Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CHD5	26038	broad.mit.edu	37	1	6185836	6185836	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6185836C>T	uc001amb.1	-	27	4261	c.4161G>A	c.(4159-4161)CCG>CCA	p.P1387P	CHD5_uc001alz.1_Silent_p.P244P|CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA|CHD5_uc009vlx.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	1387					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TCTGCCCTTCCGGCCTCTCTT	0.587													28	122	---	---	---	---	PASS
SLC25A33	84275	broad.mit.edu	37	1	9613682	9613682	+	Splice_Site	SNP	A	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9613682A>C	uc001apw.2	+	2	280	c.57_splice	c.e2-2	p.G19_splice	SLC25A33_uc001apx.2_Splice_Site	NM_032315	NP_115691	Q9BSK2	S2533_HUMAN	mitochondrial carrier protein MGC4399						transport	integral to membrane|mitochondrial inner membrane					0	all_lung(157;0.246)	all_epithelial(116;1.16e-18)|all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Breast(348;0.00191)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.44e-05)|Kidney(185;0.000262)|KIRC - Kidney renal clear cell carcinoma(229;0.000957)|BRCA - Breast invasive adenocarcinoma(304;0.0019)|STAD - Stomach adenocarcinoma(132;0.00355)|READ - Rectum adenocarcinoma(331;0.0419)		TTTCCCTTACAGGTGTGGAGG	0.408													8	81	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39789864	39789864	+	Splice_Site	SNP	G	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39789864G>C	uc010ois.1	+	35	4457	c.4252_splice	c.e35-1	p.K1418_splice	MACF1_uc001cda.1_Splice_Site_p.K1326_splice|MACF1_uc001cdc.1_Splice_Site_p.K505_splice|MACF1_uc009vvq.1_Splice_Site_p.K475_splice|MACF1_uc001cdb.1_Splice_Site_p.K505_splice	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCCTATTCTAGAAAGTGGTAG	0.383													4	48	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70503804	70503804	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70503804C>A	uc001dep.2	+	19	2213	c.2183C>A	c.(2182-2184)CCA>CAA	p.P728Q	LRRC7_uc009wbg.2_Missense_Mutation_p.P12Q|LRRC7_uc001deq.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	728						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						AGGATTGCACCATCTTTCCCA	0.507													14	158	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79403541	79403541	+	Silent	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79403541G>A	uc001diq.3	-	6	867	c.711C>T	c.(709-711)TCC>TCT	p.S237S		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	237	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GGAAGCTCTGGGATATCCTTA	0.363													15	219	---	---	---	---	PASS
HMGCS2	3158	broad.mit.edu	37	1	120295955	120295955	+	Silent	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120295955A>G	uc001eid.2	-	7	1293	c.1242T>C	c.(1240-1242)TCT>TCC	p.S414S	HMGCS2_uc010oxj.1_Silent_p.S372S|HMGCS2_uc001eie.2_Silent_p.S322S	NM_005518	NP_005509	P54868	HMCS2_HUMAN	hydroxymethylglutaryl-CoA synthase 2 isoform 1	414					acetoacetic acid biosynthetic process|cholesterol biosynthetic process|isoprenoid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA synthase activity			ovary(2)	2	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		CTGCTAAACCAGAGCCATAAG	0.418													4	39	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152187706	152187706	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152187706G>T	uc001ezt.1	-	3	6475	c.6399C>A	c.(6397-6399)TAC>TAA	p.Y2133*		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2133					keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGTGTTGTCCGTAGCCAGAGG	0.567													49	586	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152328052	152328052	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152328052G>A	uc001ezw.3	-	3	2283	c.2210C>T	c.(2209-2211)TCA>TTA	p.S737L	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	737	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCTGAGCCTGATCCATGTTG	0.498													38	562	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155783432	155783432	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155783432G>A	uc001flz.2	-	10	1542	c.1445C>T	c.(1444-1446)TCT>TTT	p.S482F	GON4L_uc001fly.1_Missense_Mutation_p.S482F|GON4L_uc009wrh.1_Missense_Mutation_p.S482F|GON4L_uc001fma.1_Missense_Mutation_p.S482F|GON4L_uc001fmc.2_Missense_Mutation_p.S482F|GON4L_uc001fmd.3_Missense_Mutation_p.S482F|GON4L_uc009wri.2_Missense_Mutation_p.S68F|GON4L_uc001fme.2_Missense_Mutation_p.S310F|GON4L_uc001fmf.2_Missense_Mutation_p.S176F	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	482					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TACCTGGAAAGAATCCATGCA	0.448													17	113	---	---	---	---	PASS
ARHGEF2	9181	broad.mit.edu	37	1	155934856	155934856	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155934856G>C	uc001fmt.2	-	7	765	c.647C>G	c.(646-648)TCT>TGT	p.S216C	ARHGEF2_uc001fmr.2_Missense_Mutation_p.S188C|ARHGEF2_uc001fms.2_Missense_Mutation_p.S215C|ARHGEF2_uc001fmu.2_Missense_Mutation_p.S260C|ARHGEF2_uc010pgt.1_Missense_Mutation_p.S189C|ARHGEF2_uc010pgu.1_Missense_Mutation_p.S261C	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor 2	216					actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					AAGACTCCAAGAGTCAGCTGC	0.488													5	127	---	---	---	---	PASS
IQGAP3	128239	broad.mit.edu	37	1	156510565	156510565	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156510565C>G	uc001fpf.2	-	23	2749	c.2674G>C	c.(2674-2676)GAG>CAG	p.E892Q		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	892					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGGTCCTGCTCCAGCTGCTGA	0.547													45	72	---	---	---	---	PASS
MNDA	4332	broad.mit.edu	37	1	158813762	158813762	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158813762C>A	uc001fsz.1	+	4	620	c.420C>A	c.(418-420)AAC>AAA	p.N140K		NM_002432	NP_002423	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	140					B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(2)|skin(2)	4	all_hematologic(112;0.0378)					AAACTCCAAACAAAGAAAAGA	0.408													8	153	---	---	---	---	PASS
TMCO1	54499	broad.mit.edu	37	1	165712508	165712508	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165712508G>C	uc001gdj.3	-	6	513	c.364C>G	c.(364-366)CTT>GTT	p.L122V	TMCO1_uc001gdl.3_Missense_Mutation_p.L38V|TMCO1_uc001gdm.3_Missense_Mutation_p.L38V|TMCO1_uc001gdk.3_Missense_Mutation_p.L110V|TMCO1_uc001gdn.3_RNA	NM_019026	NP_061899	Q9UM00	TMCO1_HUMAN	transmembrane and coiled-coil domains 1	122						endoplasmic reticulum membrane|Golgi membrane|integral to membrane				central_nervous_system(1)	1	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					ATGTAAGAAAGAGGGGTAAAA	0.373													3	81	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196309572	196309572	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196309572G>A	uc001gtd.1	-	16	1742	c.1682C>T	c.(1681-1683)TCA>TTA	p.S561L	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.S511L|KCNT2_uc001gtf.1_Missense_Mutation_p.S561L|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Missense_Mutation_p.S561L|KCNT2_uc001gth.1_Missense_Mutation_p.S82L	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	561	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						TTTAAATGCTGAATTCTCTTC	0.358													8	149	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197404300	197404300	+	Missense_Mutation	SNP	G	C	C	rs62636275		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197404300G>C	uc001gtz.2	+	9	3442	c.3307G>C	c.(3307-3309)GGA>CGA	p.G1103R	CRB1_uc010poz.1_Missense_Mutation_p.G1079R|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.G991R|CRB1_uc010ppb.1_Intron|CRB1_uc010ppd.1_Missense_Mutation_p.G584R|CRB1_uc001gub.1_Missense_Mutation_p.G752R	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	1103	Extracellular (Potential).|Laminin G-like 3.		G -> R (in LCA8 and RP12).		cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						AATAGAAATCGGAGGCATTTA	0.368													64	46	---	---	---	---	PASS
MYBPH	4608	broad.mit.edu	37	1	203144577	203144577	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203144577G>T	uc001gzh.1	-	2	277	c.218C>A	c.(217-219)GCC>GAC	p.A73D	FMOD_uc010pqi.1_Intron	NM_004997	NP_004988	Q13203	MYBPH_HUMAN	myosin binding protein H	73	Fibronectin type-III 1.				cell adhesion|regulation of striated muscle contraction	myosin filament	structural constituent of muscle				0			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		CAGCAGTGGGGCACTGGGGAC	0.642													70	88	---	---	---	---	PASS
C1orf74	148304	broad.mit.edu	37	1	209956220	209956220	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209956220C>T	uc001hhp.1	-	2	1003	c.760G>A	c.(760-762)GAT>AAT	p.D254N		NM_152485	NP_689698	Q96LT6	CA074_HUMAN	hypothetical protein LOC148304	254										skin(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		ATGCTGAGATCAGCAAAGTCA	0.478													9	171	---	---	---	---	PASS
MTR	4548	broad.mit.edu	37	1	237060905	237060905	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237060905G>T	uc001hyi.3	+	33	4182	c.3759G>T	c.(3757-3759)GAG>GAT	p.E1253D	MTR_uc010pxw.1_Missense_Mutation_p.E846D|MTR_uc010pxx.1_Missense_Mutation_p.E1202D|MTR_uc010pxy.1_Missense_Mutation_p.E1107D	NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine	1253	AdoMet activation.				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	CTGAGGTTGAGAAATGGCTTG	0.348													8	265	---	---	---	---	PASS
MTR	4548	broad.mit.edu	37	1	237060906	237060906	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237060906A>G	uc001hyi.3	+	33	4183	c.3760A>G	c.(3760-3762)AAA>GAA	p.K1254E	MTR_uc010pxw.1_Missense_Mutation_p.K847E|MTR_uc010pxx.1_Missense_Mutation_p.K1203E|MTR_uc010pxy.1_Missense_Mutation_p.K1108E	NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine	1254	AdoMet activation.				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TGAGGTTGAGAAATGGCTTGG	0.353													8	268	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237838130	237838130	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237838130G>C	uc001hyl.1	+	60	8934	c.8814G>C	c.(8812-8814)CAG>CAC	p.Q2938H	RYR2_uc010pxz.1_5'UTR	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2938	Modulator (Potential).|Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAGCCCATCAGTATATCCTGG	0.418													25	24	---	---	---	---	PASS
C2orf34	79823	broad.mit.edu	37	2	44617434	44617434	+	Silent	SNP	A	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44617434A>T	uc002rum.2	+	3	470	c.366A>T	c.(364-366)ACA>ACT	p.T122T	C2orf34_uc002rul.2_Silent_p.T122T	NM_024766	NP_079042	Q7Z624	CMKMT_HUMAN	hypothetical protein LOC79823	122						cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)				TTGACAATACAGGAAATGTTT	0.289													54	56	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	51254867	51254867	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51254867C>A	uc010fbq.2	-	2	2022	c.545G>T	c.(544-546)GGG>GTG	p.G182V	NRXN1_uc002rxe.3_Missense_Mutation_p.G182V|NRXN1_uc002rxd.1_Missense_Mutation_p.G182V	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	230	Extracellular (Potential).|Laminin G-like.				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ACGAATCCACCCCTTGAAGGG	0.697													4	21	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71838722	71838722	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71838722C>T	uc002sie.2	+	38	4509	c.4133C>T	c.(4132-4134)CCC>CTC	p.P1378L	DYSF_uc010feg.2_Missense_Mutation_p.P1409L|DYSF_uc010feh.2_Missense_Mutation_p.P1364L|DYSF_uc002sig.3_Missense_Mutation_p.P1364L|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.P1378L|DYSF_uc010fef.2_Missense_Mutation_p.P1395L|DYSF_uc010fei.2_Missense_Mutation_p.P1395L|DYSF_uc010fek.2_Missense_Mutation_p.P1396L|DYSF_uc010fej.2_Missense_Mutation_p.P1365L|DYSF_uc010fel.2_Missense_Mutation_p.P1365L|DYSF_uc010feo.2_Missense_Mutation_p.P1410L|DYSF_uc010fem.2_Missense_Mutation_p.P1379L|DYSF_uc010fen.2_Missense_Mutation_p.P1396L|DYSF_uc002sif.2_Missense_Mutation_p.P1379L|DYSF_uc010yqy.1_Missense_Mutation_p.P259L|DYSF_uc010yqz.1_Missense_Mutation_p.P118L	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1378	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						CGGAAGAACCCCAACTTTGAC	0.582													28	45	---	---	---	---	PASS
FBXO41	150726	broad.mit.edu	37	2	73498051	73498051	+	5'Flank	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73498051C>T	uc002sjb.1	-							NM_001080410	NP_001073879	Q8TF61	FBX41_HUMAN	F-box protein 41							intracellular	protein binding|zinc ion binding			breast(2)|pancreas(1)	3						CATCAAGGGTCTTCACCTACT	0.532													19	59	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73717175	73717175	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73717175C>T	uc002sje.1	+	12	8203	c.8092C>T	c.(8092-8094)CAT>TAT	p.H2698Y	ALMS1_uc002sjf.1_Missense_Mutation_p.H2654Y|ALMS1_uc002sjg.2_Missense_Mutation_p.H2084Y|ALMS1_uc002sjh.1_Missense_Mutation_p.H2084Y	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2696					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						AGTGGATTTTCATTCTTCATC	0.413													46	317	---	---	---	---	PASS
C2orf55	343990	broad.mit.edu	37	2	99413924	99413924	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99413924C>T	uc002szf.1	-	8	2787	c.2493G>A	c.(2491-2493)CGG>CGA	p.R831R		NM_207362	NP_997245	Q6NV74	CB055_HUMAN	hypothetical protein LOC343990	831											0						TCCGCTTCTGCCGAGTGACGG	0.612													5	158	---	---	---	---	PASS
NCK2	8440	broad.mit.edu	37	2	106498233	106498233	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106498233G>C	uc002tdg.2	+	4	1118	c.676G>C	c.(676-678)GAG>CAG	p.E226Q	NCK2_uc002tdh.2_Intron|NCK2_uc002tdi.2_Missense_Mutation_p.E226Q	NM_003581	NP_003572	O43639	NCK2_HUMAN	NCK adaptor protein 2 isoform A	226	SH3 3.				axon guidance|epidermal growth factor receptor signaling pathway|negative regulation of cell proliferation|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of epidermal growth factor receptor activity|regulation of translation|signal complex assembly|T cell activation	cytosol|endoplasmic reticulum	cytoskeletal adaptor activity|receptor signaling complex scaffold activity			ovary(1)|lung(1)	2						GGAGGTGATTGAGAAGCCGGA	0.617													4	136	---	---	---	---	PASS
TMEM87B	84910	broad.mit.edu	37	2	112858261	112858261	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112858261C>T	uc002thm.2	+	15	1808	c.1439C>T	c.(1438-1440)TCT>TTT	p.S480F		NM_032824	NP_116213	Q96K49	TM87B_HUMAN	transmembrane protein 87B precursor	480						integral to membrane					0						ATGGTAACTTCTGAAAATTTA	0.308													16	77	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116101447	116101447	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116101447A>T	uc002tla.1	+	3	687	c.230A>T	c.(229-231)AAA>ATA	p.K77I	DPP10_uc002tlb.1_Missense_Mutation_p.K27I|DPP10_uc002tlc.1_Missense_Mutation_p.K73I|DPP10_uc002tle.2_Missense_Mutation_p.K81I|DPP10_uc002tlf.1_Missense_Mutation_p.K70I	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	77	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						CTCTTTAGGAAAGACTTTGTG	0.338													8	100	---	---	---	---	PASS
LYPD1	116372	broad.mit.edu	37	2	133425962	133425962	+	Intron	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133425962C>A	uc002ttn.2	-						LYPD1_uc002ttm.3_Intron|LYPD1_uc002tto.2_Intron	NM_144586	NP_653187	Q8N2G4	LYPD1_HUMAN	LY6/PLAUR domain containing 1 isoform a							anchored to membrane|plasma membrane					0						GGAGGGCTGCCAGGCTCTTAC	0.527													30	55	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098806	178098806	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098806G>T	uc002ulh.3	-	2	794	c.239C>A	c.(238-240)ACA>AAA	p.T80K	NFE2L2_uc002ulg.3_Missense_Mutation_p.T64K|NFE2L2_uc010zfa.1_Missense_Mutation_p.T64K|NFE2L2_uc002uli.3_Missense_Mutation_p.T64K|NFE2L2_uc010fra.2_Missense_Mutation_p.T64K|NFE2L2_uc010frb.2_Missense_Mutation_p.T64K	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	80				T->A: Loss of interaction with KEAP1.	transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			AAATTCACCTGTCTCTTCATC	0.443			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			91	94	---	---	---	---	PASS
DFNB59	494513	broad.mit.edu	37	2	179325085	179325085	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179325085C>T	uc002umi.3	+	6	1034	c.678C>T	c.(676-678)GTC>GTT	p.V226V	DFNB59_uc002umj.3_Silent_p.V226V	NM_001042702	NP_001036167	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	226					sensory perception of sound						0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			ACCTTTGTGTCACTTCAGTGT	0.318													9	54	---	---	---	---	PASS
PDE1A	5136	broad.mit.edu	37	2	183050765	183050765	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183050765C>T	uc002uos.2	-	14	1502	c.1418G>A	c.(1417-1419)AGA>AAA	p.R473K	PDE1A_uc010zfp.1_Missense_Mutation_p.R369K|PDE1A_uc002uoq.1_Missense_Mutation_p.R473K|PDE1A_uc010zfq.1_Missense_Mutation_p.R473K|PDE1A_uc002uor.2_Missense_Mutation_p.R457K|PDE1A_uc002uou.2_Missense_Mutation_p.R439K	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2	473	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			ATTTGATCGTCTTAGTGCATC	0.458													17	57	---	---	---	---	PASS
ANKAR	150709	broad.mit.edu	37	2	190569787	190569787	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190569787T>G	uc002uqw.1	+	7	1534	c.1534T>G	c.(1534-1536)TTA>GTA	p.L512V	ANKAR_uc002uqu.2_RNA	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	583	ANK 2.					integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			GGCTTGCTCATTAGAAACAAC	0.423													45	77	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196602694	196602694	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196602694T>G	uc002utj.3	-	65	12127	c.12026A>C	c.(12025-12027)GAA>GCA	p.E4009A	DNAH7_uc002uti.3_Missense_Mutation_p.E492A	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	4009					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						AATCCAGTGTTCCTTGGGTTG	0.443													37	50	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207172827	207172827	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207172827A>G	uc002vbp.2	+	5	3825	c.3575A>G	c.(3574-3576)AAT>AGT	p.N1192S		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1192							nucleic acid binding|zinc ion binding			ovary(3)	3						GGTAAGCACAATCAATGTTGT	0.408													43	66	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228996798	228996798	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228996798G>T	uc002vpq.2	-	2	83	c.36C>A	c.(34-36)AAC>AAA	p.N12K	SPHKAP_uc002vpp.2_Missense_Mutation_p.N12K|SPHKAP_uc010zlx.1_Missense_Mutation_p.N12K	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	12						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		ATGACTCCAAGTTGCTGTTTG	0.443													13	99	---	---	---	---	PASS
SETD5	55209	broad.mit.edu	37	3	9506324	9506324	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9506324G>A	uc003brt.2	+	18	3127	c.2692G>A	c.(2692-2694)GCT>ACT	p.A898T	SETD5_uc003brs.1_Missense_Mutation_p.A879T|SETD5_uc003bru.2_Missense_Mutation_p.A800T|SETD5_uc003brv.2_Missense_Mutation_p.A787T|SETD5_uc010hck.2_Missense_Mutation_p.A380T|SETD5_uc003brx.2_Missense_Mutation_p.A567T	NM_001080517	NP_001073986	Q9C0A6	SETD5_HUMAN	SET domain containing 5	898										ovary(2)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		TCTTACTACTGCTAGTCGCTG	0.473													57	115	---	---	---	---	PASS
BRPF1	7862	broad.mit.edu	37	3	9788941	9788941	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9788941C>T	uc003bse.2	+	14	3952	c.3553C>T	c.(3553-3555)CGC>TGC	p.R1185C	BRPF1_uc003bsf.2_Missense_Mutation_p.R1191C|BRPF1_uc003bsg.2_Missense_Mutation_p.R1184C|BRPF1_uc011ati.1_Missense_Mutation_p.R1090C|OGG1_uc003bsh.2_5'Flank|OGG1_uc003bsi.2_5'Flank|OGG1_uc003bsj.2_5'Flank|OGG1_uc003bsk.2_5'Flank|OGG1_uc003bsl.2_5'Flank|OGG1_uc003bsm.2_5'Flank|OGG1_uc003bsn.2_5'Flank|OGG1_uc003bso.2_5'Flank	NM_004634	NP_004625	P55201	BRPF1_HUMAN	bromodomain and PHD finger-containing protein 1	1185					histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Medulloblastoma(99;0.227)					GTCCAACATCCGCAAGTCAGT	0.572													13	122	---	---	---	---	PASS
NISCH	11188	broad.mit.edu	37	3	52522260	52522260	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52522260A>T	uc011beg.1	+	17	2824	c.2752A>T	c.(2752-2754)AAC>TAC	p.N918Y	NISCH_uc003ded.3_Missense_Mutation_p.N918Y|NISCH_uc003dee.3_Missense_Mutation_p.N407Y|NISCH_uc003deg.1_RNA|NISCH_uc003deh.3_5'Flank	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	918					apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)		CCAGCACCTCAACGTCATCAA	0.647													7	40	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77542433	77542433	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77542433G>C	uc003dpy.3	+	5	1349	c.706G>C	c.(706-708)GTA>CTA	p.V236L	ROBO2_uc003dpz.2_Missense_Mutation_p.V236L|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.V236L	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	236	Ig-like C2-type 3.|Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		TAACCAGGTGGTACTGGAGGA	0.403													14	100	---	---	---	---	PASS
POU1F1	5449	broad.mit.edu	37	3	87311291	87311291	+	Silent	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87311291G>A	uc003dqq.1	-	4	659	c.534C>T	c.(532-534)CTC>CTT	p.L178L	POU1F1_uc010hoj.1_Silent_p.L204L	NM_000306	NP_000297	P28069	PIT1_HUMAN	pituitary specific transcription factor 1	178	POU-specific.				negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)|skin(1)	2	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00229)|Lung(72;0.00677)		TTTTAAAGCTGAGCTGCAGAT	0.453													4	116	---	---	---	---	PASS
NFKBIZ	64332	broad.mit.edu	37	3	101576185	101576185	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101576185G>A	uc003dvp.2	+	11	2100	c.1985G>A	c.(1984-1986)CGG>CAG	p.R662Q	NFKBIZ_uc003dvo.2_Missense_Mutation_p.R562Q|NFKBIZ_uc010hpo.2_Missense_Mutation_p.R562Q|NFKBIZ_uc003dvq.2_Missense_Mutation_p.R540Q	NM_031419	NP_113607	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene	662	Interaction with NFKB1/p50 (By similarity).|ANK 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(2)	2						TTGCAGTATCGGTTGACACAA	0.483													16	156	---	---	---	---	PASS
IGSF11	152404	broad.mit.edu	37	3	118624493	118624493	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118624493G>C	uc003ebw.2	-	5	900	c.653C>G	c.(652-654)TCT>TGT	p.S218C	IGSF11_uc011biv.1_Missense_Mutation_p.S218C|IGSF11_uc003ebx.2_Intron|IGSF11_uc003eby.2_Missense_Mutation_p.S217C|IGSF11_uc003ebz.2_Intron|IGSF11_uc010hqs.2_Missense_Mutation_p.S217C	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b	218	Ig-like C2-type.|Extracellular (Potential).				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						AATAGCATTAGAAGCCACGCA	0.463													7	162	---	---	---	---	PASS
SLC15A2	6565	broad.mit.edu	37	3	121643880	121643880	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121643880C>T	uc003eep.2	+	13	1277	c.1124C>T	c.(1123-1125)TCA>TTA	p.S375L	SLC15A2_uc011bjn.1_Missense_Mutation_p.S344L	NM_021082	NP_066568	Q16348	S15A2_HUMAN	peptide transporter 2 isoform a	375					protein transport	integral to plasma membrane	peptide:hydrogen symporter activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.0967)	Cefadroxil(DB01140)	ATTAACTTCTCGTAAGTGTTC	0.378													70	409	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			48	77	---	---	---	---	PASS
C3orf59	151963	broad.mit.edu	37	3	192635435	192635435	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192635435G>T	uc011bsp.1	-	1	516	c.195C>A	c.(193-195)TTC>TTA	p.F65L		NM_178496	NP_848591	Q8IYB1	M21D2_HUMAN	hypothetical protein LOC151963	65											0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)		TGGAAAAGATGAAATCCTTGG	0.453													10	137	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3134309	3134309	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3134309A>G	uc011bvq.1	+	18	2408	c.2263A>G	c.(2263-2265)ATC>GTC	p.I755V		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	753					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TGTCTCAGACATCTTGAACTA	0.478													6	42	---	---	---	---	PASS
LYAR	55646	broad.mit.edu	37	4	4269734	4269734	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4269734T>C	uc011bvy.1	-	10	1165	c.1022A>G	c.(1021-1023)TAC>TGC	p.Y341C	LYAR_uc011bvx.1_Missense_Mutation_p.Y224C|LYAR_uc003ght.2_Missense_Mutation_p.Y341C	NM_001145725	NP_001139197	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive homolog	341	Lys-rich.					nucleolus	metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGTCACTGTGTAGTACTGAGC	0.353													11	38	---	---	---	---	PASS
GNPDA2	132789	broad.mit.edu	37	4	44713069	44713069	+	Missense_Mutation	SNP	A	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44713069A>C	uc003gwy.2	-	5	652	c.495T>G	c.(493-495)GAT>GAG	p.D165E	GNPDA2_uc010iga.2_Missense_Mutation_p.D131E|GNPDA2_uc011bzb.1_Missense_Mutation_p.D95E|GNPDA2_uc003gwz.1_Missense_Mutation_p.D165E	NM_138335	NP_612208	Q8TDQ7	GNPI2_HUMAN	glucosamine-6-phosphate deaminase 2	165					N-acetylglucosamine metabolic process	cytoplasm	glucosamine-6-phosphate deaminase activity|hydrolase activity			ovary(1)	1						CCAAGATGGTATCCATTGCTA	0.403													11	78	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62903513	62903513	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62903513C>G	uc010ihh.2	+	21	3625	c.3452C>G	c.(3451-3453)TCC>TGC	p.S1151C	LPHN3_uc003hcq.3_Missense_Mutation_p.S1151C|LPHN3_uc003hct.2_Missense_Mutation_p.S535C	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	1129	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						ACAGAGAGTTCCATTGGTTCA	0.398													13	73	---	---	---	---	PASS
PPP3CA	5530	broad.mit.edu	37	4	101953522	101953522	+	Splice_Site	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101953522C>A	uc011cen.1	-	12	1917	c.1242_splice	c.e12-1	p.R414_splice	PPP3CA_uc003hvu.2_Splice_Site_p.R414_splice|PPP3CA_uc010ilj.2_Splice_Site_p.R372_splice|PPP3CA_uc003hvt.2_Splice_Site_p.R401_splice|PPP3CA_uc003hvs.2_Splice_Site_p.R347_splice|PPP3CA_uc010ilk.2_Splice_Site_p.R182_splice	NM_000944	NP_000935	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha						protein dephosphorylation	calcineurin complex|cytosol|nucleus	calcium ion binding|calmodulin binding			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		ACTCTCTTCTCTGGAAGGCAC	0.453													3	17	---	---	---	---	PASS
GAB1	2549	broad.mit.edu	37	4	144390314	144390314	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144390314C>T	uc003ije.2	+	10	2416	c.2057C>T	c.(2056-2058)TCA>TTA	p.S686L	GAB1_uc003ijd.2_Missense_Mutation_p.S716L|GAB1_uc011chq.1_Missense_Mutation_p.S583L	NM_002039	NP_002030	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1 isoform b	686					cell proliferation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			breast(2)|lung(1)|skin(1)	4	all_hematologic(180;0.158)					TCCACAGAATCAGAAACGCCA	0.418													5	56	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183245215	183245215	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183245215G>C	uc003ivd.1	+	1	79	c.42G>C	c.(40-42)AAG>AAC	p.K14N	ODZ3_uc010irv.1_Missense_Mutation_p.K14N	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	14	Cytoplasmic (Potential).|Teneurin N-terminal.				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		CCCTGACCAAGAGCAGACGAG	0.522													3	15	---	---	---	---	PASS
MTRR	4552	broad.mit.edu	37	5	7869254	7869254	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7869254C>G	uc003jed.2	+	1	38	c.8C>G	c.(7-9)GCT>GGT	p.A3G	FASTKD3_uc011cmp.1_5'Flank|FASTKD3_uc003jeb.2_5'Flank|FASTKD3_uc003jec.2_5'Flank|MTRR_uc010itn.1_RNA|MTRR_uc003jee.3_5'UTR|MTRR_uc003jef.3_RNA|MTRR_uc003jeg.3_RNA|MTRR_uc010ito.2_RNA	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2	3					methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	AGCATGGGCGCTGCGTCAGTG	0.662													40	100	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10391811	10391811	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10391811A>G	uc003jet.1	+	7	917	c.734A>G	c.(733-735)GAG>GGG	p.E245G	MARCH6_uc011cmu.1_Missense_Mutation_p.E197G|MARCH6_uc003jeu.1_5'UTR|MARCH6_uc011cmv.1_Missense_Mutation_p.E140G	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	245	Cytoplasmic (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						GCTGGTGTGGAGGATGCGGCA	0.408													3	78	---	---	---	---	PASS
IQGAP2	10788	broad.mit.edu	37	5	75964666	75964666	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75964666T>C	uc003kek.2	+	23	3062	c.2840T>C	c.(2839-2841)ATA>ACA	p.I947T	IQGAP2_uc010izv.2_Missense_Mutation_p.I500T|IQGAP2_uc011csv.1_Missense_Mutation_p.I443T|IQGAP2_uc003kel.2_Missense_Mutation_p.I443T	NM_006633	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	947	Ras-GAP.				small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		GAGGAAGAAATAAAGTATGTA	0.279													24	34	---	---	---	---	PASS
F2R	2149	broad.mit.edu	37	5	76028982	76028982	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76028982C>A	uc003ken.3	+	2	1197	c.932C>A	c.(931-933)GCT>GAT	p.A311D		NM_001992	NP_001983	P25116	PAR1_HUMAN	coagulation factor II receptor precursor	311	Cytoplasmic (Potential).				activation of caspase activity|anatomical structure morphogenesis|connective tissue replacement involved in inflammatory response wound healing|negative regulation of cell proliferation|platelet activation|positive regulation of blood coagulation|positive regulation of cell migration|positive regulation of collagen biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JAK-STAT cascade|positive regulation of MAPKKK cascade|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of transcription, DNA-dependent|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	caveola|extracellular region|Golgi apparatus|integral to plasma membrane|platelet dense tubular network	receptor binding|thrombin receptor activity			ovary(3)	3		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	AAGTCCCGGGCTTTGTTCCTG	0.478													11	117	---	---	---	---	PASS
THBS4	7060	broad.mit.edu	37	5	79363825	79363825	+	Silent	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79363825G>A	uc003kgh.2	+	11	1547	c.1224G>A	c.(1222-1224)CCG>CCA	p.P408P	uc003kgi.3_Intron	NM_003248	NP_003239	P35443	TSP4_HUMAN	thrombospondin 4 precursor	408	EGF-like 3; calcium-binding (Potential).				endothelial cell-cell adhesion|myoblast migration|negative regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation	basement membrane|extracellular space	calcium ion binding|heparin binding|integrin binding|structural molecule activity				0		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		CTTGTAAGCCGGGGTATACTG	0.498													21	125	---	---	---	---	PASS
HAPLN1	1404	broad.mit.edu	37	5	82948291	82948291	+	Silent	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82948291C>A	uc003kim.2	-	2	524	c.453G>T	c.(451-453)GTG>GTT	p.V151V	HAPLN1_uc003kin.2_Silent_p.V151V	NM_001884	NP_001875	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	151	Ig-like V-type.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			large_intestine(3)|ovary(1)|skin(1)	5		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)		CCAGTGCTACCACAACAGTAT	0.373													48	100	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90052310	90052310	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90052310A>G	uc003kju.2	+	56	11716	c.11620A>G	c.(11620-11622)ATC>GTC	p.I3874V	GPR98_uc003kjt.2_Missense_Mutation_p.I1580V|GPR98_uc003kjv.2_Missense_Mutation_p.I1474V	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	3874	Extracellular (Potential).|Calx-beta 25.				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TATTGTCACTATCACTGAGGT	0.423													22	234	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127700404	127700404	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127700404C>G	uc003kuu.2	-	18	2756	c.2317G>C	c.(2317-2319)GCT>CCT	p.A773P	FBN2_uc003kuv.2_Missense_Mutation_p.A740P	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	773	EGF-like 11; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GGATCCAAAGCACATTCATTG	0.363													17	21	---	---	---	---	PASS
PCDHB3	56132	broad.mit.edu	37	5	140481851	140481851	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140481851G>T	uc003lio.2	+	1	1618	c.1618G>T	c.(1618-1620)GCT>TCT	p.A540S	uc003lin.2_5'Flank	NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3 precursor	540	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGCTCCCCGGCTTTGAGCAG	0.687													10	94	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140554673	140554673	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140554673C>T	uc003lit.2	+	1	2431	c.2257C>T	c.(2257-2259)CTG>TTG	p.L753L	PCDHB8_uc011dai.1_5'Flank	NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	753	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGAGGTGTGCCTGACTGGAGG	0.582													6	210	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140725281	140725281	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140725281G>T	uc003ljm.1	+	1	1681	c.1681G>T	c.(1681-1683)GAG>TAG	p.E561*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Nonsense_Mutation_p.E321*|PCDHGA3_uc011dap.1_Nonsense_Mutation_p.E561*	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	561	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACGCGCCCGAGATCCTGTA	0.647													79	159	---	---	---	---	PASS
PCDHGA5	56110	broad.mit.edu	37	5	140744557	140744557	+	Silent	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140744557G>A	uc003lju.1	+	1	660	c.660G>A	c.(658-660)CCG>CCA	p.P220P	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Silent_p.P220P	NM_018918	NP_061741	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5 isoform 1	220	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGAGACCCGGTACTCTCCG	0.572													9	98	---	---	---	---	PASS
AFAP1L1	134265	broad.mit.edu	37	5	148695778	148695778	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148695778G>C	uc003lqh.2	+	11	1310	c.1179G>C	c.(1177-1179)AAG>AAC	p.K393N	AFAP1L1_uc010jgy.2_Missense_Mutation_p.K393N|AFAP1L1_uc003lqi.1_Missense_Mutation_p.K8N	NM_152406	NP_689619	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	393							protein binding			breast(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGCCGCAAGATCACCCGTA	0.607													10	111	---	---	---	---	PASS
SLC36A2	153201	broad.mit.edu	37	5	150701635	150701635	+	Silent	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150701635G>A	uc003lty.2	-	9	1282	c.1152C>T	c.(1150-1152)TCC>TCT	p.S384S	GM2A_uc011dcs.1_Intron|SLC36A2_uc003ltz.2_RNA|SLC36A2_uc003lua.2_Silent_p.S186S|SLC36A2_uc010jhv.2_Silent_p.S384S	NM_181776	NP_861441	Q495M3	S36A2_HUMAN	solute carrier family 36, member 2	384	Helical; (Potential).				cellular nitrogen compound metabolic process	cytoplasm|integral to membrane|plasma membrane	glycine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CGAGGCGAATGGACAGATCCA	0.517													9	94	---	---	---	---	PASS
GABRG2	2566	broad.mit.edu	37	5	161495095	161495095	+	Silent	SNP	G	T	T	rs115976622	by1000genomes	TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161495095G>T	uc003lyz.3	+	1	448	c.90G>T	c.(88-90)CTG>CTT	p.L30L	GABRG2_uc010jjc.2_Silent_p.L30L|GABRG2_uc003lyy.3_Silent_p.L30L|GABRG2_uc011dej.1_5'UTR	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	30					gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		TTCTGCTCCTGCTGTCGCTCT	0.507													10	59	---	---	---	---	PASS
HMP19	51617	broad.mit.edu	37	5	173491323	173491323	+	Intron	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173491323G>T	uc003mcx.2	+							NM_015980	NP_057064	Q9Y328	NSG2_HUMAN	HMP19 protein						dopamine receptor signaling pathway	cytoplasmic vesicle membrane|Golgi cisterna membrane|integral to membrane|multivesicular body membrane	dopamine receptor binding			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00925)|all_lung(126;0.0148)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TTTACGGTCAGTTTCTTGATG	0.488													4	44	---	---	---	---	PASS
PROP1	5626	broad.mit.edu	37	5	177421251	177421251	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177421251C>T	uc003mif.1	-	2	507	c.198G>A	c.(196-198)CCG>CCA	p.P66P		NM_006261	NP_006252	O75360	PROP1_HUMAN	PROP paired-like homeobox 1	66					central nervous system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCGGGAGTGCGGGCGGCCCC	0.662													36	44	---	---	---	---	PASS
FLT4	2324	broad.mit.edu	37	5	180043933	180043933	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180043933C>T	uc003mma.3	-	22	3142	c.3063G>A	c.(3061-3063)GTG>GTA	p.V1021V	FLT4_uc003mlz.3_Silent_p.V1021V	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	1021	Cytoplasmic (Potential).|Protein kinase.				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	TCCCTCTGGCCACCTGGAAGC	0.612									Congenital_Hereditary_Lymphedema				14	139	---	---	---	---	PASS
FLT4	2324	broad.mit.edu	37	5	180057798	180057798	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180057798C>T	uc003mma.3	-	3	236	c.157G>A	c.(157-159)GGA>AGA	p.G53R	FLT4_uc003mlz.3_Missense_Mutation_p.G53R|FLT4_uc003mmb.1_5'Flank|FLT4_uc011dgy.1_Missense_Mutation_p.G53R|FLT4_uc011dgz.1_Missense_Mutation_p.G53R|FLT4_uc011dha.1_Missense_Mutation_p.G53R	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	53	Ig-like C2-type 1.|Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	GGGTGCTGTCCCCTGGCAGAG	0.677									Congenital_Hereditary_Lymphedema				4	30	---	---	---	---	PASS
HIST1H2BL	8340	broad.mit.edu	37	6	27775434	27775434	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27775434T>C	uc003njl.2	-	1	276	c.251A>G	c.(250-252)TAC>TGC	p.Y84C	HIST1H3H_uc003njm.2_5'Flank	NM_003519	NP_003510	Q99880	H2B1L_HUMAN	histone cluster 1, H2bl	84					nucleosome assembly	nucleosome|nucleus	DNA binding				0						GCGCTTGTTGTAGTGCGCCAG	0.632													42	149	---	---	---	---	PASS
ZNF311	282890	broad.mit.edu	37	6	28964036	28964036	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28964036T>G	uc003nlu.2	-	7	1256	c.743A>C	c.(742-744)GAA>GCA	p.E248A	ZNF311_uc011dlk.1_Missense_Mutation_p.E156A|ZNF311_uc003nlv.2_Missense_Mutation_p.E156A	NM_001010877	NP_001010877	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	248	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding				0						CCTGGCACATTCATGGAGTTT	0.383													51	98	---	---	---	---	PASS
C6orf227	401253	broad.mit.edu	37	6	33555414	33555414	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33555414C>A	uc003oew.1	-	2	576	c.574G>T	c.(574-576)GCA>TCA	p.A192S	GGNBP1_uc003oev.2_Intron	NR_027908				RecName: Full=Putative uncharacterized protein C6orf227;												0						gggactgttgCAAGGACCTCC	0.274													28	49	---	---	---	---	PASS
TREML2	79865	broad.mit.edu	37	6	41162281	41162281	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41162281C>T	uc010jxm.1	-	3	846	c.667G>A	c.(667-669)GCT>ACT	p.A223T		NM_024807	NP_079083	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid	223	Extracellular (Potential).				T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					TCTGGGCCAGCAGAGGAGTCC	0.612													21	36	---	---	---	---	PASS
MCM3	4172	broad.mit.edu	37	6	52131488	52131488	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52131488C>T	uc003pan.1	-	15	2189	c.2079G>A	c.(2077-2079)AAG>AAA	p.K693K	MCM3_uc011dwu.1_Silent_p.K647K	NM_002388	NP_002379	P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	693					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	alpha DNA polymerase:primase complex|centrosome|MCM complex|perinuclear region of cytoplasm	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)|lung(1)|skin(1)	3	Lung NSC(77;0.0931)					GCTGGCGAGTCTTCCTTCTAA	0.488													7	348	---	---	---	---	PASS
CYB5R4	51167	broad.mit.edu	37	6	84629158	84629158	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84629158A>G	uc003pkf.2	+	7	681	c.549A>G	c.(547-549)ATA>ATG	p.I183M		NM_016230	NP_057314	Q7L1T6	NB5R4_HUMAN	cytochrome b5 reductase 4	183	CS.				cell development|detection of oxygen|generation of precursor metabolites and energy|glucose homeostasis|insulin secretion|response to antibiotic|superoxide metabolic process	endoplasmic reticulum|perinuclear region of cytoplasm	cytochrome-b5 reductase activity|heme binding|NAD(P)H oxidase activity			breast(2)	2		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)		BRCA - Breast invasive adenocarcinoma(397;0.0871)		CCATTGCCATATATACTAAAC	0.209													10	15	---	---	---	---	PASS
GJA10	84694	broad.mit.edu	37	6	90604309	90604309	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90604309C>T	uc011eaa.1	+	1	122	c.122C>T	c.(121-123)GCT>GTT	p.A41V		NM_032602	NP_115991	Q969M2	CXA10_HUMAN	gap junction protein, alpha 10	41	Extracellular (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		CGTGTGGCTGCTGAGGATGTC	0.498													10	110	---	---	---	---	PASS
FHL5	9457	broad.mit.edu	37	6	97053851	97053851	+	Silent	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97053851T>C	uc003pos.1	+	5	813	c.408T>C	c.(406-408)CCT>CCC	p.P136P	FHL5_uc003pot.1_Silent_p.P136P	NM_020482	NP_065228	Q5TD97	FHL5_HUMAN	activator of cAMP-responsive element modulator	136	LIM zinc-binding 2.					nucleus	zinc ion binding			ovary(2)	2		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		GCCGACAACCTATAGGGACAA	0.413													28	50	---	---	---	---	PASS
MED23	9439	broad.mit.edu	37	6	131943099	131943099	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131943099T>G	uc003qcs.1	-	6	591	c.417A>C	c.(415-417)AAA>AAC	p.K139N	MED23_uc003qcq.2_Missense_Mutation_p.K139N|MED23_uc003qct.1_Missense_Mutation_p.K139N|MED23_uc011ecb.1_RNA	NM_004830	NP_004821	Q9ULK4	MED23_HUMAN	mediator complex subunit 23 isoform a	139					regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		CCAAAATCACTTTTAAGAGAT	0.383													43	79	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144743002	144743002	+	Intron	SNP	T	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144743002T>A	uc003qkt.2	+						UTRN_uc010khq.1_Intron	NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TATTTGTGTTTTTCTTTTACA	0.388													6	23	---	---	---	---	PASS
PHF10	55274	broad.mit.edu	37	6	170114900	170114900	+	Silent	SNP	T	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170114900T>G	uc011egy.1	-	7	811	c.732A>C	c.(730-732)CCA>CCC	p.P244P	PHF10_uc011egz.1_Silent_p.P242P|PHF10_uc011eha.1_Silent_p.P95P	NM_018288	NP_060758	Q8WUB8	PHF10_HUMAN	PHD finger protein 10 isoform a	244	SAY.				nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	npBAF complex	zinc ion binding			urinary_tract(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		TTCGCTCTGTTGGCAAAACTT	0.403													37	150	---	---	---	---	PASS
ZFAND2A	90637	broad.mit.edu	37	7	1197328	1197328	+	Silent	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1197328T>C	uc003skc.2	-	3	415	c.114A>G	c.(112-114)CCA>CCG	p.P38P	ZFAND2A_uc003skd.3_Silent_p.P38P|uc003skf.1_5'Flank	NM_182491	NP_872297	Q8N6M9	ZFN2A_HUMAN	zinc finger, AN1-type domain 2A	38	AN1-type 1.					cytoplasm|nucleus	zinc ion binding			ovary(1)	1		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.82e-15)		GTGCAGCGTATGGAAAATGAT	0.323													67	242	---	---	---	---	PASS
SKAP2	8935	broad.mit.edu	37	7	26779509	26779509	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26779509T>C	uc003syc.2	-	5	675	c.382A>G	c.(382-384)AAA>GAA	p.K128E	SKAP2_uc011jzi.1_5'UTR|SKAP2_uc011jzj.1_Missense_Mutation_p.K113E	NM_003930	NP_003921	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	128	PH.				B cell activation|cell junction assembly|protein complex assembly|signal transduction	cytosol|plasma membrane	SH3/SH2 adaptor activity			pancreas(1)	1						AGTTTACCTTTTCTGCGTTTT	0.378													8	41	---	---	---	---	PASS
CCDC129	223075	broad.mit.edu	37	7	31682945	31682945	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31682945C>A	uc003tcj.1	+	11	2954	c.1961C>A	c.(1960-1962)ACT>AAT	p.T654N	CCDC129_uc011kad.1_Missense_Mutation_p.T664N|CCDC129_uc003tci.1_Missense_Mutation_p.T505N|CCDC129_uc011kae.1_Missense_Mutation_p.T680N|CCDC129_uc003tck.1_Missense_Mutation_p.T562N	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	654											0						CCTTATGCAACTGACCTTGCT	0.483													15	49	---	---	---	---	PASS
ADCY1	107	broad.mit.edu	37	7	45753389	45753389	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45753389A>T	uc003tne.3	+	20	3173	c.3155A>T	c.(3154-3156)TAC>TTC	p.Y1052F		NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	1052	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ATGTTGACATACTTTCTAGAA	0.547													23	110	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48284194	48284194	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48284194G>T	uc003toq.2	+	11	1309	c.1284G>T	c.(1282-1284)TTG>TTT	p.L428F	ABCA13_uc010kyr.2_5'UTR	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	428					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TGTGGAAATTGCAAAGCTTGC	0.388													9	49	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82457190	82457190	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82457190T>A	uc003uhx.2	-	17	14631	c.14342A>T	c.(14341-14343)CAG>CTG	p.Q4781L	PCLO_uc003uhv.2_Missense_Mutation_p.Q4781L|PCLO_uc003uht.1_Missense_Mutation_p.Q223L|PCLO_uc003uhu.1_Missense_Mutation_p.Q202L	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	4643	C2 1.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TTGACATACCTGTTCCATGGA	0.328													4	21	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82583709	82583709	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82583709G>A	uc003uhx.2	-	5	6849	c.6560C>T	c.(6559-6561)TCT>TTT	p.S2187F	PCLO_uc003uhv.2_Missense_Mutation_p.S2187F|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2118					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CGAAGAAACAGATGATGTGAG	0.443													4	67	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88847551	88847551	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88847551A>G	uc011khi.1	+	2	729	c.191A>G	c.(190-192)TAT>TGT	p.Y64C		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	64	C2H2-type.					intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GACAAGCAGTATCACAAACAC	0.358										HNSCC(36;0.09)			3	64	---	---	---	---	PASS
ANKIB1	54467	broad.mit.edu	37	7	92027064	92027064	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92027064G>T	uc003ulw.2	+	19	2799	c.2423G>T	c.(2422-2424)CGC>CTC	p.R808L	ANKIB1_uc010lew.1_Missense_Mutation_p.R77L	NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	808							protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGCAGCAGCCGCAGGCCTGGC	0.473													40	156	---	---	---	---	PASS
CASD1	64921	broad.mit.edu	37	7	94173810	94173810	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94173810A>G	uc003uni.3	+	11	1671	c.1444A>G	c.(1444-1446)AAA>GAA	p.K482E	CASD1_uc003unj.3_Missense_Mutation_p.K482E	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor	482	Helical; (Potential).					integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			CTTTTGGATAAAAGGAGATTT	0.363													8	114	---	---	---	---	PASS
PILRA	29992	broad.mit.edu	37	7	99997407	99997407	+	Splice_Site	SNP	G	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99997407G>C	uc003uuo.1	+	7	1002	c.790_splice	c.e7-1	p.D264_splice	PILRA_uc011kjo.1_Intron|PILRA_uc003uup.1_Splice_Site_p.D191_splice|PILRA_uc003uuq.1_Splice_Site	NM_013439	NP_038467	Q9UKJ1	PILRA_HUMAN	paired immunoglobulin-like type 2 receptor alpha						interspecies interaction between organisms	extracellular region|integral to membrane|plasma membrane	protein binding|receptor activity			skin(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TTCTCGCCCAGGATGACGGCA	0.602													8	140	---	---	---	---	PASS
SLC26A4	5172	broad.mit.edu	37	7	107341590	107341590	+	Silent	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107341590G>A	uc003vep.2	+	16	1976	c.1752G>A	c.(1750-1752)GCG>GCA	p.A584A	SLC26A4_uc011kmb.1_Silent_p.A171A|SLC26A4_uc011kmc.1_Silent_p.A145A|SLC26A4_uc011kmd.1_Silent_p.A153A	NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin	584	STAS.|Cytoplasmic (Potential).				regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						GGCTGAAAGCGCTGAGGAAAA	0.343									Pendred_syndrome				13	57	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111462433	111462433	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111462433C>A	uc003vfx.2	-	27	3184	c.2915G>T	c.(2914-2916)CGC>CTC	p.R972L	DOCK4_uc003vfw.2_Missense_Mutation_p.R413L|DOCK4_uc003vfy.2_Missense_Mutation_p.R1008L	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	972					cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				AGCAACCAAGCGCATAACAGT	0.373													4	14	---	---	---	---	PASS
MET	4233	broad.mit.edu	37	7	116417470	116417470	+	Missense_Mutation	SNP	C	G	G	rs45592846		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116417470C>G	uc003vij.2	+	16	3474	c.3287C>G	c.(3286-3288)ACT>AGT	p.T1096S	MET_uc010lkh.2_Missense_Mutation_p.T1114S|MET_uc011knj.1_Missense_Mutation_p.T666S	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor	1096	Protein kinase.|Cytoplasmic (Potential).				axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	p.Q1029_G1105del(1)		upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TATCATGGGACTTTGTTGGAC	0.343			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				15	187	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142124540	142124540	+	Intron	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142124540G>A	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		AGAAAAGGCCGCACAGCACAG	0.602													30	207	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10465017	10465017	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10465017C>A	uc003wtc.2	-	4	6820	c.6591G>T	c.(6589-6591)GAG>GAT	p.E2197D		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2197					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CCTCTGGGGCCTCTATACCTT	0.622													94	410	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10469221	10469221	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10469221G>T	uc003wtc.2	-	4	2616	c.2387C>A	c.(2386-2388)GCC>GAC	p.A796D		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	796					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CGTGTCCCTGGCCTCTTCCCC	0.682													25	83	---	---	---	---	PASS
PCM1	5108	broad.mit.edu	37	8	17804751	17804751	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17804751T>A	uc003wyi.3	+	7	1262	c.840T>A	c.(838-840)CAT>CAA	p.H280Q	PCM1_uc011kyh.1_Missense_Mutation_p.H280Q|PCM1_uc003wyj.3_Missense_Mutation_p.H280Q|PCM1_uc003wyg.2_Missense_Mutation_p.H280Q|PCM1_uc003wyh.2_Missense_Mutation_p.H319Q|PCM1_uc010lta.1_Missense_Mutation_p.H319Q	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1	280	Potential.				centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		AGAAACAACATGATTTATTAA	0.403			T	RET|JAK2	papillary thyroid|CML|MPD								15	65	---	---	---	---	PASS
CLU	1191	broad.mit.edu	37	8	27457472	27457472	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27457472G>T	uc003xfw.1	-	6	1047	c.989C>A	c.(988-990)TCC>TAC	p.S330Y	CLU_uc010lux.1_Missense_Mutation_p.S195Y|CLU_uc003xfx.1_Missense_Mutation_p.S330Y|CLU_uc003xfy.1_Missense_Mutation_p.S341Y|CLU_uc003xfz.1_Missense_Mutation_p.S382Y	NM_203339	NP_976084	P10909	CLUS_HUMAN	clusterin isoform 2	330					chaperone-mediated protein folding|complement activation, classical pathway|innate immune response|lipid metabolic process|negative regulation of apoptosis|negative regulation of protein homooligomerization|platelet activation|platelet degranulation|positive regulation of NF-kappaB transcription factor activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|response to misfolded protein|response to virus|reverse cholesterol transport	chromaffin granule|cytosol|endoplasmic reticulum|microsome|mitochondrial membrane|nucleus|perinuclear region of cytoplasm|platelet alpha granule lumen|spherical high-density lipoprotein particle	misfolded protein binding|ubiquitin protein ligase binding			ovary(2)	2		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		GACCTGGAGGGATTCGTCGAG	0.557													5	83	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35406925	35406925	+	Silent	SNP	C	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35406925C>G	uc003xjr.1	+	2	547	c.219C>G	c.(217-219)CTC>CTG	p.L73L	UNC5D_uc003xjs.1_Silent_p.L68L	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	73	Extracellular (Potential).|Ig-like.				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CTATTGCACTCAGGTGCAAAG	0.512													13	59	---	---	---	---	PASS
RAB11FIP1	80223	broad.mit.edu	37	8	37729205	37729205	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37729205C>A	uc003xkm.1	-	4	3159	c.3115G>T	c.(3115-3117)GTG>TTG	p.V1039L	RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Intron|RAB11FIP1_uc003xkl.1_Missense_Mutation_p.V368L|RAB11FIP1_uc003xko.1_Missense_Mutation_p.V368L|RAB11FIP1_uc003xkp.1_Intron	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	1039					protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			GGAGCTGTCACAGATGCCTGG	0.582													11	129	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55538558	55538558	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55538558G>T	uc003xsd.1	+	4	2264	c.2116G>T	c.(2116-2118)GGT>TGT	p.G706C	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	706			G -> R.		axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AAACACAAAAGGTAGAATTAC	0.363													8	32	---	---	---	---	PASS
TTPA	7274	broad.mit.edu	37	8	63973891	63973891	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63973891C>G	uc003xux.1	-	5	789	c.757G>C	c.(757-759)GAG>CAG	p.E253Q		NM_000370	NP_000361	P49638	TTPA_HUMAN	tocopherol (alpha) transfer protein	253	CRAL-TRIO.				lipid metabolic process		transporter activity|vitamin E binding				0	Breast(64;0.0716)	all_cancers(86;0.145)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.123)			Vitamin E(DB00163)	CAAATGTCCTCCATGGAGAAT	0.383													18	67	---	---	---	---	PASS
CSPP1	79848	broad.mit.edu	37	8	68074067	68074067	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68074067A>G	uc003xxi.2	+	22	2681	c.2650A>G	c.(2650-2652)ATA>GTA	p.I884V	CSPP1_uc003xxj.2_Missense_Mutation_p.I849V|CSPP1_uc003xxk.2_Missense_Mutation_p.I504V|CSPP1_uc010lyw.2_5'Flank	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1	884						centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GCCTTCTCCTATAGTTCCTGC	0.294													17	149	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	68982125	68982125	+	Intron	SNP	T	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68982125T>A	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						ATAAGGTGAGTCTGGTTTTTA	0.313													29	135	---	---	---	---	PASS
ZFAND1	79752	broad.mit.edu	37	8	82626221	82626221	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82626221C>T	uc003ycj.1	-	6	426	c.412G>A	c.(412-414)GAA>AAA	p.E138K	ZFAND1_uc010lzx.1_Missense_Mutation_p.E138K|ZFAND1_uc003yck.1_Missense_Mutation_p.E31K	NM_024699	NP_078975	Q8TCF1	ZFAN1_HUMAN	zinc finger, AN1-type domain 1	138							zinc ion binding			ovary(1)	1						GCAGCTGTTTCACTATTTTTG	0.338													20	82	---	---	---	---	PASS
CA3	761	broad.mit.edu	37	8	86356352	86356352	+	Silent	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86356352G>T	uc003ydj.2	+	4	524	c.441G>T	c.(439-441)CTG>CTT	p.L147L	CA3_uc011lfv.1_RNA	NM_005181	NP_005172	P07451	CAH3_HUMAN	carbonic anhydrase III	147					one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0						GCATTTTTCTGAAGGTAAAGT	0.378													6	47	---	---	---	---	PASS
TTC35	9694	broad.mit.edu	37	8	109482068	109482068	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109482068G>A	uc003ymw.1	+	6	412	c.377G>A	c.(376-378)CGT>CAT	p.R126H		NM_014673	NP_055488	Q15006	TTC35_HUMAN	tetratricopeptide repeat domain 35	126						endoplasmic reticulum|nucleus	binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(57;2.34e-10)			GCAAGAAAGCGTAAGATTGCC	0.408													11	84	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113267647	113267647	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113267647C>T	uc003ynu.2	-	62	10031	c.9872G>A	c.(9871-9873)TGT>TAT	p.C3291Y	CSMD3_uc003yns.2_Missense_Mutation_p.C2493Y|CSMD3_uc003ynt.2_Missense_Mutation_p.C3251Y|CSMD3_uc011lhx.1_Missense_Mutation_p.C3122Y	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3291	Extracellular (Potential).|Sushi 26.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AGGGTCACCACAAAACTTTGC	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			16	65	---	---	---	---	PASS
NOV	4856	broad.mit.edu	37	8	120431513	120431513	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120431513T>G	uc003yoq.2	+	4	926	c.705T>G	c.(703-705)TGT>TGG	p.C235W		NM_002514	NP_002505	P48745	NOV_HUMAN	nephroblastoma overexpressed precursor	235	TSP type-1.				regulation of cell growth		growth factor activity|insulin-like growth factor binding			ovary(2)|skin(2)|kidney(1)	5	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ACCGTCAATGTGAGATGCTGA	0.547													15	196	---	---	---	---	PASS
ZFAT	57623	broad.mit.edu	37	8	135614756	135614756	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135614756C>T	uc003yup.2	-	6	1381	c.1206G>A	c.(1204-1206)CTG>CTA	p.L402L	ZFAT_uc003yun.2_Silent_p.L390L|ZFAT_uc003yuo.2_Silent_p.L390L|ZFAT_uc010meh.2_Silent_p.L390L|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Silent_p.L390L|ZFAT_uc010mej.2_Silent_p.L340L|ZFAT_uc003yur.2_Silent_p.L390L	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1	402					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			AGTCATAGAGCAGCTGCCGCT	0.577													14	57	---	---	---	---	PASS
LYNX1	66004	broad.mit.edu	37	8	143856736	143856736	+	Missense_Mutation	SNP	C	A	A	rs142734660	by1000genomes	TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143856736C>A	uc003yxc.1	-	4	470	c.200G>T	c.(199-201)CGC>CTC	p.R67L	LYNX1_uc003yxb.2_Intron|LYNX1_uc003yxd.1_Missense_Mutation_p.R67L|LYNX1_uc003yxe.1_Missense_Mutation_p.R67L	NM_177476	NP_803429	Q9BZG9	LYNX1_HUMAN	Ly-6 neurotoxin-like protein 1 isoform c	67	UPAR/Ly6.					anchored to membrane|plasma membrane					0	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CTCGAAGCAGCGGGGCACGCA	0.657													6	47	---	---	---	---	PASS
KIF24	347240	broad.mit.edu	37	9	34306263	34306263	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34306263T>G	uc003zua.3	-	3	920	c.800A>C	c.(799-801)CAA>CCA	p.Q267P	KIF24_uc010mkb.2_Missense_Mutation_p.Q298P	NM_194313	NP_919289	Q5T7B8	KIF24_HUMAN	kinesin family member 24	267	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0107)			CAGAATATATTGAGTGAGGTC	0.348													24	249	---	---	---	---	PASS
TESK1	7016	broad.mit.edu	37	9	35608436	35608436	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35608436C>T	uc003zxa.2	+	9	1266	c.930C>T	c.(928-930)CAC>CAT	p.H310H	TESK1_uc003zwz.1_RNA|TESK1_uc010mks.2_Silent_p.H150H	NM_006285	NP_006276	Q15569	TESK1_HUMAN	testis-specific protein kinase 1	310	Protein kinase.				cell junction assembly|spermatogenesis	cytosol	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|breast(2)|lung(1)|ovary(1)|skin(1)	7			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTACCCAGCACCTGGAATGGA	0.592													15	45	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79875069	79875069	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79875069A>G	uc004akr.2	+	23	2616	c.2356A>G	c.(2356-2358)ATG>GTG	p.M786V	VPS13A_uc004akp.3_Missense_Mutation_p.M786V|VPS13A_uc004akq.3_Missense_Mutation_p.M786V|VPS13A_uc004aks.2_Missense_Mutation_p.M786V	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	786					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						ACAAGGGATTATGGAATTGAT	0.294													28	54	---	---	---	---	PASS
INVS	27130	broad.mit.edu	37	9	103014591	103014591	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103014591C>A	uc004bap.1	+	9	1317	c.1105C>A	c.(1105-1107)CAT>AAT	p.H369N	INVS_uc010mta.1_Missense_Mutation_p.H273N|INVS_uc011lve.1_Missense_Mutation_p.H273N|INVS_uc004bao.1_Missense_Mutation_p.H369N|INVS_uc004baq.1_Missense_Mutation_p.H273N|INVS_uc004bar.1_Missense_Mutation_p.H273N|INVS_uc010mtb.1_Missense_Mutation_p.H43N	NM_014425	NP_055240	Q9Y283	INVS_HUMAN	inversin isoform a	369	ANK 11.				negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasm|membrane|microtubule|nucleus|spindle	calmodulin binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.056)				TCTTTCTGGCCATGTCAGCAC	0.388													6	223	---	---	---	---	PASS
PNPLA7	375775	broad.mit.edu	37	9	140355196	140355196	+	Intron	SNP	C	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140355196C>G	uc004cnf.2	-						C9orf167_uc011mew.1_Intron|PNPLA7_uc004cnd.1_Intron|PNPLA7_uc004cne.1_Intron|PNPLA7_uc011mfa.1_Intron|PNPLA7_uc010ncj.1_Intron|NELF_uc011mey.1_5'Flank|NELF_uc004cna.2_5'Flank|NELF_uc011mez.1_5'Flank|NELF_uc004cmz.2_5'Flank|NELF_uc004cnc.2_5'Flank|NELF_uc004cnb.2_5'Flank	NM_152286	NP_689499	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7						lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity			skin(1)	1	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		TCGTCTGGCACCGAGGGTAGG	0.642													23	38	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43287953	43287953	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43287953G>T	uc001jaj.2	+	7	1150	c.792G>T	c.(790-792)TTG>TTT	p.L264F		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	264					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						TGGAAGATTTGACAAACCCAG	0.363													9	84	---	---	---	---	PASS
ERCC6	2074	broad.mit.edu	37	10	50679018	50679018	+	Intron	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50679018T>C	uc001jhs.3	-						ERCC6_uc009xod.2_Intron|ERCC6_uc010qgr.1_Intron|ERCC6_uc001jhr.3_Intron	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent						base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						TTTTATGTAATACCTGCAAAA	0.343								Direct_reversal_of_damage|NER					4	124	---	---	---	---	PASS
OIT3	170392	broad.mit.edu	37	10	74673200	74673200	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74673200C>G	uc001jte.1	+	6	1143	c.925C>G	c.(925-927)CTC>GTC	p.L309V	OIT3_uc009xqs.1_RNA	NM_152635	NP_689848	Q8WWZ8	OIT3_HUMAN	oncoprotein-induced transcript 3 precursor	309	ZP.					nuclear envelope	calcium ion binding			ovary(2)	2	Prostate(51;0.0198)					CCTCTTCTCTCTCAAGACATG	0.562													6	87	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87898569	87898569	+	Intron	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87898569G>T	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	AGGCCCCCATGACCTACCTCG	0.627										Multiple Myeloma(13;0.14)			10	87	---	---	---	---	PASS
IFIT2	3433	broad.mit.edu	37	10	91065931	91065931	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91065931G>T	uc009xts.2	+	2	393	c.218G>T	c.(217-219)TGC>TTC	p.C73F	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|uc001kgd.2_Intron	NM_001547	NP_001538	P09913	IFIT2_HUMAN	interferon-induced protein with	73	TPR 1.				negative regulation of protein binding|response to virus|type I interferon-mediated signaling pathway		protein binding			ovary(1)|skin(1)	2		Colorectal(252;0.0161)				GCCCTGGAATGCTTACGTAAA	0.483													4	59	---	---	---	---	PASS
TMEM20	159371	broad.mit.edu	37	10	95660993	95660993	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95660993G>A	uc001kjg.1	+	3	905	c.844G>A	c.(844-846)GGG>AGG	p.G282R	TMEM20_uc001kji.2_Intron|TMEM20_uc001kjf.1_Missense_Mutation_p.G281R|TMEM20_uc001kjh.2_Intron|TMEM20_uc010qnw.1_Missense_Mutation_p.G265R|TMEM20_uc001kjj.2_Intron	NM_001134658	NP_001128130	Q2M3R5	TMM20_HUMAN	transmembrane protein 20 isoform 1	282	DUF6 2.					integral to membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;3.46e-05)|Renal(717;0.018)|Ovarian(717;0.0228)|all_hematologic(284;0.189)		STAD - Stomach adenocarcinoma(243;0.00345)		GCCTTACTGTGGGTTGGACAG	0.433													11	95	---	---	---	---	PASS
NFKB2	4791	broad.mit.edu	37	10	104159110	104159110	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104159110A>G	uc001kvb.2	+	13	1448	c.1183A>G	c.(1183-1185)ATG>GTG	p.M395V	NFKB2_uc001kva.2_Missense_Mutation_p.M395V|NFKB2_uc001kvd.2_Missense_Mutation_p.M395V|NFKB2_uc009xxc.2_Missense_Mutation_p.M395V	NM_001077494	NP_001070962	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene	395	Gly-rich.				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	Bcl3/NF-kappaB2 complex|cytosol|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			lung(3)	3		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)		CGCGGGCCCCATGGGCTGCTA	0.736			T	IGH@	B-NHL								6	4	---	---	---	---	PASS
HSPA12A	259217	broad.mit.edu	37	10	118451905	118451905	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118451905C>T	uc001lct.2	-	6	725	c.620G>A	c.(619-621)TGG>TAG	p.W207*	HSPA12A_uc001lcu.2_Nonsense_Mutation_p.W124*	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	207							ATP binding			ovary(1)	1				all cancers(201;0.0158)		CGGCTGCTTCCAGATGGCAGG	0.572													63	157	---	---	---	---	PASS
OR51L1	119682	broad.mit.edu	37	11	5020860	5020860	+	Silent	SNP	A	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5020860A>T	uc010qyu.1	+	1	648	c.648A>T	c.(646-648)ATA>ATT	p.I216I		NM_001004755	NP_001004755	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L,	216	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAATCTTCATACTTCTTTCTT	0.413													18	68	---	---	---	---	PASS
OR52W1	120787	broad.mit.edu	37	11	6220979	6220979	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6220979G>A	uc010qzz.1	+	1	526	c.526G>A	c.(526-528)GCC>ACC	p.A176T		NM_001005178	NP_001005178	Q6IF63	O52W1_HUMAN	olfactory receptor, family 52, subfamily W,	176	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCACTTCCAAGCCAAGACCAT	0.512													13	49	---	---	---	---	PASS
LRP4	4038	broad.mit.edu	37	11	46921426	46921426	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46921426C>T	uc001ndn.3	-	4	564	c.418G>A	c.(418-420)GAT>AAT	p.D140N	LRP4_uc009ylh.1_Missense_Mutation_p.D91N	NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	140	Extracellular (Potential).|LDL-receptor class A 3.				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		CACTGCTCATCGCTGTTGTCG	0.617													8	92	---	---	---	---	PASS
OR4C13	283092	broad.mit.edu	37	11	49974527	49974527	+	Missense_Mutation	SNP	C	A	A	rs149246983	byFrequency	TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49974527C>A	uc010rhz.1	+	1	553	c.553C>A	c.(553-555)CTT>ATT	p.L185I		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	185	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						TTTGATCAATCTTGCCTGCAC	0.438													20	190	---	---	---	---	PASS
OR4A5	81318	broad.mit.edu	37	11	51411670	51411670	+	Silent	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51411670G>T	uc001nhi.1	-	1	726	c.726C>A	c.(724-726)ACC>ACA	p.T242T		NM_001005272	NP_001005272	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A,	242	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.T242T(1)		ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(304;0.236)				GGACAACAACGGTACTGCCGG	0.398													12	50	---	---	---	---	PASS
OR8H1	219469	broad.mit.edu	37	11	56058363	56058363	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56058363A>G	uc010rje.1	-	1	176	c.176T>C	c.(175-177)ATG>ACG	p.M59T		NM_001005199	NP_001005199	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H,	59	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	Esophageal squamous(21;0.00448)					GAAAAAATACATGGGAGTGTG	0.403													78	281	---	---	---	---	PASS
OR5B12	390191	broad.mit.edu	37	11	58206755	58206755	+	Silent	SNP	C	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58206755C>G	uc010rkh.1	-	1	870	c.870G>C	c.(868-870)CTG>CTC	p.L290L		NM_001004733	NP_001004733	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B,	290	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CTTTGTTCCTCAGGCTGTAGA	0.393													5	95	---	---	---	---	PASS
GLYATL1	92292	broad.mit.edu	37	11	58723372	58723372	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58723372C>T	uc001nnf.2	+	8	1157	c.781C>T	c.(781-783)CCA>TCA	p.P261S	uc001nng.1_Intron|GLYATL1_uc001nnh.1_Missense_Mutation_p.P292S|GLYATL1_uc001nni.1_Missense_Mutation_p.P261S|GLYATL1_uc001nnj.1_Missense_Mutation_p.P261S			Q969I3	GLYL1_HUMAN	SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;	261						mitochondrion	glycine N-acyltransferase activity			ovary(1)	1					Glycine(DB00145)	GAAGAATATTCCATTTTACAT	0.458													14	98	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64417958	64417958	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64417958G>T	uc001oar.2	-	16	3510	c.3071C>A	c.(3070-3072)ACG>AAG	p.T1024K	NRXN2_uc001oas.2_Missense_Mutation_p.T984K|NRXN2_uc001oaq.2_Missense_Mutation_p.T691K	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						GGAGTGCTGCGTGACAGTGCG	0.602													53	234	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65273851	65273851	+	RNA	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65273851T>C	uc010roh.1	+	1		c.8619T>C			uc001ody.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						GCCTTGTCTTTTTCAGGTAAT	0.338													9	23	---	---	---	---	PASS
GPR152	390212	broad.mit.edu	37	11	67219276	67219276	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67219276C>A	uc001olm.2	-	1	925	c.920G>T	c.(919-921)CGC>CTC	p.R307L	uc009yrw.1_5'Flank|CABP4_uc001oln.2_5'Flank	NM_206997	NP_996880	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	307	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			GAGCACGGAGCGCAGCAGGGT	0.647													18	71	---	---	---	---	PASS
SUV420H1	51111	broad.mit.edu	37	11	67925895	67925895	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67925895C>G	uc001onm.1	-	11	2174	c.1918G>C	c.(1918-1920)GAC>CAC	p.D640H	SUV420H1_uc009yse.1_Missense_Mutation_p.D226H|SUV420H1_uc001onn.1_Missense_Mutation_p.D468H|SUV420H1_uc009ysf.2_Missense_Mutation_p.D400H	NM_017635	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 isoform	640					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(2)|kidney(1)	3						GGTACCGCGTCGTCTTTTCCA	0.507													9	34	---	---	---	---	PASS
PCF11	51585	broad.mit.edu	37	11	82877481	82877481	+	Silent	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82877481G>T	uc001ozx.3	+	5	1887	c.1542G>T	c.(1540-1542)TCG>TCT	p.S514S	PCF11_uc010rsu.1_Silent_p.S514S	NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11	514					mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1						CTCCAACATCGACACCTAAAG	0.448													3	83	---	---	---	---	PASS
FXYD6	53826	broad.mit.edu	37	11	117711023	117711023	+	Intron	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117711023C>A	uc001pro.1	-						FXYD6_uc001prn.1_Intron|FXYD6_uc001prp.1_Intron|FXYD6_uc001prq.1_Intron|FXYD6_uc001prr.1_Intron|FXYD6_uc009yzq.1_Silent_p.P90P	NM_022003	NP_071286	Q9H0Q3	FXYD6_HUMAN	FXYD domain-containing ion transport regulator 6							integral to membrane|plasma membrane	ion channel activity			central_nervous_system(1)|skin(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|Breast(348;0.111)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.89e-05)|Epithelial(105;0.00122)		CAGGTGGTCACGGACAGTTAC	0.597													10	76	---	---	---	---	PASS
NLRX1	79671	broad.mit.edu	37	11	119045219	119045219	+	Missense_Mutation	SNP	G	A	A	rs147720831	byFrequency	TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119045219G>A	uc001pvu.2	+	6	1122	c.907G>A	c.(907-909)GTG>ATG	p.V303M	NLRX1_uc010rzc.1_Missense_Mutation_p.V125M|NLRX1_uc001pvv.2_Missense_Mutation_p.V303M|NLRX1_uc001pvw.2_Missense_Mutation_p.V303M|NLRX1_uc001pvx.2_Missense_Mutation_p.V303M	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1	303	Required for interaction with MAVS.|NACHT.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CAGCAAGTACGTGGGCCGCTA	0.567													56	228	---	---	---	---	PASS
OR10G9	219870	broad.mit.edu	37	11	123893759	123893759	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123893759G>A	uc010sad.1	+	1	40	c.40G>A	c.(40-42)GGC>AGC	p.G14S		NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G,	14	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CATCCTCACGGGCCTTCCCCA	0.562													10	287	---	---	---	---	PASS
OR10G7	390265	broad.mit.edu	37	11	123909669	123909669	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123909669C>T	uc001pzq.1	-	1	40	c.40G>A	c.(40-42)GGC>AGC	p.G14S		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	14	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TGGGGAAGGCCCGTGAGGATG	0.542													13	163	---	---	---	---	PASS
ADAMTS15	170689	broad.mit.edu	37	11	130332581	130332581	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130332581G>A	uc010scd.1	+	4	1448	c.1448G>A	c.(1447-1449)CGC>CAC	p.R483H		NM_139055	NP_620686	Q8TE58	ATS15_HUMAN	a disintegrin-like and metalloprotease	483	Disintegrin.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		TGCCAGACCCGCCACTTCCCC	0.622													12	88	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	993323	993323	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:993323C>T	uc001qio.3	+	18	4265	c.3758C>T	c.(3757-3759)TCT>TTT	p.S1253F	WNK1_uc001qip.3_Missense_Mutation_p.S1006F|WNK1_uc001qir.3_Missense_Mutation_p.S426F	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1253					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GTTGTTCATTCTGCGGGAAGG	0.363													19	141	---	---	---	---	PASS
LPCAT3	10162	broad.mit.edu	37	12	7091877	7091877	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7091877C>T	uc001qsi.2	-	3	440	c.326G>A	c.(325-327)CGC>CAC	p.R109H	EMG1_uc010sfv.1_Intron|LPCAT3_uc010sfw.1_Missense_Mutation_p.R3H|LPCAT3_uc009zfp.2_RNA|LPCAT3_uc010sfx.1_RNA|LPCAT3_uc009zfq.1_Intron	NM_005768	NP_005759	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	109					phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity			ovary(1)	1						AGTGATGGTGCGGCCCATTAG	0.502													35	71	---	---	---	---	PASS
TBC1D15	64786	broad.mit.edu	37	12	72266713	72266713	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72266713C>T	uc001swu.2	+	3	209	c.200C>T	c.(199-201)GCC>GTC	p.A67V	TBC1D15_uc009zrv.2_5'UTR|TBC1D15_uc010stt.1_Missense_Mutation_p.A53V|TBC1D15_uc001swv.2_Missense_Mutation_p.A67V|TBC1D15_uc001sww.2_5'UTR	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1	45							protein binding|Rab GTPase activator activity				0						CTCTAGGATGCCGAAGTAATA	0.308													13	176	---	---	---	---	PASS
TBC1D15	64786	broad.mit.edu	37	12	72266722	72266722	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72266722T>A	uc001swu.2	+	3	218	c.209T>A	c.(208-210)ATA>AAA	p.I70K	TBC1D15_uc009zrv.2_5'UTR|TBC1D15_uc010stt.1_Missense_Mutation_p.I56K|TBC1D15_uc001swv.2_Missense_Mutation_p.I70K|TBC1D15_uc001sww.2_5'UTR	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1	48							protein binding|Rab GTPase activator activity				0						GCCGAAGTAATAGTGGACTGG	0.303													12	186	---	---	---	---	PASS
TMTC3	160418	broad.mit.edu	37	12	88589318	88589318	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88589318C>A	uc001tau.2	+	14	2857	c.2637C>A	c.(2635-2637)GAC>GAA	p.D879E		NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat	880						integral to membrane	binding			skin(1)	1						AAAATGGAGACGAAGAGACAC	0.308													31	52	---	---	---	---	PASS
TMTC3	160418	broad.mit.edu	37	12	88589319	88589319	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88589319G>A	uc001tau.2	+	14	2858	c.2638G>A	c.(2638-2640)GAA>AAA	p.E880K		NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat	881						integral to membrane	binding			skin(1)	1						AAATGGAGACGAAGAGACACC	0.313													31	49	---	---	---	---	PASS
CRY1	1407	broad.mit.edu	37	12	107391697	107391697	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107391697T>C	uc001tmi.3	-	8	2144	c.1285A>G	c.(1285-1287)ATC>GTC	p.I429V		NM_004075	NP_004066	Q16526	CRY1_HUMAN	cryptochrome 1 (photolyase-like)	429	Required for inhibition of CLOCK-ARNTL- mediated transcription (By similarity).|FAD-binding.				DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	blue light photoreceptor activity|DNA photolyase activity|double-stranded DNA binding|nucleotide binding|protein binding			ovary(3)	3						ATTTACCTGATATAGTCTCCA	0.373													7	68	---	---	---	---	PASS
MAB21L1	4081	broad.mit.edu	37	13	36050132	36050132	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36050132C>A	uc001uvc.2	-	1	701	c.144G>T	c.(142-144)CAG>CAT	p.Q48H	NBEA_uc001uvb.2_Intron|NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_5'Flank|NBEA_uc010teg.1_5'Flank	NM_005584	NP_005575	Q13394	MB211_HUMAN	mab-21-like protein 1	48					anatomical structure morphogenesis	nucleus				ovary(2)	2		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		ACCGCGGCTCCTGCACTTCCA	0.512													41	96	---	---	---	---	PASS
FAM48A	55578	broad.mit.edu	37	13	37605726	37605726	+	Nonsense_Mutation	SNP	A	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37605726A>T	uc001uwg.2	-	12	1147	c.899T>A	c.(898-900)TTG>TAG	p.L300*	FAM48A_uc010abt.2_Nonsense_Mutation_p.L301*|FAM48A_uc001uwh.2_Nonsense_Mutation_p.L301*|FAM48A_uc001uwi.2_Nonsense_Mutation_p.L300*|FAM48A_uc001uwj.2_Nonsense_Mutation_p.L301*|FAM48A_uc001uwk.2_Nonsense_Mutation_p.L300*|FAM48A_uc010tes.1_Nonsense_Mutation_p.L288*|FAM48A_uc001uwl.1_Nonsense_Mutation_p.L300*	NM_001014286	NP_001014308	Q8NEM7	FA48A_HUMAN	family with sequence similarity 48, member A	300					autophagy|gastrulation	SAGA-type complex	protein binding				0		Lung NSC(96;2.09e-06)|Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.0959)		all cancers(112;6.06e-07)|Epithelial(112;1.87e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00794)|BRCA - Breast invasive adenocarcinoma(63;0.0128)|GBM - Glioblastoma multiforme(144;0.0477)		AGGTATGGCCAAATTACAGGG	0.279													22	48	---	---	---	---	PASS
PCDH8	5100	broad.mit.edu	37	13	53420719	53420719	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53420719G>T	uc001vhi.2	-	1	2056	c.1853C>A	c.(1852-1854)TCC>TAC	p.S618Y	PCDH8_uc001vhj.2_Missense_Mutation_p.S618Y	NM_002590	NP_002581	O95206	PCDH8_HUMAN	protocadherin 8 isoform 1 precursor	618	Extracellular (Potential).|Cadherin 6.				cell-cell signaling|homophilic cell adhesion	cell junction|dendrite|integral to plasma membrane|postsynaptic membrane|presynaptic membrane	calcium ion binding			breast(1)	1		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CACTTCTAGGGAGCCATTGGC	0.682													3	4	---	---	---	---	PASS
C14orf106	55320	broad.mit.edu	37	14	45715975	45715975	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45715975G>A	uc001wwf.2	-	2	974	c.515C>T	c.(514-516)TCA>TTA	p.S172L	C14orf106_uc010anh.2_RNA	NM_018353	NP_060823	Q6P0N0	M18BP_HUMAN	chromosome 14 open reading frame 106	172					cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm	DNA binding				0						TGACTGGAATGATTTGTTGTT	0.284													16	134	---	---	---	---	PASS
NID2	22795	broad.mit.edu	37	14	52485899	52485899	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52485899G>T	uc001wzo.2	-	14	3142	c.2908C>A	c.(2908-2910)CTG>ATG	p.L970M	NID2_uc010tqs.1_Missense_Mutation_p.L922M|NID2_uc010tqt.1_Missense_Mutation_p.L970M|NID2_uc001wzp.2_Missense_Mutation_p.L970M	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	970	Thyroglobulin type-1 1.					basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					TGTAGGGGCAGGAAGTTGCCC	0.627													10	38	---	---	---	---	PASS
EML5	161436	broad.mit.edu	37	14	89154734	89154734	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89154734C>T	uc001xxg.2	-	19	2809	c.2623G>A	c.(2623-2625)GAA>AAA	p.E875K	EML5_uc001xxh.1_Intron	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	875	WD 14.					cytoplasm|microtubule				ovary(3)	3						GCCATCTCTTCAGTCCATCCA	0.433													36	281	---	---	---	---	PASS
SCG5	6447	broad.mit.edu	37	15	32972055	32972055	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32972055G>T	uc001zha.2	+	3	432	c.315G>T	c.(313-315)AAG>AAT	p.K105N	SCG5_uc001zgz.2_Missense_Mutation_p.K105N	NM_001144757	NP_001138229	P05408	7B2_HUMAN	secretogranin V isoform 1	105					intracellular protein transport|neuropeptide signaling pathway|peptide hormone processing|regulation of hormone secretion	extracellular region|stored secretory granule	enzyme inhibitor activity|GTP binding|unfolded protein binding				0		all_lung(180;7.32e-08)		all cancers(64;6.48e-17)|Epithelial(43;1.23e-11)|GBM - Glioblastoma multiforme(186;1.39e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0212)		ACATTCCTAAGGACTTTAGTG	0.498													21	220	---	---	---	---	PASS
SLC27A2	11001	broad.mit.edu	37	15	50489802	50489802	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50489802T>C	uc001zxw.2	+	2	816	c.584T>C	c.(583-585)CTG>CCG	p.L195P	SLC27A2_uc010bes.2_Missense_Mutation_p.L195P|SLC27A2_uc001zxx.2_5'UTR	NM_003645	NP_003636	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid	195	Lumenal (Potential).				bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity			ovary(1)|skin(1)	2		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		GACTCTTTCCTGGACAAAGTG	0.423													13	96	---	---	---	---	PASS
ONECUT1	3175	broad.mit.edu	37	15	53081625	53081625	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53081625G>A	uc002aci.1	-	1	585	c.457C>T	c.(457-459)CGG>TGG	p.R153W		NM_004498	NP_004489	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	153					endocrine pancreas development	nucleus	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding				0				all cancers(107;0.0708)		CGCTCATCCCGCATGAGCGTG	0.502													4	90	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54305472	54305472	+	Silent	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54305472G>A	uc002ack.2	+	1	372	c.372G>A	c.(370-372)GAG>GAA	p.E124E		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	124	Potential.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CTTCAATCGAGAGTTCCTACT	0.408													11	30	---	---	---	---	PASS
BCL2A1	597	broad.mit.edu	37	15	80263061	80263061	+	Missense_Mutation	SNP	A	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80263061A>C	uc002bfc.3	-	1	583	c.401T>G	c.(400-402)ATA>AGA	p.I134R	BCL2A1_uc002bfd.3_Missense_Mutation_p.I134R	NM_004049	NP_004040	Q16548	B2LA1_HUMAN	BCL2-related protein A1 isoform 1	134	BH2.				anti-apoptosis|apoptosis	cytoplasm	protein binding			pancreas(1)	1						GTTTTGCCTTATCCATTCTCC	0.373													13	201	---	---	---	---	PASS
KLHL25	64410	broad.mit.edu	37	15	86312069	86312069	+	Missense_Mutation	SNP	C	A	A	rs139382084		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86312069C>A	uc002bly.2	-	2	1176	c.973G>T	c.(973-975)GAC>TAC	p.D325Y		NM_022480	NP_071925	Q9H0H3	ENC2_HUMAN	BTB/POZ KELCH domain protein	325	Kelch 1.					cytoplasm				ovary(2)	2						CTGGGCAGGTCGGCCTTGGGG	0.632													17	33	---	---	---	---	PASS
OR4F15	390649	broad.mit.edu	37	15	102358392	102358392	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102358392G>C	uc010uts.1	+	1	3	c.3G>C	c.(1-3)ATG>ATC	p.M1I		NM_001001674	NP_001001674	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F,	1	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			CTGAGGCAATGAATGGAATGA	0.368													14	164	---	---	---	---	PASS
MAPK8IP3	23162	broad.mit.edu	37	16	1810516	1810516	+	Silent	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1810516G>T	uc002cmk.2	+	12	1557	c.1437G>T	c.(1435-1437)CTG>CTT	p.L479L	MAPK8IP3_uc002cml.2_Silent_p.L473L|MAPK8IP3_uc010uvl.1_Silent_p.L480L	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	479	Potential.				vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						TCAAGGAGCTGGAAGAGGAAC	0.617													6	108	---	---	---	---	PASS
MAPK8IP3	23162	broad.mit.edu	37	16	1810517	1810517	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1810517G>T	uc002cmk.2	+	12	1558	c.1438G>T	c.(1438-1440)GAA>TAA	p.E480*	MAPK8IP3_uc002cml.2_Nonsense_Mutation_p.E474*|MAPK8IP3_uc010uvl.1_Nonsense_Mutation_p.E481*	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	480	Potential.				vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						CAAGGAGCTGGAAGAGGAACT	0.612													6	107	---	---	---	---	PASS
TMC5	79838	broad.mit.edu	37	16	19451611	19451611	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19451611C>T	uc002dgc.3	+	3	1000	c.251C>T	c.(250-252)TCT>TTT	p.S84F	TMC5_uc010vaq.1_Missense_Mutation_p.S84F|TMC5_uc002dgb.3_Missense_Mutation_p.S84F|TMC5_uc010var.1_Missense_Mutation_p.S84F	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a	84	Extracellular (Potential).					integral to membrane				skin(1)	1						CCAGACTATTCTGGCACCAGA	0.478													27	120	---	---	---	---	PASS
C16orf62	57020	broad.mit.edu	37	16	19711758	19711758	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19711758C>T	uc002dgn.1	+	31	2864	c.2852C>T	c.(2851-2853)ACG>ATG	p.T951M	C16orf62_uc002dgo.1_Missense_Mutation_p.T858M|C16orf62_uc002dgp.1_Missense_Mutation_p.T700M	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020	951						integral to membrane				ovary(1)	1						ACTCATCTGACGGAGCTGGCC	0.502													22	61	---	---	---	---	PASS
SETD1A	9739	broad.mit.edu	37	16	30994981	30994981	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30994981G>A	uc002ead.1	+	18	5524	c.4838G>A	c.(4837-4839)CGC>CAC	p.R1613H	HSD3B7_uc002eaf.2_5'Flank|HSD3B7_uc010cac.2_5'Flank|HSD3B7_uc002eag.2_5'Flank|HSD3B7_uc002eah.2_5'Flank	NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	1613	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						CGGGAGAAGCGCTACGTGCAG	0.622													7	16	---	---	---	---	PASS
SNX20	124460	broad.mit.edu	37	16	50709793	50709793	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50709793G>T	uc002egk.2	-	3	343	c.170C>A	c.(169-171)ACG>AAG	p.T57K	SNX20_uc010vgp.1_Missense_Mutation_p.T57K|SNX20_uc002egi.3_Missense_Mutation_p.T57K	NM_182854	NP_878274	Q7Z614	SNX20_HUMAN	sorting nexin 20 isoform 1	57					cell communication|protein transport	endosome membrane|nucleus|plasma membrane	phosphatidylinositol binding|protein binding			ovary(1)	1						AAGCTCCCGCGTGGTCATGCT	0.552													38	87	---	---	---	---	PASS
GOT2	2806	broad.mit.edu	37	16	58750585	58750585	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58750585T>C	uc002eof.1	-	7	949	c.835A>G	c.(835-837)AAG>GAG	p.K279E	GOT2_uc010vim.1_Missense_Mutation_p.K236E	NM_002080	NP_002071	P00505	AATM_HUMAN	aspartate aminotransferase 2 precursor	279					aspartate catabolic process|fatty acid transport|gluconeogenesis|response to ethanol	mitochondrial matrix|plasma membrane	L-aspartate:2-oxoglutarate aminotransferase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	CCCATGTTCTTGGCATATGAT	0.473													25	52	---	---	---	---	PASS
DPEP2	64174	broad.mit.edu	37	16	68021501	68021501	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68021501G>C	uc010cey.2	-	10	1533	c.1369C>G	c.(1369-1371)CCA>GCA	p.P457A	DPEP2_uc002evd.3_Missense_Mutation_p.P462A|DPEP2_uc002eve.2_Missense_Mutation_p.P457A|DPEP2_uc002evf.2_RNA	NM_022355	NP_071750	Q9H4A9	DPEP2_HUMAN	dipeptidase 2 precursor	457					hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|proteolysis	anchored to membrane|plasma membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)		CACTTGGCTGGTAACTTGGCT	0.567													71	153	---	---	---	---	PASS
ADAMTS18	170692	broad.mit.edu	37	16	77396100	77396100	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77396100G>T	uc002ffc.3	-	7	1537	c.1118C>A	c.(1117-1119)TCT>TAT	p.S373Y	ADAMTS18_uc010chc.1_Translation_Start_Site|ADAMTS18_uc002ffe.1_Missense_Mutation_p.S69Y|ADAMTS18_uc010vni.1_Intron	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	373	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						AATGAGGGCAGACTGCCATTG	0.403													33	42	---	---	---	---	PASS
SERPINF2	5345	broad.mit.edu	37	17	1650356	1650356	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1650356C>A	uc002ftk.1	+	6	488	c.411C>A	c.(409-411)CAC>CAA	p.H137Q	SERPINF2_uc010vqr.1_Missense_Mutation_p.H73Q	NM_000934	NP_000925	P08697	A2AP_HUMAN	alpha-2-antiplasmin isoform a precursor	137					acute-phase response|fibrinolysis|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Streptokinase(DB00086)	AGGTGCTGCACGCAGGCTCAG	0.682													8	21	---	---	---	---	PASS
PLD2	5338	broad.mit.edu	37	17	4720515	4720515	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4720515C>T	uc002fzc.2	+	17	1877	c.1776C>T	c.(1774-1776)CTC>CTT	p.L592L	PLD2_uc010vsj.1_Silent_p.L449L|PLD2_uc002fzd.2_Silent_p.L592L	NM_002663	NP_002654	O14939	PLD2_HUMAN	phospholipase D2	592	Catalytic.				cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5					Choline(DB00122)	CCAATCAGCTCCCCTTCACAC	0.602													49	142	---	---	---	---	PASS
AMAC1L3	643664	broad.mit.edu	37	17	7385380	7385380	+	Missense_Mutation	SNP	G	A	A	rs61740425		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7385380G>A	uc010cmj.1	+	2	192	c.77G>A	c.(76-78)CGC>CAC	p.R26H	ZBTB4_uc002ghc.3_5'Flank|ZBTB4_uc002ghd.3_Intron|POLR2A_uc002ghe.2_5'Flank|POLR2A_uc002ghf.3_5'Flank	NM_001102614	NP_001096084	P0C7Q6	AMCL3_HUMAN	acyl-malonyl condensing enzyme 1-like 3	26						integral to membrane					0		Prostate(122;0.173)				CCCAGCCTCCGCTGGCACCAG	0.662													14	70	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7681435	7681435	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7681435T>G	uc002giu.1	+	33	5302	c.5288T>G	c.(5287-5289)TTT>TGT	p.F1763C		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	1763	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AACACGCAATTTCAGTATAAT	0.542													4	43	---	---	---	---	PASS
SSH2	85464	broad.mit.edu	37	17	27959196	27959196	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27959196G>T	uc002heo.1	-	15	2935	c.2935C>A	c.(2935-2937)CAG>AAG	p.Q979K	SSH2_uc010wbh.1_Missense_Mutation_p.Q1006K	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	979					actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						CCTTCCTGCTGTGTTCCAGTA	0.537													41	87	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29483156	29483156	+	Intron	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29483156G>T	uc002hgg.2	+						NF1_uc002hge.1_Intron|NF1_uc002hgf.1_Intron|NF1_uc002hgh.2_Intron|NF1_uc010csn.1_Intron	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.0?(5)|p.?(3)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGAGTATTTGGGTTACTGTGT	0.308			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			31	107	---	---	---	---	PASS
KRT33B	3884	broad.mit.edu	37	17	39525757	39525757	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39525757C>T	uc002hwl.2	-	1	291	c.246G>A	c.(244-246)GCG>GCA	p.A82A		NM_002279	NP_002270	Q14525	KT33B_HUMAN	type I hair keratin 3B	82	Coil 1A.|Rod.					intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)				TCTCCAGCTCCGCGTTGTCCC	0.607													20	108	---	---	---	---	PASS
KCNH4	23415	broad.mit.edu	37	17	40321497	40321497	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40321497C>T	uc002hzb.2	-	9	1921	c.1588G>A	c.(1588-1590)GAG>AAG	p.E530K		NM_012285	NP_036417	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H,	530	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	two-component sensor activity|voltage-gated potassium channel activity			large_intestine(1)	1		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CAGGCTACCTCGTTGGCGTCG	0.637													5	78	---	---	---	---	PASS
G6PC	2538	broad.mit.edu	37	17	41063400	41063400	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41063400G>T	uc002icb.1	+	5	1110	c.1031G>T	c.(1030-1032)TGC>TTC	p.C344F	G6PC_uc010whf.1_3'UTR	NM_000151	NP_000142	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	344	Cytoplasmic (Potential).				gluconeogenesis|glucose homeostasis|transmembrane transport	integral to endoplasmic reticulum membrane	glucose-6-phosphatase activity|phosphate binding			ovary(1)|breast(1)|kidney(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		ATCCCCTACTGCCTCGCCCAG	0.557									Glycogen_Storage_Disease_type_Ia				30	127	---	---	---	---	PASS
HOXB8	3218	broad.mit.edu	37	17	46691646	46691646	+	Nonsense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46691646G>A	uc002inw.2	-	1	656	c.421C>T	c.(421-423)CAA>TAA	p.Q141*		NM_024016	NP_076921	P17481	HXB8_HUMAN	homeobox B8	141						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						AGCTCACCTTGCGGGCGCATC	0.716													4	13	---	---	---	---	PASS
RSAD1	55316	broad.mit.edu	37	17	48561869	48561869	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48561869G>A	uc002iqw.1	+	8	1230	c.1174G>A	c.(1174-1176)GAG>AAG	p.E392K	RSAD1_uc010wmq.1_RNA	NM_018346	NP_060816	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing	392					porphyrin biosynthetic process	mitochondrion	4 iron, 4 sulfur cluster binding|coproporphyrinogen oxidase activity|metal ion binding				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GGAGGTGCAGGAGCTGCTGGA	0.642													11	144	---	---	---	---	PASS
CD300LB	124599	broad.mit.edu	37	17	72522207	72522207	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72522207G>T	uc002jkx.2	-	2	174	c.161C>A	c.(160-162)TCC>TAC	p.S54Y	CD300LB_uc010wqz.1_Missense_Mutation_p.S54Y	NM_174892	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	17						integral to membrane|plasma membrane	receptor activity			ovary(1)	1						GCCTTGGATGGAGAAACAGCC	0.557													18	232	---	---	---	---	PASS
SMAD4	4089	broad.mit.edu	37	18	48604810	48604810	+	Silent	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48604810G>T	uc010xdp.1	+	12	2170	c.1632G>T	c.(1630-1632)CCG>CCT	p.P544P	SMAD4_uc002lfb.3_Silent_p.P389P	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	544	MH2.				BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.?(2)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		ATACCATGCCGATTGCAGACC	0.458									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				6	69	---	---	---	---	PASS
THEG	51298	broad.mit.edu	37	19	362268	362268	+	Missense_Mutation	SNP	C	T	T	rs112813656		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:362268C>T	uc002lol.2	-	8	1111	c.1072G>A	c.(1072-1074)GCC>ACC	p.A358T	THEG_uc002lom.2_Missense_Mutation_p.A334T	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1	358					cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCATAGAGGCGAGGGGACGC	0.602													23	197	---	---	---	---	PASS
SHC2	25759	broad.mit.edu	37	19	439005	439005	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:439005C>A	uc002loq.3	-	3	565	c.565G>T	c.(565-567)GCC>TCC	p.A189S	SHC2_uc002lop.3_5'Flank	NM_012435	NP_036567	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing)	189	PID.				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol					0		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGGCACGGCCTCATGGAGC	0.572													3	10	---	---	---	---	PASS
SIRT6	51548	broad.mit.edu	37	19	4174904	4174904	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4174904C>A	uc002lzo.2	-	8	838	c.778G>T	c.(778-780)GAG>TAG	p.E260*	SIRT6_uc002lzn.2_Silent_p.T174T|SIRT6_uc002lzp.2_Silent_p.T185T|SIRT6_uc010xid.1_Nonsense_Mutation_p.E188*|SIRT6_uc002lzq.2_Nonsense_Mutation_p.E233*|SIRT6_uc002lzr.2_Nonsense_Mutation_p.E161*	NM_016539	NP_057623	Q8N6T7	SIRT6_HUMAN	sirtuin 6	260	Deacetylase sirtuin-type.				chromatin silencing|protein ADP-ribosylation	nuclear telomeric heterochromatin|nucleoplasm	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity|NAD+ binding|NAD-dependent histone deacetylase activity (H3-K9 specific)|protein binding|zinc ion binding			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCATGACCTCGTCAACGTAG	0.721													7	30	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9057326	9057326	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9057326C>T	uc002mkp.2	-	3	30324	c.30120G>A	c.(30118-30120)CCG>CCA	p.P10040P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10042	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGATACTCTGCGGTAATGTGG	0.468													8	55	---	---	---	---	PASS
DNM2	1785	broad.mit.edu	37	19	10939875	10939875	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10939875C>A	uc002mps.1	+	19	2386	c.2222C>A	c.(2221-2223)ACC>AAC	p.T741N	DNM2_uc010dxk.2_Intron|DNM2_uc002mpt.1_Missense_Mutation_p.T741N|DNM2_uc002mpv.1_Missense_Mutation_p.T737N|DNM2_uc002mpu.1_Missense_Mutation_p.T737N|DNM2_uc010dxl.1_Missense_Mutation_p.T741N|DNM2_uc002mpw.2_Missense_Mutation_p.T470N|DNM2_uc002mpx.1_Missense_Mutation_p.T97N	NM_001005361	NP_001005361	P50570	DYN2_HUMAN	dynamin 2 isoform 2	741	GED.				G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding			central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			GACATCAGCACCAGCACTGTG	0.637													7	64	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17756884	17756884	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17756884G>T	uc002nhd.2	-	18	2345	c.2345C>A	c.(2344-2346)ACA>AAA	p.T782K		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	694	C2 2.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						ACTGGATCCTGTCTTGTCCTT	0.557													6	40	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17768938	17768938	+	Missense_Mutation	SNP	C	T	T	rs139378806	by1000genomes	TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17768938C>T	uc002nhd.2	-	10	964	c.964G>A	c.(964-966)GGC>AGC	p.G322S		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	234					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						TCCCGGGAGCCCAGGGGTGGT	0.577													8	27	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22153543	22153543	+	Intron	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22153543G>A	uc002nqp.2	-						ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				GTTGGGAACTGTTTAAAAGCT	0.383													7	40	---	---	---	---	PASS
MAG	4099	broad.mit.edu	37	19	35804198	35804198	+	Silent	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35804198G>A	uc002nyy.1	+	11	1871	c.1722G>A	c.(1720-1722)GAG>GAA	p.E574E	MAG_uc002nyx.1_3'UTR|MAG_uc010eds.1_Silent_p.E549E|MAG_uc002nyz.1_Silent_p.E574E	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a	574	Cytoplasmic (Potential).				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CTTAGAGCGAGAGGCGCCTGG	0.617													92	239	---	---	---	---	PASS
PSG5	5673	broad.mit.edu	37	19	43689098	43689098	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43689098T>A	uc002ovu.2	-	2	397	c.266A>T	c.(265-267)AAT>ATT	p.N89I	PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_Missense_Mutation_p.N17I|PSG5_uc002ovx.2_Missense_Mutation_p.N89I|PSG5_uc002ovv.2_Missense_Mutation_p.N89I|PSG5_uc002ovw.2_Missense_Mutation_p.N89I	NM_002781	NP_002772	Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	89	Ig-like V-type.				female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)				CCCATATATATTTATTTGACC	0.438													240	221	---	---	---	---	PASS
ZNF230	7773	broad.mit.edu	37	19	44514961	44514961	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44514961G>A	uc002oyb.1	+	5	1021	c.770G>A	c.(769-771)TGT>TAT	p.C257Y		NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	257	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				TGTGAGAAATGTGGGAGGGCC	0.413													102	110	---	---	---	---	PASS
TRPM4	54795	broad.mit.edu	37	19	49671211	49671211	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49671211T>C	uc002pmw.2	+	4	377	c.305T>C	c.(304-306)GTT>GCT	p.V102A	TRPM4_uc010emu.2_Missense_Mutation_p.V102A|TRPM4_uc010yak.1_Intron|TRPM4_uc002pmx.2_Intron|TRPM4_uc010emv.2_Intron|TRPM4_uc010yal.1_Intron	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,	102	Cytoplasmic (Potential).				dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		CCAGCTGCAGTTTATAGTCTG	0.607													13	280	---	---	---	---	PASS
ALDH16A1	126133	broad.mit.edu	37	19	49965239	49965239	+	Silent	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49965239C>T	uc002pnt.2	+	7	974	c.858C>T	c.(856-858)GAC>GAT	p.D286D	ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Silent_p.D121D|ALDH16A1_uc010yat.1_Silent_p.D123D	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	286							oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		ACACGGCGGACGTAGACTCGG	0.721													6	3	---	---	---	---	PASS
LILRA6	79168	broad.mit.edu	37	19	54744817	54744817	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54744817G>T	uc002qeu.1	-	5	969	c.845C>A	c.(844-846)ACC>AAC	p.T282N	LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Missense_Mutation_p.T282N|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Missense_Mutation_p.T282N|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.T282N|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Missense_Mutation_p.T282N|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Missense_Mutation_p.T282N|LILRA6_uc010yeq.1_Missense_Mutation_p.T282N|LILRA6_uc002qet.3_RNA|LILRA6_uc002qev.1_Missense_Mutation_p.T143N	NM_024318	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor,	282	Extracellular (Potential).|Ig-like C2-type 1.					integral to membrane	receptor activity			skin(2)	2	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGGGCCCAGGGTGAAGTTGGC	0.647													49	112	---	---	---	---	PASS
TASP1	55617	broad.mit.edu	37	20	13415774	13415774	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13415774C>A	uc002woi.2	-	12	1130	c.1013G>T	c.(1012-1014)GGC>GTC	p.G338V	TASP1_uc010zri.1_RNA|TASP1_uc002woh.2_Missense_Mutation_p.G315V	NM_017714	NP_060184	Q9H6P5	TASP1_HUMAN	taspase 1 precursor	338					asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0						GCCAAGCACGCCATCTTCACT	0.403													4	36	---	---	---	---	PASS
RALGAPB	57148	broad.mit.edu	37	20	37121581	37121581	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37121581G>T	uc002xiw.2	+	3	452	c.195G>T	c.(193-195)TGG>TGT	p.W65C	RALGAPB_uc010zvz.1_Missense_Mutation_p.W65C|RALGAPB_uc002xix.2_Missense_Mutation_p.W65C|RALGAPB_uc002xiy.1_Missense_Mutation_p.W65C|RALGAPB_uc002xiz.2_5'UTR	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	65					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						AGGTAAAATGGACCATGGAAG	0.343													28	199	---	---	---	---	PASS
SGK2	10110	broad.mit.edu	37	20	42203616	42203616	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42203616C>T	uc002xkv.2	+	9	1064	c.845C>T	c.(844-846)GCA>GTA	p.A282V	SGK2_uc002xkt.2_RNA|SGK2_uc002xkr.2_Missense_Mutation_p.A222V|SGK2_uc010ggm.2_Missense_Mutation_p.A222V|SGK2_uc002xks.2_Missense_Mutation_p.A221V|SGK2_uc002xku.2_Missense_Mutation_p.A222V	NM_016276	NP_057360	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2 isoform	282	Protein kinase.				intracellular protein kinase cascade|response to oxidative stress		ATP binding|potassium channel regulator activity|protein serine/threonine kinase activity|sodium channel regulator activity			lung(3)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	6		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TGCTTGGGGGCAGTCCTCTAC	0.512													40	52	---	---	---	---	PASS
RNF114	55905	broad.mit.edu	37	20	48568613	48568613	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48568613G>T	uc002xux.2	+	6	658	c.622G>T	c.(622-624)GAT>TAT	p.D208Y	RNF114_uc010zyo.1_Intron|RNF114_uc002xuy.2_RNA	NM_018683	NP_061153	Q9Y508	RN114_HUMAN	zinc finger protein 313	208					cell differentiation|multicellular organismal development|spermatogenesis	intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)	2						TTGCCCTTAGGATTATGATGT	0.448													12	67	---	---	---	---	PASS
SYCP2	10388	broad.mit.edu	37	20	58444975	58444975	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58444975G>A	uc002yaz.2	-	35	3758	c.3619C>T	c.(3619-3621)CTT>TTT	p.L1207F		NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1207					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TCTTGTGTAAGTACCAGAGAA	0.313													4	50	---	---	---	---	PASS
OPRL1	4987	broad.mit.edu	37	20	62729830	62729830	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62729830T>C	uc002yic.2	+	5	1193	c.791T>C	c.(790-792)CTG>CCG	p.L264P	OPRL1_uc002yid.2_Missense_Mutation_p.L264P|OPRL1_uc002yif.3_Missense_Mutation_p.L259P	NM_182647	NP_872588	P41146	OPRX_HUMAN	opiate receptor-like 1	264	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception	integral to plasma membrane	protein binding|X-opioid receptor activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					ATCACTCGGCTGGTGCTGGTG	0.662													46	60	---	---	---	---	PASS
GABPA	2551	broad.mit.edu	37	21	27117565	27117565	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27117565C>G	uc002ylx.3	+	3	649	c.122C>G	c.(121-123)GCC>GGC	p.A41G	GABPA_uc002yly.3_Missense_Mutation_p.A41G	NM_002040	NP_002031	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha	41					positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)|central_nervous_system(1)	2						GTAAGCCAGGCCATAGACATC	0.383													18	79	---	---	---	---	PASS
ADAMTS5	11096	broad.mit.edu	37	21	28338220	28338220	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28338220G>T	uc002ymg.2	-	1	1220	c.491C>A	c.(490-492)ACC>AAC	p.T164N		NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1	164					proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						TGGCTTTAGGGTGTAGCGCGC	0.652													4	17	---	---	---	---	PASS
CBS	875	broad.mit.edu	37	21	44474028	44474028	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44474028G>T	uc002zcu.2	-	17	1863	c.1618C>A	c.(1618-1620)CTG>ATG	p.L540M	CBS_uc002zcs.1_Missense_Mutation_p.L435M|CBS_uc002zct.2_Missense_Mutation_p.L540M|CBS_uc002zcw.3_Missense_Mutation_p.L540M|CBS_uc002zcv.2_Missense_Mutation_p.L540M	NM_000071	NP_000062	P35520	CBS_HUMAN	cystathionine-beta-synthase	540					cysteine biosynthetic process from serine|cysteine biosynthetic process via cystathionine|homocysteine catabolic process|hydrogen sulfide biosynthetic process|L-cysteine catabolic process|L-serine catabolic process	cytosol|nucleolus	cystathionine beta-synthase activity|heme binding|protein homodimerization activity|pyridoxal phosphate binding|ubiquitin protein ligase binding				0					L-Cysteine(DB00151)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|S-Adenosylmethionine(DB00118)	ACGAAGTTCAGCAAGTCAATG	0.652													7	51	---	---	---	---	PASS
IGLL3	91353	broad.mit.edu	37	22	25714193	25714193	+	Missense_Mutation	SNP	C	A	A	rs112211231	byFrequency	TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25714193C>A	uc003abr.2	+	1	306	c.206C>A	c.(205-207)ACA>AAA	p.T69K		NM_001013618	NP_001013640			immunoglobulin lambda-like polypeptide 3												0						TCACAGCCTACACACTGCAGC	0.642													19	77	---	---	---	---	PASS
CRYBA4	1413	broad.mit.edu	37	22	27026323	27026323	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27026323C>T	uc003acz.3	+	6	498	c.463C>T	c.(463-465)CCG>TCG	p.P155S		NM_001886	NP_001877	P53673	CRBA4_HUMAN	crystallin, beta A4	155	Beta/gamma crystallin 'Greek key' 4.				camera-type eye development|visual perception	soluble fraction	structural constituent of eye lens				0						CTCCCAGTTTCCGGGCTACCG	0.527													3	37	---	---	---	---	PASS
C1QTNF6	114904	broad.mit.edu	37	22	37578404	37578404	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37578404C>A	uc003aqw.1	-	2	1109	c.604G>T	c.(604-606)GCG>TCG	p.A202S	C1QTNF6_uc003aqx.1_Missense_Mutation_p.A221S|C1QTNF6_uc003aqy.1_Missense_Mutation_p.A221S|C1QTNF6_uc003aqz.1_RNA	NM_182486	NP_872292	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	202	C1q.					collagen					0						CTGGGCTGCGCGTACAGGATG	0.582													14	37	---	---	---	---	PASS
FANCB	2187	broad.mit.edu	37	X	14883178	14883178	+	Missense_Mutation	SNP	A	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14883178A>C	uc004cwg.1	-	3	723	c.455T>G	c.(454-456)TTT>TGT	p.F152C	FANCB_uc004cwh.1_Missense_Mutation_p.F152C	NM_001018113	NP_001018123	Q8NB91	FANCB_HUMAN	Fanconi anemia complementation group B	152					DNA repair	nucleoplasm				lung(1)	1	Hepatocellular(33;0.183)					AGAAGAGATAAAGAAGAATGC	0.393								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				20	60	---	---	---	---	PASS
MAP7D2	256714	broad.mit.edu	37	X	20033400	20033400	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20033400G>A	uc004czr.1	-	11	1586	c.1567C>T	c.(1567-1569)CGT>TGT	p.R523C	MAP7D2_uc004czq.1_Missense_Mutation_p.R408C|MAP7D2_uc011mji.1_Missense_Mutation_p.R471C|MAP7D2_uc010nfo.1_Missense_Mutation_p.R564C|MAP7D2_uc011mjj.1_Missense_Mutation_p.R478C	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	523										ovary(2)|breast(1)	3						CTCTCGAGACGCATCTGTTCA	0.463													4	107	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54275554	54275554	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54275554G>A	uc004dtd.1	-	17	3666	c.3227C>T	c.(3226-3228)CCC>CTC	p.P1076L	WNK3_uc004dtc.1_Missense_Mutation_p.P1076L	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	1076					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						GGTCTGAGTGGGAATGACTGT	0.468													14	21	---	---	---	---	PASS
ERCC6L	54821	broad.mit.edu	37	X	71427657	71427657	+	Silent	SNP	G	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71427657G>T	uc004eaq.1	-	2	1057	c.960C>A	c.(958-960)ATC>ATA	p.I320I	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Silent_p.I197I	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	320					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)					AGGGTTTTATGATTGCCATTA	0.383													67	79	---	---	---	---	PASS
SLC25A43	203427	broad.mit.edu	37	X	118544310	118544310	+	Silent	SNP	G	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118544310G>A	uc004erd.2	+	3	1019	c.675G>A	c.(673-675)GTG>GTA	p.V225V	SLC25A43_uc004erc.1_RNA|SLC25A43_uc011mtt.1_Intron	NM_145305	NP_660348	Q8WUT9	S2543_HUMAN	mitochondrial solute carrier protein	225	Solcar 3.|Helical; Name=5; (Potential).				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding			skin(1)	1						TTGAGACCGTGAAGAGAAAGA	0.517													49	61	---	---	---	---	PASS
GPC4	2239	broad.mit.edu	37	X	132437087	132437087	+	Silent	SNP	A	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132437087A>G	uc004exc.1	-	9	1691	c.1479T>C	c.(1477-1479)AGT>AGC	p.S493S	GPC4_uc011mvg.1_Silent_p.S423S	NM_001448	NP_001439	O75487	GPC4_HUMAN	glypican 4 precursor	493					anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	Acute lymphoblastic leukemia(192;0.000127)					CTTCTCCACTACTTTCATCAC	0.403													88	75	---	---	---	---	PASS
SLITRK2	84631	broad.mit.edu	37	X	144905219	144905219	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144905219C>A	uc004fcd.2	+	5	2266	c.1276C>A	c.(1276-1278)CGC>AGC	p.R426S	SLITRK2_uc010nsp.2_Missense_Mutation_p.R426S|SLITRK2_uc010nso.2_Missense_Mutation_p.R426S|SLITRK2_uc011mwq.1_Missense_Mutation_p.R426S|SLITRK2_uc011mwr.1_Missense_Mutation_p.R426S|SLITRK2_uc011mws.1_Missense_Mutation_p.R426S|SLITRK2_uc004fcg.2_Missense_Mutation_p.R426S|SLITRK2_uc011mwt.1_Missense_Mutation_p.R426S	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	426	Extracellular (Potential).|LRR 9.					integral to membrane				ovary(5)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					GACCAGTTTACGCAGACTTTA	0.398													91	88	---	---	---	---	PASS
PNCK	139728	broad.mit.edu	37	X	152936856	152936856	+	Intron	SNP	C	T	T	rs149305071		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152936856C>T	uc011myu.1	-						PNCK_uc011myt.1_Intron|PNCK_uc004fia.2_Silent_p.A201A|PNCK_uc004fhz.3_Intron|PNCK_uc010nuh.2_3'UTR|PNCK_uc011myv.1_3'UTR|PNCK_uc011myw.1_3'UTR	NM_001039582	NP_001034671	Q6P2M8	KCC1B_HUMAN	pregnancy upregulated non-ubiquitously expressed							cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			breast(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGGCACACACGCAGCCATGC	0.642													23	19	---	---	---	---	PASS
RENBP	5973	broad.mit.edu	37	X	153209166	153209166	+	Silent	SNP	A	C	C			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153209166A>C	uc004fjo.1	-	5	464	c.294T>G	c.(292-294)GGT>GGG	p.G98G	RENBP_uc011mzh.1_Silent_p.G98G	NM_002910	NP_002901	P51606	RENBP_HUMAN	renin binding protein	98					mannose metabolic process|regulation of blood pressure		endopeptidase inhibitor activity|mannose-6-phosphate isomerase activity|N-acylglucosamine 2-epimerase activity			ovary(1)|pancreas(1)	2	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	GCAAGAACTCACCACCTGGAG	0.637													28	30	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803276	142803278	+	Intron	DEL	AAC	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803276_142803278delAAC	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_5'Flank					Homo sapiens PNAS-130 mRNA, complete cds.																		ACCAAACCAAaacaacaacaaca	0.241													4	2	---	---	---	---	
C1orf125	126859	broad.mit.edu	37	1	179502762	179502762	+	Intron	DEL	T	-	-	rs35358411		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179502762delT	uc001gmo.2	+						C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmp.2_Intron|C1orf125_uc009wxh.2_Intron	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1												0						AGACAATCCCTTTTTTTTTTT	0.333													3	3	---	---	---	---	
MST1	4485	broad.mit.edu	37	3	49724049	49724049	+	Intron	DEL	C	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49724049delC	uc003cxg.2	-						MST1_uc011bcs.1_Intron|MST1_uc010hkx.2_Intron|MST1_uc011bct.1_Intron|MST1_uc011bcu.1_Intron|RNF123_uc003cxh.2_5'Flank	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth						proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCTCTTACCTCCCCGGCCAAG	0.672													4	2	---	---	---	---	
RFT1	91869	broad.mit.edu	37	3	53156295	53156295	+	Intron	DEL	A	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53156295delA	uc003dgj.2	-						RFT1_uc003dgk.2_Intron	NM_052859	NP_443091	Q96AA3	RFT1_HUMAN	RFT1 homolog						carbohydrate transport|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane	lipid transporter activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)		GCAAGTCTGGAAAAATCATTC	0.294													8	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	159820698	159820698	+	Intron	DEL	A	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159820698delA	uc003fcw.1	-											Homo sapiens cDNA FLJ39842 fis, clone SPLEN2014293.																		TGGAacagtgaaaaaaaaaag	0.090													4	2	---	---	---	---	
IGJ	3512	broad.mit.edu	37	4	71521932	71521932	+	3'UTR	DEL	A	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71521932delA	uc003hfn.3	-	4					IGJ_uc010ihz.2_3'UTR	NM_144646	NP_653247	P01591	IGJ_HUMAN	immunoglobulin J chain						immune response	extracellular region	antigen binding				0			Lung(101;0.235)			TACATCACCCAAAAAAAAAAA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	154050504	154050506	+	IGR	DEL	CAC	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154050504_154050506delCAC								FHDC1 (149656 upstream) : TRIM2 (23764 downstream)																							ccatcagcatcaccaccaccatt	0.000													4	3	---	---	---	---	
GABRR1	2569	broad.mit.edu	37	6	89899765	89899765	+	Intron	DEL	A	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89899765delA	uc003pna.2	-						GABRR1_uc011dzv.1_Intron	NM_002042	NP_002033	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 1						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Picrotoxin(DB00466)	actccatctcaaaaaaaaaaa	0.204													9	4	---	---	---	---	
MTHFD1L	25902	broad.mit.edu	37	6	151421170	151421171	+	Intron	INS	-	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151421170_151421171insT	uc003qob.2	+						MTHFD1L_uc003qoc.2_Intron	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		tctttcttttcttttttttttt	0.129													4	2	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74163251	74163252	+	Intron	INS	-	A	A			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74163251_74163252insA	uc003uau.2	+						GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron|GTF2I_uc003uba.2_5'Flank	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						tctgtctcaacaaaaaaaaaaT	0.144													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	102137057	102137063	+	5'Flank	DEL	GCCCTGG	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102137057_102137063delGCCCTGG	uc003uzs.1	-						uc010lia.1_Frame_Shift_Del_p.P215fs|uc003uzt.1_Frame_Shift_Del_p.P287fs|uc003uzu.1_Frame_Shift_Del_p.P287fs|POLR2J3_uc011kku.1_Frame_Shift_Del_p.P215fs|uc003uzv.1_5'Flank|uc010lib.1_Frame_Shift_Del_p.P95fs					SubName: Full=cDNA FLJ58943, highly similar to Ras GTPase-activating protein 4;																		GGGATCAGCTGCCCTGGGCCCTGCAGG	0.643													4	2	---	---	---	---	
ANKRD46	157567	broad.mit.edu	37	8	101535127	101535136	+	Intron	DEL	ACACACATAT	-	-	rs142068367	by1000genomes	TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101535127_101535136delACACACATAT	uc003yjm.2	-						ANKRD46_uc003yjn.1_Intron|ANKRD46_uc003yjo.1_Intron|ANKRD46_uc003yjp.1_Intron	NM_198401	NP_940683	Q86W74	ANR46_HUMAN	ankyrin repeat domain 46							integral to membrane					0	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)			acacacacacacacacatatatatatatac	0.210													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	135255759	135255760	+	IGR	INS	-	AT	AT			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135255759_135255760insAT								ST3GAL1 (671576 upstream) : ZFAT (234273 downstream)																							ggaggaggaggagaaggaggag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143209117	143209118	+	IGR	DEL	AG	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143209117_143209118delAG								MIR1302-7 (341443 upstream) : NCRNA00051 (70599 downstream)																							ggagggacacagagagagagag	0.124													4	2	---	---	---	---	
BAI1	575	broad.mit.edu	37	8	143583790	143583798	+	Intron	DEL	GTGGTGGTA	-	-	rs62513277		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143583790_143583798delGTGGTGGTA	uc003ywm.2	+							NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1						axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					gatggtggtggtggtggtagtggtggtga	0.043													4	3	---	---	---	---	
WNK2	65268	broad.mit.edu	37	9	96055488	96055488	+	Intron	DEL	C	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96055488delC	uc004ati.1	+						WNK2_uc011lud.1_Intron|WNK2_uc004atj.2_Intron|WNK2_uc004atk.2_Intron|WNK2_uc004atl.1_Intron	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2						intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						GTTGCCCCCGCCCCTGGGCCA	0.627													4	2	---	---	---	---	
SEC61B	10952	broad.mit.edu	37	9	101990074	101990075	+	Intron	INS	-	T	T	rs111986989		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101990074_101990075insT	uc004azh.2	+							NM_006808	NP_006799	P60468	SC61B_HUMAN	Sec61 beta subunit						ER-associated protein catabolic process|protein import into nucleus, translocation|retrograde protein transport, ER to cytosol|transmembrane transport	endoplasmic reticulum Sec complex|integral to membrane	epidermal growth factor binding				0		Acute lymphoblastic leukemia(62;0.0559)				AGCAAAGAAAGTTTTTTTTTTT	0.302													4	2	---	---	---	---	
EGFL7	51162	broad.mit.edu	37	9	139565480	139565480	+	Intron	DEL	G	-	-	rs71988346		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139565480delG	uc004cid.2	+						EGFL7_uc004cif.2_Intron|EGFL7_uc004cig.2_Intron|EGFL7_uc010nbp.2_Intron|EGFL7_uc004cie.2_Intron|EGFL7_uc004cih.2_Intron	NM_201446	NP_958854	Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7						angiogenesis|vasculogenesis		calcium ion binding			ovary(1)	1	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		AGGCATTGGTGGGGGGGGGGG	0.667													2	8	---	---	---	---	
CUL2	8453	broad.mit.edu	37	10	35343197	35343198	+	Intron	INS	-	CT	CT	rs142208207	by1000genomes	TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35343197_35343198insCT	uc001ixv.2	-						CUL2_uc009xma.2_Intron|CUL2_uc010qer.1_Intron|CUL2_uc001ixw.2_Intron|CUL2_uc010qes.1_Intron	NM_003591	NP_003582	Q13617	CUL2_HUMAN	cullin 2						cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding			ovary(3)	3						CTTTTTCGTTCCTGAGGATTCT	0.297													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	81788176	81788176	+	IGR	DEL	A	-	-	rs35380147		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81788176delA								MBL1P (77393 upstream) : LOC219347 (17815 downstream)																							AGCTGTGCATATCTGGACTCC	0.443													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	131247715	131247722	+	IGR	DEL	GAAGGAGT	-	-	rs28593127	by1000genomes	TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131247715_131247722delGAAGGAGT								None (None upstream) : MGMT (17732 downstream)																							aggaaggaaggaaggagtgagtgagtga	0.000													5	3	---	---	---	---	
CAPRIN1	4076	broad.mit.edu	37	11	34101453	34101469	+	Intron	DEL	TTTTTTTTTTTTTTTTT	-	-	rs67127870		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34101453_34101469delTTTTTTTTTTTTTTTTT	uc001mvh.1	+						CAPRIN1_uc001mvg.2_Intron|CAPRIN1_uc001mvi.2_Intron|CAPRIN1_uc001mvj.1_Intron	NM_005898	NP_005889	Q14444	CAPR1_HUMAN	membrane component chromosome 11 surface marker						negative regulation of translation|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis	cytoplasmic mRNA processing body|cytosol|dendrite|integral to plasma membrane|stress granule	protein binding|RNA binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				CATGACAAAGttttttttttttttttttttttttttt	0.106													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	15464239	15464253	+	IGR	DEL	TTCTTTCTTTCTTTC	-	-	rs139890862		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15464239_15464253delTTCTTTCTTTCTTTC								RERG (89935 upstream) : PTPRO (11234 downstream)																							tcctttctttttctttctttctttcttctttcttt	0.000													3	3	---	---	---	---	
TUBA1C	84790	broad.mit.edu	37	12	49635391	49635394	+	Intron	DEL	CCCT	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49635391_49635394delCCCT	uc010smh.1	+						TUBA1C_uc001rts.2_Intron	NM_032704	NP_116093	Q9BQE3	TBA1C_HUMAN	tubulin alpha 6						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0						TATTttcctcccctccctccctcc	0.157													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	61565185	61565185	+	IGR	DEL	A	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61565185delA								None (None upstream) : FAM19A2 (536858 downstream)																							gggaggaaggaaggaagggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110072927	110072929	+	IGR	DEL	CAC	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110072927_110072929delCAC								MVK (37857 upstream) : C12orf34 (79261 downstream)																							tcaccaccatcaccaccaccacc	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19985459	19985461	+	IGR	DEL	TGG	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19985459_19985461delTGG								LOC100101938 (66346 upstream) : TPTE2 (11560 downstream)																							atgtttctgttggtgatggatgg	0.192													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112869661	112869661	+	IGR	DEL	G	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112869661delG								SOX1 (143641 upstream) : C13orf28 (161008 downstream)																							gggctggagtggggagggaga	0.040													4	2	---	---	---	---	
NOVA1	4857	broad.mit.edu	37	14	27066713	27066714	+	5'UTR	INS	-	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27066713_27066714insT	uc001wpy.2	-	1					NOVA1_uc001wpz.2_5'UTR|NOVA1_uc001wqa.2_5'UTR|NOVA1_uc001wqb.2_5'UTR	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1						locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		tttcttttttcttttttttttt	0.356													3	3	---	---	---	---	
MIPOL1	145282	broad.mit.edu	37	14	37754802	37754802	+	Intron	DEL	T	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37754802delT	uc001wuc.2	+						MIPOL1_uc010amr.2_Intron|MIPOL1_uc001wub.3_Intron|MIPOL1_uc001wud.2_Intron|MIPOL1_uc010ams.2_Intron|MIPOL1_uc001wue.2_Intron|MIPOL1_uc010amt.2_Intron	NM_138731	NP_620059	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1											ovary(1)|central_nervous_system(1)	2	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		ttttcttttcttttttttttt	0.144													4	2	---	---	---	---	
SCAMP2	10066	broad.mit.edu	37	15	75137220	75137221	+	3'UTR	INS	-	T	T	rs149710989	by1000genomes	TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75137220_75137221insT	uc002azb.1	-	9					ULK3_uc010ulp.1_5'Flank|ULK3_uc010ulq.1_5'Flank|ULK3_uc010ulr.1_5'Flank|ULK3_uc010bkf.1_5'Flank|ULK3_uc002ayv.2_5'Flank|ULK3_uc010uls.1_5'Flank|ULK3_uc010ult.1_5'Flank|ULK3_uc010ulu.1_5'Flank|SCAMP2_uc002aza.1_3'UTR|SCAMP2_uc010bkg.1_RNA	NM_005697	NP_005688	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2						post-Golgi vesicle-mediated transport|protein transport	integral to membrane|nucleus|recycling endosome membrane|trans-Golgi network membrane	protein binding			ovary(1)	1						AGAGAGCTTTGTTTTTTTTTGT	0.515													3	3	---	---	---	---	
MORF4L1	10933	broad.mit.edu	37	15	79170758	79170760	+	Intron	DEL	TTG	-	-	rs141156357		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79170758_79170760delTTG	uc002bel.2	+						MORF4L1_uc010bli.1_Intron|MORF4L1_uc010blj.1_Intron|MORF4L1_uc002bem.2_Intron|MORF4L1_uc010une.1_Intron	NM_206839	NP_996670	Q9UBU8	MO4L1_HUMAN	MORF-related gene 15 isoform 2						double-strand break repair via homologous recombination|histone deacetylation|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Sin3 complex	protein N-terminus binding				0						GAGATTCTTATTGTTTTGCTTAG	0.335													3	7	---	---	---	---	
WHAMM	123720	broad.mit.edu	37	15	83502439	83502439	+	3'UTR	DEL	T	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83502439delT	uc002bje.2	+	10						NM_001080435	NP_001073904	Q8TF30	WHAMM_HUMAN	WAS protein homolog associated with actin, golgi							cytoplasmic vesicle membrane|ER-Golgi intermediate compartment|Golgi apparatus	actin binding				0						TGCTGCAGCAttttttttttt	0.259													4	2	---	---	---	---	
WFDC1	58189	broad.mit.edu	37	16	84352054	84352054	+	Intron	DEL	C	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84352054delC	uc002fhw.2	+						WFDC1_uc002fhv.2_Intron	NM_021197	NP_067020	Q9HC57	WFDC1_HUMAN	WAP four-disulfide core domain 1 precursor						negative regulation of cell growth	extracellular space	serine-type endopeptidase inhibitor activity			breast(1)	1						GGCCGGCTGTCCCCCATGCAC	0.607													8	8	---	---	---	---	
USP6	9098	broad.mit.edu	37	17	5035457	5035457	+	Intron	DEL	G	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5035457delG	uc002gau.1	+						USP6_uc002gav.1_Intron|USP6_uc010ckz.1_Intron|USP6_uc002gaw.2_Intron|uc002gay.1_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6						protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						CCCCATGCCAGGGGCCCCAGT	0.637			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								4	2	---	---	---	---	
PIK3R5	23533	broad.mit.edu	37	17	8812613	8812614	+	Intron	INS	-	T	T			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8812613_8812614insT	uc002glt.2	-						PIK3R5_uc010vuz.1_Intron|PIK3R5_uc002glu.3_Intron|PIK3R5_uc010coa.1_Intron|PIK3R5_uc010cob.1_Intron	NM_014308	NP_055123	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5						platelet activation	cytosol|membrane|nucleus				breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						CTGGAACACTCttttttttttt	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	19295078	19295078	+	IGR	DEL	T	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19295078delT								MFAP4 (4575 upstream) : RNF112 (19445 downstream)																							agcactgcagttttggccgta	0.000													4	2	---	---	---	---	
NF1	4763	broad.mit.edu	37	17	29575850	29575850	+	Intron	DEL	T	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29575850delT	uc002hgg.2	+						NF1_uc002hgh.2_Intron|NF1_uc010csn.1_Intron|NF1_uc002hgi.1_Intron	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CAAAGTTGTCTTTTTTTTTTT	0.174			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			4	2	---	---	---	---	
STAT5B	6777	broad.mit.edu	37	17	40374016	40374026	+	Intron	DEL	TGTGTGTGTGC	-	-	rs72283102		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40374016_40374026delTGTGTGTGTGC	uc002hzh.2	-						STAT5B_uc002hzi.3_Intron	NM_012448	NP_036580	P51692	STA5B_HUMAN	signal transducer and activator of transcription						2-oxoglutarate metabolic process|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|fatty acid metabolic process|isoleucine metabolic process|JAK-STAT cascade involved in growth hormone signaling pathway|oxaloacetate metabolic process|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cytosol|nucleoplasm	calcium ion binding|glucocorticoid receptor binding|sequence-specific DNA binding transcription factor activity			ovary(3)|lung(2)|skin(1)	6		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	tgtggtgtggtgtgtgtgtgctgtgtgtggt	0.000													4	4	---	---	---	---	
SLC4A1	6521	broad.mit.edu	37	17	42329088	42329089	+	Intron	INS	-	T	T	rs67064853		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42329088_42329089insT	uc002igf.3	-							NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member						bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		cttttcttttcttttttttttt	0.248													9	4	---	---	---	---	
HOXB5	3215	broad.mit.edu	37	17	46671172	46671173	+	5'Flank	INS	-	G	G			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46671172_46671173insG	uc002inr.2	-							NM_002147	NP_002138	P09067	HXB5_HUMAN	homeobox B5							nucleus	sequence-specific DNA binding				0						CGGCCAAATATGGGGGGGGGGT	0.470											OREG0024519	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
HGS	9146	broad.mit.edu	37	17	79663194	79663198	+	Intron	DEL	TGCCC	-	-	rs145540708		TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79663194_79663198delTGCCC	uc002kbg.2	+							NM_004712	NP_004703	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine						cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of JAK-STAT cascade|regulation of protein catabolic process	cytosol|early endosome membrane|multivesicular body membrane	metal ion binding|protein domain specific binding			ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			GTGATGACCAtgccctgccctgccc	0.502													3	4	---	---	---	---	
LRFN3	79414	broad.mit.edu	37	19	36435937	36435937	+	3'UTR	DEL	T	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36435937delT	uc002oco.2	+	3						NM_024509	NP_078785	Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III						cell adhesion	axon|cell junction|dendrite|integral to membrane|postsynaptic membrane|presynaptic membrane					0	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CGCCCCCCCCTCTAAGGGTCC	0.607													4	4	---	---	---	---	
ZNF565	147929	broad.mit.edu	37	19	36702351	36702352	+	Intron	INS	-	CA	CA			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36702351_36702352insCA	uc002odn.2	-						ZNF565_uc010ees.2_Intron|ZNF565_uc002odo.2_Intron|ZNF565_uc002odp.1_Intron	NM_152477	NP_689690	Q8N9K5	ZN565_HUMAN	zinc finger protein 565						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			caactcTCTCTcacacacacac	0.010													4	2	---	---	---	---	
PLEKHG2	64857	broad.mit.edu	37	19	39913185	39913185	+	Intron	DEL	T	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39913185delT	uc010xuz.1	+						PLEKHG2_uc010xuy.1_Intron|PLEKHG2_uc002olj.2_Intron|PLEKHG2_uc010xva.1_Intron	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			acccggctaattttttttttt	0.000													4	3	---	---	---	---	
KLK6	5653	broad.mit.edu	37	19	51463071	51463073	+	Intron	DEL	GAA	-	-	rs151148487	by1000genomes	TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51463071_51463073delGAA	uc002pui.2	-						KLK6_uc010eoj.2_Intron|KLK6_uc002puh.2_Intron|KLK6_uc002puj.2_Intron|KLK6_uc010ycn.1_Intron|KLK6_uc002pul.2_Intron|KLK6_uc002pum.2_Intron	NM_001012964	NP_001012982	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6 isoform A						amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		ggaggaggaggaagaggaggagg	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10841721	10841722	+	IGR	INS	-	AATGT	AATGT			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10841721_10841722insAATGT								None (None upstream) : TPTE (65021 downstream)																							aaacggaatggaatggaatgga	0.000													4	2	---	---	---	---	
NCF4	4689	broad.mit.edu	37	22	37260746	37260746	+	Intron	DEL	T	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37260746delT	uc003apy.3	+						NCF4_uc003apz.3_Intron	NM_000631	NP_000622	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4 isoform 1						cell communication|immune response|oxidation-reduction process	cytosol|NADPH oxidase complex	phosphatidylinositol binding|protein dimerization activity			ovary(1)	1						CTTTTTCCAGTtttttttttc	0.448													4	2	---	---	---	---	
TTLL1	25809	broad.mit.edu	37	22	43435575	43435576	+	3'UTR	INS	-	A	A	rs143546633	by1000genomes	TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43435575_43435576insA	uc003bdi.2	-	11					TTLL1_uc010gzh.2_3'UTR|TTLL1_uc003bdj.2_3'UTR|TTLL1_uc003bdh.2_3'UTR	NM_012263	NP_036395	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1						protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		GGTTAAAAATTAAAAAAAAAAG	0.312													2	4	---	---	---	---	
ITGB1BP2	26548	broad.mit.edu	37	X	70521865	70521865	+	Intron	DEL	T	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70521865delT	uc004dzr.1	+						BCYRN1_uc011mpt.1_Intron|ITGB1BP2_uc004dzs.1_5'UTR	NM_012278	NP_036410	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein 2						muscle organ development|signal transduction		SH3 domain binding			ovary(1)	1	Renal(35;0.156)					CTTTGCTGGCTTTTTTTTTTT	0.433													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	110864394	110864394	+	IGR	DEL	C	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110864394delC								DCX (208988 upstream) : ALG13 (60019 downstream)																							ATTGACTCTTCTGTAACATCA	0.478													9	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	146036529	146036529	+	IGR	DEL	T	-	-			TCGA-21-1071-01	TCGA-21-1071-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146036529delT								CXorf51 (144605 upstream) : MIR513C (234693 downstream)																							TAAGTTTCAGTTTTAGGGGTT	0.169													15	8	---	---	---	---	
