Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CAMTA1	23261	broad.mit.edu	37	1	7805028	7805028	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7805028G>T	uc001aoi.2	+	17	4523	c.4316G>T	c.(4315-4317)TGG>TTG	p.W1439L	CAMTA1_uc010nzv.1_Missense_Mutation_p.W526L|CAMTA1_uc001aok.3_Missense_Mutation_p.W482L|CAMTA1_uc001aoj.2_Missense_Mutation_p.W395L|CAMTA1_uc009vmf.2_Missense_Mutation_p.W43L	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	1439					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		ACAATGAGCTGGCTGGCCAGT	0.532													14	38	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7805029	7805029	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7805029G>C	uc001aoi.2	+	17	4524	c.4317G>C	c.(4315-4317)TGG>TGC	p.W1439C	CAMTA1_uc010nzv.1_Missense_Mutation_p.W526C|CAMTA1_uc001aok.3_Missense_Mutation_p.W482C|CAMTA1_uc001aoj.2_Missense_Mutation_p.W395C|CAMTA1_uc009vmf.2_Missense_Mutation_p.W43C	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	1439					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CAATGAGCTGGCTGGCCAGTT	0.527													12	38	---	---	---	---	PASS
ZBTB40	9923	broad.mit.edu	37	1	22846715	22846715	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22846715A>C	uc001bft.2	+	15	3506	c.2995A>C	c.(2995-2997)ACC>CCC	p.T999P	ZBTB40_uc001bfu.2_Missense_Mutation_p.T999P|ZBTB40_uc009vqi.1_Missense_Mutation_p.T887P	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	999	C2H2-type 7.				bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		GCACGTGGTGACCCACGTTGG	0.622													7	34	---	---	---	---	PASS
PTPRU	10076	broad.mit.edu	37	1	29651779	29651779	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29651779G>T	uc001bru.2	+	30	4329	c.4219G>T	c.(4219-4221)GAC>TAC	p.D1407Y	PTPRU_uc001brv.2_Missense_Mutation_p.D1403Y|PTPRU_uc001brw.2_Missense_Mutation_p.D1397Y|PTPRU_uc009vtq.2_Missense_Mutation_p.D1401Y|PTPRU_uc009vtr.2_Missense_Mutation_p.D1394Y|PTPRU_uc001brx.2_Missense_Mutation_p.D133Y	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1407	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CAACTTGGTGGACGTTTTCTT	0.582													27	57	---	---	---	---	PASS
ZBTB8A	653121	broad.mit.edu	37	1	33060763	33060763	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33060763C>T	uc001bvn.2	+	4	1417	c.932C>T	c.(931-933)CCA>CTA	p.P311L	ZBTB8A_uc001bvk.2_RNA|ZBTB8A_uc001bvm.2_Missense_Mutation_p.P311L	NM_001040441	NP_001035531	Q96BR9	ZBT8A_HUMAN	zinc finger and BTB domain containing 8A	311	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGGCCCTATCCATGTCAAGCT	0.433													23	70	---	---	---	---	PASS
ZBTB8OS	339487	broad.mit.edu	37	1	33099247	33099247	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33099247C>A	uc001bvp.2	-	4	381	c.362G>T	c.(361-363)CGG>CTG	p.R121L	ZBTB8OS_uc001bvo.1_Intron|ZBTB8OS_uc001bvq.2_Missense_Mutation_p.R109L	NM_178547	NP_848642	Q8IWT0	ARCH_HUMAN	zinc finger and BTB domain containing 8 opposite	109											0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TTTGCTTACCCGGGGTATGAA	0.328													6	23	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39800752	39800752	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39800752C>T	uc010oiu.1	+	1	3943	c.3812C>T	c.(3811-3813)TCT>TTT	p.S1271F	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	2836					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTGAGAGTTTCTGATGGGGAG	0.373													3	16	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39800780	39800780	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39800780G>T	uc010oiu.1	+	1	3971	c.3840G>T	c.(3838-3840)AGG>AGT	p.R1280S	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	2845					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AAAAGAGCAGGGAAATTTCCT	0.363													7	20	---	---	---	---	PASS
MPL	4352	broad.mit.edu	37	1	43804366	43804366	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43804366G>A	uc001ciw.2	+	3	411	c.366G>A	c.(364-366)CAG>CAA	p.Q122Q	MPL_uc001civ.2_Silent_p.Q122Q|MPL_uc009vwr.2_Silent_p.Q115Q	NM_005373	NP_005364	P40238	TPOR_HUMAN	myeloproliferative leukemia virus oncogene	122	Extracellular (Potential).				cell proliferation|platelet activation	integral to plasma membrane	cytokine receptor activity			haematopoietic_and_lymphoid_tissue(361)|upper_aerodigestive_tract(1)|pancreas(1)	363	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTCGGACTCAGCGAGTCCTCT	0.572			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia						14	44	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43898249	43898249	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43898249T>G	uc001cjk.1	+	23	3269	c.2807T>G	c.(2806-2808)ATC>AGC	p.I936S		NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	1835						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GTCCCCCTCATCAGCCTGCCC	0.612													27	72	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67208762	67208762	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67208762A>G	uc001dcr.2	+	25	2688	c.2471A>G	c.(2470-2472)TAC>TGC	p.Y824C	SGIP1_uc010opd.1_Missense_Mutation_p.Y424C|SGIP1_uc001dcs.2_Missense_Mutation_p.Y424C|SGIP1_uc001dct.2_Missense_Mutation_p.Y426C|SGIP1_uc009wat.2_Missense_Mutation_p.Y618C|SGIP1_uc001dcu.2_Missense_Mutation_p.Y329C	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	824					positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						GCAGGAAAATACTTGGCAGAT	0.328													11	49	---	---	---	---	PASS
PTGER3	5733	broad.mit.edu	37	1	71440049	71440049	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71440049T>C	uc001dfg.1	-	3	1331	c.1100A>G	c.(1099-1101)TAT>TGT	p.Y367C	PTGER3_uc001dfh.1_Intron|PTGER3_uc001dfi.1_Intron|PTGER3_uc001dfj.1_Intron|PTGER3_uc001dfk.1_Intron|PTGER3_uc001dfl.1_Intron|PTGER3_uc009wbm.1_Intron|PTGER3_uc001dfm.1_RNA|PTGER3_uc001dfn.2_Intron|PTGER3_uc009wbn.1_Intron|PTGER3_uc009wbo.2_Missense_Mutation_p.Y367C|PTGER3_uc001dfo.2_Intron|PTGER3_uc001dfp.1_Missense_Mutation_p.Y367C	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform	367	Cytoplasmic (Potential).				cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)	gctggatgcatagttgtttgt	0.144													9	29	---	---	---	---	PASS
PTGER3	5733	broad.mit.edu	37	1	71440051	71440051	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71440051G>T	uc001dfg.1	-	3	1329	c.1098C>A	c.(1096-1098)AAC>AAA	p.N366K	PTGER3_uc001dfh.1_Intron|PTGER3_uc001dfi.1_Intron|PTGER3_uc001dfj.1_Intron|PTGER3_uc001dfk.1_Intron|PTGER3_uc001dfl.1_Intron|PTGER3_uc009wbm.1_Intron|PTGER3_uc001dfm.1_RNA|PTGER3_uc001dfn.2_Intron|PTGER3_uc009wbn.1_Intron|PTGER3_uc009wbo.2_Missense_Mutation_p.N366K|PTGER3_uc001dfo.2_Intron|PTGER3_uc001dfp.1_Missense_Mutation_p.N366K	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform	366	Cytoplasmic (Potential).				cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)	tggatgcatagttgtttgtgt	0.134													10	28	---	---	---	---	PASS
GIPC2	54810	broad.mit.edu	37	1	78560770	78560770	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78560770G>T	uc001dik.2	+	3	751	c.561G>T	c.(559-561)AAG>AAT	p.K187N		NM_017655	NP_060125	Q8TF65	GIPC2_HUMAN	PDZ domain protein GIPC2	187	PDZ.					cytoplasm				ovary(1)	1						AATTAAAAAAGGAGGAACTCT	0.383													14	48	---	---	---	---	PASS
GIPC2	54810	broad.mit.edu	37	1	78560771	78560771	+	Nonsense_Mutation	SNP	G	T	T	rs138753471	byFrequency	TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78560771G>T	uc001dik.2	+	3	752	c.562G>T	c.(562-564)GAG>TAG	p.E188*		NM_017655	NP_060125	Q8TF65	GIPC2_HUMAN	PDZ domain protein GIPC2	188	PDZ.					cytoplasm				ovary(1)	1						ATTAAAAAAGGAGGAACTCTT	0.388													14	48	---	---	---	---	PASS
WDR47	22911	broad.mit.edu	37	1	109524461	109524461	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109524461C>A	uc001dwj.2	-	13	2668	c.2292G>T	c.(2290-2292)TGG>TGT	p.W764C	WDR47_uc001dwl.2_Missense_Mutation_p.W772C|WDR47_uc001dwi.2_Missense_Mutation_p.W765C|WDR47_uc010ovf.1_Missense_Mutation_p.W689C	NM_001142551	NP_001136023	O94967	WDR47_HUMAN	WD repeat domain 47 isoform 3	764	WD 4.									ovary(1)	1		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		TCCAGCCACTCCAGGTATAAA	0.378													18	40	---	---	---	---	PASS
WDR47	22911	broad.mit.edu	37	1	109524490	109524490	+	Intron	SNP	T	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109524490T>G	uc001dwj.2	-						WDR47_uc001dwl.2_Intron|WDR47_uc001dwi.2_Intron|WDR47_uc010ovf.1_Intron	NM_001142551	NP_001136023	O94967	WDR47_HUMAN	WD repeat domain 47 isoform 3											ovary(1)	1		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		ATATGCCCTATAAAAGATCAT	0.323													18	34	---	---	---	---	PASS
GSTM1	2944	broad.mit.edu	37	1	110232997	110232997	+	Intron	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110232997G>T	uc001dyk.2	+						GSTM1_uc001dyl.2_Intron	NM_000561	NP_000552	P09488	GSTM1_HUMAN	glutathione S-transferase mu 1 isoform 1						xenobiotic metabolic process	cytosol	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	AGGTAAAGGAGGAGTGATATG	0.458									Melanoma_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				54	113	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144881450	144881450	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144881450T>C	uc001elw.3	-	25	4037	c.3746A>G	c.(3745-3747)GAG>GGG	p.E1249G	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.E1205G|PDE4DIP_uc001elv.3_Missense_Mutation_p.E256G	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1249					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TCTGTATTTCTCCAGCTCGTT	0.408			T	PDGFRB	MPD								33	192	---	---	---	---	PASS
RORC	6097	broad.mit.edu	37	1	151786031	151786031	+	Silent	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151786031C>T	uc001ezh.2	-	7	1107	c.999G>A	c.(997-999)GAG>GAA	p.E333E	RORC_uc001ezg.2_Silent_p.E312E|RORC_uc010pdo.1_Silent_p.E387E|RORC_uc010pdp.1_Silent_p.E333E	NM_005060	NP_005051	P51449	RORG_HUMAN	RAR-related orphan receptor C isoform a	333	Ligand-binding.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TCTTGGCGAACTCCACCACGT	0.612													9	24	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157485497	157485497	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157485497G>A	uc001fqu.2	-	17	3060	c.2902C>T	c.(2902-2904)CTG>TTG	p.L968L	FCRL5_uc009wsm.2_Silent_p.P964P	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	968	Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GCCAAGAACAGGGATCCGGAA	0.577													30	104	---	---	---	---	PASS
CADM3	57863	broad.mit.edu	37	1	159166195	159166195	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159166195C>T	uc001ftl.2	+	6	875	c.733C>T	c.(733-735)CGT>TGT	p.R245C	CADM3_uc009wsy.1_Missense_Mutation_p.R199C|CADM3_uc001ftk.2_Missense_Mutation_p.R279C	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2	245	Ig-like C2-type 2.|Extracellular (Potential).				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)					TCCCCATCCTCGTGAGGGCCA	0.517											OREG0013913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	12	---	---	---	---	PASS
LY9	4063	broad.mit.edu	37	1	160784493	160784493	+	Silent	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160784493C>T	uc001fwu.2	+	4	1064	c.1014C>T	c.(1012-1014)TAC>TAT	p.Y338Y	LY9_uc010pjs.1_Silent_p.Y338Y|LY9_uc001fwv.2_Silent_p.Y338Y|LY9_uc001fww.2_Silent_p.Y338Y|LY9_uc001fwx.2_Silent_p.Y338Y|LY9_uc001fwy.1_Silent_p.Y240Y|LY9_uc001fwz.2_Translation_Start_Site	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	338	Extracellular (Potential).|Ig-like V-type 2.				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			ACCATGCCTACGTGTGCTCAG	0.587													6	19	---	---	---	---	PASS
MPZL1	9019	broad.mit.edu	37	1	167742573	167742573	+	Silent	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167742573T>C	uc001geo.2	+	4	775	c.573T>C	c.(571-573)TAT>TAC	p.Y191Y	MPZL1_uc001gen.3_Silent_p.Y191Y|MPZL1_uc001gep.2_Silent_p.Y191Y|MPZL1_uc001geq.2_Intron|MPZL1_uc009wvh.2_RNA	NM_003953	NP_003944	O95297	MPZL1_HUMAN	myelin protein zero-like 1 isoform a	191	Cytoplasmic (Potential).				cell-cell signaling|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	protein binding|structural molecule activity			ovary(2)	2	all_hematologic(923;0.215)					CTGTCCTCTATAGAAGGAAAA	0.453													25	42	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175092743	175092743	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175092743T>C	uc001gkl.1	+	12	2971	c.2858T>C	c.(2857-2859)GTG>GCG	p.V953A		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	953	Fibronectin type-III 8.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ATGGTGCACGTGTGGGCCCAG	0.622													19	34	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175334287	175334287	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175334287C>G	uc001gkp.1	-	10	2527	c.2446G>C	c.(2446-2448)GAG>CAG	p.E816Q	TNR_uc009wwu.1_Missense_Mutation_p.E816Q	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	816	Fibronectin type-III 6.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					TCCATCATCTCTTCCTCCTCA	0.532													10	46	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176738821	176738821	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176738821G>T	uc001gkz.2	+	16	5566	c.4402G>T	c.(4402-4404)GAC>TAC	p.D1468Y	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1468	Sushi 2.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CGGTGTTCCCGACCCGTCTTT	0.507													21	44	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201034963	201034963	+	Intron	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201034963C>T	uc001gvv.2	-							NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	GGCTGGGGCTCACCTTGAAGA	0.587													3	8	---	---	---	---	PASS
CR2	1380	broad.mit.edu	37	1	207647145	207647145	+	Splice_Site	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207647145G>C	uc001hfw.2	+	11	2073	c.1979_splice	c.e11-1	p.E660_splice	CR2_uc001hfv.2_Splice_Site_p.E719_splice|CR2_uc009xch.2_Splice_Site_p.E660_splice	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)						complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						TGCTTCTCCAGAAACATGCCA	0.453													28	55	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207696963	207696963	+	Silent	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207696963T>C	uc001hfy.2	+	5	635	c.495T>C	c.(493-495)CCT>CCC	p.P165P	CR1_uc009xcl.1_Silent_p.P165P|CR1_uc001hfx.2_Silent_p.P165P|CR1_uc009xcj.1_Silent_p.P165P|CR1_uc009xck.1_Silent_p.P165P	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	165	Extracellular (Potential).|Sushi 3.				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						CAGGAATTCCTTGTGGGCTAC	0.398													4	24	---	---	---	---	PASS
INTS7	25896	broad.mit.edu	37	1	212180086	212180086	+	Silent	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212180086C>T	uc001hiw.1	-	7	879	c.774G>A	c.(772-774)CAG>CAA	p.Q258Q	INTS7_uc009xdb.1_Silent_p.Q258Q|INTS7_uc001hix.1_Silent_p.Q134Q|INTS7_uc001hiy.1_Silent_p.Q258Q|INTS7_uc010pta.1_Silent_p.Q209Q	NM_015434	NP_056249	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	258					snRNA processing	integrator complex	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		TCTTCAAATACTGCAACAGAA	0.294													20	62	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215847809	215847809	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215847809C>T	uc001hku.1	-	63	13831	c.13444G>A	c.(13444-13446)GAT>AAT	p.D4482N		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4482	Fibronectin type-III 30.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATGGTTCCATCCCTCCTAAGT	0.453										HNSCC(13;0.011)			30	79	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216019303	216019303	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216019303A>G	uc001hku.1	-	45	9305	c.8918T>C	c.(8917-8919)CTA>CCA	p.L2973P		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2973	Fibronectin type-III 16.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAAGATTTTTAGAGAGTCGTT	0.408										HNSCC(13;0.011)			9	31	---	---	---	---	PASS
RHOU	58480	broad.mit.edu	37	1	228879123	228879123	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228879123A>T	uc001htf.2	+	3	1034	c.413A>T	c.(412-414)AAC>ATC	p.N138I		NM_021205	NP_067028	Q7L0Q8	RHOU_HUMAN	ras homolog gene family, member U	138					regulation of small GTPase mediated signal transduction	cell projection|cytosol|focal adhesion|Golgi membrane|podosome	GTP binding|metal ion binding|protein binding				0	Breast(184;0.162)	Prostate(94;0.183)				TCCTTCCAGAACGTCAGTGAG	0.522													15	92	---	---	---	---	PASS
NUP133	55746	broad.mit.edu	37	1	229596517	229596517	+	Splice_Site	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229596517C>G	uc001htn.2	-	20	2778	c.2686_splice	c.e20-1	p.N896_splice		NM_018230	NP_060700	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			breast(4)|skin(2)|ovary(1)	7	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				CTGAAAAATTCTACAAATAAC	0.328													3	32	---	---	---	---	PASS
SLC35F3	148641	broad.mit.edu	37	1	234367239	234367239	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234367239G>A	uc001hwa.1	+	2	381	c.153G>A	c.(151-153)GCG>GCA	p.A51A	SLC35F3_uc001hvy.1_Silent_p.A120A	NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	51					transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			GCGGGAGAGCGAGTCGCCGCT	0.741													6	19	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247587806	247587806	+	Missense_Mutation	SNP	C	A	A	rs121908149		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247587806C>A	uc001icr.2	+	5	1199	c.1061C>A	c.(1060-1062)GCC>GAC	p.A354D	NLRP3_uc001ics.2_Missense_Mutation_p.A354D|NLRP3_uc001icu.2_Missense_Mutation_p.A354D|NLRP3_uc001icw.2_Missense_Mutation_p.A354D|NLRP3_uc001icv.2_Missense_Mutation_p.A354D|NLRP3_uc010pyw.1_Missense_Mutation_p.A352D|NLRP3_uc001ict.1_Missense_Mutation_p.A352D	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	354	NACHT.		A -> V (in MWS).		detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGACCTGTGGCCCTGGAGAAA	0.557													19	40	---	---	---	---	PASS
OR14A16	284532	broad.mit.edu	37	1	247978807	247978807	+	Silent	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247978807C>A	uc001idm.1	-	1	225	c.225G>T	c.(223-225)ACG>ACT	p.T75T		NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A,	75	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATTTGGGAGCCGTGACTGAAA	0.418													7	28	---	---	---	---	PASS
TPO	7173	broad.mit.edu	37	2	1488614	1488614	+	Missense_Mutation	SNP	T	G	G	rs114401108	byFrequency	TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1488614T>G	uc002qww.2	+	9	1676	c.1585T>G	c.(1585-1587)TTA>GTA	p.L529V	TPO_uc010ewj.2_RNA|TPO_uc002qwu.2_Missense_Mutation_p.L529V|TPO_uc002qwr.2_Missense_Mutation_p.L529V|TPO_uc002qwx.2_Missense_Mutation_p.L529V|TPO_uc010yio.1_Missense_Mutation_p.L356V|TPO_uc010yip.1_Missense_Mutation_p.L529V|TPO_uc002qwy.1_5'UTR|TPO_uc002qwz.2_RNA	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	529	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CCCATGGACATTACTCCGTGG	0.507													8	32	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25464474	25464474	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25464474T>C	uc002rgc.2	-	17	2296	c.2039A>G	c.(2038-2040)AAG>AGG	p.K680R	DNMT3A_uc002rgd.2_Missense_Mutation_p.K680R|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.K491R	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	680					regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTACATGATCTTCCCCTGGTG	0.617			Mis|F|N|S		AML								7	19	---	---	---	---	PASS
BCL11A	53335	broad.mit.edu	37	2	60687659	60687659	+	Silent	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60687659C>T	uc002sae.1	-	4	2616	c.2388G>A	c.(2386-2388)GGG>GGA	p.G796G	BCL11A_uc002sab.2_Intron|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Intron|BCL11A_uc010ypj.1_Intron|BCL11A_uc002sad.1_Silent_p.G644G|BCL11A_uc002saf.1_Silent_p.G762G	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	796					negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			AAACGTCCTTCCCCACCTGGC	0.478			T	IGH@	B-CLL								16	185	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116534843	116534843	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116534843G>C	uc002tla.1	+	14	1738	c.1281G>C	c.(1279-1281)AAG>AAC	p.K427N	DPP10_uc002tlb.1_Missense_Mutation_p.K377N|DPP10_uc002tlc.1_Missense_Mutation_p.K423N|DPP10_uc002tle.2_Missense_Mutation_p.K431N|DPP10_uc002tlf.1_Missense_Mutation_p.K420N	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	427	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						AAGTGATAAAGATCTTGGCAT	0.358													9	23	---	---	---	---	PASS
PTPN4	5775	broad.mit.edu	37	2	120714483	120714483	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120714483A>G	uc002tmf.1	+	21	2815	c.2044A>G	c.(2044-2046)AAA>GAA	p.K682E	PTPN4_uc010flj.1_Missense_Mutation_p.K395E|PTPN4_uc010yyr.1_Missense_Mutation_p.K315E	NM_002830	NP_002821	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type	682	Tyrosine-protein phosphatase.					cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity			ovary(2)	2					Alendronate(DB00630)	GAATATTTCCAAAAATAGATA	0.269													21	58	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125660468	125660468	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125660468G>T	uc002tno.2	+	22	3807	c.3443G>T	c.(3442-3444)GGT>GTT	p.G1148V	CNTNAP5_uc010flu.2_Missense_Mutation_p.G1149V	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	1148	Extracellular (Potential).|Laminin G-like 4.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GAGAATCTTGGTTTGGATTCT	0.403													3	13	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133539728	133539728	+	Silent	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133539728T>C	uc002ttp.2	-	14	5030	c.4656A>G	c.(4654-4656)AAA>AAG	p.K1552K	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	1552							protein binding				0						TTTTCTCTTTTTTTCTTTCTG	0.383													15	60	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160255379	160255379	+	Silent	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160255379C>T	uc002uao.2	-	18	3277	c.2925G>A	c.(2923-2925)GCG>GCA	p.A975A	BAZ2B_uc002uap.2_Silent_p.A939A|BAZ2B_uc002uaq.1_Silent_p.A805A	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	975	Lys-rich.|Potential.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						TGGCATTTGCCGCTTCTTCCT	0.343													12	32	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162735785	162735785	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162735785C>A	uc002ubx.3	+	9	1277	c.1093C>A	c.(1093-1095)CCA>ACA	p.P365T	SLC4A10_uc010fpa.1_Missense_Mutation_p.P377T|SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Missense_Mutation_p.P335T|SLC4A10_uc010zcs.1_Missense_Mutation_p.P346T	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	365	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						GGCTGAAGTCCCAATCCCAAC	0.388													17	80	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166201106	166201106	+	Silent	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166201106T>C	uc002udc.2	+	16	2894	c.2604T>C	c.(2602-2604)AAT>AAC	p.N868N	SCN2A_uc002udd.2_Silent_p.N868N|SCN2A_uc002ude.2_Silent_p.N868N	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	868	II.				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	CAACTCTAAATATGCTAATTA	0.408													18	39	---	---	---	---	PASS
TLK1	9874	broad.mit.edu	37	2	171939356	171939356	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171939356T>C	uc002ugn.2	-	3	737	c.265A>G	c.(265-267)ACA>GCA	p.T89A	TLK1_uc002ugo.2_Missense_Mutation_p.T89A|TLK1_uc002ugp.2_Missense_Mutation_p.T41A|TLK1_uc002ugq.2_RNA	NM_012290	NP_036422	Q9UKI8	TLK1_HUMAN	tousled-like kinase 1 isoform 1	89					cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1						TCGTTATTTGTTGAGGCCTGT	0.279													19	58	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179402307	179402307	+	Silent	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179402307A>G	uc010zfg.1	-	304	92147	c.91923T>C	c.(91921-91923)GCT>GCC	p.A30641A	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.A24336A|TTN_uc010zfi.1_Silent_p.A24269A|TTN_uc010zfj.1_Silent_p.A24144A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31568							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGAACCCACAGCTCCATAAT	0.453													6	28	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196709795	196709795	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196709795G>C	uc002utj.3	-	47	8977	c.8876C>G	c.(8875-8877)ACA>AGA	p.T2959R		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2959	AAA 5 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						AGTTCGAATTGTCACAGCTTC	0.373													6	18	---	---	---	---	PASS
CDK15	65061	broad.mit.edu	37	2	202725543	202725543	+	Intron	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202725543T>C	uc002uyt.2	+						CDK15_uc010ftm.2_Intron|CDK15_uc002uys.2_Intron|CDK15_uc010ftn.1_Intron|CDK15_uc010fto.1_Silent_p.N342N|CDK15_uc002uyu.1_Intron	NM_139158	NP_631897	Q96Q40	CDK15_HUMAN	PFTAIRE protein kinase 2								ATP binding|cyclin-dependent protein kinase activity|metal ion binding|protein binding			breast(2)|ovary(1)|lung(1)|kidney(1)	5					Adenosine triphosphate(DB00171)	GTTCTAGGAATGTCTCATTTT	0.453													10	24	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207170724	207170724	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207170724G>C	uc002vbp.2	+	5	1722	c.1472G>C	c.(1471-1473)AGT>ACT	p.S491T		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	491							nucleic acid binding|zinc ion binding			ovary(3)	3						GAATCTAGTAGTTCTGAAACG	0.393													10	37	---	---	---	---	PASS
VWC2L	402117	broad.mit.edu	37	2	215440509	215440509	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215440509T>C	uc002vet.2	+	4	764	c.634T>C	c.(634-636)TCG>CCG	p.S212P	VWC2L_uc010zjl.1_3'UTR	NM_001080500	NP_001073969	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain-containing	212						extracellular region					0						TGCTCAGTGTTCGAAACGTGA	0.473													33	88	---	---	---	---	PASS
PTPRN	5798	broad.mit.edu	37	2	220167470	220167470	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220167470C>T	uc002vkz.2	-	5	556	c.467G>A	c.(466-468)CGG>CAG	p.R156Q	PTPRN_uc010zlc.1_Missense_Mutation_p.R66Q|PTPRN_uc002vla.2_Missense_Mutation_p.R156Q	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	156	Extracellular (Potential).				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		TTGTGGAAGCCGATGCTGGGC	0.632													20	36	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227886820	227886820	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227886820A>G	uc010zlt.1	-	43	4814	c.4160T>C	c.(4159-4161)ATG>ACG	p.M1387T		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	1387	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TGGTCCTCTCATGCCTGGCGC	0.547													46	119	---	---	---	---	PASS
SP100	6672	broad.mit.edu	37	2	231405712	231405712	+	Splice_Site	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231405712G>T	uc002vqu.1	+	26	2472	c.2331_splice	c.e26+1	p.L777_splice	SP100_uc010fxp.1_Splice_Site_p.L95_splice	NM_001080391	NP_001073860	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 1						DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GGAGCAGTTGGTGAGTAAAAA	0.478													14	44	---	---	---	---	PASS
NDUFA10	4705	broad.mit.edu	37	2	240929490	240929490	+	Splice_Site	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240929490C>T	uc002vyn.2	-	9	1079	c.999_splice	c.e9+1	p.E333_splice	NDUFA10_uc010fzc.1_Splice_Site_p.E363_splice	NM_004544	NP_004535	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transport	mitochondrial matrix|mitochondrial respiratory chain complex I	ATP binding|NADH dehydrogenase (ubiquinone) activity|phosphotransferase activity, alcohol group as acceptor			central_nervous_system(1)	1		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)	NADH(DB00157)	CACAGTCTTACCTCTCTGAAC	0.473													12	28	---	---	---	---	PASS
AGXT	189	broad.mit.edu	37	2	241817438	241817438	+	Splice_Site	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241817438G>T	uc002waa.3	+	10	1064	c.943_splice	c.e10-1	p.A315_splice	AGXT_uc002wab.3_Splice_Site_p.A193_splice	NM_000030	NP_000021	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase						glyoxylate metabolic process|protein targeting to peroxisome	mitochondrial matrix|peroxisomal matrix	alanine-glyoxylate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|serine-pyruvate transaminase activity				0		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	CCCTCCTGCAGGCGCTCCGGC	0.602													6	23	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38739960	38739960	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38739960A>C	uc003ciq.2	-	27	4751	c.4751T>G	c.(4750-4752)CTC>CGC	p.L1584R		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	1584	IV.|Helical; Voltage-sensor; Name=S4 of repeat IV; (Potential).				sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	GATCAGTCTGAGGATGCGGCC	0.522													20	23	---	---	---	---	PASS
ZNF654	55279	broad.mit.edu	37	3	88189354	88189354	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88189354G>T	uc003dqv.2	+	1	1093	c.894G>T	c.(892-894)CAG>CAT	p.Q298H	CGGBP1_uc003dqu.2_Intron	NM_018293	NP_060763	Q8IZM8	ZN654_HUMAN	zinc finger protein 654	298	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(201;0.0283)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		TTCAGGCTCAGTGTAGTTTTC	0.403													28	46	---	---	---	---	PASS
HHLA2	11148	broad.mit.edu	37	3	108076898	108076898	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108076898G>C	uc003dwy.3	+	6	1060	c.893G>C	c.(892-894)AGT>ACT	p.S298T	HHLA2_uc011bhl.1_Missense_Mutation_p.S234T|HHLA2_uc010hpu.2_Missense_Mutation_p.S298T|HHLA2_uc003dwz.2_Missense_Mutation_p.S298T	NM_007072	NP_009003	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2 precursor	298	Ig-like V-type 2.					integral to membrane				ovary(1)	1						ATAAACCAGAGTGACTTCTCT	0.373													23	90	---	---	---	---	PASS
TRAT1	50852	broad.mit.edu	37	3	108572698	108572698	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108572698C>A	uc003dxi.1	+	6	679	c.535C>A	c.(535-537)CGT>AGT	p.R179S	TRAT1_uc010hpx.1_Missense_Mutation_p.R142S	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN	T-cell receptor interacting molecule	179	Cytoplasmic (Potential).				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1						TGGATTGATCCGTGCTAAGAG	0.433													20	87	---	---	---	---	PASS
SIDT1	54847	broad.mit.edu	37	3	113299545	113299545	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113299545C>G	uc003eak.2	+	5	1303	c.652C>G	c.(652-654)CAG>GAG	p.Q218E	SIDT1_uc011bif.1_RNA|SIDT1_uc003eaj.1_Missense_Mutation_p.Q218E|SIDT1_uc011big.1_5'UTR	NM_017699	NP_060169	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1 precursor	218	Extracellular (Potential).					integral to membrane				ovary(3)|pancreas(1)|skin(1)	5						TGTCTCAGTCCAGAATATCAT	0.383													24	84	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121206279	121206279	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121206279G>C	uc003eee.3	-	16	5628	c.5499C>G	c.(5497-5499)GAC>GAG	p.D1833E	POLQ_uc003eed.2_Missense_Mutation_p.D1005E	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	1833					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		AAAGATTTTGGTCACTTGCTA	0.383								DNA_polymerases_(catalytic_subunits)					25	92	---	---	---	---	PASS
PLOD2	5352	broad.mit.edu	37	3	145789221	145789221	+	Intron	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145789221C>A	uc003evs.1	-						PLOD2_uc003evq.1_Intron|PLOD2_uc011bnm.1_Intron|PLOD2_uc003evr.1_Intron	NM_000935	NP_000926	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase						protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2					Vitamin C(DB00126)	CTAGAAACAACATTAATGACA	0.328													3	72	---	---	---	---	PASS
PLSCR4	57088	broad.mit.edu	37	3	145924389	145924389	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145924389T>A	uc010huy.2	-	4	607	c.278A>T	c.(277-279)CAG>CTG	p.Q93L	PLSCR4_uc010huz.2_Missense_Mutation_p.Q93L|PLSCR4_uc003evt.3_Missense_Mutation_p.Q93L|PLSCR4_uc010hva.2_Missense_Mutation_p.Q93L|PLSCR4_uc003evu.3_Missense_Mutation_p.Q78L	NM_001128305	NP_001121777	Q9NRQ2	PLS4_HUMAN	phospholipid scramblase 4 isoform a	93	Cytoplasmic (By similarity).				blood coagulation|phospholipid scrambling	integral to membrane	calcium ion binding|phospholipid scramblase activity|SH3 domain binding				0						TGGAACAGACTGATTTGGCAT	0.468													16	82	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154857994	154857994	+	Silent	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154857994T>C	uc010hvr.1	+	10	1081	c.870T>C	c.(868-870)CCT>CCC	p.P290P	MME_uc003fab.1_Silent_p.P290P|MME_uc003fac.1_Silent_p.P290P|MME_uc003fad.1_Silent_p.P290P|MME_uc003fae.1_Silent_p.P290P	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	290	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	CGGCTAAACCTGAAGATCGAA	0.308													3	36	---	---	---	---	PASS
ZBBX	79740	broad.mit.edu	37	3	167035342	167035342	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167035342G>T	uc003fep.2	-	13	1350	c.1027C>A	c.(1027-1029)CCA>ACA	p.P343T	ZBBX_uc011bpc.1_Missense_Mutation_p.P343T|ZBBX_uc003feq.2_Missense_Mutation_p.P314T	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	343						intracellular	zinc ion binding			ovary(2)	2						TGTGGATGTGGGAACGTATCT	0.338													15	72	---	---	---	---	PASS
FNDC3B	64778	broad.mit.edu	37	3	172080476	172080476	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172080476T>C	uc003fhy.2	+	23	3021	c.2849T>C	c.(2848-2850)ATT>ACT	p.I950T	FNDC3B_uc003fhz.3_Missense_Mutation_p.I950T	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	950	Fibronectin type-III 7.					endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		AGTCAGTTCATTAAAGCAAAA	0.433													36	49	---	---	---	---	PASS
EIF4G1	1981	broad.mit.edu	37	3	184043326	184043326	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184043326A>G	uc003fnp.2	+	20	3218	c.3020A>G	c.(3019-3021)AAG>AGG	p.K1007R	EIF4G1_uc003fnt.2_Missense_Mutation_p.K718R|EIF4G1_uc003fnq.2_Missense_Mutation_p.K920R|EIF4G1_uc003fnr.2_Missense_Mutation_p.K843R|EIF4G1_uc010hxx.2_Missense_Mutation_p.K1014R|EIF4G1_uc003fns.2_Missense_Mutation_p.K967R|EIF4G1_uc010hxy.2_Missense_Mutation_p.K1014R|EIF4G1_uc003fnv.3_Missense_Mutation_p.K1008R|EIF4G1_uc003fnu.3_Missense_Mutation_p.K1007R|EIF4G1_uc003fnw.2_Missense_Mutation_p.K1014R|EIF4G1_uc003fnx.2_Missense_Mutation_p.K812R|EIF4G1_uc003fny.3_Missense_Mutation_p.K811R|SNORD66_uc003fnz.2_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	1007	eIF3/EIF4A-binding.				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGATCCATAAGGAGGCTGAG	0.592													34	113	---	---	---	---	PASS
PDE6B	5158	broad.mit.edu	37	4	651290	651290	+	Intron	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:651290C>A	uc003gap.2	+						PDE6B_uc003gao.3_Intron|PDE6B_uc011buy.1_Intron|uc003gaq.1_5'Flank	NM_000283	NP_000274	P35913	PDE6B_HUMAN	phosphodiesterase 6B isoform 1						cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding				0						CCTGGTGCGGCGGGGCAGGAC	0.647													11	17	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13602759	13602759	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13602759G>A	uc003gmz.1	-	10	5882	c.5765C>T	c.(5764-5766)GCC>GTC	p.A1922V	BOD1L_uc010idr.1_Missense_Mutation_p.A1259V	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1922							DNA binding			ovary(5)|breast(1)	6						ATTCATGATGGCAGCTCCAGC	0.443													16	40	---	---	---	---	PASS
POLR2B	5431	broad.mit.edu	37	4	57897088	57897088	+	Nonsense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57897088C>G	uc003hcl.1	+	25	3502	c.3459C>G	c.(3457-3459)TAC>TAG	p.Y1153*	POLR2B_uc011cae.1_Nonsense_Mutation_p.Y1146*|POLR2B_uc011caf.1_Nonsense_Mutation_p.Y1078*|POLR2B_uc003hcm.1_Nonsense_Mutation_p.Y646*	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B	1153					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)					GAATGCCTTACGCATGCAAAC	0.353													12	59	---	---	---	---	PASS
TMPRSS11F	389208	broad.mit.edu	37	4	68930480	68930480	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68930480C>A	uc003hdt.1	-	8	987	c.938G>T	c.(937-939)TGC>TTC	p.C313F	LOC550112_uc003hdl.3_Intron|uc011cak.1_Intron|SYT14L_uc010ihn.2_5'Flank	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	313	Peptidase S1.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						GTCTGGGAGGCAAACTCTCTG	0.378													3	45	---	---	---	---	PASS
ALB	213	broad.mit.edu	37	4	74270121	74270121	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74270121C>G	uc003hgs.3	+	1	150	c.77C>G	c.(76-78)GCA>GGA	p.A26G	ALB_uc003hgw.3_Missense_Mutation_p.A26G|ALB_uc011cbe.1_5'UTR|ALB_uc003hgt.3_Missense_Mutation_p.A26G|ALB_uc010iii.2_Missense_Mutation_p.A26G|ALB_uc003hgu.3_5'UTR|ALB_uc003hgv.3_5'UTR|ALB_uc011cbf.1_5'Flank	NM_000477	NP_000468	P02768	ALBU_HUMAN	albumin preproprotein	26	Albumin 1.				bile acid and bile salt transport|bile acid metabolic process|cellular response to starvation|hemolysis by symbiont of host erythrocytes|lipoprotein metabolic process|maintenance of mitochondrion location|negative regulation of apoptosis|platelet activation|platelet degranulation|sodium-independent organic anion transport|transmembrane transport	extracellular space|platelet alpha granule lumen|protein complex	antioxidant activity|chaperone binding|copper ion binding|DNA binding|drug binding|fatty acid binding|pyridoxal phosphate binding|toxin binding			ovary(3)|skin(3)	6	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		Acenocoumarol(DB01418)|Acitretin(DB00459)|Alfentanil(DB00802)|Aluminium(DB01370)|Auranofin(DB00995)|Bismuth(DB01402)|Captopril(DB01197)|Carboplatin(DB00958)|Cefalotin(DB00456)|Cefazolin(DB01327)|Cefonicid(DB01328)|Cefoperazone(DB01329)|Chlorpheniramine(DB01114)|Chlorpromazine(DB00477)|Ciprofloxacin(DB00537)|Clonazepam(DB01068)|Cloxacillin(DB01147)|Cytarabine(DB00987)|Dantrolene(DB01219)|Diclofenac(DB00586)|Diflunisal(DB00861)|Digitoxin(DB01396)|Estrone(DB00655)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Flurbiprofen(DB00712)|Gadobenate Dimeglumine(DB00743)|Gatifloxacin(DB01044)|Gliclazide(DB01120)|Halothane(DB01159)|Human Serum Albumin(DB00062)|Hyaluronidase(DB00070)|Ibuprofen(DB01050)|Insulin-detemir(DB01307)|Insulin-glargine(DB01308)|Iodipamide(DB04711)|Ketoprofen(DB01009)|Levamisole(DB00848)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Mefenamic acid(DB00784)|Mephenytoin(DB00532)|Methotrexate(DB00563)|Nortriptyline(DB00540)|Oxazepam(DB00842)|Paclitaxel(DB01229)|Phenprocoumon(DB00946)|Probenecid(DB01032)|Propofol(DB00818)|Pyridoxine(DB00165)|Salicyclic acid(DB00936)|Saquinavir(DB01232)|Serum albumin(DB00096)|Serum albumin iodonated(DB00064)|Sodium lauryl sulfate(DB00815)|Sucralfate(DB00364)|Sulfamethizole(DB00576)|Sulindac(DB00605)|Suprofen(DB00870)|Testosterone(DB00624)|Xanthophyll(DB00137)	CGTCGAGATGCACGTAAGAAA	0.363													7	33	---	---	---	---	PASS
HPSE	10855	broad.mit.edu	37	4	84227463	84227463	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84227463C>G	uc003hoj.3	-	9	1198	c.1099G>C	c.(1099-1101)GAT>CAT	p.D367H	HPSE_uc010ika.2_Missense_Mutation_p.D309H|HPSE_uc011ccq.1_RNA|HPSE_uc011ccr.1_Intron|HPSE_uc011ccs.1_Missense_Mutation_p.D110H|HPSE_uc011cct.1_Intron|HPSE_uc003hok.3_Missense_Mutation_p.D367H	NM_001098540	NP_001092010	Q9Y251	HPSE_HUMAN	heparanase precursor	367				D->A: Strong decrease in heparanase activity.	carbohydrate metabolic process|cell adhesion|proteoglycan metabolic process	extracellular region|lysosomal membrane|nucleus	beta-glucuronidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Heparin(DB01109)	CCCAATTTATCCAGCCACCTG	0.408													16	65	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85638087	85638087	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85638087C>A	uc003hpd.2	-	49	8245	c.7837G>T	c.(7837-7839)GAT>TAT	p.D2613Y	WDFY3_uc003hpe.1_Missense_Mutation_p.D224Y	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	2613						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TCCTTGATATCTTCATATGCA	0.378													22	57	---	---	---	---	PASS
FAM13A	10144	broad.mit.edu	37	4	89679910	89679910	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89679910C>A	uc003hse.1	-	14	1929	c.1721G>T	c.(1720-1722)TGG>TTG	p.W574L	FAM13A_uc003hsa.1_Missense_Mutation_p.W45L|FAM13A_uc003hsb.1_Missense_Mutation_p.W248L|FAM13A_uc003hsd.1_Missense_Mutation_p.W248L|FAM13A_uc003hsc.1_Missense_Mutation_p.W234L|FAM13A_uc011cdq.1_Missense_Mutation_p.W220L|FAM13A_uc003hsf.1_Missense_Mutation_p.W160L|FAM13A_uc003hsg.1_Missense_Mutation_p.W45L|FAM13A_uc010ikr.1_Missense_Mutation_p.W70L	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1	574					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						CCTACCTTCCCAGTTCTTTTC	0.448													13	39	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94436380	94436380	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94436380C>A	uc011cdt.1	+	13	2269	c.2011C>A	c.(2011-2013)CTT>ATT	p.L671I	GRID2_uc011cdu.1_Missense_Mutation_p.L576I	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	671	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	TCTCCAGGACCTTTCCAAGCA	0.418													5	10	---	---	---	---	PASS
RAP1GDS1	5910	broad.mit.edu	37	4	99342542	99342542	+	Silent	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99342542A>T	uc003htx.3	+	12	1627	c.1437A>T	c.(1435-1437)TCA>TCT	p.S479S	RAP1GDS1_uc003htw.3_Silent_p.S480S|RAP1GDS1_uc003htv.3_Silent_p.S479S|RAP1GDS1_uc003htz.3_Silent_p.S430S|RAP1GDS1_uc003hty.3_Silent_p.S431S|RAP1GDS1_uc003hua.3_Silent_p.S388S	NM_001100427	NP_001093897	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1 isoform	479	ARM 5.						binding|GTPase activator activity			ovary(1)|lung(1)|breast(1)	3				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		ACAGTAAATCAAAAGTAAGTT	0.418			T	NUP98	T-ALL								3	22	---	---	---	---	PASS
AIMP1	9255	broad.mit.edu	37	4	107252864	107252864	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107252864G>C	uc011cfg.1	+	5	479	c.427G>C	c.(427-429)GGA>CGA	p.G143R	AIMP1_uc003hyg.2_Missense_Mutation_p.G143R|AIMP1_uc003hyh.2_Missense_Mutation_p.G167R	NM_001142415	NP_001135887	Q12904	AIMP1_HUMAN	small inducible cytokine subfamily E, member 1	143	Interaction with HSP90B1 (By similarity).|Required for endothelial cell migration.				angiogenesis|apoptosis|cell adhesion|cell-cell signaling|chemotaxis|glucose metabolic process|inflammatory response|leukocyte migration|negative regulation of endothelial cell proliferation|signal transduction|tRNA aminoacylation for protein translation	aminoacyl-tRNA synthetase multienzyme complex|cytosol|endoplasmic reticulum|extracellular space|Golgi apparatus|nucleus|transport vesicle	cell surface binding|cytokine activity|protein homodimerization activity|tRNA binding				0						ATCAATAGCTGGAAGTGCCGA	0.368													31	43	---	---	---	---	PASS
INTU	27152	broad.mit.edu	37	4	128584544	128584544	+	Silent	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128584544G>T	uc003ifk.1	+	4	847	c.777G>T	c.(775-777)CTG>CTT	p.L259L	INTU_uc011cgq.1_RNA	NM_015693	NP_056508	Q9ULD6	PDZD6_HUMAN	PDZ domain containing 6	259	PDZ.									ovary(1)	1						AGGTGAAACTGACATTTGAAA	0.393													3	10	---	---	---	---	PASS
CPE	1363	broad.mit.edu	37	4	166300542	166300542	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166300542C>A	uc003irg.3	+	1	446	c.169C>A	c.(169-171)CCC>ACC	p.P57T		NM_001873	NP_001864	P16870	CBPE_HUMAN	carboxypeptidase E preproprotein	57					cardiac left ventricle morphogenesis|neuropeptide signaling pathway|protein modification process	extracellular region|nucleus|plasma membrane	metallocarboxypeptidase activity|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	Glucagon recombinant(DB00040)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CCACCGCTACCCCGAGCTGCG	0.617													6	7	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175896968	175896968	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175896968A>T	uc003iuc.2	+	5	962	c.292A>T	c.(292-294)AAT>TAT	p.N98Y	ADAM29_uc003iud.2_Missense_Mutation_p.N98Y|ADAM29_uc010irr.2_Missense_Mutation_p.N98Y|ADAM29_uc011cki.1_Missense_Mutation_p.N98Y	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	98					proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		ATTTGTCCAGAATAACTGCTA	0.443													13	35	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183714971	183714971	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183714971T>A	uc003ivd.1	+	25	7183	c.7146T>A	c.(7144-7146)TTT>TTA	p.F2382L		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	2382	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		CAGCTCCTTTTAACTTGTACA	0.413													10	18	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187542483	187542483	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187542483C>A	uc003izf.2	-	10	5445	c.5257G>T	c.(5257-5259)GTT>TTT	p.V1753F		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	1753	Extracellular (Potential).|Cadherin 15.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TGCAAGTGAACTAGAACCGTT	0.423										HNSCC(5;0.00058)			14	48	---	---	---	---	PASS
TRIP13	9319	broad.mit.edu	37	5	912047	912047	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:912047T>A	uc003jbr.2	+	10	1066	c.956T>A	c.(955-957)ATT>AAT	p.I319N		NM_004237	NP_004228	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	319					double-strand break repair|reciprocal meiotic recombination|synaptonemal complex assembly|transcription from RNA polymerase II promoter		ATP binding|identical protein binding|nucleoside-triphosphatase activity|transcription cofactor activity				0			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			AAGCAGTACATTGGGCCACCC	0.458													21	121	---	---	---	---	PASS
TERT	7015	broad.mit.edu	37	5	1254487	1254487	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1254487C>A	uc003jcb.1	-	15	3349	c.3291G>T	c.(3289-3291)AGG>AGT	p.R1097S	TERT_uc003jbz.1_Missense_Mutation_p.R293S|TERT_uc003jca.1_Missense_Mutation_p.R1085S|TERT_uc003jcc.1_Missense_Mutation_p.R1034S|TERT_uc003jcd.1_RNA|TERT_uc003jce.1_RNA	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1	1097	CTE.				anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			ACTTGCCTGTCCTGAGTGACC	0.647									TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				12	78	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5235235	5235235	+	Silent	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5235235C>T	uc003jdl.2	+	13	2097	c.1959C>T	c.(1957-1959)GCC>GCT	p.A653A	ADAMTS16_uc003jdk.1_Silent_p.A653A|ADAMTS16_uc010itk.1_RNA	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	653	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	p.A653A(2)		ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						CTCAGTGTGCCGAGCACAACA	0.522													14	70	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13870880	13870880	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13870880A>G	uc003jfd.2	-	24	3872	c.3830T>C	c.(3829-3831)ATT>ACT	p.I1277T		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1277	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AGTTACCTCAATAGGTCCTAC	0.368									Kartagener_syndrome				19	54	---	---	---	---	PASS
FAM105B	90268	broad.mit.edu	37	5	14693114	14693114	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14693114A>T	uc003jfk.2	+	7	1168	c.1016A>T	c.(1015-1017)CAC>CTC	p.H339L		NM_138348	NP_612357	Q96BN8	F105B_HUMAN	hypothetical protein LOC90268	339										ovary(2)	2	Lung NSC(4;0.00696)					GACGATCGGCACTATAACATC	0.572													6	30	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19544051	19544051	+	Silent	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19544051G>T	uc003jgc.2	-	8	1694	c.1317C>A	c.(1315-1317)ACC>ACA	p.T439T	CDH18_uc003jgd.2_Silent_p.T439T|CDH18_uc011cnm.1_Silent_p.T439T	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	439	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TAGTCCTAATGGTCCCAGTAT	0.348													17	86	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19571679	19571679	+	Intron	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19571679A>G	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CGATTGAAGCATGCCATACCT	0.348													13	110	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38406999	38406999	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38406999T>A	uc003jlc.1	+	8	1222	c.898T>A	c.(898-900)TCT>ACT	p.S300T	EGFLAM_uc003jlb.1_Missense_Mutation_p.S300T|EGFLAM_uc003jle.1_Missense_Mutation_p.S66T|EGFLAM_uc003jlf.1_Intron	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	300						cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					GATGTCTATATCTAACCCAAA	0.478													18	114	---	---	---	---	PASS
PLCXD3	345557	broad.mit.edu	37	5	41510524	41510524	+	Intron	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41510524A>T	uc003jmm.1	-							NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X						intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						CTGCGCGCCTACCTGGAATGG	0.627													6	27	---	---	---	---	PASS
PAIP1	10605	broad.mit.edu	37	5	43543192	43543192	+	Silent	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43543192A>G	uc003job.2	-	4	895	c.648T>C	c.(646-648)TAT>TAC	p.Y216Y	PAIP1_uc003joa.2_Silent_p.Y137Y|PAIP1_uc010ivp.2_Silent_p.Y137Y|PAIP1_uc010ivo.2_RNA|PAIP1_uc003joc.2_Silent_p.Y104Y	NM_006451	NP_006442	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	216	MIF4G.				mRNA stabilization|nuclear-transcribed mRNA poly(A) tail shortening|translational initiation	cytosol	protein binding|RNA binding|translation activator activity			ovary(1)	1	Lung NSC(6;2.07e-05)					GAGCTCCCATATAAGAGAAAT	0.373													12	58	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45267348	45267348	+	Nonsense_Mutation	SNP	G	T	T	rs150863293	byFrequency	TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45267348G>T	uc003jok.2	-	7	1651	c.1626C>A	c.(1624-1626)TGC>TGA	p.C542*		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	542	cAMP.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						TGGTCAGCAGGCAAATCTCTA	0.398													11	71	---	---	---	---	PASS
IPO11	51194	broad.mit.edu	37	5	61923060	61923060	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61923060T>C	uc003jtc.2	+	30	3033	c.2843T>C	c.(2842-2844)CTA>CCA	p.L948P	IPO11_uc011cqr.1_Missense_Mutation_p.L988P|IPO11_uc010iwr.2_3'UTR|IPO11_uc003jte.2_Missense_Mutation_p.L67P	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2	948						cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		CAGGAGATGCTAGGAGAACAA	0.502													15	19	---	---	---	---	PASS
PTCD2	79810	broad.mit.edu	37	5	71630840	71630840	+	Intron	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71630840G>A	uc003kcb.2	+						PTCD2_uc011csf.1_Intron|PTCD2_uc003kcc.2_Intron|PTCD2_uc011csg.1_Intron|PTCD2_uc011csh.1_Intron|PTCD2_uc003kcd.2_Intron	NM_024754	NP_079030	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2												0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		GTTCTTCTTCGTTAGCATTTA	0.313													15	29	---	---	---	---	PASS
APC	324	broad.mit.edu	37	5	112154688	112154688	+	Nonsense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112154688C>G	uc010jby.2	+	10	1339	c.959C>G	c.(958-960)TCA>TGA	p.S320*	APC_uc011cvt.1_Nonsense_Mutation_p.S302*|APC_uc003kpz.3_Nonsense_Mutation_p.S320*|APC_uc003kpy.3_Nonsense_Mutation_p.S320*|APC_uc010jbz.2_Nonsense_Mutation_p.S37*|APC_uc010jca.2_5'Flank	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	320	Leu-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity			large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCATTGTTGTCAATGCTTGGT	0.388		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			41	57	---	---	---	---	PASS
PCDH12	51294	broad.mit.edu	37	5	141329130	141329130	+	Silent	SNP	T	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141329130T>G	uc003llx.2	-	3	4208	c.2997A>C	c.(2995-2997)ACA>ACC	p.T999T		NM_016580	NP_057664	Q9NPG4	PCD12_HUMAN	protocadherin 12 precursor	999	Cytoplasmic (Potential).				neuron recognition	integral to plasma membrane	calcium ion binding			ovary(3)	3		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGGGCCATCTGTGTCTGGGA	0.502													48	33	---	---	---	---	PASS
GRM6	2916	broad.mit.edu	37	5	178413911	178413911	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178413911C>A	uc003mjr.2	-	7	1607	c.1428G>T	c.(1426-1428)CAG>CAT	p.Q476H	GRM6_uc003mjq.2_5'Flank|GRM6_uc010jla.1_Missense_Mutation_p.Q59H|GRM6_uc003mjs.1_Missense_Mutation_p.Q96H	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	476	Extracellular (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		CATTGGTCGCCTGGTACTGGA	0.632													8	9	---	---	---	---	PASS
HIST1H1E	3008	broad.mit.edu	37	6	26157147	26157147	+	Nonsense_Mutation	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26157147A>T	uc003ngq.2	+	1	589	c.529A>T	c.(529-531)AAA>TAA	p.K177*	HIST1H2BD_uc003ngr.2_5'Flank|HIST1H2BD_uc003ngs.2_5'Flank	NM_005321	NP_005312	P10412	H14_HUMAN	histone cluster 1, H1e	177					nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			large_intestine(1)|ovary(1)	2						GAAAAAGGCGAAAGCAGCCAA	0.582													6	13	---	---	---	---	PASS
BTN1A1	696	broad.mit.edu	37	6	26507025	26507025	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26507025G>T	uc003nif.3	+	4	844	c.824G>T	c.(823-825)AGA>ATA	p.R275I		NM_001732	NP_001723	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1 precursor	275	Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	receptor activity			ovary(1)|skin(1)	2						TACAACGAAAGACCCAGAGAG	0.488													39	106	---	---	---	---	PASS
OR2B2	81697	broad.mit.edu	37	6	27879591	27879591	+	Silent	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27879591A>G	uc011dkw.1	-	1	507	c.507T>C	c.(505-507)TGT>TGC	p.C169C		NM_033057	NP_149046	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B,	169	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTTTGTGACCACACAGTGGCA	0.473													19	51	---	---	---	---	PASS
ZNF193	7746	broad.mit.edu	37	6	28195519	28195519	+	Silent	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28195519C>T	uc003nkq.1	+	3	587	c.472C>T	c.(472-474)CTA>TTA	p.L158L	ZNF193_uc003nkr.1_Silent_p.L158L|ZNF193_uc010jqz.1_Silent_p.L158L	NM_006299	NP_006290	O15535	ZN193_HUMAN	zinc finger protein 193	158					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GATGGTGCCTCTAGCAGAGCA	0.483													7	17	---	---	---	---	PASS
MDC1	9656	broad.mit.edu	37	6	30672865	30672865	+	Silent	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30672865T>C	uc003nrg.3	-	10	4535	c.4095A>G	c.(4093-4095)TCA>TCG	p.S1365S	MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Silent_p.S972S	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1365	Pro-rich.|Interaction with the PRKDC complex.				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						TAGGGACAGTTGATTCAGGGT	0.537								Other_conserved_DNA_damage_response_genes					25	57	---	---	---	---	PASS
MDGA1	266727	broad.mit.edu	37	6	37605156	37605156	+	Silent	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37605156C>T	uc003onu.1	-	17	4035	c.2856G>A	c.(2854-2856)GCG>GCA	p.A952A	MDGA1_uc003onv.1_3'UTR	NM_153487	NP_705691	Q8NFP4	MDGA1_HUMAN	MAM domain containing	952					brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane				central_nervous_system(2)	2						ATCTCTGCAACGCCAAGAGGA	0.637													6	24	---	---	---	---	PASS
TINAG	27283	broad.mit.edu	37	6	54216195	54216195	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54216195G>T	uc003pcj.2	+	8	1272	c.1126G>T	c.(1126-1128)GCC>TCC	p.A376S	TINAG_uc010jzt.2_RNA	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	376					cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			ACCAGTTCAAGGTAAGCTTGA	0.294													5	8	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129621881	129621881	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129621881C>G	uc003qbn.2	+	22	3143	c.3038C>G	c.(3037-3039)GCT>GGT	p.A1013G	LAMA2_uc003qbo.2_Missense_Mutation_p.A1013G	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	1013	Laminin EGF-like 10.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		ACCGGTGAAGCTTGTGAATGT	0.378													15	37	---	---	---	---	PASS
EPB41L2	2037	broad.mit.edu	37	6	131225639	131225639	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131225639G>T	uc003qch.2	-	6	1077	c.895C>A	c.(895-897)CCT>ACT	p.P299T	EPB41L2_uc003qcg.1_Missense_Mutation_p.P299T|EPB41L2_uc011eby.1_Missense_Mutation_p.P299T|EPB41L2_uc003qci.2_Missense_Mutation_p.P299T|EPB41L2_uc010kfk.2_Missense_Mutation_p.P299T|EPB41L2_uc010kfl.1_Missense_Mutation_p.P299T	NM_001431	NP_001422	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	299	FERM.				cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		GAAGGATCAGGAGGATAAAAC	0.343													15	12	---	---	---	---	PASS
KIAA1244	57221	broad.mit.edu	37	6	138640890	138640890	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138640890T>C	uc003qhu.2	+	28	4525	c.4525T>C	c.(4525-4527)TCC>CCC	p.S1509P		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	1509	Helical; (Potential).				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TCCTGTGATGTCCGTTTGGCT	0.502													41	70	---	---	---	---	PASS
ECT2L	345930	broad.mit.edu	37	6	139135688	139135688	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139135688C>G	uc003qif.1	+	2	230	c.127C>G	c.(127-129)CGT>GGT	p.R43G	ECT2L_uc011edq.1_5'UTR	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2	43					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						TAACAAGCAACGTCAAGAATT	0.363													6	13	---	---	---	---	PASS
FUCA2	2519	broad.mit.edu	37	6	143825251	143825251	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143825251A>T	uc003qjm.2	-	3	643	c.551T>A	c.(550-552)TTT>TAT	p.F184Y	FUCA2_uc003qjn.2_5'Flank	NM_032020	NP_114409	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma precursor	184					fucose metabolic process	extracellular region	alpha-L-fucosidase activity|cation binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		AAACCATTCAAAAAGGGAATA	0.448													19	32	---	---	---	---	PASS
SLC22A1	6580	broad.mit.edu	37	6	160577116	160577116	+	Intron	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160577116A>G	uc003qtc.2	+						SLC22A1_uc003qtd.2_Intron	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a							basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		GGTGAAGCCCATGGTGCCCAG	0.557													19	24	---	---	---	---	PASS
CCDC129	223075	broad.mit.edu	37	7	31682869	31682869	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31682869A>G	uc003tcj.1	+	11	2878	c.1885A>G	c.(1885-1887)ACC>GCC	p.T629A	CCDC129_uc011kad.1_Missense_Mutation_p.T639A|CCDC129_uc003tci.1_Missense_Mutation_p.T480A|CCDC129_uc011kae.1_Missense_Mutation_p.T655A|CCDC129_uc003tck.1_Missense_Mutation_p.T537A	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	629											0						CTGTCCTCACACCAACCACAG	0.463													16	18	---	---	---	---	PASS
DPY19L1	23333	broad.mit.edu	37	7	35050131	35050131	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35050131A>G	uc003tem.3	-	6	639	c.494T>C	c.(493-495)ATT>ACT	p.I165T		NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1	165	Helical; (Potential).					integral to membrane					0						TCCATTTAAAATAAAAATTAC	0.259													9	21	---	---	---	---	PASS
DPY19L1	23333	broad.mit.edu	37	7	35057586	35057586	+	Intron	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35057586A>G	uc003tem.3	-							NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1							integral to membrane					0						TGGCTCCTGGAAAAACAAAAC	0.323													9	16	---	---	---	---	PASS
GBAS	2631	broad.mit.edu	37	7	56066761	56066761	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56066761A>T	uc003tre.1	+	10	865	c.857A>T	c.(856-858)CAG>CTG	p.Q286L	GBAS_uc003trf.1_Missense_Mutation_p.Q247L	NM_001483	NP_001474	O75323	NIPS2_HUMAN	nipsnap homolog 2	286						integral to plasma membrane|membrane fraction|mitochondrion	protein binding			central_nervous_system(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TCGCCCCTCCAGTAAAGCTGT	0.373													21	42	---	---	---	---	PASS
MLXIPL	51085	broad.mit.edu	37	7	73021342	73021342	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73021342T>A	uc003tyn.1	-	5	628	c.580A>T	c.(580-582)AAG>TAG	p.K194*	MLXIPL_uc003tyk.1_Nonsense_Mutation_p.K194*|MLXIPL_uc003tyl.1_Nonsense_Mutation_p.K194*|MLXIPL_uc003tym.1_Nonsense_Mutation_p.K194*|MLXIPL_uc003tyo.1_RNA|MLXIPL_uc003typ.1_Intron|MLXIPL_uc003tyq.1_5'Flank	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN	Williams Beuren syndrome chromosome region 14	194					anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				CTGCTGGGCTTACGGAGCTGC	0.592											OREG0018107	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	14	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	78256426	78256426	+	Intron	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78256426T>C	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CTCAGGAACGTTGTGCTTACC	0.423													13	30	---	---	---	---	PASS
HGF	3082	broad.mit.edu	37	7	81386580	81386580	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81386580T>C	uc003uhl.2	-	4	572	c.407A>G	c.(406-408)TAC>TGC	p.Y136C	HGF_uc003uhm.2_Missense_Mutation_p.Y136C|HGF_uc003uhn.1_Missense_Mutation_p.Y136C|HGF_uc003uho.1_Missense_Mutation_p.Y136C|HGF_uc003uhp.2_Missense_Mutation_p.Y136C	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	136	Kringle 1.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						TGTTCCCTTGTAGCTGCGTCC	0.368													7	27	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86468464	86468464	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86468464C>G	uc003uid.2	+	4	2733	c.1634C>G	c.(1633-1635)ACC>AGC	p.T545S	GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Missense_Mutation_p.T417S|GRM3_uc010leh.2_Missense_Mutation_p.T137S	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	545	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	GATGAGTTTACCTGTATGGAT	0.527													32	138	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94052351	94052351	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94052351G>T	uc003ung.1	+	40	2957	c.2486G>T	c.(2485-2487)GGC>GTC	p.G829V	COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	829			Missing (in OI2A).		axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GGTCCAGTTGGCCGAACTGGA	0.567										HNSCC(75;0.22)			38	83	---	---	---	---	PASS
LAMB4	22798	broad.mit.edu	37	7	107732775	107732775	+	Intron	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107732775G>T	uc010ljo.1	-						LAMB4_uc003vey.2_Intron	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor						cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						AAACTTATTTGACTTACACGT	0.363													13	27	---	---	---	---	PASS
HIPK2	28996	broad.mit.edu	37	7	139305195	139305195	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139305195G>A	uc003vvf.3	-	7	1908	c.1734C>T	c.(1732-1734)ACC>ACT	p.T578T	HIPK2_uc003vvd.3_Silent_p.T578T	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform	578	Interaction with SKI and SMAD1.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					TGGTCAGGTTGGTGGACGTGC	0.552													23	69	---	---	---	---	PASS
OR2F1	26211	broad.mit.edu	37	7	143657235	143657235	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143657235C>A	uc003wds.1	+	1	216	c.172C>A	c.(172-174)CCC>ACC	p.P58T		NM_012369	NP_036501	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F,	58	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	Melanoma(164;0.0903)					ACTCCACACTCCCATGTATTT	0.502													53	213	---	---	---	---	PASS
CRYGN	155051	broad.mit.edu	37	7	151135212	151135212	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151135212C>A	uc003wke.2	-	2	236	c.140G>T	c.(139-141)GGA>GTA	p.G47V	CRYGN_uc003wkf.2_Missense_Mutation_p.G47V|CRYGN_uc003wkg.2_RNA|CRYGN_uc010lqd.1_5'Flank	NM_144727	NP_653328	Q8WXF5	CRGN_HUMAN	gammaN-crystallin	47	Beta/gamma crystallin 'Greek key' 2.										0			OV - Ovarian serous cystadenocarcinoma(82;0.00358)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GACCCAGGCTCCGCTCTCCAC	0.592													15	30	---	---	---	---	PASS
CLN8	2055	broad.mit.edu	37	8	1719295	1719295	+	Silent	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1719295C>T	uc003wpo.3	+	2	380	c.75C>T	c.(73-75)TCC>TCT	p.S25S		NM_018941	NP_061764	Q9UBY8	CLN8_HUMAN	ceroid-lipofuscinosis, neuronal 8	25	Helical; (Potential).				cell death|ceramide biosynthetic process|cholesterol metabolic process|lipid transport|negative regulation of proteolysis|phospholipid metabolic process	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3		Ovarian(12;0.0563)|Colorectal(14;0.0815)|Hepatocellular(245;0.0831)		BRCA - Breast invasive adenocarcinoma(11;7.67e-05)|READ - Rectum adenocarcinoma(644;0.0913)		GGATCCGCTCCACGCTGATGG	0.537													17	24	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52320767	52320767	+	Silent	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52320767G>C	uc003xqu.3	-	17	3518	c.3417C>G	c.(3415-3417)GCC>GCG	p.A1139A	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	1139					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GAATGATGGTGGCAGCCGAAT	0.517													17	77	---	---	---	---	PASS
SGK3	23678	broad.mit.edu	37	8	67759586	67759586	+	Intron	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67759586A>G	uc003xwr.2	+						SGK3_uc003xwp.2_Intron|SGK3_uc003xwt.2_Intron|SGK3_uc003xwu.2_Intron	NM_001033578	NP_001028750	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase 3 isoform						cell communication|response to stress	cytoplasmic membrane-bounded vesicle|early endosome	ATP binding|phosphatidylinositol binding|protein serine/threonine kinase activity			ovary(1)|large_intestine(1)|lung(1)|breast(1)	4	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			AAGACTTTGTATGTAACAGCT	0.358													24	29	---	---	---	---	PASS
ARFGEF1	10565	broad.mit.edu	37	8	68179410	68179410	+	Silent	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68179410G>T	uc003xxo.1	-	12	2118	c.1728C>A	c.(1726-1728)GCC>GCA	p.A576A	ARFGEF1_uc003xxl.1_Silent_p.A30A	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	576					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CAAATATATTGGCTGCATTTA	0.313													17	52	---	---	---	---	PASS
C8orf34	116328	broad.mit.edu	37	8	69552748	69552748	+	Splice_Site	SNP	T	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69552748T>A	uc010lyz.2	+	8	1032	c.983_splice	c.e8+2	p.R328_splice	C8orf34_uc003xyb.2_Splice_Site_p.R303_splice	NM_052958	NP_443190	Q49A92	CH034_HUMAN	hypothetical protein LOC116328						signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			GTGTGCCAGGTAAAAGACATA	0.383													24	18	---	---	---	---	PASS
CRISPLD1	83690	broad.mit.edu	37	8	75927109	75927109	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75927109G>A	uc003yan.2	+	6	1064	c.689G>A	c.(688-690)AGT>AAT	p.S230N	CRISPLD1_uc011lfk.1_Missense_Mutation_p.S42N|CRISPLD1_uc011lfl.1_Missense_Mutation_p.S42N	NM_031461	NP_113649	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain	230						extracellular region				ovary(1)|central_nervous_system(1)	2	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			TGCCCACCTAGTTTTGGAGGG	0.438													16	17	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77764469	77764469	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77764469C>T	uc003yav.2	+	10	5564	c.5177C>T	c.(5176-5178)GCT>GTT	p.A1726V	ZFHX4_uc003yau.1_Missense_Mutation_p.A1771V|ZFHX4_uc003yaw.1_Missense_Mutation_p.A1726V	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1726	Gln-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ACAGGAATGGCTGGCTCCTTG	0.433										HNSCC(33;0.089)			5	14	---	---	---	---	PASS
MATN2	4147	broad.mit.edu	37	8	98943591	98943591	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98943591C>T	uc003yic.2	+	3	784	c.553C>T	c.(553-555)CGG>TGG	p.R185W	MATN2_uc003yib.1_Missense_Mutation_p.R185W|MATN2_uc010mbh.1_Missense_Mutation_p.R185W|MATN2_uc003yid.2_Missense_Mutation_p.R185W|MATN2_uc003yie.1_Missense_Mutation_p.R185W|MATN2_uc010mbi.1_Missense_Mutation_p.R59W	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor	185	VWFA 1.					proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			TGCTAAGGCACGGGACACGGG	0.587													14	21	---	---	---	---	PASS
FBXO43	286151	broad.mit.edu	37	8	101146070	101146070	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101146070G>A	uc003yjd.2	-	5	2800	c.2087C>T	c.(2086-2088)CCA>CTA	p.P696L	FBXO43_uc003yje.2_Missense_Mutation_p.P662L	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b	696					meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			GGCACTTCCTGGGAGAGCATC	0.398													14	63	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104898414	104898414	+	Silent	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104898414T>C	uc003yls.2	+	2	1162	c.921T>C	c.(919-921)GAT>GAC	p.D307D	RIMS2_uc003ylp.2_Silent_p.D529D|RIMS2_uc003ylw.2_Silent_p.D337D|RIMS2_uc003ylq.2_Silent_p.D337D|RIMS2_uc003ylr.2_Silent_p.D337D	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	560					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CAAGTTGTGATGATGTTGAGA	0.363										HNSCC(12;0.0054)			9	36	---	---	---	---	PASS
MED30	90390	broad.mit.edu	37	8	118533160	118533160	+	Silent	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118533160C>G	uc003yoj.2	+	1	196	c.45C>G	c.(43-45)CCC>CCG	p.P15P	MED30_uc011lib.1_Silent_p.P15P	NM_080651	NP_542382	Q96HR3	MED30_HUMAN	TRAP/Mediator complex component TRAP25	15					androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding				0	all_cancers(13;3.41e-25)|Lung NSC(37;3.02e-05)|Ovarian(258;0.00163)		STAD - Stomach adenocarcinoma(47;0.0266)			CGCCCGGGCCCTTCGCCGGGC	0.716													14	11	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139160838	139160838	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139160838A>T	uc003yuy.2	-	14	3544	c.3373T>A	c.(3373-3375)TAT>AAT	p.Y1125N	FAM135B_uc003yux.2_Missense_Mutation_p.Y1026N|FAM135B_uc003yuz.2_Intron|FAM135B_uc003yva.2_Missense_Mutation_p.Y687N|FAM135B_uc003yvb.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1125										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GGTGGGAAATATGGTATATCA	0.373										HNSCC(54;0.14)			16	13	---	---	---	---	PASS
PTPRD	5789	broad.mit.edu	37	9	8527348	8527348	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8527348T>G	uc003zkk.2	-	15	1258	c.547A>C	c.(547-549)ATT>CTT	p.I183L	PTPRD_uc003zkp.2_Missense_Mutation_p.I183L|PTPRD_uc003zkq.2_Missense_Mutation_p.I183L|PTPRD_uc003zkr.2_Missense_Mutation_p.I183L|PTPRD_uc003zks.2_Missense_Mutation_p.I183L|PTPRD_uc003zkl.2_Missense_Mutation_p.I183L|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Missense_Mutation_p.I183L|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	183	Extracellular (Potential).|Ig-like C2-type 2.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CACTTACCAATAGATTCTGGA	0.284										TSP Lung(15;0.13)			11	22	---	---	---	---	PASS
IFNA4	3441	broad.mit.edu	37	9	21187362	21187362	+	Missense_Mutation	SNP	G	T	T	rs144166492	byFrequency	TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21187362G>T	uc003zon.2	-	1	237	c.169C>A	c.(169-171)CAT>AAT	p.H57N		NM_021068	NP_066546	P05014	IFNA4_HUMAN	interferon, alpha 4 precursor	57					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(5;2.69e-202)|Lung(24;2.26e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CCGAAATCATGTCTGTCCTTC	0.517													19	78	---	---	---	---	PASS
POLR1E	64425	broad.mit.edu	37	9	37495219	37495219	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37495219C>T	uc003zzz.1	+	6	1075	c.787C>T	c.(787-789)CCT>TCT	p.P263S	POLR1E_uc011lqj.1_Silent_p.F140F|POLR1E_uc003zzy.1_Missense_Mutation_p.P201S|POLR1E_uc011lqk.1_Missense_Mutation_p.P130S	NM_022490	NP_071935	Q9GZS1	RPA49_HUMAN	RNA polymerase I associated factor 53	263					rRNA transcription	cell junction|cytoplasm|nucleolus	DNA binding|DNA-directed RNA polymerase activity|protein binding				0				GBM - Glioblastoma multiforme(29;0.00851)|Lung(182;0.229)		CCTCTACCTTCCTCCCTGCTA	0.423													34	65	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79824452	79824452	+	Intron	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79824452A>T	uc004akr.2	+						VPS13A_uc004akp.3_Intron|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						AGATGATGTAAGTATTTTAAT	0.264													8	8	---	---	---	---	PASS
OR13D1	286365	broad.mit.edu	37	9	107456872	107456872	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107456872T>G	uc011lvs.1	+	1	170	c.170T>G	c.(169-171)CTT>CGT	p.L57R		NM_001004484	NP_001004484	Q8NGV5	O13D1_HUMAN	olfactory receptor, family 13, subfamily D,	57	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GAGCTCCAGCTTTTTCTGTTC	0.478													31	76	---	---	---	---	PASS
MUSK	4593	broad.mit.edu	37	9	113547908	113547908	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113547908C>A	uc004bey.2	+	12	1786	c.1688C>A	c.(1687-1689)CCC>CAC	p.P563H	MUSK_uc004bez.1_Missense_Mutation_p.P143H	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase	563	Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6						CTTCTGAACCCCAAATTGCTC	0.483													9	59	---	---	---	---	PASS
MUSK	4593	broad.mit.edu	37	9	113547909	113547909	+	Silent	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113547909C>A	uc004bey.2	+	12	1787	c.1689C>A	c.(1687-1689)CCC>CCA	p.P563P	MUSK_uc004bez.1_Silent_p.P143P	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase	563	Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6						TTCTGAACCCCAAATTGCTCA	0.483													10	59	---	---	---	---	PASS
MUSK	4593	broad.mit.edu	37	9	113547910	113547910	+	Nonsense_Mutation	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113547910A>T	uc004bey.2	+	12	1788	c.1690A>T	c.(1690-1692)AAA>TAA	p.K564*	MUSK_uc004bez.1_Nonsense_Mutation_p.K144*	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase	564	Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6						TCTGAACCCCAAATTGCTCAG	0.483													10	60	---	---	---	---	PASS
ZFP37	7539	broad.mit.edu	37	9	115805911	115805911	+	Silent	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115805911G>T	uc004bgm.1	-	4	1015	c.987C>A	c.(985-987)GCC>GCA	p.A329A	ZFP37_uc011lwz.1_Silent_p.A344A|ZFP37_uc011lxa.1_Silent_p.A330A	NM_003408	NP_003399	Q9Y6Q3	ZFP37_HUMAN	zinc finger protein 37 homolog	329	C2H2-type 2.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TTTGGCTAAAGGCTATCCCAC	0.413													34	77	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139396757	139396757	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139396757C>A	uc004chz.2	-	28	5351	c.5351G>T	c.(5350-5352)CGG>CTG	p.R1784L		NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	1784	Cytoplasmic (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	p.K1783_R1784ins31(2)		haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GAGGGGCTCCCGCCGCTTCTT	0.701			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			11	14	---	---	---	---	PASS
TAF3	83860	broad.mit.edu	37	10	8007226	8007226	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8007226G>T	uc010qbd.1	+	3	1753	c.1753G>T	c.(1753-1755)GCA>TCA	p.A585S		NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140	585	Lys-rich.				maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1						AGAGGAAGAGGCAGATCCCTA	0.284													10	35	---	---	---	---	PASS
PRKG1	5592	broad.mit.edu	37	10	53227593	53227593	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53227593A>G	uc001jjm.2	+	3	738	c.544A>G	c.(544-546)AAG>GAG	p.K182E	PRKG1_uc001jjn.2_Missense_Mutation_p.K197E|PRKG1_uc001jjo.2_Missense_Mutation_p.K197E|PRKG1_uc010qhp.1_Missense_Mutation_p.K182E	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform	182	cGMP 1.				actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		AGCGACCGTCAAGAGTAAGAC	0.358													8	37	---	---	---	---	PASS
TFAM	7019	broad.mit.edu	37	10	60147948	60147948	+	Splice_Site	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60147948A>G	uc001jkf.2	+	3	353	c.221_splice	c.e3-2	p.D74_splice	TFAM_uc001jkg.2_Splice_Site|TFAM_uc001jkh.2_Splice_Site_p.D74_splice	NM_003201	NP_003192	Q00059	TFAM_HUMAN	transcription factor A, mitochondrial precursor						DNA-dependent DNA replication|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase I promoter|transcription initiation from mitochondrial promoter	mitochondrial nucleoid	mitochondrial light strand promoter sense binding|protein binding|sequence-specific DNA binding transcription factor activity				0						TTCATTCCATAGATGCAAAAA	0.338													12	20	---	---	---	---	PASS
SFTPA1	653509	broad.mit.edu	37	10	81373017	81373017	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81373017G>A	uc001kap.2	+	5	486	c.365G>A	c.(364-366)AGG>AAG	p.R122K	SFTPA1_uc001kaq.2_Missense_Mutation_p.R122K|SFTPA1_uc009xry.2_Missense_Mutation_p.R137K|SFTPA1_uc001kar.2_Missense_Mutation_p.R122K|SFTPA1_uc010qlt.1_Missense_Mutation_p.R63K|SFTPA1_uc009xrz.2_Missense_Mutation_p.R52K|SFTPA1_uc009xsa.2_Missense_Mutation_p.R122K|SFTPA1_uc009xsf.2_5'Flank	NM_005411	NP_005402	Q8IWL2	SFTA1_HUMAN	surfactant protein A1 isoform 1	122					cell junction assembly|respiratory gaseous exchange	collagen|extracellular space	lipid transporter activity|sugar binding				0	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			CTGCAGACAAGGGGAGGTAAG	0.532													22	84	---	---	---	---	PASS
ANXA11	311	broad.mit.edu	37	10	81928934	81928934	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81928934G>C	uc001kbq.1	-	6	1177	c.352C>G	c.(352-354)CCC>GCC	p.P118A	ANXA11_uc010qlx.1_Missense_Mutation_p.P218A|ANXA11_uc001kbr.1_Missense_Mutation_p.P118A|ANXA11_uc001kbs.1_Missense_Mutation_p.P118A|ANXA11_uc001kbt.1_Missense_Mutation_p.P118A|ANXA11_uc010qly.1_Missense_Mutation_p.P85A|ANXA11_uc009xsq.1_Missense_Mutation_p.P118A|ANXA11_uc001kbu.1_Missense_Mutation_p.P118A	NM_145869	NP_665876	P50995	ANX11_HUMAN	annexin A11	118					cell cycle|cytokinesis, completion of separation|phagocytosis|response to calcium ion	azurophil granule|melanosome|midbody|nuclear envelope|nucleoplasm|phagocytic vesicle|specific granule|spindle	calcium-dependent phospholipid binding|calcium-dependent protein binding|S100 alpha binding			ovary(1)	1	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			GGATATGAGGGCATCCTGGAG	0.697													2	5	---	---	---	---	PASS
PKD2L1	9033	broad.mit.edu	37	10	102052704	102052704	+	Splice_Site	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102052704C>G	uc001kqx.1	-	11	2263	c.1880_splice	c.e11+1	p.E627_splice	PKD2L1_uc009xwm.1_Splice_Site_p.E580_splice	NM_016112	NP_057196	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1						signal transduction	integral to membrane	calcium activated cation channel activity|calcium ion binding|cytoskeletal protein binding			ovary(4)	4		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		TGGTTGCTCACTCCCTTAAGG	0.488													10	38	---	---	---	---	PASS
DUSP5	1847	broad.mit.edu	37	10	112258016	112258016	+	Missense_Mutation	SNP	A	T	T	rs149325838		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112258016A>T	uc001kzd.2	+	1	392	c.137A>T	c.(136-138)AAC>ATC	p.N46I		NM_004419	NP_004410	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	46	Rhodanese.				endoderm formation|inactivation of MAPK activity	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		CTCAACGTCAACCTCAACTCG	0.632													6	23	---	---	---	---	PASS
PWWP2B	170394	broad.mit.edu	37	10	134218192	134218192	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134218192A>G	uc001lll.3	+	2	217	c.188A>G	c.(187-189)AAC>AGC	p.N63S	PWWP2B_uc009ybe.2_Missense_Mutation_p.N63S	NM_138499	NP_612508	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2 isoform 1	63											0		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		TCCCCTGTCAACGACAGCCAT	0.677													28	88	---	---	---	---	PASS
GPR123	84435	broad.mit.edu	37	10	134912164	134912164	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134912164A>G	uc001llx.3	+	4	588	c.152A>G	c.(151-153)AAG>AGG	p.K51R	GPR123_uc001llw.2_Missense_Mutation_p.K771R	NM_001083909	NP_001077378	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	51	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		ATCAGCCGCAAGGGCCGGCAC	0.652													17	32	---	---	---	---	PASS
PAOX	196743	broad.mit.edu	37	10	135193889	135193889	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135193889C>G	uc001lmv.2	+	2	648	c.568C>G	c.(568-570)CTG>GTG	p.L190V	PAOX_uc001lmw.2_Intron|PAOX_uc001lmx.2_Missense_Mutation_p.L190V|PAOX_uc001lmy.2_Missense_Mutation_p.L190V|PAOX_uc001lmz.2_RNA|PAOX_uc001lna.2_Intron|PAOX_uc001lnb.2_RNA|PAOX_uc001lnc.2_Intron	NM_152911	NP_690875	Q6QHF9	PAOX_HUMAN	polyamine oxidase isoform 1	328					polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		CTTCTTCAACCTGGAATGCTG	0.597													7	28	---	---	---	---	PASS
SYCE1	93426	broad.mit.edu	37	10	135369308	135369308	+	Missense_Mutation	SNP	C	T	T	rs150742469		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135369308C>T	uc001lno.2	-	10	800	c.695G>A	c.(694-696)CGC>CAC	p.R232H	CYP2E1_uc001lnl.1_3'UTR|SYCE1_uc001lnm.2_Missense_Mutation_p.R104H|SYCE1_uc009ybn.2_Missense_Mutation_p.R232H|SYCE1_uc001lnn.2_Missense_Mutation_p.R196H	NM_001143764	NP_001137236	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	232	Potential.				cell division	central element				ovary(1)	1		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		CTCCTGGCTGCGGAGAAAGAG	0.642													14	19	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1267408	1267408	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1267408C>A	uc009ycr.1	+	49	11173	c.11047C>A	c.(11047-11049)CCG>ACG	p.P3683T	MUC5B_uc001ltb.2_Missense_Mutation_p.P3103T	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3100	7 X Cys-rich subdomain repeats.|Thr-rich.|17 X approximate tandem repeats, Ser/Thr- rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTCCTCCACTCCGGAGACCAC	0.642													12	31	---	---	---	---	PASS
BRSK2	9024	broad.mit.edu	37	11	1432649	1432649	+	Intron	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1432649C>A	uc001lti.2	+						BRSK2_uc009ycv.1_Intron|BRSK2_uc001lth.1_Intron|BRSK2_uc001ltj.2_Intron|BRSK2_uc001ltk.2_Intron|BRSK2_uc001ltl.2_Intron|BRSK2_uc001ltm.2_Silent_p.G5G	NM_003957	NP_003948	Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2						establishment of cell polarity|neuron differentiation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		GCCCTGAGGGCCACCCCAGCC	0.701													3	17	---	---	---	---	PASS
OR51Q1	390061	broad.mit.edu	37	11	5443646	5443646	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5443646C>A	uc010qzd.1	+	1	216	c.216C>A	c.(214-216)GAC>GAA	p.D72E	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004757	NP_001004757	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q,	72	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCTGACGGACCTGGGTCTCA	0.532													29	63	---	---	---	---	PASS
OR51Q1	390061	broad.mit.edu	37	11	5443647	5443647	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5443647C>A	uc010qzd.1	+	1	217	c.217C>A	c.(217-219)CTG>ATG	p.L73M	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004757	NP_001004757	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q,	73	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCTGACGGACCTGGGTCTCAC	0.532													29	63	---	---	---	---	PASS
TRIM6	117854	broad.mit.edu	37	11	5632516	5632516	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5632516T>C	uc001mbc.1	+	8	1543	c.1411T>C	c.(1411-1413)TAT>CAT	p.Y471H	HBG2_uc001mak.1_Intron|TRIM6-TRIM34_uc001mbf.2_Intron|TRIM6_uc009yeo.1_Missense_Mutation_p.Y445H|TRIM6_uc010qzj.1_Missense_Mutation_p.Y296H|TRIM6_uc001mbe.2_Missense_Mutation_p.Y296H|TRIM6_uc010qzk.1_Missense_Mutation_p.Y296H|TRIM6_uc010qzl.1_Missense_Mutation_p.Y296H|TRIM6_uc001mbd.2_Missense_Mutation_p.Y499H|TRIM6_uc001mbg.1_Missense_Mutation_p.Y296H|TRIM6_uc009yep.1_3'UTR	NM_058166	NP_477514	Q9C030	TRIM6_HUMAN	tripartite motif-containing 6 isoform 2	471	B30.2/SPRY.				protein trimerization	cytoplasm	zinc ion binding				0		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		TCTTTGTCCATATTTTAATCC	0.413													36	79	---	---	---	---	PASS
CNGA4	1262	broad.mit.edu	37	11	6262857	6262857	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6262857G>C	uc001mco.2	+	5	1221	c.1114G>C	c.(1114-1116)GGT>CGT	p.G372R	CNGA4_uc010raa.1_Missense_Mutation_p.G141R|CNGA4_uc001mcn.2_Missense_Mutation_p.G332R	NM_001037329	NP_001032406	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	372	cNMP.|Cytoplasmic (Potential).				response to stimulus|sensory perception of smell		cAMP binding			skin(1)	1		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTACTCACCAGGTGAATATGT	0.557													25	64	---	---	---	---	PASS
OR10A4	283297	broad.mit.edu	37	11	6898394	6898394	+	Silent	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6898394C>A	uc010rat.1	+	1	516	c.516C>A	c.(514-516)CCC>CCA	p.P172P		NM_207186	NP_997069	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TTTGTGGCCCCAACAGGGTGA	0.527													19	42	---	---	---	---	PASS
NLRP10	338322	broad.mit.edu	37	11	7982313	7982313	+	Silent	SNP	T	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7982313T>A	uc001mfv.1	-	2	863	c.846A>T	c.(844-846)ACA>ACT	p.T282T		NM_176821	NP_789791	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	282	NACHT.						ATP binding			lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ACGTGGGGAGTGTATGTCTCC	0.522													28	50	---	---	---	---	PASS
PRDM11	56981	broad.mit.edu	37	11	45203858	45203858	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45203858G>T	uc001myo.2	+	4	532	c.283G>T	c.(283-285)GAC>TAC	p.D95Y		NM_020229	NP_064614	Q9NQV5	PRD11_HUMAN	PR domain containing 11	95										upper_aerodigestive_tract(1)	1						GGGGAAGCGCGACCTCATCGT	0.592													3	20	---	---	---	---	PASS
PTPRJ	5795	broad.mit.edu	37	11	48177682	48177682	+	Intron	SNP	T	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48177682T>A	uc001ngp.3	+							NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J						contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						GTAAGTATCttttttagtttt	0.279													15	22	---	---	---	---	PASS
OR4X2	119764	broad.mit.edu	37	11	48267363	48267363	+	Silent	SNP	C	T	T	rs144663280	byFrequency	TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48267363C>T	uc001ngs.1	+	1	708	c.708C>T	c.(706-708)TTC>TTT	p.F236F		NM_001004727	NP_001004727	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X,	236	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GGTCCCATTTCGCTGTGGTTA	0.522													14	18	---	---	---	---	PASS
OR5D18	219438	broad.mit.edu	37	11	55587447	55587447	+	Silent	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587447T>C	uc010rin.1	+	1	342	c.342T>C	c.(340-342)TTT>TTC	p.F114F		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	114	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				CTGAATCCTTTTTATTAGCTG	0.438													46	112	---	---	---	---	PASS
OR5J2	282775	broad.mit.edu	37	11	55944433	55944433	+	Silent	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55944433T>C	uc010rjb.1	+	1	340	c.340T>C	c.(340-342)TTA>CTA	p.L114L		NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J,	114	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4	Esophageal squamous(21;0.00693)					AGAAGGCTTCTTACTGTCAGT	0.473													24	67	---	---	---	---	PASS
CD5	921	broad.mit.edu	37	11	60889118	60889118	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60889118G>A	uc009ynk.2	+	6	944	c.841G>A	c.(841-843)GGC>AGC	p.G281S		NM_014207	NP_055022	P06127	CD5_HUMAN	CD5 molecule precursor	281	Extracellular (Potential).|SRCR 3.				cell proliferation|cell recognition	integral to plasma membrane	scavenger receptor activity			ovary(1)	1		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		TCTGGTGGGGGGCAGCAGCAT	0.637													5	24	---	---	---	---	PASS
TSGA10IP	254187	broad.mit.edu	37	11	65721086	65721086	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65721086G>T	uc001ogk.1	+	7	1232	c.1200G>T	c.(1198-1200)CAG>CAT	p.Q400H	TSGA10IP_uc009yqw.1_RNA|TSGA10IP_uc009yqx.1_RNA	NM_152762	NP_689975	Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein	400	Potential.										0						AGCGGCAGCAGGCCGAGCTGC	0.721													12	27	---	---	---	---	PASS
MOGAT2	80168	broad.mit.edu	37	11	75442316	75442316	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75442316C>G	uc010rru.1	+	6	990	c.990C>G	c.(988-990)CAC>CAG	p.H330Q	MOGAT2_uc010rrv.1_Missense_Mutation_p.H248Q	NM_025098	NP_079374	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	330					glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			ovary(2)	2	Ovarian(111;0.103)					CTGACCAGCACTTGGAGTTCT	0.537													9	34	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85418532	85418532	+	Silent	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85418532G>T	uc010rth.1	-	13	2319	c.2043C>A	c.(2041-2043)GGC>GGA	p.G681G	SYTL2_uc010rtg.1_Silent_p.G682G|SYTL2_uc010rti.1_Silent_p.G657G|SYTL2_uc010rtj.1_Silent_p.G649G|SYTL2_uc001pav.2_Silent_p.G123G|SYTL2_uc010rte.1_Silent_p.G83G|SYTL2_uc001pax.2_Silent_p.G123G|SYTL2_uc001paz.2_Silent_p.G2G|SYTL2_uc001pba.2_Silent_p.G66G|SYTL2_uc001pay.2_Silent_p.G112G|SYTL2_uc001paw.2_Silent_p.G83G|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Silent_p.G979G|SYTL2_uc001pbb.2_Silent_p.G1019G|SYTL2_uc001pbc.2_Silent_p.G1003G|SYTL2_uc010rtf.1_Silent_p.G499G	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	681	C2 1.				intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TTTTCTTCTTGCCCATTTTGC	0.373													17	77	---	---	---	---	PASS
ROBO3	64221	broad.mit.edu	37	11	124743597	124743597	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124743597C>A	uc001qbc.2	+	11	1815	c.1623C>A	c.(1621-1623)GAC>GAA	p.D541E		NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3	541	Extracellular (Potential).				axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CTGCAGAAGACTGGGGAGTAT	0.522													4	23	---	---	---	---	PASS
HEPACAM	220296	broad.mit.edu	37	11	124794863	124794863	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124794863T>A	uc001qbk.2	-	2	594	c.188A>T	c.(187-189)GAC>GTC	p.D63V	HEPACAM_uc009zbj.2_5'Flank|HEPACAM_uc001qbl.1_Missense_Mutation_p.D63V	NM_152722	NP_689935	Q14CZ8	HECAM_HUMAN	hepatocyte cell adhesion molecule precursor	63	Extracellular (Potential).|Ig-like V-type.				cell adhesion|cell cycle arrest|regulation of growth	cytoplasm|integral to membrane				pancreas(1)	1	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.54e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		TACAGGCCTGTCGCTGCTGGT	0.622													14	39	---	---	---	---	PASS
SRPR	6734	broad.mit.edu	37	11	126136409	126136409	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126136409C>G	uc001qdh.2	-	6	853	c.802G>C	c.(802-804)GGA>CGA	p.G268R	SRPR_uc010sbm.1_Missense_Mutation_p.G240R|FOXRED1_uc001qdi.2_5'Flank|FOXRED1_uc010sbn.1_5'Flank|FOXRED1_uc010sbo.1_5'Flank|FOXRED1_uc010sbp.1_5'Flank|FOXRED1_uc010sbq.1_5'Flank|FOXRED1_uc001qdj.2_5'Flank|FOXRED1_uc010sbr.1_5'Flank	NM_003139	NP_003130	P08240	SRPR_HUMAN	signal recognition particle receptor	268					SRP-dependent cotranslational protein targeting to membrane	integral to membrane|signal recognition particle receptor complex	GTP binding|GTPase activity|receptor activity|signal recognition particle binding				0	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		TCAGGGGTTCCATTGGTGGTG	0.502													23	52	---	---	---	---	PASS
ADAMTS15	170689	broad.mit.edu	37	11	130319592	130319592	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130319592C>G	uc010scd.1	+	1	724	c.724C>G	c.(724-726)CTG>GTG	p.L242V		NM_139055	NP_620686	Q8TE58	ATS15_HUMAN	a disintegrin-like and metalloprotease	242	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GGAACATTATCTGCTGACGCT	0.602											OREG0021518	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	5	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12336941	12336941	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12336941G>A	uc001rah.3	-	5	1091	c.949C>T	c.(949-951)CTG>TTG	p.L317L	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Silent_p.L317L	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	317	Extracellular (Potential).|EGF-like 1.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				CCATTCTCCAGGAGTTTGACC	0.368													12	42	---	---	---	---	PASS
KIF5A	3798	broad.mit.edu	37	12	57957917	57957917	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57957917G>A	uc001sor.1	+	4	526	c.318G>A	c.(316-318)ATG>ATA	p.M106I	KIF5A_uc010srr.1_Intron	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A	106	Kinesin-motor.				blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						CTCAGCTGATGGGAATCATTC	0.517													15	41	---	---	---	---	PASS
MDM2	4193	broad.mit.edu	37	12	69218345	69218345	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69218345A>C	uc001sui.2	+	7	724	c.437A>C	c.(436-438)CAA>CCA	p.Q146P	MDM2_uc009zri.2_Missense_Mutation_p.Q101P|MDM2_uc009zqx.2_Intron|MDM2_uc009zqw.2_Missense_Mutation_p.Q146P|MDM2_uc001suk.2_Intron|MDM2_uc009zqy.1_Missense_Mutation_p.Q135P|MDM2_uc001sun.3_Intron|MDM2_uc009zqz.2_Missense_Mutation_p.Q140P|MDM2_uc009zra.2_Intron|MDM2_uc001sum.1_Intron|MDM2_uc009zrd.2_5'UTR|MDM2_uc009zrc.2_5'UTR|MDM2_uc009zre.2_Intron|MDM2_uc009zrf.2_Intron|MDM2_uc001suo.2_Intron|MDM2_uc009zrg.2_Intron|MDM2_uc009zrh.2_Intron	NM_002392	NP_002383	Q00987	MDM2_HUMAN	mouse double minute 2 homolog isoform MDM2	140					cellular response to hypoxia|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|establishment of protein localization|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein complex assembly|protein destabilization|protein localization to nucleus|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to antibiotic|synaptic transmission	cytosol|endocytic vesicle membrane|insoluble fraction|nucleolus|nucleoplasm|plasma membrane|protein complex	enzyme binding|identical protein binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|central_nervous_system(1)	3	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			GACCTTGTACAAGAGCTTCAG	0.328			A		sarcoma|glioma|colorectal|other								9	27	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78571406	78571406	+	Silent	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78571406C>A	uc001syp.2	+	28	5477	c.5304C>A	c.(5302-5304)CCC>CCA	p.P1768P	NAV3_uc001syo.2_Intron|NAV3_uc010sub.1_Intron|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1768						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						ACAGGTCACCCCTTGTCTGGC	0.428										HNSCC(70;0.22)			8	10	---	---	---	---	PASS
CLLU1OS	574016	broad.mit.edu	37	12	92821903	92821903	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92821903T>C	uc001tcb.1	-	1	22	c.20A>G	c.(19-21)AAC>AGC	p.N7S	CLLU1_uc001tcc.2_Intron|CLLU1_uc001tcd.2_Intron|CLLU1_uc001tce.1_Intron|CLLU1_uc001tcf.2_Intron	NM_001025232	NP_001020403	Q5K130	CLU1O_HUMAN	chronic lymphocytic leukemia up-regulated 1	7											0						cttaagttcgttgtgccccaa	0.060													17	46	---	---	---	---	PASS
FGD6	55785	broad.mit.edu	37	12	95535241	95535241	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95535241C>G	uc001tdp.3	-	6	2984	c.2760G>C	c.(2758-2760)CAG>CAC	p.Q920H	FGD6_uc009zsx.2_Missense_Mutation_p.Q53H	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	920	DH.				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						AGTATAGGATCTGATTTAGAA	0.458													12	26	---	---	---	---	PASS
TDG	6996	broad.mit.edu	37	12	104376576	104376576	+	Splice_Site	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104376576G>A	uc001tkg.2	+	5	702	c.479_splice	c.e5-1	p.W160_splice	TDG_uc009zuk.2_Splice_Site_p.W156_splice|TDG_uc010swi.1_Splice_Site_p.W17_splice|TDG_uc010swj.1_Splice_Site	NM_003211	NP_003202	Q13569	TDG_HUMAN	thymine-DNA glycosylase						depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity	p.?(1)		ovary(3)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(302;0.00114)		TCATTTTACAGGGAAGTGTTT	0.249								BER_DNA_glycosylases					21	68	---	---	---	---	PASS
NUAK1	9891	broad.mit.edu	37	12	106460732	106460732	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106460732C>A	uc001tlj.1	-	7	3214	c.1834G>T	c.(1834-1836)GAC>TAC	p.D612Y		NM_014840	NP_055655	O60285	NUAK1_HUMAN	AMPK-related protein kinase 5	612							ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|central_nervous_system(1)	2						CCCTCAAAGTCCTGGATCTGG	0.607													5	37	---	---	---	---	PASS
IFT81	28981	broad.mit.edu	37	12	110655915	110655915	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110655915T>C	uc001tqi.2	+	19	2045	c.1915T>C	c.(1915-1917)TGG>CGG	p.W639R	IFT81_uc001tqh.2_Missense_Mutation_p.W639R|IFT81_uc001tqj.2_RNA	NM_001143779	NP_001137251	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81-like isoform 1	639					cell differentiation|multicellular organismal development|spermatogenesis	intraflagellar transport particle B|microtubule-based flagellum				ovary(1)	1						AGCAAAAATGTGGCGTGATTT	0.343													16	35	---	---	---	---	PASS
MLXIP	22877	broad.mit.edu	37	12	122622070	122622070	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122622070C>T	uc001ubq.2	+	12	2087	c.2087C>T	c.(2086-2088)CCC>CTC	p.P696L	MLXIP_uc001ubt.2_Missense_Mutation_p.P303L	NM_014938	NP_055753	Q9HAP2	MLXIP_HUMAN	MLX interacting protein	696					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial outer membrane|nucleus	DNA binding			ovary(2)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		GAGCAGAGCCCCAGTCCTCAA	0.592													17	34	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132490850	132490850	+	Intron	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132490850G>A	uc001ujn.2	+						EP400_uc001ujl.2_Intron|EP400_uc001ujm.2_Intron	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400						histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CAACCTCGGTGAGGCGCTAAG	0.542													6	20	---	---	---	---	PASS
FNDC3A	22862	broad.mit.edu	37	13	49580320	49580320	+	5'UTR	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49580320A>G	uc001vcm.2	+	2					FNDC3A_uc001vcl.1_5'UTR|FNDC3A_uc001vcn.2_5'UTR|FNDC3A_uc001vco.2_RNA	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A							Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		TTAATGTCTTATTGATAATGG	0.323													10	22	---	---	---	---	PASS
ATP11A	23250	broad.mit.edu	37	13	113459361	113459361	+	Splice_Site	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113459361G>T	uc001vsi.3	+	3	340	c.252_splice	c.e3+1	p.Q84_splice	ATP11A_uc001vsj.3_Splice_Site_p.Q84_splice|ATP11A_uc001vsm.1_Splice_Site	NM_015205	NP_056020	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform a						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TCTGGTGCAGGTAAGGCCGGT	0.348													12	17	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22217816	22217816	+	Intron	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22217816A>G	uc010tmf.1	+						uc010aip.1_Missense_Mutation_p.Y52C|uc010aiq.1_Missense_Mutation_p.Y56C					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		TTATACTGGTATAAGCAAGAA	0.433													11	17	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22409734	22409734	+	Intron	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22409734A>G	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010ajb.1_RNA|uc001wck.2_Missense_Mutation_p.K75R					SubName: Full=Alpha-chain C region; Flags: Fragment;																		GCTGATGACAAGGGAAGCAAC	0.483													12	38	---	---	---	---	PASS
PRMT5	10419	broad.mit.edu	37	14	23390249	23390249	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23390249C>A	uc001whm.1	-	17	1869	c.1778G>T	c.(1777-1779)CGT>CTT	p.R593L	RBM23_uc001whh.2_5'Flank|RBM23_uc001whg.2_5'Flank|RBM23_uc001whi.2_5'Flank|RBM23_uc010tne.1_5'Flank|RBM23_uc001whj.2_5'Flank|RBM23_uc001whk.1_5'Flank|PRMT5_uc001whl.1_Missense_Mutation_p.R576L|PRMT5_uc010akd.1_RNA|PRMT5_uc010tnf.1_Missense_Mutation_p.R487L|PRMT5_uc010tng.1_Missense_Mutation_p.R532L|PRMT5_uc010tnh.1_Missense_Mutation_p.R549L|PRMT5_uc001whn.1_Missense_Mutation_p.R422L	NM_006109	NP_006100	O14744	ANM5_HUMAN	protein arginine methyltransferase 5 isoform a	593					cell proliferation|histone H4-R3 methylation|ncRNA metabolic process|regulation of mitosis|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	histone-arginine N-methyltransferase activity|protein binding|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding			ovary(1)	1	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		TTGGCCTTCACGTACCGTTAT	0.423													4	19	---	---	---	---	PASS
CDH24	64403	broad.mit.edu	37	14	23518860	23518860	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23518860T>C	uc001wil.2	-	11	1947	c.1687A>G	c.(1687-1689)AAC>GAC	p.N563D	CDH24_uc001wik.3_RNA|CDH24_uc010akf.2_Missense_Mutation_p.N525D	NM_022478	NP_071923	Q86UP0	CAD24_HUMAN	cadherin-like 24 isoform 1	563	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|cell-cell adhesion|homophilic cell adhesion	cell-cell junction|cell-cell junction|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|delta-catenin binding			central_nervous_system(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		ACAGTAAAGTTGGCATCAGGG	0.577													9	21	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47351272	47351272	+	Silent	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47351272T>C	uc001wwj.3	-	11	2380	c.2184A>G	c.(2182-2184)TCA>TCG	p.S728S	MDGA2_uc001wwh.3_5'UTR|MDGA2_uc001wwi.3_Silent_p.S499S|MDGA2_uc010ani.2_Silent_p.S288S	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	728					spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						CACGAATTGTTGAATCTCCTT	0.313													6	16	---	---	---	---	PASS
NAA30	122830	broad.mit.edu	37	14	57857808	57857808	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57857808G>T	uc001xcx.3	+	2	287	c.133G>T	c.(133-135)GAC>TAC	p.D45Y	NAA30_uc010trk.1_Intron|NAA30_uc010aow.2_Intron	NM_001011713	NP_001011713	Q147X3	NAA30_HUMAN	N-acetyltransferase 12	45						cytoplasm	peptide alpha-N-acetyltransferase activity			skin(1)	1						CGAGGAGGACGACGAAGAGCA	0.776													5	9	---	---	---	---	PASS
MLH3	27030	broad.mit.edu	37	14	75514257	75514257	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75514257C>G	uc001xrd.1	-	2	2318	c.2102G>C	c.(2101-2103)AGC>ACC	p.S701T	MLH3_uc001xre.1_Missense_Mutation_p.S701T|MLH3_uc010tuy.1_RNA	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN	mutL homolog 3 isoform 1	701					mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)		TGATTTTTTGCTACCTTCCTG	0.348								MMR					23	52	---	---	---	---	PASS
COX8C	341947	broad.mit.edu	37	14	93814406	93814406	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93814406G>A	uc001ybt.1	+	2	237	c.159G>A	c.(157-159)ACG>ACA	p.T53T	KIAA1409_uc001ybs.1_Intron	NM_182971	NP_892016	Q7Z4L0	COX8C_HUMAN	cytochrome c oxidase subunit VIIIc	53	Helical; (By similarity).					integral to membrane|mitochondrial inner membrane	cytochrome-c oxidase activity				0		all_cancers(154;0.083)		Epithelial(152;0.176)|all cancers(159;0.197)|COAD - Colon adenocarcinoma(157;0.202)		TGTTTTTTACGACCTTCTTAA	0.453													8	39	---	---	---	---	PASS
SERPINA4	5267	broad.mit.edu	37	14	95030027	95030027	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95030027A>T	uc001ydk.2	+	2	274	c.208A>T	c.(208-210)ACC>TCC	p.T70S	SERPINA4_uc010avd.2_Missense_Mutation_p.T107S|SERPINA4_uc001ydl.2_Missense_Mutation_p.T70S	NM_006215	NP_006206	P29622	KAIN_HUMAN	serine (or cysteine) proteinase inhibitor, clade	70					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity			ovary(3)|skin(1)	4				COAD - Colon adenocarcinoma(157;0.211)		CGCTTCGGAGACCCCGGGGAA	0.602													17	36	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102483190	102483190	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102483190G>A	uc001yks.2	+	38	7866	c.7702G>A	c.(7702-7704)GTC>ATC	p.V2568I	DYNC1H1_uc001ykt.1_Missense_Mutation_p.V59I	NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	2568	AAA 3 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						CCCTGATGTCGTCGTGCCAAC	0.607													7	14	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106667768	106667768	+	RNA	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106667768C>A	uc010tyt.1	-	877		c.22097G>T								Parts of antibodies, mostly variable regions.												0						TTGGCGGACCCAGCTCATGCC	0.577													23	81	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107131102	107131102	+	RNA	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107131102G>T	uc010tyt.1	-	63		c.3408C>A								Parts of antibodies, mostly variable regions.												0						GCGTGTTCTTGGAATTGTCTC	0.527													28	121	---	---	---	---	PASS
MKRN3	7681	broad.mit.edu	37	15	23812324	23812324	+	Silent	SNP	T	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23812324T>G	uc001ywh.3	+	1	1871	c.1395T>G	c.(1393-1395)CTT>CTG	p.L465L	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Intron	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	465						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		AGAAGGAGCTTGTCGTGCTTC	0.507													22	52	---	---	---	---	PASS
MAGEL2	54551	broad.mit.edu	37	15	23889139	23889139	+	3'UTR	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23889139A>G	uc001ywj.3	-	1						NM_019066	NP_061939			MAGE-like protein 2												0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		TGCTACACCTATTAGCGGGGA	0.587													5	9	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29393827	29393827	+	Missense_Mutation	SNP	G	A	A	rs142481200		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29393827G>A	uc001zck.2	+	9	1571	c.1364G>A	c.(1363-1365)CGT>CAT	p.R455H	APBA2_uc010azj.2_Missense_Mutation_p.R443H|APBA2_uc010uat.1_Missense_Mutation_p.R443H|APBA2_uc001zcl.2_Missense_Mutation_p.R443H|APBA2_uc001zcm.1_Missense_Mutation_p.R147H	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	455	PID.				nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		CACGCCTTGCGTACCATCTCC	0.552													3	9	---	---	---	---	PASS
TJP1	7082	broad.mit.edu	37	15	30092866	30092866	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30092866T>C	uc001zcr.2	-	2	542	c.67A>G	c.(67-69)ACA>GCA	p.T23A	TJP1_uc010azl.2_Missense_Mutation_p.T11A|TJP1_uc001zcq.2_Missense_Mutation_p.T27A|TJP1_uc001zcs.2_Missense_Mutation_p.T23A	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	23	PDZ 1.				cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		AGCGTCACTGTATGTTGTTCC	0.373													12	41	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33955095	33955095	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33955095G>T	uc001zhi.2	+	35	5434	c.5364G>T	c.(5362-5364)GAG>GAT	p.E1788D	RYR3_uc010bar.2_Missense_Mutation_p.E1788D	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	1788	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCGGCAAGGAGGCTCCTGTCA	0.567													32	109	---	---	---	---	PASS
ACTC1	70	broad.mit.edu	37	15	35084669	35084669	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35084669C>A	uc001ziu.1	-	4	799	c.556G>T	c.(556-558)GAC>TAC	p.D186Y	uc001zit.1_Intron	NM_005159	NP_005150	P68032	ACTC_HUMAN	cardiac muscle alpha actin 1 proprotein	186					apoptosis|cardiac muscle tissue morphogenesis|cardiac myofibril assembly|muscle filament sliding|skeletal muscle thin filament assembly	actomyosin, actin part|cytosol|I band	ATP binding|ATPase activity|myosin binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		TCAGTGAGGTCCCGACCAGCC	0.542													12	23	---	---	---	---	PASS
EIF2AK4	440275	broad.mit.edu	37	15	40322614	40322614	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40322614C>T	uc001zkm.1	+	35	4666	c.4616C>T	c.(4615-4617)CCG>CTG	p.P1539L	EIF2AK4_uc010bbj.1_Missense_Mutation_p.P1240L|EIF2AK4_uc001zkn.1_Missense_Mutation_p.P639L|EIF2AK4_uc001zko.1_Missense_Mutation_p.P420L|EIF2AK4_uc010bbk.1_RNA	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha	1539					translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		GTGCTAGCCCCGGAGAAGCTG	0.468											OREG0023054	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	17	---	---	---	---	PASS
INO80	54617	broad.mit.edu	37	15	41308393	41308393	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41308393C>T	uc001zni.2	-	27	3508	c.3295G>A	c.(3295-3297)GAC>AAC	p.D1099N	INO80_uc010ucu.1_Intron	NM_017553	NP_060023	Q9ULG1	INO80_HUMAN	INO80 complex homolog 1	1099	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.				cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4						TTTCCACTGTCAGTGATGAGG	0.493													7	22	---	---	---	---	PASS
GANC	2595	broad.mit.edu	37	15	42640296	42640296	+	Intron	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42640296T>C	uc001zpi.2	+						CAPN3_uc001zpk.1_5'Flank|CAPN3_uc001zpl.1_5'Flank	NM_198141	NP_937784	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C						carbohydrate metabolic process		carbohydrate binding|maltose alpha-glucosidase activity			central_nervous_system(2)	2		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)		GCTGCTCTGTTACAGATTCCA	0.388													6	21	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54624308	54624308	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54624308G>A	uc002ack.2	+	13	4493	c.4493G>A	c.(4492-4494)AGG>AAG	p.R1498K	UNC13C_uc002acl.2_Missense_Mutation_p.R328K	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1498					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TCAAAGTATAGGGTATGTACA	0.313													2	4	---	---	---	---	PASS
PIAS1	8554	broad.mit.edu	37	15	68434669	68434669	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68434669A>C	uc002aqz.2	+	4	692	c.596A>C	c.(595-597)CAG>CCG	p.Q199P	PIAS1_uc010ujx.1_Missense_Mutation_p.Q199P	NM_016166	NP_057250	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	199	PINIT.				androgen receptor signaling pathway|interferon-gamma-mediated signaling pathway|JAK-STAT cascade|positive regulation of protein sumoylation|positive regulation of transcription, DNA-dependent|regulation of interferon-gamma-mediated signaling pathway|transcription, DNA-dependent	nuclear speck	androgen receptor binding|DNA binding|enzyme binding|SUMO ligase activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)	2						GTACAGGTCCAGTTAAGGTAC	0.358													5	10	---	---	---	---	PASS
PARP6	56965	broad.mit.edu	37	15	72534978	72534978	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72534978T>C	uc002auc.2	-	20	2083	c.1624A>G	c.(1624-1626)ATG>GTG	p.M542V	PARP6_uc002aua.2_Missense_Mutation_p.M388V|PARP6_uc002aub.2_RNA|PARP6_uc002aud.3_RNA|PARP6_uc002auf.1_Missense_Mutation_p.M543V	NM_020214	NP_064599	Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	542	PARP catalytic.						NAD+ ADP-ribosyltransferase activity				0						ATGGTATTCATCCTGTTGTAT	0.473													23	33	---	---	---	---	PASS
NEIL1	79661	broad.mit.edu	37	15	75647319	75647319	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75647319C>T	uc002bad.2	+	10	1623	c.1117C>T	c.(1117-1119)CGG>TGG	p.R373W	NEIL1_uc002bae.2_Missense_Mutation_p.R459W|MIR631_hsa-mir-631|MI0003645_5'Flank	NM_024608	NP_078884	Q96FI4	NEIL1_HUMAN	nei endonuclease VIII-like 1	373					base-excision repair|negative regulation of nuclease activity|nucleotide-excision repair|response to oxidative stress	cytoplasm|nucleus	damaged DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|protein C-terminus binding|zinc ion binding			ovary(1)	1						CTGCAGACCCCGGAAGGTCAA	0.572								BER_DNA_glycosylases					6	10	---	---	---	---	PASS
ACD	65057	broad.mit.edu	37	16	67694091	67694091	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67694091G>A	uc002etq.3	-	1	628	c.291C>T	c.(289-291)CCC>CCT	p.P97P	ACD_uc002etp.3_Silent_p.P97P|ACD_uc002etr.3_Silent_p.P97P|ACD_uc010vjt.1_Silent_p.P87P|PARD6A_uc002ets.2_5'Flank|PARD6A_uc002ett.2_5'Flank|PARD6A_uc002etu.2_5'Flank	NM_001082486	NP_001075955	Q96AP0	ACD_HUMAN	adrenocortical dysplasia homolog isoform 1	97	PWI.				intracellular protein transport|negative regulation of telomere maintenance via telomerase|positive regulation of single-stranded telomeric DNA binding|positive regulation of telomerase activity|protection from non-homologous end joining at telomere|protein localization to chromosome, telomeric region|telomere assembly	nuclear telomere cap complex|nucleoplasm	DNA binding|DNA polymerase binding			pancreas(1)	1		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		CCCGAATCCAGGGCCGTAGGA	0.701													15	38	---	---	---	---	PASS
GLG1	2734	broad.mit.edu	37	16	74519807	74519807	+	Silent	SNP	T	A	A	rs76382044	byFrequency	TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74519807T>A	uc002fcy.3	-	9	1508	c.1458A>T	c.(1456-1458)ACA>ACT	p.T486T	GLG1_uc002fcx.2_Silent_p.T486T|GLG1_uc002fcw.3_Silent_p.T475T|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3	486	Extracellular (Potential).|Cys-rich GLG1 7.					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						CCTGAATCAGTGTTTGAAGCT	0.393													8	30	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76556015	76556015	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76556015C>A	uc002feu.1	+	19	3001	c.2616C>A	c.(2614-2616)AAC>AAA	p.N872K	CNTNAP4_uc002fev.1_Missense_Mutation_p.N736K|CNTNAP4_uc010chb.1_Missense_Mutation_p.N799K|CNTNAP4_uc002fex.1_Missense_Mutation_p.N875K	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	872	Extracellular (Potential).|Laminin G-like 3.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						CCCACTTCAACGACAACCAGT	0.502													27	57	---	---	---	---	PASS
ADAMTS18	170692	broad.mit.edu	37	16	77369771	77369771	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77369771C>A	uc002ffc.3	-	12	2160	c.1741G>T	c.(1741-1743)GGG>TGG	p.G581W	ADAMTS18_uc010chc.1_Missense_Mutation_p.G169W|ADAMTS18_uc002ffe.1_Missense_Mutation_p.G277W	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	581					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						CCGAGCTCCCCAAACTTTACG	0.597													25	86	---	---	---	---	PASS
GALNS	2588	broad.mit.edu	37	16	88902186	88902186	+	Silent	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88902186C>A	uc002fly.3	-	7	794	c.705G>T	c.(703-705)ACG>ACT	p.T235T	GALNS_uc010cid.2_Silent_p.T241T|GALNS_uc002flz.3_5'UTR	NM_000512	NP_000503	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfate sulfatase	235						lysosome	metal ion binding|N-acetylgalactosamine-4-sulfatase activity|N-acetylgalactosamine-6-sulfatase activity			large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0496)	Hyaluronidase(DB00070)	CGGGTGCGTGCGTGGCGTCGA	0.617													9	36	---	---	---	---	PASS
ALOX15	246	broad.mit.edu	37	17	4536516	4536516	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4536516G>A	uc002fyh.2	-	10	1357	c.1343C>T	c.(1342-1344)GCC>GTC	p.A448V	ALOX15_uc010vsd.1_Missense_Mutation_p.A409V|ALOX15_uc010vse.1_Missense_Mutation_p.A470V	NM_001140	NP_001131	P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	448	Lipoxygenase.				inflammatory response|leukotriene biosynthetic process	nucleus	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			skin(3)|ovary(1)|lung(1)	5				READ - Rectum adenocarcinoma(115;0.0327)	Ciclopirox(DB01188)|Masoprocol(DB00179)|Zileuton(DB00744)	CCCCCGGTCGGCCAAGTCATC	0.592													3	17	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578188	7578188	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578188C>A	uc002gim.2	-	6	855	c.661G>T	c.(661-663)GAG>TAG	p.E221*	TP53_uc002gig.1_Nonsense_Mutation_p.E221*|TP53_uc002gih.2_Nonsense_Mutation_p.E221*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.E89*|TP53_uc010cng.1_Nonsense_Mutation_p.E89*|TP53_uc002gii.1_Nonsense_Mutation_p.E89*|TP53_uc010cnh.1_Nonsense_Mutation_p.E221*|TP53_uc010cni.1_Nonsense_Mutation_p.E221*|TP53_uc002gij.2_Nonsense_Mutation_p.E221*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.E128*|TP53_uc002gio.2_Nonsense_Mutation_p.E89*|TP53_uc010vug.1_Nonsense_Mutation_p.E182*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	221	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> A (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.E221*(5)|p.E221fs*4(3)|p.E221G(2)|p.E221K(2)|p.E221D(2)|p.E221fs*26(2)|p.E221E(2)|p.Y220_P223delYEPP(1)|p.?(1)|p.E221fs*2(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y220fs*25(1)|p.V218fs*26(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCAGGCGGCTCATAGGGCACC	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			4	9	---	---	---	---	PASS
MAP2K4	6416	broad.mit.edu	37	17	12044544	12044544	+	Silent	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12044544A>T	uc002gnj.2	+	11	1236	c.1167A>T	c.(1165-1167)CCA>CCT	p.P389P	MAP2K4_uc002gnk.2_Silent_p.P400P|MAP2K4_uc010vvi.1_Silent_p.P271P|MAP2K4_uc010vvj.1_Silent_p.P261P	NM_003010	NP_003001	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	389					cellular response to mechanical stimulus|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|JUN kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.?(2)		large_intestine(14)|breast(12)|lung(8)|ovary(8)|pancreas(8)|stomach(2)|central_nervous_system(1)|biliary_tract(1)|testis(1)|endometrium(1)|urinary_tract(1)|skin(1)	58		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		ATCAAATGCCAGCTACTCCCA	0.413			D|Mis|N		pancreatic|breast|colorectal								12	39	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18039093	18039093	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18039093G>C	uc010vxh.1	+	12	4889	c.4551G>C	c.(4549-4551)CAG>CAC	p.Q1517H		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	1517	Myosin head-like.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					AGCTGCTGCAGATCTCCCCTG	0.567													5	10	---	---	---	---	PASS
ITGB3	3690	broad.mit.edu	37	17	45361811	45361811	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45361811G>T	uc002ilj.2	+	4	384	c.364G>T	c.(364-366)GAT>TAT	p.D122Y	ITGB3_uc002ili.1_Missense_Mutation_p.D122Y|ITGB3_uc010wkr.1_RNA	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor	122	Extracellular (Potential).				activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	CCTTCCAGATGATTCGAAGAA	0.418													9	27	---	---	---	---	PASS
MPO	4353	broad.mit.edu	37	17	56348155	56348155	+	Silent	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56348155G>T	uc002ivu.1	-	12	2277	c.2100C>A	c.(2098-2100)CCC>CCA	p.P700P		NM_000250	NP_000241	P05164	PERM_HUMAN	myeloperoxidase	700					anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity			ovary(2)|large_intestine(1)|pancreas(1)	4					Cefdinir(DB00535)	AGATGATCCGGGGCAATGAGA	0.547													10	26	---	---	---	---	PASS
TRIM47	91107	broad.mit.edu	37	17	73871553	73871553	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73871553C>T	uc002jpw.2	-	5	1231	c.1204G>A	c.(1204-1206)GAT>AAT	p.D402N	TRIM47_uc002jpv.2_Missense_Mutation_p.D164N	NM_033452	NP_258411	Q96LD4	TRI47_HUMAN	tripartite motif-containing 47	402						cytoplasm|nucleus	zinc ion binding			ovary(2)|prostate(1)|lung(1)|breast(1)	5			Epithelial(20;4.23e-06)|all cancers(21;5.24e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGCTCAGCATCAGCTGTAGAA	0.577													6	22	---	---	---	---	PASS
SLC25A10	1468	broad.mit.edu	37	17	79686879	79686879	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79686879G>C	uc002kbi.2	+	10	810	c.724G>C	c.(724-726)GTG>CTG	p.V242L	SLC25A10_uc010wut.1_Missense_Mutation_p.V397L|SLC25A10_uc010dif.2_Missense_Mutation_p.V251L|SLC25A10_uc010wuu.1_Missense_Mutation_p.V196L	NM_012140	NP_036272	Q9UBX3	DIC_HUMAN	solute carrier family 25 (mitochondrial carrier;	242	Solcar 3.				gluconeogenesis|mitochondrial transport	integral to membrane|mitochondrial inner membrane|nucleus	protein binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0117)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)		Succinic acid(DB00139)	CCACTGCGCCGTGGAGACAGC	0.602													54	172	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5419875	5419875	+	Silent	SNP	C	T	T	rs11661706		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5419875C>T	uc002kmt.1	-	12	1427	c.1341G>A	c.(1339-1341)GAG>GAA	p.E447E	EPB41L3_uc010wzh.1_Silent_p.E465E|EPB41L3_uc002kmu.1_Silent_p.E465E|EPB41L3_uc010dkq.1_Silent_p.E356E|EPB41L3_uc002kms.1_5'UTR|EPB41L3_uc010wze.1_5'UTR|EPB41L3_uc010wzf.1_5'UTR|EPB41L3_uc010wzg.1_5'UTR|EPB41L3_uc010dkr.2_Silent_p.E26E	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	447	Hydrophilic.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						CAGTACCAACCTCTGCAGCAG	0.328													10	56	---	---	---	---	PASS
DSG2	1829	broad.mit.edu	37	18	29125885	29125885	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29125885G>C	uc002kwu.3	+	15	2724	c.2536G>C	c.(2536-2538)GAT>CAT	p.D846H	uc002kwv.3_Intron	NM_001943	NP_001934	Q14126	DSG2_HUMAN	desmoglein 2 preproprotein	846	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(2)|breast(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			TCAAAAAATAGATATAAATAA	0.373													19	66	---	---	---	---	PASS
SMAD4	4089	broad.mit.edu	37	18	48604789	48604789	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48604789C>A	uc010xdp.1	+	12	2149	c.1611C>A	c.(1609-1611)GAC>GAA	p.D537E	SMAD4_uc002lfb.3_Missense_Mutation_p.D382E	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	537	MH2.				BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.D537Y(2)|p.?(2)|p.L536fs*11(1)|p.L536fs*14(1)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		AGCTCCTAGACGAAGTACTTC	0.483									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				5	24	---	---	---	---	PASS
NARS	4677	broad.mit.edu	37	18	55270082	55270082	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55270082T>C	uc002lgs.2	-	12	1573	c.1345A>G	c.(1345-1347)ATG>GTG	p.M449V	NARS_uc002lgt.2_Missense_Mutation_p.M448V|NARS_uc010xea.1_Missense_Mutation_p.M200V	NM_004539	NP_004530	O43776	SYNC_HUMAN	asparaginyl-tRNA synthetase	449					asparaginyl-tRNA aminoacylation	cytosol|soluble fraction	asparagine-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding				0		Colorectal(73;0.227)			L-Asparagine(DB00174)	CATCGCTGCATGTAGAAGGAC	0.438													13	27	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56203604	56203604	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56203604A>G	uc002lhj.3	-	5	4029	c.3815T>C	c.(3814-3816)GTC>GCC	p.V1272A	ALPK2_uc002lhk.1_Missense_Mutation_p.V603A	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	1272							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						TACAGCCCAGACCTTGTCAGG	0.498													37	52	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63477081	63477081	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63477081T>C	uc002ljz.2	+	3	677	c.352T>C	c.(352-354)TAC>CAC	p.Y118H	CDH7_uc002lka.2_Missense_Mutation_p.Y118H|CDH7_uc002lkb.2_Missense_Mutation_p.Y118H	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	118	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				GCAGGCCTACTACACGCTCCG	0.502													17	23	---	---	---	---	PASS
TMEM38A	79041	broad.mit.edu	37	19	16791277	16791277	+	Silent	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16791277C>T	uc002nes.2	+	3	442	c.351C>T	c.(349-351)ATC>ATT	p.I117I		NM_024074	NP_076979	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	117	Cytoplasmic (Potential).					integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity			central_nervous_system(2)|ovary(1)	3						TGAAACTCATCTTCGTGGCCA	0.552													55	87	---	---	---	---	PASS
B3GNT3	10331	broad.mit.edu	37	19	17918639	17918639	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17918639G>C	uc002nhk.1	+	2	108	c.23G>C	c.(22-24)CGG>CCG	p.R8P	B3GNT3_uc002nhl.1_Missense_Mutation_p.R8P|B3GNT3_uc010ebd.1_Missense_Mutation_p.R8P|B3GNT3_uc010ebe.1_Missense_Mutation_p.R8P	NM_014256	NP_055071	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal	8	Cytoplasmic (Potential).				protein glycosylation	Golgi membrane|integral to plasma membrane	galactosyltransferase activity			upper_aerodigestive_tract(1)	1						CGGCACCGGCGGCCCAATGCC	0.572													8	32	---	---	---	---	PASS
PLEKHG2	64857	broad.mit.edu	37	19	39912892	39912892	+	Silent	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39912892G>T	uc010xuz.1	+	17	1966	c.1641G>T	c.(1639-1641)CTG>CTT	p.L547L	PLEKHG2_uc010xuy.1_Silent_p.L488L|PLEKHG2_uc002olj.2_Silent_p.L547L|PLEKHG2_uc010xva.1_Silent_p.L325L	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide	547					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AAGAAATCCTGGAACTGCTGA	0.607													5	14	---	---	---	---	PASS
ZFP112	7771	broad.mit.edu	37	19	44844689	44844689	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44844689C>A	uc010ejj.2	-	3	134	c.21G>T	c.(19-21)ATG>ATT	p.M7I	ZFP112_uc002ozc.3_Missense_Mutation_p.M1I|ZFP112_uc010xwy.1_Missense_Mutation_p.M24I|ZFP112_uc010xwz.1_Missense_Mutation_p.M6I	NM_001083335	NP_001076804	Q9UJU3	ZF112_HUMAN	zinc finger protein 228 isoform 1	7					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)	5						TGAATGTCACCATCTCCTACA	0.507													25	50	---	---	---	---	PASS
ZNF616	90317	broad.mit.edu	37	19	52618360	52618360	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52618360T>A	uc002pym.2	-	4	2340	c.2057A>T	c.(2056-2058)AAG>ATG	p.K686M	ZNF616_uc002pyn.2_RNA	NM_178523	NP_848618	Q08AN1	ZN616_HUMAN	zinc finger protein 616	686					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		ATATGGTTTCTTTCCTGCATG	0.393													36	112	---	---	---	---	PASS
KIR3DX1	90011	broad.mit.edu	37	19	55048148	55048148	+	Nonsense_Mutation	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55048148A>T	uc010erm.2	+	1	28	c.16A>T	c.(16-18)AAG>TAG	p.K6*	KIR3DX1_uc010yfa.1_RNA|KIR3DX1_uc010yfb.1_RNA|KIR3DX1_uc010yfc.1_RNA|KIR3DX1_uc010yfd.1_RNA					Homo sapiens killer cell immunoglobulin-like receptor, three domains, X1, mRNA (cDNA clone IMAGE:4849085).											ovary(1)	1				GBM - Glioblastoma multiforme(193;0.099)		GCTGGGAGAGAAGTTGACCCT	0.502											OREG0003665	type=REGULATORY REGION|Gene=BC033195|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	6	23	---	---	---	---	PASS
ANGPT4	51378	broad.mit.edu	37	20	853651	853651	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:853651G>A	uc002wei.2	-	9	1567	c.1464C>T	c.(1462-1464)AGC>AGT	p.S488S	ANGPT4_uc010zpn.1_3'UTR	NM_015985	NP_057069	Q9Y264	ANGP4_HUMAN	angiopoietin 4 precursor	488	Fibrinogen C-terminal.				anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			ovary(2)	2						GCAGTGAGTAGCTGGGGCCCT	0.582													8	36	---	---	---	---	PASS
PLCB4	5332	broad.mit.edu	37	20	9434026	9434026	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9434026G>A	uc002wnf.2	+	31	3013	c.2877G>A	c.(2875-2877)ACG>ACA	p.T959T	PLCB4_uc010gbw.1_Silent_p.T959T|PLCB4_uc010gbx.2_Silent_p.T971T|PLCB4_uc002wne.2_Silent_p.T959T|PLCB4_uc002wnh.2_Silent_p.T806T	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b	959					intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						TACACTGCACGCAAGTTGACA	0.418													11	18	---	---	---	---	PASS
ZNFX1	57169	broad.mit.edu	37	20	47887968	47887968	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47887968C>A	uc002xui.2	-	3	628	c.381G>T	c.(379-381)TGG>TGT	p.W127C		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	127							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GGGGAGTCCGCCACTGCTGGA	0.527													47	139	---	---	---	---	PASS
ZNFX1	57169	broad.mit.edu	37	20	47887969	47887969	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47887969C>A	uc002xui.2	-	3	627	c.380G>T	c.(379-381)TGG>TTG	p.W127L		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	127							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GGGAGTCCGCCACTGCTGGAA	0.527													46	135	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10914394	10914394	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10914394A>G	uc002yip.1	-	21	1693	c.1325T>C	c.(1324-1326)GTC>GCC	p.V442A	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.V424A|TPTE_uc002yir.1_Missense_Mutation_p.V404A|TPTE_uc010gkv.1_Missense_Mutation_p.V304A	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	442	C2 tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGTGGAAAAGACAACCTTTTT	0.323													4	44	---	---	---	---	PASS
TIAM1	7074	broad.mit.edu	37	21	32598070	32598070	+	Nonsense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32598070G>C	uc002yow.1	-	8	2253	c.1781C>G	c.(1780-1782)TCA>TGA	p.S594*	TIAM1_uc011adk.1_Nonsense_Mutation_p.S594*|TIAM1_uc011adl.1_Nonsense_Mutation_p.S594*|TIAM1_uc002yox.1_Nonsense_Mutation_p.S202*	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	594					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						CTTTTTCTTTGAGTCAGTGAC	0.358													25	64	---	---	---	---	PASS
PTTG1IP	754	broad.mit.edu	37	21	46271493	46271493	+	3'UTR	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46271493G>A	uc002zgb.1	-	6					PTTG1IP_uc011afj.1_RNA|PTTG1IP_uc011afk.1_Missense_Mutation_p.A73V	NM_004339	NP_004330	P53801	PTTG_HUMAN	pituitary tumor-transforming gene 1						protein import into nucleus	cytoplasm|integral to membrane|nucleus				ovary(1)	1				Colorectal(79;0.0659)		GTGCTGGAGCGCTTTAGTTGT	0.498													19	35	---	---	---	---	PASS
USP18	11274	broad.mit.edu	37	22	18650677	18650677	+	Silent	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18650677G>T	uc002zny.2	+	6	839	c.501G>T	c.(499-501)CTG>CTT	p.L167L		NM_017414	NP_059110	Q9UMW8	UBP18_HUMAN	ubiquitin specific protease 18	167					regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway|ubiquitin-dependent protein catabolic process	cytosol|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			breast(1)	1						TGCAGGCCCTGTATACGATCC	0.547													11	33	---	---	---	---	PASS
MED15	51586	broad.mit.edu	37	22	20929434	20929434	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20929434A>G	uc002zsp.2	+	9	1267	c.1187A>G	c.(1186-1188)CAC>CGC	p.H396R	MED15_uc002zsq.2_Intron|MED15_uc010gso.2_Intron|MED15_uc002zsr.2_Intron|MED15_uc011ahs.1_Intron|MED15_uc002zss.2_Intron|MED15_uc011ahu.1_Missense_Mutation_p.H122R|MED15_uc002zst.2_Missense_Mutation_p.H12R	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a	396	Pro-rich.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			GGTGGGATGCACATAAGAGCC	0.582													32	106	---	---	---	---	PASS
THAP7	80764	broad.mit.edu	37	22	21355637	21355637	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21355637G>A	uc002ztr.1	-	3	174	c.144C>T	c.(142-144)CCC>CCT	p.P48P	THAP7_uc002zts.1_Silent_p.P48P|FLJ39582_uc002ztt.1_5'Flank|FLJ39582_uc002ztu.1_5'Flank|FLJ39582_uc002ztv.2_5'Flank	NM_001008695	NP_001008695	Q9BT49	THAP7_HUMAN	THAP domain containing 7 isoform 2	48	THAP-type.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck	C2H2 zinc finger domain binding|DNA binding|metal ion binding|protein N-terminus binding				0	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CCTGGCCGCTGGGGTCCAGCC	0.617													43	124	---	---	---	---	PASS
ASB9	140462	broad.mit.edu	37	X	15270382	15270382	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15270382T>A	uc004cwl.2	-	4	674	c.427A>T	c.(427-429)AGG>TGG	p.R143W	ASB9_uc004cwk.2_Missense_Mutation_p.R143W|ASB9_uc004cwm.2_Missense_Mutation_p.R143W|ASB9_uc010ner.2_Missense_Mutation_p.R143W|ASB9_uc004cwn.2_Missense_Mutation_p.R114W	NM_001031739	NP_001026909	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box-containing 9 isoform	143	ANK 4.				intracellular signal transduction						0	Hepatocellular(33;0.183)					TTACCTCTCCTAGCAGCTTCA	0.443													10	25	---	---	---	---	PASS
CNKSR2	22866	broad.mit.edu	37	X	21627564	21627564	+	Nonsense_Mutation	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21627564A>T	uc004czx.1	+	20	2557	c.2521A>T	c.(2521-2523)AAG>TAG	p.K841*	CNKSR2_uc004czw.2_Nonsense_Mutation_p.K841*|CNKSR2_uc011mjn.1_Nonsense_Mutation_p.K792*|CNKSR2_uc011mjo.1_Nonsense_Mutation_p.K811*|CNKSR2_uc004czy.2_Nonsense_Mutation_p.K433*	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	841					regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2						AAATGGGGGCAAGCCTCGAAG	0.532													16	44	---	---	---	---	PASS
DDX53	168400	broad.mit.edu	37	X	23019932	23019932	+	Silent	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23019932G>T	uc004daj.2	+	1	1846	c.1758G>T	c.(1756-1758)CTG>CTT	p.L586L		NM_182699	NP_874358	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	586	Helicase C-terminal.					nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			large_intestine(1)|ovary(1)|kidney(1)	3						TTAAAATTCTGGACAGAGCAA	0.423													15	55	---	---	---	---	PASS
PTCHD1	139411	broad.mit.edu	37	X	23397917	23397917	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23397917C>A	uc004dal.3	+	2	569	c.561C>A	c.(559-561)TAC>TAA	p.Y187*	PTCHD1_uc010nfu.1_Nonsense_Mutation_p.Y187*	NM_173495	NP_775766	Q96NR3	PTHD1_HUMAN	patched domain containing 1	187					cognition|smoothened signaling pathway	integral to membrane|plasma membrane	hedgehog receptor activity			ovary(4)|kidney(1)|skin(1)	6						GGGCTGTGTACAATGGGCACC	0.532													35	91	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37028238	37028238	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37028238G>A	uc004ddl.1	+	1	1769	c.1755G>A	c.(1753-1755)GAG>GAA	p.E585E		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	585										ovary(3)	3						TCTGCCCAGAGCCTCCCAAGA	0.642													19	42	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37028815	37028815	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37028815C>A	uc004ddl.1	+	1	2346	c.2332C>A	c.(2332-2334)CTT>ATT	p.L778I		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	778										ovary(3)	3						CCACCCAGAGCTTCCCAAGCC	0.632													7	32	---	---	---	---	PASS
ZNF157	7712	broad.mit.edu	37	X	47271926	47271926	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47271926C>A	uc004dhr.1	+	4	523	c.454C>A	c.(454-456)CGT>AGT	p.R152S		NM_003446	NP_003437	P51786	ZN157_HUMAN	zinc finger protein 157	152					negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CTTTGTTAGACGTAAAAGAAC	0.373													18	36	---	---	---	---	PASS
SYN1	6853	broad.mit.edu	37	X	47478795	47478795	+	Silent	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47478795G>T	uc004die.2	-	1	462	c.333C>A	c.(331-333)GCC>GCA	p.A111A	SYN1_uc004did.2_Silent_p.A111A	NM_006950	NP_008881	P17600	SYN1_HUMAN	synapsin I isoform Ia	111	B; linker.					cell junction|Golgi apparatus	actin binding|ATP binding|ligase activity|transporter activity			ovary(1)	1						CCCTGGAGGCGGCTCCCCCGC	0.716													3	7	---	---	---	---	PASS
CLCN5	1184	broad.mit.edu	37	X	49855383	49855383	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49855383G>T	uc004dos.1	+	11	2238	c.1990G>T	c.(1990-1992)GAG>TAG	p.E664*	CLCN5_uc004dor.1_Nonsense_Mutation_p.E734*|CLCN5_uc004doq.1_Nonsense_Mutation_p.E734*|CLCN5_uc004dot.1_Nonsense_Mutation_p.E664*	NM_000084	NP_000075	P51795	CLCN5_HUMAN	chloride channel 5 isoform b	664	Cytoplasmic (By similarity).				excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)					TTATTTCACGGAGCATTCTCC	0.448													6	14	---	---	---	---	PASS
AKAP4	8852	broad.mit.edu	37	X	49958335	49958335	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49958335G>T	uc004dow.1	-	5	1153	c.1029C>A	c.(1027-1029)GAC>GAA	p.D343E	AKAP4_uc004dov.1_Intron|AKAP4_uc010njp.1_Missense_Mutation_p.D165E|AKAP4_uc004dou.1_Missense_Mutation_p.D334E	NM_003886	NP_003877	Q5JQC9	AKAP4_HUMAN	A-kinase anchor protein 4 isoform 1	343	PKA-RI-alpha subunit binding domain (By similarity).				cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding			kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8	Ovarian(276;0.236)					AGACCATCATGTCAGATGCCA	0.488													7	17	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50094328	50094328	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50094328C>A	uc004dox.3	+	12	4347	c.4049C>A	c.(4048-4050)TCT>TAT	p.S1350Y	CCNB3_uc004doy.2_Missense_Mutation_p.S1350Y|CCNB3_uc004doz.2_Missense_Mutation_p.S246Y|CCNB3_uc010njq.2_Missense_Mutation_p.S242Y|CCNB3_uc004dpa.2_Missense_Mutation_p.S189Y	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	1350					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					ACTTTCAGTTCTTACGATAGT	0.458													51	137	---	---	---	---	PASS
ARHGEF9	23229	broad.mit.edu	37	X	62857963	62857963	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62857963C>T	uc004dvl.2	-	10	2335	c.1496G>A	c.(1495-1497)CGC>CAC	p.R499H	ARHGEF9_uc004dvj.1_Missense_Mutation_p.R388H|ARHGEF9_uc004dvk.1_Missense_Mutation_p.R317H|ARHGEF9_uc011mos.1_Missense_Mutation_p.R478H|ARHGEF9_uc004dvm.1_Missense_Mutation_p.R478H|ARHGEF9_uc011mot.1_Missense_Mutation_p.R446H	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9	499					apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						TGACTGGCTGCGCTTGGGTTC	0.488													3	11	---	---	---	---	PASS
ZMYM3	9203	broad.mit.edu	37	X	70469503	70469503	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70469503G>A	uc004dzh.1	-	7	1365	c.1278C>T	c.(1276-1278)AGC>AGT	p.S426S	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Silent_p.S426S|ZMYM3_uc004dzj.1_Silent_p.S426S|ZMYM3_uc011mpu.1_Silent_p.S157S|ZMYM3_uc004dzk.3_Silent_p.S426S|ZMYM3_uc004dzl.3_Silent_p.S426S|ZMYM3_uc004dzm.3_Silent_p.S426S	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	426					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)					GGTGTACCACGCTGCCATTGC	0.592													3	16	---	---	---	---	PASS
HDAC8	55869	broad.mit.edu	37	X	71708787	71708787	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71708787C>A	uc004eau.2	-	7	775	c.733G>T	c.(733-735)GAA>TAA	p.E245*	HDAC8_uc011mqe.1_Nonsense_Mutation_p.E102*|HDAC8_uc011mqf.1_Nonsense_Mutation_p.E50*|HDAC8_uc011mqg.1_Nonsense_Mutation_p.E154*|HDAC8_uc011mqh.1_Nonsense_Mutation_p.E154*|HDAC8_uc010nlk.1_Nonsense_Mutation_p.E116*|HDAC8_uc004eav.2_Nonsense_Mutation_p.E245*|HDAC8_uc004eaw.2_RNA	NM_018486	NP_060956	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	245	Histone deacetylase.				chromatin assembly or disassembly|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|nuclear chromosome	histone deacetylase activity (H3-K16 specific)|metal ion binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|transcription factor binding				0	Renal(35;0.156)				Vorinostat(DB02546)	CCATACCTTTCACAGATCTGG	0.423													21	34	---	---	---	---	PASS
NAP1L2	4674	broad.mit.edu	37	X	72433074	72433074	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72433074C>A	uc004ebi.2	-	1	1611	c.1255G>T	c.(1255-1257)GGG>TGG	p.G419W	NAP1L2_uc011mqj.1_Missense_Mutation_p.G277W	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	419					nucleosome assembly	chromatin assembly complex				lung(1)	1	Renal(35;0.156)					CTAACTACCCCCTCCTGCTGA	0.338													7	38	---	---	---	---	PASS
TSIX	9383	broad.mit.edu	37	X	73047209	73047209	+	RNA	SNP	A	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73047209A>T	uc004ebn.2	+	1		c.35170A>T			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0						AGATAGATTCATGAAGAGGCT	0.388													7	16	---	---	---	---	PASS
BRWD3	254065	broad.mit.edu	37	X	79999651	79999651	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79999651G>C	uc004edt.2	-	8	956	c.693C>G	c.(691-693)AAC>AAG	p.N231K	BRWD3_uc004edo.2_5'UTR|BRWD3_uc004edp.2_Missense_Mutation_p.N60K|BRWD3_uc004edq.2_5'UTR|BRWD3_uc010nmj.1_5'UTR|BRWD3_uc004edr.2_5'UTR|BRWD3_uc004eds.2_5'UTR|BRWD3_uc004edu.2_5'UTR|BRWD3_uc004edv.2_5'UTR|BRWD3_uc004edw.2_5'UTR|BRWD3_uc004edx.2_5'UTR|BRWD3_uc004edy.2_5'UTR|BRWD3_uc004edz.2_5'UTR|BRWD3_uc004eea.2_5'UTR|BRWD3_uc004eeb.2_Intron	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	231	WD 3.									ovary(4)	4						TGTTTTCATAGTTAACAGCCA	0.448													18	75	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91134108	91134108	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91134108A>C	uc004efk.1	+	2	3714	c.2869A>C	c.(2869-2871)AAT>CAT	p.N957H	PCDH11X_uc004efl.1_Missense_Mutation_p.N957H|PCDH11X_uc004efo.1_Missense_Mutation_p.N957H|PCDH11X_uc010nmv.1_Missense_Mutation_p.N957H|PCDH11X_uc004efm.1_Missense_Mutation_p.N957H|PCDH11X_uc004efn.1_Missense_Mutation_p.N957H|PCDH11X_uc004efh.1_Missense_Mutation_p.N957H|PCDH11X_uc004efj.1_Missense_Mutation_p.N957H	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	957	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						AACTCCCCTGAATTCGAAGCA	0.502													44	115	---	---	---	---	PASS
TAF7L	54457	broad.mit.edu	37	X	100530214	100530214	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100530214T>C	uc004ehb.2	-	12	1352	c.1340A>G	c.(1339-1341)GAG>GGG	p.E447G	TAF7L_uc004eha.2_Missense_Mutation_p.E287G	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA	447	Potential.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						TCTTACCTTCTCATTTTTTTG	0.343													33	100	---	---	---	---	PASS
TAF7L	54457	broad.mit.edu	37	X	100530223	100530223	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100530223T>G	uc004ehb.2	-	12	1343	c.1331A>C	c.(1330-1332)CAA>CCA	p.Q444P	TAF7L_uc004eha.2_Missense_Mutation_p.Q284P	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA	444	Potential.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						CTCATTTTTTTGTTTTTCCTG	0.323													35	101	---	---	---	---	PASS
MORF4L2	9643	broad.mit.edu	37	X	102931102	102931102	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102931102C>T	uc004ekw.2	-	4	2086	c.854G>A	c.(853-855)CGC>CAC	p.R285H	MORF4L2_uc004ela.2_Missense_Mutation_p.R285H|MORF4L2_uc004ekx.2_Missense_Mutation_p.R285H|MORF4L2_uc004elb.2_Missense_Mutation_p.R285H|MORF4L2_uc004eky.2_Missense_Mutation_p.R285H|MORF4L2_uc010nos.2_Missense_Mutation_p.R285H|MORF4L2_uc004ekz.2_Missense_Mutation_p.R285H|MORF4L2_uc011mry.1_Missense_Mutation_p.R285H|MORF4L2_uc011mrz.1_Missense_Mutation_p.R285H|MORF4L2_uc004elc.2_Missense_Mutation_p.R285H|MORF4L2_uc004elf.2_Missense_Mutation_p.R285H|MORF4L2_uc004ele.2_Missense_Mutation_p.R285H|MORF4L2_uc011msa.1_Missense_Mutation_p.R285H|MORF4L2_uc011msb.1_Missense_Mutation_p.R285H|MORF4L2_uc011msc.1_Missense_Mutation_p.R285H|MORF4L2_uc011msd.1_Missense_Mutation_p.R285H|MORF4L2_uc004eld.2_Missense_Mutation_p.R285H	NM_012286	NP_036418	Q15014	MO4L2_HUMAN	mortality factor 4 like 2	285					chromatin modification|DNA repair|regulation of cell growth|transcription, DNA-dependent	nucleolus	protein binding				0						CAGGGCTTTGCGGTGGTACTC	0.388													27	98	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106083280	106083280	+	Silent	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106083280G>A	uc004emo.2	+	9	1521	c.1356G>A	c.(1354-1356)TTG>TTA	p.L452L	MORC4_uc004emp.3_Intron|TBC1D8B_uc004emn.2_Silent_p.L452L	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	452						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CATTACAGTTGAAAGAAAAAA	0.328													12	39	---	---	---	---	PASS
UPF3B	65109	broad.mit.edu	37	X	118986836	118986836	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118986836G>A	uc004erz.1	-	1	133	c.56C>T	c.(55-57)CCC>CTC	p.P19L	UPF3B_uc004esa.1_Missense_Mutation_p.P19L	NM_080632	NP_542199	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B	19					mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(2)|kidney(1)	3						GGCCCCGGCGGGGGTTAACAG	0.617													40	118	---	---	---	---	PASS
ZNF280C	55609	broad.mit.edu	37	X	129394398	129394398	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129394398G>T	uc004evm.2	-	2	180	c.26C>A	c.(25-27)CCA>CAA	p.P9Q	ZNF280C_uc010nrf.1_Missense_Mutation_p.P9Q	NM_017666	NP_060136	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	9					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)	3						CTTACTTTTTGGTTGAAAAGG	0.353													13	52	---	---	---	---	PASS
MBNL3	55796	broad.mit.edu	37	X	131526209	131526209	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131526209C>A	uc004ewv.3	-	3	575	c.496G>T	c.(496-498)GCT>TCT	p.A166S	uc004ewr.1_Intron|MBNL3_uc004eww.2_Missense_Mutation_p.A70S|MBNL3_uc004ews.2_Missense_Mutation_p.A70S|MBNL3_uc004ewt.2_Missense_Mutation_p.A116S|MBNL3_uc011muz.1_Missense_Mutation_p.A70S|MBNL3_uc004ewu.3_Missense_Mutation_p.A166S|MBNL3_uc004ewx.1_Missense_Mutation_p.A116S	NM_018388	NP_060858	Q9NUK0	MBNL3_HUMAN	muscleblind-like 3 isoform G	166	Pro-rich.				mRNA processing|multicellular organismal development|regulation of RNA splicing|RNA splicing	Golgi apparatus|nucleus	nucleic acid binding|zinc ion binding				0	Acute lymphoblastic leukemia(192;0.000127)					GGGCCAACAGCTCCTGGCATT	0.423													6	45	---	---	---	---	PASS
RBMX	27316	broad.mit.edu	37	X	135958741	135958741	+	Silent	SNP	T	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135958741T>A	uc004fae.1	-	5	672	c.462A>T	c.(460-462)CCA>CCT	p.P154P	RBMX_uc004fac.1_5'Flank|RBMX_uc011mwf.1_Intron|RBMX_uc004fad.1_Silent_p.P154P|RBMX_uc011mwg.1_Silent_p.P115P|RBMX_uc004faf.1_Silent_p.P15P|RBMX_uc010nsf.1_Silent_p.P115P|RBMX_uc004fag.1_Silent_p.P26P	NM_002139	NP_002130	P38159	HNRPG_HUMAN	RNA binding motif protein, X-linked isoform 1	154						catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					CACTTCTTGGTGGTGGTCCTC	0.448													32	116	---	---	---	---	PASS
MIR506	574511	broad.mit.edu	37	X	146312250	146312250	+	RNA	SNP	G	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146312250G>T	hsa-mir-506|MI0003193	-			c.112G>T																				0						CACCACAAATGTTGTCCATGT	0.428													12	43	---	---	---	---	PASS
MAGEA4	4103	broad.mit.edu	37	X	151092423	151092423	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151092423C>A	uc004fez.2	+	3	443	c.287C>A	c.(286-288)CCA>CAA	p.P96Q	MAGEA4_uc004ffa.2_Missense_Mutation_p.P96Q|MAGEA4_uc004ffb.2_Missense_Mutation_p.P96Q|MAGEA4_uc004ffc.2_Missense_Mutation_p.P96Q|MAGEA4_uc004ffd.2_Missense_Mutation_p.P96Q	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	96				GP -> EA (in Ref. 3; BAA06841).			protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GAGGAGGGGCCAAGCACCTCG	0.567													18	68	---	---	---	---	PASS
GABRQ	55879	broad.mit.edu	37	X	151820229	151820229	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151820229T>C	uc004ffp.1	+	8	1162	c.1142T>C	c.(1141-1143)GTG>GCG	p.V381A		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	381						cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CAGCAAGTGGTGGTAGGAAAC	0.517													27	41	---	---	---	---	PASS
ATP2B3	492	broad.mit.edu	37	X	152845732	152845732	+	Silent	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152845732C>A	uc004fht.1	+	20	3765	c.3639C>A	c.(3637-3639)CTC>CTA	p.L1213L	ATP2B3_uc004fhs.1_3'UTR|ATP2B3_uc010nuf.1_Silent_p.L350L|ATP2B3_uc004fhu.1_Silent_p.L165L	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	1213	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGAGCCCGCTCCACAGCGTGG	0.388													12	21	---	---	---	---	PASS
OPN1LW	5956	broad.mit.edu	37	X	153418503	153418503	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153418503A>C	uc004fjz.3	+	3	533	c.500A>C	c.(499-501)AAG>ACG	p.K167T		NM_020061	NP_064445	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	167	Cytoplasmic.				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TTTGATGCCAAGCTGGCCATC	0.577													7	28	---	---	---	---	PASS
F8	2157	broad.mit.edu	37	X	154182312	154182312	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154182312C>A	uc004fmt.2	-	12	1929	c.1758G>T	c.(1756-1758)ATG>ATT	p.M586I		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	586	F5/8 type A 2.|Plastocyanin-like 4.		M -> V (in HEMA; mild).		acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TCTTGTCTGACATTATCTGTT	0.418													35	91	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	18427690	18427692	+	IGR	DEL	TCC	-	-	rs141803945		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18427690_18427692delTCC								ACTL8 (274134 upstream) : IGSF21 (6548 downstream)																							ttacagAAGTTCCTCCTttcttt	0.025													4	2	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39929442	39929442	+	Intron	DEL	C	-	-			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39929442delC	uc010oiu.1	+						MACF1_uc010ois.1_Intron|MACF1_uc001cde.1_Intron|MACF1_uc001cdf.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGCTTAGAGGCCCAGAGCCCA	0.468													4	4	---	---	---	---	
VPS72	6944	broad.mit.edu	37	1	151150319	151150319	+	Intron	DEL	A	-	-			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151150319delA	uc001exe.1	-						TMOD4_uc001exd.2_5'Flank|TMOD4_uc001exc.3_5'Flank|TMOD4_uc010pct.1_5'Flank|VPS72_uc001exf.1_3'UTR	NM_005997	NP_005988	Q15906	VPS72_HUMAN	transcription factor-like 1						chromatin modification|negative regulation of transcription from RNA polymerase II promoter	nucleus|protein complex	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|pancreas(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			atcatgtctcaaaaaaaaaaa	0.159													4	2	---	---	---	---	
RGPD1	400966	broad.mit.edu	37	2	88095379	88095380	+	Intron	INS	-	A	A			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88095379_88095380insA	uc010fhc.1	-						RGPD1_uc002ssm.1_5'Flank	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						TGAAATAAAATAAAAAAATTGG	0.337													15	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	233282752	233282753	+	IGR	DEL	GT	-	-	rs58479826		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233282752_233282753delGT								ALPPL2 (7330 upstream) : ALPI (38080 downstream)																							GGGGGGGGGGGTGATCTTCTGC	0.574													7	4	---	---	---	---	
DGKD	8527	broad.mit.edu	37	2	234359428	234359428	+	Intron	DEL	C	-	-			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234359428delC	uc002vui.1	+						DGKD_uc002vuj.1_Intron|DGKD_uc010fyh.1_Intron|DGKD_uc010fyi.1_Intron	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CCTTCTTTGTCCCACACACTT	0.622													30	13	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188295533	188295540	+	Intron	DEL	GTTCCTTC	-	-	rs67188827		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188295533_188295540delGTTCCTTC	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		tccttcctttgttccttcgttccttcgt	0.053			T	HMGA2|MLL|C12orf9	lipoma|leukemia								3	3	---	---	---	---	
AFAP1	60312	broad.mit.edu	37	4	7802149	7802150	+	Intron	INS	-	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7802149_7802150insC	uc003gkg.1	-						AFAP1_uc011bwk.1_Intron	NM_198595	NP_940997	Q8N556	AFAP1_HUMAN	actin filament associated protein 1							actin cytoskeleton|cytoplasm|focal adhesion	actin binding				0						GTGGAGTACAGCCCCTGGGAAA	0.525													20	9	---	---	---	---	
UBA6	55236	broad.mit.edu	37	4	68531151	68531152	+	Intron	INS	-	TG	TG	rs60372702		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68531151_68531152insTG	uc003hdg.3	-						UBA6_uc003hdi.2_Intron|UBA6_uc003hdj.2_Intron	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2						protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0						gtttgtttgttttttttttttt	0.213													4	3	---	---	---	---	
MRPS18B	28973	broad.mit.edu	37	6	30585855	30585855	+	Intron	DEL	C	-	-	rs3214308		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30585855delC	uc003nqo.2	+						PPP1R10_uc003nqn.1_5'Flank|PPP1R10_uc010jsc.1_5'Flank|MRPS18B_uc011dml.1_Intron|MRPS18B_uc010jsd.1_Intron	NM_014046	NP_054765	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B precursor						translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(1)	1						CTTCCTGCAACCCCCCCCCCA	0.512													4	2	---	---	---	---	
LAMB1	3912	broad.mit.edu	37	7	107602132	107602135	+	Intron	DEL	AAAC	-	-			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107602132_107602135delAAAC	uc003vew.2	-						LAMB1_uc003vev.2_Intron|LAMB1_uc003vex.2_Intron	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor						axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTAGAATAAGAAACAAACAATGAA	0.436													23	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142448200	142448207	+	Intron	DEL	GGTGGAAA	-	-	rs112413030	by1000genomes	TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142448200_142448207delGGTGGAAA	uc011krr.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc011ksl.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		GTTAACACTGGGTGGAAAGGTGGAAAGA	0.457													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	116686698	116686699	+	IGR	INS	-	CCTC	CCTC	rs142743732	by1000genomes	TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116686698_116686699insCCTC								TRPS1 (5470 upstream) : EIF3H (970357 downstream)																							cttccttccttcctccctccct	0.124													6	4	---	---	---	---	
CDKN2A	1029	broad.mit.edu	37	9	21974695	21974696	+	Frame_Shift_Ins	INS	-	T	T			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21974695_21974696insT	uc003zpk.2	-	1	343_344	c.131_132insA	c.(130-132)TACfs	p.Y44fs	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_Frame_Shift_Ins_p.Y44fs|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Intron	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	44	ANK 2.				cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.?(25)|p.Y44*(3)|p.Y44fs*1(1)|p.Y44fs*76(1)|p.V28_V51del(1)|p.G45del(1)|p.Y44S(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCCTCCGACCGTAACTATTCGG	0.683		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			68	62	---	---	---	---	
ENTPD2	954	broad.mit.edu	37	9	139946896	139946897	+	Intron	INS	-	C	C			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139946896_139946897insC	uc004ckw.1	-						ENTPD2_uc004ckv.1_5'Flank|ENTPD2_uc004ckx.1_Intron	NM_203468	NP_982293	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2							integral to membrane	ATP binding				0	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TTGCCACCGCTCCCCCCCCCAC	0.653													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385707	42385722	+	IGR	DEL	AATGGAATCATCATTA	-	-	rs33914712		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385707_42385722delAATGGAATCATCATTA								None (None upstream) : LOC441666 (441593 downstream)																							aatggaatcgaatggaatcatcattaaatggaatca	0.042													5	3	---	---	---	---	
BTBD16	118663	broad.mit.edu	37	10	124097514	124097514	+	Intron	DEL	T	-	-			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124097514delT	uc001lgc.1	+						BTBD16_uc001lgd.1_Intron	NM_144587	NP_653188	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16											skin(1)	1		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				ATTCACTTTGTTTTTTTTCAT	0.358													30	13	---	---	---	---	
NELL1	4745	broad.mit.edu	37	11	20959423	20959423	+	Intron	DEL	G	-	-			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20959423delG	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						TTAATTTTATGGTCCCTATCA	0.448													29	15	---	---	---	---	
MS4A13	503497	broad.mit.edu	37	11	60296728	60296729	+	Intron	INS	-	T	T	rs35057428		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60296728_60296729insT	uc001nps.2	+						MS4A13_uc009ync.2_Intron|MS4A13_uc009ynd.2_Intron	NM_001012417	NP_001012417	Q5J8X5	M4A13_HUMAN	membrane-spanning 4-domains, subfamily A, member							integral to membrane					0						Attttccttccttttttttttt	0.327													5	3	---	---	---	---	
FLT1	2321	broad.mit.edu	37	13	28932003	28932005	+	Intron	DEL	TCC	-	-	rs71190777		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28932003_28932005delTCC	uc001usb.3	-							NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1						cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	ttcttttctttcctttttttttt	0.409													4	2	---	---	---	---	
KHNYN	23351	broad.mit.edu	37	14	24905801	24905801	+	Intron	DEL	T	-	-			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24905801delT	uc001wph.3	+						KHNYN_uc010tpc.1_Intron|KHNYN_uc010alw.2_Intron	NM_015299	NP_056114	O15037	KHNYN_HUMAN	hypothetical protein LOC23351											ovary(2)|liver(1)	3						GCCAGCTTAATTTTGCAGTGG	0.547											OREG0022628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
GZMB	3002	broad.mit.edu	37	14	25101690	25101690	+	Intron	DEL	G	-	-			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25101690delG	uc001wps.2	-						GZMB_uc010ama.2_Intron|GZMB_uc010amb.2_Intron	NM_004131	NP_004122	P10144	GRAB_HUMAN	granzyme B precursor						activation of pro-apoptotic gene products|cleavage of lamin|cytolysis|induction of apoptosis by intracellular signals	cytosol|immunological synapse|nucleus	protein binding|serine-type endopeptidase activity				0				GBM - Glioblastoma multiforme(265;0.028)		GAGTGAGGATGGGGGTGGAGT	0.557													28	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	69328777	69328778	+	IGR	INS	-	TT	TT	rs34505623		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69328777_69328778insTT								C14orf181 (65587 upstream) : ACTN1 (12063 downstream)																							GAGCACATATCttttttttttt	0.233													4	2	---	---	---	---	
TTC7B	145567	broad.mit.edu	37	14	91110622	91110625	+	Intron	DEL	CACG	-	-	rs147942996	by1000genomes	TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91110622_91110625delCACG	uc001xyp.2	-						TTC7B_uc001xyo.2_5'Flank|TTC7B_uc010ats.2_Intron|uc001xyq.2_Intron	NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)				cacacacacacacGCGCGAAAGAA	0.328													7	4	---	---	---	---	
GGA2	23062	broad.mit.edu	37	16	23502852	23502852	+	Intron	DEL	A	-	-	rs71379683		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23502852delA	uc002dlq.2	-						GGA2_uc010bxo.1_Intron	NM_015044	NP_055859	Q9UJY4	GGA2_HUMAN	ADP-ribosylation factor binding protein 2						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|clathrin-coated vesicle|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0386)		TTTATTGCGTAAAAAAAAAAA	0.189													5	3	---	---	---	---	
ERN2	10595	broad.mit.edu	37	16	23711659	23711659	+	Intron	DEL	A	-	-			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23711659delA	uc002dma.3	-						ERN2_uc010bxp.2_Intron	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2						apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		tcctgtctccaaaaaaataat	0.169													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33413053	33413054	+	IGR	INS	-	T	T	rs141044276		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33413053_33413054insT								SLC6A10P (516590 upstream) : MIR1826 (552454 downstream)																							TTTTTACTGTCTTTTTTTTGTT	0.327													5	4	---	---	---	---	
TBC1D28	254272	broad.mit.edu	37	17	18541851	18541852	+	Intron	INS	-	AG	AG			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18541851_18541852insAG	uc002gud.2	-							NM_001039397	NP_001034486	Q2M2D7	TBC28_HUMAN	TBC1 domain family, member 28							intracellular	Rab GTPase activator activity			ovary(1)	1						CACTGAGAGGCACCCACCCAGG	0.609													4	2	---	---	---	---	
MRPL38	64978	broad.mit.edu	37	17	73897033	73897034	+	Intron	INS	-	C	C	rs149514417	by1000genomes	TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73897033_73897034insC	uc010wso.1	-						FBF1_uc002jqa.1_Intron|MRPL38_uc002jpz.1_Intron	NM_032478	NP_115867	Q96DV4	RM38_HUMAN	mitochondrial ribosomal protein L38 precursor							actin cytoskeleton|mitochondrion|ribosome				pancreas(1)	1			all cancers(21;0.000154)|Epithelial(20;0.000156)|BRCA - Breast invasive adenocarcinoma(9;0.00936)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCTGGGCAGCACCCCCTACCCC	0.594													7	7	---	---	---	---	
HMHA1	23526	broad.mit.edu	37	19	1079503	1079503	+	Intron	DEL	A	-	-			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1079503delA	uc002lqz.1	+						HMHA1_uc010xgd.1_Intron|HMHA1_uc010xge.1_Intron|HMHA1_uc002lra.1_Intron|HMHA1_uc002lrb.1_Intron|HMHA1_uc002lrc.1_Intron	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
NANOS3	342977	broad.mit.edu	37	19	13986003	13986003	+	5'Flank	DEL	T	-	-	rs77913995		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13986003delT	uc002mxj.3	+							NM_001098622	NP_001092092	P60323	NANO3_HUMAN	nanos homolog 3						anti-apoptosis|germ cell development|multicellular organismal development|oogenesis|regulation of cell cycle|regulation of translation|spermatogenesis	cytoplasmic mRNA processing body|nucleus|stress granule	RNA binding|zinc ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			TAAAATCCCCttttttttttt	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20361665	20361666	+	IGR	DEL	CA	-	-			TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20361665_20361666delCA								DGCR6L (54057 upstream) : PI4KAP1 (22065 downstream)																							CATAATCTCTCACACACACACA	0.312													4	2	---	---	---	---	
SELO	83642	broad.mit.edu	37	22	50646860	50646860	+	Intron	DEL	A	-	-	rs72106458		TCGA-22-5492-01	TCGA-22-5492-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50646860delA	uc011arr.1	+						SELO_uc010hap.2_Intron|SELO_uc003bjy.2_5'UTR|SELO_uc003bjz.2_5'Flank	NM_031454	NP_113642	Q9BVL4	SELO_HUMAN	selenoprotein O												0		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		actccatctcaaaaaaaaaaa	0.214													5	3	---	---	---	---	
