498_uc010lge.1_Missense_Mutation_p.G166S|ZNF498_uc010lgf.1_Missense_Mutation_p.G258S|ZNF498_uc003uro.1_Missense_Mutation_p.G114S	NM_145115	NP_660090	Q6NSZ9	ZN498_HUMAN	zinc finger and SCAN domain containing 25	330					regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_epithelial(64;1.95e-08)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)													0.324675	142.078262	146.289303	50	104	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99064932	99064932	18541	7	G	A	A	39	39	ZNF498	A	1	1
MCM7	4176	broad.mit.edu	36	7	99535209	99535209	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:99535209C>T	uc003usw.1	-	c.215G>A	c.(214-216)CGC>CAC	p.R72H	MCM7_uc003usv.1_5'UTR|MCM7_uc003usx.1_5'UTR|AP4M1_uc010lgk.1_5'Flank|AP4M1_uc010lgl.1_5'Flank|AP4M1_uc003utb.2_5'Flank|AP4M1_uc003utc.2_5'Flank|AP4M1_uc010lgm.1_5'Flank|AP4M1_uc003utd.2_5'Flank|AP4M1_uc003ute.2_5'Flank|AP4M1_uc003utf.2_5'Flank	NM_005916	NP_005907	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	72					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of phosphorylation|response to DNA damage stimulus|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				Atorvastatin(DB01076)									0.46696	315.025803	315.241695	106	121	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99535209	99535209	9781	7	C	T	T	27	27	MCM7	T	1	1
FAM167A	83648	broad.mit.edu	36	8	11319430	11319430	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:11319430G>A	uc010lry.1	-	c.507C>T	c.(505-507)TAC>TAT	p.Y169Y	C8orf12_uc003wtu.2_Intron|C8orf12_uc003wtv.2_Intron|FAM167A_uc003wtw.2_Silent_p.Y169Y	NM_053279	NP_444509	Q96KS9	F167A_HUMAN	hypothetical protein LOC83648	169											0														0.688679	227.894356	231.25035	73	33	GG		KEEP	---	---	---	---	capture			Silent	SNP	11319430	11319430	5687	8	G	A	A	40	40	FAM167A	A	1	1
FER1L6	654463	broad.mit.edu	36	8	125143453	125143453	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:125143453C>T	uc003yqw.1	+	c.3327C>T	c.(3325-3327)CAC>CAT	p.H1109H		NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	1109	Cytoplasmic (Potential).					integral to membrane				ovary(5)|central_nervous_system(1)|skin(1)	7	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)													0.75	271.632591	277.992043	84	28	CC		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(47;0.00186)		Silent	SNP	125143453	125143453	6052	8	C	T	T	19	19	FER1L6	T	1	1
KIAA0196	9897	broad.mit.edu	36	8	126149123	126149123	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:126149123G>A	uc003yrt.1	-	c.1171C>T	c.(1171-1173)CGC>TGC	p.R391C	KIAA0196_uc003yru.1_De_novo_Start_OutOfFrame	NM_014846	NP_055661	Q12768	STRUM_HUMAN	strumpellin	391					cell death	WASH complex		p.R391C(1)		ovary(2)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)													0.82	264.593711	274.217672	82	18	GG		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)		Missense_Mutation	SNP	126149123	126149123	8468	8	G	A	A	40	40	KIAA0196	A	1	1
SLA	6503	broad.mit.edu	36	8	134141558	134141558	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:134141558C>T	uc003yty.1	-	c.30G>A	c.(28-30)GCG>GCA	p.A10A	TG_uc003ytw.1_Intron|TG_uc010mdw.1_Intron|SLA_uc003ytz.1_Silent_p.A10A|SLA_uc003yua.1_Silent_p.A10A|SLA_uc010mdy.1_Silent_p.A10A|SLA_uc010mdz.1_Silent_p.A10A|SLA_uc010mea.1_Non-coding_Transcript	NM_006748	NP_006739	Q13239	SLAP1_HUMAN	Src-like-adaptor isoform c	10						endosome	SH3/SH2 adaptor activity			lung(1)|liver(1)	2	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)												0.185535	118.764286	148.22865	59	259	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(115;0.000701)		Silent	SNP	134141558	134141558	14858	8	C	T	T	27	27	SLA	T	1	1
COL22A1	169044	broad.mit.edu	36	8	139959192	139959192	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:139959192C>T	uc003yvd.1	-	c.641G>A	c.(640-642)CGG>CAG	p.R214Q		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	214					cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(10)|pancreas(1)	11	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)													0.805556	196.288001	202.558331	58	14	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(115;0.0517)		Missense_Mutation	SNP	139959192	139959192	3819	8	C	T	T	23	23	COL22A1	T	1	1
GPR20	2843	broad.mit.edu	36	8	142436666	142436666	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:142436666G>A	uc003ywf.1	-	c.540C>T	c.(538-540)GCC>GCT	p.A180A	GPR20_uc010mer.1_Silent_p.A180A	NM_005293	NP_005284	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	180	Helical; Name=4; (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)													0.636364	22.127545	22.307586	7	4	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(115;0.0415)		Silent	SNP	142436666	142436666	6955	8	G	A	A	39	39	GPR20	A	1	1
EEF1D	1936	broad.mit.edu	36	8	144742750	144742750	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:144742750C>T	uc003yyq.1	-	c.795G>A	c.(793-795)CCG>CCA	p.P265P	EEF1D_uc003yyp.1_Silent_p.P215P|EEF1D_uc003yyr.1_Silent_p.P215P|EEF1D_uc003yys.1_Intron|EEF1D_uc003yyt.1_Silent_p.P215P|EEF1D_uc003yyu.1_Intron|EEF1D_uc003yyv.1_Intron	NM_032378	NP_115754	P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta	Error:Variant_position_missing_in_P29692_after_alignment					positive regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|eukaryotic translation elongation factor 1 complex	protein binding|signal transducer activity|translation elongation factor activity			ovary(1)|kidney(1)|skin(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)									610				0.647059	35.154803	35.499754	11	6	CC		KEEP	---	---	---	---	capture	Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		Silent	SNP	144742750	144742750	5113	8	C	T	T	23	23	EEF1D	T	1	1
ZNF707	286075	broad.mit.edu	36	8	144848068	144848068	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:144848068C>T	uc003yze.2	+	c.496C>T	c.(496-498)CGC>TGC	p.R166C	ZNF707_uc010mfh.1_Missense_Mutation_p.R166C|ZNF707_uc010mfi.1_Missense_Mutation_p.R166C|ZNF707_uc003yzf.2_Missense_Mutation_p.R166C|ZNF707_uc003yzg.2_Non-coding_Transcript|ZNF707_uc003yzh.2_Missense_Mutation_p.R93C	NM_173831	NP_776192	Q96C28	ZN707_HUMAN	zinc finger protein 707	166					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(1)	1	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)													0.714286	65.81237	66.968606	20	8	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(54;5.6e-41)|Epithelial(56;1.02e-39)|all cancers(56;9.65e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)		Missense_Mutation	SNP	144848068	144848068	18707	8	C	T	T	27	27	ZNF707	T	1	1
SCRIB	23513	broad.mit.edu	36	8	144965115	144965115	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:144965115C>T	uc003yzo.1	-	c.1222G>A	c.(1222-1224)GAG>AAG	p.E408K	SCRIB_uc003yzp.1_Missense_Mutation_p.E408K	NM_182706	NP_874365	Q14160	SCRIB_HUMAN	scribble isoform a	408	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)					Pancreas(51;966 1133 10533 14576 29674)				520				0.551724	50.902792	50.970373	16	13	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)		Missense_Mutation	SNP	144965115	144965115	14419	8	C	T	T	31	31	SCRIB	T	1	1
PLEC	5339	broad.mit.edu	36	8	145062528	145062528	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:145062528G>A	uc003zaf.1	-	c.13860C>T	c.(13858-13860)TCC>TCT	p.S4620S	PLEC_uc003zag.1_Silent_p.S4461S|PLEC_uc003zah.1_Silent_p.S4469S|PLEC_uc003zai.1_Silent_p.S4510S|PLEC_uc003zaj.1_Silent_p.S4510S|PLEC_uc003zab.1_Silent_p.S4483S|PLEC_uc003zac.1_Silent_p.S4487S|PLEC_uc003zad.1_Silent_p.S4483S|PLEC_uc003zae.1_Silent_p.S4451S	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin 1 isoform 6	4620	Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|central_nervous_system(1)	7														0.758621	209.278738	214.588984	66	21	GG		KEEP	---	---	---	---	capture			Silent	SNP	145062528	145062528	12478	8	G	A	A	39	39	PLEC	A	1	1
PLEC	5339	broad.mit.edu	36	8	145065905	145065905	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:145065905C>T	uc003zaf.1	-	c.10483G>A	c.(10483-10485)GCC>ACC	p.A3495T	PLEC_uc003zag.1_Missense_Mutation_p.A3336T|PLEC_uc003zah.1_Missense_Mutation_p.A3344T|PLEC_uc003zai.1_Missense_Mutation_p.A3385T|PLEC_uc003zaj.1_Missense_Mutation_p.A3385T|PLEC_uc003zab.1_Missense_Mutation_p.A3358T|PLEC_uc003zac.1_Missense_Mutation_p.A3362T|PLEC_uc003zad.1_Missense_Mutation_p.A3358T|PLEC_uc003zae.1_Missense_Mutation_p.A3326T	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin 1 isoform 6	3495	Plectin 12.|Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|central_nervous_system(1)	7														0.657534	145.718895	147.323338	48	25	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	145065905	145065905	12478	8	C	T	T	27	27	PLEC	T	1	1
PLEC	5339	broad.mit.edu	36	8	145096794	145096794	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:145096794G>A	uc003zaf.1	-	c.69C>T	c.(67-69)GGC>GGT	p.G23G	PLEC_uc003zag.1_Intron|PLEC_uc003zah.1_Intron|PLEC_uc003zai.1_Intron|PLEC_uc003zaj.1_Intron	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin 1 isoform 6	23	Globular 1.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|central_nervous_system(1)	7														0.666667	28.247313	28.614654	10	5	GG		KEEP	---	---	---	---	capture			Silent	SNP	145096794	145096794	12478	8	G	A	A	38	38	PLEC	A	1	1
SLC39A4	55630	broad.mit.edu	36	8	145610233	145610233	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:145610233G>A	uc003zcq.1	-	c.1204C>T	c.(1204-1206)CGC>TGC	p.R402C	SLC39A4_uc003zcm.1_5'Flank|SLC39A4_uc003zcn.1_5'Flank|SLC39A4_uc003zco.1_Missense_Mutation_p.R126C|SLC39A4_uc003zcp.1_Missense_Mutation_p.R377C	NM_130849	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter),	402	Extracellular (Potential).					cytoplasmic membrane-bounded vesicle|integral to membrane|recycling endosome membrane	zinc ion transmembrane transporter activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)													0.833333	46.733564	48.629195	15	3	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)		Missense_Mutation	SNP	145610233	145610233	15117	8	G	A	A	38	38	SLC39A4	A	1	1
ARHGAP39	80728	broad.mit.edu	36	8	145801786	145801786	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:145801786C>T	uc003zds.1	-	c.22G>A	c.(22-24)GAG>AAG	p.E8K	ARHGAP39_uc003zdt.1_Missense_Mutation_p.E8K	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	8					axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0														0.811321	142.851364	147.659662	43	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	145801786	145801786	896	8	C	T	T	31	31	ARHGAP39	T	1	1
FGF20	26281	broad.mit.edu	36	8	16895101	16895101	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:16895101G>A	uc003wxc.1	-	c.487C>T	c.(487-489)CGC>TGC	p.R163C	FGF20_uc010lsv.1_Non-coding_Transcript|FGF20_uc010lsw.1_3'UTR	NM_019851	NP_062825	Q9NP95	FGF20_HUMAN	fibroblast growth factor 20	163					cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	extracellular region|soluble fraction	growth factor activity				0										153				0.713592	499.007698	507.440519	147	59	GG		KEEP	---	---	---	---	capture		Colorectal(111;0.0511)|COAD - Colon adenocarcinoma(73;0.207)	Missense_Mutation	SNP	16895101	16895101	6086	8	G	A	A	39	39	FGF20	A	1	1
MTMR7	9108	broad.mit.edu	36	8	17204113	17204113	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:17204113C>T	uc003wxm.1	-	c.1541G>A	c.(1540-1542)CGA>CAA	p.R514Q	MTMR7_uc003wxn.2_Missense_Mutation_p.R293Q	NM_004686	NP_004677	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	514							protein tyrosine phosphatase activity				0														0.720779	365.384811	372.135184	111	43	CC		KEEP	---	---	---	---	capture		Colorectal(111;0.112)	Missense_Mutation	SNP	17204113	17204113	10341	8	C	T	T	31	31	MTMR7	T	1	1
MYOM2	9172	broad.mit.edu	36	8	2044706	2044706	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:2044706G>A	uc003wpx.2	+	c.3157G>A	c.(3157-3159)GAC>AAC	p.D1053N		NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	1053					muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)	5		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)												0.77027	190.309693	195.263864	57	17	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)	Missense_Mutation	SNP	2044706	2044706	10487	8	G	A	A	37	37	MYOM2	A	1	1
KIF13B	23303	broad.mit.edu	36	8	29045796	29045796	+	Missense_Mutation	SNP	C	T	T	rs12549991	by-hapmap	TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:29045796C>T	uc003xhh.2	-	c.2890G>A	c.(2890-2892)GCC>ACC	p.A964T		NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	964					microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)												0.726027	173.105154	176.468908	53	20	CC		KEEP	---	---	---	---	capture		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)	Missense_Mutation	SNP	29045796	29045796	8586	8	C	T	T	27	27	KIF13B	T	1	1
KIF13B	23303	broad.mit.edu	36	8	29060863	29060863	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:29060863G>A	uc003xhh.2	-	c.1989C>T	c.(1987-1989)AGC>AGT	p.S663S	KIF13B_uc003xhj.2_Silent_p.S560S	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	663	Potential.				microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)												0.761905	52.108869	53.424714	16	5	GG		KEEP	---	---	---	---	capture		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)	Silent	SNP	29060863	29060863	8586	8	G	A	A	38	38	KIF13B	A	1	1
BRF2	55290	broad.mit.edu	36	8	37821753	37821753	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:37821753C>T	uc003xkk.1	-	c.673G>A	c.(673-675)GTC>ATC	p.V225I		NM_018310	NP_060780	Q9HAW0	BRF2_HUMAN	RNA polymerase III transcription initiation	225	2.				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter|transcription initiation, DNA-dependent	nucleoplasm	protein binding|transcription regulator activity|zinc ion binding				0		Lung NSC(58;0.118)|all_lung(54;0.195)								145				0.85	105.966659	110.663674	34	6	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;1.81e-10)		Missense_Mutation	SNP	37821753	37821753	1542	8	C	T	T	19	19	BRF2	T	1	1
IKBKB	3551	broad.mit.edu	36	8	42297508	42297508	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:42297508G>A	uc003xow.1	+	c.1677G>A	c.(1675-1677)ACG>ACA	p.T559T	IKBKB_uc010lxh.1_3'UTR|IKBKB_uc003xox.1_Silent_p.T280T|IKBKB_uc010lxi.1_Non-coding_Transcript|IKBKB_uc010lxj.1_Silent_p.T336T	NM_001556	NP_001547	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene	559					anti-apoptosis|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein phosphorylation|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|membrane raft	ATP binding|identical protein binding|IkappaB kinase activity|transcription activator activity			breast(3)|ovary(2)|lung(1)|skin(1)	7	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)			Arsenic trioxide(DB01169)|Auranofin(DB00995)				p.T559T(MDAMB435S-Tumor)|p.T559T(NCIH596-Tumor)|p.T559T(CAL29-Tumor)	402				0.759036	195.454752	200.531885	63	20	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Silent	SNP	42297508	42297508	7912	8	G	A	A	38	38	IKBKB	A	1	1
SGK196	84197	broad.mit.edu	36	8	43078104	43078104	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:43078104C>T	uc003xpw.1	+	c.256C>T	c.(256-258)CGT>TGT	p.R86C		NM_032237	NP_115613	Q9H5K3	SG196_HUMAN	protein kinase-like protein SgK196	86	Protein kinase.				protein phosphorylation	integral to membrane	ATP binding|protein kinase activity				0										75				0.583333	66.600306	66.826416	21	15	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43078104	43078104	14699	8	C	T	T	27	27	SGK196	T	1	1
MCPH1	79648	broad.mit.edu	36	8	6325717	6325717	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:6325717C>T	uc003wqi.1	+	c.2048C>T	c.(2047-2049)ACG>ATG	p.T683M		NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin	683	BRCT 2.					microtubule organizing center				central_nervous_system(1)	1		Hepatocellular(245;0.0663)				Colon(95;1448 1467 8277 34473 35819)								0.692308	282.690836	286.979257	90	40	CC		KEEP	---	---	---	---	capture		Colorectal(4;0.0505)	Missense_Mutation	SNP	6325717	6325717	9787	8	C	T	T	19	19	MCPH1	T	1	1
PAG1	55824	broad.mit.edu	36	8	82067946	82067946	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:82067946G>A	uc003ybz.1	-	c.72C>T	c.(70-72)GTC>GTT	p.V24V		NM_018440	NP_060910	Q9NWQ8	PAG1_HUMAN	phosphoprotein associated with glycosphingolipid	24	Helical; Signal-anchor for type III membrane protein; (Potential).				epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity				0	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)													0.451613	40.644751	40.70808	14	17	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)		Silent	SNP	82067946	82067946	11804	8	G	A	A	37	37	PAG1	A	1	1
PDP1	54704	broad.mit.edu	36	8	95004334	95004334	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:95004334G>A	uc003ygf.1	+	c.946G>A	c.(946-948)GAT>AAT	p.D316N	PDP1_uc003yge.1_Missense_Mutation_p.D291N|PDP1_uc003ygg.1_Missense_Mutation_p.D316N|PDP1_uc010max.1_Missense_Mutation_p.D291N	NM_018444	NP_060914	Q9P0J1	PDP1_HUMAN	pyruvate dehydrogenase phosphatase precursor	291					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3														0.689189	163.845913	166.203663	51	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	95004334	95004334	12106	8	G	A	A	37	37	PDP1	A	1	1
OR1J1	347168	broad.mit.edu	36	9	124279892	124279892	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:124279892G>A	uc004bmk.1	-	c.135C>T	c.(133-135)ATC>ATT	p.I45I	OR1J2_uc004bmj.1_Intron	NM_001004451	NP_001004451	Q8NGS3	OR1J1_HUMAN	olfactory receptor, family 1, subfamily J,	45	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1														0.769231	414.216426	425.433799	130	39	GG		KEEP	---	---	---	---	capture			Silent	SNP	124279892	124279892	11365	9	G	A	A	45	45	OR1J1	A	2	2
DENND1A	57706	broad.mit.edu	36	9	125259451	125259451	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:125259451C>T	uc004bnz.1	-	c.1183G>A	c.(1183-1185)GCT>ACT	p.A395T	DENND1A_uc004bny.1_Intron|DENND1A_uc004boa.1_Missense_Mutation_p.A395T|DENND1A_uc004bob.1_Missense_Mutation_p.A365T|DENND1A_uc004boc.2_Missense_Mutation_p.A363T	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1	395						cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2														0.116279	18.580758	43.510873	20	152	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	125259451	125259451	4605	9	C	T	T	27	27	DENND1A	T	1	1
ANGPTL2	23452	broad.mit.edu	36	9	128891158	128891158	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:128891158C>T	uc004bqr.1	-	c.1363G>A	c.(1363-1365)GGG>AGG	p.G455R	RALGPS1_uc004bqo.1_Intron|RALGPS1_uc004bqp.2_Intron|RALGPS1_uc004bqq.2_Intron|ANGPTL2_uc010mxg.1_Missense_Mutation_p.G153R	NM_012098	NP_036230	Q9UKU9	ANGL2_HUMAN	angiopoietin-like 2 precursor	455	Fibrinogen C-terminal.				multicellular organismal development|signal transduction	extracellular space	receptor binding				0														0.73262	434.708831	443.833426	137	50	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128891158	128891158	617	9	C	T	T	23	23	ANGPTL2	T	1	1
USP20	10868	broad.mit.edu	36	9	131671068	131671068	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:131671068C>T	uc004bys.2	+	c.1242C>T	c.(1240-1242)CCC>CCT	p.P414P	USP20_uc004byr.2_Silent_p.P414P|USP20_uc004byt.1_Silent_p.P414P	NM_001110303	NP_001103773	Q9Y2K6	UBP20_HUMAN	ubiquitin specific protease 20	414					endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|ubiquitin thiolesterase activity|zinc ion binding				0		Ovarian(14;0.00556)												0.773585	132.898538	136.541111	41	12	CC		KEEP	---	---	---	---	capture			Silent	SNP	131671068	131671068	17615	9	C	T	T	23	23	USP20	T	1	1
LAMC3	10319	broad.mit.edu	36	9	132942413	132942413	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:132942413G>A	uc004caa.1	+	c.3648G>A	c.(3646-3648)GCG>GCA	p.A1216A	LAMC3_uc010mze.1_5'Flank	NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	1216	Domain II and I.|Potential.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)												0.306122	83.413846	86.698775	30	68	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)	Silent	SNP	132942413	132942413	8939	9	G	A	A	39	39	LAMC3	A	1	1
VAV2	7410	broad.mit.edu	36	9	135650655	135650655	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:135650655G>A	uc004ces.1	-	c.1057C>T	c.(1057-1059)CGG>TGG	p.R353W	VAV2_uc004cer.1_Missense_Mutation_p.R348W	NM_003371	NP_003362	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform	353	DH.				angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)	7														0.738739	257.785697	263.506836	82	29	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)	Missense_Mutation	SNP	135650655	135650655	17697	9	G	A	A	40	40	VAV2	A	1	1
VAV2	7410	broad.mit.edu	36	9	135667092	135667092	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:135667092C>T	uc004ces.1	-	c.517G>A	c.(517-519)GAG>AAG	p.E173K	VAV2_uc004cer.1_Missense_Mutation_p.E173K	NM_003371	NP_003362	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform	173					angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)	7														0.683168	223.303731	226.31485	69	32	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)	Missense_Mutation	SNP	135667092	135667092	17697	9	C	T	T	31	31	VAV2	T	1	1
COL5A1	1289	broad.mit.edu	36	9	136761974	136761974	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:136761974C>T	uc004cfe.1	+	c.996C>T	c.(994-996)GAC>GAT	p.D332D		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	332	Nonhelical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)|skin(1)	8		Myeloproliferative disorder(178;0.0341)												0.293103	133.010775	139.648057	51	123	CC		KEEP	---	---	---	---	capture		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)	Silent	SNP	136761974	136761974	3834	9	C	T	T	19	19	COL5A1	T	1	1
OLFM1	10439	broad.mit.edu	36	9	137121945	137121945	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:137121945C>T	uc010nar.1	+	c.234C>T	c.(232-234)GTC>GTT	p.V78V	OLFM1_uc004cfl.2_Silent_p.V60V|OLFM1_uc004cfk.2_Silent_p.V60V|OLFM1_uc004cfm.2_Silent_p.V78V	NM_014279	NP_055094	Q99784	NOE1_HUMAN	olfactomedin related ER localized protein	78					nervous system development	endoplasmic reticulum lumen	protein binding			ovary(1)	1		Myeloproliferative disorder(178;0.0333)												0.666667	94.559919	95.66602	30	15	CC		KEEP	---	---	---	---	capture		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)	Silent	SNP	137121945	137121945	11257	9	C	T	T	31	31	OLFM1	T	1	1
KIAA0649	9858	broad.mit.edu	36	9	137518849	137518849	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:137518849G>A	uc004cfr.1	+	c.2672G>A	c.(2671-2673)CGC>CAC	p.R891H	KIAA0649_uc010nas.1_Missense_Mutation_p.R891H	NM_014811	NP_055626	Q5T8A7	K0649_HUMAN	1A6/DRIM (down-regulated in metastasis)	891						nucleolus	protein binding			ovary(1)|central_nervous_system(1)	2														0.201439	57.923222	69.439111	28	111	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(145;6.91e-08)|Epithelial(140;4.69e-07)|all cancers(34;9.33e-06)	Missense_Mutation	SNP	137518849	137518849	8494	9	G	A	A	38	38	KIAA0649	A	1	1
TRAF2	7186	broad.mit.edu	36	9	138935473	138935473	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:138935473G>A	uc010nbu.1	+	c.1123G>A	c.(1123-1125)GCC>ACC	p.A375T	TRAF2_uc004cjv.1_Missense_Mutation_p.A375T|TRAF2_uc010nbw.1_Missense_Mutation_p.A350T	NM_021138	NP_066961	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	375	MATH.				activation of caspase activity|activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cellular protein complex assembly|induction of apoptosis by extracellular signals|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell activation|positive regulation of T cell cytokine production|protein autoubiquitination|protein homotrimerization|protein K63-linked ubiquitination|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane	CD40 receptor binding|enzyme binding|protein binding|signal transducer activity|sphingolipid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)								212				0.763889	160.869126	165.542812	55	17	GG		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)	Missense_Mutation	SNP	138935473	138935473	16982	9	G	A	A	38	38	TRAF2	A	1	1
TPRN	286262	broad.mit.edu	36	9	139213351	139213351	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:139213351C>T	uc004clu.2	-	c.1451G>A	c.(1450-1452)CGC>CAC	p.R484H	TPRN_uc004clt.2_Missense_Mutation_p.R239H	NM_001128228	NP_001121700	Q4KMQ1	TPRN_HUMAN	hypothetical protein LOC286262 isoform 1	545					sensory perception of sound	stereocilium					0														0.791667	420.060642	433.346701	133	35	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	139213351	139213351	16965	9	C	T	T	27	27	TPRN	T	1	1
SLC34A3	142680	broad.mit.edu	36	9	139248995	139248995	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:139248995C>T	uc004cme.1	+	c.1326C>T	c.(1324-1326)AGC>AGT	p.S442S	SLC34A3_uc004cmf.1_Silent_p.S442S	NM_080877	NP_543153	Q8N130	NPT2C_HUMAN	solute carrier family 34 (sodium phosphate),	442	Extracellular (Potential).				cellular phosphate ion homeostasis	apical plasma membrane|integral to membrane	sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity				0	all_cancers(76;0.0926)													0.674419	88.980508	90.143836	29	14	CC		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)	Silent	SNP	139248995	139248995	15066	9	C	T	T	27	27	SLC34A3	T	1	1
TAF1L	138474	broad.mit.edu	36	9	32621859	32621859	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:32621859C>T	uc003zrg.1	-	c.3719G>A	c.(3718-3720)CGG>CAG	p.R1240Q		NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1240					male meiosis|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding|transcription activator activity			lung(8)|large_intestine(3)|central_nervous_system(3)|skin(2)|ovary(2)|breast(1)|pancreas(1)	20										234				0.740458	331.73814	338.616685	97	34	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	Missense_Mutation	SNP	32621859	32621859	16044	9	C	T	T	23	23	TAF1L	T	1	1
ARID3C	138715	broad.mit.edu	36	9	34611537	34611537	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:34611537C>T	uc003zuy.1	-	c.1157G>A	c.(1156-1158)CGC>CAC	p.R386H	DCTN3_uc003zuw.1_5'Flank|DCTN3_uc003zux.1_5'Flank	NM_001017363	NP_001017363	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT- like)	386	REKLES.|Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	all_epithelial(49;0.102)													0.757576	161.175555	165.168486	50	16	CC		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)	Missense_Mutation	SNP	34611537	34611537	933	9	C	T	T	27	27	ARID3C	T	1	1
DOCK8	81704	broad.mit.edu	36	9	367067	367067	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:367067G>A	uc003zgf.1	+	c.2296G>A	c.(2296-2298)GAG>AAG	p.E766K	DOCK8_uc003zgi.1_Missense_Mutation_p.E698K|DOCK8_uc010mgu.1_Missense_Mutation_p.E68K|DOCK8_uc010mgv.1_Missense_Mutation_p.E698K|DOCK8_uc010mgw.1_Missense_Mutation_p.E68K|DOCK8_uc003zgk.1_Missense_Mutation_p.E224K|DOCK8_uc003zgh.1_Non-coding_Transcript	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	766					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)												0.736842	92.715792	94.643394	28	10	GG		KEEP	---	---	---	---	capture		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)	Missense_Mutation	SNP	367067	367067	4877	9	G	A	A	37	37	DOCK8	A	1	1
PRKACG	5568	broad.mit.edu	36	9	70818523	70818523	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:70818523C>T	uc004agy.1	-	c.306G>A	c.(304-306)CCG>CCA	p.P102P		NM_002732	NP_002723	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic,	102	Protein kinase.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|gluconeogenesis|intracellular protein kinase cascade|male gonad development|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|spermatogenesis|transmembrane transport|triglyceride catabolic process|water transport	cytosol|nucleoplasm	ATP binding|cAMP-dependent protein kinase activity			ovary(1)|pancreas(1)	2						Esophageal Squamous(110;2236 2623 32146)			p.P102P(RPMI8402-Tumor)|p.P102P(CALU1-Tumor)	42				0.622642	206.205082	207.625983	66	40	CC		KEEP	---	---	---	---	capture			Silent	SNP	70818523	70818523	12942	9	C	T	T	19	19	PRKACG	T	1	1
PRKACG	5568	broad.mit.edu	36	9	70818722	70818722	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1787-01	TCGA-19-1787-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:70818722T>A	uc004agy.1	-	c.107A>T	c.(106-108)CAA>CTA	p.Q36L		NM_002732	NP_002723	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic,	36					activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|gluconeogenesis|intracellular protein kinase cascade|male gonad development|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|spermatogenesis|transmembrane transport|triglyceride catabolic process|water transport	cytosol|nucleoplasm	ATP binding|cAMP-dependent protein kinase activity			ovary(1)|pancreas(1)	2						Esophageal Squamous(110;2236 2623 32146)				42				0.148936	23.891021	35.004941	14	80	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70818722	70818722	12942	9	T	A	A	63	63	PRKACG	A	4	4
TMEM2	23670	broad.mit.edu	36	9	73550081	73550081	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:73550081C>T	uc004aij.1	-	c.707G>A	c.(706-708)CGG>CAG	p.R236Q	TMEM2_uc010mos.1_Missense_Mutation_p.R236Q	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a	236	G8.					integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)												0.682119	355.778176	360.229963	103	48	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)	Missense_Mutation	SNP	73550081	73550081	16656	9	C	T	T	23	23	TMEM2	T	1	1
TRPM6	140803	broad.mit.edu	36	9	76566799	76566799	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:76566799G>A	uc004ajl.1	-	c.4608C>T	c.(4606-4608)TTC>TTT	p.F1536F	TRPM6_uc004ajj.1_Silent_p.F492F|TRPM6_uc004ajk.1_Silent_p.F1531F|TRPM6_uc010mpb.1_Non-coding_Transcript|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	1536	Cytoplasmic (Potential).				protein phosphorylation|response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4										879				0.655738	130.317061	131.624099	40	21	GG		KEEP	---	---	---	---	capture			Silent	SNP	76566799	76566799	17141	9	G	A	A	37	37	TRPM6	A	1	1
TRPM6	140803	broad.mit.edu	36	9	76605090	76605090	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:76605090G>A	uc004ajl.1	-	c.2138C>T	c.(2137-2139)TCG>TTG	p.S713L	TRPM6_uc004ajk.1_Missense_Mutation_p.S708L|TRPM6_uc010mpb.1_Non-coding_Transcript|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_Missense_Mutation_p.S91L	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	713	Cytoplasmic (Potential).				protein phosphorylation|response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4										879				0.743902	198.004357	202.426791	61	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	76605090	76605090	17141	9	G	A	A	37	37	TRPM6	A	1	1
PHF2	5253	broad.mit.edu	36	9	95468123	95468123	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:95468123C>T	uc004aub.1	+	c.2147C>T	c.(2146-2148)ACG>ATG	p.T716M	PHF2_uc004auc.2_Missense_Mutation_p.T135M	NM_005392	NP_005383	O75151	PHF2_HUMAN	PHD finger protein 2	716				AVLPTPVT -> EALLMPTS (in Ref. 1; AAD21791).	negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	methylated histone residue binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)												0.363636	76.885377	78.142261	28	49	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)	Missense_Mutation	SNP	95468123	95468123	12253	9	C	T	T	19	19	PHF2	T	1	1
CAPN6	827	broad.mit.edu	36	X	110376546	110376546	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:110376546C>T	uc004epc.1	-	c.1841G>A	c.(1840-1842)CGT>CAT	p.R614H		NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6	614	C2.				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6														0.825758	361.584291	374.910372	109	23	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	110376546	110376546	2748	23	C	T	T	19	19	CAPN6	T	1	1
TRPC5	7224	broad.mit.edu	36	X	110977223	110977223	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:110977223C>T	uc004epl.1	-	c.1475G>A	c.(1474-1476)CGT>CAT	p.R492H	TRPC5_uc004epm.1_Missense_Mutation_p.R492H	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	492	Cytoplasmic (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1														0.810811	296.509017	306.538786	90	21	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	110977223	110977223	17133	23	C	T	T	19	19	TRPC5	T	1	1
PRPS2	5634	broad.mit.edu	36	X	12747715	12747715	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:12747715G>A	uc004cva.1	+	c.708G>A	c.(706-708)GCG>GCA	p.A236A	PRPS2_uc004cvb.1_Silent_p.A233A|PRPS2_uc010nec.1_Intron	NM_001039091	NP_001034180	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	233					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity				0														0.795812	523.281351	538.809051	152	39	GG		KEEP	---	---	---	---	capture			Silent	SNP	12747715	12747715	13023	23	G	A	A	39	39	PRPS2	A	1	1
SMARCA1	6594	broad.mit.edu	36	X	128451837	128451837	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:128451837C>T	uc004eun.2	-	c.1829G>A	c.(1828-1830)CGT>CAT	p.R610H	SMARCA1_uc004eup.2_Missense_Mutation_p.R598H	NM_003069	NP_003060	P28370	SMCA1_HUMAN	SWI/SNF-related matrix-associated	610	Helicase C-terminal.				ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of gene-specific transcription|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding|transcription regulator activity			ovary(3)|skin(1)	4														0.824561	158.659256	164.323259	47	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128451837	128451837	15266	23	C	T	T	19	19	SMARCA1	T	1	1
TLR8	51311	broad.mit.edu	36	X	12849585	12849585	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:12849585G>A	uc004cvd.1	+	c.2559G>A	c.(2557-2559)ACG>ACA	p.T853T	TLR8_uc004cve.1_Silent_p.T835T	NM_138636	NP_619542	Q9NR97	TLR8_HUMAN	toll-like receptor 8	835	Helical; (Potential).				cellular response to mechanical stimulus|defense response to virus|I-kappaB kinase/NF-kappaB cascade|immunoglobulin mediated immune response|inflammatory response|innate immune response|positive regulation of innate immune response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process	endosome membrane|integral to membrane	DNA binding|double-stranded RNA binding|single-stranded RNA binding|transmembrane receptor activity			ovary(4)|large_intestine(1)	5														0.835443	438.997488	455.892578	132	26	GG		KEEP	---	---	---	---	capture			Silent	SNP	12849585	12849585	16487	23	G	A	A	40	40	TLR8	A	1	1
FMR1NB	158521	broad.mit.edu	36	X	146870756	146870756	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:146870756G>A	uc004fcm.1	+	c.142G>A	c.(142-144)GCC>ACC	p.A48T		NM_152578	NP_689791	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	48	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)													0.805556	364.947565	377.476959	116	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	146870756	146870756	6203	23	G	A	A	38	38	FMR1NB	A	1	1
MAGEA11	4110	broad.mit.edu	36	X	148576734	148576734	+	Silent	SNP	A	G	G			TCGA-19-1787-01	TCGA-19-1787-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:148576734A>G	uc004fdq.1	-	c.525T>C	c.(523-525)CCT>CCC	p.P175P	HSFX1_uc004fdl.1_Intron|HSFX1_uc004fdm.1_Intron|MAGEA11_uc004fdr.1_Silent_p.P146P|MAGEA11_uc004fds.1_Silent_p.P140P	NM_005366	NP_005357	P43364	MAGAB_HUMAN	melanoma antigen family A, 11 isoform a	175						cytoplasm|nucleus	protein binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)													0.416667	99.636911	100.073448	30	42	AA		KEEP	---	---	---	---	capture			Silent	SNP	148576734	148576734	9542	23	A	G	G	11	11	MAGEA11	G	4	4
GABRQ	55879	broad.mit.edu	36	X	151570819	151570819	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:151570819G>A	uc004ffp.1	+	c.1076G>A	c.(1075-1077)CGG>CAG	p.R359Q		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	359						cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)													0.894231	311.432036	327.499382	93	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	151570819	151570819	6426	23	G	A	A	39	39	GABRQ	A	1	1
ATP2B3	492	broad.mit.edu	36	X	152474788	152474788	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:152474788G>A	uc004fht.1	+	c.2146G>A	c.(2146-2148)GCA>ACA	p.A716T	ATP2B3_uc004fhs.1_Missense_Mutation_p.A716T	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	716	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)													0.126214	14.513897	28.554642	13	90	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	152474788	152474788	1160	23	G	A	A	38	38	ATP2B3	A	1	1
PLXNA3	55558	broad.mit.edu	36	X	153352717	153352717	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:153352717G>A	uc004flm.1	+	c.5232G>A	c.(5230-5232)ACG>ACA	p.T1744T		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3	1744	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)													0.698113	242.586113	246.302186	74	32	GG		KEEP	---	---	---	---	capture			Silent	SNP	153352717	153352717	12547	23	G	A	A	39	39	PLXNA3	A	1	1
MPP1	4354	broad.mit.edu	36	X	153667805	153667805	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:153667805G>A	uc004fmp.1	-	c.545C>T	c.(544-546)GCG>GTG	p.A182V	MPP1_uc004fmq.1_Missense_Mutation_p.A136V|MPP1_uc010nvg.1_Missense_Mutation_p.A162V|MPP1_uc010nvh.1_Missense_Mutation_p.A56V	NM_002436	NP_002427	Q00013	EM55_HUMAN	palmitoylated membrane protein 1	182	SH3.				regulation of neutrophil chemotaxis|signal transduction	integral to plasma membrane|membrane fraction|stereocilium	guanylate kinase activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)													0.717949	790.689115	805.654021	252	99	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	153667805	153667805	10125	23	G	A	A	38	38	MPP1	A	1	1
MXRA5	25878	broad.mit.edu	36	X	3238395	3238395	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:3238395C>T	uc004crg.2	-	c.7849G>A	c.(7849-7851)GTG>ATG	p.V2617M		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican	2617	Ig-like C2-type 10.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(23;0.00031)|Lung NSC(23;0.000946)												0.769231	29.642046	30.502874	10	3	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3238395	3238395	10397	23	C	T	T	19	19	MXRA5	T	1	1
MED14	9282	broad.mit.edu	36	X	40455431	40455431	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:40455431C>T	uc004dex.2	-	c.956G>A	c.(955-957)CGG>CAG	p.R319Q	MED14_uc010nhe.1_Missense_Mutation_p.R203Q	NM_004229	NP_004220	O60244	MED14_HUMAN	mediator complex subunit 14	319	Interaction with STAT2.				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription mediator activity|thyroid hormone receptor binding|transcription activator activity|vitamin D receptor binding			breast(2)|kidney(1)|skin(1)	4														0.830986	201.068925	208.435564	59	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40455431	40455431	9821	23	C	T	T	23	23	MED14	T	1	1
USP9X	8239	broad.mit.edu	36	X	40892621	40892621	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:40892621G>A	uc004dfb.1	+	c.1475G>A	c.(1474-1476)CGT>CAT	p.R492H	USP9X_uc004dfc.1_Missense_Mutation_p.R492H	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	492					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			ovary(1)	1						Ovarian(172;1807 2695 35459 49286)								0.311111	75.666643	78.52659	28	62	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40892621	40892621	17654	23	G	A	A	40	40	USP9X	A	1	1
USP9X	8239	broad.mit.edu	36	X	40958799	40958799	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:40958799G>A	uc004dfb.1	+	c.5224G>A	c.(5224-5226)GTA>ATA	p.V1742I	USP9X_uc004dfc.1_Missense_Mutation_p.V1742I	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	1742					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			ovary(1)	1						Ovarian(172;1807 2695 35459 49286)								0.805556	97.795306	100.930516	29	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40958799	40958799	17654	23	G	A	A	40	40	USP9X	A	1	1
USP11	8237	broad.mit.edu	36	X	46987809	46987809	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:46987809C>T	uc004dhp.1	+	c.1783C>T	c.(1783-1785)CGG>TGG	p.R595W	USP11_uc004dhq.1_Missense_Mutation_p.R322W	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific protease 11	595					protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|central_nervous_system(1)	2														0.77027	181.008417	185.968837	57	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46987809	46987809	17604	23	C	T	T	27	27	USP11	T	1	1
PRICKLE3	4007	broad.mit.edu	36	X	48921723	48921723	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:48921723G>A	uc004dmy.1	-	c.610C>T	c.(610-612)CGT>TGT	p.R204C		NM_006150	NP_006141	O43900	PRIC3_HUMAN	LIM domain only 6	204	LIM zinc-binding 1.						protein binding|zinc ion binding			breast(1)	1														0.8125	133.350435	137.74335	39	9	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48921723	48921723	12931	23	G	A	A	39	39	PRICKLE3	A	1	1
WNK3	65267	broad.mit.edu	36	X	54276113	54276113	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:54276113C>T	uc004dtc.1	-	c.4694G>A	c.(4693-4695)CGC>CAC	p.R1565H	WNK3_uc004dtd.1_Missense_Mutation_p.R1518H	NM_020922	NP_065973	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 1	1518					intracellular protein kinase cascade|protein phosphorylation		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11										290				0.811189	370.46537	383.420009	116	27	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54276113	54276113	17953	23	C	T	T	27	27	WNK3	T	1	1
ZXDA	7789	broad.mit.edu	36	X	57952814	57952814	+	Nonsense_Mutation	SNP	C	A	A			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:57952814C>A	uc004dve.1	-	c.766G>T	c.(766-768)GGA>TGA	p.G256*		NM_007156	NP_009087	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	256					positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1														0.454545	14.974306	14.993987	5	6	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	57952814	57952814	18855	23	C	A	A	23	23	ZXDA	A	5	3
KIF4A	24137	broad.mit.edu	36	X	69435728	69435728	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:69435728G>A	uc004dyg.1	+	c.467G>A	c.(466-468)CGT>CAT	p.R156H	KIF4A_uc004dyf.1_Missense_Mutation_p.R156H|KIF4A_uc010nkw.1_Missense_Mutation_p.R156H	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	156	Kinesin-motor.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4														0.847826	132.754518	138.081266	39	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69435728	69435728	8614	23	G	A	A	40	40	KIF4A	A	1	1
MED12	9968	broad.mit.edu	36	X	70277430	70277430	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:70277430C>T	uc004dyy.1	+	c.6265C>T	c.(6265-6267)CGG>TGG	p.R2089W	MED12_uc004dyz.1_Missense_Mutation_p.R2088W|MED12_uc004dza.1_Missense_Mutation_p.R1939W|MED12_uc010nla.1_Missense_Mutation_p.R718W	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	2089	Gln-rich.				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription mediator activity|thyroid hormone receptor binding|transcription activator activity|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)													0.842105	152.034032	158.41551	48	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70277430	70277430	9817	23	C	T	T	27	27	MED12	T	1	1
RGAG4	340526	broad.mit.edu	36	X	71266480	71266480	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:71266480G>A	uc010nlh.1	-	c.1636C>T	c.(1636-1638)CGC>TGC	p.R546C	RGAG4_uc004eaj.1_Non-coding_Transcript	NM_001024455	NP_001019626	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	546										ovary(2)|skin(1)	3	Renal(35;0.156)													0.891304	128.588668	135.567378	41	5	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71266480	71266480	13748	23	G	A	A	40	40	RGAG4	A	1	1
CITED1	4435	broad.mit.edu	36	X	71438775	71438775	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:71438775C>T	uc004eas.1	-	c.105G>A	c.(103-105)GCG>GCA	p.A35A	CITED1_uc004eat.1_Silent_p.A35A	NM_004143	NP_004134	Q99966	CITE1_HUMAN	melanocyte-specific gene 1 isoform 1	35					branching involved in ureteric bud morphogenesis|cell proliferation|melanin biosynthetic process|melanocyte differentiation|mesenchymal to epithelial transition|metanephros development|negative regulation of neuron apoptosis|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|nucleocytoplasmic transport|placenta development|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transcription from RNA polymerase II promoter|response to cAMP|response to estrogen stimulus|response to insulin stimulus|response to interferon-gamma|response to interleukin-1|response to interleukin-11|response to interleukin-2|response to interleukin-4|response to interleukin-6|response to interleukin-9|response to lipopolysaccharide|response to parathyroid hormone stimulus|response to transforming growth factor beta stimulus|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	cytosol|nucleus	co-SMAD binding|LBD domain binding|promoter binding|protein C-terminus binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription activator activity|transcription coactivator activity|transcription repressor activity				0	Renal(35;0.156)													0.727273	27.204662	27.716684	8	3	CC		KEEP	---	---	---	---	capture			Silent	SNP	71438775	71438775	3574	23	C	T	T	23	23	CITED1	T	1	1
TGIF2LX	90316	broad.mit.edu	36	X	89063851	89063851	+	Silent	SNP	C	T	T			TCGA-19-1787-01	TCGA-19-1787-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:89063851C>T	uc004efe.1	+	c.111C>T	c.(109-111)AAC>AAT	p.N37N	TGIF2LX_uc010nmt.1_Silent_p.N37N	NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	37					regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1														0.84375	176.583331	183.800558	54	10	CC		KEEP	---	---	---	---	capture			Silent	SNP	89063851	89063851	16355	23	C	T	T	19	19	TGIF2LX	T	1	1
FAM133A	286499	broad.mit.edu	36	X	92851382	92851382	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:92851382G>A	uc004efr.1	+	c.308G>A	c.(307-309)CGG>CAG	p.R103Q	FAM133A_uc010nmw.1_Missense_Mutation_p.R103Q	NM_173698	NP_775969	Q8N9E0	F133A_HUMAN	hypothetical protein LOC286499	103	Ser-rich.|Lys-rich.										0														0.9375	54.132635	56.030512	15	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	92851382	92851382	5640	23	G	A	A	39	39	FAM133A	A	1	1
KDM5D	8284	broad.mit.edu	36	Y	20337202	20337202	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrY:20337202G>A	uc004fug.1	-	c.2108C>T	c.(2107-2109)ACG>ATG	p.T703M	KDM5D_uc004fuf.1_5'Flank|KDM5D_uc010nwy.1_Missense_Mutation_p.T646M	NM_004653	NP_004644	Q9BY66	KDM5D_HUMAN	jumonji, AT rich interactive domain 1D	703					chromatin modification|oxidation-reduction process|spermatogenesis	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1					Vitamin C(DB00126)									0.875	183.339717	192.129773	56	8	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20337202	20337202	8442	24	G	A	A	40	40	KDM5D	A	1	1
KDM5D	8284	broad.mit.edu	36	Y	20353142	20353142	+	Silent	SNP	G	A	A			TCGA-19-1787-01	TCGA-19-1787-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrY:20353142G>A	uc004fug.1	-	c.1275C>T	c.(1273-1275)GAC>GAT	p.D425D	KDM5D_uc010nwy.1_Silent_p.D368D|KDM5D_uc004fuh.1_Silent_p.D380D	NM_004653	NP_004644	Q9BY66	KDM5D_HUMAN	jumonji, AT rich interactive domain 1D	425					chromatin modification|oxidation-reduction process|spermatogenesis	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1					Vitamin C(DB00126)									0.831933	317.586989	330.003071	99	20	GG		KEEP	---	---	---	---	capture			Silent	SNP	20353142	20353142	8442	24	G	A	A	40	40	KDM5D	A	1	1
PSD	5662	broad.mit.edu	36	10	104164914	104164915	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:104164914_104164915delCA	uc001kvg.1	-	c.819_820delTG	c.(817-822)TCTGGGfs	p.S273fs	PSD_uc001kvh.1_5'UTR|PSD_uc009xxd.1_Frame_Shift_Del_p.S273fs	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	273_274					regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)										0.70			53	23				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	104164914	104164915	13099	10	CA	-	-	21	21	PSD	-	5	5
PDCD4	27250	broad.mit.edu	36	10	112631000	112631003	+	Frame_Shift_Del	DEL	CTCT	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:112631000_112631003delCTCT	uc001kzh.1	+	c.63_66delCTCT	c.(61-66)GACTCTfs	p.D21fs	PDCD4_uc001kzg.1_Frame_Shift_Del_p.D10fs	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN	programmed cell death 4 isoform 1	21_22					apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding			ovary(1)|breast(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		Ovarian(115;1498 1603 9363 40056 40885)								0.56			53	41				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	112631000	112631003	12042	10	CTCT	-	-	20	20	PDCD4	-	5	5
DCLRE1A	9937	broad.mit.edu	36	10	115599844	115599846	+	In_Frame_Del	DEL	TCT	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:115599844_115599846delTCT	uc001law.1	-	c.1008_1010delAGA	c.(1006-1011)GAAGAT>GAT	p.E336del		NM_014881	NP_055696	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	336					cell division|mitosis	nucleus	hydrolase activity			skin(1)	1				Epithelial(162;0.0157)|all cancers(201;0.0171)										0.59			104	71				---	---	---	---	capture_indel			In_Frame_Del	DEL	115599844	115599846	4465	10	TCT	-	-	50	50	DCLRE1A	-	5	5
FANK1	92565	broad.mit.edu	36	10	127687959	127687959	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:127687959_127687959delA	uc009yan.1	+	c.1078_1078delA	c.(1078-1080)AAAfs	p.K360fs	FANK1_uc001ljh.2_Frame_Shift_Del_p.K334fs|FANK1_uc001lji.2_3'UTR	NM_145235	NP_660278	Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains	334						cytoplasm|nucleus				ovary(1)	1		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)												0.70			48	21				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	127687959	127687959	5908	10	A	-	-	9	9	FANK1	-	5	5
ATM	472	broad.mit.edu	36	11	107620027	107620027	+	Frame_Shift_Del	DEL	T	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:107620027_107620027delT	uc001pkb.1	+	c.634_634delT	c.(634-636)TTTfs	p.F212fs	ATM_uc009yxr.1_Frame_Shift_Del_p.F212fs	NM_000051	NP_612149	Q13315	ATM_HUMAN	ataxia telangiectasia mutated protein isoform 1	212					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(24)|breast(14)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	238		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)						1073	TSP Lung(14;0.12)			0.36			35	61				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	107620027	107620027	1128	11	T	-	-	56	56	ATM	-	5	5
ANO5	203859	broad.mit.edu	36	11	22199320	22199321	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:22199320_22199321delAG	uc001mqi.1	+	c.282_283delAG	c.(280-285)GCAGAGfs	p.A94fs	ANO5_uc001mqj.1_Frame_Shift_Del_p.A93fs	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	94_95	Cytoplasmic (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4														0.58			18	13				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	22199320	22199321	708	11	AG	-	-	7	7	ANO5	-	5	5
STX5	6811	broad.mit.edu	36	11	62355160	62355161	+	Frame_Shift_Ins	INS	-	G	G			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:62355160_62355161insG	uc001nvh.1	-	c.131_132insC	c.(130-132)CCAfs	p.P44fs	STX5_uc001nvi.1_Splice_Site_Ins|STX5_uc009yoh.1_Non-coding_Transcript|STX5_uc001nvj.1_5'UTR	NM_003164	NP_003155	Q13190	STX5_HUMAN	syntaxin 5	44	Cytoplasmic (Potential).				intracellular protein transport|retrograde transport, endosome to Golgi|vesicle targeting	ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|nucleus|SNARE complex	protein N-terminus binding|SNAP receptor activity			ovary(1)|breast(1)	2														0.50			4	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	62355160	62355161	15868	11	-	G	G	55	55	STX5	G	5	5
CEP57	9702	broad.mit.edu	36	11	95200780	95200782	+	In_Frame_Del	DEL	TAA	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:95200780_95200782delTAA	uc001pfp.1	+	c.1068_1070delTAA	c.(1066-1071)ATTAAT>ATT	p.N357del	CEP57_uc009ywn.1_In_Frame_Del_p.N205del|CEP57_uc001pfq.1_In_Frame_Del_p.N331del|CEP57_uc001pfr.1_In_Frame_Del_p.N205del	NM_014679	NP_055494	Q86XR8	CEP57_HUMAN	translokin	357	Mediates interaction with microtubules (By similarity).				fibroblast growth factor receptor signaling pathway|G2/M transition of mitotic cell cycle|protein import into nucleus, translocation|spermatid development	centrosome|cytosol|Golgi apparatus|microtubule|nucleus	fibroblast growth factor binding|protein homodimerization activity			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)												0.63			44	26				---	---	---	---	capture_indel			In_Frame_Del	DEL	95200780	95200782	3389	11	TAA	-	-	61	61	CEP57	-	5	5
SPIC	121599	broad.mit.edu	36	12	100404364	100404365	+	Frame_Shift_Ins	INS	-	A	A			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:100404364_100404365insA	uc001tid.1	+	c.431_432insA	c.(430-432)TCAfs	p.S144fs	SPIC_uc001tie.1_Frame_Shift_Ins_p.S144fs|SPIC_uc009zua.1_Frame_Shift_Ins_p.S19fs	NM_152323	NP_689536	Q8N5J4	SPIC_HUMAN	Spi-C transcription factor (Spi-1/PU.1 related)	144	ETS.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0														0.31			30	66				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	100404364	100404365	15563	12	-	A	A	29	29	SPIC	A	5	5
PPP1R12A	4659	broad.mit.edu	36	12	78693829	78693829	+	Splice_Site_Del	DEL	T	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:78693829_78693829delT	uc001syz.1	-	c.e25_splice_site			PPP1R12A_uc001sza.1_3'UTR|PPP1R12A_uc001szb.1_3'UTR|PPP1R12A_uc001syy.1_Non-coding_Transcript	NM_002480	NP_002471			protein phosphatase 1, regulatory (inhibitor)							contractile fiber	protein binding|signal transducer activity			ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7														0.44			4	5				---	---	---	---	capture_indel			Splice_Site_Del	DEL	78693829	78693829	12789	12	T	-	-	56	56	PPP1R12A	-	5	5
MRPS31	10240	broad.mit.edu	36	13	40201544	40201545	+	Frame_Shift_Ins	INS	-	T	T			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:40201544_40201545insT	uc001uxm.2	-	c.1151_1152insA	c.(1150-1152)AAGfs	p.K384fs		NM_005830	NP_005821	Q92665	RT31_HUMAN	mitochondrial ribosomal protein S31	384						mitochondrion|ribosome	protein domain specific binding				0		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.52e-08)|Epithelial(112;7.63e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000192)|GBM - Glioblastoma multiforme(144;0.00233)|BRCA - Breast invasive adenocarcinoma(63;0.0706)										0.64			7	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	40201544	40201545	10234	13	-	T	T	24	24	MRPS31	T	5	5
RB1	5925	broad.mit.edu	36	13	47832205	47832206	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:47832205_47832206delTA	uc001vcb.1	+	c.659_660delTA	c.(658-660)CTAfs	p.L220fs	RB1_uc010act.1_5'UTR|RB1_uc010acs.1_Non-coding_Transcript	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	220					androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|transcription repressor activity|ubiquitin protein ligase binding	p.0?(13)		lung(93)|eye(89)|central_nervous_system(47)|bone(22)|breast(20)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|soft_tissue(8)|prostate(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	355		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)			6		568	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.79			27	7				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	47832205	47832206	13559	13	TA	-	-	53	53	RB1	-	5	5
LECT1	11061	broad.mit.edu	36	13	52211767	52211767	+	Frame_Shift_Del	DEL	G	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:52211767_52211767delG	uc001vhf.1	-	c.71_71delC	c.(70-72)CCGfs	p.P24fs	LECT1_uc001vhg.1_Frame_Shift_Del_p.P24fs|LECT1_uc001vhh.1_Frame_Shift_Del_p.P51fs	NM_007015	NP_008946	O75829	LECT1_HUMAN	leukocyte cell derived chemotaxin 1 isoform 1	24					cartilage development|proteoglycan metabolic process	endomembrane system|extracellular region|integral to membrane				ovary(1)	1		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.38e-08)										0.71			41	17				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	52211767	52211767	9036	13	G	-	-	39	39	LECT1	-	5	5
PCDH17	27253	broad.mit.edu	36	13	57138599	57138602	+	Splice_Site_Del	DEL	ACAG	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:57138599_57138602delACAG	uc001vhq.1	+	c.e2_splice_site			PCDH17_uc010aec.1_Splice_Site_Del|PCDH17_uc001vhr.1_5'Flank	NM_001040429	NP_001035519			protocadherin 17 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(2)|pancreas(2)	4		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		Melanoma(72;952 1291 1619 12849 33676)								0.51			25	24				---	---	---	---	capture_indel			Splice_Site_Del	DEL	57138599	57138602	11932	13	ACAG	-	-	6	6	PCDH17	-	5	5
ATL1	51062	broad.mit.edu	36	14	50164731	50164734	+	Frame_Shift_Del	DEL	TGTT	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:50164731_50164734delTGTT	uc001wyf.2	+	c.1352_1355delTGTT	c.(1351-1356)CTGTTTfs	p.L451fs	ATL1_uc001wyd.2_Frame_Shift_Del_p.L451fs|ATL1_uc001wye.2_Frame_Shift_Del_p.L451fs|ATL1_uc010anw.1_Frame_Shift_Del_p.L451fs	NM_015915	NP_853629	Q8WXF7	ATLA1_HUMAN	atlastin GTPase 1 isoform a	451_452	Helical; (Potential).|Sufficient for membrane association.				axonogenesis|cell death|endoplasmic reticulum organization|protein homooligomerization	axon|endoplasmic reticulum membrane|Golgi cis cisterna|Golgi membrane|integral to membrane|microsome	GTP binding|GTPase activity|identical protein binding			central_nervous_system(1)	1														0.66			94	48				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	50164731	50164734	1125	14	TGTT	-	-	55	55	ATL1	-	5	5
SEL1L	6400	broad.mit.edu	36	14	81034041	81034043	+	In_Frame_Del	DEL	TCT	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:81034041_81034043delTCT	uc001xvn.1	-	c.1074_1076delAGA	c.(1072-1077)GAAGAT>GAT	p.E358del		NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like	358	Lumenal (Potential).|Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)										0.70			58	25				---	---	---	---	capture_indel			In_Frame_Del	DEL	81034041	81034043	14496	14	TCT	-	-	50	50	SEL1L	-	5	5
EVL	51466	broad.mit.edu	36	14	99664680	99664680	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:99664680_99664680delC	uc001ygu.1	+	c.559_559delC	c.(559-561)CCCfs	p.P187fs	EVL_uc001ygt.1_Frame_Shift_Del_p.P185fs|EVL_uc010avu.1_Frame_Shift_Del_p.P44fs|EVL_uc001ygv.1_5'UTR	NM_016337	NP_057421	Q9UI08	EVL_HUMAN	Enah/Vasp-like	185	Pro-rich.				actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)												0.47			14	16				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	99664680	99664680	5484	14	C	-	-	26	26	EVL	-	5	5
BTBD1	53339	broad.mit.edu	36	15	81478458	81478461	+	Splice_Site_Del	DEL	CTTA	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:81478458_81478461delCTTA	uc002bjn.1	-	c.e7_splice_site			BTBD1_uc002bjo.1_Splice_Site_Del	NM_025238	NP_079514			BTB (POZ) domain containing 1 isoform 1							cytoplasmic mRNA processing body|protein complex	protein binding			ovary(1)|central_nervous_system(1)	2				all cancers(203;0.000186)										0.77			71	21				---	---	---	---	capture_indel			Splice_Site_Del	DEL	81478458	81478461	1569	15	CTTA	-	-	32	32	BTBD1	-	5	5
PDXDC1	23042	broad.mit.edu	36	16	15011073	15011074	+	Frame_Shift_Del	DEL	AT	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:15011073_15011074delAT	uc002dda.2	+	c.683_684delAT	c.(682-684)GATfs	p.D228fs	PDXDC1_uc002ddc.2_Frame_Shift_Del_p.D228fs|PDXDC1_uc002dcz.2_Frame_Shift_Del_p.D205fs|PDXDC1_uc002ddb.2_Frame_Shift_Del_p.D201fs	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain	228					carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)									0.31			49	109				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	15011073	15011074	12117	16	AT	-	-	12	12	PDXDC1	-	5	5
CCNF	899	broad.mit.edu	36	16	2447019	2447022	+	Frame_Shift_Del	DEL	GTAA	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:2447019_2447022delGTAA	uc002cqd.1	+	c.2358_2361delGTAA	c.(2356-2361)CTGTAAfs	p.L786fs	CCNF_uc002cqe.1_Frame_Shift_Del_p.L478fs	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	786_787					cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)												0.67			24	12				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	2447019	2447022	3049	16	GTAA	-	-	48	48	CCNF	-	5	5
CEMP1	752014	broad.mit.edu	36	16	2520571	2520571	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:2520571_2520571delC	uc002cqr.2	-	c.505_505delG	c.(505-507)GAAfs	p.E169fs		NM_001048212	NP_001041677	Q6PRD7	CEMP1_HUMAN	cementum protein 1	169						cytoplasm					0														0.33			53	110				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	2520571	2520571	3357	16	C	-	-	30	30	CEMP1	-	5	5
KIAA0556	23247	broad.mit.edu	36	16	27659389	27659391	+	In_Frame_Del	DEL	CTT	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:27659389_27659391delCTT	uc002dow.1	+	c.2270_2272delCTT	c.(2269-2274)CCTTCT>CCT	p.S758del		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	758										ovary(4)|large_intestine(2)	6														0.72			118	47				---	---	---	---	capture_indel			In_Frame_Del	DEL	27659389	27659391	8490	16	CTT	-	-	24	24	KIAA0556	-	5	5
ASPHD1	253982	broad.mit.edu	36	16	29819842	29819845	+	Frame_Shift_Del	DEL	GAGA	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:29819842_29819845delGAGA	uc002dut.1	+	c.49_52delGAGA	c.(49-54)GAGAGAfs	p.E17fs	BOLA2_uc010bzb.1_Intron|BOLA2_uc010bzc.1_Intron|SEZ6L2_uc002dup.2_5'Flank|SEZ6L2_uc002duq.2_5'Flank|SEZ6L2_uc002dur.2_5'Flank|SEZ6L2_uc002dus.2_5'Flank|ASPHD1_uc002duu.2_Non-coding_Transcript|ASPHD1_uc010bzi.1_Non-coding_Transcript	NM_181718	NP_859069	Q5U4P2	ASPH1_HUMAN	aspartate beta-hydroxylase domain containing 1	17_18	Cytoplasmic (Potential).				oxidation-reduction process|peptidyl-amino acid modification	integral to endoplasmic reticulum membrane	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity				0														0.60			9	6				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	29819842	29819845	1073	16	GAGA	-	-	41	41	ASPHD1	-	5	5
NCOR1	9611	broad.mit.edu	36	17	15970171	15970171	+	Frame_Shift_Del	DEL	T	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:15970171_15970171delT	uc002gpo.1	-	c.1584_1584delA	c.(1582-1584)AAAfs	p.K528fs	NCOR1_uc002gpn.1_Frame_Shift_Del_p.K528fs|NCOR1_uc002gpp.1_Frame_Shift_Del_p.K419fs|NCOR1_uc002gpr.2_Frame_Shift_Del_p.K419fs|NCOR1_uc002gps.1_Frame_Shift_Del_p.K537fs|NCOR1_uc010coz.1_Frame_Shift_Del_p.K344fs|NCOR1_uc010cpa.1_Frame_Shift_Del_p.K529fs|NCOR1_uc010cpb.1_Frame_Shift_Del_p.K538fs	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	528	Potential.				cellular lipid metabolic process|chromatin modification|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of JNK cascade|regulation of fatty acid transport|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	spindle microtubule|transcriptional repressor complex	histone deacetylase binding|promoter binding|transcription corepressor activity			ovary(1)|kidney(1)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)										0.63			17	10				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	15970171	15970171	10634	17	T	-	-	56	56	NCOR1	-	5	5
GIT1	28964	broad.mit.edu	36	17	24928085	24928087	+	In_Frame_Del	DEL	GTA	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:24928085_24928087delGTA	uc002heg.2	-	c.1174_1176delTAC	c.(1174-1176)TACdel	p.Y392del	GIT1_uc002hef.2_In_Frame_Del_p.Y383del|GIT1_uc010csb.1_In_Frame_Del_p.Y383del	NM_001085454	NP_001078923	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interactor 1	383	PTK2-binding (By similarity).				regulation of ARF GTPase activity|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|focal adhesion	ARF GTPase activator activity|protein binding|zinc ion binding				0				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		Colon(81;41 1719 20078 35068)								0.79			23	6				---	---	---	---	capture_indel			In_Frame_Del	DEL	24928085	24928087	6664	17	GTA	-	-	40	40	GIT1	-	5	5
TMEM95	339168	broad.mit.edu	36	17	7199953	7199953	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:7199953_7199953delC	uc002ggf.1	+	c.299_299delC	c.(298-300)ACCfs	p.T100fs	TMEM95_uc002ggg.1_Frame_Shift_Del_p.T100fs|TMEM95_uc002ggh.1_Frame_Shift_Del_p.T100fs	NM_198154	NP_937797	Q3KNT9	TMM95_HUMAN	transmembrane protein 95	100	Extracellular (Potential).					integral to membrane					0		Prostate(122;0.173)										OREG0024137	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.68			105	49				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	7199953	7199953	16763	17	C	-	-	18	18	TMEM95	-	5	5
ZNF492	57615	broad.mit.edu	36	19	22638485	22638486	+	Frame_Shift_Ins	INS	-	A	A			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:22638485_22638486insA	uc002nqw.2	+	c.174_175insA	c.(172-177)GGCAAAfs	p.G58fs		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	58_59					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)												0.48			10	11				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	22638485	22638486	18537	19	-	A	A	25	25	ZNF492	A	5	5
ZSCAN18	65982	broad.mit.edu	36	19	63288420	63288422	+	In_Frame_Del	DEL	TCC	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:63288420_63288422delTCC	uc002qrh.1	-	c.975_977delGGA	c.(973-978)GAGGAA>GAA	p.325_326EE>E	ZSCAN18_uc002qri.1_In_Frame_Del_p.325_326EE>E|ZSCAN18_uc002qrj.2_In_Frame_Del_p.324_325EE>E|ZSCAN18_uc002qrk.1_3'UTR|ZSCAN18_uc002qrl.1_3'UTR	NM_023926	NP_076415	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	325_326					regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)										0.59			20	14				---	---	---	---	capture_indel			In_Frame_Del	DEL	63288420	63288422	18834	19	TCC	-	-	62	62	ZSCAN18	-	5	5
RRP15	51018	broad.mit.edu	36	1	216525330	216525330	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:216525330_216525330delA	uc001hlj.1	+	c.49_49delA	c.(49-51)AAAfs	p.K17fs		NM_016052	NP_057136	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog	17						mitochondrion|nucleolus	protein binding				0				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)										0.62			42	26				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	216525330	216525330	14167	1	A	-	-	9	9	RRP15	-	5	5
RERE	473	broad.mit.edu	36	1	8342456	8342461	+	In_Frame_Del	DEL	CTCCTT	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:8342456_8342461delCTCCTT	uc001ape.1	-	c.3568_3573delAAGGAG	c.(3568-3573)AAGGAGdel	p.KE1190del	RERE_uc001apd.1_In_Frame_Del_p.KE636del|RERE_uc001apf.1_In_Frame_Del_p.KE1190del	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	1190_1191	Arg/Glu-rich (mixed charge).|Potential.				multicellular organismal development|NLS-bearing substrate import into nucleus|regulation of transcription, DNA-dependent	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)										0.57			32	24				---	---	---	---	capture_indel			In_Frame_Del	DEL	8342456	8342461	13700	1	CTCCTT	-	-	28	28	RERE	-	5	5
SLC13A3	64849	broad.mit.edu	36	20	44645661	44645663	+	In_Frame_Del	DEL	GAA	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:44645661_44645663delGAA	uc002xsf.1	-	c.1174_1176delTTC	c.(1174-1176)TTCdel	p.F392del	SLC13A3_uc002xsg.1_In_Frame_Del_p.F345del|SLC13A3_uc010gho.1_In_Frame_Del_p.F310del|SLC13A3_uc010ghn.1_In_Frame_Del_p.F361del	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a	392	Helical; (Potential).					integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)									0.61			50	32				---	---	---	---	capture_indel			In_Frame_Del	DEL	44645661	44645663	14888	20	GAA	-	-	41	41	SLC13A3	-	5	5
SCN1A	6323	broad.mit.edu	36	2	166606051	166606052	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:166606051_166606052delAA	uc010fpj.1	-	c.2317_2318delTT	c.(2317-2319)TTCfs	p.F773fs	SCN1A_uc002udo.2_Frame_Shift_Del_p.F653fs|SCN1A_uc010fpk.1_Frame_Shift_Del_p.F625fs	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	784	Helical; Name=S1 of repeat II; (By similarity).|II.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|large_intestine(1)	7					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)									0.32			24	50				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	166606051	166606052	14396	2	AA	-	-	9	9	SCN1A	-	5	5
TTN	7273	broad.mit.edu	36	2	179153150	179153151	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:179153150_179153151delAG	uc002umr.1	-	c.59405_59406delCT	c.(59404-59406)TCTfs	p.S19802fs	TTN_uc002ums.1_Frame_Shift_Del_p.S13497fs|TTN_uc010frc.1_Frame_Shift_Del_p.S13430fs|TTN_uc010frd.1_Frame_Shift_Del_p.S13305fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20729										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)							8722				0.69			59	26				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	179153150	179153151	17290	2	AG	-	-	7	7	TTN	-	5	5
HECW2	57520	broad.mit.edu	36	2	196879507	196879508	+	Frame_Shift_Ins	INS	-	G	G			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:196879507_196879508insG	uc002utm.1	-	c.2763_2764insC	c.(2761-2766)CCCGTGfs	p.P921fs	HECW2_uc002utl.1_Frame_Shift_Ins_p.P565fs	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	921_922	Interaction with TP73.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			ovary(5)|pancreas(1)|kidney(1)|central_nervous_system(1)|skin(1)	9														0.69			44	20				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	196879507	196879508	7326	2	-	G	G	19	19	HECW2	G	5	5
SP140	11262	broad.mit.edu	36	2	230867269	230867269	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:230867269_230867269delA	uc002vql.1	+	c.2008_2008delA	c.(2008-2010)AAAfs	p.K670fs	SP140_uc002vqm.1_Frame_Shift_Del_p.K610fs|SP140_uc010fxl.1_Frame_Shift_Del_p.K643fs|SP140_uc002vqn.1_Frame_Shift_Del_p.K556fs	NM_007237	NP_009168	Q13342	LY10_HUMAN	SP140 nuclear body protein isoform 1	670					defense response	cytoplasm|nuclear envelope|nucleolus|nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)						802				0.50			25	25				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	230867269	230867269	15462	2	A	-	-	9	9	SP140	-	5	5
PRR21	643905	broad.mit.edu	36	2	240630790	240630817	+	Frame_Shift_Del	DEL	GTGGGTGAAGAGGCATGGATGAAGGACT	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:240630790_240630817delGTGGGTGAAGAGGCATGGATGAAGGACT	uc002vys.1	-	c.256_283delAGTCCTTCATCCATGCCTCTTCACCCAC	c.(256-285)AGTCCTTCATCCATGCCTCTTCACCCACGGfs	p.S86fs		NM_001080835	NP_001074304	Q8WXC7	PRR21_HUMAN	hypothetical protein LOC643905	86_95	Pro-rich.									ovary(1)	1														0.42			25	34				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	240630790	240630817	13040	2	GTGGGTGAAGAGGCATGGATGAAGGACT	-	-	40	40	PRR21	-	5	5
ASAP2	8853	broad.mit.edu	36	2	9458922	9458924	+	In_Frame_Del	DEL	CTT	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:9458922_9458924delCTT	uc002qzh.1	+	c.2892_2894delCTT	c.(2890-2895)ACCTTC>ACC	p.F965del	ASAP2_uc002qzi.1_In_Frame_Del_p.F920del	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH	965	SH3.				regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0														0.68			36	17				---	---	---	---	capture_indel			In_Frame_Del	DEL	9458922	9458924	1029	2	CTT	-	-	24	24	ASAP2	-	5	5
ASB5	140458	broad.mit.edu	36	4	177427173	177427177	+	Frame_Shift_Del	DEL	AAAAC	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:177427173_177427177delAAAAC	uc003iuq.1	-	c.77_81delGTTTT	c.(76-81)TGTTTTfs	p.C26fs		NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein	26_27					intracellular signal transduction						0		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)										0.66			56	29				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	177427173	177427177	1044	4	AAAAC	-	-	13	13	ASB5	-	5	5
FRYL	285527	broad.mit.edu	36	4	48254345	48254350	+	In_Frame_Del	DEL	TCATCT	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:48254345_48254350delTCATCT	uc003gyh.1	-	c.4002_4007delAGATGA	c.(4000-4008)GAAGATGAT>GAT	p.ED1334del	FRYL_uc003gyg.1_In_Frame_Del_p.ED30del|FRYL_uc003gyi.1_In_Frame_Del_p.ED223del|FRYL_uc003gyk.1_In_Frame_Del_p.ED1334del	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	1334_1335					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1														0.50			112	110				---	---	---	---	capture_indel			In_Frame_Del	DEL	48254345	48254350	6314	4	TCATCT	-	-	50	50	FRYL	-	5	5
VCAN	1462	broad.mit.edu	36	5	82872854	82872856	+	In_Frame_Del	DEL	CTT	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:82872854_82872856delCTT	uc003kii.2	+	c.8276_8278delCTT	c.(8275-8280)CCTTCT>CCT	p.S2760del	VCAN_uc003kik.2_Intron|VCAN_uc010jau.1_Intron|VCAN_uc003kij.2_In_Frame_Del_p.S1773del|VCAN_uc003kil.2_In_Frame_Del_p.S1424del	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1	2760	GAG-beta.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(3)|lung(2)|central_nervous_system(1)	13		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)										0.55			56	46				---	---	---	---	capture_indel			In_Frame_Del	DEL	82872854	82872856	17703	5	CTT	-	-	24	24	VCAN	-	5	5
AGER	177	broad.mit.edu	36	6	32258346	32258347	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:32258346_32258347delGA	uc003oap.1	-	c.846_847delTC	c.(844-849)TCTCCTfs	p.S282fs	AGER_uc003oak.1_5'UTR|AGER_uc003oal.1_Frame_Shift_Del_p.S266fs|AGER_uc003oau.1_Frame_Shift_Del_p.S266fs|AGER_uc010jtv.1_Frame_Shift_Del_p.S266fs|AGER_uc003oam.1_Non-coding_Transcript|AGER_uc003oan.1_Frame_Shift_Del_p.S252fs|AGER_uc003oao.1_Non-coding_Transcript|AGER_uc003oaq.1_Frame_Shift_Del_p.S252fs|AGER_uc010jtw.1_Non-coding_Transcript|AGER_uc003oar.1_Frame_Shift_Del_p.S165fs|AGER_uc003oas.1_Frame_Shift_Del_p.S266fs|AGER_uc003oat.1_Frame_Shift_Del_p.S282fs	NM_001136	NP_001127	Q15109	RAGE_HUMAN	advanced glycosylation end product-specific	266_267	Extracellular (Potential).|Ig-like C2-type 2.				cell surface receptor linked signaling pathway|inflammatory response|innate immune response|neuron projection development|positive regulation of NF-kappaB transcription factor activity	integral to plasma membrane	S100 alpha binding|transmembrane receptor activity			breast(1)	1														0.68			142	68				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	32258346	32258347	382	6	GA	-	-	41	41	AGER	-	5	5
SPDEF	25803	broad.mit.edu	36	6	34615009	34615011	+	In_Frame_Del	DEL	CTC	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:34615009_34615011delCTC	uc003ojq.1	-	c.823_825delGAG	c.(823-825)GAGdel	p.E275del		NM_012391	NP_036523	O95238	SPDEF_HUMAN	SAM pointed domain containing ets transcription	275	ETS.				negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of survival gene product expression	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(3)|ovary(1)|central_nervous_system(1)	5														0.73			160	59				---	---	---	---	capture_indel			In_Frame_Del	DEL	34615009	34615011	15536	6	CTC	-	-	32	32	SPDEF	-	5	5
C6orf89	221477	broad.mit.edu	36	6	36975348	36975349	+	Frame_Shift_Ins	INS	-	C	C			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:36975348_36975349insC	uc003omw.1	+	c.171_172insC	c.(169-174)AGACCCfs	p.R57fs	C6orf89_uc003omv.1_5'UTR|C6orf89_uc003omx.1_Frame_Shift_Ins_p.R50fs	NM_152734	NP_689947	Q6UWU4	CF089_HUMAN	hypothetical protein LOC221477	50_51						integral to membrane				ovary(1)	1														0.45			22	27				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	36975348	36975349	2479	6	-	C	C	10	10	C6orf89	C	5	5
PRPF4B	8899	broad.mit.edu	36	6	3976880	3976880	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:3976880_3976880delA	uc003mvv.1	+	c.130_130delA	c.(130-132)AAAfs	p.K44fs		NM_003913	NP_003904	Q13523	PRP4B_HUMAN	serine/threonine-protein kinase PRP4K	44	His-rich.|Arg/Lys-rich (basic).				nuclear mRNA splicing, via spliceosome|protein phosphorylation	catalytic step 2 spliceosome	ATP binding|protein binding|protein serine/threonine kinase activity			breast(4)	4	Ovarian(93;0.0925)	all_hematologic(90;0.0895)								298				0.32			16	34				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	3976880	3976880	13016	6	A	-	-	5	5	PRPF4B	-	5	5
EMID2	136227	broad.mit.edu	36	7	100974035	100974036	+	Frame_Shift_Ins	INS	-	CC	CC			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:100974035_100974036insCC	uc010lhy.1	+	c.635_636insCC	c.(634-636)GGCfs	p.G212fs	EMID2_uc003uyo.1_Frame_Shift_Ins_p.G214fs	NM_133457	NP_597714	Q96A83	EMID2_HUMAN	EMI domain containing 2	214	Collagen-like 1.					collagen				ovary(1)	1	Lung NSC(181;0.215)													0.35			9	17				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	100974035	100974036	5284	7	-	CC	CC	42	42	EMID2	CC	5	5
C7orf60	154743	broad.mit.edu	36	7	112249512	112249514	+	In_Frame_Del	DEL	AAG	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:112249512_112249514delAAG	uc003vgo.1	-	c.739_741delCTT	c.(739-741)CTTdel	p.L247del		NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN	hypothetical protein LOC154743	247										ovary(2)	2														0.43			46	61				---	---	---	---	capture_indel			In_Frame_Del	DEL	112249512	112249514	2514	7	AAG	-	-	1	1	C7orf60	-	5	5
ZC3HAV1	56829	broad.mit.edu	36	7	138424919	138424919	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:138424919_138424919delA	uc003vun.1	-	c.435_435delT	c.(433-435)TTTfs	p.F145fs	ZC3HAV1_uc003vup.1_Frame_Shift_Del_p.F145fs	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1	145					response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1														0.33			40	81				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	138424919	138424919	18163	7	A	-	-	13	13	ZC3HAV1	-	5	5
WIPI2	26100	broad.mit.edu	36	7	5223261	5223264	+	Frame_Shift_Del	DEL	TCAA	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:5223261_5223264delTCAA	uc003snv.1	+	c.493_496delTCAA	c.(493-498)TCAATCfs	p.S165fs	WIPI2_uc003snw.1_Frame_Shift_Del_p.S165fs|WIPI2_uc003snx.1_Frame_Shift_Del_p.S147fs|WIPI2_uc003sny.1_Frame_Shift_Del_p.S147fs|WIPI2_uc010ksv.1_Frame_Shift_Del_p.S21fs|WIPI2_uc003snz.2_Frame_Shift_Del_p.S106fs|WIPI2_uc003soa.1_Frame_Shift_Del_p.S106fs	NM_015610	NP_056425	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2	165_166					autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding			ovary(2)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)										0.62			64	40				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	5223261	5223264	17945	7	TCAA	-	-	58	58	WIPI2	-	5	5
HIP1	3092	broad.mit.edu	36	7	75021345	75021346	+	Splice_Site_Del	DEL	CA	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:75021345_75021346delCA	uc003uds.1	-	c.e21_splice_site				NM_005338	NP_005329			huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			pancreas(2)|ovary(1)|central_nervous_system(1)	4										1179				0.37			23	40				---	---	---	---	capture_indel			Splice_Site_Del	DEL	75021345	75021346	7399	7	CA	-	-	29	29	HIP1	-	5	5
XKR9	389668	broad.mit.edu	36	8	71755940	71755941	+	Frame_Shift_Ins	INS	-	T	T			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:71755940_71755941insT	uc003xyq.1	+	c.93_94insT	c.(91-96)AGATTTfs	p.R31fs	XKR9_uc010lzd.1_5'UTR|XKR9_uc010lze.1_Frame_Shift_Ins_p.R31fs	NM_001011720	NP_001011720	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related	31_32						integral to membrane				ovary(1)	1	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)											0.63			168	99				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	71755940	71755941	18019	8	-	T	T	12	12	XKR9	T	5	5
C9orf150	286343	broad.mit.edu	36	9	12765861	12765862	+	In_Frame_Ins	INS	-	GGCGGCGGC	GGCGGCGGC			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:12765861_12765862insGGCGGCGGC	uc003zkw.1	+	c.147_148insGGCGGCGGC	c.(145-150)insGGCGGCGGC	p.55_56insGGG		NM_203403	NP_981948	Q8IV03	CI150_HUMAN	hypothetical protein LOC286343	58_59	Gly-rich.										0				GBM - Glioblastoma multiforme(1;1.64e-13)										0.40			6	9				---	---	---	---	capture_indel			In_Frame_Ins	INS	12765861	12765862	2576	9	-	GGCGGCGGC	GGCGGCGGC	59	59	C9orf150	GGCGGCGGC	5	5
RFX3	5991	broad.mit.edu	36	9	3215248	3215251	+	Frame_Shift_Del	DEL	CATC	-	-			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:3215248_3215251delCATC	uc003zhr.1	-	c.2041_2044delGATG	c.(2041-2046)GATGAAfs	p.D681fs	RFX3_uc010mhd.1_Frame_Shift_Del_p.D681fs	NM_134428	NP_602304	P48380	RFX3_HUMAN	regulatory factor X3 isoform b	681_682					cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin|transcription factor complex	promoter binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription activator activity|transcription repressor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)										0.58			26	19				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	3215248	3215251	13736	9	CATC	-	-	29	29	RFX3	-	5	5
C1GALT1C1	29071	broad.mit.edu	36	X	119644567	119644568	+	Frame_Shift_Ins	INS	-	T	T			TCGA-19-1787-01	TCGA-19-1787-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:119644567_119644568insT	uc004esy.1	-	c.482_483insA	c.(481-483)AAGfs	p.K161fs	C1GALT1C1_uc004esz.1_Frame_Shift_Ins_p.K161fs|C1GALT1C1_uc010nqr.1_Frame_Shift_Ins_p.K161fs	NM_152692	NP_689905	Q96EU7	C1GLC_HUMAN	C1GALT1-specific chaperone 1	161	Lumenal (Potential).					integral to membrane					0														0.78			108	30				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	119644567	119644568	2020	23	-	T	T	24	24	C1GALT1C1	T	5	5
