Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PUSL1	126789	broad.mit.edu	37	1	1246036	1246036	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1246036G>C	uc001aed.2	+	6	697	c.667G>C	c.(667-669)GAG>CAG	p.E223Q	ACAP3_uc001aeb.2_5'Flank|ACAP3_uc001aec.1_5'Flank|PUSL1_uc010nyi.1_Missense_Mutation_p.E62Q|PUSL1_uc009vjx.2_Missense_Mutation_p.E24Q	NM_153339	NP_699170	Q8N0Z8	PUSL1_HUMAN	pseudouridylate synthase-like 1	223					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			skin(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.95e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CTGGAACCTGGAGTTTGAGAG	0.587													5	155	---	---	---	---	PASS
PAFAH2	5051	broad.mit.edu	37	1	26310425	26310425	+	Intron	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26310425G>A	uc001bld.3	-						PAFAH2_uc001ble.3_Intron	NM_000437	NP_000428	Q99487	PAFA2_HUMAN	platelet-activating factor acetylhydrolase 2						lipid catabolic process	cytoplasm	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding			ovary(2)	2		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)		TCCCCAACTGGCACAAACTTA	0.473													3	58	---	---	---	---	PASS
AHDC1	27245	broad.mit.edu	37	1	27878009	27878009	+	Silent	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27878009G>A	uc009vsy.2	-	6	1587	c.618C>T	c.(616-618)GAC>GAT	p.D206D	AHDC1_uc009vsz.1_Silent_p.D206D|AHDC1_uc001boh.1_Silent_p.D79D	NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	206	Pro-rich.						DNA binding			central_nervous_system(1)	1		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GCTGGGGACTGTCCCTAGGCT	0.667													8	29	---	---	---	---	PASS
KIF2C	11004	broad.mit.edu	37	1	45232580	45232580	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45232580C>G	uc001cmg.3	+	20	2169	c.2054C>G	c.(2053-2055)TCT>TGT	p.S685C	KIF2C_uc010olb.1_Missense_Mutation_p.S644C|KIF2C_uc010olc.1_Missense_Mutation_p.S572C|KIF2C_uc001cmh.3_Missense_Mutation_p.S631C	NM_006845	NP_006836	Q99661	KIF2C_HUMAN	kinesin family member 2C	685					blood coagulation|cell division|cell proliferation|chromosome segregation|establishment or maintenance of microtubule cytoskeleton polarity|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|kinesin complex|microtubule|nucleus	ATP binding|centromeric DNA binding|microtubule motor activity|microtubule plus-end binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					AAAGCGGAATCTGCTCTGGCC	0.587													18	34	---	---	---	---	PASS
KIF2C	11004	broad.mit.edu	37	1	45232776	45232776	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45232776C>G	uc001cmg.3	+	21	2218	c.2103C>G	c.(2101-2103)ATC>ATG	p.I701M	KIF2C_uc010olb.1_Missense_Mutation_p.I660M|KIF2C_uc010olc.1_Missense_Mutation_p.I588M|KIF2C_uc001cmh.3_Missense_Mutation_p.I647M	NM_006845	NP_006836	Q99661	KIF2C_HUMAN	kinesin family member 2C	701					blood coagulation|cell division|cell proliferation|chromosome segregation|establishment or maintenance of microtubule cytoskeleton polarity|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|kinesin complex|microtubule|nucleus	ATP binding|centromeric DNA binding|microtubule motor activity|microtubule plus-end binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					CAGATGTCATCAAGGCCTTGC	0.542													23	44	---	---	---	---	PASS
NOTCH2NL	388677	broad.mit.edu	37	1	145282031	145282031	+	Nonstop_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145282031G>C	uc001emn.3	+	5	1081	c.711G>C	c.(709-711)TAG>TAC	p.*237Y	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NOTCH2NL_uc001emm.3_Nonstop_Mutation_p.*237Y|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_203458	NP_982283	Q7Z3S9	NT2NL_HUMAN	Notch homolog 2 N-terminal like protein	237					cell differentiation|multicellular organismal development|Notch signaling pathway	cytoplasm|extracellular region	calcium ion binding			ovary(1)	1						ATGAGAATTAGACACTGGAAA	0.368													6	71	---	---	---	---	PASS
INTS3	65123	broad.mit.edu	37	1	153735786	153735786	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153735786G>C	uc009wom.2	+	17	1935	c.1714G>C	c.(1714-1716)GAC>CAC	p.D572H	INTS3_uc001fct.2_Missense_Mutation_p.D572H|INTS3_uc001fcu.2_Missense_Mutation_p.D264H|INTS3_uc001fcv.2_Missense_Mutation_p.D366H|INTS3_uc010peb.1_Missense_Mutation_p.D366H|INTS3_uc001fcw.2_Missense_Mutation_p.D85H|INTS3_uc010pec.1_Missense_Mutation_p.D85H	NM_023015	NP_075391	Q68E01	INT3_HUMAN	integrator complex subunit 3	573					DNA repair|G2/M transition checkpoint|response to ionizing radiation|snRNA processing	integrator complex|SOSS complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCCTTACCTTGACCAGTTGGA	0.517													58	71	---	---	---	---	PASS
ATP1A4	480	broad.mit.edu	37	1	160136391	160136391	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160136391C>T	uc001fve.3	+	8	1600	c.1121C>T	c.(1120-1122)ACG>ATG	p.T374M	ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_Translation_Start_Site	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	374	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCGGTGGAGACGCTGGGCTCC	0.582													15	45	---	---	---	---	PASS
PBX1	5087	broad.mit.edu	37	1	164781371	164781371	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164781371A>G	uc001gct.2	+	6	1240	c.982A>G	c.(982-984)ACT>GCT	p.T328A	PBX1_uc010pku.1_Missense_Mutation_p.T328A|PBX1_uc010pkv.1_Missense_Mutation_p.T245A|PBX1_uc001gcs.2_Missense_Mutation_p.T328A|PBX1_uc010pkw.1_Missense_Mutation_p.T218A	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	328					negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						CTCGCCCTCAACTCCCAACTC	0.438			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								6	49	---	---	---	---	PASS
SLC9A11	284525	broad.mit.edu	37	1	173486811	173486811	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173486811C>A	uc001giz.2	-	23	3195	c.2772G>T	c.(2770-2772)GAG>GAT	p.E924D	SLC9A11_uc009wwe.2_Missense_Mutation_p.E482D	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11	924	cNMP.				sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						TTTGATTACTCTCTATTCCAA	0.393													4	115	---	---	---	---	PASS
ZNF238	10472	broad.mit.edu	37	1	244218145	244218145	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244218145G>T	uc001iae.2	+	1	1564	c.1042G>T	c.(1042-1044)GAG>TAG	p.E348*	ZNF238_uc001iad.3_Nonsense_Mutation_p.E357*|ZNF238_uc001iaf.1_3'UTR	NM_006352	NP_006343	Q99592	ZN238_HUMAN	zinc finger protein 238 isoform 2	348	Interaction with DNMT3A.				negative regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|pancreas(2)	5	all_cancers(71;6.42e-05)|all_epithelial(71;7e-05)|Breast(184;0.0333)|Ovarian(71;0.0619)|all_lung(81;0.089)|all_neural(11;0.101)|Lung NSC(105;0.123)		all cancers(7;1.35e-08)|GBM - Glioblastoma multiforme(7;1e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00223)			TGTCCAGGTGGAGGGAGGCAT	0.622													23	23	---	---	---	---	PASS
TTC15	51112	broad.mit.edu	37	2	3392130	3392130	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3392130G>A	uc002qxm.1	+	2	942	c.736G>A	c.(736-738)GCC>ACC	p.A246T	TTC15_uc002qxn.1_Missense_Mutation_p.A246T|TTC15_uc010ewm.1_Missense_Mutation_p.A246T|TTC15_uc002qxl.1_Missense_Mutation_p.A246T	NM_016030	NP_057114	Q8WVT3	TTC15_HUMAN	tetratricopeptide repeat domain 15	246							binding			ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.214)		OV - Ovarian serous cystadenocarcinoma(76;0.0402)|Epithelial(75;0.0986)|all cancers(51;0.149)		cccggcccccgccagcccgcc	0.577													6	2	---	---	---	---	PASS
EMILIN1	11117	broad.mit.edu	37	2	27303628	27303628	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27303628C>T	uc002rii.3	+	3	747	c.319C>T	c.(319-321)CGT>TGT	p.R107C	EMILIN1_uc010eyq.1_Missense_Mutation_p.R107C|EMILIN1_uc002rik.3_5'Flank	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1 precursor	107	EMI.				cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCTCGCTACCGTGTGGCCTA	0.637											OREG0014513	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	19	---	---	---	---	PASS
ALK	238	broad.mit.edu	37	2	29917801	29917801	+	Silent	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29917801G>A	uc002rmy.2	-	3	1774	c.867C>T	c.(865-867)TCC>TCT	p.S289S		NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	289	MAM 1.|Extracellular (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	TGCGGCGCCAGGACCAGCTCT	0.602			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				4	88	---	---	---	---	PASS
FSHR	2492	broad.mit.edu	37	2	49381444	49381444	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49381444G>C	uc002rww.2	-	1	187	c.113C>G	c.(112-114)ACA>AGA	p.T38R	FSHR_uc002rwx.2_Missense_Mutation_p.T38R|FSHR_uc010fbn.2_Missense_Mutation_p.T38R|FSHR_uc010fbo.1_RNA	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	38	LRRNT.|Extracellular (Potential).				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	AGGAATCTCTGTCACCTTGCT	0.502									Gonadal_Dysgenesis_46_XX				14	28	---	---	---	---	PASS
ERLEC1	27248	broad.mit.edu	37	2	54014505	54014505	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54014505C>G	uc002rxl.2	+	1	438	c.158C>G	c.(157-159)TCT>TGT	p.S53C	ASB3_uc002rxg.1_5'Flank|ASB3_uc002rxh.1_5'Flank|ASB3_uc002rxi.3_Intron|ASB3_uc010yoo.1_5'Flank|ERLEC1_uc002rxm.2_Missense_Mutation_p.S53C|ERLEC1_uc002rxn.2_Missense_Mutation_p.S53C	NM_015701	NP_056516	Q96DZ1	ERLEC_HUMAN	erlectin isoform 1	53					ER-associated protein catabolic process	endoplasmic reticulum lumen	glycoprotein binding|protein binding			ovary(2)	2						ACCGAGTTCTCTCTGGTCAGT	0.622													18	44	---	---	---	---	PASS
ADD2	119	broad.mit.edu	37	2	70933547	70933547	+	5'UTR	SNP	G	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70933547G>T	uc002sgz.2	-	3					ADD2_uc010fds.1_RNA|ADD2_uc002sgy.2_5'UTR|ADD2_uc002sha.2_5'UTR|ADD2_uc002sgx.2_5'UTR|ADD2_uc010fdt.1_5'UTR|ADD2_uc002shc.1_5'UTR|ADD2_uc002shd.1_5'UTR|ADD2_uc010fdu.1_Silent_p.T14T	NM_001617	NP_001608	P35612	ADDB_HUMAN	adducin 2 isoform a						actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding			ovary(2)|pancreas(1)	3						TCATTTTCCCGGTGGGTTTGC	0.617													21	31	---	---	---	---	PASS
HTRA2	27429	broad.mit.edu	37	2	74757203	74757203	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74757203C>T	uc002smi.1	+	1	672	c.70C>T	c.(70-72)CGC>TGC	p.R24C	AUP1_uc002sme.2_5'Flank|AUP1_uc002smf.2_5'Flank|AUP1_uc002smg.2_5'Flank|AUP1_uc002smh.2_5'Flank|AUP1_uc010yrx.1_5'Flank|AUP1_uc010yry.1_5'Flank|HTRA2_uc002smj.1_Missense_Mutation_p.R24C|HTRA2_uc002smk.1_Missense_Mutation_p.R24C|HTRA2_uc002sml.1_Missense_Mutation_p.R24C|HTRA2_uc002smm.1_Intron|HTRA2_uc002smn.1_Intron|HTRA2_uc010ffl.2_5'Flank	NM_013247	NP_037379	O43464	HTRA2_HUMAN	HtrA serine peptidase 2 isoform 1 preproprotein	24					apoptosis|proteolysis|response to stress	CD40 receptor complex|endoplasmic reticulum membrane|internal side of plasma membrane|mitochondrial intermembrane space|mitochondrial membrane|nucleus	serine-type endopeptidase activity|unfolded protein binding			ovary(1)	1						GGGGGGCATTCGCTGGGGGAG	0.711													13	28	---	---	---	---	PASS
FABP1	2168	broad.mit.edu	37	2	88427470	88427470	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88427470C>T	uc002sst.1	-	1	109	c.67G>A	c.(67-69)GGT>AGT	p.G23S	FABP1_uc002ssu.2_Missense_Mutation_p.G23S	NM_001443	NP_001434	P07148	FABPL_HUMAN	fatty acid binding protein 1, liver	23					organ morphogenesis						0						CAGCACTCACCGATTGCCTTC	0.517													38	90	---	---	---	---	PASS
FHL2	2274	broad.mit.edu	37	2	105990063	105990063	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105990063T>C	uc002tcu.2	-	3	621	c.284A>G	c.(283-285)AAC>AGC	p.N95S	FHL2_uc002tdc.2_Intron|FHL2_uc002tdd.2_Missense_Mutation_p.N95S|FHL2_uc002tcv.2_Missense_Mutation_p.N95S|FHL2_uc002tcw.2_Missense_Mutation_p.N95S|FHL2_uc002tcx.2_Missense_Mutation_p.N95S|FHL2_uc010fje.2_Intron|FHL2_uc002tcy.2_Missense_Mutation_p.N95S|FHL2_uc002tcz.2_Missense_Mutation_p.N205S|FHL2_uc002tda.2_Intron|FHL2_uc002tdb.2_Missense_Mutation_p.N211S|FHL2_uc002tde.1_Missense_Mutation_p.N188S	NM_201557	NP_963851	Q14192	FHL2_HUMAN	four and a half LIM domains 2	95					androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription, DNA-dependent|response to hormone stimulus|transcription, DNA-dependent	actin cytoskeleton|focal adhesion|nucleus	androgen receptor binding|identical protein binding|transcription coactivator activity|zinc ion binding			ovary(1)	1						TGAGTACTCGTTGGAATAGCA	0.532													6	28	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131520797	131520797	+	Silent	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131520797C>T	uc002trw.2	+	2	1342	c.1152C>T	c.(1150-1152)GAC>GAT	p.D384D	FAM123C_uc010fmv.2_Silent_p.D384D|FAM123C_uc010fms.1_Silent_p.D384D|FAM123C_uc010fmt.1_Silent_p.D384D|FAM123C_uc010fmu.1_Silent_p.D384D	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	384										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		CCACAAGTGACGAGGGCTACT	0.627													11	28	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098810	178098810	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098810C>G	uc002ulh.3	-	2	790	c.235G>C	c.(235-237)GAG>CAG	p.E79Q	NFE2L2_uc002ulg.3_Missense_Mutation_p.E63Q|NFE2L2_uc010zfa.1_Missense_Mutation_p.E63Q|NFE2L2_uc002uli.3_Missense_Mutation_p.E63Q|NFE2L2_uc010fra.2_Missense_Mutation_p.E63Q|NFE2L2_uc010frb.2_Missense_Mutation_p.E63Q	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	79					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TCACCTGTCTCTTCATCTAGT	0.443			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			19	55	---	---	---	---	PASS
AGPS	8540	broad.mit.edu	37	2	178402887	178402887	+	Silent	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178402887C>T	uc002ull.2	+	20	1988	c.1941C>T	c.(1939-1941)GAC>GAT	p.D647D	AGPS_uc010zfb.1_Silent_p.D557D	NM_003659	NP_003650	O00116	ADAS_HUMAN	alkyldihydroxyacetone phosphate synthase	647					ether lipid biosynthetic process	peroxisomal matrix|peroxisomal membrane|plasma membrane	alkylglycerone-phosphate synthase activity|flavin adenine dinucleotide binding|oxidoreductase activity			ovary(2)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			AATATGTGGACCCCAATAACA	0.348													6	133	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179579026	179579026	+	Silent	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179579026G>A	uc010zfg.1	-	88	22967	c.22743C>T	c.(22741-22743)TCC>TCT	p.S7581S	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.S4242S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8508							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACCGAGAACGGATAGCGTGG	0.398													4	173	---	---	---	---	PASS
CCNYL1	151195	broad.mit.edu	37	2	208611876	208611876	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208611876G>A	uc002vci.2	+	6	949	c.592G>A	c.(592-594)GAT>AAT	p.D198N	CCNYL1_uc002vch.2_Missense_Mutation_p.D179N	NM_001142300	NP_001135772	Q8N7R7	CCYL1_HUMAN	cyclin Y-like 1 isoform 1	249	Cyclin N-terminal.				regulation of cyclin-dependent protein kinase activity		protein kinase binding				0				LUSC - Lung squamous cell carcinoma(261;0.0731)|Epithelial(149;0.139)|Lung(261;0.14)		GGTTTGGGACGATCAGGCTGT	0.428													15	45	---	---	---	---	PASS
GLB1L	79411	broad.mit.edu	37	2	220103867	220103867	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220103867C>G	uc002vkm.2	-	11	1248	c.1009G>C	c.(1009-1011)GAA>CAA	p.E337Q	GLB1L_uc002vkk.2_Missense_Mutation_p.E94Q|GLB1L_uc010zkx.1_Missense_Mutation_p.E247Q|GLB1L_uc002vkn.2_Missense_Mutation_p.E337Q	NM_024506	NP_078782	Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like precursor	337					carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds				0		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCCCTGCTTCAGATATAGGT	0.423													14	42	---	---	---	---	PASS
NUP210	23225	broad.mit.edu	37	3	13417073	13417073	+	Silent	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13417073G>A	uc003bxv.1	-	11	1445	c.1362C>T	c.(1360-1362)ATC>ATT	p.I454I	NUP210_uc003bxx.2_Silent_p.I126I	NM_024923	NP_079199	Q8TEM1	PO210_HUMAN	nucleoporin 210 precursor	454	Lumenal (Probable).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11	all_neural(104;0.187)					GATACAGGGTGATCGGGATGT	0.542													20	99	---	---	---	---	PASS
CLASP2	23122	broad.mit.edu	37	3	33617711	33617711	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33617711G>A	uc003cfu.2	-	24	2758	c.2404C>T	c.(2404-2406)CGA>TGA	p.R802*	CLASP2_uc003cfs.2_Nonsense_Mutation_p.R2*|CLASP2_uc003cft.2_RNA|CLASP2_uc010hgb.2_RNA|CLASP2_uc011axt.1_Nonsense_Mutation_p.R395*	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2	803										ovary(3)|central_nervous_system(1)	4						TTCAGGACTCGCATGGCACTA	0.423													3	28	---	---	---	---	PASS
NPFFR2	10886	broad.mit.edu	37	4	73013431	73013431	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73013431C>G	uc003hgg.2	+	4	1569	c.1471C>G	c.(1471-1473)CAT>GAT	p.H491D	NPFFR2_uc010iig.1_Missense_Mutation_p.H273D|NPFFR2_uc003hgi.2_Missense_Mutation_p.H392D|NPFFR2_uc003hgh.2_Missense_Mutation_p.H389D|NPFFR2_uc003hgj.2_RNA	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2 isoform 1	491	Cytoplasmic (Potential).				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			TCAAAACCCTCATGGGGAAAC	0.378													17	34	---	---	---	---	PASS
ANKRD17	26057	broad.mit.edu	37	4	73943167	73943167	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73943167G>C	uc003hgp.2	-	32	7609	c.7492C>G	c.(7492-7494)CAA>GAA	p.Q2498E	ANKRD17_uc003hgo.2_Missense_Mutation_p.Q2385E|ANKRD17_uc003hgq.2_Missense_Mutation_p.Q2247E|ANKRD17_uc003hgr.2_Missense_Mutation_p.Q2497E	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	2498					interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCCATTGCTTGATGTTGTGAA	0.453													30	57	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94145893	94145893	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94145893G>T	uc011cdt.1	+	7	1350	c.1092G>T	c.(1090-1092)CAG>CAT	p.Q364H	GRID2_uc011cdu.1_Missense_Mutation_p.Q269H|GRID2_uc010ikz.1_Missense_Mutation_p.Q45H	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	364	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	AGCCCTGGCAGGGTGGGCGCT	0.408													9	18	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123178555	123178555	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123178555T>A	uc003ieh.2	+	39	6569	c.6524T>A	c.(6523-6525)ATG>AAG	p.M2175K	KIAA1109_uc003iel.1_Missense_Mutation_p.M110K|KIAA1109_uc003iek.2_Missense_Mutation_p.M794K	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	2175					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						CAAATAGCTATGGACCATGAA	0.463													28	92	---	---	---	---	PASS
TLL1	7092	broad.mit.edu	37	4	167022040	167022040	+	3'UTR	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167022040C>T	uc003irh.1	+	21					TLL1_uc011cjn.1_3'UTR|TLL1_uc011cjo.1_3'UTR	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor						cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		ACCAAAACCTCTGTCAGAACA	0.318													6	21	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13841159	13841159	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13841159G>C	uc003jfd.2	-	34	5607	c.5565C>G	c.(5563-5565)ATC>ATG	p.I1855M		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1855	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TTTTCTGCATGATTTTTTTAT	0.403									Kartagener_syndrome				18	94	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13920702	13920702	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13920702G>A	uc003jfd.2	-	6	727	c.685C>T	c.(685-687)CTT>TTT	p.L229F	DNAH5_uc003jfe.1_RNA	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	229	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TTCAGTTCAAGTATGTCACAC	0.378									Kartagener_syndrome				13	79	---	---	---	---	PASS
SPEF2	79925	broad.mit.edu	37	5	35740042	35740042	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35740042C>T	uc003jjo.2	+	22	3196	c.3085C>T	c.(3085-3087)CCT>TCT	p.P1029S	SPEF2_uc003jjp.1_Missense_Mutation_p.P515S	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	1029					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GTTTTTAGTACCTTACTGGGA	0.348													12	65	---	---	---	---	PASS
NKX2-5	1482	broad.mit.edu	37	5	172659789	172659789	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172659789T>G	uc003mcm.1	-	2	934	c.758A>C	c.(757-759)TAC>TCC	p.Y253S		NM_004387	NP_004378	P52952	NKX25_HUMAN	NK2 transcription factor related, locus 5	253	Ala/Pro-rich.				adult heart development|atrial cardiac muscle cell development|atrial septum morphogenesis|heart looping|hemopoiesis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell apoptosis|negative regulation of myotube differentiation|negative regulation of transcription from RNA polymerase II promoter|outflow tract septum morphogenesis|pharyngeal system development|positive regulation of calcium ion transport via voltage-gated calcium channel activity|positive regulation of cardioblast differentiation|positive regulation of cell proliferation|positive regulation of heart contraction|positive regulation of neuron differentiation|positive regulation of sodium ion transport|positive regulation of survival gene product expression|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription via serum response element binding|regulation of cardiac muscle contraction|right ventricular cardiac muscle tissue morphogenesis|septum secundum development|spleen development|thyroid gland development|vasculogenesis|ventricular septum morphogenesis		chromatin binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|serum response element binding|transcription factor binding			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ATAGGCGGGGTAGGCGTTATA	0.706													5	8	---	---	---	---	PASS
DDR1	780	broad.mit.edu	37	6	30856735	30856735	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30856735G>A	uc003nrr.2	+	4	395	c.136G>A	c.(136-138)GAC>AAC	p.D46N	DDR1_uc010jse.2_Missense_Mutation_p.D46N|DDR1_uc003nrq.2_Missense_Mutation_p.D46N|DDR1_uc003nrs.2_Missense_Mutation_p.D46N|DDR1_uc003nrt.2_Missense_Mutation_p.D46N|DDR1_uc011dms.1_Missense_Mutation_p.D64N|DDR1_uc011dmt.1_Missense_Mutation_p.D72N|DDR1_uc003nru.2_Missense_Mutation_p.D46N|DDR1_uc011dmu.1_Missense_Mutation_p.D46N|DDR1_uc003nrv.2_Missense_Mutation_p.D46N|DDR1_uc003nrw.1_5'Flank	NM_013993	NP_054699	Q08345	DDR1_HUMAN	discoidin domain receptor family, member 1	46	Extracellular (Potential).|F5/8 type C.				cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane	ATP binding|protein binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|central_nervous_system(3)|large_intestine(1)|ovary(1)	9					Imatinib(DB00619)	CCCAGACAGTGACATCTCTGC	0.592													9	18	---	---	---	---	PASS
IP6K3	117283	broad.mit.edu	37	6	33694687	33694687	+	Intron	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33694687C>T	uc010jvf.2	-						IP6K3_uc003ofb.2_Intron	NM_001142883	NP_001136355	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3						inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|protein phosphorylation	cytoplasm	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol hexakisphosphate 6-kinase activity|inositol trisphosphate 3-kinase activity				0						GGCCGGGCTGCGGCGGAGTGG	0.637													3	63	---	---	---	---	PASS
CCND3	896	broad.mit.edu	37	6	42016369	42016369	+	5'UTR	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42016369C>T	uc003orp.2	-	1					CCND3_uc011duk.1_5'UTR|CCND3_uc011dum.1_5'UTR|TAF8_uc003orr.2_5'Flank|TAF8_uc003ors.2_5'Flank|TAF8_uc003ort.2_5'Flank|TAF8_uc003oru.1_5'Flank|TAF8_uc003orv.1_5'Flank|TAF8_uc011dun.1_5'Flank	NM_001136017	NP_001129489	P30281	CCND3_HUMAN	cyclin D3 isoform 1						cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding				0	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TTGCACCTCTCCCCCCCGGCC	0.692			T	IGH@	MM								5	13	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	161026228	161026228	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161026228T>C	uc003qtl.2	-	19	2915	c.2795A>G	c.(2794-2796)GAG>GGG	p.E932G		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3440	Kringle 31.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	AGGCCTTTGCTCAGTTGGTGC	0.443													4	229	---	---	---	---	PASS
C7orf31	136895	broad.mit.edu	37	7	25208096	25208096	+	Intron	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25208096G>C	uc003sxn.1	-							NM_138811	NP_620166	Q8N865	CG031_HUMAN	hypothetical protein LOC136895												0						TGTGAAAAAAGAGAGACTTCA	0.328													16	54	---	---	---	---	PASS
INHBA	3624	broad.mit.edu	37	7	41739883	41739883	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41739883G>T	uc003thq.2	-	1	325	c.90C>A	c.(88-90)AGC>AGA	p.S30R	LOC285954_uc003tht.3_Intron|INHBA_uc003thr.2_Missense_Mutation_p.S30R|LOC285954_uc003ths.2_Intron	NM_002192	NP_002183	P08476	INHBA_HUMAN	inhibin beta A precursor	30					cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6						CGGGGGCCGCGCTGTGCCCCT	0.587										TSP Lung(11;0.080)			50	175	---	---	---	---	PASS
OGDH	4967	broad.mit.edu	37	7	44714139	44714139	+	Silent	SNP	C	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44714139C>A	uc003tln.2	+	7	1027	c.918C>A	c.(916-918)ATC>ATA	p.I306I	OGDH_uc003tlm.2_Silent_p.I306I|OGDH_uc011kbx.1_Silent_p.I302I|OGDH_uc011kby.1_Silent_p.I156I|OGDH_uc003tlp.2_Silent_p.I317I|OGDH_uc011kbz.1_Silent_p.I101I|OGDH_uc003tlo.1_Silent_p.I139I	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	306					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	ACTACGTGATCATGGGCATGC	0.562													8	41	---	---	---	---	PASS
TNS3	64759	broad.mit.edu	37	7	47319763	47319763	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47319763T>C	uc003tnv.2	-	30	4559	c.4192A>G	c.(4192-4194)AAA>GAA	p.K1398E	TNS3_uc003tnw.2_Missense_Mutation_p.K1398E	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3	1398						focal adhesion	protein binding			ovary(4)	4						GCAACTTACTTTGAGGAAGGG	0.368													34	60	---	---	---	---	PASS
CALN1	83698	broad.mit.edu	37	7	71571274	71571274	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71571274G>A	uc003twa.3	-	3	651	c.124C>T	c.(124-126)CGA>TGA	p.R42*	CALN1_uc003twb.3_Nonsense_Mutation_p.R84*|CALN1_uc003twc.3_Nonsense_Mutation_p.R42*	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	42	EF-hand 1.|Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				AAGGCCTCTCGGATTTCTACA	0.522													11	21	---	---	---	---	PASS
PTPN12	5782	broad.mit.edu	37	7	77247787	77247787	+	Intron	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77247787C>T	uc003ugh.2	+						PTPN12_uc011kgp.1_Intron|PTPN12_uc011kgq.1_Intron|PTPN12_uc010lds.2_Intron	NM_002835	NP_002826	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type							soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding			ovary(1)|breast(1)|pancreas(1)	3						AGTATTTTTTCCCTTGGCAGA	0.358													11	58	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82764926	82764926	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82764926C>A	uc003uhx.2	-	3	2229	c.1940G>T	c.(1939-1941)GGC>GTC	p.G647V	PCLO_uc003uhv.2_Missense_Mutation_p.G647V	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	593	Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CAGATCCCCGCCTAGAGCTCT	0.448													4	9	---	---	---	---	PASS
CFTR	1080	broad.mit.edu	37	7	117254679	117254679	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117254679G>C	uc003vjd.2	+	21	3512	c.3380G>C	c.(3379-3381)GGA>GCA	p.G1127A	CFTR_uc011knq.1_Missense_Mutation_p.G533A	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance	1127	Extracellular (Potential).|ABC transmembrane type-1 2.				respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	GAAGGAGAAGGAAGAGTTGGT	0.398									Cystic_Fibrosis				14	50	---	---	---	---	PASS
CFTR	1080	broad.mit.edu	37	7	117307086	117307086	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117307086G>T	uc003vjd.2	+	27	4499	c.4367G>T	c.(4366-4368)AGC>ATC	p.S1456I	CFTR_uc011knq.1_Missense_Mutation_p.S862I	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance	1456	Cytoplasmic (Potential).				respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	CGGAACTCAAGCAAGTGCAAG	0.517									Cystic_Fibrosis				6	20	---	---	---	---	PASS
EPHA1	2041	broad.mit.edu	37	7	143091367	143091367	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143091367C>T	uc003wcz.2	-	15	2509	c.2422G>A	c.(2422-2424)GAT>AAT	p.D808N		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	808	Protein kinase.|Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				CTCCACACATCGCTGGCTGTG	0.542													14	48	---	---	---	---	PASS
NCAPG2	54892	broad.mit.edu	37	7	158449118	158449118	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158449118G>A	uc003wnv.1	-	19	2367	c.2222C>T	c.(2221-2223)ACA>ATA	p.T741I	NCAPG2_uc010lqu.1_Missense_Mutation_p.T533I|NCAPG2_uc003wnw.1_RNA|NCAPG2_uc003wnx.1_Missense_Mutation_p.T741I|NCAPG2_uc011kwe.1_Missense_Mutation_p.T741I|NCAPG2_uc011kwc.1_Missense_Mutation_p.T242I|NCAPG2_uc011kwd.1_Missense_Mutation_p.T184I	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5	741					cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		TTTAGAAGCTGTGTTGCTCTG	0.423													3	63	---	---	---	---	PASS
IKBKB	3551	broad.mit.edu	37	8	42176881	42176881	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42176881C>G	uc003xow.1	+	14	1635	c.1458C>G	c.(1456-1458)TTC>TTG	p.F486L	IKBKB_uc010lxh.1_Missense_Mutation_p.F381L|IKBKB_uc011lco.1_RNA|IKBKB_uc010lxj.1_Missense_Mutation_p.F263L|IKBKB_uc003xox.1_Missense_Mutation_p.F207L|IKBKB_uc011lcp.1_RNA|IKBKB_uc011lcq.1_Missense_Mutation_p.F484L|IKBKB_uc010lxi.1_RNA|IKBKB_uc011lcr.1_Missense_Mutation_p.F427L	NM_001556	NP_001547	O14920	IKKB_HUMAN	inhibitor of nuclear factor kappa B kinase beta	486					anti-apoptosis|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|membrane raft	ATP binding|identical protein binding|IkappaB kinase activity			breast(3)|ovary(2)|lung(1)|skin(1)	7	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Arsenic trioxide(DB01169)|Auranofin(DB00995)	TGGATTTCTTCAAAACCAGCA	0.458											OREG0018747	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	54	---	---	---	---	PASS
NCOA2	10499	broad.mit.edu	37	8	71075035	71075035	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71075035C>T	uc003xyn.1	-	9	1049	c.887G>A	c.(886-888)TGG>TAG	p.W296*		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	296					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CAGGTCCTCCCAGCCTGGTTT	0.458			T	RUNXBP2	AML								43	101	---	---	---	---	PASS
MRPS28	28957	broad.mit.edu	37	8	80942390	80942390	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80942390C>A	uc003ybp.2	-	1	117	c.94G>T	c.(94-96)GAG>TAG	p.E32*	MRPS28_uc003ybo.2_5'UTR|TPD52_uc010lzr.2_Intron	NM_014018	NP_054737	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S28	32						mitochondrial small ribosomal subunit					0	Lung NSC(7;1.86e-06)|all_lung(9;6.91e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00769)|Epithelial(68;0.0208)|all cancers(69;0.0805)			GATCCACTCTCAGTGCCTACA	0.592													14	27	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131916111	131916111	+	Silent	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131916111C>T	uc003ytd.3	-	7	2074	c.1818G>A	c.(1816-1818)GTG>GTA	p.V606V	ADCY8_uc010mds.2_Silent_p.V606V	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	606	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CTGAGGAGCTCACTGACTCCT	0.473										HNSCC(32;0.087)			21	61	---	---	---	---	PASS
DOCK8	81704	broad.mit.edu	37	9	406924	406924	+	Intron	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:406924C>T	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CCTTACGTTTCTGTAGAACTC	0.542													28	82	---	---	---	---	PASS
IFNA17	3451	broad.mit.edu	37	9	21227905	21227905	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21227905G>C	uc003zos.1	-	1	317	c.268C>G	c.(268-270)CTC>GTC	p.L90V	IFNA14_uc003zoo.1_Intron	NM_021268	NP_067091	P01571	IFN17_HUMAN	interferon, alpha 17 precursor	90					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding				0				Lung(24;2.13e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		GTGCTGAAGAGATTGAAGGTC	0.473													31	74	---	---	---	---	PASS
C9orf11	54586	broad.mit.edu	37	9	27296647	27296647	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27296647C>G	uc003zql.2	-	2	250	c.166G>C	c.(166-168)GAG>CAG	p.E56Q	C9orf11_uc011lnq.1_Missense_Mutation_p.E56Q|C9orf11_uc003zqm.2_Missense_Mutation_p.E56Q	NM_020641	NP_065692	Q9NQ60	AFAF_HUMAN	Acr formation associated factor isoform 1	56	Vesicular (Potential).					acrosomal membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(39;7.39e-08)|Lung(218;1.26e-05)|LUSC - Lung squamous cell carcinoma(38;0.000106)		CCATTTTTCTCATTAGCAGGA	0.294													8	66	---	---	---	---	PASS
KIF24	347240	broad.mit.edu	37	9	34290194	34290194	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34290194C>A	uc003zua.3	-	5	1225	c.1105G>T	c.(1105-1107)GAC>TAC	p.D369Y	KIF24_uc010mkb.2_Missense_Mutation_p.D400Y	NM_194313	NP_919289	Q5T7B8	KIF24_HUMAN	kinesin family member 24	369	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0107)			TTTAGGAGGTCATAAAGCTGT	0.413													16	73	---	---	---	---	PASS
CA9	768	broad.mit.edu	37	9	35675547	35675547	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35675547G>A	uc003zxo.3	+	2	458	c.416G>A	c.(415-417)AGT>AAT	p.S139N	C9orf100_uc003zxl.2_RNA|CA9_uc003zxp.3_Missense_Mutation_p.S139N	NM_001216	NP_001207	Q16790	CAH9_HUMAN	carbonic anhydrase IX precursor	139	Extracellular.|Catalytic.				one-carbon metabolic process	integral to membrane|microvillus membrane|nucleolus	carbonate dehydratase activity|zinc ion binding			ovary(4)|skin(1)	5	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GATGACCAGAGTCATTGGCGC	0.498													30	16	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120475644	120475644	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120475644C>G	uc004bjz.2	+	3	1529	c.1238C>G	c.(1237-1239)ACC>AGC	p.T413S	TLR4_uc004bka.2_Missense_Mutation_p.T373S|TLR4_uc004bkb.2_Missense_Mutation_p.T213S	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	413	LRR 12.|Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						GGTGTTATTACCATGAGTTCA	0.378													7	77	---	---	---	---	PASS
SCAI	286205	broad.mit.edu	37	9	127790688	127790688	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127790688C>A	uc004bpe.2	-	5	477	c.396G>T	c.(394-396)CAG>CAT	p.Q132H	SCAI_uc004bpd.2_Missense_Mutation_p.Q155H|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	132	Required for interaction with MKL1 (By similarity).|Necessary to inhibit MKL1-induced SRF transcriptional activity (By similarity).				negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						GATAGTATAGCTGCCCAATCT	0.338													6	48	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135211885	135211885	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135211885G>C	uc004cbk.2	-	6	699	c.516C>G	c.(514-516)ATC>ATG	p.I172M		NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	172					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TTGCAGTCAAGATAGCCCAAC	0.348													7	47	---	---	---	---	PASS
COMMD3	23412	broad.mit.edu	37	10	22607579	22607579	+	Intron	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22607579C>T	uc001irf.2	+						COMMD3_uc001ire.2_3'UTR|COMMD3_uc001irg.2_Intron|BMI1_uc009xkg.2_Intron|BMI1_uc001irh.2_5'Flank	NM_012071	NP_036203	Q9UBI1	COMD3_HUMAN	COMM domain containing 3								protein binding				0						TTGCATCTTTCAGTATAGGCA	0.383													16	50	---	---	---	---	PASS
SLC16A9	220963	broad.mit.edu	37	10	61432635	61432635	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61432635G>T	uc010qig.1	-	3	682	c.233C>A	c.(232-234)GCA>GAA	p.A78E		NM_194298	NP_919274	Q7RTY1	MOT9_HUMAN	solute carrier family 16 (monocarboxylic acid	78	Extracellular (Potential).				urate metabolic process	integral to membrane|plasma membrane	symporter activity			skin(2)|ovary(1)	3						GACAGGTCTTGCTCCAAAAGA	0.398													11	19	---	---	---	---	PASS
MMRN2	79812	broad.mit.edu	37	10	88703038	88703038	+	Silent	SNP	C	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88703038C>A	uc001kea.2	-	6	1630	c.1503G>T	c.(1501-1503)CTG>CTT	p.L501L	MMRN2_uc010qmn.1_Silent_p.L144L|MMRN2_uc009xtb.2_Silent_p.L458L	NM_024756	NP_079032	Q9H8L6	MMRN2_HUMAN	multimerin 2 precursor	501						extracellular space				large_intestine(1)	1						GGATGACGTCCAGGTCTAAAT	0.642													9	33	---	---	---	---	PASS
OR56A3	390083	broad.mit.edu	37	11	5969026	5969026	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5969026G>A	uc010qzt.1	+	1	450	c.450G>A	c.(448-450)ATG>ATA	p.M150I		NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A,	150	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGCTGCCATGTTTATTTTGA	0.443													9	101	---	---	---	---	PASS
CTR9	9646	broad.mit.edu	37	11	10794075	10794075	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10794075C>T	uc001mja.2	+	20	2602	c.2453C>T	c.(2452-2454)TCT>TTT	p.S818F		NM_014633	NP_055448	Q6PD62	CTR9_HUMAN	SH2 domain binding protein 1	818					histone H2B ubiquitination|histone monoubiquitination	Cdc73/Paf1 complex|nuclear speck				ovary(2)	2				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		AGGCAGTGTTCTGACTTACTG	0.433													9	19	---	---	---	---	PASS
OR4C11	219429	broad.mit.edu	37	11	55371600	55371600	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55371600G>A	uc010rii.1	-	1	250	c.250C>T	c.(250-252)CTC>TTC	p.L84F		NM_001004700	NP_001004700	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C,	84	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TTTTCAGAGAGAGCATCCACA	0.403													32	29	---	---	---	---	PASS
OR5F1	338674	broad.mit.edu	37	11	55761723	55761723	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55761723A>G	uc010riv.1	-	1	379	c.379T>C	c.(379-381)TGT>CGT	p.C127R		NM_003697	NP_003688	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F,	127	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)					AGCGGGCGACATATGGCCGCA	0.507													11	54	---	---	---	---	PASS
CTNND1	1500	broad.mit.edu	37	11	57576856	57576856	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57576856G>C	uc001nmc.3	+	15	2924	c.2353G>C	c.(2353-2355)GTT>CTT	p.V785L	CTNND1_uc001nlh.1_Missense_Mutation_p.V785L|CTNND1_uc001nlu.3_Missense_Mutation_p.V678L|CTNND1_uc001nlt.3_Missense_Mutation_p.V678L|CTNND1_uc001nls.3_Missense_Mutation_p.V678L|CTNND1_uc001nlw.3_Missense_Mutation_p.V678L|CTNND1_uc001nmf.3_Missense_Mutation_p.V785L|CTNND1_uc001nmd.3_Missense_Mutation_p.V731L|CTNND1_uc001nlk.3_Missense_Mutation_p.V731L|CTNND1_uc001nme.3_Missense_Mutation_p.V779L|CTNND1_uc001nll.3_Missense_Mutation_p.V725L|CTNND1_uc001nmg.3_Missense_Mutation_p.V725L|CTNND1_uc001nlj.3_Missense_Mutation_p.V725L|CTNND1_uc001nlr.3_Missense_Mutation_p.V725L|CTNND1_uc001nlp.3_Missense_Mutation_p.V725L|CTNND1_uc001nlx.3_Missense_Mutation_p.V462L|CTNND1_uc001nlz.3_Missense_Mutation_p.V462L|CTNND1_uc009ymn.2_Missense_Mutation_p.V456L|CTNND1_uc001nlm.3_Missense_Mutation_p.V779L|CTNND1_uc001nly.3_Missense_Mutation_p.V456L|CTNND1_uc001nmb.3_Missense_Mutation_p.V456L|CTNND1_uc001nma.3_Missense_Mutation_p.V456L|CTNND1_uc001nmi.3_Missense_Mutation_p.V684L|CTNND1_uc001nmh.3_Missense_Mutation_p.V779L|CTNND1_uc001nlq.3_Missense_Mutation_p.V684L|CTNND1_uc001nln.3_Missense_Mutation_p.V779L|CTNND1_uc001nli.3_Missense_Mutation_p.V779L|CTNND1_uc001nlo.3_Missense_Mutation_p.V678L|CTNND1_uc001nlv.3_Missense_Mutation_p.V678L	NM_001085458	NP_001078927	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1ABC	785	ARM 10.				adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				TATCAACGAGGTTATCGCTGA	0.443													15	31	---	---	---	---	PASS
UVRAG	7405	broad.mit.edu	37	11	75727967	75727967	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75727967G>T	uc001oxc.2	+	12	1410	c.1169G>T	c.(1168-1170)GGG>GTG	p.G390V	UVRAG_uc010rrw.1_Missense_Mutation_p.G289V|UVRAG_uc001oxd.2_Missense_Mutation_p.G18V|UVRAG_uc010rrx.1_Missense_Mutation_p.G18V|UVRAG_uc009yuh.1_RNA	NM_003369	NP_003360	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	390					DNA repair|positive regulation of autophagy	early endosome|late endosome|lysosome	protein binding			skin(4)|lung(2)	6						ATTCATAAGGGGTCTAGATCA	0.373													15	60	---	---	---	---	PASS
KIAA1826	84437	broad.mit.edu	37	11	105880459	105880459	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105880459C>T	uc001piy.2	-	3	1014	c.841G>A	c.(841-843)GGT>AGT	p.G281S	KIAA1826_uc001piz.2_Missense_Mutation_p.G281S	NM_032424	NP_115800	Q8NCY6	K1826_HUMAN	hypothetical protein LOC84437	281	Potential.					nucleus				breast(1)	1		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.56e-05)|Epithelial(105;0.00432)|all cancers(92;0.0309)		TCTCCTTGACCAAGTTCATTT	0.438													39	128	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108382977	108382977	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108382977G>A	uc001pkk.2	-	6	3368	c.3257C>T	c.(3256-3258)TCA>TTA	p.S1086L	EXPH5_uc010rvy.1_Missense_Mutation_p.S898L|EXPH5_uc010rvz.1_Missense_Mutation_p.S930L|EXPH5_uc010rwa.1_Missense_Mutation_p.S1010L	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	1086					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		GGCTGAGTCTGAAAGGACTTT	0.413													20	61	---	---	---	---	PASS
DRD2	1813	broad.mit.edu	37	11	113283341	113283341	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113283341T>C	uc001pnz.2	-	6	1396	c.1075A>G	c.(1075-1077)AGC>GGC	p.S359G	DRD2_uc010rwv.1_Missense_Mutation_p.S358G|DRD2_uc001poa.3_Missense_Mutation_p.S359G|DRD2_uc001pob.3_Missense_Mutation_p.S330G	NM_000795	NP_000786	P14416	DRD2_HUMAN	dopamine receptor D2 isoform long	359	Cytoplasmic (By similarity).|Interaction with PPP1R9B (By similarity).				activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding			pancreas(1)|skin(1)	2		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)	TTCCTACGGCTCATGGTCTTG	0.567													3	60	---	---	---	---	PASS
HSPA8	3312	broad.mit.edu	37	11	122930469	122930469	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122930469T>G	uc001pyo.2	-	5	910	c.832A>C	c.(832-834)ACC>CCC	p.T278P	HSPA8_uc009zbc.2_Missense_Mutation_p.T42P|HSPA8_uc001pyp.2_Missense_Mutation_p.T278P|HSPA8_uc010rzu.1_Missense_Mutation_p.T201P|HSPA8_uc009zbd.1_Missense_Mutation_p.T278P	NM_006597	NP_006588	P11142	HSP7C_HUMAN	heat shock 70kDa protein 8 isoform 1	278	Interaction with BAG1.				cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding			central_nervous_system(7)|lung(1)	8		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		CTGGCCTGGGTGCTGGAAGAG	0.488													3	36	---	---	---	---	PASS
CDON	50937	broad.mit.edu	37	11	125864259	125864259	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125864259G>A	uc009zbw.2	-	14	2698	c.2570C>T	c.(2569-2571)ACT>ATT	p.T857I	CDON_uc001qdb.3_Missense_Mutation_p.T234I|CDON_uc001qdc.3_Missense_Mutation_p.T857I	NM_016952	NP_058648	Q4KMG0	CDON_HUMAN	surface glycoprotein, Ig superfamily member	857	Extracellular (Potential).|Fibronectin type-III 3.				cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TTGAATGGGAGTGTTATTGTT	0.353													6	27	---	---	---	---	PASS
ANO2	57101	broad.mit.edu	37	12	5722118	5722118	+	Silent	SNP	C	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5722118C>A	uc001qnm.2	-	19	2007	c.1935G>T	c.(1933-1935)GTG>GTT	p.V645V		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	650	Extracellular (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						CAGGCCTGCCCACAAACCTGA	0.532													10	38	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	9002262	9002262	+	Intron	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9002262C>G	uc001quz.3	+						A2ML1_uc001qva.1_Intron|A2ML1_uc010sgm.1_Intron	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor							extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						TGATGCCTATCAGGACGTGGG	0.453													7	36	---	---	---	---	PASS
ATF7IP	55729	broad.mit.edu	37	12	14578137	14578137	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14578137A>G	uc001rbw.2	+	2	1446	c.1288A>G	c.(1288-1290)ATG>GTG	p.M430V	ATF7IP_uc010shs.1_Missense_Mutation_p.M430V|ATF7IP_uc001rbu.2_Missense_Mutation_p.M430V|ATF7IP_uc001rbv.1_Missense_Mutation_p.M430V|ATF7IP_uc001rbx.2_Missense_Mutation_p.M430V|ATF7IP_uc010sht.1_Missense_Mutation_p.M430V|ATF7IP_uc001rby.3_Missense_Mutation_p.M430V|ATF7IP_uc001rbz.1_Missense_Mutation_p.M430V|ATF7IP_uc001rca.2_Missense_Mutation_p.M430V|ATF7IP_uc001rcb.2_Missense_Mutation_p.M41V	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	430	Glu-rich.				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						TACAGACTCTATGGAGACAGA	0.333													16	44	---	---	---	---	PASS
SOX5	6660	broad.mit.edu	37	12	23696276	23696276	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23696276C>T	uc001rfw.2	-	13	1742	c.1640G>A	c.(1639-1641)CGA>CAA	p.R547Q	SOX5_uc001rfx.2_Missense_Mutation_p.R534Q|SOX5_uc001rfy.2_Missense_Mutation_p.R426Q|SOX5_uc001rfv.2_Missense_Mutation_p.R161Q|SOX5_uc010siv.1_Missense_Mutation_p.R534Q|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Missense_Mutation_p.R499Q	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	547					transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						ACCACGCCCTCGGGATTCCCT	0.453													34	82	---	---	---	---	PASS
LIMA1	51474	broad.mit.edu	37	12	50571710	50571710	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50571710C>G	uc001rwj.3	-	11	1591	c.1417G>C	c.(1417-1419)GAG>CAG	p.E473Q	LIMA1_uc001rwg.3_Missense_Mutation_p.E171Q|LIMA1_uc001rwh.3_Missense_Mutation_p.E312Q|LIMA1_uc001rwi.3_Missense_Mutation_p.E314Q|LIMA1_uc001rwk.3_Missense_Mutation_p.E474Q|LIMA1_uc010smr.1_RNA|LIMA1_uc010sms.1_RNA	NM_016357	NP_057441	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1 isoform b	473					actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1						TCCAAAATCTCTTCGTTTTCA	0.498													7	119	---	---	---	---	PASS
DIP2B	57609	broad.mit.edu	37	12	51068252	51068252	+	Intron	SNP	C	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51068252C>A	uc001rwv.2	+						DIP2B_uc001rwu.2_Intron|DIP2B_uc009zls.1_Intron	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						GTTTTCTCCTCTCAGAGAATT	0.408													18	39	---	---	---	---	PASS
KRT6A	3853	broad.mit.edu	37	12	52885385	52885385	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52885385C>T	uc001sam.2	-	2	885	c.676G>A	c.(676-678)GAC>AAC	p.D226N		NM_005554	NP_005545	P02538	K2C6A_HUMAN	keratin 6A	226	Coil 1B.|Rod.				cell differentiation|ectoderm development|positive regulation of cell proliferation	keratin filament	protein binding|structural constituent of cytoskeleton			ovary(4)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.189)		ACAATGCTGTCCAGCTGCCTC	0.562													23	75	---	---	---	---	PASS
KRT4	3851	broad.mit.edu	37	12	53201458	53201458	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53201458T>C	uc001saz.2	-	7	1809	c.1538A>G	c.(1537-1539)TAC>TGC	p.Y513C		NM_002272	NP_002263	B4DRS2	B4DRS2_HUMAN	keratin 4	439						keratin filament	structural molecule activity			ovary(4)|skin(2)	6						CAGTTTGCGGTAGGTGGCGAT	0.592													14	72	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57588840	57588840	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57588840G>A	uc001snd.2	+	51	8730	c.8264G>A	c.(8263-8265)GGC>GAC	p.G2755D		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	2755	Extracellular (Potential).|LDL-receptor class A 16.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTGTGTGACGGCAGCGATGAC	0.607													28	56	---	---	---	---	PASS
ZDHHC17	23390	broad.mit.edu	37	12	77239571	77239571	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77239571G>C	uc001syk.1	+	13	1575	c.1412G>C	c.(1411-1413)GGT>GCT	p.G471A		NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14	471	Cytoplasmic (Potential).|DHHC-type.				lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						CCATGGGTGGGTAACTGTGTA	0.343													3	83	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117768176	117768176	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117768176C>T	uc001twm.1	-	2	1385	c.699G>A	c.(697-699)ATG>ATA	p.M233I		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	233	PIN (nNOS-inhibiting protein) binding.				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	CCATATCTTTCATCTCTGCCT	0.408													13	71	---	---	---	---	PASS
CCDC60	160777	broad.mit.edu	37	12	119916931	119916931	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119916931G>A	uc001txe.2	+	4	839	c.374G>A	c.(373-375)GGA>GAA	p.G125E	uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	125										ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		AAGACACTGGGAGCTAGAGTC	0.483													11	31	---	---	---	---	PASS
ZDHHC20	253832	broad.mit.edu	37	13	21965981	21965981	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21965981C>T	uc001uob.2	-	8	720	c.607G>A	c.(607-609)GAT>AAT	p.D203N	ZDHHC20_uc001uod.2_RNA|ZDHHC20_uc001uoc.2_RNA|ZDHHC20_uc001uoe.2_RNA|ZDHHC20_uc010tcs.1_Missense_Mutation_p.D140N	NM_153251	NP_694983	Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20	203						integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)		GCACGTGTATCTGTCAGTTCA	0.358													4	17	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22369131	22369131	+	Silent	SNP	C	A	A	rs141142184		TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369131C>A	uc010tzu.1	+	1	556	c.556C>A	c.(556-558)CGG>AGG	p.R186R	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	186	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		ACAGGTTGTCCGGATTGCCTG	0.458													32	116	---	---	---	---	PASS
EIF2AK4	440275	broad.mit.edu	37	15	40265206	40265206	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40265206A>T	uc001zkm.1	+	10	1701	c.1651A>T	c.(1651-1653)AGT>TGT	p.S551C	EIF2AK4_uc001zkl.2_Missense_Mutation_p.S551C|EIF2AK4_uc010bbj.1_Missense_Mutation_p.S280C	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha	551					translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		AGTGGAACAAAGTCCTGAAGG	0.398													3	64	---	---	---	---	PASS
TYRO3	7301	broad.mit.edu	37	15	41862508	41862508	+	Silent	SNP	C	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41862508C>A	uc001zof.1	+	11	1677	c.1453C>A	c.(1453-1455)CGA>AGA	p.R485R		NM_006293	NP_006284	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase precursor	485	Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			ovary(3)|lung(2)|central_nervous_system(1)	6		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GTCCTTCAATCGAGAAAGGCC	0.567													20	93	---	---	---	---	PASS
MGA	23269	broad.mit.edu	37	15	42032210	42032210	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42032210C>T	uc010uda.1	+	3	368	c.242C>T	c.(241-243)TCA>TTA	p.S81L	MGA_uc010ucy.1_Intron|MGA_uc010ucz.1_Intron	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	1470						MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		TTGCGACCCTCAGTCCTGGAC	0.532													22	98	---	---	---	---	PASS
SLC30A4	7782	broad.mit.edu	37	15	45814460	45814460	+	Silent	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45814460G>A	uc001zvj.2	-	2	405	c.93C>T	c.(91-93)TTC>TTT	p.F31F	C15orf21_uc010beg.1_Intron|C15orf21_uc010beh.1_Intron|C15orf21_uc010bei.1_Intron|C15orf21_uc010bej.1_Intron|C15orf21_uc001zvm.1_Intron|C15orf21_uc001zvn.1_Intron	NM_013309	NP_037441	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter),	31	Cytoplasmic (Potential).|Asp-rich (acidic).				regulation of sequestering of zinc ion|response to toxin	endosome membrane|integral to membrane|late endosome	zinc ion transmembrane transporter activity				0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		CCTCATCCGAGAAGTCAAAGG	0.582													3	45	---	---	---	---	PASS
COPS2	9318	broad.mit.edu	37	15	49429425	49429425	+	Splice_Site	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49429425C>T	uc001zxf.2	-	6	542	c.463_splice	c.e6-1	p.L155_splice	COPS2_uc001zxh.2_Splice_Site_p.L162_splice|COPS2_uc010ufa.1_Splice_Site_p.L91_splice	NM_004236	NP_004227	P61201	CSN2_HUMAN	COP9 constitutive photomorphogenic homolog						cullin deneddylation|transcription from RNA polymerase II promoter	cytoplasm|signalosome	protein binding|signal transducer activity			lung(1)	1		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		ATTTTCCAAGCTGCAAGAAAG	0.333													9	33	---	---	---	---	PASS
ITGA11	22801	broad.mit.edu	37	15	68661578	68661578	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68661578G>A	uc002ari.2	-	3	296	c.209C>T	c.(208-210)ACG>ATG	p.T70M	ITGA11_uc010bib.2_Missense_Mutation_p.T70M	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor	70	FG-GAP 1.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	CACGTCTCCCGTCTTCTGGTA	0.557													18	37	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84652054	84652054	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84652054A>G	uc002bjz.3	+	21	3898	c.3674A>G	c.(3673-3675)TAT>TGT	p.Y1225C	ADAMTSL3_uc010bmt.1_Missense_Mutation_p.Y1225C|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.Y1225C	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	1225	Ig-like C2-type 2.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			GAGGCCACATATACATGGACC	0.363													40	111	---	---	---	---	PASS
RPL3L	6123	broad.mit.edu	37	16	2000847	2000847	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2000847G>A	uc002cnh.2	-	4	546	c.499C>T	c.(499-501)CAG>TAG	p.Q167*		NM_005061	NP_005052	Q92901	RL3L_HUMAN	ribosomal protein L3-like	167					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	RNA binding|structural constituent of ribosome				0						GGGCTGACCTGAGTGTGGACA	0.587													31	34	---	---	---	---	PASS
NLRC5	84166	broad.mit.edu	37	16	57095620	57095620	+	Intron	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57095620C>T	uc002ekk.1	+						NLRC5_uc002ekn.2_Intron|NLRC5_uc002ekl.2_Intron|NLRC5_uc002ekm.2_Intron|NLRC5_uc010ccr.1_Intron|NLRC5_uc010ccs.1_Intron|NLRC5_uc002eko.1_Intron|NLRC5_uc002ekp.1_Intron|NLRC5_uc002ekq.1_Intron|NLRC5_uc002ekr.1_Intron	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27						defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				TCAGGTACCTCCTCCCCCGCT	0.657													13	37	---	---	---	---	PASS
ANKRD11	29123	broad.mit.edu	37	16	89351186	89351186	+	Silent	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89351186C>T	uc002fmx.1	-	9	2225	c.1764G>A	c.(1762-1764)TCG>TCA	p.S588S	ANKRD11_uc002fmy.1_Silent_p.S588S|ANKRD11_uc002fnc.1_Silent_p.S588S|ANKRD11_uc002fnb.1_Silent_p.S545S	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	588	Ser-rich.					nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CTGGCTTCAGCGATTCCACAC	0.592													5	24	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577580	7577580	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577580T>G	uc002gim.2	-	7	895	c.701A>C	c.(700-702)TAC>TCC	p.Y234S	TP53_uc002gig.1_Missense_Mutation_p.Y234S|TP53_uc002gih.2_Missense_Mutation_p.Y234S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y102S|TP53_uc010cng.1_Missense_Mutation_p.Y102S|TP53_uc002gii.1_Missense_Mutation_p.Y102S|TP53_uc010cnh.1_Missense_Mutation_p.Y234S|TP53_uc010cni.1_Missense_Mutation_p.Y234S|TP53_uc002gij.2_Missense_Mutation_p.Y234S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.Y141S|TP53_uc002gio.2_Missense_Mutation_p.Y102S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	234	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> F (in a sporadic cancer; somatic mutation).|Y -> K (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> N (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> Q (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y234C(70)|p.Y234H(13)|p.Y234N(11)|p.0?(7)|p.Y234S(6)|p.Y234*(4)|p.Y234D(3)|p.Y234del(3)|p.Y234fs*2(1)|p.V225fs*23(1)|p.Y234fs*6(1)|p.Y234fs*5(1)|p.Y234fs*4(1)|p.Y234R(1)|p.Y234Y(1)|p.H233_C242del10(1)|p.D228fs*12(1)|p.Y234F(1)|p.I232_Y236delIHYNY(1)|p.Y141S(1)|p.T230_Y234delTTIHY(1)|p.H233fs*6(1)|p.Y234_N235insX(1)|p.I232fs*5(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CATGTAGTTGTAGTGGATGGT	0.572		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			24	15	---	---	---	---	PASS
MED1	5469	broad.mit.edu	37	17	37564166	37564166	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37564166G>C	uc002hrv.3	-	17	4520	c.4308C>G	c.(4306-4308)ATC>ATG	p.I1436M	MED1_uc010wee.1_Missense_Mutation_p.I1264M|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	1436	Ser-rich.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TGGAACCACTGATGAGTGGAG	0.493										HNSCC(31;0.082)			14	49	---	---	---	---	PASS
MED1	5469	broad.mit.edu	37	17	37564269	37564269	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37564269G>C	uc002hrv.3	-	17	4417	c.4205C>G	c.(4204-4206)CCT>CGT	p.P1402R	MED1_uc010wee.1_Missense_Mutation_p.P1230R|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	1402	Ser-rich.|Interaction with TP53.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TTTAATGCTAGGGGAGCCTCC	0.458										HNSCC(31;0.082)			29	59	---	---	---	---	PASS
MED1	5469	broad.mit.edu	37	17	37564891	37564891	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37564891G>A	uc002hrv.3	-	17	3795	c.3583C>T	c.(3583-3585)CAT>TAT	p.H1195Y	MED1_uc010wee.1_Missense_Mutation_p.H1023Y|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	1195	Ser-rich.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GGCCTTGAATGAGAAGGGGAT	0.483										HNSCC(31;0.082)			10	47	---	---	---	---	PASS
RND2	8153	broad.mit.edu	37	17	41179320	41179320	+	Intron	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41179320G>C	uc002icn.2	+							NM_005440	NP_005431	P52198	RND2_HUMAN	Rho family GTPase 2 precursor						small GTPase mediated signal transduction	acrosomal membrane	GTP binding|GTPase activity				0		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)		GTGGGAGCCTGGGGAAATAGG	0.567													10	59	---	---	---	---	PASS
TRIM25	7706	broad.mit.edu	37	17	54969227	54969227	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54969227C>G	uc002iut.2	-	9	1787	c.1727G>C	c.(1726-1728)CGG>CCG	p.R576P	TRIM25_uc010dcj.2_Missense_Mutation_p.R368P	NM_005082	NP_005073	Q14258	TRI25_HUMAN	tripartite motif-containing 25	576	B30.2/SPRY.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|response to virus	cell junction|cytosol|nucleus	sequence-specific DNA binding transcription factor activity|ubiquitin-protein ligase activity|zinc ion binding			lung(1)|breast(1)|skin(1)	3	Breast(9;6.15e-08)					CACGCCCACCCGCGTGGCCTT	0.567													20	21	---	---	---	---	PASS
OR4D2	124538	broad.mit.edu	37	17	56247784	56247784	+	Silent	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56247784C>T	uc010wnp.1	+	1	768	c.768C>T	c.(766-768)TAC>TAT	p.Y256Y		NM_001004707	NP_001004707	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D,	256	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						CAAGCATTTACCTCTATGCCC	0.537													48	50	---	---	---	---	PASS
ABCA9	10350	broad.mit.edu	37	17	67039850	67039850	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67039850T>C	uc002jhu.2	-	6	723	c.580A>G	c.(580-582)ACA>GCA	p.T194A	ABCA9_uc010dez.2_Missense_Mutation_p.T194A|ABCA9_uc002jhv.2_Missense_Mutation_p.T194A	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	194					transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					GAATGATTTGTTGCGATCTGA	0.343													28	24	---	---	---	---	PASS
CYGB	114757	broad.mit.edu	37	17	74527629	74527629	+	Silent	SNP	C	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74527629C>A	uc002jru.1	-	2	446	c.288G>T	c.(286-288)CTG>CTT	p.L96L	CYGB_uc002jrv.1_Silent_p.L31L|PRCD_uc002jrw.1_Intron	NM_134268	NP_599030	Q8WWM9	CYGB_HUMAN	cytoglobin	96	Globin.				response to oxidative stress	cytoplasm	heme binding|oxygen binding|oxygen transporter activity|peroxidase activity				0						CGGGGTCATGCAGGTTCTCCA	0.627													13	36	---	---	---	---	PASS
ZBTB7A	51341	broad.mit.edu	37	19	4054254	4054254	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4054254G>A	uc002lzh.2	-	2	1052	c.977C>T	c.(976-978)TCG>TTG	p.S326L	ZBTB7A_uc002lzi.2_Missense_Mutation_p.S326L	NM_015898	NP_056982	O95365	ZBT7A_HUMAN	zinc finger and BTB domain containing 7A	326					cell differentiation|multicellular organismal development|transcription, DNA-dependent	nucleus	DNA binding|histone acetyltransferase binding|zinc ion binding			pancreas(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)		ccggcccACCGATGACATCAT	0.597													3	4	---	---	---	---	PASS
UPF1	5976	broad.mit.edu	37	19	18960909	18960909	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18960909G>A	uc002nkg.2	+	4	762	c.487G>A	c.(487-489)GCA>ACA	p.A163T	UPF1_uc002nkf.2_Missense_Mutation_p.A163T	NM_002911	NP_002902	Q92900	RENT1_HUMAN	regulator of nonsense transcripts 1	163	Sufficient for interaction with RENT2.				cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CCTTGTGAGGGCAAAATGCAA	0.517													4	109	---	---	---	---	PASS
ZNF93	81931	broad.mit.edu	37	19	20027425	20027425	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20027425T>G	uc002non.2	+	3	298	c.187T>G	c.(187-189)TTG>GTG	p.L63V	ZNF93_uc002nom.2_Missense_Mutation_p.L63V	NM_031218	NP_112495	P35789	ZNF93_HUMAN	zinc finger protein 93	63	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1						AAAAAAACCTTTGACTATGAA	0.418													4	81	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22940429	22940429	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940429C>G	uc010xrh.1	-	5	2009	c.2009G>C	c.(2008-2010)TGC>TCC	p.C670S		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TTCACATTTGCAGGGTTTCTC	0.358													8	76	---	---	---	---	PASS
ZNF569	148266	broad.mit.edu	37	19	37904954	37904954	+	Silent	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37904954G>A	uc002ogi.2	-	6	1164	c.606C>T	c.(604-606)ATC>ATT	p.I202I	ZNF569_uc002ogh.2_Silent_p.I43I|ZNF569_uc002ogj.2_Silent_p.I226I	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	202	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCAGATGTCTGATGAGGTCCA	0.358													31	71	---	---	---	---	PASS
ZFP30	22835	broad.mit.edu	37	19	38126846	38126846	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38126846G>A	uc002ogv.1	-	6	1112	c.596C>T	c.(595-597)GCC>GTC	p.A199V	ZFP30_uc002ogw.1_Missense_Mutation_p.A199V|ZFP30_uc002ogx.1_Missense_Mutation_p.A199V|ZFP30_uc010xtt.1_Missense_Mutation_p.A198V	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	zinc finger protein 30 homolog	199	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ACTGAGGTGGGCACACTGTCT	0.388													4	171	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38948934	38948934	+	Splice_Site	SNP	T	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38948934T>C	uc002oit.2	+	18	2297	c.2167_splice	c.e18+2	p.G723_splice	RYR1_uc002oiu.2_Splice_Site_p.G723_splice	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	TCTGGACAGGTACCTGACCCC	0.612													55	79	---	---	---	---	PASS
ZNF222	7673	broad.mit.edu	37	19	44536873	44536873	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44536873G>T	uc002oyc.2	+	4	1229	c.1046G>T	c.(1045-1047)GGC>GTC	p.G349V	ZNF284_uc010ejd.2_Intron|ZNF222_uc002oye.2_Missense_Mutation_p.G389V|ZNF222_uc002oyd.2_Missense_Mutation_p.G295V	NM_013360	NP_037492	Q9UK12	ZN222_HUMAN	zinc finger protein 222 isoform 2	349	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Prostate(69;0.0435)				TGTGGGAAGGGCTACATTAGT	0.448													15	78	---	---	---	---	PASS
PPP2R1A	5518	broad.mit.edu	37	19	52705205	52705205	+	Silent	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52705205C>T	uc002pyp.2	+	2	246	c.87C>T	c.(85-87)CTC>CTT	p.L29L	PPP2R1A_uc010ydk.1_Missense_Mutation_p.S8L|PPP2R1A_uc010epm.1_Silent_p.L69L|PPP2R1A_uc002pyq.2_5'UTR	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein	29	PP2A subunit B binding.|HEAT 1.				ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		AGCTTCGCCTCAACAGCATCA	0.532			Mis		clear cell ovarian carcinoma								6	26	---	---	---	---	PASS
PLCB4	5332	broad.mit.edu	37	20	9317805	9317805	+	Silent	SNP	C	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9317805C>T	uc002wnf.2	+	4	253	c.117C>T	c.(115-117)TTC>TTT	p.F39F	PLCB4_uc010gbw.1_Silent_p.F39F|PLCB4_uc010gbx.2_Silent_p.F39F|PLCB4_uc002wne.2_Silent_p.F39F	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b	39					intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						ACTGCCTCTTCAAAGTGGATG	0.378													15	49	---	---	---	---	PASS
C22orf30	253143	broad.mit.edu	37	22	32097716	32097716	+	Silent	SNP	T	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32097716T>C	uc003alp.3	-	7	6226	c.6033A>G	c.(6031-6033)TCA>TCG	p.S2011S	C22orf30_uc003alo.1_Silent_p.S1810S|C22orf30_uc010gwj.1_Intron	NM_173566	NP_775837	Q5THK1	PR14L_HUMAN	hypothetical protein LOC253143	2011											0						TGCGAATCTGTGAGACTTTCT	0.408													17	54	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50037927	50037927	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50037927C>A	uc004dox.3	+	5	567	c.269C>A	c.(268-270)TCC>TAC	p.S90Y	CCNB3_uc004doy.2_Missense_Mutation_p.S90Y|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_5'UTR	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	90					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					AAAGTTGTTTCCAAGAAGATA	0.428													21	11	---	---	---	---	PASS
ZIC3	7547	broad.mit.edu	37	X	136649888	136649888	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136649888G>C	uc004fak.2	+	1	1543	c.1038G>C	c.(1036-1038)AAG>AAC	p.K346N		NM_003413	NP_003404	O60481	ZIC3_HUMAN	zinc finger protein of the cerebellum 3	346	C2H2-type 3.|Nuclear localization signal.			K->A: Increases its cytoplasmic localization. Does not interact with KPNA1 and KPNA6 and increases strongly its cytoplasmic localization; when associated with A-320; A-337; A-341; A- 349 and A-350.	cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					AGAACCTCAAGATCCACAAGA	0.602													3	64	---	---	---	---	PASS
USP48	84196	broad.mit.edu	37	1	22079458	22079458	+	Intron	DEL	A	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22079458delA	uc001bfb.2	-						USP48_uc010odq.1_Intron|USP48_uc009vqc.2_Intron|USP48_uc001bfc.2_Intron|USP48_uc001bfe.1_Intron|USP48_uc001bff.2_Intron	NM_032236	NP_115612	Q86UV5	UBP48_HUMAN	ubiquitin specific protease 48 isoform a						ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		CTGaatatttaaaaaaaaaaa	0.318													12	6	---	---	---	---	
ANKAR	150709	broad.mit.edu	37	2	190541861	190541861	+	Intron	DEL	G	-	-	rs56090484		TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190541861delG	uc002uqw.1	+						ANKAR_uc002uqu.2_Intron|ANKAR_uc002uqv.1_Intron	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing							integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			ttttttttttggaacagagtc	0.124													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	233282753	233282753	+	IGR	DEL	T	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233282753delT								ALPPL2 (7331 upstream) : ALPI (38080 downstream)																							GGGGGGGGGGTGATCTTCTGC	0.577													6	5	---	---	---	---	
SCN11A	11280	broad.mit.edu	37	3	38888776	38888776	+	Frame_Shift_Del	DEL	A	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38888776delA	uc011ays.1	-	26	4984	c.4785delT	c.(4783-4785)GTTfs	p.V1595fs		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	1595	IV.|Helical; Name=S6 of repeat IV; (By similarity).				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	ACATGTTGACAACAATGAGAA	0.393													68	36	---	---	---	---	
C3orf18	51161	broad.mit.edu	37	3	50599335	50599336	+	Intron	INS	-	T	T	rs35405680		TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50599335_50599336insT	uc003das.2	-						C3orf18_uc003dar.2_Intron|C3orf18_uc011bdr.1_Intron|C3orf18_uc010hlo.2_Intron|C3orf18_uc010hlp.2_Intron|C3orf18_uc003dat.2_Intron	NM_016210	NP_057294	Q9UK00	CC018_HUMAN	hypothetical protein LOC51161							integral to membrane				pancreas(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.0175)|Kidney(197;0.0207)		CTTCATGCCtcttttttttttt	0.282													4	2	---	---	---	---	
PROK2	60675	broad.mit.edu	37	3	71821711	71821711	+	3'UTR	DEL	A	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71821711delA	uc003dpa.3	-	4					PROK2_uc003doz.3_3'UTR	NM_001126128	NP_001119600	Q9HC23	PROK2_HUMAN	prokineticin 2 isoform a precursor						activation of MAPK activity|angiogenesis|anti-apoptosis|cell proliferation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response|neuropeptide signaling pathway|positive regulation of smooth muscle contraction|sensory perception of pain|spermatogenesis	extracellular region	G-protein-coupled receptor binding				0		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)		CTCTTTCGATAAAAAAAAAAA	0.299													4	3	---	---	---	---	
TBCCD1	55171	broad.mit.edu	37	3	186276537	186276537	+	Intron	DEL	T	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186276537delT	uc003fqg.2	-						TBCCD1_uc011bry.1_Intron|TBCCD1_uc003fqh.2_Intron	NM_018138	NP_060608	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1						cell morphogenesis|maintenance of centrosome location|maintenance of Golgi location|regulation of cell migration|regulation of cell shape	spindle pole centrosome	binding			large_intestine(1)|ovary(1)	2	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		tttctttttcttttttttttg	0.164													4	2	---	---	---	---	
CHIC2	26511	broad.mit.edu	37	4	54876132	54876132	+	3'UTR	DEL	C	-	-	rs68107873		TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54876132delC	uc003haj.1	-	6					PDGFRA_uc003haa.2_Intron	NM_012110	NP_036242	Q9UKJ5	CHIC2_HUMAN	cysteine-rich hydrophobic domain 2							plasma membrane	protein binding			central_nervous_system(1)	1	all_cancers(7;0.0193)|all_neural(26;0.0209)|Lung NSC(11;0.0281)|Glioma(25;0.08)		LUSC - Lung squamous cell carcinoma(32;0.00216)			aaaaaaaaaacaaaaacaaaa	0.323			T	ETV6	AML								6	5	---	---	---	---	
CCDC109B	55013	broad.mit.edu	37	4	110581324	110581325	+	Intron	INS	-	T	T	rs139082600	by1000genomes	TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110581324_110581325insT	uc011cfs.1	+						CCDC109B_uc010imf.2_Intron	NM_017918	NP_060388	Q9NWR8	C109B_HUMAN	coiled-coil domain containing 109B							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;6.65e-06)		AAATTTACTCATTTTTTTTTCT	0.282													2	4	---	---	---	---	
C5orf44	80006	broad.mit.edu	37	5	64933458	64933458	+	Intron	DEL	A	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64933458delA	uc003jtz.3	+						C5orf44_uc003jua.3_Intron|C5orf44_uc003juc.3_Intron|C5orf44_uc010iwv.2_Intron	NM_024941	NP_079217	A5PLN9	CE044_HUMAN	hypothetical protein LOC80006 isoform 2											ovary(1)	1						actctgtctcaaaaaaaaaaa	0.114													6	3	---	---	---	---	
REEP5	7905	broad.mit.edu	37	5	112228792	112228803	+	Intron	DEL	AAAAAAAAAAAA	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112228792_112228803delAAAAAAAAAAAA	uc003kqe.1	-						REEP5_uc011cvw.1_Intron|REEP5_uc011cvx.1_Intron|REEP5_uc011cvy.1_Intron|REEP5_uc011cvz.1_Intron	NM_005669	NP_005660	Q00765	REEP5_HUMAN	receptor accessory protein 5							integral to membrane	protein binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		TTTTGTTCTTaaaaaaaaaaaaaaaaaaaaaa	0.236													4	2	---	---	---	---	
C6orf201	404220	broad.mit.edu	37	6	4130954	4130957	+	3'UTR	DEL	TTCT	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4130954_4130957delTTCT	uc003mwa.3	+	6					C6orf201_uc003mvz.3_RNA|C6orf201_uc003mwb.3_RNA|PECI_uc003mwc.2_Intron|PECI_uc003mwd.2_Intron|PECI_uc003mwe.2_Intron|PECI_uc003mwf.2_Intron|PECI_uc010jnr.1_Intron	NM_001085401	NP_001078870	Q7Z4U5	CF201_HUMAN	hypothetical protein LOC404220												0	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				AAGCACAAACTTCTTTAGAAGTAC	0.397													34	31	---	---	---	---	
RHAG	6005	broad.mit.edu	37	6	49604649	49604650	+	5'Flank	INS	-	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49604649_49604650insA	uc003ozk.3	-						RHAG_uc010jzl.2_5'Flank|RHAG_uc010jzm.2_5'Flank	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein						carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)					GACATCACAAGAAAAAAAAAAT	0.406													6	3	---	---	---	---	
ALDH8A1	64577	broad.mit.edu	37	6	135265198	135265199	+	Intron	INS	-	TTTTG	TTTTG	rs146661388	by1000genomes	TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135265198_135265199insTTTTG	uc003qew.2	-						ALDH8A1_uc003qex.2_Intron|ALDH8A1_uc010kgh.2_Intron|ALDH8A1_uc011ecx.1_Intron	NM_022568	NP_072090	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8A1 isoform 1						retinal metabolic process	cytoplasm	retinal dehydrogenase activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		ACACACCTCATttttgttttgt	0.243													4	2	---	---	---	---	
GTF2IRD1	9569	broad.mit.edu	37	7	74004033	74004033	+	Intron	DEL	A	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74004033delA	uc003uaq.2	+						GTF2IRD1_uc010lbq.2_Intron|GTF2IRD1_uc003uap.2_Intron|GTF2IRD1_uc003uar.1_Intron	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1							nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						tctcaaaaggaaaaaaaaaaa	0.244													4	2	---	---	---	---	
NSUN5P1	155400	broad.mit.edu	37	7	75045497	75045497	+	Intron	DEL	G	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75045497delG	uc003udh.1	+						NSUN5P1_uc003ude.1_Intron|NSUN5P1_uc003udf.1_Intron|NSUN5P1_uc003udg.1_Intron	NM_145645	NP_663620			NOL1/NOP2/Sun domain family, member 5B												0						GGGTCGTGGAGGGGGGGGATG	0.657													4	3	---	---	---	---	
MCPH1	79648	broad.mit.edu	37	8	6272541	6272541	+	Intron	DEL	G	-	-	rs3214738		TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6272541delG	uc003wqi.2	+						MCPH1_uc003wqh.2_Intron|MCPH1_uc011kwl.1_Intron	NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		CTAGTAATTTGAAATCCTCCA	0.408													3	3	---	---	---	---	
DEPDC6	64798	broad.mit.edu	37	8	121061618	121061618	+	Intron	DEL	T	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121061618delT	uc003yow.3	+						DEPDC6_uc011lid.1_Intron	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			actaaaacgattttttttttt	0.129													4	2	---	---	---	---	
BRD3	8019	broad.mit.edu	37	9	136906781	136906782	+	Intron	INS	-	C	C	rs145199743	by1000genomes	TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136906781_136906782insC	uc004cew.2	-						BRD3_uc004cex.2_Intron	NM_007371	NP_031397	Q15059	BRD3_HUMAN	bromodomain containing protein 3							nucleus	protein binding		BRD3/C15orf55(3)	stomach(4)|midline_organs(3)|kidney(1)	8				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		GCTGAGGGACAGGGGCAGAGGA	0.653			T	NUT|C15orf55	lethal midline carcinoma of young people								3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	121312535	121312536	+	IGR	INS	-	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121312535_121312536insA								RGS10 (10313 upstream) : TIAL1 (20442 downstream)																							gcaagactctcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135455131	135455131	+	IGR	DEL	C	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135455131delC								FRG2B (14832 upstream) : LOC653544 (35148 downstream)																							TACAAAAAAACGATGAGGAAA	0.343													4	3	---	---	---	---	
MMP12	4321	broad.mit.edu	37	11	102737277	102737283	+	Intron	DEL	TTTCCAT	-	-	rs28381683		TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102737277_102737283delTTTCCAT	uc001phk.2	-							NM_002426	NP_002417	P39900	MMP12_HUMAN	matrix metalloproteinase 12 preproprotein						positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)	CCAATATTTCTTTCCATTGTCTTCACA	0.353													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	13004257	13004258	+	IGR	INS	-	A	A			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13004257_13004258insA								DDX47 (21348 upstream) : RPL13AP20 (24153 downstream)																							TGATTATTGTTAAAAAAAAAAA	0.396													9	5	---	---	---	---	
WHAMML1	339005	broad.mit.edu	37	15	23205231	23205231	+	Intron	DEL	G	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23205231delG	uc001yvg.2	-						WHAMML1_uc010ayc.2_Intron|WHAMML1_uc010ayd.2_Intron|WHAMML1_uc010aye.1_5'Flank	NR_003521				Homo sapiens mRNA; cDNA DKFZp313L2232 (from clone DKFZp313L2232).												0						GCTCAAGTCAGGACAGTGTAA	0.333													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	32635922	32635922	+	5'Flank	DEL	T	-	-			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32635922delT	uc001zfv.1	-						uc001zfw.1_5'Flank					Homo sapiens cDNA FLJ43588 fis, clone SKNSH2009991.																		CATAACGCTCTTTTTTTTTTT	0.413													4	3	---	---	---	---	
PSTPIP1	9051	broad.mit.edu	37	15	77310785	77310786	+	Intron	INS	-	T	T			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77310785_77310786insT	uc002bcf.2	+						PSTPIP1_uc010bkt.1_Intron|PSTPIP1_uc010umo.1_Intron|PSTPIP1_uc010bku.1_Intron|PSTPIP1_uc002bcg.2_Intron|PSTPIP1_uc010bkv.1_Intron|PSTPIP1_uc010bkw.1_Intron	NM_003978	NP_003969	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting						cell adhesion|signal transduction	cleavage furrow|lamellipodium|perinuclear region of cytoplasm	catalytic activity			ovary(1)	1						TTCAAATGCCCTTTTTTTTGCA	0.554													4	2	---	---	---	---	
UNKL	64718	broad.mit.edu	37	16	1451528	1451529	+	Intron	INS	-	C	C			TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1451528_1451529insC	uc010bro.1	-						UNKL_uc002clq.2_Intron	NM_001037125	NP_001032202	Q9H9P5	UNKL_HUMAN	unkempt homolog (Drosophila)-like isoform 2							cytoplasm|nucleus	ligase activity|nucleic acid binding|zinc ion binding				0		Hepatocellular(780;0.0893)				CGCTGTGCCCGCCCCCCCCACC	0.540													4	2	---	---	---	---	
PRSS21	10942	broad.mit.edu	37	16	2867531	2867532	+	Intron	INS	-	G	G	rs111876704		TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2867531_2867532insG	uc002crt.2	+						PRSS21_uc002crs.2_Intron|PRSS21_uc002crr.2_Intron	NM_006799	NP_006790	Q9Y6M0	TEST_HUMAN	testisin isoform 1						proteolysis	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	serine-type endopeptidase activity			ovary(1)|skin(1)	2						GAGGGGGTAGAGGGGGGCCTTT	0.698													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25031511	25031512	+	IGR	INS	-	GGAAGGAA	GGAAGGAA	rs7498498	by1000genomes	TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25031511_25031512insGGAAGGAA								ARHGAP17 (4836 upstream) : LCMT1 (91535 downstream)																							gaaggaaggacggaaggaagga	0.144													4	3	---	---	---	---	
GLOD4	51031	broad.mit.edu	37	17	673935	673936	+	Intron	INS	-	T	T	rs79441857		TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:673935_673936insT	uc002frv.2	-						GLOD4_uc002frt.2_Intron|GLOD4_uc002fru.2_Intron|GLOD4_uc010vqc.1_Intron	NM_016080	NP_057164	Q9HC38	GLOD4_HUMAN	glyoxalase domain containing 4							mitochondrion					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		acgcatctatgttttttttttt	0.000													4	3	---	---	---	---	
ALOX12B	242	broad.mit.edu	37	17	7990528	7990537	+	Intron	DEL	ACACACAGAC	-	-	rs67354772		TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7990528_7990537delACACACAGAC	uc002gjy.1	-						hsa-mir-4314|MI0015846_5'Flank	NM_001139	NP_001130	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type						epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity				0						GGCCACAAAGacacacagacacacacagac	0.400										Multiple Myeloma(8;0.094)			6	4	---	---	---	---	
MYH4	4622	broad.mit.edu	37	17	10359842	10359842	+	Frame_Shift_Del	DEL	T	-	-	rs137989230		TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10359842delT	uc002gmn.2	-	17	2039	c.1928delA	c.(1927-1929)AAGfs	p.K643fs	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	643	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						AGAACCCTTCTTTTTGCCACC	0.338													40	33	---	---	---	---	
PTPRS	5802	broad.mit.edu	37	19	5239175	5239176	+	Intron	INS	-	GA	GA	rs79455606		TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5239175_5239176insGA	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc010xin.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		ggggggagggggagagagagag	0.124													7	4	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26709565	26709570	+	Intron	DEL	CACACG	-	-	rs150855077	by1000genomes	TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26709565_26709570delCACACG	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						cacacacacacacacgcacacacaca	0.413													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	134748987	134748987	+	IGR	DEL	T	-	-	rs66464343		TCGA-22-5474-01	TCGA-22-5474-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134748987delT								DDX26B (32528 upstream) : CT45A1 (98198 downstream)																							TCAATCATAGTTCATACTATT	0.433													8	4	---	---	---	---	
