Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
IGSF22	283284	broad.mit.edu	36	11	18692153	18692153	+	Silent	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:18692153C>T	uc009yht.1	-	c.1917G>A	c.(1915-1917)GTG>GTA	p.V639V	IGSF22_uc001mpa.2_Silent_p.V639V	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	639	Ig-like 4.									ovary(4)|large_intestine(2)|kidney(1)	7														0.423913	219.391495	220.32537	78	106	CC		KEEP	---	---	---	---	capture			Silent	SNP	18692153	18692153	7901	11	C	T	T	29	29	IGSF22	T	2	2
IFITM3	10410	broad.mit.edu	36	11	309848	309848	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:309848G>A	uc001lpa.2	-	c.392C>T	c.(391-393)GCC>GTC	p.A131V		NM_021034	NP_066362	Q01628	IFM3_HUMAN	interferon-induced transmembrane protein 3	131	Extracellular (Potential).				response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane				central_nervous_system(7)	7		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)										0.15	6.652684	13.705576	9	51	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	309848	309848	7829	11	G	A	A	42	42	IFITM3	A	2	2
OR2D2	120776	broad.mit.edu	36	11	6869630	6869630	+	Silent	SNP	G	T	T			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:6869630G>T	uc001mew.1	-	c.678C>A	c.(676-678)GTC>GTA	p.V226V		NM_003700	NP_003691	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D,	226	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)										0.276923	188.872952	200.529602	72	188	GG		KEEP	---	---	---	---	capture			Silent	SNP	6869630	6869630	11400	11	G	T	T	45	45	OR2D2	T	3	3
RBMXL2	27288	broad.mit.edu	36	11	7067823	7067823	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:7067823C>A	uc001mfc.2	+	c.896C>A	c.(895-897)CCG>CAG	p.P299Q		NM_014469	NP_055284	O75526	HNRGT_HUMAN	testes-specific heterogenous nuclear	299	Arg/Gly/Pro-rich.					nucleus|ribonucleoprotein complex	nucleotide binding|RNA binding				0				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)										0.473684	26.07146	26.082712	9	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7067823	7067823	13616	11	C	A	A	23	23	RBMXL2	A	3	3
FOLH1B	219595	broad.mit.edu	36	11	89053456	89053456	+	Silent	SNP	A	G	G			TCGA-19-1791-01	TCGA-19-1791-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:89053456A>G	uc001pda.1	+	c.480A>G	c.(478-480)CCA>CCG	p.P160P		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	hypothetical protein LOC219595	160					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|central_nervous_system(1)	4														0.190476	9.888374	11.768389	4	17	AA		KEEP	---	---	---	---	capture			Silent	SNP	89053456	89053456	6222	11	A	G	G	6	6	FOLH1B	G	4	4
GALNT9	50614	broad.mit.edu	36	12	131247617	131247617	+	Silent	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:131247617G>A	uc001ukc.2	-	c.1800C>T	c.(1798-1800)CAC>CAT	p.H600H	GALNT9_uc009zyr.1_Silent_p.H374H|GALNT9_uc001ukb.1_Silent_p.H457H|GALNT9_uc001uka.1_Silent_p.H234H	NM_001122636	NP_001116108	Q9HCQ5	GALT9_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	600	Ricin B-type lectin.|Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		Colon(186;2147 2752 13553 41466)								0.777778	21.327084	21.965904	7	2	GG		KEEP	---	---	---	---	capture			Silent	SNP	131247617	131247617	6484	12	G	A	A	40	40	GALNT9	A	1	1
AKAP3	10566	broad.mit.edu	36	12	4607978	4607978	+	Silent	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:4607978G>A	uc001qnb.2	-	c.351C>T	c.(349-351)AAC>AAT	p.N117N		NM_006422	NP_006413	O75969	AKAP3_HUMAN	A-kinase anchor protein 3	117					acrosome reaction|cellular component movement	acrosomal vesicle	protein kinase A binding			skin(2)|large_intestine(1)|ovary(1)|kidney(1)	5														0.519824	358.154637	358.233548	118	109	GG		KEEP	---	---	---	---	capture			Silent	SNP	4607978	4607978	455	12	G	A	A	40	40	AKAP3	A	1	1
USP5	8078	broad.mit.edu	36	12	6844667	6844667	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1791-01	TCGA-19-1791-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:6844667A>T	uc001qri.2	+	c.2477A>T	c.(2476-2478)GAA>GTA	p.E826V	USP5_uc001qrh.2_Missense_Mutation_p.E803V|TPI1_uc001qrk.1_5'Flank	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1	826					positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding				0														0.2	13.412862	17.613947	10	40	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6844667	6844667	17645	12	A	T	T	9	9	USP5	T	4	4
SACS	26278	broad.mit.edu	36	13	22812686	22812686	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1791-01	TCGA-19-1791-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:22812686A>C	uc001uon.2	-	c.3329T>G	c.(3328-3330)ATT>AGT	p.I1110S	SACS_uc001uoo.2_Missense_Mutation_p.I963S|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1110					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)|skin(1)	11		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)						738				0.429787	305.46465	306.485036	101	134	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22812686	22812686	14284	13	A	C	C	4	4	SACS	C	4	4
TEP1	7011	broad.mit.edu	36	14	19919551	19919551	+	Splice_Site_SNP	SNP	C	A	A			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:19919551C>A	uc001vxe.1	-	c.e31_splice_site			TEP1_uc010ahk.1_Splice_Site_SNP	NM_007110	NP_009041			telomerase-associated protein 1						telomere maintenance via recombination|telomere maintenance via telomerase	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)										0.785714	412.332553	423.939038	121	33	CC		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	19919551	19919551	16286	14	C	A	A	18	18	TEP1	A	5	3
EIF2B2	8892	broad.mit.edu	36	14	74541263	74541264	+	Missense_Mutation	DNP	TG	AA	AA			TCGA-19-1791-01	TCGA-19-1791-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:74541263_74541264TG>AA	uc001xrc.1	+	c.504_505TG>AA	c.(502-507)ATTGGC>ATAAGC	p.G169S		NM_014239	NP_055054	P49770	EI2BB_HUMAN	eukaryotic translation initiation factor 2B,	169					cellular response to stimulus|myelination|oligodendrocyte development|ovarian follicle development|regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	ATP binding|GTP binding|protein binding|translation initiation factor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00661)										0.162791	7.799886	12.453786	7	36	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	74541263	74541264	5190	14	TG	AA	AA	63	63	EIF2B2	AA	4	4
PLA2G4D	283748	broad.mit.edu	36	15	40159221	40159221	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:40159221C>T	uc001zox.1	-	c.1123G>A	c.(1123-1125)GAG>AAG	p.E375K		NM_178034	NP_828848	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD	375	PLA2c.				phospholipid catabolic process	cytoplasmic vesicle membrane|cytosol	metal ion binding|phospholipase A2 activity			large_intestine(1)	1		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)										0.227273	61.216164	68.726768	25	85	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40159221	40159221	12430	15	C	T	T	29	29	PLA2G4D	T	2	2
CNGB1	1258	broad.mit.edu	36	16	56555946	56555946	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:56555946G>T	uc002emt.1	-	c.163C>A	c.(163-165)CCC>ACC	p.P55T	CNGB1_uc010cdh.1_Missense_Mutation_p.P55T|CNGB1_uc002emu.1_Missense_Mutation_p.P55T	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform	55	Glu-rich.				sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						Colon(156;1293 1853 16336 28962 38659)								0.333333	77.748511	79.826799	28	56	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	56555946	56555946	3738	16	G	T	T	43	43	CNGB1	T	3	3
SP2	6668	broad.mit.edu	36	17	43357798	43357798	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:43357798C>A	uc002imk.1	+	c.1633C>A	c.(1633-1635)CAT>AAT	p.H545N	SP2_uc002iml.1_Missense_Mutation_p.H538N|SP2_uc002imn.1_Missense_Mutation_p.H60N	NM_003110	NP_003101	Q02086	SP2_HUMAN	Sp2 transcription factor	545	C2H2-type 1.				immune response|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|histone deacetylase binding|RNA polymerase II transcription factor activity|zinc ion binding				0														0.578947	204.923623	205.538995	66	48	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43357798	43357798	15464	17	C	A	A	21	21	SP2	A	3	3
GPRC5C	55890	broad.mit.edu	36	17	69954750	69954750	+	Silent	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:69954750C>T	uc002jkp.1	+	c.1449C>T	c.(1447-1449)TAC>TAT	p.Y483Y	GPRC5C_uc002jkq.1_3'UTR|GPRC5C_uc002jkr.1_Silent_p.Y450Y|GPRC5C_uc002jks.1_Silent_p.Y438Y|GPRC5C_uc002jkt.2_Intron|GPRC5C_uc002jku.2_Intron	NM_022036	NP_071319	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,	438	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.121622	22.963522	43.711973	18	130	CC		KEEP	---	---	---	---	capture			Silent	SNP	69954750	69954750	7002	17	C	T	T	19	19	GPRC5C	T	1	1
FOXK2	3607	broad.mit.edu	36	17	78135203	78135203	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:78135203G>A	uc002kfn.1	+	c.1129G>A	c.(1129-1131)GCG>ACG	p.A377T	FOXK2_uc002kfm.1_Missense_Mutation_p.A377T|FOXK2_uc010diu.1_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2	377					embryo development|negative regulation of gene-specific transcription from RNA polymerase II promoter|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)											0.6	30.276981	30.407956	9	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	78135203	78135203	6261	17	G	A	A	38	38	FOXK2	A	1	1
MOCOS	55034	broad.mit.edu	36	18	32049560	32049560	+	Silent	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:32049560G>A	uc002kzq.2	+	c.1419G>A	c.(1417-1419)TCG>TCA	p.S473S		NM_017947	NP_060417	Q96EN8	MOCOS_HUMAN	molybdenum cofactor sulfurase	473					Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)									0.5625	229.000322	229.434647	72	56	GG		KEEP	---	---	---	---	capture			Silent	SNP	32049560	32049560	10080	18	G	A	A	37	37	MOCOS	A	1	1
DLGAP1	9229	broad.mit.edu	36	18	3498653	3498653	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:3498653C>G	uc002kmf.1	-	c.2486G>C	c.(2485-2487)GGA>GCA	p.G829A	DLGAP1_uc002kme.1_Missense_Mutation_p.G527A|DLGAP1_uc002kmg.2_Missense_Mutation_p.G527A	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform	829					synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)												0.471014	208.054352	208.154238	65	73	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3498653	3498653	4739	18	C	G	G	30	30	DLGAP1	G	3	3
TMPRSS9	360200	broad.mit.edu	36	19	2350177	2350177	+	Nonsense_Mutation	SNP	C	A	A			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:2350177C>A	uc002lvw.1	+	c.398C>A	c.(397-399)TCG>TAG	p.S133*	TMPRSS9_uc002lvv.1_Nonsense_Mutation_p.S167*	NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	133	Extracellular (Potential).				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.742857	79.756292	81.628852	26	9	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	2350177	2350177	16794	19	C	A	A	31	31	TMPRSS9	A	5	3
UBA2	10054	broad.mit.edu	36	19	39651878	39651878	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:39651878G>A	uc002nvk.1	+	c.1835G>A	c.(1834-1836)AGG>AAG	p.R612K	UBA2_uc002nvl.1_Missense_Mutation_p.R516K	NM_005499	NP_005490	Q9UBT2	SAE2_HUMAN	SUMO-1 activating enzyme subunit 2	612					protein sumoylation	nucleus	ATP binding|enzyme activator activity|ligase activity|metal ion binding|protein heterodimerization activity|SUMO activating enzyme activity			ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)											0.148148	8.784694	11.99068	4	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39651878	39651878	17385	19	G	A	A	35	35	UBA2	A	2	2
NUMBL	9253	broad.mit.edu	36	19	45865577	45865577	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:45865577G>T	uc002oon.1	-	c.1466C>A	c.(1465-1467)CCT>CAT	p.P489H	NUMBL_uc002ooo.1_Missense_Mutation_p.P488H	NM_004756	NP_004747	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	489					cytokine-mediated signaling pathway|lateral ventricle development|neuroblast division in subventricular zone|protein metabolic process	cytoplasm	protein binding			ovary(1)	1			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)											0.75	21.654136	22.108788	6	2	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45865577	45865577	11157	19	G	T	T	35	35	NUMBL	T	3	3
CD101	9398	broad.mit.edu	36	1	117361242	117361242	+	Silent	SNP	T	C	C			TCGA-19-1791-01	TCGA-19-1791-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:117361242T>C	uc009whd.1	+	c.1236T>C	c.(1234-1236)AGT>AGC	p.S412S		NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2	412	Extracellular (Potential).|Ig-like C2-type 4.				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(1)	1														0.461538	165.54507	165.703382	54	63	TT		KEEP	---	---	---	---	capture			Silent	SNP	117361242	117361242	3089	1	T	C	C	59	59	CD101	C	4	4
MIIP	60672	broad.mit.edu	36	1	12005036	12005036	+	Nonsense_Mutation	SNP	G	T	T			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:12005036G>T	uc001ato.1	+	c.412G>T	c.(412-414)GAG>TAG	p.E138*	MIIP_uc009vnj.1_5'Flank	NM_021933	NP_068752	Q5JXC2	MIIP_HUMAN	invasion inhibitory protein 45	138										ovary(1)	1														0.733333	66.244931	67.717868	22	8	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	12005036	12005036	9975	1	G	T	T	41	41	MIIP	T	5	3
PRAMEF12	390999	broad.mit.edu	36	1	12757850	12757850	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:12757850C>T	uc001aui.1	+	c.253C>T	c.(253-255)CTT>TTT	p.L85F		NM_001080830	NP_001074299	O95522	PRA12_HUMAN	PRAME family member 12	85										ovary(3)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)										0.264368	111.329872	120.031049	46	128	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12757850	12757850	12864	1	C	T	T	28	28	PRAMEF12	T	2	2
FLG	2312	broad.mit.edu	36	1	150549282	150549282	+	Silent	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150549282G>A	uc001ezu.1	-	c.4704C>T	c.(4702-4704)GCC>GCT	p.A1568A		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1568	Ser-rich.|Filaggrin 9.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)	9	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.272189	123.100134	130.992904	46	123	GG		KEEP	---	---	---	---	capture			Silent	SNP	150549282	150549282	6160	1	G	A	A	39	39	FLG	A	1	1
OLFML2B	25903	broad.mit.edu	36	1	160234539	160234539	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:160234539C>T	uc001gbu.1	-	c.1174G>A	c.(1174-1176)GGA>AGA	p.G392R		NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	392											0	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)											0.854015	392.925678	409.421678	117	20	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	160234539	160234539	11263	1	C	T	T	22	22	OLFML2B	T	2	2
ZFYVE9	9372	broad.mit.edu	36	1	52477093	52477093	+	Silent	SNP	T	C	C			TCGA-19-1791-01	TCGA-19-1791-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:52477093T>C	uc001cto.1	+	c.1416T>C	c.(1414-1416)AAT>AAC	p.N472N	ZFYVE9_uc001ctn.1_Silent_p.N472N|ZFYVE9_uc001ctp.1_Silent_p.N472N	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	472					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor complex assembly	early endosome membrane	protein binding|receptor activity|serine-type peptidase activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(2)	6										498				0.506173	274.047676	274.053115	82	80	TT		KEEP	---	---	---	---	capture			Silent	SNP	52477093	52477093	18261	1	T	C	C	52	52	ZFYVE9	C	4	4
CHD5	26038	broad.mit.edu	36	1	6111232	6111232	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:6111232G>A	uc001amb.1	-	c.3644C>T	c.(3643-3645)CCG>CTG	p.P1215L	CHD5_uc001alz.1_Missense_Mutation_p.P72L|CHD5_uc001ama.1_Non-coding_Transcript|CHD5_uc001amc.1_Non-coding_Transcript|CHD5_uc009vlx.1_Non-coding_Transcript	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	1215					chromatin assembly or disassembly|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin|nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|zinc ion binding			breast(3)|central_nervous_system(3)|ovary(1)|lung(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)						2304				0.384615	16.492764	16.636793	5	8	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6111232	6111232	3462	1	G	A	A	39	39	CHD5	A	1	1
DDAH1	23576	broad.mit.edu	36	1	85597018	85597018	+	Splice_Site_SNP	SNP	C	G	G			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:85597018C>G	uc001dlb.1	-	c.e2_splice_site			DDAH1_uc009wco.1_Splice_Site_SNP|DDAH1_uc001dlc.1_Splice_Site_SNP	NM_012137	NP_036269			dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)									0.34375	26.81239	27.503676	11	21	CC		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	85597018	85597018	4492	1	C	G	G	18	18	DDAH1	G	5	3
COMMD7	149951	broad.mit.edu	36	20	30756286	30756286	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1791-01	TCGA-19-1791-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:30756286T>G	uc002wyb.2	-	c.418A>C	c.(418-420)AAA>CAA	p.K140Q	COMMD7_uc002wya.2_Missense_Mutation_p.K140Q|COMMD7_uc010ged.1_Missense_Mutation_p.K139Q	NM_053041	NP_444269	Q86VX2	COMD7_HUMAN	COMM domain containing 7 isoform 1	140	COMM.				negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|tumor necrosis factor-mediated signaling pathway		NF-kappaB binding			breast(1)	1														0.468571	275.042543	275.192172	82	93	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30756286	30756286	3859	20	T	G	G	62	62	COMMD7	G	4	4
KCNS1	3787	broad.mit.edu	36	20	43159876	43159876	+	Silent	SNP	A	G	G			TCGA-19-1791-01	TCGA-19-1791-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr20:43159876A>G	uc002xnc.1	-	c.951T>C	c.(949-951)TAT>TAC	p.Y317Y	KCNS1_uc002xnd.1_Silent_p.Y317Y	NM_002251	NP_002242	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel	317	Helical; Name=Segment S3; (Potential).					voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity|protein binding				0		Myeloproliferative disorder(115;0.0122)												0.3125	8.561363	9.06686	5	11	AA		KEEP	---	---	---	---	capture			Silent	SNP	43159876	43159876	8393	20	A	G	G	12	12	KCNS1	G	4	4
ZNF280B	140883	broad.mit.edu	36	22	21172452	21172452	+	Silent	SNP	C	G	G			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:21172452C>G	uc002zwc.1	-	c.1272G>C	c.(1270-1272)ACG>ACC	p.T424T	ZNF280B_uc010gtp.1_Silent_p.T424T	NM_080764	NP_542942	Q86YH2	Z280B_HUMAN	zinc finger protein 280B	424					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)										0.753968	328.574403	335.991149	95	31	CC		KEEP	---	---	---	---	capture			Silent	SNP	21172452	21172452	18407	22	C	G	G	19	19	ZNF280B	G	3	3
SUSD2	56241	broad.mit.edu	36	22	22911529	22911529	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:22911529G>T	uc002zzn.1	+	c.1060G>T	c.(1060-1062)GTG>TTG	p.V354L		NM_019601	NP_062547	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	354	AMOP.|Extracellular (Potential).				immune response	integral to membrane	polysaccharide binding|protein binding|scavenger receptor activity				0														1	11.047637	10.929714	3	0	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22911529	22911529	15928	22	G	T	T	48	48	SUSD2	T	3	3
NFAM1	150372	broad.mit.edu	36	22	41123895	41123895	+	Silent	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:41123895C>T	uc003bcn.2	-	c.576G>A	c.(574-576)CGG>CGA	p.R192R		NM_145912	NP_666017	Q8NET5	NFAM1_HUMAN	NFAT activation molecule 1 precursor	192	Cytoplasmic (Potential).				B cell differentiation|inflammatory response|intracellular signal transduction|positive regulation of B cell receptor signaling pathway|positive regulation of cytokine production|positive regulation of sequence-specific DNA binding transcription factor activity	integral to membrane|plasma membrane	transmembrane receptor activity				0														0.608696	42.748002	42.98496	14	9	CC		KEEP	---	---	---	---	capture			Silent	SNP	41123895	41123895	10758	22	C	T	T	22	22	NFAM1	T	2	2
GAL3ST2	64090	broad.mit.edu	36	2	242389992	242389992	+	Silent	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:242389992C>T	uc002wcj.1	+	c.243C>T	c.(241-243)TCC>TCT	p.S81S		NM_022134	NP_071417	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	81	Lumenal (Potential).				biosynthetic process	Golgi cisterna membrane|integral to membrane	galactosylceramide sulfotransferase activity				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)										0.48	37.5453	37.550489	12	13	CC		KEEP	---	---	---	---	capture			Silent	SNP	242389992	242389992	6462	2	C	T	T	23	23	GAL3ST2	T	1	1
SPTBN1	6711	broad.mit.edu	36	2	54734310	54734311	+	Missense_Mutation	DNP	GA	TG	TG			TCGA-19-1791-01	TCGA-19-1791-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:54734310_54734311GA>TG	uc002rxu.1	+	c.5638_5639GA>TG	c.(5638-5640)GAC>TGC	p.D1880C	SPTBN1_uc002rxx.1_Missense_Mutation_p.D1867C|SPTBN1_uc002rxy.1_Missense_Mutation_p.D25C	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	1880	Interaction with ANK2.|Spectrin 15.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(2)|breast(2)|central_nervous_system(2)	6			Lung(47;0.24)											0.184211	8.703818	12.264376	7	31	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	54734310	54734311	15633	2	GA	TG	TG	37	37	SPTBN1	TG	3	3
TMPRSS7	344805	broad.mit.edu	36	3	113267933	113267933	+	Silent	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:113267933C>T	uc010hqb.1	+	c.1182C>T	c.(1180-1182)AGC>AGT	p.S394S	TMPRSS7_uc003dyp.1_Silent_p.S249S	NM_001042575	NP_001036040	Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	520	Extracellular (Potential).|LDL-receptor class A 2.				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2														0.354839	29.002047	29.583332	11	20	CC		KEEP	---	---	---	---	capture			Silent	SNP	113267933	113267933	16793	3	C	T	T	26	26	TMPRSS7	T	2	2
IQSEC1	9922	broad.mit.edu	36	3	12952452	12952452	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1791-01	TCGA-19-1791-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr3:12952452T>C	uc003bxt.1	-	c.1106A>G	c.(1105-1107)GAG>GGG	p.E369G	IQSEC1_uc003bxu.2_Missense_Mutation_p.E247G	NM_014869	NP_055684	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1 isoform b	369					regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1														0.428571	6.547728	6.592364	3	4	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12952452	12952452	8120	3	T	C	C	54	54	IQSEC1	C	4	4
OSBPL10	114884	broad.mit.edu	36	3	31687376	31687376	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1791-01	TCGA-19-1791-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr3:31687376T>G	uc003cev.1	-	c.1830A>C	c.(1828-1830)AAA>AAC	p.K610N	OSBPL10_uc003ceu.1_Missense_Mutation_p.K367N	NM_017784	NP_060254	Q9BXB5	OSB10_HUMAN	oxysterol-binding protein-like protein 10	610					lipid transport		lipid binding				0				STAD - Stomach adenocarcinoma(1;0.00406)										0.278539	148.924888	158.637852	61	158	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31687376	31687376	11686	3	T	G	G	56	56	OSBPL10	G	4	4
XIRP1	165904	broad.mit.edu	36	3	39201638	39201638	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:39201638G>A	uc003cjk.1	-	c.4303C>T	c.(4303-4305)CCC>TCC	p.P1435S	XIRP1_uc003cji.2_3'UTR|XIRP1_uc003cjj.2_Missense_Mutation_p.P118S|XIRP1_uc010hhp.1_Missense_Mutation_p.P1435S	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1435							actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)										0.333333	16.146121	16.587873	6	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39201638	39201638	18010	3	G	A	A	41	41	XIRP1	A	2	2
COL7A1	1294	broad.mit.edu	36	3	48601792	48601792	+	Silent	SNP	C	G	G			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:48601792C>G	uc003ctz.2	-	c.2286G>C	c.(2284-2286)GGG>GGC	p.G762G		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	762	Nonhelical region (NC1).|Fibronectin type-III 6.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(2)	9				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)										0.230769	7.432328	8.286147	3	10	CC		KEEP	---	---	---	---	capture			Silent	SNP	48601792	48601792	3842	3	C	G	G	26	26	COL7A1	G	3	3
USP53	54532	broad.mit.edu	36	4	120412202	120412202	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:120412202G>A	uc003ics.2	+	c.1739G>A	c.(1738-1740)CGG>CAG	p.R580Q	USP53_uc003icr.2_Missense_Mutation_p.R580Q|USP53_uc003icu.2_Missense_Mutation_p.R203Q|USP53_uc003ict.2_Missense_Mutation_p.R203Q	NM_019050	NP_061923	Q70EK8	UBP53_HUMAN	ubiquitin specific protease 53	580					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			ovary(1)|breast(1)|kidney(1)	3														0.382979	54.243144	54.805804	18	29	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	120412202	120412202	17648	4	G	A	A	39	39	USP53	A	1	1
CYP4V2	285440	broad.mit.edu	36	4	187367120	187367120	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:187367120C>T	uc003iyw.2	+	c.1198C>T	c.(1198-1200)CGT>TGT	p.R400C	CYP4V2_uc010ism.1_Non-coding_Transcript	NM_207352	NP_997235	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily v,	400					oxidation-reduction process|response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity				0		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)										0.5125	131.548559	131.55877	41	39	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	187367120	187367120	4357	4	C	T	T	23	23	CYP4V2	T	1	1
KCNMB1	3779	broad.mit.edu	36	5	169738395	169738395	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:169738395G>A	uc003maq.1	-	c.467C>T	c.(466-468)GCC>GTC	p.A156V	KCNIP1_uc003map.1_Intron	NM_004137	NP_004128	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated	156	Extracellular (Potential).				platelet activation|synaptic transmission		calcium-activated potassium channel activity|potassium channel regulator activity			ovary(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)										0.552632	59.972391	60.06411	21	17	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	169738395	169738395	8379	5	G	A	A	42	42	KCNMB1	A	2	2
ADAMTS12	81792	broad.mit.edu	36	5	33612201	33612201	+	Silent	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:33612201G>A	uc003jia.1	-	c.3687C>T	c.(3685-3687)TCC>TCT	p.S1229S	ADAMTS12_uc010iuq.1_Silent_p.S1144S	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1229	Spacer 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|lung(1)|kidney(1)|skin(1)	7														0.567742	266.001388	266.62399	88	67	GG		KEEP	---	---	---	---	capture			Silent	SNP	33612201	33612201	258	5	G	A	A	39	39	ADAMTS12	A	1	1
ADAMTS16	170690	broad.mit.edu	36	5	5199317	5199317	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:5199317C>T	uc003jdl.1	+	c.250C>T	c.(250-252)CGG>TGG	p.R84W	ADAMTS16_uc003jdj.1_Missense_Mutation_p.R84W|ADAMTS16_uc003jdk.1_Missense_Mutation_p.R84W	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	84					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8														0.152778	20.183243	28.487117	11	61	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5199317	5199317	262	5	C	T	T	27	27	ADAMTS16	T	1	1
RTN4IP1	84816	broad.mit.edu	36	6	107142353	107142353	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:107142353G>T	uc003prj.1	-	c.884C>A	c.(883-885)GCC>GAC	p.A295D	RTN4IP1_uc010kdd.1_Intron|RTN4IP1_uc003prk.1_Missense_Mutation_p.A195D	NM_032730	NP_116119	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1 precursor	295					oxidation-reduction process	mitochondrion	oxidoreductase activity|zinc ion binding				0	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)										0.205882	9.798298	12.536912	7	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	107142353	107142353	14209	6	G	T	T	42	42	RTN4IP1	T	3	3
OR2B6	26212	broad.mit.edu	36	6	28033897	28033897	+	Silent	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:28033897C>T	uc003nke.1	+	c.900C>T	c.(898-900)GGC>GGT	p.G300G		NM_012367	NP_036499	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B,	300	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.166667	9.733727	15.440556	9	45	CC		KEEP	---	---	---	---	capture			Silent	SNP	28033897	28033897	11397	6	C	T	T	28	28	OR2B6	T	2	2
ITPR3	3710	broad.mit.edu	36	6	33742948	33742948	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1791-01	TCGA-19-1791-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:33742948A>G	uc010jvc.1	+	c.1616A>G	c.(1615-1617)GAG>GGG	p.E539G		NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	539	Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			central_nervous_system(5)|ovary(3)|lung(1)|kidney(1)	10														0.277778	7.447995	8.26445	5	13	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33742948	33742948	8226	6	A	G	G	11	11	ITPR3	G	4	4
EIF3B	8662	broad.mit.edu	36	7	2370555	2370555	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:2370555G>A	uc003slx.1	+	c.1022G>A	c.(1021-1023)CGT>CAT	p.R341H	EIF3B_uc003sly.1_Missense_Mutation_p.R341H|EIF3B_uc003slz.1_Missense_Mutation_p.R302H|EIF3B_uc003sma.2_Missense_Mutation_p.R69H	NM_003751	NP_003742	P55884	EIF3B_HUMAN	eukaryotic translation initiation factor 3,	341	Sufficient for interaction with EIF3E.|WD 1.				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)										0.176	44.214888	56.55568	22	103	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2370555	2370555	5202	7	G	A	A	40	40	EIF3B	A	1	1
HIBADH	11112	broad.mit.edu	36	7	27544559	27544559	+	Silent	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:27544559C>T	uc003szf.1	-	c.621G>A	c.(619-621)GCG>GCA	p.A207A	HIBADH_uc003szg.1_Silent_p.A158A|HIBADH_uc003szh.1_Silent_p.A106A	NM_152740	NP_689953	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase	207					branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(1)	1			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)									0.560606	126.284891	126.496654	37	29	CC		KEEP	---	---	---	---	capture			Silent	SNP	27544559	27544559	7384	7	C	T	T	23	23	HIBADH	T	1	1
SAMD9	54809	broad.mit.edu	36	7	92570187	92570187	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1791-01	TCGA-19-1791-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:92570187A>C	uc003umf.1	-	c.3160T>G	c.(3160-3162)TTT>GTT	p.F1054V	SAMD9_uc003umg.1_Missense_Mutation_p.F1054V|SAMD9_uc010lfa.1_Missense_Mutation_p.F1054V	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1054						cytoplasm				ovary(3)|breast(1)|central_nervous_system(1)	5	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)											0.322581	177.467404	182.649423	60	126	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	92570187	92570187	14306	7	A	C	C	4	4	SAMD9	C	4	4
PTCD1	26024	broad.mit.edu	36	7	98855527	98855527	+	Nonstop_Mutation	SNP	C	G	G			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:98855527C>G	uc003uqh.1	-	c.2102G>C	c.(2101-2103)TGA>TCA	p.*701S	PDAP1_uc010lfv.1_Intron	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	701										ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)											0.248	81.476111	88.690974	31	94	CC		KEEP	---	---	---	---	capture			Nonstop_Mutation	SNP	98855527	98855527	13181	7	C	G	G	29	29	PTCD1	G	5	3
CNPY4	245812	broad.mit.edu	36	7	99555417	99555417	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:99555417C>G	uc003uto.1	+	c.114C>G	c.(112-114)TGC>TGG	p.C38W	TAF6_uc003uti.1_5'Flank|TAF6_uc003utk.1_5'Flank|TAF6_uc003utj.1_5'Flank|TAF6_uc003utm.1_5'Flank|TAF6_uc003utl.1_5'Flank|TAF6_uc003utn.1_5'Flank	NM_152755	NP_689968	Q8N129	CNPY4_HUMAN	canopy 4 homolog	38						extracellular region					0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)													0.383721	97.834918	98.859856	33	53	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99555417	99555417	3768	7	C	G	G	27	27	CNPY4	G	3	3
GNAQ	2776	broad.mit.edu	36	9	79533284	79533285	+	Missense_Mutation	DNP	AT	GG	GG			TCGA-19-1791-01	TCGA-19-1791-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:79533284_79533285AT>GG	uc004akw.1	-	c.854_855AT>CC	c.(853-855)TAT>TCC	p.Y285S		NM_002072	NP_002063	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein),	285					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity			eye(128)|skin(44)|meninges(11)|ovary(1)|kidney(1)	185										84				0.2	7.860297	9.956251	5	20	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	79533284	79533285	6778	9	AT	GG	GG	4	4	GNAQ	GG	4	4
ZRSR2	8233	broad.mit.edu	36	X	15751236	15751236	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1791-01	TCGA-19-1791-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:15751236A>G	uc004cxg.2	+	c.1399A>G	c.(1399-1401)AGG>GGG	p.R467G		NM_005089	NP_005080	Q15696	U2AFM_HUMAN	U2 small nuclear RNA auxiliary factor 1-like 2	467	Arg/Ser-rich (RS domain).				spliceosome assembly	U12-type spliceosomal complex	nucleotide binding|pre-mRNA 3'-splice site binding|protein binding|zinc ion binding			breast(3)	3	Hepatocellular(33;0.183)					NSCLC(197;1631 3042 5741 31152)								0.466667	8.819889	8.849977	7	8	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15751236	15751236	18829	23	A	G	G	11	11	ZRSR2	G	4	4
GRPR	2925	broad.mit.edu	36	X	16052396	16052396	+	Silent	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:16052396G>A	uc004cxj.1	+	c.399G>A	c.(397-399)GCG>GCA	p.A133A		NM_005314	NP_005305	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	133	Helical; Name=3; (Potential).				cell proliferation	integral to plasma membrane	bombesin receptor activity			ovary(3)	3	Hepatocellular(33;0.183)													0.47191	256.648544	256.772566	84	94	GG		KEEP	---	---	---	---	capture			Silent	SNP	16052396	16052396	7087	23	G	A	A	38	38	GRPR	A	1	1
SYAP1	94056	broad.mit.edu	36	X	16671841	16671841	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:16671841G>C	uc004cxp.1	+	c.532G>C	c.(532-534)GAT>CAT	p.D178H	SYAP1_uc004cxo.1_Missense_Mutation_p.D178H	NM_032796	NP_116185	Q96A49	SYAP1_HUMAN	SYAP1 protein	178	BSD.										0	Hepatocellular(33;0.0997)													0.447368	54.973182	55.06431	17	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16671841	16671841	15946	23	G	C	C	41	41	SYAP1	C	3	3
NHS	4810	broad.mit.edu	36	X	17654495	17654495	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:17654495G>A	uc004cxx.1	+	c.2285G>A	c.(2284-2286)GGA>GAA	p.G762E	NHS_uc004cxy.1_Missense_Mutation_p.G606E|NHS_uc004cxz.1_Missense_Mutation_p.G585E|NHS_uc004cya.1_Missense_Mutation_p.G485E	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	762						nucleus				ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	6	Hepatocellular(33;0.183)													0.615385	255.009092	256.522908	80	50	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17654495	17654495	10811	23	G	A	A	41	41	NHS	A	2	2
ACOT9	23597	broad.mit.edu	36	X	23635977	23635977	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:23635977G>T	uc004dao.1	-	c.668C>A	c.(667-669)GCA>GAA	p.A223E	ACOT9_uc004dan.1_5'Flank|ACOT9_uc004dap.1_Missense_Mutation_p.A214E|ACOT9_uc004daq.1_Missense_Mutation_p.A172E|ACOT9_uc004dar.1_Missense_Mutation_p.A154E|ACOT9_uc004das.1_Missense_Mutation_p.A154E	NM_001037171	NP_001032248	Q9Y305	ACOT9_HUMAN	acyl-Coenzyme A thioesterase 2, mitochondrial	214					acyl-CoA metabolic process	mitochondrion	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(2)|pancreas(1)	3														0.447368	52.46787	52.559869	17	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23635977	23635977	158	23	G	T	T	46	46	ACOT9	T	3	3
PHF8	23133	broad.mit.edu	36	X	53982360	53982360	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1791-01	TCGA-19-1791-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:53982360C>T	uc004dsu.1	-	c.3139G>A	c.(3139-3141)GGC>AGC	p.G1047S	PHF8_uc004dst.1_Missense_Mutation_p.G1011S|PHF8_uc004dsv.2_Missense_Mutation_p.G877S	NM_015107	NP_055922	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	1047					brain development|G1/S transition of mitotic cell cycle|negative regulation of chromatin silencing at rDNA|oxidation-reduction process|positive regulation of transcription from RNA polymerase I promoter|transcription, DNA-dependent	nucleolus	chromatin binding|histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(3)	3														0.470833	362.792465	362.965618	113	127	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53982360	53982360	12263	23	C	T	T	23	23	PHF8	T	1	1
FGD1	2245	broad.mit.edu	36	X	54513306	54513306	+	Silent	SNP	G	A	A			TCGA-19-1791-01	TCGA-19-1791-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:54513306G>A	uc004dtg.1	-	c.969C>T	c.(967-969)GCC>GCT	p.A323A		NM_004463	NP_004454	P98174	FGD1_HUMAN	faciogenital dysplasia protein	323	Pro-rich.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	Rho guanyl-nucleotide exchange factor activity|small GTPase binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6														0.190476	17.78238	21.540227	8	34	GG		KEEP	---	---	---	---	capture			Silent	SNP	54513306	54513306	6069	23	G	A	A	35	35	FGD1	A	2	2
ANO9	338440	broad.mit.edu	36	11	423356	423357	+	Frame_Shift_Ins	INS	-	G	G			TCGA-19-1791-01	TCGA-19-1791-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:423356_423357insG	uc001lpi.2	-	c.307_308insC	c.(307-309)CACfs	p.H103fs		NM_001012302	NP_001012302	A1A5B4	ANO9_HUMAN	tumor protein p53 inducible protein 5	103	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4														0.33			3	6				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	423356	423357	712	11	-	G	G	59	59	ANO9	G	5	5
ZNF599	148103	broad.mit.edu	36	19	39942600	39942621	+	Frame_Shift_Del	DEL	ATTCTTTGCATAAAAAGGGTTT	-	-			TCGA-19-1791-01	TCGA-19-1791-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:39942600_39942621delATTCTTTGCATAAAAAGGGTTT	uc010edn.1	-	c.925_946delAAACCCTTTTTATGCAAAGAAT	c.(925-948)AAACCCTTTTTATGCAAAGAATGTfs	p.K309fs	ZNF599_uc010edm.1_Frame_Shift_Del_p.K272fs	NM_001007248	NP_001007249	Q96NL3	ZN599_HUMAN	zinc finger protein 599	309_316	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)											0.61			93	59				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	39942600	39942621	18624	19	ATTCTTTGCATAAAAAGGGTTT	-	-	8	8	ZNF599	-	5	5
CPSF3L	54973	broad.mit.edu	36	1	1244701	1244716	+	Frame_Shift_Del	DEL	GGGCCCGTCGTAGCCC	-	-			TCGA-19-1791-01	TCGA-19-1791-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:1244701_1244716delGGGCCCGTCGTAGCCC	uc001aee.1	-	c.252_267delGGGCTACGACGGGCCC	c.(250-267)GTGGGCTACGACGGGCCCfs	p.V84fs	CPSF3L_uc009vjy.1_5'Flank|CPSF3L_uc001aef.1_Frame_Shift_Del_p.V90fs|CPSF3L_uc009vjz.1_Frame_Shift_Del_p.V84fs|CPSF3L_uc001aeg.1_Intron|CPSF3L_uc001aeh.1_Intron|CPSF3L_uc001aei.1_Intron|CPSF3L_uc001aej.1_Intron|CPSF3L_uc001aek.1_Intron|CPSF3L_uc001aem.1_Frame_Shift_Del_p.V84fs|CPSF3L_uc001ael.1_Frame_Shift_Del_p.V2fs|CPSF3L_uc001aen.1_3'UTR	NM_017871	NP_060341	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor	84_89						Golgi apparatus|nucleus	hydrolase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)										0.42			5	7				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	1244701	1244716	3965	1	GGGCCCGTCGTAGCCC	-	-	47	47	CPSF3L	-	5	5
KIF21B	23046	broad.mit.edu	36	1	199222876	199222888	+	Frame_Shift_Del	DEL	TTGGTGGAGATAT	-	-			TCGA-19-1791-01	TCGA-19-1791-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:199222876_199222888delTTGGTGGAGATAT	uc001gvs.1	-	c.3473_3485delATATCTCCACCAA	c.(3472-3486)GATATCTCCACCAAGfs	p.D1158fs	KIF21B_uc001gvr.1_Frame_Shift_Del_p.D1158fs|KIF21B_uc009wzl.1_Frame_Shift_Del_p.D1158fs	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	1158_1162					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	p.T1161N(1)		ovary(3)	3														0.41			62	90				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	199222876	199222888	8600	1	TTGGTGGAGATAT	-	-	56	56	KIF21B	-	5	5
ZNF684	127396	broad.mit.edu	36	1	40779968	40780010	+	Splice_Site_Del	DEL	AGGTGAGTGAGAGAAATTCAGATGGGGCTGTGTGGAGTTGAGA	-	-			TCGA-19-1791-01	TCGA-19-1791-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:40779968_40780010delAGGTGAGTGAGAGAAATTCAGATGGGGCTGTGTGGAGTTGAGA	uc001cft.1	+	c.e4_splice_site				NM_152373	NP_689586			zinc finger protein 684						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.42e-18)											0.47			63	72				---	---	---	---	capture_indel			Splice_Site_Del	DEL	40779968	40780010	18686	1	AGGTGAGTGAGAGAAATTCAGATGGGGCTGTGTGGAGTTGAGA	-	-	7	7	ZNF684	-	5	5
GMEB2	26205	broad.mit.edu	36	20	61692453	61692453	+	Frame_Shift_Del	DEL	G	-	-			TCGA-19-1791-01	TCGA-19-1791-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:61692453_61692453delG	uc002yfp.1	-	c.1026_1026delC	c.(1024-1026)AACfs	p.N342fs	GMEB2_uc002yfo.1_Frame_Shift_Del_p.N264fs|GMEB2_uc002yfq.1_Frame_Shift_Del_p.N342fs	NM_012384	NP_036516	Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding	342	Potential.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding|RNA polymerase II transcription factor activity				0	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)											0.31			13	29				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	61692453	61692453	6757	20	G	-	-	40	40	GMEB2	-	5	5
RIPK4	54101	broad.mit.edu	36	21	42049846	42049847	+	Frame_Shift_Ins	INS	-	A	A			TCGA-19-1791-01	TCGA-19-1791-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:42049846_42049847insA	uc002yzn.1	-	c.381_382insT	c.(379-384)GTGGGCfs	p.V127fs		NM_020639	NP_065690	Q9H4D1	Q9H4D1_HUMAN	ankyrin repeat domain 3	127_128					protein phosphorylation	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7									p.V127V(U937-Tumor)	268				0.65			89	48				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	42049846	42049847	13860	21	-	A	A	22	22	RIPK4	A	5	5
NR4A2	4929	broad.mit.edu	36	2	156892695	156892706	+	In_Frame_Del	DEL	GGGGAGAGGGCT	-	-			TCGA-19-1791-01	TCGA-19-1791-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:156892695_156892706delGGGGAGAGGGCT	uc002tyz.2	-	c.1061_1072delAGCCCTCTCCCC	c.(1060-1074)GAGCCCTCTCCCCCT>GCT	p.354_358EPSPP>A	NR4A2_uc002tyx.2_In_Frame_Del_p.291_295EPSPP>A|NR4A2_uc002tyy.2_In_Frame_Del_p.354_358EPSPP>A|NR4A2_uc002tza.2_In_Frame_Del_p.354_358EPSPP>A	NM_006186	NP_775265	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	354_358	Pro-rich.				cellular response to extracellular stimulus|dopaminergic neuron differentiation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus	nucleoplasm	sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3														0.54			29	25				---	---	---	---	capture_indel			In_Frame_Del	DEL	156892695	156892706	11038	2	GGGGAGAGGGCT	-	-	43	43	NR4A2	-	5	5
C5	727	broad.mit.edu	36	9	122819947	122819961	+	Splice_Site_Del	DEL	AAAATCTAAAAATAA	-	-			TCGA-19-1791-01	TCGA-19-1791-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:122819947_122819961delAAAATCTAAAAATAA	uc004bkv.1	-	c.e13_splice_site			C5_uc010mvm.1_Splice_Site_Del|C5_uc010mvn.1_Splice_Site_Del	NM_001735	NP_001726			complement component 5 preproprotein						activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity	p.?(1)		ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)									0.46			11	13				---	---	---	---	capture_indel			Splice_Site_Del	DEL	122819947	122819961	2378	9	AAAATCTAAAAATAA	-	-	13	13	C5	-	5	5
