Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
HPSE2	60495	broad.mit.edu	36	10	100985530	100985530	+	Missense_Mutation	SNP	A	T	T			TCGA-19-2621-01	TCGA-19-2621-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:100985530A>T	uc001kpn.1	-	c.20T>A	c.(19-21)TTC>TAC	p.F7Y	HPSE2_uc009xwc.1_5'UTR|HPSE2_uc001kpo.1_5'UTR|HPSE2_uc009xwd.1_5'UTR	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2	7					carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)										0.352941	10.231895	10.561425	6	11	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100985530	100985530	7637	10	A	T	T	9	9	HPSE2	T	4	4
MCM10	55388	broad.mit.edu	36	10	13257642	13257642	+	Missense_Mutation	SNP	C	T	T	rs35586085	by-cluster	TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:13257642C>T	uc001ima.1	+	c.722C>T	c.(721-723)ACG>ATG	p.T241M	MCM10_uc001imc.2_Missense_Mutation_p.T240M|MCM10_uc001imb.1_Missense_Mutation_p.T240M	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	241					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3														0.846561	530.895405	552.619722	160	29	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	13257642	13257642	9774	10	C	T	T	19	19	MCM10	T	1	1
CDHR1	92211	broad.mit.edu	36	10	85960876	85960876	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:85960876G>T	uc001kcv.1	+	c.1460G>T	c.(1459-1461)GGG>GTG	p.G487V	CDHR1_uc001kcw.2_Missense_Mutation_p.G487V|CDHR1_uc009xst.1_Intron|CDHR1_uc001kcx.1_5'Flank	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN	protocadherin 21 precursor	487	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion		calcium ion binding|receptor activity			ovary(1)	1														0.25	8.060168	9.202024	5	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	85960876	85960876	3247	10	G	T	T	43	43	CDHR1	T	3	3
PTEN	5728	broad.mit.edu	36	10	89682774	89682774	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2621-01	TCGA-19-2621-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:89682774A>G	uc001kfb.1	+	c.278A>G	c.(277-279)CAT>CGT	p.H93R		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	93	Phosphatase tensin-type.		H -> R (in MCEPHAS).|H -> Y (in CD).	H->A: 75% reduction in phosphatase activity towards PtdIns(3,4,5)P3. Modest reduction in phosphatase activity towards PtdIns(3,4)P2.	apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.Y27_N212>Y(2)|p.H93R(1)|p.Q87_P96del(1)|p.N82_P95del(1)|p.F90_P95>L(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)				31		264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.919355	187.883845	198.823043	57	5	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	89682774	89682774	13192	10	A	G	G	8	8	PTEN	G	4	4
ARCN1	372	broad.mit.edu	36	11	117957323	117957323	+	Silent	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:117957323G>A	uc009zag.1	+	c.279G>A	c.(277-279)GAG>GAA	p.E93E	ARCN1_uc001ptq.1_Silent_p.E52E|ARCN1_uc009zah.1_Silent_p.E52E	NM_001655	NP_001646	P48444	COPD_HUMAN	archain isoform 1	52					COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	clathrin adaptor complex|COPI vesicle coat|cytosol					0	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)										0.144144	25.128867	38.661267	16	95	GG		KEEP	---	---	---	---	capture			Silent	SNP	117957323	117957323	853	11	G	A	A	33	33	ARCN1	A	2	2
CNGA4	1262	broad.mit.edu	36	11	6218197	6218197	+	Silent	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:6218197C>T	uc001mco.2	+	c.597C>T	c.(595-597)GAC>GAT	p.D199D	CNGA4_uc001mcn.2_Silent_p.D159D	NM_001037329	NP_001032406	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	199	Cytoplasmic (Potential).				response to stimulus|sensory perception of smell		cAMP binding				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)										0.546667	126.57665	126.719043	41	34	CC		KEEP	---	---	---	---	capture			Silent	SNP	6218197	6218197	3737	11	C	T	T	19	19	CNGA4	T	1	1
LRP5	4041	broad.mit.edu	36	11	67930626	67930626	+	Silent	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:67930626C>T	uc001ont.1	+	c.1860C>T	c.(1858-1860)CCC>CCT	p.P620P	LRP5_uc009ysg.1_Silent_p.P30P	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein	620	EGF-like 2.|Extracellular (Potential).				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(1)|pancreas(1)	2														0.2	41.882842	49.827888	19	76	CC		KEEP	---	---	---	---	capture			Silent	SNP	67930626	67930626	9333	11	C	T	T	22	22	LRP5	T	2	2
MTL5	9633	broad.mit.edu	36	11	68232521	68232521	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:68232521C>T	uc001ooc.1	-	c.1358G>A	c.(1357-1359)TGG>TAG	p.W453*		NM_004923	NP_004914	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific isoform	453					cell differentiation|cellular metal ion homeostasis|multicellular organismal development|response to metal ion|spermatogenesis	cytoplasm|nucleus|soluble fraction	metal ion binding			ovary(2)|breast(1)	3	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)											0.142857	7.252185	11.554496	5	30	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	68232521	68232521	10329	11	C	T	T	21	21	MTL5	T	5	2
FOLR2	2350	broad.mit.edu	36	11	71609594	71609594	+	Silent	SNP	A	G	G			TCGA-19-2621-01	TCGA-19-2621-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:71609594A>G	uc009ytd.1	+	c.183A>G	c.(181-183)ACA>ACG	p.T61T	FOLR2_uc009yte.1_Silent_p.T61T|FOLR2_uc001ose.2_Silent_p.T61T|FOLR2_uc009ytf.1_Silent_p.T61T	NM_001113534	NP_001107006	P14207	FOLR2_HUMAN	folate receptor 2 precursor	61					folic acid transport	anchored to membrane|extracellular region|membrane fraction|plasma membrane	folic acid binding|receptor activity			breast(2)|ovary(1)	3					Folic Acid(DB00158)									0.333333	17.916337	18.433783	7	14	AA		KEEP	---	---	---	---	capture			Silent	SNP	71609594	71609594	6224	11	A	G	G	7	7	FOLR2	G	4	4
RNF169	254225	broad.mit.edu	36	11	74223399	74223399	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:74223399G>C	uc001ovl.2	+	c.873G>C	c.(871-873)CAG>CAC	p.Q291H	XRRA1_uc001ovm.2_Intron	NM_001098638	NP_001092108	Q8NCN4	RN169_HUMAN	ring finger protein 169	291							zinc ion binding			ovary(1)	1														0.140845	6.889645	15.761341	10	61	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74223399	74223399	13937	11	G	C	C	33	33	RNF169	C	3	3
GPR83	10888	broad.mit.edu	36	11	93752973	93752973	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:93752973G>A	uc001pet.1	-	c.1262C>T	c.(1261-1263)ACG>ATG	p.T421M		NM_016540	NP_057624	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	421	Cytoplasmic (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			central_nervous_system(2)|ovary(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)												0.4375	85.499412	85.715348	28	36	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	93752973	93752973	6988	11	G	A	A	40	40	GPR83	A	1	1
PITPNM2	57605	broad.mit.edu	36	12	122051301	122051302	+	Missense_Mutation	DNP	CA	AT	AT			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:122051301_122051302CA>AT	uc001uej.1	-	c.1200_1201TG>AT	c.(1198-1203)AGTGTG>AGATTG	p.400_401SV>RL	PITPNM2_uc001uek.1_Missense_Mutation_p.400_401SV>RL|PITPNM2_uc009zxu.1_Missense_Mutation_p.400_401SV>RL	NM_020845	NP_065896	Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein,	400_401					metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)										0.205882	9.519263	12.242743	7	27	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	122051301	122051302	12375	12	CA	AT	AT	17	17	PITPNM2	AT	3	3
DDX47	51202	broad.mit.edu	36	12	12873750	12873750	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:12873750C>T	uc001rav.1	+	c.1363C>T	c.(1363-1365)CGT>TGT	p.R455C	DDX47_uc001rax.1_Missense_Mutation_p.R455C|DDX47_uc001ray.1_Missense_Mutation_p.R406C	NM_016355	NP_057439	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	455						nucleolus|nucleolus	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding				0		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)										0.403846	62.174485	62.591431	21	31	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12873750	12873750	4536	12	C	T	T	23	23	DDX47	T	1	1
MMP17	4326	broad.mit.edu	36	12	130891209	130891209	+	Silent	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:130891209C>T	uc001ujc.1	+	c.561C>T	c.(559-561)ATC>ATT	p.I187I	MMP17_uc001ujd.1_Silent_p.I103I	NM_016155	NP_057239	Q9ULZ9	MMP17_HUMAN	matrix metalloproteinase 17 preproprotein	187					proteolysis	anchored to membrane|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)										0.657143	76.936063	77.700874	23	12	CC		KEEP	---	---	---	---	capture			Silent	SNP	130891209	130891209	10046	12	C	T	T	31	31	MMP17	T	1	1
LRRK2	120892	broad.mit.edu	36	12	38964004	38964004	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:38964004G>A	uc001rmg.2	+	c.2302G>A	c.(2302-2304)GAA>AAA	p.E768K	LRRK2_uc001rmh.1_Missense_Mutation_p.E390K	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	768					activation of MAPKK activity|determination of adult lifespan|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(11)|lung(2)|upper_aerodigestive_tract(1)|large_intestine(1)|stomach(1)|urinary_tract(1)|pancreas(1)	18	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)								1771				0.38189	273.208086	276.31629	97	157	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38964004	38964004	9409	12	G	A	A	45	45	LRRK2	A	2	2
PDZRN4	29951	broad.mit.edu	36	12	40253185	40253185	+	Silent	SNP	C	A	A			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:40253185C>A	uc001rmq.2	+	c.1563C>A	c.(1561-1563)ACC>ACA	p.T521T	PDZRN4_uc009zjz.1_Silent_p.T519T|PDZRN4_uc001rmr.1_Silent_p.T406T	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4	779							ubiquitin-protein ligase activity|zinc ion binding			lung(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	8	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)								467				0.3125	127.201363	132.20436	50	110	CC		KEEP	---	---	---	---	capture			Silent	SNP	40253185	40253185	12131	12	C	A	A	22	22	PDZRN4	A	3	3
PLEKHG6	55200	broad.mit.edu	36	12	6297016	6297016	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:6297016G>A	uc001qnr.1	+	c.910G>A	c.(910-912)GAC>AAC	p.D304N	PLEKHG6_uc001qns.2_Missense_Mutation_p.D304N	NM_018173	NP_060643	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain-containing family G	304	DH.				regulation of Rho protein signal transduction	cleavage furrow|cytoplasm|spindle pole	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1														0.27027	21.132261	22.896052	10	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6297016	6297016	12500	12	G	A	A	45	45	PLEKHG6	A	2	2
YEATS4	8089	broad.mit.edu	36	12	68050759	68050759	+	Silent	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:68050759C>T	uc001sux.1	+	c.340C>T	c.(340-342)CTG>TTG	p.L114L		NM_006530	NP_006521	O95619	YETS4_HUMAN	glioma-amplified sequence-41	114	YEATS.				histone H2A acetylation|histone H4 acetylation|mitosis|positive regulation of transcription, DNA-dependent|regulation of growth	NuA4 histone acetyltransferase complex|nuclear matrix	DNA binding|protein C-terminus binding|sequence-specific DNA binding transcription factor activity|structural constituent of cytoskeleton				0	all_epithelial(5;9.25e-35)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;6.89e-18)|BRCA - Breast invasive adenocarcinoma(5;3.14e-09)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)											0.137255	11.188439	17.685886	7	44	CC		KEEP	---	---	---	---	capture			Silent	SNP	68050759	68050759	18056	12	C	T	T	24	24	YEATS4	T	2	2
PTPRB	5787	broad.mit.edu	36	12	69289346	69289346	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:69289346G>A	uc001swc.2	-	c.749C>T	c.(748-750)GCG>GTG	p.A250V	PTPRB_uc001swb.2_Missense_Mutation_p.A32V|PTPRB_uc001swa.2_Missense_Mutation_p.A250V|PTPRB_uc001swd.2_Missense_Mutation_p.A249V|PTPRB_uc009zrr.1_Missense_Mutation_p.A129V|PTPRB_uc001swe.2_Missense_Mutation_p.A250V	NM_001109754	NP_001103224	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	32	Fibronectin type-III 1.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)											0.216216	16.888562	19.633431	8	29	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69289346	69289346	13253	12	G	A	A	38	38	PTPRB	A	1	1
E2F7	144455	broad.mit.edu	36	12	75947912	75947912	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:75947912C>T	uc001sym.2	-	c.1714G>A	c.(1714-1716)GAG>AAG	p.E572K	E2F7_uc009zse.1_Missense_Mutation_p.E59K	NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	572					cell cycle|regulation of transcription, DNA-dependent	transcription factor complex	DNA binding|identical protein binding			ovary(1)|kidney(1)	2														0.272321	163.595272	174.051237	61	163	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75947912	75947912	5058	12	C	T	T	32	32	E2F7	T	2	2
AMDHD1	144193	broad.mit.edu	36	12	94885747	94885748	+	Missense_Mutation	DNP	AC	GG	GG			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:94885747_94885748AC>GG	uc001tel.1	+	c.1276_1277AC>GG	c.(1276-1278)ACA>GGA	p.T426G	AMDHD1_uc009zth.1_Missense_Mutation_p.T317G	NM_152435	NP_689648	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	426					histidine catabolic process to glutamate and formamide	cytosol	imidazolonepropionase activity|metal ion binding			central_nervous_system(1)	1														0.428571	7.823752	7.854873	3	4	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	94885747	94885748	570	12	AC	GG	GG	2	2	AMDHD1	GG	4	4
AHNAK2	113146	broad.mit.edu	36	14	104478788	104478788	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:104478788C>T	uc010axc.1	-	c.14045G>A	c.(14044-14046)CGC>CAC	p.R4682H	AHNAK2_uc001ypx.2_Missense_Mutation_p.R4582H	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4682						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)											0.2	11.666729	13.754778	5	20	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	104478788	104478788	418	14	C	T	T	27	27	AHNAK2	T	1	1
NPAS3	64067	broad.mit.edu	36	14	33339360	33339360	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:33339360G>C	uc001wru.1	+	c.2096G>C	c.(2095-2097)GGT>GCT	p.G699A	NPAS3_uc001wrt.1_Missense_Mutation_p.G667A|NPAS3_uc001wrv.1_Missense_Mutation_p.G669A|NPAS3_uc001wrs.1_Missense_Mutation_p.G686A	NM_022123	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 1	699	Gly-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity|transcription regulator activity			ovary(1)	1	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)										0.666667	9.998636	10.145992	4	2	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33339360	33339360	10968	14	G	C	C	44	44	NPAS3	C	3	3
SLC35F4	341880	broad.mit.edu	36	14	57108417	57108417	+	Missense_Mutation	SNP	A	T	T			TCGA-19-2621-01	TCGA-19-2621-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:57108417A>T	uc001xdb.1	-	c.989T>A	c.(988-990)ATC>AAC	p.I330N	SLC35F4_uc010aoz.1_Non-coding_Transcript|SLC35F4_uc010apa.1_Missense_Mutation_p.I171N	NM_001080455	NP_001073924	A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	330	Helical; (Potential).				transport	integral to membrane				ovary(2)	2														0.481013	114.445595	114.47017	38	41	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57108417	57108417	15088	14	A	T	T	12	12	SLC35F4	T	4	4
LTBP2	4053	broad.mit.edu	36	14	74065468	74065468	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:74065468G>A	uc001xqa.1	-	c.2098C>T	c.(2098-2100)CGC>TGC	p.R700C		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	700	TB 2.				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)										0.777778	46.757771	48.035198	14	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74065468	74065468	9450	14	G	A	A	39	39	LTBP2	A	1	1
TTC7B	145567	broad.mit.edu	36	14	90077502	90077502	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:90077502G>T	uc001xyp.1	-	c.2495C>A	c.(2494-2496)CCC>CAC	p.P832H	TTC7B_uc001xyo.1_Missense_Mutation_p.P276H|TTC7B_uc010ats.1_Non-coding_Transcript	NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	832							binding			ovary(2)	2		Melanoma(154;0.222)												0.238095	6.959005	8.28228	5	16	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	90077502	90077502	17268	14	G	T	T	43	43	TTC7B	T	3	3
C15orf2	23742	broad.mit.edu	36	15	22474899	22474899	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:22474899C>T	uc001ywo.1	+	c.2792C>T	c.(2791-2793)CCT>CTT	p.P931L		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	931					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|kidney(1)|central_nervous_system(1)	6		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)						443				0.313725	41.679486	43.255727	16	35	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22474899	22474899	1834	15	C	T	T	24	24	C15orf2	T	2	2
RPAP1	26015	broad.mit.edu	36	15	39597178	39597178	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:39597178G>A	uc001zod.1	-	c.4036C>T	c.(4036-4038)CTC>TTC	p.L1346F	RPAP1_uc001zoc.1_Missense_Mutation_p.L365F	NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	1346						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)										0.345833	215.321979	220.371803	83	157	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39597178	39597178	14020	15	G	A	A	33	33	RPAP1	A	2	2
FES	2242	broad.mit.edu	36	15	89237013	89237013	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:89237013G>A	uc002bpv.1	+	c.1780G>A	c.(1780-1782)GAG>AAG	p.E594K	FES_uc002bpw.1_Non-coding_Transcript|FES_uc002bpx.1_Missense_Mutation_p.E524K|FES_uc002bpy.1_Missense_Mutation_p.E536K|FES_uc002bpz.1_Missense_Mutation_p.E466K|FES_uc010bny.1_Missense_Mutation_p.E466K	NM_002005	NP_001996	P07332	FES_HUMAN	feline sarcoma oncogene isoform 1	594	Protein kinase.				axon guidance|cell proliferation|peptidyl-tyrosine phosphorylation	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)							206				0.5625	27.375531	27.429976	9	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	89237013	89237013	6057	15	G	A	A	33	33	FES	A	2	2
ERN2	10595	broad.mit.edu	36	16	23625601	23625601	+	Silent	SNP	G	T	T			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:23625601G>T	uc002dma.2	-	c.606C>A	c.(604-606)ACC>ACA	p.T202T	ERN2_uc010bxp.1_Silent_p.T202T|ERN2_uc010bxq.1_Silent_p.T10T	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2	154	Lumenal (Potential).				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|protein phosphorylation|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)						225				0.473684	220.324418	220.411903	72	80	GG		KEEP	---	---	---	---	capture			Silent	SNP	23625601	23625601	5431	16	G	T	T	43	43	ERN2	T	3	3
PAQR4	124222	broad.mit.edu	36	16	2961650	2961650	+	Silent	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:2961650C>T	uc002csj.2	+	c.522C>T	c.(520-522)CTC>CTT	p.L174L	PAQR4_uc002csk.2_Silent_p.L135L|PAQR4_uc002csl.2_Silent_p.L100L	NM_152341	NP_689554	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	174						integral to membrane	receptor activity				0														0.615385	25.702181	25.853894	8	5	CC		KEEP	---	---	---	---	capture			Silent	SNP	2961650	2961650	11854	16	C	T	T	30	30	PAQR4	T	2	2
MYLK3	91807	broad.mit.edu	36	16	45318789	45318789	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:45318789C>T	uc002eei.2	-	c.1774G>A	c.(1774-1776)GTG>ATG	p.V592M	MYLK3_uc002eej.1_Missense_Mutation_p.V251M	NM_182493	NP_872299	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	592	Protein kinase.				cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|protein phosphorylation|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)								207				0.253968	40.209042	43.64554	16	47	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45318789	45318789	10453	16	C	T	T	19	19	MYLK3	T	1	1
WDR90	197335	broad.mit.edu	36	16	643436	643436	+	Missense_Mutation	SNP	T	G	G			TCGA-19-2621-01	TCGA-19-2621-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:643436T>G	uc002cii.1	+	c.1217T>G	c.(1216-1218)CTT>CGT	p.L406R	WDR90_uc002cij.1_Non-coding_Transcript|WDR90_uc002cig.1_Missense_Mutation_p.L406R|WDR90_uc002cih.1_Missense_Mutation_p.L407R|WDR90_uc002cik.1_5'Flank	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	406										ovary(1)	1		Hepatocellular(780;0.0218)												0.272727	9.531208	10.563297	6	16	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	643436	643436	17911	16	T	G	G	56	56	WDR90	G	4	4
PLEKHG4	25894	broad.mit.edu	36	16	65879987	65879987	+	Silent	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:65879987G>A	uc002eso.2	+	c.3549G>A	c.(3547-3549)AGG>AGA	p.R1183R	PLEKHG4_uc002esp.2_Silent_p.R990R|PLEKHG4_uc002esq.2_Silent_p.R1183R|PLEKHG4_uc010cef.1_Silent_p.R1183R|PLEKHG4_uc002ess.2_Silent_p.R1183R|PLEKHG4_uc010ceg.1_Silent_p.R1102R	NM_015432	NP_056247	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G	1183					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)										0.666667	165.558147	167.547467	54	27	GG		KEEP	---	---	---	---	capture			Silent	SNP	65879987	65879987	12497	16	G	A	A	43	43	PLEKHG4	A	2	2
GALNS	2588	broad.mit.edu	36	16	87425936	87425936	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2621-01	TCGA-19-2621-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:87425936A>G	uc002fly.2	-	c.973T>C	c.(973-975)TGG>CGG	p.W325R	GALNS_uc010cid.1_Missense_Mutation_p.W331R|GALNS_uc002flz.2_Missense_Mutation_p.W8R	NM_000512	NP_000503	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfate sulfatase	325			Missing (in MPS4A).|W -> C (in MPS4A).			lysosome	metal ion binding|N-acetylgalactosamine-4-sulfatase activity|N-acetylgalactosamine-6-sulfatase activity			large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0496)	Hyaluronidase(DB00070)	GBM(129;1929 2344 25209 33204)								0.428571	7.222257	7.253676	3	4	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	87425936	87425936	6470	16	A	G	G	8	8	GALNS	G	4	4
SCARF1	8578	broad.mit.edu	36	17	1484963	1484963	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:1484963G>A	uc002fsz.1	-	c.2332C>T	c.(2332-2334)CGG>TGG	p.R778W	SCARF1_uc002fsy.1_3'UTR|SCARF1_uc002fta.1_3'UTR|SCARF1_uc002ftb.1_3'UTR|SCARF1_uc010cjv.1_Missense_Mutation_p.R692W	NM_003693	NP_003684	Q14162	SREC_HUMAN	scavenger receptor class F, member 1 isoform 1	778	Gly-rich.|Cytoplasmic (Potential).				cell adhesion|cholesterol catabolic process|neuron remodeling|positive regulation of axon regeneration|receptor-mediated endocytosis	integral to membrane	low-density lipoprotein particle binding|scavenger receptor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)										0.567568	64.075682	64.222933	21	16	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1484963	1484963	14364	17	G	A	A	39	39	SCARF1	A	1	1
ATP6V0A1	535	broad.mit.edu	36	17	37913151	37913151	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:37913151C>T	uc002hzs.1	+	c.2113C>T	c.(2113-2115)CAC>TAC	p.H705Y	ATP6V0A1_uc002hzq.1_Missense_Mutation_p.H698Y|ATP6V0A1_uc002hzr.1_Missense_Mutation_p.H698Y|ATP6V0A1_uc010cyg.1_Missense_Mutation_p.H344Y|ATP6V0A1_uc002hzt.1_5'UTR	NM_005177	NP_005168	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	698	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)										0.305648	223.836587	234.016398	92	209	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37913151	37913151	1187	17	C	T	T	21	21	ATP6V0A1	T	2	2
HDAC5	10014	broad.mit.edu	36	17	39526629	39526629	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:39526629C>G	uc002iff.1	-	c.197G>C	c.(196-198)GGC>GCC	p.G66A	HDAC5_uc002ifd.1_Missense_Mutation_p.G65A|HDAC5_uc002ife.1_Missense_Mutation_p.G65A|HDAC5_uc010czp.1_Missense_Mutation_p.G65A|HDAC5_uc002ifh.1_5'Flank	NM_001015053	NP_001015053	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5 isoform 3	65					B cell differentiation|cellular response to insulin stimulus|chromatin remodeling|chromatin silencing|inflammatory response|negative regulation of cell migration involved in sprouting angiogenesis|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of myotube differentiation|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of protein binding|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding|specific transcriptional repressor activity			ovary(1)	1		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)										0.75	7.131497	7.349359	3	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39526629	39526629	7293	17	C	G	G	26	26	HDAC5	G	3	3
HDAC5	10014	broad.mit.edu	36	17	39526631	39526632	+	Missense_Mutation	DNP	CA	AG	AG			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:39526631_39526632CA>AG	uc002iff.1	-	c.194_195TG>CT	c.(193-195)GTG>GCT	p.V65A	HDAC5_uc002ifd.1_Missense_Mutation_p.V64A|HDAC5_uc002ife.1_Missense_Mutation_p.V64A|HDAC5_uc010czp.1_Missense_Mutation_p.V64A|HDAC5_uc002ifh.1_5'Flank	NM_001015053	NP_001015053	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5 isoform 3	64					B cell differentiation|cellular response to insulin stimulus|chromatin remodeling|chromatin silencing|inflammatory response|negative regulation of cell migration involved in sprouting angiogenesis|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of myotube differentiation|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of protein binding|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding|specific transcriptional repressor activity			ovary(1)	1		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)										0.888889	19.157538	20.432546	8	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	39526631	39526632	7293	17	CA	AG	AG	21	21	HDAC5	AG	3	3
HLF	3131	broad.mit.edu	36	17	50700156	50700156	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:50700156G>A	uc002iug.1	+	c.161G>A	c.(160-162)AGT>AAT	p.S54N	HLF_uc010dce.1_5'UTR|HLF_uc002iuh.1_5'UTR	NM_002126	NP_002117	Q16534	HLF_HUMAN	hepatic leukemia factor	54					multicellular organismal development|regulation of transcription, DNA-dependent|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2									p.S54T(LS411N-Tumor)	60				0.160714	16.44426	22.576962	9	47	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	50700156	50700156	7505	17	G	A	A	36	36	HLF	A	2	2
EPX	8288	broad.mit.edu	36	17	53629550	53629550	+	Silent	SNP	C	T	T	rs34607215	by-frequency	TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:53629550C>T	uc002ivq.2	+	c.1053C>T	c.(1051-1053)TTC>TTT	p.F351F		NM_000502	NP_000493	P11678	PERE_HUMAN	eosinophil peroxidase	351					hydrogen peroxide catabolic process|oxidation-reduction process		heme binding|peroxidase activity|protein binding			ovary(2)	2														0.231481	57.229612	64.358729	25	83	CC		KEEP	---	---	---	---	capture			Silent	SNP	53629550	53629550	5393	17	C	T	T	31	31	EPX	T	1	1
CASKIN2	57513	broad.mit.edu	36	17	71009562	71009562	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2621-01	TCGA-19-2621-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71009562A>G	uc002joc.1	-	c.3188T>C	c.(3187-3189)GTG>GCG	p.V1063A		NM_020753	NP_065804	Q8WXE0	CSKI2_HUMAN	cask-interacting protein 2 isoform a	1063	Pro-rich.					cytoplasm				pancreas(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)											0.625	11.763466	11.870873	5	3	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71009562	71009562	2786	17	A	G	G	6	6	CASKIN2	G	4	4
PFAS	5198	broad.mit.edu	36	17	8107665	8107665	+	Missense_Mutation	SNP	A	C	C			TCGA-19-2621-01	TCGA-19-2621-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:8107665A>C	uc002gkr.1	+	c.1615A>C	c.(1615-1617)ACC>CCC	p.T539P	PFAS_uc010cnw.1_Missense_Mutation_p.T93P|PFAS_uc002gks.2_5'Flank	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	539					'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)									0.265625	9.053695	12.762629	17	47	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8107665	8107665	12176	17	A	C	C	6	6	PFAS	C	4	4
ZNF407	55628	broad.mit.edu	36	18	70474540	70474540	+	Silent	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:70474540C>T	uc002llw.2	+	c.2577C>T	c.(2575-2577)GCC>GCT	p.A859A	ZNF407_uc010dqu.1_Silent_p.A858A|ZNF407_uc002llu.2_Silent_p.A858A	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	859	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)										0.3	39.004694	40.792411	15	35	CC		KEEP	---	---	---	---	capture			Silent	SNP	70474540	70474540	18480	18	C	T	T	24	24	ZNF407	T	2	2
NDUFV2	4729	broad.mit.edu	36	18	9124191	9124191	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:9124191C>T	uc002knu.1	+	c.664C>T	c.(664-666)CGC>TGC	p.R222C	ANKRD12_uc002knv.2_5'Flank|ANKRD12_uc002knw.2_5'Flank	NM_021074	NP_066552	P19404	NDUV2_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 2,	222					cardiac muscle tissue development|mitochondrial electron transport, NADH to ubiquinone|nervous system development|transport	mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|electron carrier activity|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity			ovary(1)	1					NADH(DB00157)									0.673913	97.734104	98.969719	31	15	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9124191	9124191	10699	18	C	T	T	19	19	NDUFV2	T	1	1
JAK3	3718	broad.mit.edu	36	19	17803063	17803063	+	Silent	SNP	G	C	C			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:17803063G>C	uc002nhn.2	-	c.2952C>G	c.(2950-2952)CGC>CGG	p.R984R	JAK3_uc010ebh.1_Intron|JAK3_uc002nho.2_Silent_p.R984R	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3	984	Protein kinase 2.				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(36)|lung(3)|ovary(3)|stomach(2)|breast(2)	46								2		364				0.304348	10.65225	11.482073	7	16	GG		KEEP	---	---	---	---	capture			Silent	SNP	17803063	17803063	8243	19	G	C	C	38	38	JAK3	C	3	3
NLRP13	126204	broad.mit.edu	36	19	61115347	61115347	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:61115347G>T	uc002qmg.1	-	c.1648C>A	c.(1648-1650)CTA>ATA	p.L550I		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	550	NACHT.						ATP binding			ovary(3)|skin(2)|pancreas(1)|lung(1)	7		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)										0.137931	39.560446	65.316534	28	175	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61115347	61115347	10878	19	G	T	T	34	34	NLRP13	T	3	3
ZNF460	10794	broad.mit.edu	36	19	62494510	62494510	+	Silent	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:62494510C>T	uc002qog.2	+	c.789C>T	c.(787-789)CGC>CGT	p.R263R		NM_006635	NP_006626	Q14592	ZN460_HUMAN	zinc finger protein 460	263	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)										0.4375	61.474898	61.636605	21	27	CC		KEEP	---	---	---	---	capture			Silent	SNP	62494510	62494510	18517	19	C	T	T	27	27	ZNF460	T	1	1
A1BG	1	broad.mit.edu	36	19	63550588	63550588	+	Missense_Mutation	SNP	A	T	T			TCGA-19-2621-01	TCGA-19-2621-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:63550588A>T	uc002qsd.2	-	c.1423T>A	c.(1423-1425)TGG>AGG	p.W475R	A1BG-AS_uc002qse.2_5'Flank	NM_130786	NP_570602	P04217	A1BG_HUMAN	alpha 1B-glycoprotein precursor	475	Ig-like V-type 5.					extracellular region					0		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)										0.933333	38.719326	40.664875	14	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	63550588	63550588	1	19	A	T	T	7	7	A1BG	T	4	4
A1BG	1	broad.mit.edu	36	19	63550591	63550592	+	Missense_Mutation	DNP	AG	GC	GC			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:63550591_63550592AG>GC	uc002qsd.2	-	c.1419_1420CT>GC	c.(1417-1422)CGCTCC>CGGCCC	p.S474P	A1BG-AS_uc002qse.2_5'Flank	NM_130786	NP_570602	P04217	A1BG_HUMAN	alpha 1B-glycoprotein precursor	474	Ig-like V-type 5.					extracellular region					0		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)										0.875	17.904395	18.919637	7	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	63550591	63550592	1	19	AG	GC	GC	11	11	A1BG	GC	4	4
DUSP10	11221	broad.mit.edu	36	1	219942565	219942565	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:219942565C>T	uc001hmy.1	-	c.1261G>A	c.(1261-1263)GCT>ACT	p.A421T	DUSP10_uc001hmx.1_Missense_Mutation_p.A79T|DUSP10_uc001hmz.1_Missense_Mutation_p.A79T	NM_007207	NP_009138	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10 isoform a	421	Tyrosine-protein phosphatase.				inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|negative regulation of stress-activated MAPK cascade	Golgi apparatus|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0				GBM - Glioblastoma multiforme(131;0.0103)										0.329489	529.247427	544.864857	200	407	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	219942565	219942565	4995	1	C	T	T	27	27	DUSP10	T	1	1
E2F2	1870	broad.mit.edu	36	1	23723512	23723512	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:23723512G>A	uc001bhe.1	-	c.308C>T	c.(307-309)CCA>CTA	p.P103L		NM_004091	NP_004082	Q14209	E2F2_HUMAN	E2F transcription factor 2	103	Cyclin A/CDK2 binding (Potential).				G1 phase of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	transcription factor complex	DNA binding|RNA polymerase II transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(2)|skin(2)	4		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.52e-24)|Colorectal(126;6.25e-08)|COAD - Colon adenocarcinoma(152;3.42e-06)|GBM - Glioblastoma multiforme(114;8.98e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|KIRC - Kidney renal clear cell carcinoma(1967;0.00366)|STAD - Stomach adenocarcinoma(196;0.0132)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.0888)|LUSC - Lung squamous cell carcinoma(448;0.19)										0.444444	57.587579	57.709411	20	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23723512	23723512	5053	1	G	A	A	47	47	E2F2	A	2	2
IQCC	55721	broad.mit.edu	36	1	32446257	32446257	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2621-01	TCGA-19-2621-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:32446257A>G	uc009vua.1	+	c.1628A>G	c.(1627-1629)GAA>GGA	p.E543G	IQCC_uc001bum.1_Missense_Mutation_p.E463G|DCDC2B_uc001bun.2_5'Flank	NM_018134	NP_060604	Q4KMZ1	IQCC_HUMAN	IQ motif containing C	463										ovary(4)	4		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)												0.307692	7.191201	7.622368	4	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32446257	32446257	8105	1	A	G	G	9	9	IQCC	G	4	4
NFYC	4802	broad.mit.edu	36	1	41009072	41009072	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:41009072G>T	uc001cge.2	+	c.1362G>T	c.(1360-1362)CAG>CAT	p.Q454H	NFYC_uc001cfz.2_Missense_Mutation_p.Q330H|NFYC_uc009vwd.1_Missense_Mutation_p.Q331H|NFYC_uc001cfx.2_Missense_Mutation_p.Q350H|NFYC_uc001cfy.2_Missense_Mutation_p.Q331H|NFYC_uc001cgb.2_Missense_Mutation_p.Q435H|NFYC_uc001cgd.2_Missense_Mutation_p.Q331H	NM_014223	NP_055038	Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma isoform 2	454					protein folding|regulation of transcription from RNA polymerase II promoter	CCAAT-binding factor complex	protein binding|RNA polymerase II transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			breast(2)|kidney(1)	3	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)											0.468085	126.986929	127.070336	44	50	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41009072	41009072	10791	1	G	T	T	35	35	NFYC	T	3	3
SLC1A7	6512	broad.mit.edu	36	1	53328904	53328904	+	Silent	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:53328904G>A	uc001cuy.1	-	c.1194C>T	c.(1192-1194)TAC>TAT	p.Y398Y	SLC1A7_uc001cux.1_De_novo_Start_OutOfFrame	NM_006671	NP_006662	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter),	398						integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)	NSCLC(128;80 1811 21245 38490 51715)								0.421053	20.926234	21.021233	8	11	GG		KEEP	---	---	---	---	capture			Silent	SNP	53328904	53328904	14933	1	G	A	A	40	40	SLC1A7	A	1	1
LRRC40	55631	broad.mit.edu	36	1	70397617	70397617	+	Nonsense_Mutation	SNP	T	A	A			TCGA-19-2621-01	TCGA-19-2621-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:70397617T>A	uc001der.1	-	c.1204A>T	c.(1204-1206)AAA>TAA	p.K402*		NM_017768	NP_060238	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	402	LRR 13.									ovary(1)	1														0.212121	8.91792	11.445275	7	26	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	70397617	70397617	9373	1	T	A	A	64	64	LRRC40	A	5	4
PIK3CD	5293	broad.mit.edu	36	1	9693212	9693212	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:9693212C>T	uc001aqe.2	+	c.112C>T	c.(112-114)CGC>TGC	p.R38C	PIK3CD_uc001aqb.2_Missense_Mutation_p.R38C|PIK3CD_uc001aqa.2_Missense_Mutation_p.R38C	NM_005026	NP_005017	O00329	PK3CD_HUMAN	phosphoinositide-3-kinase, catalytic, delta	38					phosphatidylinositol-mediated signaling|protein phosphorylation	phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(2)|central_nervous_system(1)	3	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)						859				0.155738	31.963375	45.763657	19	103	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9693212	9693212	12339	1	C	T	T	23	23	PIK3CD	T	1	1
KIF16B	55614	broad.mit.edu	36	20	16433145	16433145	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:16433145G>A	uc010gci.1	-	c.1048C>T	c.(1048-1050)CGC>TGC	p.R350C	KIF16B_uc002wpg.1_Missense_Mutation_p.R350C|KIF16B_uc010gch.1_Missense_Mutation_p.R350C|KIF16B_uc010gcj.1_Missense_Mutation_p.R350C	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	350	Kinesin-motor.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7														0.12766	30.896293	56.292109	24	164	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16433145	16433145	8589	20	G	A	A	37	37	KIF16B	A	1	1
CST9L	128821	broad.mit.edu	36	20	23497050	23497050	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:23497050G>A	uc002wtk.2	-	c.38C>T	c.(37-39)GCG>GTG	p.A13V		NM_080610	NP_542177	Q9H4G1	CST9L_HUMAN	cystatin 9-like precursor	13						extracellular region	cysteine-type endopeptidase inhibitor activity				0	Colorectal(13;0.0431)|Lung NSC(19;0.235)													0.575758	51.520958	51.68566	19	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23497050	23497050	4121	20	G	A	A	38	38	CST9L	A	1	1
ZNF335	63925	broad.mit.edu	36	20	44025974	44025974	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:44025974G>A	uc002xqw.1	-	c.1165C>T	c.(1165-1167)CCC>TCC	p.P389S		NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	389					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)												0.15	14.844301	21.884533	9	51	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44025974	44025974	18444	20	G	A	A	41	41	ZNF335	A	2	2
CTCFL	140690	broad.mit.edu	36	20	55511946	55511946	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:55511946C>T	uc010giw.1	-	c.1792G>A	c.(1792-1794)GGT>AGT	p.G598S	CTCFL_uc010giu.1_Non-coding_Transcript|CTCFL_uc010giv.1_Non-coding_Transcript|CTCFL_uc010gix.1_Missense_Mutation_p.G598S|CTCFL_uc002xym.2_Missense_Mutation_p.G598S|CTCFL_uc010giy.1_Missense_Mutation_p.G268S|CTCFL_uc010giz.1_Missense_Mutation_p.G186S|CTCFL_uc010gja.1_Missense_Mutation_p.G548S|CTCFL_uc010gjb.1_Missense_Mutation_p.G598S|CTCFL_uc010gjc.1_Missense_Mutation_p.G598S|CTCFL_uc010gjd.1_Missense_Mutation_p.G598S|CTCFL_uc010gje.1_Missense_Mutation_p.G598S|CTCFL_uc010gjf.1_Missense_Mutation_p.G393S|CTCFL_uc010gjg.1_Missense_Mutation_p.G330S	NM_080618	NP_542185	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor-like protein	598					cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of gene expression|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|promoter binding|transcription activator activity|zinc ion binding			ovary(2)|large_intestine(1)	3	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)											0.355114	360.631887	367.117642	125	227	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55511946	55511946	4160	20	C	T	T	22	22	CTCFL	T	2	2
DNMT3L	29947	broad.mit.edu	36	21	44505544	44505544	+	Silent	SNP	T	A	A			TCGA-19-2621-01	TCGA-19-2621-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr21:44505544T>A	uc002zeh.1	-	c.27A>T	c.(25-27)CCA>CCT	p.P9P	DNMT3L_uc002zeg.1_Silent_p.P9P	NM_013369	NP_037501	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein	9					DNA methylation|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|transcription repressor activity|zinc ion binding				0				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)										0.6	6.721549	6.764518	3	2	TT		KEEP	---	---	---	---	capture			Silent	SNP	44505544	44505544	4861	21	T	A	A	55	55	DNMT3L	A	4	4
MCM3AP	8888	broad.mit.edu	36	21	46516986	46516986	+	Silent	SNP	T	C	C			TCGA-19-2621-01	TCGA-19-2621-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr21:46516986T>C	uc002zir.1	-	c.2382A>G	c.(2380-2382)AGA>AGG	p.R794R		NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	794					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)									639				0.185714	16.418554	22.931372	13	57	TT		KEEP	---	---	---	---	capture			Silent	SNP	46516986	46516986	9777	21	T	C	C	62	62	MCM3AP	C	4	4
ITGB6	3694	broad.mit.edu	36	2	160761094	160761094	+	Silent	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:160761094G>A	uc002ubh.2	-	c.225C>T	c.(223-225)ATC>ATT	p.I75I	ITGB6_uc010fou.1_Silent_p.I75I|ITGB6_uc010fov.1_Silent_p.I75I|ITGB6_uc010fow.1_Non-coding_Transcript	NM_000888	NP_000879	P18564	ITB6_HUMAN	integrin, beta 6	75	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3									p.I75I(DAUDI-Tumor)	575				0.176829	117.866519	150.13692	58	270	GG		KEEP	---	---	---	---	capture			Silent	SNP	160761094	160761094	8203	2	G	A	A	37	37	ITGB6	A	1	1
LRP2	4036	broad.mit.edu	36	2	169763591	169763591	+	Silent	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:169763591G>A	uc002ues.1	-	c.8529C>T	c.(8527-8529)GAC>GAT	p.D2843D		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	2843	LDL-receptor class A 19.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	23				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)					2055				0.718391	392.510485	399.962208	125	49	GG		KEEP	---	---	---	---	capture			Silent	SNP	169763591	169763591	9329	2	G	A	A	40	40	LRP2	A	1	1
ALS2CR11	151254	broad.mit.edu	36	2	202148257	202148257	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:202148257C>T	uc002uyf.1	-	c.677G>A	c.(676-678)GGA>GAA	p.G226E	ALS2CR11_uc002uye.1_Missense_Mutation_p.G226E|ALS2CR11_uc010fti.1_Missense_Mutation_p.G226E	NM_152525	NP_689738	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	226										large_intestine(1)|ovary(1)	2														0.107143	9.318323	22.177162	9	75	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	202148257	202148257	555	2	C	T	T	30	30	ALS2CR11	T	2	2
DGKD	8527	broad.mit.edu	36	2	234023458	234023458	+	Silent	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:234023458C>T	uc002vui.1	+	c.1980C>T	c.(1978-1980)TGC>TGT	p.C660C	DGKD_uc002vuj.1_Silent_p.C616C|DGKD_uc010fyh.1_Silent_p.C527C|DGKD_uc010fyi.1_Non-coding_Transcript	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	660					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)									0.5	73.206268	73.206268	25	25	CC		KEEP	---	---	---	---	capture			Silent	SNP	234023458	234023458	4646	2	C	T	T	26	26	DGKD	T	2	2
C2orf85	285093	broad.mit.edu	36	2	242463488	242463488	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2621-01	TCGA-19-2621-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:242463488T>A	uc010fzu.1	+	c.1108T>A	c.(1108-1110)TTC>ATC	p.F370I		NM_173821	NP_776182	Q14D33	CB085_HUMAN	hypothetical protein LOC285093	370						integral to membrane				ovary(1)	1														0.6	8.025858	8.069937	3	2	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	242463488	242463488	2292	2	T	A	A	56	56	C2orf85	A	4	4
LOXL3	84695	broad.mit.edu	36	2	74615356	74615356	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:74615356C>T	uc002smp.1	-	c.1633G>A	c.(1633-1635)GAA>AAA	p.E545K	LOXL3_uc002smo.1_Missense_Mutation_p.E184K|LOXL3_uc010ffm.1_Missense_Mutation_p.E489K|LOXL3_uc002smq.1_Missense_Mutation_p.E400K|LOXL3_uc010ffn.1_Missense_Mutation_p.E400K	NM_032603	NP_115992	P58215	LOXL3_HUMAN	lysyl oxidase-like 3 precursor	545	Lysyl-oxidase like.				oxidation-reduction process	extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity				0														0.607843	189.960616	191.000163	62	40	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74615356	74615356	9274	2	C	T	T	31	31	LOXL3	T	1	1
COL6A6	131873	broad.mit.edu	36	3	131767087	131767087	+	Silent	SNP	G	C	C			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:131767087G>C	uc010htl.1	+	c.1221G>C	c.(1219-1221)CTG>CTC	p.L407L		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6	407	Nonhelical region.|VWFA 2.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8														0.190476	7.187688	9.069219	4	17	GG		KEEP	---	---	---	---	capture			Silent	SNP	131767087	131767087	3841	3	G	C	C	46	46	COL6A6	C	3	3
C3orf20	84077	broad.mit.edu	36	3	14699500	14699500	+	Silent	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:14699500G>A	uc003byy.1	+	c.276G>A	c.(274-276)AAG>AAA	p.K92K	C3orf20_uc003byx.1_Silent_p.K92K|C3orf20_uc003byz.1_5'UTR|C3orf20_uc003bza.1_5'UTR	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	92						cytoplasm|integral to membrane				ovary(3)	3														0.315789	9.967786	10.58689	6	13	GG		KEEP	---	---	---	---	capture			Silent	SNP	14699500	14699500	2306	3	G	A	A	33	33	C3orf20	A	2	2
ENPEP	2028	broad.mit.edu	36	4	111617181	111617181	+	Silent	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:111617181G>A	uc003iab.2	+	c.162G>A	c.(160-162)GCG>GCA	p.A54A		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	54	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)									0.351562	228.056373	232.947741	90	166	GG		KEEP	---	---	---	---	capture			Silent	SNP	111617181	111617181	5321	4	G	A	A	38	38	ENPEP	A	1	1
C4orf49	84709	broad.mit.edu	36	4	140407505	140407505	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:140407505C>G	uc003ihr.1	-	c.421G>C	c.(421-423)GGT>CGT	p.G141R		NM_032623	NP_116012	Q8TDB4	CD049_HUMAN	ovary-specific acidic protein	141						integral to membrane				central_nervous_system(1)	1														0.399015	224.91395	226.729238	81	122	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140407505	140407505	2372	4	C	G	G	24	24	C4orf49	G	3	3
ATOH1	474	broad.mit.edu	36	4	94969184	94969184	+	Silent	SNP	C	A	A			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:94969184C>A	uc003hta.1	+	c.84C>A	c.(82-84)CTC>CTA	p.L28L		NM_005172	NP_005163	Q92858	ATOH1_HUMAN	atonal homolog 1	28					transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulator activity				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)										0.75	6.436802	6.645831	3	1	CC		KEEP	---	---	---	---	capture			Silent	SNP	94969184	94969184	1131	4	C	A	A	30	30	ATOH1	A	3	3
PCDHA6	56142	broad.mit.edu	36	5	140187975	140187975	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140187975G>T	uc003lho.1	+	c.115G>T	c.(115-117)GCC>TCC	p.A39S	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA4_uc003lhi.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.1_Intron|PCDHA6_uc003lhn.1_Missense_Mutation_p.A39S|PCDHA6_uc003lhm.1_Missense_Mutation_p.A39S	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	39	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.181818	6.435693	9.578711	6	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140187975	140187975	11948	5	G	T	T	42	42	PCDHA6	T	3	3
N4BP3	23138	broad.mit.edu	36	5	177480025	177480025	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2621-01	TCGA-19-2621-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:177480025T>A	uc003mik.1	+	c.571T>A	c.(571-573)TCC>ACC	p.S191T	N4BP3_uc003mil.1_5'Flank	NM_015111	NP_055926	O15049	N4BP3_HUMAN	Nedd4 binding protein 3	191						cytoplasmic vesicle membrane					0	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)											0.172414	6.454873	9.400347	5	24	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	177480025	177480025	10508	5	T	A	A	54	54	N4BP3	A	4	4
STX11	8676	broad.mit.edu	36	6	144549671	144549671	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2621-01	TCGA-19-2621-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:144549671T>C	uc003qks.2	+	c.214T>C	c.(214-216)TTC>CTC	p.F72L	STX11_uc010khp.1_Missense_Mutation_p.F72L	NM_003764	NP_003755	O75558	STX11_HUMAN	syntaxin 11	72					cellular membrane fusion|intracellular protein transport|vesicle-mediated transport	Golgi apparatus|membrane	SNAP receptor activity			ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)										0.444444	7.066133	7.09445	4	5	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	144549671	144549671	15857	6	T	C	C	56	56	STX11	C	4	4
STXBP5	134957	broad.mit.edu	36	6	147726411	147726411	+	Silent	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:147726411G>A	uc003qlz.2	+	c.2793G>A	c.(2791-2793)CAG>CAA	p.Q931Q	STXBP5_uc010khz.1_Silent_p.Q895Q|STXBP5_uc003qlx.2_Non-coding_Transcript|STXBP5_uc003qly.2_Silent_p.Q586Q	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	931	WD 12.				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)										0.196262	45.713812	54.914412	21	86	GG		KEEP	---	---	---	---	capture			Silent	SNP	147726411	147726411	15876	6	G	A	A	33	33	STXBP5	A	2	2
UHRF1BP1	54887	broad.mit.edu	36	6	34939877	34939877	+	Silent	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:34939877G>A	uc003oju.2	+	c.3336G>A	c.(3334-3336)TTG>TTA	p.L1112L	UHRF1BP1_uc010jvm.1_Non-coding_Transcript|UHRF1BP1_uc010jvn.1_Non-coding_Transcript|UHRF1BP1_uc010jvo.1_Intron	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	1112										ovary(3)	3														0.556548	577.65038	578.592404	187	149	GG		KEEP	---	---	---	---	capture			Silent	SNP	34939877	34939877	17526	6	G	A	A	47	47	UHRF1BP1	A	2	2
CRISP3	10321	broad.mit.edu	36	6	49811235	49811235	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:49811235G>A	uc003ozs.1	-	c.218C>T	c.(217-219)GCC>GTC	p.A73V	CRISP3_uc003ozt.2_Missense_Mutation_p.A73V	NM_006061	NP_006052	P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3	73					innate immune response	proteinaceous extracellular matrix|specific granule				skin(1)	1	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)											0.18	54.14442	68.584095	27	123	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49811235	49811235	4020	6	G	A	A	42	42	CRISP3	A	2	2
SLC17A5	26503	broad.mit.edu	36	6	74408199	74408199	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:74408199G>A	uc003phn.2	-	c.461C>T	c.(460-462)CCC>CTC	p.P154L	SLC17A5_uc010kay.1_Non-coding_Transcript	NM_012434	NP_036566	Q9NRA2	S17A5_HUMAN	sialin	154	Helical; (Potential).				anion transport	integral to plasma membrane|lysosomal membrane|membrane fraction	sialic acid:hydrogen symporter activity				0														0.117647	35.338382	69.538223	28	210	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74408199	74408199	14916	6	G	A	A	43	43	SLC17A5	A	2	2
POU3F2	5454	broad.mit.edu	36	6	99390614	99390614	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:99390614C>T	uc003ppe.1	+	c.1144C>T	c.(1144-1146)CAG>TAG	p.Q382*		NM_005604	NP_005595	P20265	PO3F2_HUMAN	POU domain, class 3, transcription factor 2	382	Homeobox.				positive regulation of cell proliferation		identical protein binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity				0		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)										0.6	109.197403	109.721595	36	24	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	99390614	99390614	12705	6	C	T	T	21	21	POU3F2	T	5	2
EGFR	1956	broad.mit.edu	36	7	55200615	55200615	+	Missense_Mutation	SNP	G	T	T	rs28384376	unknown	TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:55200615G>T	uc003tqk.1	+	c.1871G>T	c.(1870-1872)TGC>TTC	p.C624F	EGFR_uc003tqi.1_Missense_Mutation_p.C624F|EGFR_uc003tqj.1_Missense_Mutation_p.C624F|EGFR_uc010kzg.1_Missense_Mutation_p.C579F|EGFR_uc003tqn.1_Non-coding_Transcript	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	624	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.C624F(1)		lung(8200)|central_nervous_system(103)|upper_aerodigestive_tract(37)|prostate(32)|ovary(31)|thyroid(23)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|stomach(6)|urinary_tract(6)|skin(5)|adrenal_gland(5)|kidney(4)|soft_tissue(4)|bone(3)|NS(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)|pancreas(1)	8515	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)			8		608	TCGA GBM(3;<1E-8)|TSP Lung(4;<1E-8)			0.95614	2195.798525	2255.120752	654	30	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55200615	55200615	5156	7	G	T	T	46	46	EGFR	T	3	3
SAMD9	54809	broad.mit.edu	36	7	92572420	92572420	+	Silent	SNP	A	T	T			TCGA-19-2621-01	TCGA-19-2621-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:92572420A>T	uc003umf.1	-	c.927T>A	c.(925-927)ATT>ATA	p.I309I	SAMD9_uc003umg.1_Silent_p.I309I|SAMD9_uc010lfa.1_Silent_p.I309I	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	309						cytoplasm				ovary(3)|breast(1)|central_nervous_system(1)	5	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)											0.288136	41.455955	43.82841	17	42	AA		KEEP	---	---	---	---	capture			Silent	SNP	92572420	92572420	14306	7	A	T	T	13	13	SAMD9	T	4	4
MYST3	7994	broad.mit.edu	36	8	41910141	41910141	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:41910141C>T	uc010lxb.1	-	c.4754G>A	c.(4753-4755)AGC>AAC	p.S1585N	MYST3_uc010lxc.1_Missense_Mutation_p.S1585N|MYST3_uc003xon.2_Missense_Mutation_p.S1585N	NM_001099412	NP_006757	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	1585	Interaction with RUNX1-2.				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription activator activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)							476				0.456311	140.127498	140.295995	47	56	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41910141	41910141	10499	8	C	T	T	28	28	MYST3	T	2	2
ST18	9705	broad.mit.edu	36	8	53242020	53242020	+	Nonsense_Mutation	SNP	G	T	T			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:53242020G>T	uc003xqz.1	-	c.1149C>A	c.(1147-1149)TAC>TAA	p.Y383*	ST18_uc003xra.1_Nonsense_Mutation_p.Y383*|ST18_uc003xrb.1_Nonsense_Mutation_p.Y383*	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	383	C2HC-type 1.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)												0.2	9.464412	12.832597	8	32	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	53242020	53242020	15730	8	G	T	T	44	44	ST18	T	5	3
C9orf93	203238	broad.mit.edu	36	9	15734738	15734738	+	Silent	SNP	G	T	T			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:15734738G>T	uc003zmd.1	+	c.2517G>T	c.(2515-2517)GTG>GTT	p.V839V	C9orf93_uc010mih.1_Silent_p.V847V|C9orf93_uc003zme.1_Silent_p.V754V|C9orf93_uc003zmf.1_Silent_p.V147V	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238	839											0				GBM - Glioblastoma multiforme(50;4.84e-07)										0.316667	53.702382	55.496367	19	41	GG		KEEP	---	---	---	---	capture			Silent	SNP	15734738	15734738	2622	9	G	T	T	48	48	C9orf93	T	3	3
BRCC3	79184	broad.mit.edu	36	X	153960093	153960093	+	Silent	SNP	T	C	C			TCGA-19-2621-01	TCGA-19-2621-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:153960093T>C	uc004fna.1	+	c.324T>C	c.(322-324)GCT>GCC	p.A108A	BRCC3_uc004fnb.1_Silent_p.A108A	NM_024332	NP_077308	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3	108					double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|positive regulation of DNA repair|response to X-ray	BRCA1-A complex|BRISC complex|nuclear ubiquitin ligase complex	enzyme regulator activity|metal ion binding|metallopeptidase activity|polyubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(3)|large_intestine(1)|ovary(1)	5	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)									82				0.92	76.71065	80.82435	23	2	TT		KEEP	---	---	---	---	capture			Silent	SNP	153960093	153960093	1531	23	T	C	C	55	55	BRCC3	C	4	4
REPS2	9185	broad.mit.edu	36	X	16975435	16975435	+	Silent	SNP	C	T	T			TCGA-19-2621-01	TCGA-19-2621-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:16975435C>T	uc004cxv.1	+	c.816C>T	c.(814-816)CCC>CCT	p.P272P	REPS2_uc004cxw.1_Silent_p.P271P	NM_004726	NP_004717	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	272					epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding			central_nervous_system(1)|skin(1)	2	Hepatocellular(33;0.183)													0.12204	88.849963	165.689041	67	482	CC		KEEP	---	---	---	---	capture			Silent	SNP	16975435	16975435	13698	23	C	T	T	23	23	REPS2	T	1	1
FAM120C	54954	broad.mit.edu	36	X	54175940	54175940	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2621-01	TCGA-19-2621-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:54175940G>A	uc004dsz.2	-	c.1972C>T	c.(1972-1974)CGT>TGT	p.R658C		NM_017848	NP_060318	Q9NX05	F120C_HUMAN	hypothetical protein LOC54954	658										ovary(1)|central_nervous_system(1)	2														0.162791	6.998824	11.658097	7	36	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54175940	54175940	5615	23	G	A	A	37	37	FAM120C	A	1	1
APOOL	139322	broad.mit.edu	36	X	84197550	84197550	+	Silent	SNP	A	G	G			TCGA-19-2621-01	TCGA-19-2621-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:84197550A>G	uc004eem.1	+	c.357A>G	c.(355-357)ACA>ACG	p.T119T	APOOL_uc010nmp.1_Intron	NM_198450	NP_940852	Q6UXV4	APOOL_HUMAN	apolipoprotein O-like	119						extracellular region					0														0.1875	7.315523	8.778439	3	13	AA		KEEP	---	---	---	---	capture			Silent	SNP	84197550	84197550	825	23	A	G	G	7	7	APOOL	G	4	4
SLC29A2	3177	broad.mit.edu	36	11	65895366	65895371	+	In_Frame_Del	DEL	GTGGTA	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:65895366_65895371delGTGGTA	uc001oht.1	-	c.31_36delTACCAC	c.(31-36)TACCACdel	p.YH11del	SLC29A2_uc001ohs.1_5'Flank|SLC29A2_uc009yrf.1_5'UTR|SLC29A2_uc001ohu.1_In_Frame_Del_p.YH11del|SLC29A2_uc001ohv.1_In_Frame_Del_p.YH11del	NM_001532	NP_001523	Q14542	S29A2_HUMAN	solute carrier family 29 (nucleoside	11_12					cell proliferation|nucleobase, nucleoside and nucleotide metabolic process	basolateral plasma membrane|integral to plasma membrane|nuclear membrane|nucleolus	nucleoside transmembrane transporter activity			ovary(1)	1														0.44			32	40				---	---	---	---	capture_indel			In_Frame_Del	DEL	65895366	65895371	15032	11	GTGGTA	-	-	44	44	SLC29A2	-	5	5
MTL5	9633	broad.mit.edu	36	11	68274267	68274267	+	Frame_Shift_Del	DEL	T	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:68274267_68274267delT	uc001ooc.1	-	c.438_438delA	c.(436-438)GAAfs	p.E146fs	MTL5_uc001ood.1_Frame_Shift_Del_p.E146fs|MTL5_uc009ysi.1_Frame_Shift_Del_p.E146fs|MTL5_uc001ooe.2_Frame_Shift_Del_p.E146fs	NM_004923	NP_004914	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific isoform	146					cell differentiation|cellular metal ion homeostasis|multicellular organismal development|response to metal ion|spermatogenesis	cytoplasm|nucleus|soluble fraction	metal ion binding			ovary(2)|breast(1)	3	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)											0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	68274267	68274267	10329	11	T	-	-	56	56	MTL5	-	5	5
HSPB8	26353	broad.mit.edu	36	12	118101759	118101760	+	Frame_Shift_Ins	INS	-	C	C			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:118101759_118101760insC	uc001txb.1	+	c.259_260insC	c.(259-261)ACCfs	p.T87fs	HSPB8_uc001txc.1_Frame_Shift_Ins_p.T87fs	NM_014365	NP_055180	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8	87					cell death|response to heat	cytoplasm|nucleus	identical protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)									174				0.31			4	9				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	118101759	118101760	7723	12	-	C	C	10	10	HSPB8	C	5	5
ESPL1	9700	broad.mit.edu	36	12	51957596	51957596	+	Frame_Shift_Del	DEL	G	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:51957596_51957596delG	uc001sck.2	+	c.2161_2161delG	c.(2161-2163)GATfs	p.D721fs	ESPL1_uc001scj.2_Frame_Shift_Del_p.D396fs	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	extra spindle poles like 1	721					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)	2						Colon(53;1069 1201 2587 5382)								0.38			82	134				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	51957596	51957596	5446	12	G	-	-	33	33	ESPL1	-	5	5
PPFIA2	8499	broad.mit.edu	36	12	80280668	80280669	+	Frame_Shift_Ins	INS	-	T	T			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:80280668_80280669insT	uc001szo.1	-	c.1571_1572insA	c.(1570-1572)AAGfs	p.K524fs	PPFIA2_uc009zsh.1_Non-coding_Transcript|PPFIA2_uc009zsi.1_Non-coding_Transcript	NM_003625	NP_003616	O75334	LIPA2_HUMAN	PTPRF interacting protein alpha 2	524	Glu-rich.|Potential.				cell-matrix adhesion	cell surface|cytoplasm	protein binding			ovary(3)|lung(2)|pancreas(1)	6														0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	80280668	80280669	12740	12	-	T	T	28	28	PPFIA2	T	5	5
WDHD1	11169	broad.mit.edu	36	14	54503012	54503037	+	Frame_Shift_Del	DEL	ATAACCATTTTTAGCTAAATAATCAA	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:54503012_54503037delATAACCATTTTTAGCTAAATAATCAA	uc001xbm.1	-	c.2216_2241delTTGATTATTTAGCTAAAAATGGTTAT	c.(2215-2241)CTTGATTATTTAGCTAAAAATGGTTATfs	p.L739fs	WDHD1_uc010aom.1_Frame_Shift_Del_p.L256fs|WDHD1_uc001xbn.1_Frame_Shift_Del_p.L616fs	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	739_747						cytoplasm|nucleoplasm	DNA binding				0									p.D617D(OVKATE-Tumor)|p.G623G(SNGM-Tumor)	606				0.32			42	88				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	54503012	54503037	17844	14	ATAACCATTTTTAGCTAAATAATCAA	-	-	8	8	WDHD1	-	5	5
PPL	5493	broad.mit.edu	36	16	4875269	4875274	+	In_Frame_Del	DEL	CCTCCC	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:4875269_4875274delCCTCCC	uc002cyd.1	-	c.3383_3388delGGGAGG	c.(3382-3390)AGGGAGGTC>ATC	p.1128_1130REV>I		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	1128_1130	Potential.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)	4														0.33			15	30				---	---	---	---	capture_indel			In_Frame_Del	DEL	4875269	4875274	12769	16	CCTCCC	-	-	18	18	PPL	-	5	5
ZDHHC1	29800	broad.mit.edu	36	16	65990333	65990333	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:65990333_65990333delA	uc002etc.1	-	c.546_546delT	c.(544-546)AGTfs	p.S182fs		NM_013304	NP_037436	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	182	DHHC-type.					integral to membrane	DNA binding|zinc ion binding				0		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	65990333	65990333	18188	16	A	-	-	6	6	ZDHHC1	-	5	5
BCMO1	53630	broad.mit.edu	36	16	79861406	79861410	+	Frame_Shift_Del	DEL	AACAG	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:79861406_79861410delAACAG	uc002fgn.1	+	c.985_989delAACAG	c.(985-990)AACAGCfs	p.N329fs		NM_017429	NP_059125	Q9HAY6	BCDO1_HUMAN	beta-carotene 15, 15'-monooxygenase 1	329_330					oxidation-reduction process|retinoid metabolic process|steroid metabolic process	cytosol	beta-carotene 15,15'-monooxygenase activity|metal ion binding				0														0.33			81	168				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	79861406	79861410	1405	16	AACAG	-	-	5	5	BCMO1	-	5	5
C17orf63	55731	broad.mit.edu	36	17	24111002	24111002	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:24111002_24111002delA	uc002hcu.1	-	c.101_101delT	c.(100-102)ATGfs	p.M34fs	C17orf63_uc002hct.1_5'UTR|C17orf63_uc002hcv.1_Frame_Shift_Del_p.M34fs|C17orf63_uc002hcw.2_Intron	NM_018182	NP_060652	Q8WU58	CQ063_HUMAN	hypothetical protein LOC55731	34										ovary(1)	1	all_epithelial(6;5.06e-20)|Lung NSC(42;0.01)		Epithelial(11;3.38e-06)|all cancers(11;2.46e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.104)											0.53			8	7				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	24111002	24111002	1928	17	A	-	-	8	8	C17orf63	-	5	5
OBSCN	84033	broad.mit.edu	36	1	226540593	226540606	+	Frame_Shift_Del	DEL	CGGCAGCTGGCGCT	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:226540593_226540606delCGGCAGCTGGCGCT	uc009xez.1	+	c.9196_9209delCGGCAGCTGGCGCT	c.(9196-9210)CGGCAGCTGGCGCTCfs	p.R3066fs	OBSCN_uc001hsn.1_Frame_Shift_Del_p.R3066fs|OBSCN_uc001hsq.1_Frame_Shift_Del_p.R322fs	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	3066_3070	Ig-like 30.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			large_intestine(7)|breast(5)|ovary(4)|skin(2)|stomach(1)|central_nervous_system(1)|pancreas(1)	21		Prostate(94;0.0405)								4006				0.53			17	15				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	226540593	226540606	11217	1	CGGCAGCTGGCGCT	-	-	27	27	OBSCN	-	5	5
MN1	4330	broad.mit.edu	36	22	26524077	26524101	+	Frame_Shift_Del	DEL	GGTTGTCCTTGGAGCTGGGCTTGTT	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:26524077_26524101delGGTTGTCCTTGGAGCTGGGCTTGTT	uc003adj.1	-	c.2431_2455delAACAAGCCCAGCTCCAAGGACAACC	c.(2431-2457)AACAAGCCCAGCTCCAAGGACAACCTGfs	p.N811fs		NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1	811_819							binding			central_nervous_system(3)|large_intestine(1)|ovary(1)	5										140				0.52			15	14				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	26524077	26524101	10064	22	GGTTGTCCTTGGAGCTGGGCTTGTT	-	-	35	35	MN1	-	5	5
PHLDB2	90102	broad.mit.edu	36	3	113086809	113086813	+	Frame_Shift_Del	DEL	AGACA	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:113086809_113086813delAGACA	uc010hqa.1	+	c.1195_1199delAGACA	c.(1195-1200)AGACAGfs	p.R399fs	PHLDB2_uc003dyc.1_Frame_Shift_Del_p.R426fs|PHLDB2_uc003dyd.1_Frame_Shift_Del_p.R399fs|PHLDB2_uc003dyf.2_Frame_Shift_Del_p.R399fs|PHLDB2_uc003dyg.1_Frame_Shift_Del_p.R399fs|PHLDB2_uc003dyh.1_Frame_Shift_Del_p.R399fs|PHLDB2_uc003dye.2_Frame_Shift_Del_p.R399fs	NM_145753	NP_665696	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,	399_400						cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)	4														0.46			67	80				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	113086809	113086813	12276	3	AGACA	-	-	7	7	PHLDB2	-	5	5
NAA11	84779	broad.mit.edu	36	4	80465940	80465952	+	Frame_Shift_Del	DEL	GGCCAGGAAAGGC	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:80465940_80465952delGGCCAGGAAAGGC	uc003hlt.2	-	c.104_116delGCCTTTCCTGGCC	c.(103-117)GGCCTTTCCTGGCCCfs	p.G35fs		NM_032693	NP_116082	Q9BSU3	NAA11_HUMAN	ARD1 homolog B protein	35_39	Interaction with NAA15 (By similarity).|N-acetyltransferase.					cytoplasm|nucleus	peptide alpha-N-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2														0.31			170	374				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	80465940	80465952	10512	4	GGCCAGGAAAGGC	-	-	43	43	NAA11	-	5	5
IP6K3	117283	broad.mit.edu	36	6	33798935	33798936	+	Frame_Shift_Ins	INS	-	G	G			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:33798935_33798936insG	uc003ofb.1	-	c.772_773insC	c.(772-774)CAAfs	p.Q258fs	IP6K3_uc010jvf.1_Frame_Shift_Ins_p.Q258fs	NM_054111	NP_473452	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	258					inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|protein phosphorylation	cytoplasm	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol hexakisphosphate 6-kinase activity|inositol trisphosphate 3-kinase activity				0														0.44			45	57				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	33798935	33798936	8091	6	-	G	G	63	63	IP6K3	G	5	5
PNPLA7	375775	broad.mit.edu	36	9	139481605	139481612	+	Frame_Shift_Del	DEL	GGCCCGGA	-	-			TCGA-19-2621-01	TCGA-19-2621-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:139481605_139481612delGGCCCGGA	uc010ncj.1	-	c.3017_3024delTCCGGGCC	c.(3016-3024)ATCCGGGCCfs	p.I1006fs	PNPLA7_uc004cnd.1_Frame_Shift_Del_p.I247fs|PNPLA7_uc004cne.1_Frame_Shift_Del_p.I247fs|PNPLA7_uc004cnf.2_Frame_Shift_Del_p.I981fs	NM_001098537	NP_001092007	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	981_983	Patatin.				lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity				0	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)										0.64			34	19				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	139481605	139481612	12597	9	GGCCCGGA	-	-	47	47	PNPLA7	-	5	5
