Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRDM16	63976	broad.mit.edu	37	1	3347564	3347564	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3347564C>G	uc001akf.2	+	15	3493	c.3413C>G	c.(3412-3414)TCG>TGG	p.S1138W	PRDM16_uc001akc.2_Missense_Mutation_p.S1137W|PRDM16_uc001akd.2_Missense_Mutation_p.S1137W|PRDM16_uc001ake.2_Missense_Mutation_p.S1138W|PRDM16_uc009vlh.2_Missense_Mutation_p.S838W	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1	1138	Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GCCGGGAAGTCGCAGGATGAC	0.493			T	EVI1	MDS|AML								3	11	---	---	---	---	PASS
CCDC27	148870	broad.mit.edu	37	1	3683924	3683924	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3683924T>C	uc001akv.2	+	10	1739	c.1658T>C	c.(1657-1659)CTG>CCG	p.L553P		NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	553										skin(1)	1	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		TGGAAGCAGCTGCAGGAGGAT	0.597													10	67	---	---	---	---	PASS
CA6	765	broad.mit.edu	37	1	9022676	9022676	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9022676A>G	uc001apm.2	+	5	556	c.532A>G	c.(532-534)AGC>GGC	p.S178G	CA6_uc009vmn.2_Missense_Mutation_p.S118G	NM_001215	NP_001206	P23280	CAH6_HUMAN	carbonic anhydrase VI precursor	178					one-carbon metabolic process	extracellular region	carbonate dehydratase activity|zinc ion binding			ovary(2)	2	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)		CACTTATTACAGCAACTTCAT	0.498													24	148	---	---	---	---	PASS
EPHA8	2046	broad.mit.edu	37	1	22923930	22923930	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22923930G>C	uc001bfx.1	+	10	2016	c.1891G>C	c.(1891-1893)GAG>CAG	p.E631Q		NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	631	Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TCGGGAGATCGAGGCCTCTAG	0.652													4	175	---	---	---	---	PASS
CNKSR1	10256	broad.mit.edu	37	1	26513718	26513718	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26513718T>G	uc001bln.3	+	15	1447	c.1389T>G	c.(1387-1389)GAT>GAG	p.D463E	CNKSR1_uc001blm.3_Missense_Mutation_p.D456E|CNKSR1_uc009vsd.2_Missense_Mutation_p.D198E|CNKSR1_uc009vse.2_Missense_Mutation_p.D198E|CNKSR1_uc001blo.2_Missense_Mutation_p.D198E	NM_006314	NP_006305	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras	463	PH.				Rho protein signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cell cortex|cell-cell junction	protein binding, bridging			lung(1)|kidney(1)	2		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		GTGGACATGATCAGAAGAAGA	0.527													18	45	---	---	---	---	PASS
DHDDS	79947	broad.mit.edu	37	1	26759433	26759433	+	5'UTR	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26759433A>G	uc001bml.2	+	2					DHDDS_uc001bmk.2_5'UTR|DHDDS_uc001bmm.2_5'UTR|DHDDS_uc001bmn.2_5'UTR|DHDDS_uc010ofd.1_5'UTR	NM_205861	NP_995583	Q86SQ9	DHDDS_HUMAN	dehydrodolichyl diphosphate synthase isoform b								protein binding|transferase activity, transferring alkyl or aryl (other than methyl) groups			breast(3)	3		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)		ACTGGAAAAGAACTATGTCAT	0.463													9	84	---	---	---	---	PASS
SNHG3-RCC1	751867	broad.mit.edu	37	1	28833872	28833872	+	Intron	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28833872G>A	uc001bqa.1	+						SNHG3-RCC1_uc001bqb.1_Intron|SNHG3-RCC1_uc001bqc.1_Intron	NM_001048197	NP_001041662			regulator of chromosome condensation 1												0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|READ - Rectum adenocarcinoma(331;0.0649)		GCGTTACACTGATTGtccaac	0.184													39	255	---	---	---	---	PASS
BAI2	576	broad.mit.edu	37	1	32196407	32196407	+	Silent	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32196407G>T	uc001btn.2	-	29	4728	c.4374C>A	c.(4372-4374)TCC>TCA	p.S1458S	BAI2_uc001btm.2_Silent_p.S452S|BAI2_uc001btp.1_Silent_p.S452S|BAI2_uc010ogn.1_Silent_p.S428S|BAI2_uc010ogo.1_Silent_p.S1067S|BAI2_uc010ogp.1_Silent_p.S1391S|BAI2_uc010ogq.1_Silent_p.S1425S|BAI2_uc001bto.2_Silent_p.S1458S	NM_001703	NP_001694	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1458	Cytoplasmic (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(5)|breast(4)|ovary(2)|central_nervous_system(1)|skin(1)	13		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		TCACCTCCAGGGAGCCCATCT	0.682													28	108	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34208955	34208955	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34208955C>A	uc001bxn.1	-	14	2008	c.1979G>T	c.(1978-1980)AGT>ATT	p.S660I	CSMD2_uc001bxm.1_Missense_Mutation_p.S700I	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	660	Extracellular (Potential).|CUB 4.					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CACGTGGCCACTGCTTGTGAT	0.592													17	88	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39801075	39801075	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39801075C>G	uc010oiu.1	+	1	4266	c.4135C>G	c.(4135-4137)CAA>GAA	p.Q1379E	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	2944					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AAGAGAAAATCAAGGGGAAGT	0.378													7	135	---	---	---	---	PASS
TSPAN1	10103	broad.mit.edu	37	1	46650002	46650002	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46650002T>C	uc001cpd.2	+	4	661	c.197T>C	c.(196-198)GTG>GCG	p.V66A	TSPAN1_uc009vyd.1_Missense_Mutation_p.V66A	NM_005727	NP_005718	O60635	TSN1_HUMAN	tetraspan 1	66	Helical; (Potential).					integral to membrane|lysosomal membrane				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)	Medulloblastoma(700;0.00498)|all_neural(321;0.0212)				GCCGGCGTTGTGGTCTTTGCT	0.557													5	75	---	---	---	---	PASS
NFIA	4774	broad.mit.edu	37	1	61824824	61824824	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61824824C>G	uc001czw.2	+	6	1308	c.824C>G	c.(823-825)ACA>AGA	p.T275R	NFIA_uc001czy.2_Missense_Mutation_p.T267R|NFIA_uc010oos.1_Missense_Mutation_p.T320R|NFIA_uc001czv.2_Missense_Mutation_p.T275R	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN	nuclear factor I/A isoform 1	275					DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2						TTCAGCTCCACAAAGCGCCTC	0.502													6	394	---	---	---	---	PASS
PDE4B	5142	broad.mit.edu	37	1	66458712	66458712	+	Intron	SNP	A	C	C	rs116785815	by1000genomes	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66458712A>C	uc001dcn.2	+						PDE4B_uc009war.2_Intron|PDE4B_uc001dco.2_Intron|PDE4B_uc001dcp.2_Silent_p.T41T	NM_001037341	NP_001032418	Q07343	PDE4B_HUMAN	phosphodiesterase 4B isoform 1						signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)	ACAGACCTACATCTCCTAAAA	0.438													26	115	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75055466	75055466	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75055466T>A	uc001dgg.2	-	12	2244	c.2025A>T	c.(2023-2025)AAA>AAT	p.K675N	uc001dgh.2_Intron|C1orf173_uc001dgi.3_Missense_Mutation_p.K469N	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	675	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CTTGGGTTCCTTTCTCCGTTC	0.408													37	185	---	---	---	---	PASS
FAM73A	374986	broad.mit.edu	37	1	78272736	78272736	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78272736T>C	uc001dhx.2	+	5	619	c.587T>C	c.(586-588)ATT>ACT	p.I196T	FAM73A_uc010ork.1_Missense_Mutation_p.I196T|FAM73A_uc010orl.1_Missense_Mutation_p.I158T|FAM73A_uc001dhy.1_5'UTR	NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN	hypothetical protein LOC374986	196						integral to membrane				ovary(1)	1				Colorectal(170;0.226)		GAAGATGATATTAAACTTGTT	0.343													7	178	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79403966	79403966	+	Splice_Site	SNP	T	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79403966T>G	uc001diq.3	-	5	553	c.397_splice	c.e5-1	p.I133_splice		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain						neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GGATCTGATCTGAGAAAAAAT	0.313													9	41	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109815822	109815822	+	Silent	SNP	A	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109815822A>T	uc001dxa.3	+	32	8434	c.8373A>T	c.(8371-8373)CCA>CCT	p.P2791P		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	2791	Cytoplasmic (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCCCCTGGCCAGGAGACTTTG	0.647													31	95	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152277174	152277174	+	Silent	SNP	A	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152277174A>T	uc001ezu.1	-	3	10224	c.10188T>A	c.(10186-10188)TCT>TCA	p.S3396S		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3396	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGGCAGACTCAGACTGTTCAT	0.612									Ichthyosis				128	608	---	---	---	---	PASS
ETV3	2117	broad.mit.edu	37	1	157104020	157104020	+	Splice_Site	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157104020C>A	uc001fqr.2	-	4	574	c.285_splice	c.e4-1	p.R95_splice	ETV3_uc001fqt.2_Intron	NM_001145312	NP_001138784	P41162	ETV3_HUMAN	ets variant gene 3 isoform 1								sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(266;0.158)	Prostate(1639;0.174)				GTAATAGTATCTGTAAAAACA	0.368													22	78	---	---	---	---	PASS
CD1D	912	broad.mit.edu	37	1	158151509	158151509	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158151509C>G	uc001frr.2	+	3	825	c.326C>G	c.(325-327)TCC>TGC	p.S109C	CD1D_uc009wsr.1_Missense_Mutation_p.S109C|CD1D_uc009wss.2_Missense_Mutation_p.S109C|CD1D_uc009wst.1_Missense_Mutation_p.S5C	NM_001766	NP_001757	P15813	CD1D_HUMAN	CD1D antigen precursor	109	Extracellular (Potential).				antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding			ovary(1)	1	all_hematologic(112;0.0378)					CTACGCTTATCCTGTGAGCTG	0.532													16	122	---	---	---	---	PASS
PEA15	8682	broad.mit.edu	37	1	160182942	160182942	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160182942G>A	uc001fvk.2	+	3	405	c.215G>A	c.(214-216)CGT>CAT	p.R72H	PEA15_uc001fvl.2_Missense_Mutation_p.R93H|PEA15_uc001fvm.2_Missense_Mutation_p.R50H	NM_003768	NP_003759	Q15121	PEA15_HUMAN	phosphoprotein enriched in astrocytes 15	72	DED.				anti-apoptosis|apoptosis|carbohydrate transport|negative regulation of glucose import	cytoplasm|microtubule associated complex	protein binding				0	all_cancers(52;3.11e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ATCTCCCGCCGTCCTGACCTA	0.542													22	264	---	---	---	---	PASS
NCSTN	23385	broad.mit.edu	37	1	160319459	160319459	+	Silent	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160319459T>C	uc001fvx.2	+	4	559	c.435T>C	c.(433-435)TTT>TTC	p.F145F	NCSTN_uc009wtk.1_RNA|NCSTN_uc001fvy.2_Silent_p.F125F|NCSTN_uc010pjf.1_Silent_p.F145F|NCSTN_uc001fvz.2_5'Flank|NCSTN_uc010pjg.1_5'Flank	NM_015331	NP_056146	Q92542	NICA_HUMAN	nicastrin precursor	145	Extracellular (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane|melanosome	protein binding			ovary(1)|lung(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ATGATGGGTTTGGTAAGTGTC	0.507													47	95	---	---	---	---	PASS
FCRLB	127943	broad.mit.edu	37	1	161693147	161693147	+	Intron	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161693147C>A	uc001gbh.2	+						FCRLB_uc009wus.2_Intron|FCRLB_uc001gbj.2_Intron|FCRLB_uc001gbk.2_Intron|FCRLB_uc001gbl.2_Intron|FCRLB_uc001gbm.2_Intron|FCRLB_uc001gbi.2_Intron|FCRLB_uc001gbn.3_5'Flank	NM_001002901	NP_001002901	Q6BAA4	FCRLB_HUMAN	Fc receptor-like B							endoplasmic reticulum					0	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			CACCCCACTCCCCACCCCAGC	0.532													4	237	---	---	---	---	PASS
POU2F1	5451	broad.mit.edu	37	1	167343475	167343475	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167343475C>G	uc001gec.2	+	7	626	c.464C>G	c.(463-465)GCC>GGC	p.A155G	POU2F1_uc010plg.1_RNA|POU2F1_uc001ged.2_Missense_Mutation_p.A153G|POU2F1_uc001gee.2_Missense_Mutation_p.A155G|POU2F1_uc010plh.1_Intron|POU2F1_uc001gef.2_Missense_Mutation_p.A167G|POU2F1_uc001geg.2_Missense_Mutation_p.A53G	NM_002697	NP_002688	P14859	PO2F1_HUMAN	POU class 2 homeobox 1	155					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5						ACCATCTCCGCCTCTGCTGCC	0.622													17	38	---	---	---	---	PASS
SELP	6403	broad.mit.edu	37	1	169564103	169564103	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169564103G>T	uc001ggi.3	-	13	2179	c.2114C>A	c.(2113-2115)TCA>TAA	p.S705*	SELP_uc001ggh.2_Nonsense_Mutation_p.S540*|SELP_uc009wvr.2_Nonsense_Mutation_p.S705*	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	705	Extracellular (Potential).|Sushi 9.				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	ATGTAGTTCTGAGCATTTCAC	0.398													11	91	---	---	---	---	PASS
CFHR5	81494	broad.mit.edu	37	1	196973805	196973805	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196973805T>C	uc001gts.3	+	9	1473	c.1345T>C	c.(1345-1347)TGT>CGT	p.C449R		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor	449	Sushi 8.				complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						TACTGCATATTGTGGGCCCCC	0.368													7	238	---	---	---	---	PASS
CHIT1	1118	broad.mit.edu	37	1	203188958	203188958	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203188958C>T	uc001gzn.2	-	8	845	c.749G>A	c.(748-750)TGG>TAG	p.W250*	FMOD_uc010pqi.1_Intron|CHIT1_uc001gzm.1_RNA|CHIT1_uc009xal.1_Nonsense_Mutation_p.W41*|CHIT1_uc009xam.1_RNA|CHIT1_uc009xan.1_RNA|CHIT1_uc001gzo.2_Nonsense_Mutation_p.W241*	NM_003465	NP_003456	Q13231	CHIT1_HUMAN	chitotriosidase precursor	250					chitin catabolic process|immune response|response to bacterium	extracellular space|lysosome	cation binding|chitin binding|endochitinase activity				0						CTTCTGCAGCCACTGTTGCAC	0.582											OREG0006436	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=CHIT1|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	25	42	---	---	---	---	PASS
ZC3H11A	9877	broad.mit.edu	37	1	203819633	203819633	+	Intron	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203819633C>A	uc001hac.2	+						ZC3H11A_uc001had.2_Intron|ZC3H11A_uc001hae.2_Intron|ZC3H11A_uc001haf.2_Intron|ZC3H11A_uc010pqm.1_Intron	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A								nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ATATTTTCTGCCCTTTGTAGC	0.393													12	318	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220170329	220170329	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220170329G>A	uc001hly.1	-	18	2807	c.2537C>T	c.(2536-2538)CCT>CTT	p.P846L	EPRS_uc010puf.1_Missense_Mutation_p.P597L|EPRS_uc001hlz.1_Missense_Mutation_p.P853L	NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	846	WHEP-TRS 2.|3 X 57 AA approximate repeats.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	ACTGACCTTAGGGGATTTTTC	0.388													76	278	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220179484	220179484	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220179484G>C	uc001hly.1	-	15	2184	c.1914C>G	c.(1912-1914)GAC>GAG	p.D638E	EPRS_uc010puf.1_Missense_Mutation_p.D389E|EPRS_uc001hlz.1_Missense_Mutation_p.D645E|EPRS_uc009xdt.1_Intron	NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	638	Glutamyl-tRNA synthetase.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	TAAAGTCCTCGTCTTTTCCTA	0.363													53	191	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220198593	220198593	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220198593G>T	uc001hly.1	-	7	901	c.631C>A	c.(631-633)CAC>AAC	p.H211N	EPRS_uc010puf.1_5'UTR|EPRS_uc001hlz.1_Missense_Mutation_p.H211N|EPRS_uc009xdt.1_Missense_Mutation_p.H12N	NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	211	"Glutamyl-tRNA synthetase.|""HIGH"" region."	ATP (By similarity).			glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	TGCCCAATGTGTAAGTAACTA	0.323													16	73	---	---	---	---	PASS
ARF1	375	broad.mit.edu	37	1	228285654	228285654	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228285654C>T	uc001hrr.2	+	5	714	c.486C>T	c.(484-486)AGC>AGT	p.S162S	ARF1_uc001hrs.2_Silent_p.S162S|ARF1_uc001hrt.2_Missense_Mutation_p.R84W|ARF1_uc009xev.2_RNA|ARF1_uc001hru.2_Silent_p.S162S|ARF1_uc001hrv.2_Silent_p.S162S|ARF1_uc001hrw.2_Silent_p.S162S	NM_001024226	NP_001019397	P84077	ARF1_HUMAN	ADP-ribosylation factor 1	162					cellular copper ion homeostasis|COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|protein transport|regulation of defense response to virus by virus|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction|viral reproduction	cytosol|Golgi membrane|perinuclear region of cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding|receptor signaling protein activity				0		Prostate(94;0.0405)				GCGCCACCAGCGGCGACGGGC	0.612													4	100	---	---	---	---	PASS
KIAA1804	84451	broad.mit.edu	37	1	233482294	233482294	+	Silent	SNP	A	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233482294A>T	uc001hvt.3	+	2	1173	c.912A>T	c.(910-912)ACA>ACT	p.T304T	KIAA1804_uc001hvs.1_Silent_p.T304T	NM_032435	NP_115811	Q5TCX8	M3KL4_HUMAN	mixed lineage kinase 4	304	Protein kinase.				activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity			lung(5)|central_nervous_system(2)|skin(1)	8		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)				AAATGAGCACAGCAGGCACCT	0.463													53	100	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237777331	237777331	+	Intron	SNP	T	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237777331T>G	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTCTCCTCCCTTCTACAGATC	0.393													23	63	---	---	---	---	PASS
HNRNPU	3192	broad.mit.edu	37	1	245018908	245018908	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245018908G>A	uc001iaz.1	-	12	2388	c.2170C>T	c.(2170-2172)CCT>TCT	p.P724S	HNRNPU_uc001iaw.1_RNA|HNRNPU_uc001iax.1_RNA|HNRNPU_uc001iay.1_Missense_Mutation_p.P448S|HNRNPU_uc001iba.1_Missense_Mutation_p.P705S	NM_031844	NP_114032	Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U	724	RNA-binding RGG-box.|Gly-rich.				CRD-mediated mRNA stabilization	catalytic step 2 spliceosome|cell surface|CRD-mediated mRNA stability complex|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	ATP binding|DNA binding|protein binding|RNA binding				0	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			CGATTCCCAGGGGCTAAAAGA	0.463													23	124	---	---	---	---	PASS
SMYD3	64754	broad.mit.edu	37	1	246027182	246027182	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246027182C>T	uc001ibl.2	-	9	915	c.820G>A	c.(820-822)GAT>AAT	p.D274N	SMYD3_uc001ibk.2_Missense_Mutation_p.D215N|SMYD3_uc001ibi.2_Missense_Mutation_p.D85N|SMYD3_uc001ibj.2_Missense_Mutation_p.D85N	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	274						cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		GTTAGCATATCAGCATCCTGC	0.284													9	98	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1842948	1842948	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1842948A>G	uc002qxe.2	-	21	3880	c.3053T>C	c.(3052-3054)GTC>GCC	p.V1018A	MYT1L_uc002qxd.2_Missense_Mutation_p.V1016A|MYT1L_uc010ewk.2_Missense_Mutation_p.V14A	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1018	C2HC-type 6.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCTGCCGCTGACGTGGCCTGA	0.652													4	22	---	---	---	---	PASS
TMEM214	54867	broad.mit.edu	37	2	27260540	27260540	+	Silent	SNP	C	T	T	rs77468296	byFrequency	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27260540C>T	uc002ria.3	+	9	1232	c.1122C>T	c.(1120-1122)ACC>ACT	p.T374T	TMEM214_uc010yle.1_RNA|TMEM214_uc002rib.3_Silent_p.T329T	NM_017727	NP_060197	Q6NUQ4	TM214_HUMAN	transmembrane protein 214 isoform 1	374						integral to membrane	protein binding				0						CCAGAGCCACCCCTAGCTGTC	0.552													24	169	---	---	---	---	PASS
TTC27	55622	broad.mit.edu	37	2	32927940	32927940	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32927940G>C	uc002rom.2	+	10	1417	c.1186G>C	c.(1186-1188)GAG>CAG	p.E396Q	TTC27_uc010ymx.1_Missense_Mutation_p.E346Q	NM_017735	NP_060205	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	396							protein binding			central_nervous_system(1)	1						GACAAAACTTGAGAAAGGAAG	0.433													27	225	---	---	---	---	PASS
RASGRP3	25780	broad.mit.edu	37	2	33752259	33752259	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33752259G>T	uc002rox.2	+	11	1490	c.863G>T	c.(862-864)CGC>CTC	p.R288L	RASGRP3_uc010ync.1_Missense_Mutation_p.R288L|RASGRP3_uc002roy.2_Missense_Mutation_p.R288L	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and	288	Ras-GEF.				MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)					TGCAATTACCGCAAGGCCTTT	0.458													7	71	---	---	---	---	PASS
MAP4K3	8491	broad.mit.edu	37	2	39485574	39485574	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39485574T>C	uc002rro.2	-	31	2476	c.2385A>G	c.(2383-2385)ATA>ATG	p.I795M	MAP4K3_uc002rrp.2_Missense_Mutation_p.I774M|MAP4K3_uc010yns.1_Missense_Mutation_p.I348M	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase	795	CNH.				JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				TTACTATTTTTATACAACCTA	0.294													23	70	---	---	---	---	PASS
FSHR	2492	broad.mit.edu	37	2	49217732	49217732	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49217732T>A	uc002rww.2	-	5	493	c.419A>T	c.(418-420)AAG>ATG	p.K140M	FSHR_uc002rwx.2_Missense_Mutation_p.K140M|FSHR_uc010fbn.2_Missense_Mutation_p.K140M|FSHR_uc010fbo.1_RNA	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	140	Extracellular (Potential).|LRR 4.				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	AGAATGAATCTTGTGAACATC	0.383									Gonadal_Dysgenesis_46_XX				33	132	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50723176	50723176	+	Silent	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50723176T>C	uc010fbq.2	-	15	4534	c.3057A>G	c.(3055-3057)TCA>TCG	p.S1019S	NRXN1_uc002rxb.3_Silent_p.S651S|NRXN1_uc002rxe.3_Silent_p.S979S|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	168	Extracellular (Potential).|Laminin G-like.				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GAGGTTTATTTGAGCTTCCTT	0.398													3	33	---	---	---	---	PASS
C2orf78	388960	broad.mit.edu	37	2	74042951	74042951	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74042951G>T	uc002sjr.1	+	3	1722	c.1601G>T	c.(1600-1602)GGC>GTC	p.G534V		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	534										ovary(2)	2						GTGGTTGTTGGCAGTGCTACA	0.493													10	37	---	---	---	---	PASS
CCDC142	84865	broad.mit.edu	37	2	74708340	74708340	+	Intron	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74708340C>T	uc002slr.2	-						TTC31_uc002sls.2_5'Flank|TTC31_uc010yrv.1_5'Flank|TTC31_uc002slt.2_5'Flank|TTC31_uc002slu.2_5'Flank|CCDC142_uc002slo.2_Intron|CCDC142_uc002slq.2_Intron|CCDC142_uc002slp.2_Intron	NM_032779	NP_116168	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142											central_nervous_system(1)	1						GCCCCAGCCCCTCGTCTCACC	0.532													30	87	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90212098	90212098	+	RNA	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90212098C>G	uc010fhm.2	+	26		c.3522C>G								Parts of antibodies, mostly variable regions.																		TGGCCAGGCTCCCAGGCTCCT	0.592													37	129	---	---	---	---	PASS
UNC50	25972	broad.mit.edu	37	2	99234637	99234637	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99234637C>T	uc002szc.3	+	6	802	c.650C>T	c.(649-651)CCA>CTA	p.P217L	C2orf64_uc002sza.2_Intron|UNC50_uc002szb.2_Missense_Mutation_p.P217L|UNC50_uc010yvl.1_Missense_Mutation_p.P234L	NM_014044	NP_054763	Q53HI1	UNC50_HUMAN	unc-50 homolog	217	Cytoplasmic (Potential).				protein transport	Golgi membrane|integral to membrane|nuclear inner membrane	RNA binding				0						CCAGCATTGCCATTTTTGAAA	0.353													6	22	---	---	---	---	PASS
KCNJ3	3760	broad.mit.edu	37	2	155711809	155711809	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155711809C>A	uc002tyv.1	+	3	1685	c.1490C>A	c.(1489-1491)TCT>TAT	p.S497Y	KCNJ3_uc010zce.1_3'UTR	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3	497	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)	AAAATGAACTCTGATCGCTTC	0.418													3	23	---	---	---	---	PASS
DPP4	1803	broad.mit.edu	37	2	162902048	162902048	+	Nonsense_Mutation	SNP	G	T	T	rs141276765		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162902048G>T	uc002ubz.2	-	5	921	c.360C>A	c.(358-360)TAC>TAA	p.Y120*	DPP4_uc010fpb.2_5'UTR|DPP4_uc002uca.1_RNA|DPP4_uc002ucb.1_RNA	NM_001935	NP_001926	P27487	DPP4_HUMAN	dipeptidylpeptidase IV	120	Extracellular (Potential).				cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)	TTACCTTCACGTAGTTGTATT	0.299													48	116	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164591418	164591418	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164591418A>G	uc002uck.1	-	2	331	c.20T>C	c.(19-21)GTT>GCT	p.V7A		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	7						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						CATACCATAAACACTGGTGCT	0.378													30	82	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179399830	179399830	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179399830C>G	uc010zfg.1	-	307	94032	c.93808G>C	c.(93808-93810)GAA>CAA	p.E31270Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E24965Q|TTN_uc010zfi.1_Missense_Mutation_p.E24898Q|TTN_uc010zfj.1_Missense_Mutation_p.E24773Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32197							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGGATGTTTCAACACAACGA	0.383													31	219	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179408666	179408666	+	Silent	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179408666A>G	uc010zfg.1	-	295	88725	c.88501T>C	c.(88501-88503)TTG>CTG	p.L29501L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L23196L|TTN_uc010zfi.1_Silent_p.L23129L|TTN_uc010zfj.1_Silent_p.L23004L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30428							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTATTAGCAATGAGTAGCTC	0.448													63	176	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179417067	179417067	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179417067A>G	uc010zfg.1	-	284	83080	c.82856T>C	c.(82855-82857)ATT>ACT	p.I27619T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.I21314T|TTN_uc010zfi.1_Missense_Mutation_p.I21247T|TTN_uc010zfj.1_Missense_Mutation_p.I21122T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	28546							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTCAAAGTAATTTTGTTTTC	0.383													33	98	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179610450	179610450	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179610450G>C	uc002unb.2	-	46	16901	c.16677C>G	c.(16675-16677)TTC>TTG	p.F5559L	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTCAACAGTGAACCTTCTTC	0.418													46	174	---	---	---	---	PASS
DYTN	391475	broad.mit.edu	37	2	207527699	207527699	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207527699C>T	uc002vbr.1	-	11	1678	c.1561G>A	c.(1561-1563)GAG>AAG	p.E521K		NM_001093730	NP_001087199	A2CJ06	DYTN_HUMAN	dystrotelin	521	Potential.					plasma membrane	zinc ion binding			ovary(1)|central_nervous_system(1)	2				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		TCCTCCAGCTCATCCTTTCTC	0.463													74	277	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210545476	210545476	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210545476G>C	uc002vde.1	+	6	627	c.379G>C	c.(379-381)GCT>CCT	p.A127P	MAP2_uc002vdc.1_Missense_Mutation_p.A127P|MAP2_uc002vdd.1_Missense_Mutation_p.A127P|MAP2_uc002vdf.1_Missense_Mutation_p.A127P|MAP2_uc002vdg.1_Missense_Mutation_p.A127P|MAP2_uc002vdh.1_Missense_Mutation_p.A127P|MAP2_uc002vdi.1_Missense_Mutation_p.A127P	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	127					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	ATCTTTAGCAGCTGAAGAAAC	0.428													89	369	---	---	---	---	PASS
BARD1	580	broad.mit.edu	37	2	215645366	215645366	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215645366G>T	uc002veu.2	-	4	1367	c.1232C>A	c.(1231-1233)CCC>CAC	p.P411H	BARD1_uc010zjm.1_Missense_Mutation_p.P267H	NM_000465	NP_000456	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	411					cell cycle arrest|DNA repair|negative regulation of apoptosis|negative regulation of mRNA 3'-end processing|negative regulation of protein export from nucleus|positive regulation of apoptosis|positive regulation of protein catabolic process|protein K6-linked ubiquitination|regulation of phosphorylation|tissue homeostasis	BRCA1-A complex|BRCA1-BARD1 complex|cytoplasm	kinase binding|protein heterodimerization activity|protein homodimerization activity|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CATTGCTGAGGGACTAGACAT	0.408									Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				4	196	---	---	---	---	PASS
AGFG1	3267	broad.mit.edu	37	2	228401617	228401617	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228401617C>G	uc002vpc.2	+	10	1536	c.1286C>G	c.(1285-1287)GCT>GGT	p.A429G	AGFG1_uc002vpd.2_Missense_Mutation_p.A453G|AGFG1_uc002vpe.2_Missense_Mutation_p.A429G|AGFG1_uc002vpf.2_Missense_Mutation_p.A389G	NM_004504	NP_004495	P52594	AGFG1_HUMAN	HIV-1 Rev binding protein isoform 2	429				A -> R (in Ref. 2; CAA61667).	cell differentiation|mRNA export from nucleus|multicellular organismal development|regulation of ARF GTPase activity|spermatogenesis	cytoplasmic membrane-bounded vesicle|Golgi apparatus|nuclear pore	ARF GTPase activator activity|DNA binding|protein binding|RNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4						TTTTTTAAAGCTACGCCTTCC	0.328													10	91	---	---	---	---	PASS
GIGYF2	26058	broad.mit.edu	37	2	233671277	233671277	+	Silent	SNP	G	A	A	rs114498122	byFrequency	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233671277G>A	uc002vti.3	+	17	2053	c.1716G>A	c.(1714-1716)GCG>GCA	p.A572A	GIGYF2_uc010zmj.1_Silent_p.A572A|GIGYF2_uc002vtg.2_Silent_p.A566A|GIGYF2_uc002vtj.3_Silent_p.A593A|GIGYF2_uc002vtk.3_Silent_p.A572A|GIGYF2_uc002vth.3_Silent_p.A566A|GIGYF2_uc010zmk.1_RNA|GIGYF2_uc010zml.1_Silent_p.A403A	NM_015575	NP_056390	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2 isoform b	572	GYF.				cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		TGAAGAGAGCGTGTGATGAAA	0.453													121	224	---	---	---	---	PASS
ULK4	54986	broad.mit.edu	37	3	41657215	41657215	+	Intron	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41657215A>G	uc003ckv.3	-							NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		AAGTCTGTTAAAAACAAGAAA	0.338													8	25	---	---	---	---	PASS
NKTR	4820	broad.mit.edu	37	3	42684091	42684091	+	Intron	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42684091G>C	uc003clo.2	+						NKTR_uc003clp.2_Intron|NKTR_uc011azp.1_Intron|NKTR_uc003cls.2_Intron	NM_005385	NP_005376	P30414	NKTR_HUMAN	natural killer-tumor recognition sequence						protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)		AGTCACAGGTGAGCTTGTGAT	0.488													14	74	---	---	---	---	PASS
FBXW12	285231	broad.mit.edu	37	3	48416948	48416948	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48416948T>C	uc003csr.2	+	5	577	c.391T>C	c.(391-393)TGG>CGG	p.W131R	FBXW12_uc010hjv.2_Missense_Mutation_p.W112R|FBXW12_uc003css.2_Missense_Mutation_p.W131R|FBXW12_uc010hjw.2_Missense_Mutation_p.W52R	NM_207102	NP_996985	Q6X9E4	FBW12_HUMAN	F-box and WD repeat domain containing 12 isoform	131	WD 1.										0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCTTTGTGCCTGGGATGTGCA	0.423													34	127	---	---	---	---	PASS
QRICH1	54870	broad.mit.edu	37	3	49067898	49067898	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49067898C>G	uc010hkq.2	-	11	2614	c.2318G>C	c.(2317-2319)AGC>ACC	p.S773T	IMPDH2_uc003cvt.2_5'Flank|IMPDH2_uc010hkp.1_5'Flank|QRICH1_uc003cvu.2_Missense_Mutation_p.S773T|QRICH1_uc003cvv.2_Missense_Mutation_p.S773T	NM_198880	NP_942581	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	773										ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GTGCATAGTGCTTGCATTGGC	0.483													5	94	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51265417	51265417	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51265417G>T	uc011bds.1	+	17	1568	c.1545G>T	c.(1543-1545)AAG>AAT	p.K515N		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	515	DHR-1.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TTACAGCAAAGGACAAAGGGG	0.428													6	60	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52651314	52651314	+	Silent	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52651314G>A	uc003des.2	-	14	1794	c.1782C>T	c.(1780-1782)TTC>TTT	p.F594F	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Silent_p.F594F|PBRM1_uc003der.2_Silent_p.F562F|PBRM1_uc003det.2_Silent_p.F609F|PBRM1_uc003deu.2_Silent_p.F609F|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Silent_p.F594F|PBRM1_uc010hmk.1_Silent_p.F594F|PBRM1_uc003dey.2_Silent_p.F594F|PBRM1_uc003dez.1_Silent_p.F594F|PBRM1_uc003dfb.1_Silent_p.F507F|PBRM1_uc003dfc.2_5'Flank	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	594	Bromo 4.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TGGCATTCCGGAACATCAGCT	0.463			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								12	70	---	---	---	---	PASS
KLF15	28999	broad.mit.edu	37	3	126071007	126071007	+	Silent	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126071007G>A	uc011bkk.1	-	2	941	c.759C>T	c.(757-759)GTC>GTT	p.V253V		NM_014079	NP_054798	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	253						nucleus	DNA binding|zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(114;0.147)		CCTGGATGTTGACCAGGAGCT	0.622													3	16	---	---	---	---	PASS
KY	339855	broad.mit.edu	37	3	134322634	134322634	+	Silent	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134322634G>C	uc010hty.2	-	11	1835	c.1773C>G	c.(1771-1773)GCC>GCG	p.A591A	KY_uc011blw.1_3'UTR|KY_uc011blx.1_Silent_p.A570A	NM_178554	NP_848649	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	Error:Variant_position_missing_in_Q8NBH2_after_alignment						cytoskeleton|Z disc	peptidase activity			ovary(2)	2						CATTCCGGTTGGCAGGAAGCA	0.557													6	87	---	---	---	---	PASS
PRR23B	389151	broad.mit.edu	37	3	138739282	138739282	+	Silent	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138739282G>A	uc003esy.1	-	1	487	c.222C>T	c.(220-222)GAC>GAT	p.D74D		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	74										breast(1)	1						GGTCGACGTCGTCCAGGGGCA	0.697													11	41	---	---	---	---	PASS
TSC22D2	9819	broad.mit.edu	37	3	150128694	150128694	+	Silent	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150128694T>A	uc003exv.2	+	1	1907	c.1557T>A	c.(1555-1557)CCT>CCA	p.P519P	TSC22D2_uc003exw.2_RNA|TSC22D2_uc003exx.2_Silent_p.P519P	NM_014779	NP_055594	O75157	T22D2_HUMAN	TSC22 domain family, member 2	519							sequence-specific DNA binding transcription factor activity			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CAAGCGTGCCTAGTGTGTCTA	0.632													5	85	---	---	---	---	PASS
IL12A	3592	broad.mit.edu	37	3	159706967	159706967	+	Intron	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159706967T>C	uc003fcx.2	+						uc003fcw.1_RNA	NM_000882	NP_000873	P29459	IL12A_HUMAN	interleukin 12A precursor						cell cycle arrest|cell migration|defense response to Gram-positive bacterium|immune response|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of cell adhesion|positive regulation of interferon-gamma production|positive regulation of natural killer cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of NK T cell activation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of tyrosine phosphorylation of Stat4 protein|response to lipopolysaccharide|response to UV-B|response to virus	interleukin-12 complex	cytokine activity|growth factor activity|interleukin-12 receptor binding|interleukin-27 binding|protein heterodimerization activity				0			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GCGCAGTGAGTACTCAGCCCG	0.657											OREG0015908	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	18	---	---	---	---	PASS
ZBBX	79740	broad.mit.edu	37	3	166960356	166960356	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166960356T>A	uc003fep.2	-	20	2536	c.2213A>T	c.(2212-2214)CAG>CTG	p.Q738L	ZBBX_uc011bpc.1_Missense_Mutation_p.Q777L|ZBBX_uc003feq.2_Missense_Mutation_p.Q709L	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	738						intracellular	zinc ion binding			ovary(2)	2						TGTGGAAATCTGACTTATATT	0.368													32	76	---	---	---	---	PASS
MFN1	55669	broad.mit.edu	37	3	179096197	179096197	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179096197C>T	uc003fjs.2	+	13	1524	c.1398C>T	c.(1396-1398)AAC>AAT	p.N466N	MFN1_uc010hxb.2_RNA|MFN1_uc003fjt.2_Silent_p.N494N|MFN1_uc010hxc.2_Intron	NM_033540	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	466	Cytoplasmic (Potential).				mitochondrial fusion	integral to membrane|mitochondrial outer membrane	GTP binding|GTPase activity			ovary(2)|large_intestine(1)	3	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			ATGAAGTAAACGCCTTAGTGC	0.353													8	96	---	---	---	---	PASS
DNAJC19	131118	broad.mit.edu	37	3	180704720	180704720	+	Intron	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180704720G>C	uc003fkt.2	-						DNAJC19_uc003fku.2_Intron	NM_145261	NP_660304	Q96DA6	TIM14_HUMAN	DnaJ homolog, subfamily C, member 19						genitalia development|protein folding|protein targeting to mitochondrion|transmembrane transport|visual perception	integral to membrane|mitochondrial inner membrane	heat shock protein binding				0	all_cancers(143;3.12e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-36)|OV - Ovarian serous cystadenocarcinoma(80;1.55e-22)			AAATATTAGAGATTATTTTAC	0.393													5	193	---	---	---	---	PASS
ABCF3	55324	broad.mit.edu	37	3	183907499	183907499	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183907499A>G	uc003fmz.2	+	13	1401	c.1268A>G	c.(1267-1269)CAG>CGG	p.Q423R	ABCF3_uc003fna.2_Missense_Mutation_p.Q417R|ABCF3_uc003fnb.2_Missense_Mutation_p.Q104R	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	423	ABC transporter 1.						ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGCTCAACCAGCAGCGTGAA	0.607													12	29	---	---	---	---	PASS
EPHB3	2049	broad.mit.edu	37	3	184294844	184294844	+	Silent	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184294844G>T	uc003foz.2	+	5	1664	c.1227G>T	c.(1225-1227)CGG>CGT	p.R409R		NM_004443	NP_004434	P54753	EPHB3_HUMAN	ephrin receptor EphB3 precursor	409	Fibronectin type-III 1.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(5)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|ovary(1)	11	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			CGGAGCGCCGGGTCCACATCA	0.647													45	116	---	---	---	---	PASS
CCDC50	152137	broad.mit.edu	37	3	191093098	191093098	+	Intron	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191093098G>A	uc003fsw.2	+						CCDC50_uc003fsv.2_Silent_p.R232R	NM_174908	NP_777568	Q8IVM0	CCD50_HUMAN	Ymer protein short isoform							cytoplasm	protein binding				0	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		CTCAGGAGAGGCCTCGGAGAC	0.502													18	57	---	---	---	---	PASS
LRRC15	131578	broad.mit.edu	37	3	194080070	194080070	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194080070C>A	uc003ftu.2	-	2	1789	c.1703G>T	c.(1702-1704)AGC>ATC	p.S568I	LRRC15_uc003ftt.2_Missense_Mutation_p.S574I	NM_130830	NP_570843	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15 isoform b	568	Cytoplasmic (Potential).					integral to membrane				ovary(3)	3	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		GACAGCTTGGCTCCTCTTCTT	0.597													13	161	---	---	---	---	PASS
WHSC2	7469	broad.mit.edu	37	4	1985126	1985126	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1985126C>T	uc003gem.2	-	11	1780	c.1540G>A	c.(1540-1542)GAC>AAC	p.D514N	WHSC2_uc003gek.2_Missense_Mutation_p.D240N|WHSC2_uc003gel.2_Missense_Mutation_p.D428N|WHSC2_uc003gen.2_Missense_Mutation_p.D368N	NM_005663	NP_005654	Q9H3P2	NELFA_HUMAN	Wolf-Hirschhorn syndrome candidate 2 protein	503					multicellular organismal development|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm				skin(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.0155)			AACACTGTGTCCACCAGCATG	0.597													45	202	---	---	---	---	PASS
TBC1D14	57533	broad.mit.edu	37	4	6925734	6925734	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6925734C>A	uc011bwg.1	+	2	697	c.618C>A	c.(616-618)AGC>AGA	p.S206R	TBC1D14_uc003gjs.3_Missense_Mutation_p.S206R	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a	206						intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						TCACCTTGAGCTCTATCAAGG	0.488													10	61	---	---	---	---	PASS
ZNF518B	85460	broad.mit.edu	37	4	10445664	10445664	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10445664C>A	uc003gmn.2	-	3	2776	c.2289G>T	c.(2287-2289)AAG>AAT	p.K763N		NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	763					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4						CAACATGAGCCTTCCTGGCCA	0.453													54	107	---	---	---	---	PASS
PROM1	8842	broad.mit.edu	37	4	16010597	16010597	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16010597T>C	uc003goo.2	-	11	1488	c.1276A>G	c.(1276-1278)ACA>GCA	p.T426A	PROM1_uc003gor.2_Missense_Mutation_p.T426A|PROM1_uc003gos.2_Missense_Mutation_p.T417A|PROM1_uc003got.2_Missense_Mutation_p.T426A|PROM1_uc003gou.2_Missense_Mutation_p.T417A|PROM1_uc003gop.2_Missense_Mutation_p.T417A|PROM1_uc003goq.3_Missense_Mutation_p.T417A|PROM1_uc010iec.1_Missense_Mutation_p.T304A	NM_006017	NP_006008	O43490	PROM1_HUMAN	prominin 1 isoform 1	426	Extracellular (Potential).				camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						TCTTCCAATGTAGGTAAATTT	0.378													8	30	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46043016	46043016	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46043016G>T	uc003gxb.2	-	9	1539	c.1387C>A	c.(1387-1389)CTT>ATT	p.L463I		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	463	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		TATAAGTAAAGATAGCCAACC	0.318													9	81	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55972980	55972980	+	Intron	SNP	A	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55972980A>T	uc003has.2	-						KDR_uc003hat.1_Intron|KDR_uc011bzx.1_Intron	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor						angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	CAGCTTGGCTATAAGAAAGAG	0.333			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			11	87	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56878146	56878146	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56878146C>G	uc003hbi.2	+	21	3031	c.2797C>G	c.(2797-2799)CAA>GAA	p.Q933E	CEP135_uc003hbj.2_Missense_Mutation_p.Q639E	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	933	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					AAAAGAAATTCAAGAGGTAAT	0.289													7	53	---	---	---	---	PASS
HTN1	3346	broad.mit.edu	37	4	70918792	70918792	+	5'UTR	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70918792C>A	uc003hex.2	+	2						NM_002159	NP_002150	P15515	HIS1_HUMAN	histatin 1 precursor						biomineral tissue development|defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular region	protein binding			skin(1)	1						ACTCAGCCAACTATGAAGTTT	0.318													4	67	---	---	---	---	PASS
PPEF2	5470	broad.mit.edu	37	4	76793323	76793323	+	Intron	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76793323A>G	uc003hix.2	-						PPEF2_uc003hiy.2_Intron|PPEF2_uc003hiz.1_Intron	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with						detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GTTAATACCTACATCAAAACA	0.473													8	54	---	---	---	---	PASS
CNOT6L	246175	broad.mit.edu	37	4	78650191	78650191	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78650191C>T	uc011ccd.1	-	10	1200	c.1069G>A	c.(1069-1071)GCA>ACA	p.A357T	CNOT6L_uc003hks.2_Missense_Mutation_p.A357T|CNOT6L_uc003hkt.1_Missense_Mutation_p.A200T	NM_144571	NP_653172	Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	357					nuclear-transcribed mRNA poly(A) tail shortening	cytosol	exonuclease activity|protein binding	p.V357I(1)		large_intestine(1)	1						TGGGCATTTGCCACTATAAGC	0.388													4	230	---	---	---	---	PASS
HERC6	55008	broad.mit.edu	37	4	89361102	89361102	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89361102G>C	uc011cdi.1	+	21	2815	c.2632G>C	c.(2632-2634)GGA>CGA	p.G878R	HERC6_uc011cdj.1_Missense_Mutation_p.G842R|HERC6_uc011cdk.1_RNA|HERC6_uc011cdl.1_RNA	NM_017912	NP_060382	Q8IVU3	HERC6_HUMAN	hect domain and RLD 6 isoform 1	878	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity			lung(3)|ovary(1)|kidney(1)	5		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		ATTTCAGAGAGGATTTTATAG	0.333													20	29	---	---	---	---	PASS
NHEDC1	150159	broad.mit.edu	37	4	103822366	103822366	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103822366G>T	uc003hww.2	-	12	1578	c.1456C>A	c.(1456-1458)CTA>ATA	p.L486I	NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Missense_Mutation_p.L259I	NM_139173	NP_631912	Q4ZJI4	NHDC1_HUMAN	Na+/H+ exchanger domain containing 1 isoform 1	486	Helical; (Potential).					integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)		CCCATAAGTAGAGCTCCATTT	0.413													17	522	---	---	---	---	PASS
GAR1	54433	broad.mit.edu	37	4	110745172	110745172	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110745172G>T	uc003hzt.2	+	6	930	c.623G>T	c.(622-624)AGA>ATA	p.R208I	GAR1_uc003hzu.2_Missense_Mutation_p.R208I|GAR1_uc010imi.2_Missense_Mutation_p.R190I	NM_018983	NP_061856	Q9NY12	GAR1_HUMAN	nucleolar protein family A, member 1	208	RGG-box 2.				rRNA processing|snRNA pseudouridine synthesis	box H/ACA snoRNP complex|Cajal body	cation channel activity|pseudouridine synthase activity|snoRNA binding				0						AGAGGAGGAAGAGGTGGTGGT	0.318													75	120	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153244194	153244194	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153244194C>A	uc003ims.2	-	12	2112	c.1963G>T	c.(1963-1965)GAA>TAA	p.E655*	FBXW7_uc011cii.1_Nonsense_Mutation_p.E655*|FBXW7_uc003imt.2_Nonsense_Mutation_p.E655*|FBXW7_uc011cih.1_Nonsense_Mutation_p.E479*|FBXW7_uc003imq.2_Nonsense_Mutation_p.E575*|FBXW7_uc003imr.2_Nonsense_Mutation_p.E537*	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	655	WD 7.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CGAATAAATTCACCCGTTTTC	0.468			Mis|N|D|F		colorectal|endometrial|T-ALL								86	152	---	---	---	---	PASS
TRIM60	166655	broad.mit.edu	37	4	165961611	165961611	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165961611C>T	uc003iqy.1	+	3	557	c.387C>T	c.(385-387)TAC>TAT	p.Y129Y	TRIM60_uc010iqx.1_Silent_p.Y129Y	NM_152620	NP_689833	Q495X7	TRI60_HUMAN	ring finger protein 129	129	B box-type.					intracellular	zinc ion binding			skin(1)	1	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		AGAAGCACTACATTTGCCCTA	0.388													4	107	---	---	---	---	PASS
CLCN3	1182	broad.mit.edu	37	4	170628195	170628195	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170628195G>T	uc003isi.2	+	11	2436	c.1927G>T	c.(1927-1929)GAT>TAT	p.D643Y	CLCN3_uc003ish.2_Missense_Mutation_p.D643Y|CLCN3_uc011cjz.1_Missense_Mutation_p.D626Y|CLCN3_uc011cka.1_Missense_Mutation_p.D616Y|CLCN3_uc003isj.1_Missense_Mutation_p.D616Y	NM_001829	NP_001820	P51790	CLCN3_HUMAN	chloride channel 3 isoform b	643	Cytoplasmic (By similarity).				endosomal lumen acidification	cell surface|early endosome membrane|Golgi membrane|integral to membrane|late endosome membrane|transport vesicle membrane	antiporter activity|ATP binding|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|voltage-gated chloride channel activity			breast(2)|ovary(1)	3		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		CCCTTTCTTGGATGCAAAAGA	0.468													19	143	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187541367	187541367	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187541367C>A	uc003izf.2	-	10	6561	c.6373G>T	c.(6373-6375)GAA>TAA	p.E2125*		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2125	Extracellular (Potential).|Cadherin 19.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TGAAAGTGTTCATGATGTTCC	0.423										HNSCC(5;0.00058)			87	171	---	---	---	---	PASS
SLC6A19	340024	broad.mit.edu	37	5	1213604	1213604	+	Silent	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1213604C>G	uc003jbw.3	+	5	746	c.690C>G	c.(688-690)CCC>CCG	p.P230P		NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19	230	Helical; Name=5; (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CCACGCTGCCCTATGTCGTCC	0.572													8	109	---	---	---	---	PASS
PAPD7	11044	broad.mit.edu	37	5	6743891	6743891	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6743891G>A	uc003jdx.1	+	6	562	c.433G>A	c.(433-435)GAA>AAA	p.E145K	PAPD7_uc011cmn.1_Missense_Mutation_p.E136K|PAPD7_uc010itl.1_5'Flank	NM_006999	NP_008930	Q5XG87	PAPD7_HUMAN	DNA polymerase sigma	145					cell division|DNA replication|double-strand break repair|mitotic chromosome condensation|response to drug|sister chromatid cohesion	nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|SMC protein binding			ovary(1)	1						GGACCTGAATGAAGTTTTTAC	0.348													24	397	---	---	---	---	PASS
MYO10	4651	broad.mit.edu	37	5	16694657	16694657	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16694657C>A	uc003jft.3	-	27	4091	c.3623G>T	c.(3622-3624)CGC>CTC	p.R1208L	MYO10_uc011cnc.1_Missense_Mutation_p.R87L|MYO10_uc011cnd.1_Missense_Mutation_p.R565L|MYO10_uc011cne.1_Missense_Mutation_p.R565L|MYO10_uc010itx.2_Missense_Mutation_p.R831L	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X	1208					axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						CTGCTTGGAGCGGAACCACAA	0.572													187	149	---	---	---	---	PASS
MYO10	4651	broad.mit.edu	37	5	16694658	16694658	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16694658G>A	uc003jft.3	-	27	4090	c.3622C>T	c.(3622-3624)CGC>TGC	p.R1208C	MYO10_uc011cnc.1_Missense_Mutation_p.R87C|MYO10_uc011cnd.1_Missense_Mutation_p.R565C|MYO10_uc011cne.1_Missense_Mutation_p.R565C|MYO10_uc010itx.2_Missense_Mutation_p.R831C	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X	1208					axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						TGCTTGGAGCGGAACCACAAG	0.567													187	150	---	---	---	---	PASS
BASP1	10409	broad.mit.edu	37	5	17275787	17275787	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17275787C>T	uc003jfx.2	+	2	641	c.462C>T	c.(460-462)CCC>CCT	p.P154P		NM_006317	NP_006308	P80723	BASP1_HUMAN	brain abundant, membrane attached signal protein	154					glomerular visceral epithelial cell differentiation|negative regulation of transcription, DNA-dependent	cytoplasm|cytoskeleton|growth cone|nuclear speck|plasma membrane	protein domain specific binding|transcription corepressor activity|transcription regulatory region DNA binding				0						CTGAGGCGCCCGCAGCTCCTG	0.502													9	11	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24593368	24593368	+	Splice_Site	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24593368C>A	uc003jgr.1	-	2	563	c.231_splice	c.e2+1	p.K77_splice	CDH10_uc011cnu.1_Splice_Site	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		CACAAGCTTACCTTGCCTACG	0.318										HNSCC(23;0.051)			151	136	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24593369	24593369	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24593369C>A	uc003jgr.1	-	2	563	c.231G>T	c.(229-231)AAG>AAT	p.K77N	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	77	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		ACAAGCTTACCTTGCCTACGT	0.323										HNSCC(23;0.051)			153	137	---	---	---	---	PASS
C5orf22	55322	broad.mit.edu	37	5	31534400	31534400	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31534400G>T	uc003jhj.3	+	2	230	c.103G>T	c.(103-105)GCC>TCC	p.A35S	RNASEN_uc003jhh.2_5'Flank|RNASEN_uc003jhg.2_5'Flank|RNASEN_uc003jhi.2_5'Flank|C5orf22_uc011cnw.1_RNA|C5orf22_uc003jhk.3_5'UTR	NM_018356	NP_060826	Q49AR2	CE022_HUMAN	hypothetical protein LOC55322	35										ovary(2)	2						TATATACCGGGCCATAGGCTC	0.423													20	285	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33527346	33527346	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33527346G>T	uc003jia.1	-	24	4895	c.4732C>A	c.(4732-4734)CAC>AAC	p.H1578N	ADAMTS12_uc010iuq.1_Missense_Mutation_p.H1493N	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1578				H -> R (in Ref. 4; AAI31734).	proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CTTTGGGTGTGTGTGATGTGT	0.532										HNSCC(64;0.19)			56	537	---	---	---	---	PASS
NNT	23530	broad.mit.edu	37	5	43644885	43644885	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43644885G>C	uc003joe.2	+	9	1526	c.1271G>C	c.(1270-1272)AGA>ACA	p.R424T	NNT_uc003jof.2_Missense_Mutation_p.R424T	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	424	Mitochondrial matrix.				tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	CATGTCATTAGAGGAACTGTA	0.333													127	99	---	---	---	---	PASS
PHAX	51808	broad.mit.edu	37	5	125960256	125960256	+	Intron	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125960256C>G	uc003kua.1	+							NM_032177	NP_115553	Q9H814	PHAX_HUMAN	RNA U, small nuclear RNA export adaptor						ncRNA metabolic process|protein transport|snRNA export from nucleus|spliceosomal snRNP assembly	Cajal body|cytosol	RNA binding				0						AACTTTGTTCCTTTATTACAG	0.308													13	34	---	---	---	---	PASS
PCDHGB2	56103	broad.mit.edu	37	5	140739886	140739886	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140739886C>T	uc003ljs.1	+	1	184	c.184C>T	c.(184-186)CCA>TCA	p.P62S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc011dar.1_Missense_Mutation_p.P62S	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	62	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGGGACTTGCCAGCCCGGAA	0.537													5	125	---	---	---	---	PASS
PCDHGA10	56106	broad.mit.edu	37	5	140794992	140794992	+	Silent	SNP	T	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140794992T>G	uc003lkl.1	+	1	2250	c.2250T>G	c.(2248-2250)GTT>GTG	p.V750V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc011day.1_Silent_p.V750V|PCDHGB7_uc003lkm.2_5'Flank|PCDHGB7_uc003lkn.1_5'Flank	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1	750	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGACGGGGTTCGGGCTTTCC	0.632													41	102	---	---	---	---	PASS
PCDHGA10	56106	broad.mit.edu	37	5	140794994	140794994	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140794994G>A	uc003lkl.1	+	1	2252	c.2252G>A	c.(2251-2253)CGG>CAG	p.R751Q	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc011day.1_Missense_Mutation_p.R751Q|PCDHGB7_uc003lkm.2_5'Flank|PCDHGB7_uc003lkn.1_5'Flank	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1	751	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGGGGTTCGGGCTTTCCTG	0.627													43	103	---	---	---	---	PASS
TIGD6	81789	broad.mit.edu	37	5	149374569	149374569	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149374569G>T	uc003lri.2	-	2	2105	c.1343C>A	c.(1342-1344)GCA>GAA	p.A448E	TIGD6_uc003lrj.2_Missense_Mutation_p.A448E	NM_030953	NP_112215	Q17RP2	TIGD6_HUMAN	hypothetical protein LOC81789	448					regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TTCACTTCCTGCTTCACTGGT	0.438													53	140	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150947352	150947352	+	Missense_Mutation	SNP	C	A	A	rs149703698		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150947352C>A	uc003lue.3	-	1	1154	c.1141G>T	c.(1141-1143)GTG>TTG	p.V381L	GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Missense_Mutation_p.V381L	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	381	Extracellular (Potential).|Cadherin 3.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCATCACCACGCGGCTGCCA	0.498													4	136	---	---	---	---	PASS
CYFIP2	26999	broad.mit.edu	37	5	156788526	156788526	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156788526G>C	uc003lwq.2	+	28	3097	c.2959G>C	c.(2959-2961)GAG>CAG	p.E987Q	CYFIP2_uc011ddn.1_Missense_Mutation_p.E961Q|CYFIP2_uc011ddo.1_Missense_Mutation_p.E791Q|CYFIP2_uc003lwr.2_Missense_Mutation_p.E987Q|CYFIP2_uc003lws.2_Missense_Mutation_p.E987Q|CYFIP2_uc003lwt.2_Missense_Mutation_p.E890Q|CYFIP2_uc011ddp.1_Missense_Mutation_p.E721Q	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2	1012					apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGAGTACGCAGAGCTCAAAAC	0.547													7	68	---	---	---	---	PASS
ADRA1B	147	broad.mit.edu	37	5	159344738	159344738	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159344738A>G	uc003lxt.1	+	1	999	c.826A>G	c.(826-828)AGG>GGG	p.R276G		NM_000679	NP_000670	P35368	ADA1B_HUMAN	alpha-1B-adrenergic receptor	276	Cytoplasmic (By similarity).				cell proliferation|cell-cell signaling|G-protein signaling, coupled to cAMP nucleotide second messenger|intracellular protein kinase cascade	integral to plasma membrane	alpha1-adrenergic receptor activity			lung(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alfuzosin(DB00346)|Bethanidine(DB00217)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Guanfacine(DB01018)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Midodrine(DB00211)|Modafinil(DB00745)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Olanzapine(DB00334)|Phendimetrazine(DB01579)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)|Trazodone(DB00656)	CCACAACCCCAGGAGTTCCAT	0.502													61	135	---	---	---	---	PASS
MIR585	693170	broad.mit.edu	37	5	168690660	168690660	+	RNA	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168690660G>A	hsa-mir-585|MI0003592	-			c.39G>A			SLIT3_uc003mab.2_Intron|SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron																	0						TTCTCTGGGCGTATCTGTGTG	0.388													20	48	---	---	---	---	PASS
TSPAN17	26262	broad.mit.edu	37	5	176084646	176084646	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176084646G>T	uc003met.2	+	9	1175	c.946G>T	c.(946-948)GTT>TTT	p.V316F	TSPAN17_uc003mes.3_3'UTR|TSPAN17_uc003meu.2_Missense_Mutation_p.V313F|TSPAN17_uc003mev.2_3'UTR|TSPAN17_uc003mew.2_3'UTR	NM_012171	NP_036303	Q96FV3	TSN17_HUMAN	transmembrane 4 superfamily member 17 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						integral to membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			cagccgacatgttttctttgg	0.169													13	46	---	---	---	---	PASS
GFPT2	9945	broad.mit.edu	37	5	179740888	179740888	+	Silent	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179740888G>A	uc003mlw.1	-	14	1448	c.1350C>T	c.(1348-1350)ACC>ACT	p.T450T		NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	450	SIS 1.				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	AGCTGCCCACGGTGTTGGTGA	0.701													3	23	---	---	---	---	PASS
PHACTR1	221692	broad.mit.edu	37	6	12749917	12749917	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12749917G>T	uc010jpc.2	+	4	477	c.145G>T	c.(145-147)GCA>TCA	p.A49S	PHACTR1_uc011dir.1_Missense_Mutation_p.A49S|PHACTR1_uc003nag.1_Missense_Mutation_p.A49S|PHACTR1_uc003nah.1_Missense_Mutation_p.A49S|PHACTR1_uc003nai.2_Missense_Mutation_p.A49S	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	49						cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			ATTAATGGCGGCATCCTCGGA	0.458													12	17	---	---	---	---	PASS
MYLIP	29116	broad.mit.edu	37	6	16144053	16144053	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16144053C>T	uc003nbq.2	+	5	1023	c.786C>T	c.(784-786)AGC>AGT	p.S262S	MYLIP_uc003nbr.2_Silent_p.S81S	NM_013262	NP_037394	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting	262	FERM.			SG -> TR (in Ref. 3; AAF87323).	cellular component movement|nervous system development	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|ubiquitin-protein ligase activity|zinc ion binding			pancreas(1)	1	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			GGGCGGCCAGCGGGCTCTACC	0.522													8	310	---	---	---	---	PASS
USP49	25862	broad.mit.edu	37	6	41773584	41773584	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41773584C>A	uc003ori.2	-	4	1360	c.1138G>T	c.(1138-1140)GCC>TCC	p.A380S		NM_018561	NP_061031	Q70CQ1	UBP49_HUMAN	ubiquitin thioesterase 49	380					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGGAGCATGGCGAAGGGCGAC	0.597													14	108	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43410728	43410728	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43410728C>T	uc003ouy.1	+	10	2462	c.2247C>T	c.(2245-2247)CTC>CTT	p.L749L	ABCC10_uc003ouz.1_Silent_p.L721L|ABCC10_uc010jyo.1_5'UTR	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	749	ABC transporter 1.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			TCTATCTCCTCGATGACCCTC	0.582													10	130	---	---	---	---	PASS
PGK2	5232	broad.mit.edu	37	6	49754769	49754769	+	Silent	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49754769G>A	uc003ozu.2	-	1	239	c.132C>T	c.(130-132)ATC>ATT	p.I44I		NM_138733	NP_620061	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	44					glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			ovary(1)	1	Lung NSC(77;0.0402)					TGATGCTTGGGATGGAAGCCT	0.463													62	165	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56483201	56483201	+	Intron	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56483201G>A	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Silent_p.T1877T	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTGGTTTGAAGGTACAGTCTT	0.448													77	116	---	---	---	---	PASS
EEF1A1	1915	broad.mit.edu	37	6	74229735	74229735	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74229735C>G	uc003phi.2	-	1	52	c.15G>C	c.(13-15)AAG>AAC	p.K5N	EEF1A1_uc003phd.2_5'Flank|EEF1A1_uc003phe.2_Missense_Mutation_p.K5N|EEF1A1_uc003phf.2_Missense_Mutation_p.K5N|EEF1A1_uc003phg.2_Missense_Mutation_p.K5N|EEF1A1_uc003phh.2_5'UTR|EEF1A1_uc003phj.2_Missense_Mutation_p.K5N|EEF1A1_uc003phk.2_Missense_Mutation_p.K5N|EEF1A1_uc003phl.2_Missense_Mutation_p.K5N|EEF1A1_uc003phm.1_RNA	NM_001402	NP_001393	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha	5						cytosol|eukaryotic translation elongation factor 1 complex	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0						TGATATGAGTCTTTTCCTTTC	0.433													52	139	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76550324	76550324	+	Silent	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76550324T>C	uc003pih.1	+	8	855	c.576T>C	c.(574-576)TTT>TTC	p.F192F	MYO6_uc003pig.1_Silent_p.F192F|MYO6_uc003pii.1_Silent_p.F192F	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	192	Myosin head-like.				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		TAGAAGCCTTTGGAAATGCGA	0.343													39	150	---	---	---	---	PASS
IBTK	25998	broad.mit.edu	37	6	82901496	82901496	+	Intron	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82901496C>G	uc003pjl.1	-						IBTK_uc011dyu.1_Intron|IBTK_uc011dyv.1_Intron|IBTK_uc011dyw.1_Intron|IBTK_uc010kbi.1_Intron|IBTK_uc003pjm.2_Missense_Mutation_p.E1147Q	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase						negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		GTAATGTTTTCAACCCACCCT	0.363													22	89	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90377791	90377791	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90377791C>G	uc003pnn.1	-	84	14152	c.14036G>C	c.(14035-14037)GGA>GCA	p.G4679A		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	4679					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TTCTCCAATTCCACCTCCCTC	0.433													28	300	---	---	---	---	PASS
SFRS18	25957	broad.mit.edu	37	6	99852551	99852551	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99852551C>G	uc003ppo.3	-	9	1258	c.1030G>C	c.(1030-1032)GAA>CAA	p.E344Q	SFRS18_uc003ppp.3_Missense_Mutation_p.E344Q|SFRS18_uc011eag.1_Missense_Mutation_p.E344Q	NM_032870	NP_116259	Q8TF01	PNISR_HUMAN	splicing factor, arginine/serine-rich 130	344						nuclear speck					0		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0631)		AGCAGAATTTCTGTTAGAAGC	0.318													18	107	---	---	---	---	PASS
SIM1	6492	broad.mit.edu	37	6	100895250	100895250	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100895250G>C	uc003pqj.3	-	8	1099	c.892C>G	c.(892-894)CTG>GTG	p.L298V	SIM1_uc010kcu.2_Missense_Mutation_p.L298V	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	298	PAC.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		TGTTTCGCCAGGAACCTGTAG	0.592													7	64	---	---	---	---	PASS
CDK19	23097	broad.mit.edu	37	6	111067360	111067360	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111067360C>G	uc003puh.1	-	2	246	c.173G>C	c.(172-174)GGA>GCA	p.G58A	CDK19_uc003pui.1_5'UTR	NM_015076	NP_055891	Q9BWU1	CDK19_HUMAN	cell division cycle 2-like 6 (CDK8-like)	58	Protein kinase.						ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4						CATGGATATTCCTGTGCCTTC	0.279													5	192	---	---	---	---	PASS
C6orf58	352999	broad.mit.edu	37	6	127898557	127898557	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127898557C>A	uc003qbh.2	+	1	239	c.227C>A	c.(226-228)GCA>GAA	p.A76E		NM_001010905	NP_001010905	Q6P5S2	CF058_HUMAN	hypothetical protein LOC352999 precursor	76						extracellular region					0				GBM - Glioblastoma multiforme(226;0.0405)|all cancers(137;0.156)		AGGTATTTTGCAAAATTTGCA	0.388													22	326	---	---	---	---	PASS
ENPP1	5167	broad.mit.edu	37	6	132181518	132181518	+	Intron	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132181518C>G	uc011ecf.1	+						ENPP1_uc003qcy.2_5'Flank	NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	TCTGTTTTATCTTTTTTAGGG	0.284													7	95	---	---	---	---	PASS
TMEM181	57583	broad.mit.edu	37	6	159046773	159046773	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159046773G>T	uc003qrm.3	+	13	1518	c.1507G>T	c.(1507-1509)GTA>TTA	p.V503L	TMEM181_uc010kjr.1_Missense_Mutation_p.V334L	NM_020823	NP_065874	Q9P2C4	TM181_HUMAN	G protein-coupled receptor 178	503	Helical; (Potential).				pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		GACTTTCGTAGTACTTGTCAT	0.338													11	58	---	---	---	---	PASS
T	6862	broad.mit.edu	37	6	166574401	166574401	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166574401A>C	uc003quu.1	-	8	1451	c.958T>G	c.(958-960)TGG>GGG	p.W320G	T_uc003qut.1_Missense_Mutation_p.W321G|T_uc003quv.1_Missense_Mutation_p.W262G	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T	320					anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		AGGCTGGACCAATTGTCATGG	0.517									Chordoma_Familial_Clustering_of				7	163	---	---	---	---	PASS
WIPI2	26100	broad.mit.edu	37	7	5269374	5269374	+	Intron	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5269374G>A	uc003snv.2	+						WIPI2_uc003snw.2_Intron|WIPI2_uc003snx.2_Intron|WIPI2_uc003sny.2_Intron|WIPI2_uc010ksv.2_Intron|WIPI2_uc003soa.2_Intron|WIPI2_uc003sob.2_Intron	NM_015610	NP_056425	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2						autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding			ovary(2)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		GACTTGGTAAGGGGCGTGACG	0.587													7	67	---	---	---	---	PASS
TNRC18	84629	broad.mit.edu	37	7	5352353	5352353	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5352353C>T	uc003soi.3	-	27	8518	c.8169G>A	c.(8167-8169)GCG>GCA	p.A2723A		NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2723							DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGGGCTGGGGCGCGGGCGTCT	0.746													9	25	---	---	---	---	PASS
NXPH1	30010	broad.mit.edu	37	7	8790697	8790697	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8790697C>A	uc003srv.2	+	3	1025	c.114C>A	c.(112-114)AGC>AGA	p.S38R	NXPH1_uc011jxh.1_5'UTR	NM_152745	NP_689958	P58417	NXPH1_HUMAN	neurexophilin 1 precursor	38	II.					extracellular region				ovary(1)|central_nervous_system(1)	2		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		CAGGAAGCAGCAAATCCACAC	0.418													46	164	---	---	---	---	PASS
TWISTNB	221830	broad.mit.edu	37	7	19738155	19738155	+	Silent	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19738155C>G	uc003sup.1	-	4	822	c.801G>C	c.(799-801)GCG>GCC	p.A267A		NM_001002926	NP_001002926	Q3B726	RPA43_HUMAN	TWIST neighbor	267	Lys-rich.					microtubule cytoskeleton|nucleolus	DNA-directed RNA polymerase activity			ovary(1)	1						AGATGCCATTCGCATTATTAG	0.478													171	757	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20725340	20725340	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20725340C>A	uc003suw.3	+	7	1102	c.556C>A	c.(556-558)CAG>AAG	p.Q186K	ABCB5_uc010kuh.2_Missense_Mutation_p.Q631K	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	186	Extracellular (Potential).				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						AGCTGATGAACAGATGGAGTC	0.348													3	72	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21604007	21604007	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21604007A>C	uc003svc.2	+	6	1217	c.1186A>C	c.(1186-1188)ATT>CTT	p.I396L		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	396	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TAATCTCTTCATTAACCAGGT	0.353									Kartagener_syndrome				25	60	---	---	---	---	PASS
AVL9	23080	broad.mit.edu	37	7	32584372	32584372	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32584372A>G	uc003tcv.1	+	3	427	c.281A>G	c.(280-282)TAT>TGT	p.Y94C	AVL9_uc011kai.1_Missense_Mutation_p.Y94C|AVL9_uc010kwj.1_5'UTR	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	94						integral to membrane					0						ATCTCTTGCTATCGACAAATT	0.353													31	49	---	---	---	---	PASS
SUN3	256979	broad.mit.edu	37	7	48056848	48056848	+	Intron	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48056848C>T	uc003tof.2	-						SUN3_uc003tog.2_Intron|SUN3_uc011kcf.1_Intron	NM_152782	NP_689995	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 1							integral to membrane				central_nervous_system(1)	1						AATTACTTAACAAAATATCAC	0.279													18	44	---	---	---	---	PASS
BAZ1B	9031	broad.mit.edu	37	7	72891486	72891486	+	Silent	SNP	T	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72891486T>G	uc003tyc.2	-	7	2650	c.2305A>C	c.(2305-2307)AGA>CGA	p.R769R		NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	769	Potential.				ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				ATCTGCTGTCTGGTCTCCATG	0.368													16	174	---	---	---	---	PASS
DMTF1	9988	broad.mit.edu	37	7	86794247	86794247	+	Intron	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86794247C>A	uc003uih.2	+						DMTF1_uc003uii.2_Intron|DMTF1_uc003uij.2_Intron|DMTF1_uc011khb.1_Intron|DMTF1_uc003uik.2_Intron|DMTF1_uc003uil.2_Intron|DMTF1_uc003uim.1_Intron|DMTF1_uc003uin.2_Intron	NM_001142327	NP_001135799	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1						cell cycle	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(14;0.0058)					TGTTCTTGTACAGATTTGAGT	0.378													29	82	---	---	---	---	PASS
ACN9	57001	broad.mit.edu	37	7	96747030	96747030	+	5'UTR	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96747030G>A	uc003uoo.3	+	1						NM_020186	NP_064571	Q9NRP4	ACN9_HUMAN	ACN9 homolog precursor						regulation of gluconeogenesis	mitochondrial intermembrane space					0	all_cancers(62;2.54e-08)|all_epithelial(64;2.24e-08)|Esophageal squamous(72;0.00507)|all_lung(186;0.154)|Lung NSC(181;0.159)					GTCGGCGTGGGGCGCTATGCC	0.657													54	103	---	---	---	---	PASS
TFEC	22797	broad.mit.edu	37	7	115594631	115594631	+	Intron	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115594631T>C	uc003vhj.1	-						TFEC_uc003vhk.1_Intron|TFEC_uc003vhl.3_Intron|TFEC_uc011kmw.1_Intron	NM_012252	NP_036384	O14948	TFEC_HUMAN	transcription factor EC isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)			TGGAAAAATATATACTCACTG	0.318													40	104	---	---	---	---	PASS
PTPRZ1	5803	broad.mit.edu	37	7	121653467	121653467	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121653467T>A	uc003vjy.2	+	12	4762	c.4367T>A	c.(4366-4368)ATG>AAG	p.M1456K	PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	1456	Extracellular (Potential).				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						GAAAAGGTAATGAATGATTCA	0.323													54	95	---	---	---	---	PASS
AASS	10157	broad.mit.edu	37	7	121718032	121718032	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121718032C>T	uc003vka.2	-	22	2618	c.2522G>A	c.(2521-2523)AGC>AAC	p.S841N	AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Missense_Mutation_p.S841N|AASS_uc011knw.1_Missense_Mutation_p.S329N	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor	841	Saccharopine dehydrogenase.				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	GATTCCAAAGCTGTCTCTCAT	0.358													216	579	---	---	---	---	PASS
SPAM1	6677	broad.mit.edu	37	7	123599691	123599691	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123599691C>T	uc003vld.2	+	6	1600	c.1198C>T	c.(1198-1200)CTC>TTC	p.L400F	SPAM1_uc003vle.2_Missense_Mutation_p.L400F|SPAM1_uc011koa.1_Missense_Mutation_p.L56F|SPAM1_uc003vlf.3_Missense_Mutation_p.L400F|SPAM1_uc010lku.2_Missense_Mutation_p.L400F	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	400					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	CTATCTTCACCTCAACCCAGA	0.408													48	124	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126544719	126544719	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126544719T>A	uc003vlr.2	-	3	1057	c.746A>T	c.(745-747)CAG>CTG	p.Q249L	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.Q249L|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_5'UTR	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	249	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	TTTCTGTGACTGAGCAATGCA	0.378										HNSCC(24;0.065)			47	169	---	---	---	---	PASS
CHRM2	1129	broad.mit.edu	37	7	136700371	136700371	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136700371T>A	uc003vtf.1	+	4	1382	c.759T>A	c.(757-759)GAT>GAA	p.D253E	CHRM2_uc003vtg.1_Missense_Mutation_p.D253E|CHRM2_uc003vtj.1_Missense_Mutation_p.D253E|CHRM2_uc003vtk.1_Missense_Mutation_p.D253E|CHRM2_uc003vtl.1_Missense_Mutation_p.D253E|CHRM2_uc003vtm.1_Missense_Mutation_p.D253E|CHRM2_uc003vti.1_Missense_Mutation_p.D253E|CHRM2_uc003vto.1_Missense_Mutation_p.D253E|CHRM2_uc003vtn.1_Missense_Mutation_p.D253E|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	253	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)	GCAGTGACGATGGCCTGGAGC	0.507													21	62	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	2824228	2824228	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2824228C>T	uc011kwk.1	-	58	9357	c.8967G>A	c.(8965-8967)ATG>ATA	p.M2989I	CSMD1_uc011kwj.1_Missense_Mutation_p.M2318I|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2989	Extracellular (Potential).|Sushi 23.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TACTGACAATCATTCCGTTGG	0.532													5	25	---	---	---	---	PASS
CYP7A1	1581	broad.mit.edu	37	8	59409687	59409687	+	Silent	SNP	A	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59409687A>T	uc003xtm.3	-	3	447	c.384T>A	c.(382-384)ACT>ACA	p.T128T		NM_000780	NP_000771	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A,	128					bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TTTTGATGAAAGTGTCGTTTA	0.433									Neonatal_Giant_Cell_Hepatitis				45	159	---	---	---	---	PASS
YTHDF3	253943	broad.mit.edu	37	8	64100053	64100053	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64100053A>G	uc003xuy.2	+	5	1800	c.1484A>G	c.(1483-1485)GAT>GGT	p.D495G	YTHDF3_uc010lys.2_Missense_Mutation_p.D439G|YTHDF3_uc003xuz.2_Missense_Mutation_p.D439G|YTHDF3_uc003xva.2_Missense_Mutation_p.D439G|YTHDF3_uc011len.1_Missense_Mutation_p.D439G	NM_152758	NP_689971	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	495	YTH.										0	Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			TGGTCTCAGGATAAGTGGAAG	0.393													3	89	---	---	---	---	PASS
NCOA2	10499	broad.mit.edu	37	8	71044152	71044152	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71044152G>A	uc003xyn.1	-	16	3406	c.3244C>T	c.(3244-3246)CAG>TAG	p.Q1082*	NCOA2_uc011lfb.1_Nonsense_Mutation_p.Q170*	NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	1082	LLXXLXXXL motif.			LLDQL->AADQA: Reduces transcriptional coactivation and disrupts interaction with CREBBP/CBP.|DQ->AA: Has little effect on transcriptional coactivation.	cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			AGATACAGCTGGTCCAGGAGA	0.532			T	RUNXBP2	AML								11	17	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77768505	77768505	+	Silent	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77768505C>A	uc003yav.2	+	10	9600	c.9213C>A	c.(9211-9213)TCC>TCA	p.S3071S	ZFHX4_uc003yau.1_Silent_p.S3116S|ZFHX4_uc003yaw.1_Silent_p.S3071S	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3071	Pro-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ACGGTCCATCCTCCTTGCCGG	0.502										HNSCC(33;0.089)			9	87	---	---	---	---	PASS
ANKRD46	157567	broad.mit.edu	37	8	101534833	101534833	+	Splice_Site	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101534833C>T	uc003yjm.2	-	5	840	c.636_splice	c.e5+1	p.Y212_splice	ANKRD46_uc003yjn.1_Missense_Mutation_p.V213M|ANKRD46_uc003yjo.1_Missense_Mutation_p.V213M|ANKRD46_uc003yjp.1_Missense_Mutation_p.V213M	NM_198401	NP_940683	Q86W74	ANR46_HUMAN	ankyrin repeat domain 46							integral to membrane					0	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)			ACCCCACTCACATAATAAGCA	0.488													14	96	---	---	---	---	PASS
PABPC1	26986	broad.mit.edu	37	8	101730122	101730122	+	Intron	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101730122G>A	uc003yjs.1	-						PABPC1_uc011lhc.1_Intron|PABPC1_uc011lhd.1_Intron|PABPC1_uc003yjt.1_Intron|PABPC1_uc003yju.2_Intron	NM_002568	NP_002559	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1						mRNA polyadenylation|mRNA stabilization|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|translation	catalytic step 2 spliceosome|cytosol	nucleotide binding|poly(A) RNA binding|protein C-terminus binding|translation activator activity				0	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			ACCACCTAGGGAAAAACATAT	0.353													14	103	---	---	---	---	PASS
GRHL2	79977	broad.mit.edu	37	8	102649120	102649120	+	Intron	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102649120C>T	uc010mbu.2	+							NM_024915	NP_079191	Q6ISB3	GRHL2_HUMAN	transcription factor CP2-like 3							cytoplasm|nucleus	DNA binding			ovary(2)|skin(1)	3	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			TGTTTTGTTCCACAGGTGTAT	0.393													61	244	---	---	---	---	PASS
FER1L6	654463	broad.mit.edu	37	8	125035716	125035716	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125035716G>T	uc003yqw.2	+	18	2372	c.2166G>T	c.(2164-2166)TGG>TGT	p.W722C	uc003yqx.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	722	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TTTTCATCTGGATGCTCAGCA	0.532													80	193	---	---	---	---	PASS
FER1L6	654463	broad.mit.edu	37	8	125058096	125058096	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125058096A>C	uc003yqw.2	+	21	2884	c.2678A>C	c.(2677-2679)GAG>GCG	p.E893A		NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	893	Cytoplasmic (Potential).|C2 3.					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GAGCTGGCAGAGTCCCCGCCC	0.562													113	318	---	---	---	---	PASS
KCNK9	51305	broad.mit.edu	37	8	140630900	140630900	+	Silent	SNP	G	A	A	rs113907649		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140630900G>A	uc003yvf.1	-	2	790	c.726C>T	c.(724-726)GTC>GTT	p.V242V	KCNK9_uc003yvg.1_Silent_p.V242V|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	242	Cytoplasmic (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			ACCTGAGGACGACCAGGTTGA	0.572													21	72	---	---	---	---	PASS
SCRIB	23513	broad.mit.edu	37	8	144893462	144893462	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144893462G>T	uc003yzp.1	-	10	967	c.960C>A	c.(958-960)GAC>GAA	p.D320E	SCRIB_uc003yzo.1_Missense_Mutation_p.D320E	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b	320	LRR 13.|Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GGTGGTTCCGGTCCACGTTGA	0.667													6	40	---	---	---	---	PASS
WASH5P	375690	broad.mit.edu	37	9	17150	17150	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17150A>T	uc010mgm.1	-	7	841	c.698T>A	c.(697-699)TTC>TAC	p.F233Y	WASH5P_uc003zfr.2_RNA|WASH5P_uc011llq.1_RNA|WASH5P_uc003zfu.1_Missense_Mutation_p.F246Y	NM_182905	NP_878908			WAS protein family homolog 1												0						TGGCACATAGAAGTAGTTCTC	0.582													4	70	---	---	---	---	PASS
MPDZ	8777	broad.mit.edu	37	9	13110012	13110012	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13110012C>A	uc010mhy.2	-	43	5845	c.5794G>T	c.(5794-5796)GCA>TCA	p.A1932S	MPDZ_uc003zkx.3_Missense_Mutation_p.A156S|MPDZ_uc003zky.3_Missense_Mutation_p.A495S|MPDZ_uc010mib.2_Missense_Mutation_p.A666S|MPDZ_uc010mhx.2_Missense_Mutation_p.A783S|MPDZ_uc011lmm.1_Missense_Mutation_p.A820S|MPDZ_uc003zkz.3_Missense_Mutation_p.A654S|MPDZ_uc010mhz.2_Missense_Mutation_p.A1928S|MPDZ_uc011lmn.1_Missense_Mutation_p.A1899S|MPDZ_uc003zlb.3_Missense_Mutation_p.A1932S	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1961					interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)		CTGGAACTTGCAGGCTCCTGC	0.458													12	22	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21974792	21974792	+	Nonsense_Mutation	SNP	G	T	T	rs141798398		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21974792G>T	uc003zpk.2	-	1	247	c.35C>A	c.(34-36)TCG>TAG	p.S12*	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_Nonsense_Mutation_p.S12*|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Intron	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	12	ANK 1.				cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.?(23)|p.S12*(3)|p.S12fs*6(1)|p.S12fs*14(1)|p.S7_A19del(1)|p.M9_A20>X(1)|p.P11_S12insAAGSSMEP(1)|p.S12fs*20(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCAGTCAGCCGAAGGCTCCAT	0.761		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			3	7	---	---	---	---	PASS
TOPORS	10210	broad.mit.edu	37	9	32541551	32541551	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32541551G>A	uc003zrb.2	-	3	3139	c.2972C>T	c.(2971-2973)TCA>TTA	p.S991L	TOPORS_uc003zrc.2_Missense_Mutation_p.S924L	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich	991					DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TTGTTCAACTGAAGCTGCCAG	0.413													10	281	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32631934	32631934	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32631934C>T	uc003zrg.1	-	1	3734	c.3644G>A	c.(3643-3645)CGC>CAC	p.R1215H	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1215					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AGTCCGTATGCGCACATAGGC	0.433													22	227	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32632145	32632145	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32632145G>A	uc003zrg.1	-	1	3523	c.3433C>T	c.(3433-3435)CGG>TGG	p.R1145W	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1145					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AGTTCCTTCCGCTCCTGCTCC	0.468													40	89	---	---	---	---	PASS
PTPN3	5774	broad.mit.edu	37	9	112151660	112151660	+	Splice_Site	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112151660C>T	uc004bed.2	-	22	2219	c.2107_splice	c.e22-1	p.M703_splice	PTPN3_uc004beb.2_Splice_Site_p.M572_splice|PTPN3_uc004bec.2_Splice_Site_p.M527_splice|PTPN3_uc010mtu.2_Splice_Site|PTPN3_uc011lwg.1_Splice_Site_p.M658_splice|PTPN3_uc011lwh.1_Splice_Site_p.M549_splice|PTPN3_uc011lwd.1_Splice_Site_p.M171_splice|PTPN3_uc011lwe.1_Splice_Site_p.M416_splice|PTPN3_uc011lwf.1_Splice_Site_p.M371_splice	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type						negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3						GAATTTCCATCTGGTAAGAAA	0.463													3	86	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137674461	137674461	+	Intron	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137674461G>T	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGGACCGCCAGGGAGGCGGGT	0.627													37	152	---	---	---	---	PASS
LARP4B	23185	broad.mit.edu	37	10	890987	890987	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:890987C>T	uc001ifs.1	-	5	480	c.439G>A	c.(439-441)GAG>AAG	p.E147K		NM_015155	NP_055970	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	147							nucleotide binding|RNA binding			ovary(2)|central_nervous_system(1)	3						GGTTGAGACTCATTTCCTCCT	0.388													36	86	---	---	---	---	PASS
STAM	8027	broad.mit.edu	37	10	17742236	17742236	+	Silent	SNP	A	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17742236A>T	uc001ipj.1	+	9	1086	c.870A>T	c.(868-870)GTA>GTT	p.V290V	STAM_uc010qcf.1_Silent_p.V179V|STAM_uc009xjw.1_5'UTR	NM_003473	NP_003464	Q92783	STAM1_HUMAN	signal transducing adaptor molecule 1	290					cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	SH3/SH2 adaptor activity			large_intestine(1)|ovary(1)	2						ATGTTCAGGTAGAGACAATAG	0.313													12	114	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27382400	27382400	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27382400C>T	uc001ith.2	-	3	581	c.409G>A	c.(409-411)GCT>ACT	p.A137T	ANKRD26_uc009xku.1_Missense_Mutation_p.A137T	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	137	ANK 3.					centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TTTGGATCAGCACCATGTTCT	0.413													12	107	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37421200	37421200	+	Silent	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37421200G>C	uc001iza.1	+	4	474	c.375G>C	c.(373-375)ACG>ACC	p.T125T		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	181	ANK 4.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						TATCCATAACGAAAAGAAGTG	0.284													17	94	---	---	---	---	PASS
HNRNPF	3185	broad.mit.edu	37	10	43882414	43882414	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43882414T>A	uc009xmh.1	-	3	1406	c.919A>T	c.(919-921)AAC>TAC	p.N307Y	HNRNPF_uc001jar.2_Missense_Mutation_p.N307Y|HNRNPF_uc001jas.2_Missense_Mutation_p.N307Y|HNRNPF_uc001jat.2_Missense_Mutation_p.N307Y|HNRNPF_uc001jav.2_Missense_Mutation_p.N307Y|HNRNPF_uc001jau.2_Missense_Mutation_p.N307Y|uc010qfa.1_Silent_p.V32V	NM_001098208	NP_001091678	P52597	HNRPF_HUMAN	heterogeneous nuclear ribonucleoprotein F	307	RRM 3.				regulation of RNA splicing	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding				0						GAGAAGAAGTTGTAAATGTCG	0.517													13	113	---	---	---	---	PASS
HNRNPF	3185	broad.mit.edu	37	10	43882837	43882837	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43882837C>G	uc009xmh.1	-	3	983	c.496G>C	c.(496-498)GAG>CAG	p.E166Q	HNRNPF_uc001jar.2_Missense_Mutation_p.E166Q|HNRNPF_uc001jas.2_Missense_Mutation_p.E166Q|HNRNPF_uc001jat.2_Missense_Mutation_p.E166Q|HNRNPF_uc001jav.2_Missense_Mutation_p.E166Q|HNRNPF_uc001jau.2_Missense_Mutation_p.E166Q|uc010qfa.1_3'UTR	NM_001098208	NP_001091678	P52597	HNRPF_HUMAN	heterogeneous nuclear ribonucleoprotein F	166	RRM 2.				regulation of RNA splicing	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding				0						AGAGCCTTCTCAGCTAACTCC	0.522													19	139	---	---	---	---	PASS
RBP3	5949	broad.mit.edu	37	10	48390698	48390698	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48390698C>A	uc001jez.2	-	1	294	c.180G>T	c.(178-180)GAG>GAT	p.E60D		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	60	4 X approximate tandem repeats.|1.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	TGCTCAGAATCTCATGGCTCT	0.592													29	116	---	---	---	---	PASS
AGAP7	653268	broad.mit.edu	37	10	51465318	51465318	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51465318G>T	uc001jio.2	-	7	1264	c.1138C>A	c.(1138-1140)CTA>ATA	p.L380I	PARG_uc001jih.2_Intron|uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron	NM_001077685	NP_001071153	Q5VUJ5	AGAP7_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	380	PH.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0						TTCTTCTTTAGGTGTTTCTTT	0.527													48	142	---	---	---	---	PASS
A1CF	29974	broad.mit.edu	37	10	52573658	52573658	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52573658G>A	uc001jjj.2	-	10	1494	c.1306C>T	c.(1306-1308)CCT>TCT	p.P436S	A1CF_uc010qhn.1_Missense_Mutation_p.P436S|A1CF_uc001jji.2_Missense_Mutation_p.P428S|A1CF_uc001jjh.2_Missense_Mutation_p.P436S|A1CF_uc010qho.1_Missense_Mutation_p.P444S|A1CF_uc009xov.2_Missense_Mutation_p.P428S	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2	436					cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1						AATGTGACAGGATTCATTGGG	0.438													56	182	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	67829247	67829247	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67829247C>A	uc009xpn.1	-	15	2101	c.1978G>T	c.(1978-1980)GCT>TCT	p.A660S	CTNNA3_uc001jmw.2_Missense_Mutation_p.A660S	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	660					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						GTCATCTTAGCCTAAAACATG	0.328													22	175	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69935179	69935179	+	Silent	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69935179G>A	uc001jnm.3	+	13	2849	c.2664G>A	c.(2662-2664)GGG>GGA	p.G888G	MYPN_uc001jnn.3_Silent_p.G613G|MYPN_uc001jno.3_Silent_p.G888G|MYPN_uc009xpt.2_Silent_p.G888G|MYPN_uc010qit.1_Silent_p.G594G|MYPN_uc010qiu.1_Intron	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	888						nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						GAGACTTGGGGAAAAAAATAA	0.363													16	124	---	---	---	---	PASS
OIT3	170392	broad.mit.edu	37	10	74684331	74684331	+	Silent	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74684331G>A	uc001jte.1	+	7	1514	c.1296G>A	c.(1294-1296)TTG>TTA	p.L432L	OIT3_uc009xqs.1_Intron	NM_152635	NP_689848	Q8WWZ8	OIT3_HUMAN	oncoprotein-induced transcript 3 precursor	432	ZP.					nuclear envelope	calcium ion binding			ovary(2)	2	Prostate(51;0.0198)					TGGAAAGCTTGGTGGAGAGCT	0.557													11	90	---	---	---	---	PASS
SEC24C	9632	broad.mit.edu	37	10	75520505	75520505	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75520505T>A	uc001juw.2	+	7	1064	c.885T>A	c.(883-885)AAT>AAA	p.N295K	SEC24C_uc010qkn.1_RNA|SEC24C_uc009xrj.1_Missense_Mutation_p.N153K|SEC24C_uc001jux.2_Missense_Mutation_p.N295K|SEC24C_uc010qko.1_Missense_Mutation_p.N153K|SEC24C_uc010qkp.1_Intron|SEC24C_uc010qkq.1_Intron	NM_004922	NP_004913	P53992	SC24C_HUMAN	SEC24-related protein C	295					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|zinc ion binding			skin(2)|central_nervous_system(1)	3	Prostate(51;0.0112)					CTCAGTCTAATTATGGAGGCC	0.582													22	161	---	---	---	---	PASS
GLUD1	2746	broad.mit.edu	37	10	88834324	88834324	+	Silent	SNP	T	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88834324T>G	uc001keh.2	-	4	727	c.630A>C	c.(628-630)GCA>GCC	p.A210A	GLUD1_uc001keg.2_Silent_p.A43A|GLUD1_uc010qmp.1_Silent_p.A77A	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor	210					glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	AGCCCTTTTTTGCTAGCTCCA	0.239													5	236	---	---	---	---	PASS
LGI1	9211	broad.mit.edu	37	10	95518036	95518036	+	Silent	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95518036G>A	uc001kjc.3	+	1	471	c.135G>A	c.(133-135)GTG>GTA	p.V45V	LGI1_uc010qnv.1_Silent_p.V45V|LGI1_uc001kjd.3_Silent_p.V45V|LGI1_uc009xui.2_RNA|LGI1_uc001kje.2_RNA	NM_005097	NP_005088	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1 precursor	45	LRRNT.				axon guidance|cell proliferation|positive regulation of cell growth|positive regulation of synaptic transmission	cell junction|extracellular space|synapse	receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4		Colorectal(252;0.124)				GCCCTGCCGTGTGTACTTGTA	0.453													16	183	---	---	---	---	PASS
PDCD11	22984	broad.mit.edu	37	10	105162882	105162882	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105162882G>T	uc001kwy.1	+	4	329	c.242G>T	c.(241-243)TGT>TTT	p.C81F		NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11	81					mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TAGTCCCTGTGTGAGGGAATG	0.443													84	289	---	---	---	---	PASS
LRRC27	80313	broad.mit.edu	37	10	134188614	134188614	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134188614A>C	uc010quw.1	+	11	1656	c.1461A>C	c.(1459-1461)TTA>TTC	p.L487F	LRRC27_uc001llg.2_RNA|LRRC27_uc001lli.2_Missense_Mutation_p.L487F|LRRC27_uc001llj.2_Missense_Mutation_p.L425F	NM_030626	NP_085129	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27 isoform a	487										ovary(1)	1		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		AATTGGGATTAACCTTGAACA	0.488													8	84	---	---	---	---	PASS
KNDC1	85442	broad.mit.edu	37	10	135011179	135011179	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135011179G>T	uc001llz.1	+	12	1814	c.1813G>T	c.(1813-1815)GTG>TTG	p.V605L	KNDC1_uc001lma.1_Missense_Mutation_p.V540L|KNDC1_uc001lmb.1_Missense_Mutation_p.V17L	NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)	605	KIND 2.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TCCTCCCCAGGTGTACCAGGA	0.677													27	155	---	---	---	---	PASS
OR52A5	390054	broad.mit.edu	37	11	5153746	5153746	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5153746C>A	uc010qyx.1	-	1	127	c.127G>T	c.(127-129)GGA>TGA	p.G43*		NM_001005160	NP_001005160	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A,	43	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.G43E(1)		skin(2)|lung(1)|central_nervous_system(1)	4		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		AGGGAATTTCCAATCACACCA	0.403													30	121	---	---	---	---	PASS
PIK3C2A	5286	broad.mit.edu	37	11	17132046	17132046	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17132046G>C	uc001mmq.3	-	21	3543	c.3477C>G	c.(3475-3477)ATC>ATG	p.I1159M	PIK3C2A_uc009ygu.1_Translation_Start_Site|PIK3C2A_uc010rcw.1_Missense_Mutation_p.I779M|PIK3C2A_uc001mmr.3_Intron	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha	1159	PI3K/PI4K.				cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	CTTTAAGCCAGATCTTATCCA	0.358													17	176	---	---	---	---	PASS
MRGPRX1	259249	broad.mit.edu	37	11	18956325	18956325	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18956325G>T	uc001mpg.2	-	1	225	c.7C>A	c.(7-9)CCA>ACA	p.P3T		NM_147199	NP_671732	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	3	Extracellular (Potential).				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(2)|central_nervous_system(1)	3						GAGATGGTTGGATCCATGCTC	0.413													101	501	---	---	---	---	PASS
SLC17A6	57084	broad.mit.edu	37	11	22363311	22363311	+	Silent	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22363311C>G	uc001mqk.2	+	2	737	c.324C>G	c.(322-324)GGC>GGG	p.G108G		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	108	Vesicular (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						ACCGCGGGGGCAAGGTCATCA	0.632													12	69	---	---	---	---	PASS
C11orf41	25758	broad.mit.edu	37	11	33682446	33682446	+	Silent	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33682446C>A	uc001mup.3	+	19	5296	c.5172C>A	c.(5170-5172)GCC>GCA	p.A1724A		NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	1718						integral to membrane				ovary(2)	2						TCCCAGCTGCCAACAGACCTG	0.582													12	36	---	---	---	---	PASS
CD44	960	broad.mit.edu	37	11	35227749	35227749	+	Nonsense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35227749C>G	uc001mvu.2	+	11	1807	c.1373C>G	c.(1372-1374)TCA>TGA	p.S458*	CD44_uc001mvv.2_Nonsense_Mutation_p.S415*|CD44_uc001mvw.2_Intron|CD44_uc001mvx.2_Intron|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Intron|CD44_uc010rer.1_Intron|CD44_uc009ykh.2_Intron|CD44_uc010res.1_Nonsense_Mutation_p.S22*|CD44_uc010ret.1_Intron|CD44_uc010reu.1_Intron	NM_000610	NP_000601	P16070	CD44_HUMAN	CD44 antigen isoform 1 precursor	458	Extracellular (Potential).|Stem.				cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)	AACCCAATCTCACACCCCATG	0.468													4	260	---	---	---	---	PASS
SYT13	57586	broad.mit.edu	37	11	45268004	45268004	+	Silent	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45268004G>A	uc001myq.2	-	5	1032	c.906C>T	c.(904-906)AAC>AAT	p.N302N	SYT13_uc009yku.1_Silent_p.N158N	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	302	C2 2.|Cytoplasmic (Potential).					transport vesicle				ovary(1)	1						CCAGGAGGCGGTTGGCAGCCG	0.572													31	89	---	---	---	---	PASS
CHST1	8534	broad.mit.edu	37	11	45671891	45671891	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45671891C>T	uc001mys.1	-	4	1254	c.583G>A	c.(583-585)GAG>AAG	p.E195K		NM_003654	NP_003645	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6)	195	Lumenal (Potential).				galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity			skin(4)|pancreas(1)	5				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		CGGCACGCCTCGGCCGCCACG	0.697													10	57	---	---	---	---	PASS
FOLH1	2346	broad.mit.edu	37	11	49175955	49175955	+	Silent	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49175955T>C	uc001ngy.2	-	16	1974	c.1713A>G	c.(1711-1713)AAA>AAG	p.K571K	FOLH1_uc001ngx.2_Silent_p.K3K|FOLH1_uc001ngz.2_Silent_p.K571K|FOLH1_uc009yly.2_Silent_p.K556K|FOLH1_uc009ylz.2_Silent_p.K556K|FOLH1_uc009yma.2_Silent_p.K263K	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	571	NAALADase.|Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	TGAGGTGATATTTAAACATTG	0.398													4	134	---	---	---	---	PASS
OR4C46	119749	broad.mit.edu	37	11	51515878	51515878	+	Silent	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51515878C>G	uc010ric.1	+	1	597	c.597C>G	c.(595-597)GCC>GCG	p.A199A		NM_001004703	NP_001004703	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C,	199	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TCATTGCTGCCAACAGTGGAT	0.483													28	187	---	---	---	---	PASS
OR4P4	81300	broad.mit.edu	37	11	55406513	55406513	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55406513C>T	uc010rij.1	+	1	680	c.680C>T	c.(679-681)TCT>TTT	p.S227F		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	227	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						AGAGCATACTCTGCAGAGAGA	0.393													47	170	---	---	---	---	PASS
OR5A1	219982	broad.mit.edu	37	11	59210840	59210840	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59210840A>C	uc001nnx.1	+	1	199	c.199A>C	c.(199-201)AGC>CGC	p.S67R		NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A,	67	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2						CTTCTTCCTAAGCAACTTATC	0.488													34	320	---	---	---	---	PASS
RAB3IL1	5866	broad.mit.edu	37	11	61672049	61672049	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61672049T>G	uc001nso.2	-	7	1026	c.868A>C	c.(868-870)AAG>CAG	p.K290Q	RAB3IL1_uc001nsp.2_Missense_Mutation_p.K264Q	NM_013401	NP_037533	Q8TBN0	R3GEF_HUMAN	RAB3A interacting protein (rabin3)-like 1	290							protein binding			skin(2)|central_nervous_system(1)	3						TCGGCCACCTTCACTGTGGGC	0.622													5	26	---	---	---	---	PASS
PLCB3	5331	broad.mit.edu	37	11	64031594	64031594	+	Intron	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64031594G>T	uc001nzb.2	+						PLCB3_uc009ypg.1_Intron|PLCB3_uc009yph.1_Intron|PLCB3_uc009ypi.2_Intron	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C beta 3						intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2						GGTGAGCCGGGGCAGGGCAGG	0.657													28	75	---	---	---	---	PASS
ATG2A	23130	broad.mit.edu	37	11	64663931	64663931	+	Intron	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64663931C>G	uc001obx.2	-						ATG2A_uc001obw.2_Intron	NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A								protein binding			ovary(1)|central_nervous_system(1)	2						GGCACCCACTCACCTGGATAG	0.557													6	22	---	---	---	---	PASS
PHOX2A	401	broad.mit.edu	37	11	71952160	71952160	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71952160C>T	uc001osh.3	-	2	563	c.391G>A	c.(391-393)GAG>AAG	p.E131K		NM_005169	NP_005160	O14813	PHX2A_HUMAN	paired-like homeobox 2a	131	Homeobox.				noradrenergic neuron differentiation|positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						ACGCGAGCCTCAGTGAGGTCG	0.592													11	66	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78383075	78383075	+	Intron	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78383075T>A	uc001ozl.3	-						ODZ4_uc001ozk.3_Intron|ODZ4_uc009yvb.1_Intron	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						GACAGACACCTGCCTTCTCTA	0.547													10	31	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85437341	85437341	+	Intron	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85437341G>A	uc010rth.1	-						SYTL2_uc010rtg.1_Intron|SYTL2_uc010rti.1_Intron|SYTL2_uc010rtj.1_Intron|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Silent_p.H53H|SYTL2_uc001pbb.2_Silent_p.H53H|SYTL2_uc001pbc.2_Silent_p.H53H|SYTL2_uc010rtf.1_Intron	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TGAATTCCTTGTGTTTCTGCC	0.358													69	159	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88583186	88583186	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88583186G>C	uc001pcq.2	-	2	999	c.799C>G	c.(799-801)CAC>GAC	p.H267D	GRM5_uc009yvm.2_Missense_Mutation_p.H267D	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	267	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	TTGGGCAAGTGACTTGTGAGC	0.542													39	70	---	---	---	---	PASS
NOX4	50507	broad.mit.edu	37	11	89135615	89135615	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89135615T>A	uc001pct.2	-	9	964	c.725A>T	c.(724-726)TAT>TTT	p.Y242F	NOX4_uc009yvr.2_Missense_Mutation_p.Y217F|NOX4_uc001pcu.2_Missense_Mutation_p.Y168F|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Missense_Mutation_p.Y242F|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Missense_Mutation_p.Y76F|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Missense_Mutation_p.Y218F|NOX4_uc009yvq.2_Missense_Mutation_p.Y218F|NOX4_uc009yvs.1_RNA	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	242	Extracellular (Potential).|Ferric oxidoreductase.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				TTCTGAGAAATACTCTGGTAA	0.423													38	258	---	---	---	---	PASS
SIK3	23387	broad.mit.edu	37	11	116827790	116827790	+	Intron	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116827790G>A	uc001ppy.2	-						SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK							cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						CCTGACAACAGAGGGAAAAAA	0.338													102	242	---	---	---	---	PASS
CEP164	22897	broad.mit.edu	37	11	117265653	117265653	+	Silent	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117265653T>C	uc001prc.2	+	22	2925	c.2778T>C	c.(2776-2778)GAT>GAC	p.D926D	CEP164_uc001prb.2_Silent_p.D929D|CEP164_uc010rxk.1_Silent_p.D900D|CEP164_uc001prf.2_Intron|CEP164_uc009yzp.1_RNA|CEP164_uc001prg.1_Silent_p.D359D	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	926	Glu-rich.				cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		AGCTCCAGGATTTAGAGTTGG	0.517													58	318	---	---	---	---	PASS
FEZ1	9638	broad.mit.edu	37	11	125359634	125359634	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125359634C>T	uc001qbx.2	-	2	192	c.40G>A	c.(40-42)GAC>AAC	p.D14N	FEZ1_uc010sbc.1_Missense_Mutation_p.D14N|FEZ1_uc001qby.1_Missense_Mutation_p.D14N	NM_005103	NP_005094	Q99689	FEZ1_HUMAN	zygin 1 isoform 1	14					axon guidance|cell adhesion|transport	microtubule|plasma membrane				central_nervous_system(3)|ovary(1)	4	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		GGTCGAAGGTCCTCAAACTCT	0.532													14	125	---	---	---	---	PASS
DCPS	28960	broad.mit.edu	37	11	126208221	126208221	+	Missense_Mutation	SNP	G	A	A	rs140993180		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126208221G>A	uc001qdp.2	+	4	892	c.563G>A	c.(562-564)CGG>CAG	p.R188Q		NM_014026	NP_054745	Q96C86	DCPS_HUMAN	mRNA decapping enzyme	188					deadenylation-dependent decapping of nuclear-transcribed mRNA|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	exoribonuclease activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		GAAGCGGACCGGATTGTTTTC	0.502													13	81	---	---	---	---	PASS
HSN2	378465	broad.mit.edu	37	12	977437	977437	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:977437G>T	uc001qiq.2	+	1	568	c.442G>T	c.(442-444)GCA>TCA	p.A148S	WNK1_uc001qio.3_Intron|WNK1_uc001qip.3_Intron|WNK1_uc001qir.3_Intron	NM_213655	NP_998820			hereditary sensory neuropathy, type II												0	all_cancers(10;0.0107)|all_epithelial(11;0.0151)|Ovarian(42;0.0512)|all_lung(10;0.0521)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.000967)|BRCA - Breast invasive adenocarcinoma(9;0.0178)			TCCTCAGGAAGCAGTGTATGT	0.443													20	17	---	---	---	---	PASS
CCND2	894	broad.mit.edu	37	12	4409107	4409107	+	Missense_Mutation	SNP	G	C	C	rs3217921	byFrequency	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4409107G>C	uc001qmo.2	+	5	1107	c.802G>C	c.(802-804)GGA>CGA	p.G268R		NM_001759	NP_001750	P30279	CCND2_HUMAN	cyclin D2	268					cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding			haematopoietic_and_lymphoid_tissue(1)|breast(1)|kidney(1)	3			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			CCAACGTGACGGATCCAAGTC	0.567			T	IGL@	NHL,CLL								6	110	---	---	---	---	PASS
NDUFA9	4704	broad.mit.edu	37	12	4778914	4778914	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4778914A>T	uc001qnc.2	+	8	741	c.731A>T	c.(730-732)GAT>GTT	p.D244V	NDUFA9_uc010ses.1_Missense_Mutation_p.D25V	NM_005002	NP_004993	Q16795	NDUA9_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	244					mitochondrial electron transport, NADH to ubiquinone|sodium ion transport	mitochondrial matrix|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	CAGGTCGTAGATGTATCCAAA	0.299													75	173	---	---	---	---	PASS
SLC2A13	114134	broad.mit.edu	37	12	40442010	40442010	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40442010T>C	uc010skm.1	-	2	610	c.559A>G	c.(559-561)ATT>GTT	p.I187V	SLC2A13_uc001rmf.2_Missense_Mutation_p.I187V	NM_052885	NP_443117	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose	187	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)				ATAGAAGCAATGCCTATAAAA	0.388										HNSCC(50;0.14)			63	153	---	---	---	---	PASS
ANKRD33	341405	broad.mit.edu	37	12	52284807	52284807	+	Intron	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52284807G>A	uc001rzf.3	+						ANKRD33_uc001rzh.3_3'UTR|ANKRD33_uc001rzd.2_Silent_p.P359P|ANKRD33_uc001rze.2_Silent_p.P255P|ANKRD33_uc001rzg.3_Intron|ANKRD33_uc001rzi.3_Intron	NM_001130015	NP_001123487	Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33 isoform 1												0				BRCA - Breast invasive adenocarcinoma(357;0.0969)		CCCAGTCCCCGCCAGGGAGTC	0.642													8	51	---	---	---	---	PASS
MFSD5	84975	broad.mit.edu	37	12	53646886	53646886	+	Silent	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53646886C>A	uc001sci.1	+	2	458	c.267C>A	c.(265-267)GTC>GTA	p.V89V	MFSD5_uc001sch.1_Silent_p.V196V	NM_032889	NP_116278	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing	89	Helical; (Potential).				transport	integral to membrane				skin(2)|ovary(1)	3						CCTCTACAGTCCTCTTTGGCC	0.498													66	501	---	---	---	---	PASS
AAAS	8086	broad.mit.edu	37	12	53708616	53708616	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53708616C>A	uc001scr.3	-	6	627	c.464G>T	c.(463-465)CGT>CTT	p.R155L	AAAS_uc001scs.3_Intron	NM_015665	NP_056480	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency,	155	WD 1.				carbohydrate metabolic process|glucose transport|nucleocytoplasmic transport|regulation of glucose transport|regulation of nucleocytoplasmic transport|transmembrane transport|viral reproduction	nuclear pore				ovary(1)	1						TGCAAAGACACGCAAGCAGCA	0.527													11	35	---	---	---	---	PASS
OR6C1	390321	broad.mit.edu	37	12	55715175	55715175	+	Silent	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55715175T>C	uc010spi.1	+	1	792	c.792T>C	c.(790-792)GAT>GAC	p.D264D		NM_001005182	NP_001005182	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C,	264	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2						CAGCAAAAGATAGAGTGTCCT	0.438													35	184	---	---	---	---	PASS
MDM1	56890	broad.mit.edu	37	12	68715378	68715378	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68715378C>G	uc001stz.2	-	6	968	c.832G>C	c.(832-834)GAA>CAA	p.E278Q	MDM1_uc010stc.1_Missense_Mutation_p.E233Q|MDM1_uc009zqv.1_5'UTR	NM_017440	NP_059136	Q8TC05	MDM1_HUMAN	mouse Mdm1 nuclear protein homolog isoform 1	278						nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		ATCTCTGCTTCCAATTTTAAA	0.313													9	65	---	---	---	---	PASS
RAB3IP	117177	broad.mit.edu	37	12	70188917	70188917	+	Intron	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70188917C>T	uc001svp.2	+						RAB3IP_uc001svl.1_Intron|RAB3IP_uc001svm.2_Intron|RAB3IP_uc001svn.2_Intron|RAB3IP_uc001svo.2_Intron|RAB3IP_uc001svq.2_Intron|RAB3IP_uc001svr.2_Intron|RAB3IP_uc001svs.2_Intron|RAB3IP_uc001svt.2_Intron	NM_175623	NP_783322	Q96QF0	RAB3I_HUMAN	RAB3A interacting protein isoform alpha 2						cilium assembly|Golgi to plasma membrane transport|protein localization to organelle|protein transport	actin cortical patch|centrosome|cytosol|lamellipodium|microtubule basal body|nucleus	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			GATTTCTTTCCAAGATTGATG	0.378													26	66	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70932804	70932804	+	Intron	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70932804C>A	uc001swb.3	-						PTPRB_uc010sto.1_Intron|PTPRB_uc010stp.1_Intron|PTPRB_uc001swc.3_Intron|PTPRB_uc001swa.3_Intron	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B						angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CCTGTTAGGTCAAATATGAGT	0.358													6	35	---	---	---	---	PASS
ZFC3H1	196441	broad.mit.edu	37	12	72057376	72057376	+	Silent	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72057376A>G	uc001swo.2	-	1	374	c.15T>C	c.(13-15)GAT>GAC	p.D5D	ZFC3H1_uc010sts.1_Silent_p.D5D|ZFC3H1_uc001swp.2_Silent_p.D5D|THAP2_uc001swq.2_5'Flank	NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	5					RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						GGGCCGGAGTATCTGCGGTCG	0.602											OREG0021993	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	187	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80660274	80660274	+	IGR	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80660274G>A								PPP1R12A (331039 upstream) : PTPRQ (177852 downstream)																							ACTGTTCCTCGTTCTGCCTCC	0.468													11	54	---	---	---	---	PASS
PAH	5053	broad.mit.edu	37	12	103237469	103237469	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103237469A>G	uc001tjq.1	-	12	1626	c.1154T>C	c.(1153-1155)CTG>CCG	p.L385P		NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase	385					catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	CACGTAATAGAGGGGCTGGAA	0.527													28	100	---	---	---	---	PASS
MYO1H	283446	broad.mit.edu	37	12	109880040	109880040	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109880040C>T	uc010sxo.1	+	4	451	c.176C>T	c.(175-177)CCG>CTG	p.P59L	MYO1H_uc010sxn.1_Missense_Mutation_p.P868L			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;	59						myosin complex	motor activity				0						GACATTAATCCGAAAGTGCTT	0.443													21	70	---	---	---	---	PASS
RASAL1	8437	broad.mit.edu	37	12	113539713	113539713	+	Silent	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113539713G>A	uc001tum.1	-	20	2496	c.2203C>T	c.(2203-2205)CTG>TTG	p.L735L	RASAL1_uc010syp.1_Silent_p.L736L|RASAL1_uc001tul.2_Silent_p.L707L|RASAL1_uc001tun.1_Silent_p.L737L	NM_004658	NP_004649	O95294	RASL1_HUMAN	RAS protein activator like 1	735					intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity			ovary(2)|skin(2)	4						TCCCGCCCCAGGAGCAGCTGC	0.652													10	87	---	---	---	---	PASS
SLC24A6	80024	broad.mit.edu	37	12	113758204	113758204	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113758204T>C	uc001tvc.2	-	7	836	c.626A>G	c.(625-627)TAC>TGC	p.Y209C	SLC24A6_uc001tuz.2_5'Flank|SLC24A6_uc001tva.2_RNA|SLC24A6_uc001tvb.2_Intron	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor	209	Helical; Name=4; (Potential).				response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						AGCCACCATGTAGAAAACGAT	0.612													23	448	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117718548	117718548	+	Silent	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117718548G>T	uc001twm.1	-	8	2192	c.1506C>A	c.(1504-1506)GCC>GCA	p.A502A		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	502					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	ACTGCACATTGGCTGGGTCCC	0.597													32	99	---	---	---	---	PASS
ZCCHC8	55596	broad.mit.edu	37	12	122966644	122966644	+	Intron	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122966644G>C	uc001ucn.2	-						ZCCHC8_uc001ucm.2_Intron|ZCCHC8_uc009zxp.2_Intron|ZCCHC8_uc009zxq.2_Intron	NM_017612	NP_060082	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8							catalytic step 2 spliceosome	nucleic acid binding|protein binding|zinc ion binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		GCTACATCATGACACATTTGA	0.323													3	90	---	---	---	---	PASS
GPR81	27198	broad.mit.edu	37	12	123214157	123214157	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123214157G>A	uc001ucz.2	-	1	973	c.730C>T	c.(730-732)CTC>TTC	p.L244F	GPR81_uc001ucw.1_RNA	NM_032554	NP_115943	Q9BXC0	HCAR1_HUMAN	G protein-coupled receptor 81	244	Extracellular (Potential).				response to estradiol stimulus	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.14e-05)|Epithelial(86;3.25e-05)|BRCA - Breast invasive adenocarcinoma(302;0.197)		ACCGTCCAGAGGAAATAGAGT	0.567													45	123	---	---	---	---	PASS
ULK1	8408	broad.mit.edu	37	12	132400609	132400609	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132400609G>C	uc001uje.2	+	19	2051	c.1783G>C	c.(1783-1785)GGC>CGC	p.G595R		NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1	595					autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		GCCGTCCCACGGCCTGCAGTC	0.692													31	40	---	---	---	---	PASS
MPHOSPH8	54737	broad.mit.edu	37	13	20220920	20220920	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20220920G>C	uc001umh.2	+	3	716	c.707G>C	c.(706-708)AGA>ACA	p.R236T	MPHOSPH8_uc001umf.1_Missense_Mutation_p.R236T|MPHOSPH8_uc001umg.2_Missense_Mutation_p.R236T|MPHOSPH8_uc001umi.2_5'UTR	NM_017520	NP_059990	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	236	Lys-rich.				cell cycle	cytoplasm|nucleus					0		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		ggtgaaataagagatttaaag	0.164													7	53	---	---	---	---	PASS
RNF17	56163	broad.mit.edu	37	13	25356003	25356003	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25356003C>A	uc001upr.2	+	6	573	c.532C>A	c.(532-534)CAA>AAA	p.Q178K	RNF17_uc010tdd.1_Missense_Mutation_p.Q37K|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.Q178K|RNF17_uc001ups.2_Missense_Mutation_p.Q117K|RNF17_uc001upq.1_Missense_Mutation_p.Q178K	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	178					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		CATGCAGAAGCAAACGATAGA	0.303													3	88	---	---	---	---	PASS
CDX2	1045	broad.mit.edu	37	13	28539154	28539154	+	Splice_Site	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28539154T>C	uc001urv.2	-	2	716	c.542_splice	c.e2-1	p.V181_splice		NM_001265	NP_001256	Q99626	CDX2_HUMAN	caudal type homeobox 2						organ morphogenesis|transcription from RNA polymerase II promoter		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(110;0.191)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0407)|all cancers(112;0.0491)|OV - Ovarian serous cystadenocarcinoma(117;0.199)		TGGTTTTCACTGTGGAGGAAG	0.527			T	ETV6	AML								6	39	---	---	---	---	PASS
WBP4	11193	broad.mit.edu	37	13	41642710	41642710	+	Silent	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41642710A>G	uc001uxt.2	+	5	389	c.276A>G	c.(274-276)CCA>CCG	p.P92P	WBP4_uc010tfd.1_Silent_p.P71P	NM_007187	NP_009118	O75554	WBP4_HUMAN	WW domain-containing binding protein 4	92					nuclear mRNA cis splicing, via spliceosome	nuclear speck|spliceosomal complex	nucleic acid binding|proline-rich region binding|zinc ion binding			breast(2)|kidney(1)	3		Lung NSC(96;3.55e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;3.11e-09)|Epithelial(112;3.37e-06)|OV - Ovarian serous cystadenocarcinoma(117;8.3e-05)|GBM - Glioblastoma multiforme(144;0.00102)|BRCA - Breast invasive adenocarcinoma(63;0.07)		TTTTGGAGCCAAGCATAACAC	0.289													11	114	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70314629	70314629	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70314629G>T	uc001vip.2	-	8	2493	c.1699C>A	c.(1699-1701)CTG>ATG	p.L567M	KLHL1_uc010thm.1_Missense_Mutation_p.L506M	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	567	Kelch 3.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ACTGTATTCAGATAGCTCCAG	0.398													16	79	---	---	---	---	PASS
EDNRB	1910	broad.mit.edu	37	13	78474768	78474768	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78474768C>T	uc001vko.2	-	5	1231	c.973G>A	c.(973-975)GTC>ATC	p.V325I	EDNRB_uc001vkq.1_Missense_Mutation_p.V325I|uc001vkn.1_Intron|EDNRB_uc010aez.1_Missense_Mutation_p.V325I|EDNRB_uc001vkp.1_Missense_Mutation_p.V408I	NM_001122659	NP_001116131	P24530	EDNRB_HUMAN	endothelin receptor type B isoform 1 precursor	325	Helical; Name=6; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|enteric nervous system development|enteric smooth muscle cell differentiation|macrophage chemotaxis|negative regulation of adenylate cyclase activity|negative regulation of cellular protein metabolic process|negative regulation of neuron maturation|negative regulation of transcription from RNA polymerase II promoter|vein smooth muscle contraction	integral to plasma membrane	endothelin-B receptor activity|peptide hormone binding				0		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)	AGGCAAAAGACGGTTTTGGCC	0.418													38	89	---	---	---	---	PASS
DCT	1638	broad.mit.edu	37	13	95131309	95131309	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95131309G>C	uc001vlv.3	-	1	628	c.201C>G	c.(199-201)GAC>GAG	p.D67E	DCT_uc010afh.2_Missense_Mutation_p.D67E	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1	67	Lumenal, melanosome (Potential).				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		AGGGCCTTGTGTCGGCTCGCA	0.607													7	150	---	---	---	---	PASS
ABCC4	10257	broad.mit.edu	37	13	95715008	95715008	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95715008T>C	uc001vmd.3	-	26	3435	c.3316A>G	c.(3316-3318)ACT>GCT	p.T1106A	ABCC4_uc010afj.2_5'UTR|ABCC4_uc010afk.2_Missense_Mutation_p.T1059A	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4	1106	ABC transporter 2.				platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	CCAATTTCAGTTGTCAAGATC	0.413													58	229	---	---	---	---	PASS
EFNB2	1948	broad.mit.edu	37	13	107145564	107145564	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107145564T>A	uc001vqi.2	-	5	851	c.826A>T	c.(826-828)AAG>TAG	p.K276*		NM_004093	NP_004084	P52799	EFNB2_HUMAN	ephrin B2 precursor	276	Cytoplasmic (Potential).				cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					CCGCTGCGCTTGGGTGTGGCC	0.597													36	88	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23854130	23854130	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23854130T>G	uc001wjv.2	-	35	5351	c.5284A>C	c.(5284-5286)ACG>CCG	p.T1762P		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	1762	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CTTACATCCGTGATGGCCTTC	0.582													28	150	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33291373	33291373	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33291373G>A	uc001wrq.2	+	13	4524	c.4354G>A	c.(4354-4356)GAC>AAC	p.D1452N		NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	1452					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ACATACCCCTGACTGTTTGGG	0.358													27	61	---	---	---	---	PASS
SDCCAG1	9147	broad.mit.edu	37	14	50296057	50296057	+	Intron	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50296057A>G	uc001wxc.2	-						SDCCAG1_uc010anj.1_Intron|SDCCAG1_uc010tqi.1_Intron|SDCCAG1_uc001wxe.2_Intron|SDCCAG1_uc001wxd.1_Intron|SDCCAG1_uc010anq.1_Intron	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1							cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)		GAGAAAGCCAAACATAATACC	0.348													12	74	---	---	---	---	PASS
ARID4A	5926	broad.mit.edu	37	14	58814583	58814583	+	Nonsense_Mutation	SNP	T	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58814583T>G	uc001xdp.2	+	15	1645	c.1391T>G	c.(1390-1392)TTA>TGA	p.L464*	ARID4A_uc001xdo.2_Nonsense_Mutation_p.L464*|ARID4A_uc001xdq.2_Nonsense_Mutation_p.L464*|ARID4A_uc010apg.1_Nonsense_Mutation_p.L142*	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	464					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						GAGATAGAATTAAAATCTCCG	0.294													18	54	---	---	---	---	PASS
PAPLN	89932	broad.mit.edu	37	14	73726051	73726051	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73726051C>G	uc010ttx.1	+	15	1946	c.1783C>G	c.(1783-1785)CCC>GCC	p.P595A	PAPLN_uc001xnw.3_Missense_Mutation_p.P568A|PAPLN_uc010arl.2_RNA|PAPLN_uc010ttw.1_RNA|PAPLN_uc010tty.1_Missense_Mutation_p.P595A|PAPLN_uc010arm.2_5'Flank	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	595						proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		ACGAGGTGACCCCAGGGGCGA	0.662													17	118	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106967184	106967184	+	RNA	SNP	A	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106967184A>T	uc010tyt.1	-	201		c.9257T>A								Parts of antibodies, mostly variable regions.												0						TACCACCACTAGGGTTGATTA	0.547													8	232	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20170322	20170322	+	IGR	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20170322C>G								None (None upstream) : GOLGA6L6 (566772 downstream)																							CAGCTATGACCACCAAAAACA	0.542													33	144	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25299445	25299445	+	Intron	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25299445G>C	uc001yxh.1	+						SNORD116-2_uc001yxi.2_RNA|SNORD116-4_uc001yxj.1_5'Flank|SNORD116-3_uc001yxk.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						CATCGGAACTGAGGTCCAGCA	0.483													56	133	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28358790	28358790	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28358790G>A	uc001zbj.2	-	91	14054	c.13948C>T	c.(13948-13950)CGG>TGG	p.R4650W	HERC2_uc001zbi.2_Missense_Mutation_p.R339W	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	4650	HECT.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ATTCCTTCCCGAACAGCAGCC	0.542													14	33	---	---	---	---	PASS
EIF2AK4	440275	broad.mit.edu	37	15	40241344	40241344	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40241344G>A	uc001zkm.1	+	4	438	c.388G>A	c.(388-390)GTG>ATG	p.V130M	EIF2AK4_uc001zkl.2_Missense_Mutation_p.V130M	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha	130	RWD.				translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		GGCTTACCACGTGCAGTCATT	0.468													16	296	---	---	---	---	PASS
MAPKBP1	23005	broad.mit.edu	37	15	42109934	42109934	+	Splice_Site	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42109934G>T	uc001zok.3	+	17	2208	c.1922_splice	c.e17+1	p.R641_splice	MAPKBP1_uc001zoj.3_Splice_Site_p.R635_splice|MAPKBP1_uc010bcj.2_Splice_Site_p.R142_splice|MAPKBP1_uc010bci.2_Splice_Site_p.R635_splice|MAPKBP1_uc010udb.1_Splice_Site_p.R474_splice|MAPKBP1_uc010bck.2_Splice_Site|MAPKBP1_uc010bcl.2_Splice_Site_p.R142_splice	NM_001128608	NP_001122080	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein											central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		GAAATATTCGGTGGGCGTCCC	0.572													10	19	---	---	---	---	PASS
HDC	3067	broad.mit.edu	37	15	50534807	50534807	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50534807C>G	uc001zxz.2	-	12	1745	c.1639G>C	c.(1639-1641)GAC>CAC	p.D547H	HDC_uc001zxy.2_Missense_Mutation_p.D290H|HDC_uc010uff.1_Missense_Mutation_p.D514H	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	547					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	TCAACTGGGTCCAGCAGGGTT	0.522													30	129	---	---	---	---	PASS
RFX7	64864	broad.mit.edu	37	15	56386134	56386134	+	Silent	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56386134T>C	uc010bfn.2	-	9	3792	c.3792A>G	c.(3790-3792)GCA>GCG	p.A1264A	RFX7_uc010ugk.1_RNA|RFX7_uc002adn.1_Silent_p.A1078A	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	1167					regulation of transcription, DNA-dependent	nucleus	DNA binding				0						AACCTCTCACTGCATCATCAT	0.423													37	75	---	---	---	---	PASS
SCAPER	49855	broad.mit.edu	37	15	77021063	77021063	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77021063G>C	uc002bby.2	-	16	2097	c.2038C>G	c.(2038-2040)CTA>GTA	p.L680V	SCAPER_uc010bkr.2_5'UTR|SCAPER_uc002bbx.2_Missense_Mutation_p.L434V|SCAPER_uc002bbz.1_Missense_Mutation_p.L551V|SCAPER_uc002bca.1_Missense_Mutation_p.L545V|SCAPER_uc002bcb.1_Missense_Mutation_p.L686V	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	679	Glu-rich.			RAL->AAA: No effect on CCNA2/CDK2 complex-binding.		endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						TCTGCCTCTAGAGCTCTCTTG	0.368													7	33	---	---	---	---	PASS
ACSBG1	23205	broad.mit.edu	37	15	78486325	78486325	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78486325C>A	uc002bdh.2	-	4	547	c.491G>T	c.(490-492)GGC>GTC	p.G164V	ACSBG1_uc010umw.1_Missense_Mutation_p.G160V|ACSBG1_uc010umx.1_Intron|ACSBG1_uc010umy.1_Missense_Mutation_p.G57V	NM_015162	NP_055977	Q96GR2	ACBG1_HUMAN	lipidosin	164					long-chain fatty acid metabolic process|myelination|very long-chain fatty acid metabolic process	cytoplasmic membrane-bounded vesicle|endoplasmic reticulum|microsome	ATP binding|long-chain fatty acid-CoA ligase activity|very long-chain fatty acid-CoA ligase activity			ovary(1)	1						GGAGTTGAAGCCGAGGATGGC	0.662													5	37	---	---	---	---	PASS
SH3GL3	6457	broad.mit.edu	37	15	84228078	84228078	+	Intron	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84228078G>C	uc002bjw.2	+						SH3GL3_uc010bms.2_Intron|SH3GL3_uc010uot.1_Intron|SH3GL3_uc002bjx.2_Intron|SH3GL3_uc002bju.2_Intron|SH3GL3_uc002bjv.2_Intron	NM_003027	NP_003018	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3						central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding			pancreas(1)|central_nervous_system(1)|skin(1)	3						GAAAGGGTAAGAGCATTTTAA	0.303											OREG0023396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	53	---	---	---	---	PASS
ST8SIA2	8128	broad.mit.edu	37	15	92977483	92977483	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92977483A>T	uc002bra.2	+	3	323	c.168A>T	c.(166-168)GAA>GAT	p.E56D	ST8SIA2_uc002brb.2_Missense_Mutation_p.E35D	NM_006011	NP_006002	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide	56	Lumenal (Potential).				axon guidance|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity				0	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			CCAGAGCTGAAGTTGTAATAA	0.433													35	198	---	---	---	---	PASS
SOLH	6650	broad.mit.edu	37	16	597775	597775	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:597775G>A	uc002chi.2	+	4	1300	c.937G>A	c.(937-939)GGC>AGC	p.G313S	SOLH_uc002chh.1_Missense_Mutation_p.G313S	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes	313					proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				CGTAGAGGCCGGCAGCTCCAC	0.677													14	17	---	---	---	---	PASS
SEPT12	124404	broad.mit.edu	37	16	4836106	4836106	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4836106C>A	uc002cxq.2	-	3	308	c.167G>T	c.(166-168)GGG>GTG	p.G56V	SEPT12_uc002cxr.2_Missense_Mutation_p.G56V|SEPT12_uc010bty.2_RNA|uc002cxt.2_5'Flank	NM_144605	NP_653206	Q8IYM1	SEP12_HUMAN	septin 12 isoform 2	56	GTP (By similarity).			G->N: Abolishes binding to GTP and to SEPT11, and also abolishes the ability of SEPT12 to form filamentous structures.	cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity			skin(1)	1						CCCGCTTTGCCCTGGGAGTGG	0.478													19	43	---	---	---	---	PASS
TMEM186	25880	broad.mit.edu	37	16	8890269	8890269	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8890269C>T	uc002cze.2	-	2	216	c.182G>A	c.(181-183)CGT>CAT	p.R61H	PMM2_uc002czf.3_5'Flank|PMM2_uc010uyf.1_5'Flank|PMM2_uc010uyg.1_5'Flank|PMM2_uc010uyh.1_5'Flank|PMM2_uc010buj.2_5'Flank|PMM2_uc010uyi.1_5'Flank|PMM2_uc010uye.1_5'Flank	NM_015421	NP_056236	Q96B77	TM186_HUMAN	transmembrane protein 186	61						integral to membrane|mitochondrion				ovary(1)	1						GGCATCAAAACGGTAAAACAT	0.512													45	132	---	---	---	---	PASS
NSMCE1	197370	broad.mit.edu	37	16	27268767	27268767	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27268767T>C	uc002doi.1	-	2	223	c.125A>G	c.(124-126)AAG>AGG	p.K42R	NSMCE1_uc002doj.1_RNA	NM_145080	NP_659547	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog	42					DNA recombination|DNA repair|intracellular signal transduction	nucleus	zinc ion binding				0						GTCATGGACCTTGTAGCAGTG	0.547													25	202	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27751428	27751428	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27751428T>G	uc002dow.2	+	15	1834	c.1810T>G	c.(1810-1812)TTA>GTA	p.L604V		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	604										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						CAATGGCAAGTTAGACAAAGG	0.473													54	120	---	---	---	---	PASS
GOT2	2806	broad.mit.edu	37	16	58750702	58750702	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58750702C>A	uc002eof.1	-	7	832	c.718G>T	c.(718-720)GCG>TCG	p.A240S	GOT2_uc010vim.1_Missense_Mutation_p.A197S	NM_002080	NP_002071	P00505	AATM_HUMAN	aspartate aminotransferase 2 precursor	240					aspartate catabolic process|fatty acid transport|gluconeogenesis|response to ethanol	mitochondrial matrix|plasma membrane	L-aspartate:2-oxoglutarate aminotransferase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	TCAAAGAACGCAAAGAGATTC	0.453													22	76	---	---	---	---	PASS
C16orf48	84080	broad.mit.edu	37	16	67698949	67698949	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67698949G>A	uc002etw.1	-	3	686	c.403C>T	c.(403-405)CGC>TGC	p.R135C	C16orf48_uc002etv.1_5'Flank|C16orf48_uc010cem.1_Missense_Mutation_p.R135C|C16orf86_uc002etx.1_5'Flank|C16orf86_uc002ety.2_5'Flank|C16orf86_uc002etz.2_5'Flank	NM_032140	NP_115516	Q9H0I2	CP048_HUMAN	hypothetical protein LOC84080	135						microtubule cytoskeleton	protein binding				0		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		TTGGGTGAGCGCCACAGAGCT	0.597													7	245	---	---	---	---	PASS
WWP2	11060	broad.mit.edu	37	16	69965469	69965469	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69965469G>T	uc002exu.1	+	16	1668	c.1579G>T	c.(1579-1581)GAT>TAT	p.D527Y	WWP2_uc002exv.1_Missense_Mutation_p.D527Y|WWP2_uc010vlm.1_Missense_Mutation_p.D411Y|WWP2_uc010vln.1_Missense_Mutation_p.D145Y|WWP2_uc002exw.1_Missense_Mutation_p.D88Y|uc002exx.1_5'Flank|MIR140_hsa-mir-140|MI0000456_5'Flank	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase	527					entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						GCTTTTCGAAGATTCCTTCCA	0.502													32	64	---	---	---	---	PASS
BCAR1	9564	broad.mit.edu	37	16	75263596	75263596	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75263596C>T	uc002fdv.2	-	7	2549	c.2426G>A	c.(2425-2427)CGC>CAC	p.R809H	BCAR1_uc002fdt.2_Missense_Mutation_p.R262H|BCAR1_uc002fdu.2_Missense_Mutation_p.R599H|BCAR1_uc010cgu.2_Missense_Mutation_p.R798H|BCAR1_uc010vna.1_Missense_Mutation_p.R807H|BCAR1_uc010vnb.1_Missense_Mutation_p.R855H|BCAR1_uc002fdw.2_Missense_Mutation_p.R809H|BCAR1_uc010vnc.1_Missense_Mutation_p.R661H|BCAR1_uc010vnd.1_Missense_Mutation_p.R827H|BCAR1_uc002fdx.2_Missense_Mutation_p.R827H	NM_014567	NP_055382	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	809					actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity			central_nervous_system(5)|breast(2)|prostate(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.169)		CACCTGGCTGCGCACGTCAGC	0.632													14	44	---	---	---	---	PASS
PKD1L2	114780	broad.mit.edu	37	16	81161381	81161381	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81161381C>T	uc002fgh.1	-	38	6335	c.6335G>A	c.(6334-6336)CGC>CAC	p.R2112H	PKD1L2_uc002fgf.1_5'UTR|PKD1L2_uc002fgg.1_RNA	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	2112	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CGTGCTTTGGCGATCAGTCCC	0.517													14	37	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1585256	1585256	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1585256C>A	uc002fte.2	-	5	625	c.511G>T	c.(511-513)GAT>TAT	p.D171Y		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	171						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GGCTCCTCATCATCAAAAGGG	0.512													4	156	---	---	---	---	PASS
CTNS	1497	broad.mit.edu	37	17	3561418	3561418	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3561418C>A	uc002fwb.2	+	10	1394	c.801C>A	c.(799-801)TTC>TTA	p.F267L	CTNS_uc002fwa.2_Missense_Mutation_p.F267L|CTNS_uc010ckj.2_Missense_Mutation_p.F267L|CTNS_uc010vrv.1_Missense_Mutation_p.F120L|CTNS_uc010vrw.1_Missense_Mutation_p.F159L	NM_004937	NP_004928	O60931	CTNS_HUMAN	cystinosin isoform 2	267	Helical; (Potential).|PQ-loop 2.				ATP metabolic process|brain development|cognition|glutathione metabolic process	integral to membrane|late endosome|lysosomal membrane	L-cystine transmembrane transporter activity				0				COAD - Colon adenocarcinoma(5;0.0829)	L-Cystine(DB00138)	AGTTTCTCTTCTGCTTCTCCT	0.587													6	112	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578177	7578177	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578177C>G	uc002gim.2	-	6	866	c.672G>C	c.(670-672)GAG>GAC	p.E224D	TP53_uc002gig.1_Missense_Mutation_p.E224D|TP53_uc002gih.2_Missense_Mutation_p.E224D|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E92D|TP53_uc010cng.1_Missense_Mutation_p.E92D|TP53_uc002gii.1_Missense_Mutation_p.E92D|TP53_uc010cnh.1_Missense_Mutation_p.E224D|TP53_uc010cni.1_Missense_Mutation_p.E224D|TP53_uc002gij.2_Missense_Mutation_p.E224D|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.E131D|TP53_uc002gio.2_Missense_Mutation_p.E92D|TP53_uc010vug.1_Missense_Mutation_p.E185D	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	224	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E224D(11)|p.0?(7)|p.E224E(6)|p.E224K(5)|p.E224*(4)|p.?(3)|p.E224G(2)|p.E224fs*4(1)|p.E224fs*5(1)|p.V218_E224delVPYEPPE(1)|p.E224fs*23(1)|p.V225fs*24(1)|p.E224fs*24(1)|p.E224_V225insXX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAAACCAGACCTCAGGCGGCT	0.522		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			15	35	---	---	---	---	PASS
UNC45B	146862	broad.mit.edu	37	17	33498393	33498393	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33498393C>G	uc002hja.2	+	13	1845	c.1748C>G	c.(1747-1749)ACC>AGC	p.T583S	UNC45B_uc002hjb.2_Missense_Mutation_p.T581S|UNC45B_uc002hjc.2_Missense_Mutation_p.T581S|UNC45B_uc010cto.2_Missense_Mutation_p.T502S	NM_173167	NP_775259	Q8IWX7	UN45B_HUMAN	cardiomyopathy associated 4 isoform 1	583					cell differentiation|muscle organ development	cytosol	binding			ovary(3)|central_nervous_system(2)|breast(1)	6		Ovarian(249;0.17)				GTGAACTGCACCAACAGCTAC	0.567											OREG0024327	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	183	---	---	---	---	PASS
TMEM99	147184	broad.mit.edu	37	17	38991294	38991294	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38991294C>G	uc002hvj.1	+	3	833	c.526C>G	c.(526-528)CTT>GTT	p.L176V		NM_145274	NP_660317	Q8N816	TMM99_HUMAN	transmembrane protein 99 precursor	176						integral to membrane				skin(1)	1		Breast(137;0.000301)				CCCATCAGTTCTTTACTCTGA	0.393													33	288	---	---	---	---	PASS
KRT31	3881	broad.mit.edu	37	17	39550377	39550377	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39550377G>T	uc002hwn.2	-	7	1195	c.1142C>A	c.(1141-1143)CCC>CAC	p.P381H	KRT31_uc010cxn.2_3'UTR	NM_002277	NP_002268	Q15323	K1H1_HUMAN	keratin 31	381	Tail.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000496)				GGGTCCGATGGGCTTGCTGCA	0.557													24	109	---	---	---	---	PASS
JUP	3728	broad.mit.edu	37	17	39912009	39912009	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39912009T>C	uc002hxq.2	-	14	2502	c.2225A>G	c.(2224-2226)CAC>CGC	p.H742R	JUP_uc010wfs.1_Intron|JUP_uc002hxr.2_Missense_Mutation_p.H742R|JUP_uc002hxs.2_Missense_Mutation_p.H742R	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin	742					adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		GGCCAGCATGTGGTCTGCAGT	0.637													17	60	---	---	---	---	PASS
DBF4B	80174	broad.mit.edu	37	17	42815778	42815778	+	Missense_Mutation	SNP	C	G	G	rs61660093		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42815778C>G	uc002ihf.2	+	9	912	c.699C>G	c.(697-699)ATC>ATG	p.I233M	DBF4B_uc010wjb.1_RNA|DBF4B_uc002ihe.2_Missense_Mutation_p.I47M|DBF4B_uc010wjc.1_Missense_Mutation_p.I217M	NM_145663	NP_663696	Q8NFT6	DBF4B_HUMAN	DBF4 homolog B isoform 1	233					cell cycle	nucleus	nucleic acid binding|zinc ion binding				0		Prostate(33;0.0322)				TCCTCAAAATCGAAGATGAAA	0.587													54	168	---	---	---	---	PASS
KIF18B	146909	broad.mit.edu	37	17	43004447	43004447	+	Splice_Site	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43004447C>T	uc010wji.1	-	14	2387	c.2286_splice	c.e14-1	p.R762_splice	KIF18B_uc002iht.2_Splice_Site_p.R771_splice|KIF18B_uc010wjh.1_Splice_Site_p.R759_splice	NM_001080443	NP_001073912			kinesin family member 18B											ovary(2)	2		Prostate(33;0.155)				CACAGGTGCCCTGGGGAGGGA	0.463													10	26	---	---	---	---	PASS
KIF18B	146909	broad.mit.edu	37	17	43012738	43012738	+	Silent	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43012738C>A	uc010wji.1	-	3	461	c.360G>T	c.(358-360)CTG>CTT	p.L120L	KIF18B_uc002iht.2_Silent_p.L120L|KIF18B_uc010wjh.1_Silent_p.L120L	NM_001080443	NP_001073912			kinesin family member 18B											ovary(2)	2		Prostate(33;0.155)				CCTCCCTTCCCAGCATGGTGT	0.632													18	75	---	---	---	---	PASS
MAPT	4137	broad.mit.edu	37	17	44096082	44096082	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44096082G>A	uc002ijr.3	+	13	2367	c.2047G>A	c.(2047-2049)GGA>AGA	p.G683R	MAPT_uc010dau.2_Missense_Mutation_p.G701R|MAPT_uc002ijs.3_Missense_Mutation_p.G366R|MAPT_uc002ijx.3_Missense_Mutation_p.G337R|MAPT_uc002ijt.3_Missense_Mutation_p.G308R|MAPT_uc002iju.3_Missense_Mutation_p.G277R|MAPT_uc002ijv.3_Missense_Mutation_p.G284R	NM_016835	NP_058519	P10636	TAU_HUMAN	microtubule-associated protein tau isoform 1	683	Tau/MAP 4.				cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)				CGTCCCTGGCGGAGGAAATAA	0.512													62	164	---	---	---	---	PASS
WNT9B	7484	broad.mit.edu	37	17	44952487	44952487	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44952487C>G	uc002ikw.1	+	3	392	c.355C>G	c.(355-357)CTG>GTG	p.L119V	WNT9B_uc002ikx.1_Missense_Mutation_p.L119V	NM_003396	NP_003387	O14905	WNT9B_HUMAN	wingless-type MMTV integration site family,	119					anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|collecting duct development|cornea development in camera-type eye|endoderm development|establishment of planar polarity involved in nephron morphogenesis|kidney rudiment formation|male genitalia development|mesonephric duct formation|metanephric tubule development|neuron differentiation|palate development|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|uterus morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway|Wnt receptor signaling pathway, planar cell polarity pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding			lung(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.0257)			GACAGCTTTCCTGTACGCGGT	0.542													40	388	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45232092	45232092	+	Silent	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45232092G>A	uc002ild.3	-	8	1030	c.903C>T	c.(901-903)TAC>TAT	p.Y301Y	CDC27_uc002ile.3_Silent_p.Y301Y|CDC27_uc002ilf.3_Silent_p.Y301Y|CDC27_uc010wkp.1_Silent_p.Y240Y|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	301					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						GTGTATTAGTGTAGTTTTGTA	0.388													17	62	---	---	---	---	PASS
ABCC3	8714	broad.mit.edu	37	17	48745019	48745019	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48745019G>T	uc002isl.2	+	12	1616	c.1536G>T	c.(1534-1536)AAG>AAT	p.K512N	ABCC3_uc002isk.3_Missense_Mutation_p.K512N	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3	512	ABC transmembrane type-1 1.|Cytoplasmic (By similarity).				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	GCTTCCTGAAGCAGGTGGAGG	0.592													21	51	---	---	---	---	PASS
ACE	1636	broad.mit.edu	37	17	61560819	61560819	+	Splice_Site	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61560819A>G	uc002jau.1	+	10	1510	c.1488_splice	c.e10-2	p.R496_splice	ACE_uc010wpi.1_Splice_Site_p.E448_splice|ACE_uc010ddu.1_Splice_Site_p.R313_splice|ACE_uc002jav.1_5'Flank|ACE_uc010ddv.1_5'Flank|ACE_uc010wpj.1_5'Flank|ACE_uc002jaw.1_5'Flank|ACE_uc010wpk.1_5'Flank	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1						arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	ATCCTTTTCCAGAACCAAGTA	0.453													36	146	---	---	---	---	PASS
DDX42	11325	broad.mit.edu	37	17	61886913	61886913	+	Intron	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61886913C>G	uc002jbu.2	+						DDX42_uc002jbv.2_Intron|DDX42_uc002jbw.1_Intron|DDX42_uc002jbx.2_Intron|DDX42_uc002jby.2_5'Flank	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN	DEAD box polypeptide 42 protein						protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5						TTTTGTTGATCTTATAGGGTC	0.383													51	117	---	---	---	---	PASS
SLC16A6	9120	broad.mit.edu	37	17	66267246	66267246	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66267246T>A	uc002jgz.1	-	5	1243	c.1055A>T	c.(1054-1056)AAC>ATC	p.N352I	ARSG_uc002jhc.2_Intron|SLC16A6_uc002jha.1_Missense_Mutation_p.N352I	NM_004694	NP_004685	O15403	MOT7_HUMAN	solute carrier family 16, member 6	352	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity				0	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	GGGCTCCCTGTTGAGGACAAA	0.458													26	130	---	---	---	---	PASS
KCNJ2	3759	broad.mit.edu	37	17	68171404	68171404	+	Missense_Mutation	SNP	C	A	A	rs104894585		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68171404C>A	uc010dfg.2	+	2	625	c.224C>A	c.(223-225)ACG>AAG	p.T75K	KCNJ2_uc002jir.2_Missense_Mutation_p.T75K	NM_000891	NP_000882	P63252	IRK2_HUMAN	potassium inwardly-rectifying channel J2	75	Cytoplasmic (By similarity).				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity|protein binding				0	Breast(10;1.64e-08)					ATCTTCACCACGTGTGTGGAC	0.512													70	174	---	---	---	---	PASS
TBCD	6904	broad.mit.edu	37	17	80755631	80755631	+	Splice_Site	SNP	A	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80755631A>T	uc002kfz.2	+	8	902	c.772_splice	c.e8-2	p.A258_splice	TBCD_uc002kfx.1_Splice_Site_p.A241_splice|TBCD_uc002kfy.1_Splice_Site_p.A258_splice	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			TTTTTTTTTTAGGCACAAATA	0.264													3	28	---	---	---	---	PASS
PSMA8	143471	broad.mit.edu	37	18	23731827	23731827	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23731827A>G	uc002kvq.2	+	3	367	c.253A>G	c.(253-255)ACT>GCT	p.T85A	PSMA8_uc002kvo.2_Missense_Mutation_p.T41A|PSMA8_uc002kvp.2_Missense_Mutation_p.T79A|PSMA8_uc002kvr.2_Missense_Mutation_p.T53A	NM_144662	NP_653263	Q8TAA3	PSA7L_HUMAN	proteasome alpha 8 subunit isoform 1	85					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	threonine-type endopeptidase activity			skin(1)	1	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			TATAGGACTTACTGCTGATGC	0.363													12	183	---	---	---	---	PASS
CDH2	1000	broad.mit.edu	37	18	25570124	25570124	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25570124G>A	uc002kwg.2	-	10	1994	c.1535C>T	c.(1534-1536)GCC>GTC	p.A512V	CDH2_uc010xbn.1_Missense_Mutation_p.A481V	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	512	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						CATGGTACCGGCATGAAGCCC	0.413													5	252	---	---	---	---	PASS
PSTPIP2	9050	broad.mit.edu	37	18	43579495	43579495	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43579495C>A	uc002lbp.3	-	7	519	c.423G>T	c.(421-423)AAG>AAT	p.K141N	PSTPIP2_uc002lbq.3_Missense_Mutation_p.K141N	NM_024430	NP_077748	Q9H939	PPIP2_HUMAN	proline-serine-threonine phosphatase interacting	141	Potential.					membrane				ovary(1)	1						CATAGTTCTTCTTTGCCTTTG	0.498													4	166	---	---	---	---	PASS
SERPINB13	5275	broad.mit.edu	37	18	61260205	61260205	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61260205G>T	uc002ljc.2	+	5	640	c.472G>T	c.(472-474)GAA>TAA	p.E158*	SERPINB13_uc002ljd.2_5'UTR|SERPINB13_uc010xep.1_Nonsense_Mutation_p.E167*|SERPINB13_uc010xeq.1_Intron|SERPINB13_uc010xer.1_Intron	NM_012397	NP_036529	Q9UIV8	SPB13_HUMAN	serine (or cysteine) proteinase inhibitor, clade	158					regulation of proteolysis|response to UV	cytoplasm|extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1						CAAAACAAATGGTAGAGTATG	0.264													39	127	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74625717	74625717	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74625717A>G	uc002lmi.2	+	18	3116	c.2918A>G	c.(2917-2919)AAC>AGC	p.N973S	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	973	C2H2-type 18.				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GACTATTGCAACAAAGGCTTT	0.468													23	92	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76753289	76753289	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76753289G>C	uc002lmt.2	+	2	1298	c.1298G>C	c.(1297-1299)AGC>ACC	p.S433T	SALL3_uc010dra.2_Missense_Mutation_p.S40T	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	433	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GGCAGCGACAGCGCGCTCCAG	0.622													11	27	---	---	---	---	PASS
SPPL2B	56928	broad.mit.edu	37	19	2351493	2351493	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2351493C>T	uc002lvs.2	+	15	1496	c.1416C>T	c.(1414-1416)CCC>CCT	p.P472P	SPPL2B_uc002lvr.2_Silent_p.P472P	NM_152988	NP_694533	Q8TCT7	PSL1_HUMAN	signal peptide peptidase-like 2B isoform 2	472						Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGCCAGCCCGCTCTCCTCT	0.682													80	76	---	---	---	---	PASS
STAP2	55620	broad.mit.edu	37	19	4327374	4327374	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4327374A>C	uc002mab.2	-	7	696	c.599T>G	c.(598-600)GTG>GGG	p.V200G	STAP2_uc002mac.2_Missense_Mutation_p.V200G|STAP2_uc002mad.2_Missense_Mutation_p.V93G	NM_001013841	NP_001013863	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	200	SH2.					cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGCCGGACCACGTGCGTCCT	0.642													3	60	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9062137	9062137	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9062137G>T	uc002mkp.2	-	3	25513	c.25309C>A	c.(25309-25311)CTT>ATT	p.L8437I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8439	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ACTTCAGAAAGGACAGTGCTT	0.522													85	151	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9084383	9084383	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9084383T>C	uc002mkp.2	-	1	7636	c.7432A>G	c.(7432-7434)ATG>GTG	p.M2478V		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2478	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTGCTGACCATGGTGCTGAAA	0.517											OREG0006611	type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	39	62	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10112354	10112354	+	Intron	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10112354C>A	uc002mmq.1	-							NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein						collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			CCTCTGAGAACGTTAGGAAAG	0.562											OREG0025228	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	54	107	---	---	---	---	PASS
DOCK6	57572	broad.mit.edu	37	19	11361676	11361676	+	Silent	SNP	T	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11361676T>G	uc002mqs.3	-	6	635	c.594A>C	c.(592-594)GCA>GCC	p.A198A		NM_020812	NP_065863	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	198					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						ATGAGTCAGCTGCCAGGTTCC	0.652													6	45	---	---	---	---	PASS
MIR24-2	407013	broad.mit.edu	37	19	13947400	13947400	+	5'Flank	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13947400G>C	hsa-mir-24-2|MI0000081	-						uc002mxi.3_Missense_Mutation_p.P18R|MIR27A_hsa-mir-27a|MI0000085_5'Flank																	0						GCAGAGCTCAGGGTCGGTTGG	0.657													4	59	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23544808	23544808	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23544808C>A	uc002nre.2	-	4	1086	c.973G>T	c.(973-975)GAA>TAA	p.E325*	ZNF91_uc010xrj.1_Nonsense_Mutation_p.E293*	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	325	C2H2-type 7.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				CCACATTCTTCACATTTGTAG	0.388													33	228	---	---	---	---	PASS
ZNF527	84503	broad.mit.edu	37	19	37870038	37870038	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37870038G>T	uc010efk.1	+	3	161	c.50G>T	c.(49-51)AGA>ATA	p.R17I	ZNF527_uc002ogf.3_Missense_Mutation_p.R17I|ZNF527_uc010xtq.1_RNA|ZNF527_uc002oge.2_Missense_Mutation_p.R17I	NM_032453	NP_115829	Q8NB42	ZN527_HUMAN	zinc finger protein 527	17	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTGACCTTCAGAGATGTGGCG	0.433													30	109	---	---	---	---	PASS
ZNF573	126231	broad.mit.edu	37	19	38229489	38229489	+	Silent	SNP	A	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38229489A>G	uc002ohe.2	-	4	1924	c.1902T>C	c.(1900-1902)GGT>GGC	p.G634G	ZNF573_uc010efs.2_Silent_p.G547G|ZNF573_uc002ohd.2_Silent_p.G632G|ZNF573_uc002ohf.2_Silent_p.G576G|ZNF573_uc002ohg.2_Silent_p.G546G	NM_152360	NP_689573	Q86YE8	ZN573_HUMAN	zinc finger protein 573	614					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			AGGGTTTCTCACCAGTATGAA	0.408													15	312	---	---	---	---	PASS
FBXO27	126433	broad.mit.edu	37	19	39516090	39516090	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39516090C>T	uc002okh.2	-	6	895	c.813G>A	c.(811-813)GTG>GTA	p.V271V		NM_178820	NP_849142	Q8NI29	FBX27_HUMAN	F-box protein 27	271	FBA.				protein catabolic process	SCF ubiquitin ligase complex	glycoprotein binding			ovary(1)	1	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			TGGAGTTGGTCACACGGGCTC	0.587													12	126	---	---	---	---	PASS
HNRNPUL1	11100	broad.mit.edu	37	19	41784998	41784998	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41784998C>T	uc002oqb.3	+	6	1092	c.803C>T	c.(802-804)TCC>TTC	p.S268F	CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Missense_Mutation_p.S168F|HNRNPUL1_uc002oqa.3_Missense_Mutation_p.S168F|HNRNPUL1_uc010ehm.2_Missense_Mutation_p.S268F|HNRNPUL1_uc002oqc.3_Intron|HNRNPUL1_uc002oqe.3_Intron|HNRNPUL1_uc002oqd.3_Missense_Mutation_p.S168F|HNRNPUL1_uc010ehn.2_Missense_Mutation_p.S168F|HNRNPUL1_uc010eho.2_Missense_Mutation_p.S168F|HNRNPUL1_uc010xvy.1_Missense_Mutation_p.S168F|HNRNPUL1_uc010ehp.2_Missense_Mutation_p.S124F|HNRNPUL1_uc010ehl.1_Missense_Mutation_p.S168F	NM_007040	NP_008971	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	268	B30.2/SPRY.|Necessary for interaction with TP53.				nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding			central_nervous_system(1)|skin(1)	2						GAGGAAATCTCCGTGAAGCAC	0.557													31	201	---	---	---	---	PASS
GRLF1	2909	broad.mit.edu	37	19	47503883	47503883	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47503883A>C	uc010ekv.2	+	6	4438	c.4438A>C	c.(4438-4440)ACC>CCC	p.T1480P		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	1480	Pro-rich.				axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		GCCTCCACCCACCCCCCAGTC	0.667													4	8	---	---	---	---	PASS
SLC8A2	6543	broad.mit.edu	37	19	47944446	47944446	+	Intron	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47944446G>A	uc002pgx.2	-						SLC8A2_uc010xyq.1_Intron|SLC8A2_uc010xyr.1_Intron|SLC8A2_uc010ele.2_Intron	NM_015063	NP_055878	Q9UPR5	NAC2_HUMAN	solute carrier family 8 member 2 precursor						cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(1)	4		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		TAGCAGAGCTGGGGAGAGACA	0.592													42	141	---	---	---	---	PASS
NLRP12	91662	broad.mit.edu	37	19	54314294	54314294	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54314294G>T	uc002qch.3	-	3	839	c.619C>A	c.(619-621)CCC>ACC	p.P207T	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.P207T|NLRP12_uc002qcj.3_Missense_Mutation_p.P207T|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.P207T	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	207					negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GGTGGCTCGGGGCGCTCCTCG	0.647													13	117	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56422060	56422060	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56422060G>T	uc010ygg.1	-	6	2176	c.2151C>A	c.(2149-2151)AGC>AGA	p.S717R		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	717							ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TAGAGCAAATGCTGTTCCATG	0.458													21	156	---	---	---	---	PASS
ZNF667	63934	broad.mit.edu	37	19	56953098	56953098	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56953098C>T	uc002qnd.2	-	5	1428	c.1266G>A	c.(1264-1266)AAG>AAA	p.K422K	ZNF667_uc010etl.2_Silent_p.K204K|ZNF667_uc002qne.2_Silent_p.K422K|ZNF667_uc010etm.2_Silent_p.K365K	NM_022103	NP_071386	Q5HYK9	ZN667_HUMAN	zinc finger protein 667	422	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		CAGAAAACATCTTCCCACATT	0.343													16	64	---	---	---	---	PASS
MIR103-2	406896	broad.mit.edu	37	20	3898152	3898152	+	RNA	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3898152G>C	hsa-mir-103-2|MI0000108	+			c.12G>C			PANK2_uc002wkb.2_Intron|PANK2_uc002wkc.2_Intron|PANK2_uc002wkd.2_Intron|PANK2_uc002wke.2_Intron|PANK2_uc002wkf.2_Intron|uc002wkg.2_RNA|MIR103-2AS_hsa-mir-103-2-as|MI0007262_RNA																	0						TGTGCTTTCAGCTTCTTTACA	0.542													6	158	---	---	---	---	PASS
CRNKL1	51340	broad.mit.edu	37	20	20033048	20033048	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20033048G>T	uc002wrs.2	-	2	454	c.422C>A	c.(421-423)TCT>TAT	p.S141Y	C20orf26_uc010gcw.1_5'Flank|C20orf26_uc010zse.1_5'Flank|C20orf26_uc002wru.2_5'Flank|CRNKL1_uc002wrt.1_Missense_Mutation_p.S129Y	NM_016652	NP_057736	Q9BZJ0	CRNL1_HUMAN	crooked neck-like 1 protein	141					spliceosome assembly	catalytic step 2 spliceosome|cytoplasm|nuclear speck	RNA binding			ovary(2)|large_intestine(1)	3						TCGGCTCTGAGAGCTCACCGA	0.597													12	108	---	---	---	---	PASS
CST11	140880	broad.mit.edu	37	20	23433296	23433296	+	Silent	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23433296G>T	uc002wtf.1	-	1	187	c.153C>A	c.(151-153)ATC>ATA	p.I51I	CST11_uc002wtg.1_Silent_p.I51I	NM_130794	NP_570612	Q9H112	CST11_HUMAN	cystatin 11 isoform 1 precursor	51					defense response to bacterium	cytoplasm|nucleus	cysteine-type endopeptidase inhibitor activity				0	Colorectal(13;0.0431)|Lung NSC(19;0.235)					ACTGGTCGGTGATCCACTGCA	0.493													43	314	---	---	---	---	PASS
NINL	22981	broad.mit.edu	37	20	25448084	25448084	+	Missense_Mutation	SNP	C	G	G	rs35479032	byFrequency	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25448084C>G	uc002wux.1	-	19	3438	c.3364G>C	c.(3364-3366)GAG>CAG	p.E1122Q	NINL_uc010gdn.1_Missense_Mutation_p.E773Q	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like	1122	Potential.				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						TTTAAAACCTCAATTTCCTTC	0.498													39	215	---	---	---	---	PASS
SFRS6	6431	broad.mit.edu	37	20	42087023	42087023	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42087023G>A	uc010zwg.1	+	2	300	c.130G>A	c.(130-132)GAC>AAC	p.D44N	SFRS6_uc002xki.2_5'UTR|SFRS6_uc002xkk.2_Missense_Mutation_p.D44N	NM_006275	NP_006266	Q13247	SRSF6_HUMAN	arginine/serine-rich splicing factor 6	44	RRM 1.				mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GGAGTTCGAGGACTCCCGCGA	0.716													3	16	---	---	---	---	PASS
GDAP1L1	78997	broad.mit.edu	37	20	42893100	42893100	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42893100C>A	uc002xlq.2	+	5	728	c.661C>A	c.(661-663)CAT>AAT	p.H221N	GDAP1L1_uc002xlp.1_Missense_Mutation_p.H221N|GDAP1L1_uc010zwl.1_Missense_Mutation_p.H240N|GDAP1L1_uc010zwm.1_Missense_Mutation_p.H163N|GDAP1L1_uc010zwn.1_Missense_Mutation_p.H29N	NM_024034	NP_076939	Q96MZ0	GD1L1_HUMAN	ganglioside-induced differentiation-associated	221	GST C-terminal.									large_intestine(1)	1		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GATCTTGGAGCATGATGATGT	0.557													17	35	---	---	---	---	PASS
ARFGEF2	10564	broad.mit.edu	37	20	47633845	47633845	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47633845G>A	uc002xtx.3	+	32	4527	c.4375G>A	c.(4375-4377)GGA>AGA	p.G1459R	ARFGEF2_uc010zyf.1_Missense_Mutation_p.G752R	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	1459					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AATATCCAATGGAGAGAAATT	0.363													23	208	---	---	---	---	PASS
ARFGEF2	10564	broad.mit.edu	37	20	47633846	47633846	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47633846G>T	uc002xtx.3	+	32	4528	c.4376G>T	c.(4375-4377)GGA>GTA	p.G1459V	ARFGEF2_uc010zyf.1_Missense_Mutation_p.G752V	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	1459					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			ATATCCAATGGAGAGAAATTC	0.368													23	214	---	---	---	---	PASS
CASS4	57091	broad.mit.edu	37	20	55027721	55027721	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55027721G>T	uc002xxp.2	+	6	1714	c.1489G>T	c.(1489-1491)GCC>TCC	p.A497S	CASS4_uc002xxq.3_Missense_Mutation_p.A497S|CASS4_uc002xxr.2_Missense_Mutation_p.A497S|CASS4_uc010zze.1_Missense_Mutation_p.A443S|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	497					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						TCTGGATTTTGCCCGAGGAGT	0.488													8	107	---	---	---	---	PASS
GAB4	128954	broad.mit.edu	37	22	17443699	17443699	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17443699T>C	uc002zlw.2	-	10	1757	c.1649A>G	c.(1648-1650)CAG>CGG	p.Q550R		NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member	550										large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				CTGCAGGGCCTGGGTCTTCTC	0.607													24	87	---	---	---	---	PASS
USP18	11274	broad.mit.edu	37	22	18653530	18653530	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18653530T>A	uc002zny.2	+	8	1072	c.734T>A	c.(733-735)CTG>CAG	p.L245Q		NM_017414	NP_059110	Q9UMW8	UBP18_HUMAN	ubiquitin specific protease 18	245					regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway|ubiquitin-dependent protein catabolic process	cytosol|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			breast(1)	1						GTCTTGAAGCTGACCCATTTG	0.483													23	245	---	---	---	---	PASS
USP18	11274	broad.mit.edu	37	22	18653534	18653534	+	Silent	SNP	C	T	T	rs113750800		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18653534C>T	uc002zny.2	+	8	1076	c.738C>T	c.(736-738)ACC>ACT	p.T246T		NM_017414	NP_059110	Q9UMW8	UBP18_HUMAN	ubiquitin specific protease 18	246					regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway|ubiquitin-dependent protein catabolic process	cytosol|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			breast(1)	1						TGAAGCTGACCCATTTGCCCC	0.493													24	240	---	---	---	---	PASS
CLTCL1	8218	broad.mit.edu	37	22	19221124	19221124	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19221124T>C	uc002zpb.2	-	8	1264	c.1189A>G	c.(1189-1191)ACG>GCG	p.T397A	CLTCL1_uc011agv.1_Missense_Mutation_p.T397A|CLTCL1_uc011agw.1_Missense_Mutation_p.T397A	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1 isoform 1	397	Globular terminal domain.				anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)					TTCTGGACCGTCTCTCTGGTA	0.458			T	?	ALCL								19	67	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21119398	21119398	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21119398G>A	uc002zsz.3	-	21	2621	c.2390C>T	c.(2389-2391)ACG>ATG	p.T797M		NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	797					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GGGGGTGACCGTGTCATTCTT	0.498													37	490	---	---	---	---	PASS
DEPDC5	9681	broad.mit.edu	37	22	32234677	32234677	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32234677C>T	uc003als.2	+	27	2476	c.2334C>T	c.(2332-2334)GAC>GAT	p.D778D	DEPDC5_uc011als.1_Silent_p.D709D|DEPDC5_uc011alu.1_Silent_p.D787D|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Silent_p.D778D|DEPDC5_uc003alu.2_Silent_p.D227D|DEPDC5_uc003alv.2_RNA|DEPDC5_uc011alw.1_Silent_p.D108D|DEPDC5_uc003alw.2_Silent_p.D76D|DEPDC5_uc011alx.1_Translation_Start_Site	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	778					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						TCAGGAGGGACGAAGATGGTG	0.483													21	204	---	---	---	---	PASS
LARGE	9215	broad.mit.edu	37	22	34000432	34000432	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34000432C>A	uc003and.3	-	6	1183	c.604G>T	c.(604-606)GAC>TAC	p.D202Y	LARGE_uc003ane.3_Missense_Mutation_p.D202Y|LARGE_uc010gwp.2_Missense_Mutation_p.D202Y|LARGE_uc011ame.1_Missense_Mutation_p.D134Y|LARGE_uc011amf.1_Missense_Mutation_p.D202Y	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase	202	Lumenal (Potential).				glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				TTGAGCTCGTCTGCATTGTAG	0.547													32	132	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36690217	36690217	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36690217T>G	uc003apg.2	-	28	3989	c.3758A>C	c.(3757-3759)CAG>CCG	p.Q1253P		NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	1253	Potential.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity	p.K1249_E1256delKVEAQLQE(1)		breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						CTCCTGCAGCTGCGCCTCCAC	0.647			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				16	192	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50714336	50714336	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50714336C>T	uc003bkv.3	-	36	5500	c.5394G>A	c.(5392-5394)ACG>ACA	p.T1798T	PLXNB2_uc003bkt.1_Silent_p.T590T|PLXNB2_uc003bku.1_Silent_p.T783T	NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	1798	Cytoplasmic (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AGTACTTCTGCGTGTATTGGT	0.657											OREG0026679	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	53	---	---	---	---	PASS
CSF2RA	1438	broad.mit.edu	37	X	1407771	1407771	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1407771C>T	uc010nct.2	+	7	785	c.463C>T	c.(463-465)CGA>TGA	p.R155*	CSF2RA_uc011mhb.1_Nonsense_Mutation_p.R155*|CSF2RA_uc004cpq.2_Nonsense_Mutation_p.R155*|CSF2RA_uc004cpn.2_Nonsense_Mutation_p.R155*|CSF2RA_uc004cpo.2_Nonsense_Mutation_p.R155*|CSF2RA_uc010ncu.2_RNA|CSF2RA_uc011mhc.1_Nonsense_Mutation_p.R22*|CSF2RA_uc004cpp.2_Nonsense_Mutation_p.R155*|CSF2RA_uc010ncv.2_Nonsense_Mutation_p.R155*|CSF2RA_uc004cpr.2_Nonsense_Mutation_p.R155*	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain	155	Extracellular (Potential).					extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TTTGTACATACGAAACTCAAA	0.393													39	142	---	---	---	---	PASS
SHROOM2	357	broad.mit.edu	37	X	9862559	9862559	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9862559G>C	uc004csu.1	+	4	701	c.611G>C	c.(610-612)AGC>ACC	p.S204T		NM_001649	NP_001640	Q13796	SHRM2_HUMAN	apical protein of Xenopus-like	204					apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8		Hepatocellular(5;0.000888)				GGCAGCCACAGCAAGCGCGAC	0.622													3	63	---	---	---	---	PASS
POLA1	5422	broad.mit.edu	37	X	24751921	24751921	+	Silent	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24751921C>G	uc004dbl.2	+	17	1826	c.1803C>G	c.(1801-1803)GTC>GTG	p.V601V	POLA1_uc004dbn.2_Silent_p.V465V	NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1	601					cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	TCAAAGAAGTCATTGAGAAAA	0.338													24	102	---	---	---	---	PASS
CXorf59	286464	broad.mit.edu	37	X	36103515	36103515	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36103515G>T	uc004ddk.1	+	5	687	c.501G>T	c.(499-501)AAG>AAT	p.K167N		NM_173695	NP_775966	Q8N9S7	CX059_HUMAN	hypothetical protein LOC286464	167						integral to membrane				central_nervous_system(1)	1						AATATAATAAGACCATTTATG	0.353													54	129	---	---	---	---	PASS
RPGR	6103	broad.mit.edu	37	X	38145005	38145005	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38145005C>T	uc004ded.1	-	15	3415	c.3247G>A	c.(3247-3249)GAG>AAG	p.E1083K	RPGR_uc004deb.2_Intron|RPGR_uc004dea.2_Intron|RPGR_uc004dec.2_Intron	NM_001034853	NP_001030025	Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator isoform C	865	Glu-rich.				intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						TTGTACTCCTCTCCATCCTGC	0.289													6	438	---	---	---	---	PASS
AKAP4	8852	broad.mit.edu	37	X	49957274	49957274	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49957274A>C	uc004dow.1	-	5	2214	c.2090T>G	c.(2089-2091)ATA>AGA	p.I697R	AKAP4_uc004dov.1_Missense_Mutation_p.I314R|AKAP4_uc010njp.1_Missense_Mutation_p.I519R|AKAP4_uc004dou.1_Missense_Mutation_p.I688R	NM_003886	NP_003877	Q5JQC9	AKAP4_HUMAN	A-kinase anchor protein 4 isoform 1	697					cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding			kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8	Ovarian(276;0.236)					TAGTTTATCTATAAATTGCCC	0.473													4	134	---	---	---	---	PASS
PAGE5	90737	broad.mit.edu	37	X	55247903	55247903	+	Intron	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55247903C>T	uc004duj.2	+						PAGE5_uc004duk.2_Intron	NM_130467	NP_569734	Q96GU1	GGEE1_HUMAN	P antigen family, member 5 isoform 1												0						GATTGTGAGTCCTTTAGCATT	0.363													9	81	---	---	---	---	PASS
LAS1L	81887	broad.mit.edu	37	X	64734720	64734720	+	Silent	SNP	G	A	A	rs146839918		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64734720G>A	uc004dwa.1	-	13	2133	c.2061C>T	c.(2059-2061)CCC>CCT	p.P687P	LAS1L_uc004dwc.1_Silent_p.P670P|LAS1L_uc004dwd.1_Silent_p.P628P|LAS1L_uc004dvy.1_Silent_p.P200P|LAS1L_uc004dvz.1_Silent_p.P200P	NM_031206	NP_112483	Q9Y4W2	LAS1L_HUMAN	LAS1-like	687						MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4						TGCATGTTGAGGGTTCCAGCC	0.557													3	24	---	---	---	---	PASS
OPHN1	4983	broad.mit.edu	37	X	67432046	67432046	+	Silent	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67432046G>T	uc004dww.3	-	8	900	c.606C>A	c.(604-606)GCC>GCA	p.A202A	OPHN1_uc011mpg.1_Silent_p.A202A|OPHN1_uc004dwx.2_Silent_p.A202A	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1	202					axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						TATGAAGAAAGGCCAAGACCT	0.378													3	38	---	---	---	---	PASS
EFNB1	1947	broad.mit.edu	37	X	68058546	68058546	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68058546C>A	uc004dxd.3	+	2	995	c.215C>A	c.(214-216)CCC>CAC	p.P72H	EFNB1_uc004dxe.2_Missense_Mutation_p.P72H	NM_004429	NP_004420	P98172	EFNB1_HUMAN	ephrin-B1 precursor	72	Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to plasma membrane|soluble fraction|synapse	ephrin receptor binding				0						GCAGGGCGGCCCTATGAGTAC	0.572													4	28	---	---	---	---	PASS
EFNB1	1947	broad.mit.edu	37	X	68058547	68058547	+	Silent	SNP	C	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68058547C>T	uc004dxd.3	+	2	996	c.216C>T	c.(214-216)CCC>CCT	p.P72P	EFNB1_uc004dxe.2_Silent_p.P72P	NM_004429	NP_004420	P98172	EFNB1_HUMAN	ephrin-B1 precursor	72	Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to plasma membrane|soluble fraction|synapse	ephrin receptor binding				0						CAGGGCGGCCCTATGAGTACT	0.577													4	29	---	---	---	---	PASS
PJA1	64219	broad.mit.edu	37	X	68381405	68381405	+	Silent	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68381405T>C	uc004dxh.2	-	2	1963	c.1677A>G	c.(1675-1677)GCA>GCG	p.A559A	PJA1_uc011mpi.1_Silent_p.A277A|PJA1_uc004dxg.2_Silent_p.A371A|PJA1_uc004dxi.2_Silent_p.A504A	NM_145119	NP_660095	Q8NG27	PJA1_HUMAN	praja 1 isoform a	559							zinc ion binding				0						CTACATCCACTGCGAGAGACT	0.552													20	125	---	---	---	---	PASS
GDPD2	54857	broad.mit.edu	37	X	69649804	69649804	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69649804C>G	uc004dyh.2	+	12	1449	c.1198C>G	c.(1198-1200)CGA>GGA	p.R400G	GDPD2_uc010nky.1_Missense_Mutation_p.N252K|GDPD2_uc011mpk.1_Missense_Mutation_p.R400G|GDPD2_uc011mpl.1_Missense_Mutation_p.R321G|GDPD2_uc011mpm.1_Missense_Mutation_p.R321G	NM_017711	NP_060181	Q9HCC8	GDPD2_HUMAN	osteoblast differentiation promoting factor	400	GDPD.|Extracellular (Potential).				glycerol metabolic process|lipid metabolic process	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol inositolphosphodiesterase activity|metal ion binding			ovary(2)	2	Renal(35;0.156)					TAATGTCCAACGACGGGCACC	0.537													9	100	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73064898	73064898	+	RNA	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73064898G>C	uc004ebm.1	-	1		c.7691C>G				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						AAAGGGGTCTGAGAGTAGGAC	0.463													5	196	---	---	---	---	PASS
ITM2A	9452	broad.mit.edu	37	X	78618612	78618612	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78618612A>T	uc004edh.2	-	3	603	c.268T>A	c.(268-270)TGC>AGC	p.C90S	ITM2A_uc011mqr.1_Missense_Mutation_p.C46S	NM_004867	NP_004858	O43736	ITM2A_HUMAN	integral membrane protein 2A	90						integral to membrane	protein binding			lung(2)	2						TCAAAAAAGCACATCTCTCCA	0.413													7	45	---	---	---	---	PASS
NAP1L3	4675	broad.mit.edu	37	X	92928264	92928264	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92928264C>A	uc004efq.2	-	1	345	c.40G>T	c.(40-42)GCC>TCC	p.A14S	FAM133A_uc004efr.1_5'Flank	NM_004538	NP_004529	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	14					nucleosome assembly	chromatin assembly complex				ovary(1)|skin(1)	2						ACCCCATGGGCGACAGGTTCC	0.418													20	157	---	---	---	---	PASS
CSTF2	1478	broad.mit.edu	37	X	100077295	100077295	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100077295C>G	uc004egh.2	+	3	251	c.193C>G	c.(193-195)CAA>GAA	p.Q65E	CSTF2_uc010nnd.2_Missense_Mutation_p.Q65E|CSTF2_uc004egi.2_Missense_Mutation_p.Q65E	NM_001325	NP_001316	P33240	CSTF2_HUMAN	cleavage stimulation factor subunit 2	65	RRM.				mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cleavage body|mRNA cleavage and polyadenylation specificity factor complex	nucleotide binding|protein binding|protein binding|RNA binding			skin(1)	1						CTGTGAATACCAAGACCAAGA	0.473													11	79	---	---	---	---	PASS
GLA	2717	broad.mit.edu	37	X	100653447	100653447	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100653447T>A	uc004ehl.1	-	6	1020	c.910A>T	c.(910-912)AGC>TGC	p.S304C		NM_000169	NP_000160	P06280	AGAL_HUMAN	alpha-galactosidase A precursor	304					glycoside catabolic process|glycosphingolipid catabolic process|glycosylceramide catabolic process|negative regulation of nitric oxide biosynthetic process|negative regulation of nitric-oxide synthase activity|oligosaccharide metabolic process	extracellular region|Golgi apparatus|lysosome	cation binding|protein homodimerization activity|raffinose alpha-galactosidase activity|receptor binding				0					Agalsidase beta(DB00103)	GCTTGAGGGCTGATGTGTCGG	0.498													33	310	---	---	---	---	PASS
RAB40AL	282808	broad.mit.edu	37	X	102193089	102193089	+	3'UTR	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102193089G>T	uc004ejs.2	+	1						NM_001031834	NP_001027004	P0C0E4	RB40L_HUMAN	RAB40A, member RAS oncogene family-like						protein transport|small GTPase mediated signal transduction	mitochondrion|plasma membrane	GTP binding			ovary(2)	2						CTTAAGGAAGGCACCAAAAGG	0.458													39	78	---	---	---	---	PASS
COL4A5	1287	broad.mit.edu	37	X	107814652	107814652	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107814652G>T	uc004enz.1	+	7	596	c.394G>T	c.(394-396)GGA>TGA	p.G132*	COL4A5_uc011mso.1_Nonsense_Mutation_p.G132*	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	132	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						GGGAGAACGTGGATTTCCAGG	0.363									Alport_syndrome_with_Diffuse_Leiomyomatosis				45	380	---	---	---	---	PASS
COL4A5	1287	broad.mit.edu	37	X	107814653	107814653	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107814653G>T	uc004enz.1	+	7	597	c.395G>T	c.(394-396)GGA>GTA	p.G132V	COL4A5_uc011mso.1_Missense_Mutation_p.G132V	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	132	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						GGAGAACGTGGATTTCCAGGC	0.363									Alport_syndrome_with_Diffuse_Leiomyomatosis				45	379	---	---	---	---	PASS
GUCY2F	2986	broad.mit.edu	37	X	108619187	108619187	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108619187C>A	uc004eod.3	-	19	3544	c.3268G>T	c.(3268-3270)GAG>TAG	p.E1090*	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	1090	Cytoplasmic (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						GCTGCAATCTCCACTGGTTGC	0.502													44	326	---	---	---	---	PASS
CHRDL1	91851	broad.mit.edu	37	X	109919591	109919591	+	Intron	SNP	T	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109919591T>C	uc004eou.3	-						CHRDL1_uc004eov.2_Intron|CHRDL1_uc004eow.2_Intron|CHRDL1_uc010nps.2_Intron|CHRDL1_uc004eot.2_Intron|CHRDL1_uc011mss.1_Intron	NM_001143981	NP_001137453	Q9BU40	CRDL1_HUMAN	chordin-like 1 isoform 1 precursor						BMP signaling pathway|cell differentiation|nervous system development|ossification	extracellular region					0						TCCACTGGCCTAAAAGGCAAA	0.448													4	109	---	---	---	---	PASS
KIAA1210	57481	broad.mit.edu	37	X	118220627	118220627	+	Silent	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118220627G>T	uc004era.3	-	11	4566	c.4566C>A	c.(4564-4566)TCC>TCA	p.S1522S		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	1522										ovary(4)|skin(1)	5						GGAGCCCCTGGGAAGTGCTTC	0.493													16	104	---	---	---	---	PASS
NKRF	55922	broad.mit.edu	37	X	118724761	118724761	+	Silent	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118724761C>A	uc004erq.2	-	2	1280	c.627G>T	c.(625-627)GCG>GCT	p.A209A	NKRF_uc004err.2_Silent_p.A209A	NM_017544	NP_060014	O15226	NKRF_HUMAN	transcription factor NRF	209	Active repression domain.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|double-stranded RNA binding			ovary(1)|central_nervous_system(1)	2						TTGTCTTACACGCCTGAATAC	0.353													12	100	---	---	---	---	PASS
NKRF	55922	broad.mit.edu	37	X	118724823	118724823	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118724823C>A	uc004erq.2	-	2	1218	c.565G>T	c.(565-567)GAA>TAA	p.E189*	NKRF_uc004err.2_Nonsense_Mutation_p.E189*	NM_017544	NP_060014	O15226	NKRF_HUMAN	transcription factor NRF	189	Active repression domain.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|double-stranded RNA binding			ovary(1)|central_nervous_system(1)	2						GAAGTCATTTCTGGATTAGAA	0.363													21	142	---	---	---	---	PASS
UPF3B	65109	broad.mit.edu	37	X	118979257	118979257	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118979257G>T	uc004erz.1	-	4	450	c.373C>A	c.(373-375)CAG>AAG	p.Q125K	UPF3B_uc004esa.1_Missense_Mutation_p.Q125K	NM_080632	NP_542199	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B	125	Sufficient for association with EJC core.|Necessary for interaction with UPF2.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(2)|kidney(1)	3						GGATATTCCTGACCTGTTTAG	0.358													13	114	---	---	---	---	PASS
GRIA3	2892	broad.mit.edu	37	X	122598733	122598733	+	Silent	SNP	G	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122598733G>T	uc004etq.3	+	14	2387	c.2094G>T	c.(2092-2094)GTG>GTT	p.V698V	GRIA3_uc004etr.3_Silent_p.V698V|GRIA3_uc004ets.3_RNA	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	698	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	AAATTGCTGTGTACGAGAAAA	0.413													20	171	---	---	---	---	PASS
SPANXN2	494119	broad.mit.edu	37	X	142795238	142795238	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142795238G>A	uc004fbz.2	-	2	1194	c.440C>T	c.(439-441)TCT>TTT	p.S147F		NM_001009615	NP_001009615	Q5MJ10	SPXN2_HUMAN	SPANX-N2 protein	147										ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					CTCCTGTGAAGATCCTTCAGA	0.532													76	628	---	---	---	---	PASS
SPANXN2	494119	broad.mit.edu	37	X	142795316	142795316	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142795316G>A	uc004fbz.2	-	2	1116	c.362C>T	c.(361-363)TCT>TTT	p.S121F		NM_001009615	NP_001009615	Q5MJ10	SPXN2_HUMAN	SPANX-N2 protein	121										ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					CTCCTGTGAAGATCCTTCAGA	0.522													5	423	---	---	---	---	PASS
AFF2	2334	broad.mit.edu	37	X	148037249	148037249	+	Silent	SNP	G	C	C			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148037249G>C	uc004fcp.2	+	11	2153	c.1674G>C	c.(1672-1674)CTG>CTC	p.L558L	AFF2_uc004fcq.2_Silent_p.L548L|AFF2_uc004fcr.2_Silent_p.L519L|AFF2_uc011mxb.1_Silent_p.L523L|AFF2_uc004fcs.2_Silent_p.L525L|AFF2_uc011mxc.1_Silent_p.L199L	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	558					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					CTATTTCTCTGCCTCCTCCAA	0.458													79	558	---	---	---	---	PASS
VMA21	203547	broad.mit.edu	37	X	150573518	150573518	+	Silent	SNP	C	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150573518C>A	uc004feu.2	+	3	370	c.294C>A	c.(292-294)GGC>GGA	p.G98G		NM_001017980	NP_001017980	Q3ZAQ7	VMA21_HUMAN	VMA21 vacuolar H+-ATPase homolog	98					vacuolar proton-transporting V-type ATPase complex assembly	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to membrane|lysosome					0						GGCGTGAAGGCAAACAGGATT	0.423													11	119	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	4204647	4204649	+	IGR	DEL	ACT	-	-	rs61768843		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4204647_4204649delACT								LOC100133612 (370770 upstream) : LOC284661 (267462 downstream)																							caccaccaccactaccacaccac	0.034													5	3	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39833649	39833649	+	Intron	DEL	A	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39833649delA	uc010oiu.1	+						MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			tctcaaaaggaaaaaaaaaaa	0.129													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	110663170	110663172	+	IGR	DEL	CAT	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110663170_110663172delCAT								UBL4B (6602 upstream) : SLC6A17 (29960 downstream)																							ctaccaccaccatcaccatcacc	0.030													4	2	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120612224	120612226	+	5'UTR	DEL	GCC	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612224_120612226delGCC	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGCCGCCTCAGCCGCCGCCCGAA	0.695			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				5	3	---	---	---	---	
SELL	6402	broad.mit.edu	37	1	169670639	169670640	+	Intron	INS	-	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169670639_169670640insT	uc001ggk.2	-						C1orf112_uc001ggj.2_Intron|SELL_uc010pls.1_Intron	NM_000655	NP_000646	P14151	LYAM1_HUMAN	selectin L precursor						blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	integral to plasma membrane	glycosphingolipid binding|heparin binding|protease binding|sugar binding				0	all_hematologic(923;0.208)					CTGTGGGTTTCTTTTTTTTTTC	0.361													5	7	---	---	---	---	
NENF	29937	broad.mit.edu	37	1	212617908	212617911	+	Intron	DEL	TGTA	-	-	rs10590281		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212617908_212617911delTGTA	uc001hjd.2	+						NENF_uc010ptf.1_Intron	NM_013349	NP_037481	Q9UMX5	NENF_HUMAN	neuron derived neurotrophic factor precursor							extracellular space	heme binding				0				all cancers(67;0.00967)|OV - Ovarian serous cystadenocarcinoma(81;0.0108)|GBM - Glioblastoma multiforme(131;0.0325)|Epithelial(68;0.132)		tgtgtgtgtgtgtATCTGGGCAAG	0.162													9	4	---	---	---	---	
B3GALNT2	148789	broad.mit.edu	37	1	235652776	235652776	+	Intron	DEL	T	-	-	rs11299116		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235652776delT	uc001hxc.2	-						B3GALNT2_uc001hxd.1_Intron	NM_152490	NP_689703	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2						protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			breast(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			GCATGAGTCCTTTATTGCAAT	0.338													4	6	---	---	---	---	
B3GALNT2	148789	broad.mit.edu	37	1	235657766	235657766	+	Intron	DEL	T	-	-	rs34730227		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235657766delT	uc001hxc.2	-						B3GALNT2_uc001hxd.1_Intron	NM_152490	NP_689703	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2						protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			breast(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			TTTTCAGAACttttttttttt	0.179													4	3	---	---	---	---	
DDX1	1653	broad.mit.edu	37	2	15757227	15757227	+	Intron	DEL	T	-	-	rs67926060		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15757227delT	uc002rce.2	+						DDX1_uc010yjq.1_Intron	NM_004939	NP_004930	Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1						DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		CTGTAACTCCttttttttttt	0.259													3	3	---	---	---	---	
NFU1	27247	broad.mit.edu	37	2	69627837	69627838	+	Intron	INS	-	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69627837_69627838insT	uc002sfk.2	-						NFU1_uc002sfj.2_Intron|NFU1_uc002sfl.2_Intron|NFU1_uc002sfm.2_Intron|NFU1_uc010fdi.2_Intron|NFU1_uc002sfn.1_Intron	NM_001002755	NP_001002755	Q9UMS0	NFU1_HUMAN	HIRA interacting protein 5 isoform 2						iron-sulfur cluster assembly	cytosol|mitochondrion|nucleus	4 iron, 4 sulfur cluster binding|iron ion binding|protein binding				0						ttagaattaaattttttttttt	0.257													7	5	---	---	---	---	
KDM3A	55818	broad.mit.edu	37	2	86717003	86717004	+	Intron	DEL	TG	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86717003_86717004delTG	uc002sri.3	+						KDM3A_uc010ytj.1_Intron|KDM3A_uc010ytk.1_Intron	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A						androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						CTTTTATGTCTGTGTTTTGTGT	0.366													3	3	---	---	---	---	
NCAPH	23397	broad.mit.edu	37	2	97017424	97017424	+	Intron	DEL	C	-	-	rs772153		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97017424delC	uc002svz.1	+						NCAPH_uc010fhu.1_Intron|NCAPH_uc010fhv.1_Intron|NCAPH_uc010yum.1_Intron|NCAPH_uc010fhw.1_Intron|NCAPH_uc010yun.1_Intron|NCAPH_uc002swa.1_Intron	NM_015341	NP_056156	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|microtubule cytoskeleton|nucleus				urinary_tract(1)|skin(1)	2		Ovarian(717;0.0221)				aaaaaaaaaacaaaaacaaaC	0.189													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235453352	235453353	+	IGR	INS	-	G	G			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235453352_235453353insG								ARL4C (47659 upstream) : SH3BP4 (407275 downstream)																							gaaggaaggaaggaagggaagg	0.000													4	4	---	---	---	---	
MBNL1	4154	broad.mit.edu	37	3	152165233	152165233	+	Intron	DEL	T	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152165233delT	uc003ezm.2	+						MBNL1_uc003ezh.2_Intron|MBNL1_uc003ezi.2_Intron|MBNL1_uc003ezj.2_Intron|MBNL1_uc003ezl.2_Intron|MBNL1_uc003ezp.2_Intron|MBNL1_uc003ezn.2_Intron|MBNL1_uc003ezo.2_Intron|MBNL1_uc010hvp.2_Intron	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c						embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TTTATCTTGCTTTTTTTTTTT	0.328													4	2	---	---	---	---	
QDPR	5860	broad.mit.edu	37	4	17513499	17513499	+	Intron	DEL	C	-	-	rs112530867		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17513499delC	uc003gpd.2	-						QDPR_uc003gpe.2_Intron|QDPR_uc003gpf.2_Intron	NM_000320	NP_000311	P09417	DHPR_HUMAN	quinoid dihydropteridine reductase						dihydrobiopterin metabolic process|L-phenylalanine catabolic process|tetrahydrobiopterin biosynthetic process	cytosol	6,7-dihydropteridine reductase activity|binding|electron carrier activity			ovary(1)	1					NADH(DB00157)	CTCTAGACTGCCCCCCGCCGG	0.677													6	3	---	---	---	---	
PDS5A	23244	broad.mit.edu	37	4	39929903	39929904	+	Intron	DEL	CA	-	-	rs71969631		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39929903_39929904delCA	uc003guv.3	-						PDS5A_uc010ifo.2_Intron|PDS5A_uc003guw.3_Intron	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						CCAGACAGTTCACAGTCAACTT	0.337													2	4	---	---	---	---	
AMBN	258	broad.mit.edu	37	4	71465157	71465157	+	Intron	DEL	A	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71465157delA	uc003hfl.2	+							NM_016519	NP_057603	Q9NP70	AMBN_HUMAN	ameloblastin precursor						bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)			attccatctcaaaaaaaaaaa	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	95332244	95332245	+	IGR	INS	-	AAGG	AAGG	rs141921585	by1000genomes	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95332244_95332245insAAGG								HPGDS (68217 upstream) : PDLIM5 (40793 downstream)																							aaagaaagaaaaaggaaggaag	0.074													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	185899235	185899236	+	IGR	DEL	TA	-	-	rs10545309		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185899235_185899236delTA								ACSL1 (152020 upstream) : HELT (40759 downstream)																							tcacaaagtgtatatatatata	0.035													3	3	---	---	---	---	
CYP4V2	285440	broad.mit.edu	37	4	187118942	187118945	+	Intron	DEL	TATG	-	-	rs144489932		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187118942_187118945delTATG	uc003iyw.3	+							NM_207352	NP_997235	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily v,						response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		acatctagattatgtagtaattta	0.093													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7207149	7207157	+	IGR	DEL	TCCCTTCCT	-	-	rs111399864	byFrequency	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7207149_7207157delTCCCTTCCT								PAPD7 (449988 upstream) : ADCY2 (189186 downstream)																							ccttccttcctcccttccttttcttcctt	0.091													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7990045	7990046	+	IGR	INS	-	CC	CC	rs70940774		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7990045_7990046insCC								MTRR (88812 upstream) : None (None downstream)																							cttccttccttttttttttttt	0.079													4	2	---	---	---	---	
HCN1	348980	broad.mit.edu	37	5	45353110	45353116	+	Intron	DEL	TCTTTAG	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45353110_45353116delTCTTTAG	uc003jok.2	-							NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic							integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						TTTAGGTTTTTCTTTAGAGTAACGTGG	0.304													43	26	---	---	---	---	
MCCC2	64087	broad.mit.edu	37	5	70939896	70939899	+	Intron	DEL	GTGC	-	-	rs71859051		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70939896_70939899delGTGC	uc003kbs.3	+						MCCC2_uc003kbt.3_Intron	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)						leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	gtgtgtgtgtgtgcgcgcgtgtgt	0.201													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	92604392	92604392	+	IGR	DEL	A	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92604392delA								None (None upstream) : FLJ42709 (140673 downstream)																							GCTGATGCGGAAAAAAAAAAA	0.259													3	3	---	---	---	---	
NUDT12	83594	broad.mit.edu	37	5	102886823	102886823	+	Intron	DEL	T	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102886823delT	uc003koi.2	-						NUDT12_uc011cvb.1_Intron	NM_031438	NP_113626	Q9BQG2	NUD12_HUMAN	nudix-type motif 12							nucleus|peroxisome	metal ion binding|NAD+ diphosphatase activity				0		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		ACATGCAAAGttttttttttt	0.139													4	3	---	---	---	---	
HSPA9	3313	broad.mit.edu	37	5	137897634	137897634	+	Intron	DEL	T	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137897634delT	uc003ldf.2	-						HSPA9_uc011cyw.1_Intron|SNORD63_uc003ldg.2_5'Flank	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCAAGAATACttttttttttt	0.174													6	4	---	---	---	---	
TIMD4	91937	broad.mit.edu	37	5	156381896	156381896	+	Intron	DEL	T	-	-	rs71922795		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156381896delT	uc003lwh.2	-						TIMD4_uc010jii.2_Intron	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain							integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ttttctttccttttttttttt	0.164													4	2	---	---	---	---	
XPO5	57510	broad.mit.edu	37	6	43538049	43538049	+	Intron	DEL	A	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43538049delA	uc003ovp.2	-							NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			cctccgtctcaaaaaaaaaaa	0.095													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	98983553	98983554	+	IGR	INS	-	AAGG	AAGG	rs142987745	by1000genomes	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98983553_98983554insAAGG								MIR2113 (511056 upstream) : POU3F2 (299026 downstream)																							cacagagaaaaaaggaaggaag	0.000													3	4	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	144772824	144772824	+	Intron	DEL	T	-	-	rs113888539		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144772824delT	uc003qkt.2	+						UTRN_uc010khq.1_Intron	NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTGGAGGACGTTTTTTTTTTT	0.353													9	4	---	---	---	---	
MTHFD1L	25902	broad.mit.edu	37	6	151204173	151204174	+	Intron	INS	-	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151204173_151204174insT	uc003qob.2	+						MTHFD1L_uc011een.1_Intron|MTHFD1L_uc011eeo.1_Intron|MTHFD1L_uc003qoc.2_Intron|MTHFD1L_uc003qoa.1_Intron|MTHFD1L_uc010kil.1_Intron	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		AGTCTATAGGAttttttttttt	0.124													4	2	---	---	---	---	
NOX3	50508	broad.mit.edu	37	6	155749721	155749722	+	Intron	DEL	TT	-	-	rs111606766		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155749721_155749722delTT	uc003qqm.2	-							NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3								electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TCtttttttctttttttttttt	0.361													5	3	---	---	---	---	
SERAC1	84947	broad.mit.edu	37	6	158579538	158579538	+	Intron	DEL	A	-	-	rs111829898		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158579538delA	uc003qrc.2	-						SERAC1_uc003qrb.2_Intron	NM_032861	NP_116250	Q96JX3	SRAC1_HUMAN	serine active site containing 1						GPI anchor metabolic process|intracellular protein transport	integral to membrane|intrinsic to endoplasmic reticulum membrane	binding|hydrolase activity, acting on ester bonds				0		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		CTTTCCAATTAAAAAAAAAAT	0.294													9	5	---	---	---	---	
THBS2	7058	broad.mit.edu	37	6	169631971	169631972	+	Intron	INS	-	AATG	AATG	rs144146818	by1000genomes	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169631971_169631972insAATG	uc003qwt.2	-							NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor						cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CCCTCCTTCCAAATTCCCTGTG	0.683													6	3	---	---	---	---	
GLCCI1	113263	broad.mit.edu	37	7	8020896	8020899	+	Intron	DEL	TTTC	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8020896_8020899delTTTC	uc003srk.2	+							NM_138426	NP_612435	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1												0		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		tttctctttttttctttctttctt	0.147													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63033168	63033170	+	IGR	DEL	GAG	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63033168_63033170delGAG								LOC100287704 (221017 upstream) : ZNF727 (472651 downstream)																							ggaggaggatgaggaggaggagg	0.286													8	4	---	---	---	---	
TMEM130	222865	broad.mit.edu	37	7	98457692	98457692	+	Intron	DEL	A	-	-	rs67317732		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98457692delA	uc003upo.2	-						TMEM130_uc011kiq.1_Intron|TMEM130_uc011kir.1_Intron|TMEM130_uc003upn.2_Intron	NM_001134450	NP_001127922	Q8N3G9	TM130_HUMAN	transmembrane protein 130 isoform a							Golgi membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			actgcatctcaaaaaaaaaaa	0.249													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	99608922	99608922	+	IGR	DEL	C	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99608922delC								AZGP1 (35235 upstream) : ZKSCAN1 (4297 downstream)																							ttccttccttcccttcccttc	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	27071188	27071189	+	IGR	INS	-	AGGAAGGA	AGGAAGGA			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27071188_27071189insAGGAAGGA								MIR548H-4 (164708 upstream) : STMN4 (22627 downstream)																							GGAAAACaggaaggaaggaagg	0.153													3	3	---	---	---	---	
CA1	759	broad.mit.edu	37	8	86250873	86250874	+	Intron	INS	-	TT	TT			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86250873_86250874insTT	uc003ydh.2	-						CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Intron|CA1_uc003ydi.2_Intron	NM_001738	NP_001729	P00915	CAH1_HUMAN	carbonic anhydrase I						one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)	ttctttctttctttctttcttt	0.084													3	3	---	---	---	---	
RCL1	10171	broad.mit.edu	37	9	4834472	4834473	+	Intron	DEL	TT	-	-	rs144793993		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4834472_4834473delTT	uc003zis.2	+						RCL1_uc003zit.2_Intron|RCL1_uc010mhk.1_Intron	NM_005772	NP_005763	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1						ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		TGAGTCATTCtttttttttttt	0.351													4	2	---	---	---	---	
GATA3	2625	broad.mit.edu	37	10	8106259	8106265	+	Intron	DEL	TCTTTTC	-	-	rs60280763		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8106259_8106265delTCTTTTC	uc001ika.2	+						GATA3_uc001ijz.2_Intron	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2						aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						tttctttctttcttttcttcttcttct	0.329			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	16454800	16454800	+	IGR	DEL	A	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16454800delA								FAM188A (552281 upstream) : PTER (24167 downstream)																							ggaaggaaggaagaaagaaag	0.005													4	2	---	---	---	---	
C10orf11	83938	broad.mit.edu	37	10	77685366	77685367	+	Intron	INS	-	ATGGTGGCAGTGGTGGTGGTA	ATGGTGGCAGTGGTGGTGGTA	rs147511604	by1000genomes	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77685366_77685367insATGGTGGCAGTGGTGGTGGTA	uc001jxi.2	+							NM_032024	NP_114413	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)					GGAAGAAggtgatggtggcagt	0.243													4	2	---	---	---	---	
INSC	387755	broad.mit.edu	37	11	15134194	15134194	+	Intron	DEL	G	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15134194delG	uc001mly.2	+						INSC_uc001mlz.2_5'Flank	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a						cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						ATTGGGAAGTGGGGGGGGGGC	0.398													6	3	---	---	---	---	
EIF3M	10480	broad.mit.edu	37	11	32609935	32609942	+	Intron	DEL	AAAAAAAA	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32609935_32609942delAAAAAAAA	uc001mtu.2	+						EIF3M_uc010ref.1_Intron	NM_006360	NP_006351	Q7L2H7	EIF3M_HUMAN	eukaryotic translation initiation factor 3,							eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)|breast(1)|skin(1)	3	Breast(20;0.109)					acttcatctgaaaaaaaaaaaaaaaaaa	0.125													6	3	---	---	---	---	
GDF3	9573	broad.mit.edu	37	12	7848201	7848201	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7848201delG	uc001qte.2	-	1	160	c.124delC	c.(124-126)CAGfs	p.Q42fs		NM_020634	NP_065685	Q9NR23	GDF3_HUMAN	growth differentiation factor 3 precursor	42					eye development|growth|skeletal system development	extracellular space	cytokine activity|growth factor activity			skin(3)|ovary(1)|lung(1)|central_nervous_system(1)	6						TGGAACTTCTGGGGTGAAGGC	0.483													87	39	---	---	---	---	
BICD1	636	broad.mit.edu	37	12	32520417	32520417	+	Intron	DEL	A	-	-	rs63514564		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32520417delA	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TGTATTTAAGAAAAAAAAAAA	0.303													5	3	---	---	---	---	
SLC2A13	114134	broad.mit.edu	37	12	40153654	40153654	+	3'UTR	DEL	A	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40153654delA	uc010skm.1	-	10					C12orf40_uc009zjv.1_Intron	NM_052885	NP_443117	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose							integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)				TTCCTTGTGGAAAAAAAAAGT	0.299										HNSCC(50;0.14)			0	6	---	---	---	---	
PLXNC1	10154	broad.mit.edu	37	12	94654286	94654286	+	Intron	DEL	A	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94654286delA	uc001tdc.2	+						PLXNC1_uc010sut.1_Intron|PLXNC1_uc009zsv.2_5'Flank	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						TCTAAACattaaaaaaaaaaa	0.438													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132137842	132137845	+	IGR	DEL	TGTT	-	-	rs67171823	by1000genomes	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132137842_132137845delTGTT								LOC116437 (440367 upstream) : SFRS8 (57790 downstream)																							CCCAgtgtgatgtttgtgtgtgtg	0.162													4	3	---	---	---	---	
CPB2	1361	broad.mit.edu	37	13	46641324	46641325	+	Intron	INS	-	A	A	rs149303629	by1000genomes	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46641324_46641325insA	uc001vaw.2	-						uc001vau.1_Intron|uc001vav.1_Intron|CPB2_uc001vax.2_Intron	NM_001872	NP_001863	Q96IY4	CBPB2_HUMAN	plasma carboxypeptidase B2 isoform a						blood coagulation|fibrinolysis|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		Caataaaagttaaaaaaaatta	0.158													3	4	---	---	---	---	
ING1	3621	broad.mit.edu	37	13	111367630	111367630	+	5'UTR	DEL	A	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111367630delA	uc001vri.2	+	1					CARS2_uc010tjm.1_5'Flank|uc001vre.2_5'Flank|ING1_uc001vrf.2_Intron|ING1_uc001vrg.2_Intron|ING1_uc001vrh.2_Intron	NM_005537	NP_005528	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1 isoform D						cell cycle|negative regulation of cell growth|negative regulation of cell proliferation	nucleus	zinc ion binding			ovary(1)	1	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGGTGGGGGCAAAAAAAAAAA	0.517													5	3	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92347465	92347472	+	Intron	DEL	ACACACAC	-	-	rs140834248	by1000genomes	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92347465_92347472delACACACAC	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				GTTCTATTCTacacacacacacacacac	0.207													4	8	---	---	---	---	
ATP10A	57194	broad.mit.edu	37	15	25953620	25953621	+	Intron	INS	-	ATGCAA	ATGCAA	rs151256521	by1000genomes	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25953620_25953621insATGCAA	uc010ayu.2	-							NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A						ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GTCTCATCAATATGTTTGACTG	0.183													5	4	---	---	---	---	
NDRG4	65009	broad.mit.edu	37	16	58540038	58540039	+	Intron	DEL	GT	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58540038_58540039delGT	uc002eno.2	+						NDRG4_uc002enk.2_Intron|NDRG4_uc002enm.2_Intron|NDRG4_uc010vif.1_Intron|NDRG4_uc010cdk.2_Intron|NDRG4_uc010vig.1_Intron|NDRG4_uc010vih.1_Intron|NDRG4_uc010vii.1_Intron|NDRG4_uc002enp.2_Intron|NDRG4_uc002enq.1_5'UTR	NM_022910	NP_075061	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 1						cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1						TTGAAAGAGCgtgtgtgtgtgt	0.262													3	3	---	---	---	---	
CRISPLD2	83716	broad.mit.edu	37	16	84923191	84923192	+	Intron	INS	-	AA	AA	rs139008924	by1000genomes	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84923191_84923192insAA	uc010voh.1	+						CRISPLD2_uc010vog.1_Intron|CRISPLD2_uc002fio.2_Intron	NM_031476	NP_113664	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain							extracellular region|transport vesicle					0						TTGGGATTAAGAAAAAAAAAAG	0.198													6	3	---	---	---	---	
EPN3	55040	broad.mit.edu	37	17	48617904	48617904	+	Intron	DEL	A	-	-	rs66736597		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48617904delA	uc002ira.3	+						SPATA20_uc002irc.2_5'Flank|EPN3_uc010wms.1_Intron|EPN3_uc010wmt.1_Intron|EPN3_uc010wmu.1_Intron	NM_017957	NP_060427	Q9H201	EPN3_HUMAN	epsin 3							clathrin-coated vesicle|nucleus|perinuclear region of cytoplasm	lipid binding			ovary(1)	1	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			GAAACGCAGCAAAATGTTCTC	0.577													3	3	---	---	---	---	
MARCH10	162333	broad.mit.edu	37	17	60878821	60878821	+	Intron	DEL	T	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60878821delT	uc010ddr.2	-						MARCH10_uc002jag.3_Intron|MARCH10_uc010dds.2_Intron|MARCH10_uc002jah.2_Intron	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190								ligase activity|zinc ion binding				0						gctatccccgttttttttttt	0.035													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	110304	110304	+	Intron	DEL	G	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:110304delG	uc002kke.2	+											Homo sapiens Rho-associated, coiled-coil containing protein kinase 1, mRNA (cDNA clone IMAGE:5269982), complete cds.																		actctgcctagagggggattt	0.000													4	2	---	---	---	---	
CDH2	1000	broad.mit.edu	37	18	25562696	25562697	+	Intron	INS	-	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25562696_25562697insT	uc002kwg.2	-						CDH2_uc010xbn.1_Intron	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein						adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						GAAACAAGGTGTTTTTTTTTTT	0.248													3	3	---	---	---	---	
SBNO2	22904	broad.mit.edu	37	19	1164488	1164488	+	Intron	DEL	A	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1164488delA	uc002lrk.3	-						SBNO2_uc010dse.2_Intron	NM_014963	NP_055778	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 isoform 1						macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		cccagatgccaggggcagtgg	0.109													2	4	---	---	---	---	
GMIP	51291	broad.mit.edu	37	19	19749401	19749401	+	Intron	DEL	T	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19749401delT	uc002nnd.2	-						GMIP_uc010xrb.1_Intron|GMIP_uc010xrc.1_Intron	NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein						negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1						CTGGACTCTAttttttttttt	0.299													5	3	---	---	---	---	
RYR1	6261	broad.mit.edu	37	19	39009568	39009568	+	Intron	DEL	A	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39009568delA	uc002oit.2	+						RYR1_uc002oiu.2_Intron|RYR1_uc002oiv.1_Intron|RYR1_uc010xuf.1_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	actctgtctcaaaaaaaaaaa	0.249													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42107414	42107415	+	IGR	DEL	CA	-	-	rs72172011		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107414_42107415delCA								CEACAM21 (14218 upstream) : CEACAM4 (17929 downstream)																							Gacacgcacgcacgcgcgcgcg	0.183													6	4	---	---	---	---	
LILRA5	353514	broad.mit.edu	37	19	54818526	54818526	+	3'UTR	DEL	A	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54818526delA	uc002qfe.2	-	7						NM_021250	NP_067073	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor subfamily						innate immune response	extracellular region|integral to membrane	receptor activity			upper_aerodigestive_tract(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		actccatctcaaaaaaaaaaa	0.124													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	32823673	32823680	+	IGR	DEL	AAGGAAGG	-	-	rs71337945		TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32823673_32823680delAAGGAAGG								EIF2S2 (123588 upstream) : ASIP (24491 downstream)																							gaaggaaggaaaggaaggaaggaaggaa	0.000													2	5	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	40739003	40739003	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40739003delG	uc002xkg.2	-	23	3408	c.3224delC	c.(3223-3225)CCGfs	p.P1075fs	PTPRT_uc010ggj.2_Frame_Shift_Del_p.P1094fs|PTPRT_uc010ggi.2_Frame_Shift_Del_p.P278fs	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1075	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CCCAGCTTCCGGGGGGTTGAG	0.453													80	41	---	---	---	---	
ATP9A	10079	broad.mit.edu	37	20	50292847	50292848	+	Intron	INS	-	T	T			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50292847_50292848insT	uc002xwg.1	-						ATP9A_uc010gih.1_Intron|ATP9A_uc002xwf.1_Intron	NM_006045	NP_006036	O75110	ATP9A_HUMAN	ATPase, class II, type 9A						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4						AGACTGGGttcttttttttttt	0.149													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	62118476	62118476	+	IGR	DEL	C	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62118476delC								KCNQ2 (14483 upstream) : EEF1A2 (890 downstream)																							CTCCACCCAACCCTCCTCTGC	0.657													4	3	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53652829	53652852	+	Intron	DEL	GCCGGGGCCGGGGCCGGGGCCGGT	-	-	rs78801842	by1000genomes	TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53652829_53652852delGCCGGGGCCGGGGCCGGGGCCGGT	uc004dsp.2	-							NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						cggggccggggccggggccggggccggggccggtgccgggactg	0.219													6	9	---	---	---	---	
ATRX	546	broad.mit.edu	37	X	76907987	76907988	+	Intron	INS	-	A	A			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76907987_76907988insA	uc004ecp.3	-						ATRX_uc004ecq.3_Intron|ATRX_uc004eco.3_Intron	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1						DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	agagtagtattaaaaaaaaaaa	0.064			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						4	2	---	---	---	---	
PRPS1	5631	broad.mit.edu	37	X	106891164	106891164	+	Intron	DEL	T	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106891164delT	uc004ene.3	+						PRPS1_uc010npg.2_Intron|PRPS1_uc011msj.1_Intron	NM_002764	NP_002755	P60891	PRPS1_HUMAN	phosphoribosyl pyrophosphate synthetase 1						5-phosphoribose 1-diphosphate biosynthetic process|hypoxanthine biosynthetic process|nervous system development|nucleoside metabolic process|purine nucleotide biosynthetic process|pyrimidine nucleotide biosynthetic process|ribonucleoside monophosphate biosynthetic process|urate biosynthetic process	cytosol	ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			breast(3)|large_intestine(1)	4						TTTCTTTTCCTTTTTTTTTTT	0.289													4	2	---	---	---	---	
RBMX2	51634	broad.mit.edu	37	X	129546064	129546064	+	Intron	DEL	T	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129546064delT	uc004evt.2	+							NM_016024	NP_057108	Q9Y388	RBMX2_HUMAN	RNA binding motif protein, X-linked 2								nucleotide binding|RNA binding			breast(3)|ovary(1)	4						acccggctaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13483364	13483364	+	IGR	DEL	T	-	-			TCGA-22-1012-01	TCGA-22-1012-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13483364delT								None (None upstream) : None (None downstream)																							tctgtcacaattcccctttag	0.000													7	4	---	---	---	---	
